Prefrontal-hippocampal-fusiform activity during encoding predicts intraindividual differences in free recall ability: an event-related functional-anatomic MRI study.

Science.gov (United States)

Dickerson, B C; Miller, S L; Greve, D N; Dale, A M; Albert, M S; Schacter, D L; Sperling, R A

2007-01-01

The ability to spontaneously recall recently learned information is a fundamental mnemonic activity of daily life, but has received little study using functional neuroimaging. We developed a functional MRI (fMRI) paradigm to study regional brain activity during encoding that predicts free recall. In this event-related fMRI study, ten lists of fourteen pictures of common objects were shown to healthy young individuals and regional brain activity during encoding was analyzed based on subsequent free recall performance. Free recall of items was predicted by activity during encoding in hippocampal, fusiform, and inferior prefrontal cortical regions. Within-subject variance in free recall performance for the ten lists was predicted by a linear combination of condition-specific inferior prefrontal, hippocampal, and fusiform activity. Recall performance was better for lists in which prefrontal activity was greater for all items of the list and hippocampal and fusiform activity were greater specifically for items that were recalled from the list. Thus, the activity of medial temporal, fusiform, and prefrontal brain regions during the learning of new information is important for the subsequent free recall of this information. These fronto-temporal brain regions act together as a large-scale memory-related network, the components of which make distinct yet interacting contributions during encoding that predict subsequent successful free recall performance.

SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

Directory of Open Access Journals (Sweden)

Benjamin C Hitz

Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

Encoding efficiency of suprathreshold stochastic resonance on stimulus-specific information

Energy Technology Data Exchange (ETDEWEB)

Duan, Fabing, E-mail: fabing.duan@gmail.com [Institute of Complexity Science, Qingdao University, Qingdao 266071 (China); Chapeau-Blondeau, François, E-mail: chapeau@univ-angers.fr [Laboratoire Angevin de Recherche en Ingénierie des Systèmes (LARIS), Université d' Angers, 62 avenue Notre Dame du Lac, 49000 Angers (France); Abbott, Derek, E-mail: derek.abbott@adelaide.edu.au [Centre for Biomedical Engineering (CBME) and School of Electrical & Electronic Engineering, The University of Adelaide, Adelaide, SA 5005 (Australia)

2016-01-08

In this paper, we evaluate the encoding efficiency of suprathreshold stochastic resonance (SSR) based on a local information-theoretic measure of stimulus-specific information (SSI), which is the average specific information of responses associated with a particular stimulus. The theoretical and numerical analyses of SSIs reveal that noise can improve neuronal coding efficiency for a large population of neurons, which leads to produce increased information-rich responses. The SSI measure, in contrast to the global measure of average mutual information, can characterize the noise benefits in finer detail for describing the enhancement of neuronal encoding efficiency of a particular stimulus, which may be of general utility in the design and implementation of a SSR coding scheme. - Highlights: • Evaluating the noise-enhanced encoding efficiency via stimulus-specific information. • New form of stochastic resonance based on the measure of encoding efficiency. • Analyzing neural encoding schemes from suprathreshold stochastic resonance detailedly.

Radiology now. The ten day rule - principles and practice

Energy Technology Data Exchange (ETDEWEB)

Carmichael, J H.E. [Broadgreen Hospital, Liverpool (UK); Warrick, C K

1978-11-01

The ten day rule recommends that non-urgent diagnostic radiography of the abdomen in women of child-bearing capacity should be confined to the pre-ovulatory phase of the menstrual cycle. Arguments for and against this rule are reviewed. The attitudes and organization of radiographic practice in the UK differ from those in the USA. Assessment of the evidence for the hazards involved leads to the conclusion that the continued application of the ten day rule should be strongly recommended as an essential part of good radiological and radiographic practice.

Photocatalyzed removal of lead ion from lead-chelator solution

Energy Technology Data Exchange (ETDEWEB)

Cho, Young Hyun; Na, Jung Won; Sung, Ki Woung [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1994-07-01

The present study was undertaken to examine the influence of such chelating agents on the ease and speed of photocatalyzed metal removal and deposition. With excess EDTA, the free EDTA competes with Pb for oxidation, and at a ten fold excess, no lead oxidation (hence removal) occurs. With insufficient EDTA, the corresponding initial concentration of Pb-EDTA is decreased; after its destruction, the remaining Pb{sup 2+} is removed more slowly, at rates found with lead nitrate solution. The net result is that the maximum rate of lead deposition occurs at the stoichiometric ratio of 1:1 EDTA : Pb{sup 2+}.

MicroRNA-encoding long non-coding RNAs

Directory of Open Access Journals (Sweden)

Zhu Xiaopeng

2008-05-01

Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.

Fulfilling the atomic promise: Ten years history gives pointers for the future

International Nuclear Information System (INIS)

1967-01-01

Ten years is a short period in human history, and a short period in the life of an international organization. Nevertheless the ten years now completed by the International Atomic Energy Agency has seen much work accomplished and has brought greater realization than ever before of the promise held out by the atom for peaceful benefits leading to the promotion of peace, health and prosperity throughout the world

Ten questions about systems biology

DEFF Research Database (Denmark)

Joyner, Michael J; Pedersen, Bente K

2011-01-01

to understand how whole animals adapt to the real world. We argue that a lack of fluency in these concepts is a major stumbling block for what has been narrowly defined as 'systems biology' by some of its leading advocates. We also point out that it is a failure of regulation at multiple levels that causes many......In this paper we raise 'ten questions' broadly related to 'omics', the term systems biology, and why the new biology has failed to deliver major therapeutic advances for many common diseases, especially diabetes and cardiovascular disease. We argue that a fundamentally narrow and reductionist...

Ten questions about systems biology

DEFF Research Database (Denmark)

Joyner, Michael J; Pedersen, Bente K

2011-01-01

In this paper we raise 'ten questions' broadly related to 'omics', the term systems biology, and why the new biology has failed to deliver major therapeutic advances for many common diseases, especially diabetes and cardiovascular disease. We argue that a fundamentally narrow and reductionist...... to understand how whole animals adapt to the real world. We argue that a lack of fluency in these concepts is a major stumbling block for what has been narrowly defined as 'systems biology' by some of its leading advocates. We also point out that it is a failure of regulation at multiple levels that causes many...

Transferring and generalizing deep-learning-based neural encoding models across subjects.

Science.gov (United States)

Wen, Haiguang; Shi, Junxing; Chen, Wei; Liu, Zhongming

2018-08-01

Recent studies have shown the value of using deep learning models for mapping and characterizing how the brain represents and organizes information for natural vision. However, modeling the relationship between deep learning models and the brain (or encoding models), requires measuring cortical responses to large and diverse sets of natural visual stimuli from single subjects. This requirement limits prior studies to few subjects, making it difficult to generalize findings across subjects or for a population. In this study, we developed new methods to transfer and generalize encoding models across subjects. To train encoding models specific to a target subject, the models trained for other subjects were used as the prior models and were refined efficiently using Bayesian inference with a limited amount of data from the target subject. To train encoding models for a population, the models were progressively trained and updated with incremental data from different subjects. For the proof of principle, we applied these methods to functional magnetic resonance imaging (fMRI) data from three subjects watching tens of hours of naturalistic videos, while a deep residual neural network driven by image recognition was used to model visual cortical processing. Results demonstrate that the methods developed herein provide an efficient and effective strategy to establish both subject-specific and population-wide predictive models of cortical representations of high-dimensional and hierarchical visual features. Copyright © 2018 Elsevier Inc. All rights reserved.

Distinctiveness and encoding effects in online sentence comprehension

Directory of Open Access Journals (Sweden)

Philip eHofmeister

2014-12-01

Full Text Available In explicit memory recall and recognition tasks, elaboration and contextual isolation both facilitate memory performance. Here, we investigate these effects in the context of sentence processing: targets for retrieval during online sentence processing of English object relative clause constructions differ in the amount of elaboration associated with the target noun phrase, or the homogeneity of superficial features (text color. Experiment 1 shows that greater elaboration for targets during the encoding phase reduces reading times at retrieval sites, but elaboration of non-targets has considerably weaker effects. Experiment 2 illustrates that processing isolated superficial features of target noun phrases --- here, a green word in a sentence with words colored white --- does not lead to enhanced memory performance, despite triggering longer encoding times. These results are interpreted in the light of the memory models of Nairne 1990, 2001, 2006, which state that encoding remnants contribute to the set of retrieval cues that provide the basis for similarity-based interference effects.

Encoding, storage and judgment of experienced frequency and duration

Directory of Open Access Journals (Sweden)

Tilmann Betsch

2010-08-01

Full Text Available This paper examines conditions that do or do not lead to accurate judgments of frequency (JOF and judgments of duration (JOD. In three experiments, duration and frequency of visually presented stimuli are varied orthogonally in a within-subjects design. Experiment 1 reveals an asymmetric judgment pattern. JOFs reflected actual presentation frequency quite accurately and were unbiased by exposure duration. Conversely, JODs were almost insensitive to actual exposure duration and were systematically biased by presentation frequency. We show, however, that a tendency towards a symmetric judgment pattern can be obtained by manipulating encoding conditions. Sustaining attention during encoding (Experiment 2 or enhancing richness of the encoded stimuli (Experiment 3 increases judgment sensitivity in JOD and yields biases in both directions (JOF biased by exposure duration, JOD biased by presentation frequency. The implications of these findings for underlying memory mechanisms are discussed.

ERP Correlates of Encoding Success and Encoding Selectivity in Attention Switching

Science.gov (United States)

Yeung, Nick

2016-01-01

Long-term memory encoding depends critically on effective processing of incoming information. The degree to which participants engage in effective encoding can be indexed in electroencephalographic (EEG) data by studying event-related potential (ERP) subsequent memory effects. The current study investigated ERP correlates of memory success operationalised with two different measures—memory selectivity and global memory—to assess whether previously observed ERP subsequent memory effects reflect focused encoding of task-relevant information (memory selectivity), general encoding success (global memory), or both. Building on previous work, the present study combined an attention switching paradigm—in which participants were presented with compound object-word stimuli and switched between attending to the object or the word across trials—with a later recognition memory test for those stimuli, while recording their EEG. Our results provided clear evidence that subsequent memory effects resulted from selective attentional focusing and effective top-down control (memory selectivity) in contrast to more general encoding success effects (global memory). Further analyses addressed the question of whether successful encoding depended on similar control mechanisms to those involved in attention switching. Interestingly, differences in the ERP correlates of attention switching and successful encoding, particularly during the poststimulus period, indicated that variability in encoding success occurred independently of prestimulus demands for top-down cognitive control. These results suggest that while effects of selective attention and selective encoding co-occur behaviourally their ERP correlates are at least partly dissociable. PMID:27907075

The lead and lead-acid battery industries during 2002 and 2007 in China

Energy Technology Data Exchange (ETDEWEB)

Chen, H.Y.; Li, A.J.; Finlow, D.E. [Key Lab of Electrochemical Technology on Energy Storage and Power Generation in Guangdong Universities, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)

2009-06-01

In the past 15 years, the center of the international lead market has shifted to China. China has become the largest producer of raw and refined lead, plus the largest consumer. This paper reviews the status of the lead and lead-acid battery industries in China, including lead mining, lead refining, secondary lead production, the lead-acid battery industry, new opportunities for lead-acid batteries, and the environmental problems associated with lead and lead-acid batteries. The output of raw and refined lead has increased annually in China, and now accounts for more than 30% of the world total. As a result of a change in the Chinese government's policy regarding the export of lead, plus an increase in the price of lead, the profits of Chinese lead manufacturers were significantly reduced, the trade deficit of the Chinese lead industry increased, the operating rates of lead smelter enterprises greatly reduced, and some small enterprises were forced to shut down. At the present time, an increasing number of enterprises have begun to produce secondary lead, and the scale of production has expanded from tens of tons to tens of thousands of tons. In 2006, the output of secondary lead in China reached 700,000 tons, but outdated technology and equipment limited development of the secondary lead industry. Because of serious pollution problems, raw material shortages, and fierce price competition in the battery market, changes in the development of the lead-acid battery industry have been dramatic; approximately one thousand medium-sized and small lead-acid battery producers have been closed in the past 3 years. The output of large lead-acid battery enterprises has not been reduced, however, as a result of their manufacturing technology and equipment being comparable to those in other advanced industrial countries. In China, the flourishing development of electric bicycles, electric tricycles, and photovoltaic energy systems should provide ongoing opportunities for

The lead and lead-acid battery industries during 2002 and 2007 in China

International Nuclear Information System (INIS)

Chen, H.Y.; Li, A.J.; Finlow, D.E.

2009-01-01

In the past 15 years, the center of the international lead market has shifted to China. China has become the largest producer of raw and refined lead, plus the largest consumer. This paper reviews the status of the lead and lead-acid battery industries in China, including lead mining, lead refining, secondary lead production, the lead-acid battery industry, new opportunities for lead-acid batteries, and the environmental problems associated with lead and lead-acid batteries. The output of raw and refined lead has increased annually in China, and now accounts for more than 30% of the world total. As a result of a change in the Chinese government's policy regarding the export of lead, plus an increase in the price of lead, the profits of Chinese lead manufacturers were significantly reduced, the trade deficit of the Chinese lead industry increased, the operating rates of lead smelter enterprises greatly reduced, and some small enterprises were forced to shut down. At the present time, an increasing number of enterprises have begun to produce secondary lead, and the scale of production has expanded from tens of tons to tens of thousands of tons. In 2006, the output of secondary lead in China reached 700,000 tons, but outdated technology and equipment limited development of the secondary lead industry. Because of serious pollution problems, raw material shortages, and fierce price competition in the battery market, changes in the development of the lead-acid battery industry have been dramatic; approximately one thousand medium-sized and small lead-acid battery producers have been closed in the past 3 years. The output of large lead-acid battery enterprises has not been reduced, however, as a result of their manufacturing technology and equipment being comparable to those in other advanced industrial countries. In China, the flourishing development of electric bicycles, electric tricycles, and photovoltaic energy systems should provide ongoing opportunities for the

Theory of multisource crosstalk reduction by phase-encoded statics

KAUST Repository

Schuster, Gerard T.

2011-03-01

Formulas are derived that relate the strength of the crosstalk noise in supergather migration images to the variance of time, amplitude and polarity shifts in encoding functions. A supergather migration image is computed by migrating an encoded supergather, where the supergather is formed by stacking a large number of encoded shot gathers. Analysis reveals that for temporal source static shifts in each shot gather, the crosstalk noise is exponentially reduced with increasing variance of the static shift and the square of source frequency. This is not too surprising because larger time shifts lead to less correlation between traces in different shot gathers, and so should tend to reduce the crosstalk noise. Analysis also reveals that combining both polarity and time statics is a superior encoding strategy compared to using either polarity statics or time statics alone. Signal-to-noise (SNR) estimates show that for a standard migration image and for an image computed by migrating a phase-encoded supergather; here, G is the number of traces in a shot gather, I is the number of stacking iterations in the supergather and S is the number of encoded/blended shot gathers that comprise the supergather. If the supergather can be uniformly divided up into Q unique sub-supergathers, then the resulting SNR of the final image is, which means that we can enhance image quality but at the expense of Q times more cost. The importance of these formulas is that they provide a precise understanding between different phase encoding strategies and image quality. Finally, we show that iterative migration of phase-encoded supergathers is a special case of passive seismic interferometry. We suggest that the crosstalk noise formulas can be helpful in designing optimal strategies for passive seismic interferometry and efficient extraction of Green\\'s functions from simulated supergathers. © 2011 The Authors Geophysical Journal International © 2011 RAS.

Neutral details associated with emotional events are encoded: evidence from a cued recall paradigm.

Science.gov (United States)

Mickley Steinmetz, Katherine R; Knight, Aubrey G; Kensinger, Elizabeth A

2016-11-01

Enhanced emotional memory often comes at the cost of memory for surrounding background information. Narrowed-encoding theories suggest that this is due to narrowed attention for emotional information at encoding, leading to impaired encoding of background information. Recent work has suggested that an encoding-based theory may be insufficient. Here, we examined whether cued recall-instead of previously used recognition memory tasks-would reveal evidence that non-emotional information associated with emotional information was effectively encoded. Participants encoded positive, negative, or neutral objects on neutral backgrounds. At retrieval, they were given either the item or the background as a memory cue and were asked to recall the associated scene element. Counter to narrowed-encoding theories, emotional items were more likely than neutral items to trigger recall of the associated background. This finding suggests that there is a memory trace of this contextual information and that emotional cues may facilitate retrieval of this information.

Diffusion tensor imaging of the brain. Effects of distortion correction with correspondence to numbers of encoding directions

International Nuclear Information System (INIS)

Yoshikawa, Takeharu; Aoki, Shigeki; Abe, Osamu; Hayashi, Naoto; Masutani, Yoshitaka; Masumoto, Tomohiko; Mori, Harushi; Satake, Yoshiroh; Ohtomo, Kuni

2008-01-01

The aim of the study was to estimate the effect of distortion correction with correspondence to numbers of encoding directions to acquire diffusion tensor imaging (DTI) of improved quality. Ten volunteers underwent DTI of the head using echo planar imaging with 6, 13, 27, and 55 encoding directions. Fractional anisotropy (FA) maps and apparent diffusion coefficient (ADC) maps were created before and after distortion correction. Regions of interest were placed in the corpus callosum on each map, and standard deviations of FA and ADC were calculated. FA maps were also evaluated visually by experienced neuroradiologists. Dispersion of standard deviations tended to be reduced after distortion correction, with significant differences found in FA maps with 6 encoding directions, ADC maps with 6 directions, and ADC maps with 13 directions (P<0.001, P<0.005, and P<0.05, respectively). Visual image quality was improved after distortion correction (P<0.01 for all of the visual comparisons). Distortion correction is effective in providing DTI of enhanced quality, notwithstanding the number of encoding directions. (author)

Clinical experience with TENS and TENS combined with nitrous oxide-oxygen. Report of 371 patients.

OpenAIRE

Quarnstrom, F. C.; Milgrom, P.

1989-01-01

Transcutaneous electrical nerve stimulation (TENS) alone or TENS combined with nitrous oxide-oxygen (N2O) was administered for restorative dentistry without local anesthesia to 371 adult patients. A total of 55% of TENS alone and 84% of TENS/N2O visits were rated successful. A total of 53% of TENS alone and 82% of TENS/N2O patients reported slight or no pain. In multivariable analyses, pain reports were related to the anesthesia technique and patient fear and unrelated to sex, race, age, toot...

Upconversion Nanoparticles-Encoded Hydrogel Microbeads-Based Multiplexed Protein Detection

Science.gov (United States)

Shikha, Swati; Zheng, Xiang; Zhang, Yong

2018-06-01

Fluorescently encoded microbeads are in demand for multiplexed applications in different fields. Compared to organic dye-based commercially available Luminex's xMAP technology, upconversion nanoparticles (UCNPs) are better alternatives due to their large anti-Stokes shift, photostability, nil background, and single wavelength excitation. Here, we developed a new multiplexed detection system using UCNPs for encoding poly(ethylene glycol) diacrylate (PEGDA) microbeads as well as for labeling reporter antibody. However, to prepare UCNPs-encoded microbeads, currently used swelling-based encapsulation leads to non-uniformity, which is undesirable for fluorescence-based multiplexing. Hence, we utilized droplet microfluidics to obtain encoded microbeads of uniform size, shape, and UCNPs distribution inside. Additionally, PEGDA microbeads lack functionality for probe antibodies conjugation on their surface. Methods to functionalize the surface of PEGDA microbeads (acrylic acid incorporation, polydopamine coating) reported thus far quench the fluorescence of UCNPs. Here, PEGDA microbeads surface was coated with silica followed by carboxyl modification without compromising the fluorescence intensity of UCNPs. In this study, droplet microfluidics-assisted UCNPs-encoded microbeads of uniform shape, size, and fluorescence were prepared. Multiple color codes were generated by mixing UCNPs emitting red and green colors at different ratios prior to encapsulation. UCNPs emitting blue color were used to label the reporter antibody. Probe antibodies were covalently immobilized on red UCNPs-encoded microbeads for specific capture of human serum albumin (HSA) as a model protein. The system was also demonstrated for multiplexed detection of both human C-reactive protein (hCRP) and HSA protein by immobilizing anti-hCRP antibodies on green UCNPs.

Displacement encoder

International Nuclear Information System (INIS)

Hesketh, T.G.

1983-01-01

In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

Audits reveal ten common environmental problems

International Nuclear Information System (INIS)

Buys, M.W.

1992-01-01

The old saying that open-quotes an ounce of prevention is worth a pound of cureclose quotes rings particularly true in environmental matters in the 1990s. Environmental problems can potentially lead to expensive fines, costly cleanups, negative public relations, and even criminal sanctions against members of the corporation. A recurring pattern of problems has been noted during the performance of environmental disposition, acquisition, and compliance assessments of many different operators in most of the producing states. The ten most common problems found in oilfield audits are discussed here in an effort to enhance the awareness of operators

The Top Ten Algorithms in Data Mining

CERN Document Server

Wu, Xindong

2009-01-01

From classification and clustering to statistical learning, association analysis, and link mining, this book covers the most important topics in data mining research. It presents the ten most influential algorithms used in the data mining community today. Each chapter provides a detailed description of the algorithm, a discussion of available software implementation, advanced topics, and exercises. With a simple data set, examples illustrate how each algorithm works and highlight the overall performance of each algorithm in a real-world application. Featuring contributions from leading researc

2D Barcode for DNA Encoding

OpenAIRE

Elena Purcaru; Cristian Toma

2011-01-01

The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

Science.gov (United States)

Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

2013-07-22

Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

The effect of encoding strategy on the neural correlates of memory for faces.

Science.gov (United States)

Bernstein, Lori J; Beig, Sania; Siegenthaler, Amy L; Grady, Cheryl L

2002-01-01

Encoding and recognition of unfamiliar faces in young adults were examined using positron emission tomography to determine whether different encoding strategies would lead to encoding/retrieval differences in brain activity. Three types of encoding were compared: a 'deep' task (judging pleasantness/unpleasantness), a 'shallow' task (judging right/left orientation), and an intentional learning task in which subjects were instructed to learn the faces for a subsequent memory test but were not provided with a specific strategy. Memory for all faces was tested with an old/new recognition test. A modest behavioral effect was obtained, with deeply-encoded faces being recognized more accurately than shallowly-encoded or intentionally-learned faces. Regardless of encoding strategy, encoding activated a primarily ventral system including bilateral temporal and fusiform regions and left prefrontal cortices, whereas recognition activated a primarily dorsal set of regions including right prefrontal and parietal areas. Within encoding, the type of strategy produced different brain activity patterns, with deep encoding being characterized by left amygdala and left anterior cingulate activation. There was no effect of encoding strategy on brain activity during the recognition conditions. Posterior fusiform gyrus activation was related to better recognition accuracy in those conditions encouraging perceptual strategies, whereas activity in left frontal and temporal areas correlated with better performance during the 'deep' condition. Results highlight three important aspects of face memory: (1) the effect of encoding strategy was seen only at encoding and not at recognition; (2) left inferior prefrontal cortex was engaged during encoding of faces regardless of strategy; and (3) differential activity in fusiform gyrus was found, suggesting that activity in this area is not only a result of automatic face processing but is modulated by controlled processes.

Flipped-Adversarial AutoEncoders

OpenAIRE

Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

2018-01-01

We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

a permutation encoding te algorithm solution of reso tation encoding

African Journals Online (AJOL)

eobe

Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

HIPs at Ten

Science.gov (United States)

Kuh, George; O'Donnell, Ken; Schneider, Carol Geary

2017-01-01

2017 is the anniversary of the introduction of what are now commonly known as high-impact practices (HIPs). Many of the specific activities pursued under the HIPs acronym have been around in some form for decades, such as study abroad, internships, and student-faculty research. It was about ten years ago that, after conferring HIPs at Ten with…

Some hallways lead to other hallways and some lead to dead ends

OpenAIRE

Tam, Nancy Y.S

2013-01-01

Some Hallways Lead To Other Hallways And Some Lead To Dead Ends is a one-hour long synchronized audio tour for ten people. Listening to their assigned tracks played through headphones, the audience is mobilized through the SFU Woodward’s building. The aural content is comprised of choreographic instructions and my personal stories as a third culture kid in finding home. Appendix A is a research paper written for FPA 812, where I examine Henri Lefebvre’s ideas of space and how these ideas are ...

Selecting Operations for Assembler Encoding

Directory of Open Access Journals (Sweden)

Tomasz Praczyk

2010-04-01

Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

Granulocyte colony-stimulating factor in toxic epidermal necrolysis (TEN) and Chelsea & Westminster TEN management protocol [corrected].

Science.gov (United States)

de Sica-Chapman, A; Williams, G; Soni, N; Bunker, C B

2010-04-01

Toxic epidermal necrolysis (TEN) is a rare but life-threatening, allergic drug reaction. Skin blistering with epidermal and mucosal necrolysis with subsequent detachment from an inflamed underlying dermis is a hallmark of the condition. The pathogenesis of TEN is not well understood, accounting for controversies about its management and significant delay in initiating potentially beneficial therapy. There are no management protocols based on a robust evidence base. Prompt recognition of the diagnosis and consensus on early management initiatives are necessary in order to improve outcomes and survival in TEN. To date, TEN management has been directed at arresting the allergic reaction and treating the complications. We have identified a need for specific medical interventions to accelerate wound regeneration. This approach has not previously been adopted in the management of TEN. We observed that in two cases of severe TEN, dramatic re-epithelialization and recovery coincided with the introduction of granulocyte colony-stimulating factor (G-CSF) for neutropenia. We explain how addition of the G-CSF promotes recovery from TEN by enhanced bioregeneration of the damaged tissues through accelerated re-epithelialization. G-CSF has been used for severe neutropenia in TEN, but we recommend and explain why, as in our Chelsea and Westminster protocol, G-CSF should be considered in treating severe TEN irrespective of the severity of neutropenia.

Aging and Memory as Discrimination: Influences of Encoding Specificity, Cue Overload, and Prior Knowledge

OpenAIRE

Badham, S. P.; Poirier, M.; Gandhi, N.; Hadjivassiliou, A.; Maylor, E. A.

2016-01-01

From the perspective of memory-as-discrimination, whether a cue leads to correct retrieval simultaneously depends on the cue?s relationship to (a) the memory target and (b) the other retrieval candidates. A corollary of the view is that increasing encoding-retrieval match may only help memory if it improves the cue?s capacity to discriminate the target from competitors. Here, age differences in this discrimination process were assessed by manipulating the overlap between cues present at encod...

Synthesis and pharmacological characterization of novel inverse agonists acting on the viral-encoded chemokine receptor US28.

Science.gov (United States)

Hulshof, Janneke W; Vischer, Henry F; Verheij, Mark H P; Fratantoni, Silvina A; Smit, Martine J; de Esch, Iwan J P; Leurs, Rob

2006-11-01

G-protein coupled receptors encoded by viruses represent an unexplored class of potential drug targets. In this study, we describe the synthesis and pharmacological characterization of the first class of inverse agonists acting on the HCMV-encoded receptor US28. It is shown that replacement of the 4-hydroxy group of lead compound 1 with a methylamine group results in a significant 6-fold increase in affinity. Interestingly, increasing the rigidity of the spacer by the introduction of a double bond also leads to a significant increase in binding affinity compared to 1. These novel inverse agonists serve as valuable tools to elucidate the role of constitutive signaling in the pathogenesis of viral infection and may have therapeutic potential as leads for new antiviral drugs.

QR encoded smart oral dosage forms by inkjet printing.

Science.gov (United States)

Edinger, Magnus; Bar-Shalom, Daniel; Sandler, Niklas; Rantanen, Jukka; Genina, Natalja

2018-01-30

The use of inkjet printing (IJP) technology enables the flexible manufacturing of personalized medicine with the doses tailored for each patient. In this study we demonstrate, for the first time, the applicability of IJP in the production of edible dosage forms in the pattern of a quick response (QR) code. This printed pattern contains the drug itself and encoded information relevant to the patient and/or healthcare professionals. IJP of the active pharmaceutical ingredient (API)-containing ink in the pattern of QR code was performed onto a newly developed porous and flexible, but mechanically stable substrate with a good absorption capacity. The printing did not affect the mechanical properties of the substrate. The actual drug content of the printed dosage forms was in accordance with the encoded drug content. The QR encoded dosage forms had a good print definition without significant edge bleeding. They were readable by a smartphone even after storage in harsh conditions. This approach of efficient data incorporation and data storage combined with the use of smart devices can lead to safer and more patient-friendly drug products in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

Humanities and Social Sciences Books of Ten National Disciplinary Associations, 2000-2009

Science.gov (United States)

Wiberley, Stephen E., Jr.

2016-01-01

Books are the most important medium of communication in the humanities, a major medium in the social sciences, and a central component of academic library collections. This study examined humanities and social sciences books that won prizes from ten leading United States disciplinary associations between 2000 and 2009. The study extends earlier…

Lead in some food crops and trees

Energy Technology Data Exchange (ETDEWEB)

Warren, H V; Delavault, R E

1962-02-01

An investigation has been made of the lead content of trees and some of the more common vegetables and cereals (maize, cabbage, potatoes, carrots, beets, onions, peas, hops, oats, rhubarb, lettuce, cauliflower, leeks, barley, rye, and wheat) grown in British Columbia and in Great Britain. The lead content of the lime, yew, willow, birch, oak, ash, hazel and cypress was determined. It was concluded that in areas where soils have an abnormally high lead content, food products may acquire up to ten times as much lead, or more, than those grown on normal soil.

Landscape encodings enhance optimization.

Directory of Open Access Journals (Sweden)

Konstantin Klemm

Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

Landscape Encodings Enhance Optimization

Science.gov (United States)

Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.

2012-01-01

Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

Stress as a mnemonic filter: Interactions between medial temporal lobe encoding processes and post-encoding stress.

Science.gov (United States)

Ritchey, Maureen; McCullough, Andrew M; Ranganath, Charan; Yonelinas, Andrew P

2017-01-01

Acute stress has been shown to modulate memory for recently learned information, an effect attributed to the influence of stress hormones on medial temporal lobe (MTL) consolidation processes. However, little is known about which memories will be affected when stress follows encoding. One possibility is that stress interacts with encoding processes to selectively protect memories that had elicited responses in the hippocampus and amygdala, two MTL structures important for memory formation. There is limited evidence for interactions between encoding processes and consolidation effects in humans, but recent studies of consolidation in rodents have emphasized the importance of encoding "tags" for determining the impact of consolidation manipulations on memory. Here, we used functional magnetic resonance imaging in humans to test the hypothesis that the effects of post-encoding stress depend on MTL processes observed during encoding. We found that changes in stress hormone levels were associated with an increase in the contingency of memory outcomes on hippocampal and amygdala encoding responses. That is, for participants showing high cortisol reactivity, memories became more dependent on MTL activity observed during encoding, thereby shifting the distribution of recollected events toward those that had elicited relatively high activation. Surprisingly, this effect was generally larger for neutral, compared to emotionally negative, memories. The results suggest that stress does not uniformly enhance memory, but instead selectively preserves memories tagged during encoding, effectively acting as mnemonic filter. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Effect of burst TENS and conventional TENS combined with cryotherapy on pressure pain threshold: randomised, controlled, clinical trial.

Science.gov (United States)

Macedo, L B; Josué, A M; Maia, P H B; Câmara, A E; Brasileiro, J S

2015-06-01

To assess the immediate effect of conventional and burst transcutaneous electrical nerve stimulation (TENS) in combination with cryotherapy on pain threshold and tolerance in healthy individuals. Randomised, controlled trial. University laboratory. One hundred and twelve healthy women. Volunteers were allocated at random to seven groups (n=16): (1) control, (2) placebo TENS, (3) conventional TENS, (4) burst TENS, (5) cryotherapy, (6) cryotherapy in combination with burst TENS, and (7) cryotherapy in combination with conventional TENS. Pain threshold and tolerance were measured by applying a pressure algometer at the lateral epicondyle of the humerus, before and after each intervention. The primary outcome measure was pressure pain threshold. A significant increase in pain threshold and tolerance at the 5% level of significance was recorded as follows: burst TENS {pain threshold: mean difference 1.3 [95% confidence interval (CI) 1.4 to 1.2]; pain tolerance: mean difference 3.8 (95% CI 3.9 to 3.7)}, cryotherapy [pain threshold: mean difference 1.3 (95% CI 1.4 to 1.2); pain tolerance: mean difference 1.9 (95% CI 1.8 to 2.0)] and cryotherapy in combination with burst TENS [pain threshold: mean difference 2.6 (95% CI 2.4 to 2.8); pain tolerance: mean difference 4.9 (95% CI 5.0 to 4.8)]. Cryotherapy in combination with burst TENS provided greater analgesia compared with the other groups (Pcryotherapy in combination with burst TENS to reduce induced pain, and suggest a potentiating effect when these techniques are combined. No such association was found between cryotherapy and conventional TENS. Copyright © 2014 Chartered Society of Physiotherapy. Published by Elsevier Ltd. All rights reserved.

TENS (transcutaneous electrical nerve stimulation) for labour pain.

Science.gov (United States)

Francis, Richard

2012-05-01

Because TENS is applied inconsistently and not always in line with optimal TENS application theory, this may explain why TENS for labour pain appears to be effective in some individuals and not in others. This article reviews TENS theory, advises upon optimal TENS application for labour pain and discusses some of the limitations of TENS research on labour pain. TENS application for labour pain may include TENS applied to either side of the lower spine, set to 200 mus pulse duration and 100 pulses per second. As pain increases, TENS intensity should be increased and as pain decreases, TENS intensity should be reduced to maintain a strong but pain free intensity of stimulation. This application may particularly reduce back pain during labour.

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

Science.gov (United States)

Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

2013-01-01

Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

Powers of ten

CERN Document Server

1979-01-01

Powers of Ten is a 1977 short documentary film written and directed by Charles Eames and his wife, Ray. The film depicts the relative scale of the Universe in factors of ten (see also logarithmic scale and order of magnitude). The idea for the film appears to have come from the 1957 book Cosmic View by Kees Boeke. The film begins with an aerial image of a man reclining on a blanket; the view is that of one meter across. The viewpoint, accompanied by expository voiceover, then slowly zooms out to a view ten meters across ( or 101 m in standard form), revealing that the man is picnicking in a park with a female companion. The zoom-out continues, to a view of 100 meters (102 m), then 1 kilometer (103 m), and so on, increasing the perspective—the picnic is revealed to be taking place near Soldier Field on Chicago's waterfront—and continuing to zoom out to a field of view of 1024 meters, or the size of the observable universe. The camera then zooms back in to the picnic, and then to views of negative pow...

Chern-Simons gauge theory: Ten years after

International Nuclear Information System (INIS)

Labastida, J. M. F.

1999-01-01

A brief review on the progress made in the study of Chern-Simons gauge theory since its relation to knot theory was discovered ten years ago is presented. Emphasis is made on the analysis of the perturbative study of the theory and its connection to the theory of Vassiliev invariants. It is described how the study of the quantum field theory for three different gauge fixings leads to three different representations for Vassiliev invariants. Two of these gauge fixings lead to well known representations: the covariant Landau gauge corresponds to the configuration space integrals while the non-covariant light-cone gauge to the Kontsevich integral. The progress made in the analysis of the third gauge fixing, the non-covariant temporal gauge, is described in detail. In this case one obtains combinatorial expressions, instead of integral ones, for Vassiliev invariants. The approach based on this last gauge fixing seems very promising to obtain a full combinatorial formula. We collect the combinatorial expressions for all the Vassiliev invariants up to order four which have been obtained in this approach

A model for visual memory encoding.

Directory of Open Access Journals (Sweden)

Rodolphe Nenert

Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

A model for visual memory encoding.

Science.gov (United States)

Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P

2014-01-01

Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

Lead Farmers Approach in Disseminating Improved Tef Production ...

African Journals Online (AJOL)

Abate

interview schedule and testing the tef variety on field plots of ten lead farmers ..... Product transporting from the farm ... partly explained by the fact that smallholder farmers cannot afford to purchase .... Agricultural Extension, Good Intentions.

Encoding of coordination complexes with XML.

Science.gov (United States)

Vinoth, P; Sankar, P

2017-09-01

An in-silico system to encode structure, bonding and properties of coordination complexes is developed. The encoding is achieved through a semantic XML markup frame. Composition of the coordination complexes is captured in terms of central atom and ligands. Structural information of central atom is detailed in terms of electron status of valence electron orbitals. The ligands are encoded with specific reference to the electron environment of ligand centre atoms. Behaviour of ligands to form low or high spin complexes is accomplished by assigning a Ligand Centre Value to every ligand based on the electronic environment of ligand centre atom. Chemical ontologies are used for categorization purpose and to control different hybridization schemes. Complexes formed by the central atoms of transition metal, non-transition elements belonging to s-block, p-block and f-block are encoded with a generic encoding platform. Complexes of homoleptic, heteroleptic and bridged types are also covered by this encoding system. Utility of the encoded system to predict redox electron transfer reaction in the coordination complexes is demonstrated with a simple application. Copyright © 2017 Elsevier Inc. All rights reserved.

Bacillus halodurans Strain C125 Encodes and Synthesizes Enzymes from Both Known Pathways To Form dUMP Directly from Cytosine Deoxyribonucleotides

DEFF Research Database (Denmark)

Oehlenschlæger, Christian Berg; Løvgreen, Monika Nøhr; Reinauer, Eva

2015-01-01

Analysis of the genome of Bacillus halodurans strain C125 indicated that two pathways leading from a cytosine deoxyribonucleotide to dUMP, used for dTMP synthesis, were encoded by the genome of the bacterium. The genes that were responsible, the comEB gene and the dcdB gene, encoding dCMP deaminase...

Optimal higher-order encoder time-stamping

NARCIS (Netherlands)

Merry, R.J.E.; Molengraft, van de M.J.G.; Steinbuch, M.

2013-01-01

Optical incremental encoders are used to measure the position of motion control systems. The accuracy of the position measurement is determined and bounded by the number of slits on the encoder. The position measurement is affected by quantization errors and encoder imperfections. In this paper, an

Neural correlates of the spacing effect in explicit verbal semantic encoding support the deficient-processing theory.

Science.gov (United States)

Callan, Daniel E; Schweighofer, Nicolas

2010-04-01

Spaced presentations of to-be-learned items during encoding leads to superior long-term retention over massed presentations. Despite over a century of research, the psychological and neural basis of this spacing effect however is still under investigation. To test the hypotheses that the spacing effect results either from reduction in encoding-related verbal maintenance rehearsal in massed relative to spaced presentations (deficient processing hypothesis) or from greater encoding-related elaborative rehearsal of relational information in spaced relative to massed presentations (encoding variability hypothesis), we designed a vocabulary learning experiment in which subjects encoded paired-associates, each composed of a known word paired with a novel word, in both spaced and massed conditions during functional magnetic resonance imaging. As expected, recall performance in delayed cued-recall tests was significantly better for spaced over massed conditions. Analysis of brain activity during encoding revealed that the left frontal operculum, known to be involved in encoding via verbal maintenance rehearsal, was associated with greater performance-related increased activity in the spaced relative to massed condition. Consistent with the deficient processing hypothesis, a significant decrease in activity with subsequent episodes of presentation was found in the frontal operculum for the massed but not the spaced condition. Our results suggest that the spacing effect is mediated by activity in the frontal operculum, presumably by encoding-related increased verbal maintenance rehearsal, which facilitates binding of phonological and word level verbal information for transfer into long-term memory. Copyright 2009 Wiley-Liss, Inc.

Ten Lessons from Ten Years PPP Experience in Belgium

NARCIS (Netherlands)

Willems, T.; Verhoest, K.; Voets, J.; Coppens, T.; van Dooren, W.; van den Hurk, M.

2017-01-01

In 2004 Flanders, the northern region of Belgium launched a range of large public–private partnership (PPP) projects for a total value of 6 billion euros. Ten years later, PPP has become a well-embedded procurement method for long-term public infrastructure projects. This article makes a critical

Emotional arousal and memory after deep encoding.

Science.gov (United States)

Leventon, Jacqueline S; Camacho, Gabriela L; Ramos Rojas, Maria D; Ruedas, Angelica

2018-05-22

Emotion often enhances long-term memory. One mechanism for this enhancement is heightened arousal during encoding. However, reducing arousal, via emotion regulation (ER) instructions, has not been associated with reduced memory. In fact, the opposite pattern has been observed: stronger memory for emotional stimuli encoded with an ER instruction to reduce arousal. This pattern may be due to deeper encoding required by ER instructions. In the current research, we examine the effects of emotional arousal and deep-encoding on memory across three studies. In Study 1, adult participants completed a writing task (deep-encoding) for encoding negative, neutral, and positive picture stimuli, whereby half the emotion stimuli had the ER instruction to reduce the emotion. Memory was strong across conditions, and no memory enhancement was observed for any condition. In Study 2, adult participants completed the same writing task as Study 1, as well as a shallow-encoding task for one-third of negative, neutral, and positive trials. Memory was strongest for deep vs. shallow encoding trials, with no effects of emotion or ER instruction. In Study 3, adult participants completed a shallow-encoding task for negative, neutral, and positive stimuli, with findings indicating enhanced memory for negative emotional stimuli. Findings suggest that deep encoding must be acknowledged as a source of memory enhancement when examining manipulations of emotion-related arousal. Copyright © 2018. Published by Elsevier B.V.

Novel Insights into the Diversity of Catabolic Metabolism from Ten Haloarchaeal Genomes

Energy Technology Data Exchange (ETDEWEB)

Anderson, Iain; Scheuner, Carmen; Goker, Markus; Mavromatis, Kostas; Hooper, Sean D.; Porat, Iris; Klenk, Hans-Peter; Ivanova, Natalia; Kyrpides, Nikos

2011-05-03

The extremely halophilic archaea are present worldwide in saline environments and have important biotechnological applications. Ten complete genomes of haloarchaea are now available, providing an opportunity for comparative analysis. We report here the comparative analysis of five newly sequenced haloarchaeal genomes with five previously published ones. Whole genome trees based on protein sequences provide strong support for deep relationships between the ten organisms. Using a soft clustering approach, we identified 887 protein clusters present in all halophiles. Of these core clusters, 112 are not found in any other archaea and therefore constitute the haloarchaeal signature. Four of the halophiles were isolated from water, and four were isolated from soil or sediment. Although there are few habitat-specific clusters, the soil/sediment halophiles tend to have greater capacity for polysaccharide degradation, siderophore synthesis, and cell wall modification. Halorhabdus utahensis and Haloterrigena turkmenica encode over forty glycosyl hydrolases each, and may be capable of breaking down naturally occurring complex carbohydrates. H. utahensis is specialized for growth on carbohydrates and has few amino acid degradation pathways. It uses the non-oxidative pentose phosphate pathway instead of the oxidative pathway, giving it more flexibility in the metabolism of pentoses. These new genomes expand our understanding of haloarchaeal catabolic pathways, providing a basis for further experimental analysis, especially with regard to carbohydrate metabolism. Halophilic glycosyl hydrolases for use in biofuel production are more likely to be found in halophiles isolated from soil or sediment.

Multidimensionally encoded magnetic resonance imaging.

Science.gov (United States)

Lin, Fa-Hsuan

2013-07-01

Magnetic resonance imaging (MRI) typically achieves spatial encoding by measuring the projection of a q-dimensional object over q-dimensional spatial bases created by linear spatial encoding magnetic fields (SEMs). Recently, imaging strategies using nonlinear SEMs have demonstrated potential advantages for reconstructing images with higher spatiotemporal resolution and reducing peripheral nerve stimulation. In practice, nonlinear SEMs and linear SEMs can be used jointly to further improve the image reconstruction performance. Here, we propose the multidimensionally encoded (MDE) MRI to map a q-dimensional object onto a p-dimensional encoding space where p > q. MDE MRI is a theoretical framework linking imaging strategies using linear and nonlinear SEMs. Using a system of eight surface SEM coils with an eight-channel radiofrequency coil array, we demonstrate the five-dimensional MDE MRI for a two-dimensional object as a further generalization of PatLoc imaging and O-space imaging. We also present a method of optimizing spatial bases in MDE MRI. Results show that MDE MRI with a higher dimensional encoding space can reconstruct images more efficiently and with a smaller reconstruction error when the k-space sampling distribution and the number of samples are controlled. Copyright © 2012 Wiley Periodicals, Inc.

Still No Evidence for the Encoding Variability Hypothesis: A Reply to Jang, Mickes, and Wixted (2012) and Starns, Rotello, and Ratcliff (2012)

Science.gov (United States)

Koen, Joshua D.; Yonelinas, Andrew P.

2013-01-01

Koen and Yonelinas (2010) contrasted the recollection and encoding variability accounts of the finding that old items are associated with more variable memory strength than new items. The study indicated that (a) increasing encoding variability did not lead to increased measures of old item variance, and (b) old item variance was directly related…

Shot-Noise Limited Time-Encoded Raman Spectroscopy

Directory of Open Access Journals (Sweden)

Sebastian Karpf

2017-01-01

Full Text Available Raman scattering, an inelastic scattering mechanism, provides information about molecular excitation energies and can be used to identify chemical compounds. Albeit being a powerful analysis tool, especially for label-free biomedical imaging with molecular contrast, it suffers from inherently low signal levels. This practical limitation can be overcome by nonlinear enhancement techniques like stimulated Raman scattering (SRS. In SRS, an additional light source stimulates the Raman scattering process. This can lead to orders of magnitude increase in signal levels and hence faster acquisition in biomedical imaging. However, achieving a broad spectral coverage in SRS is technically challenging and the signal is no longer background-free, as either stimulated Raman gain (SRG or loss (SRL is measured, turning a sensitivity limit into a dynamic range limit. Thus, the signal has to be isolated from the laser background light, requiring elaborate methods for minimizing detection noise. Here, we analyze the detection sensitivity of a shot-noise limited broadband stimulated time-encoded Raman (TICO-Raman system in detail. In time-encoded Raman, a wavelength-swept Fourier domain mode locking (FDML laser covers a broad range of Raman transition energies while allowing a dual-balanced detection for lowering the detection noise to the fundamental shot-noise limit.

Cortical encoding of timbre changes in cochlear implant users.

Science.gov (United States)

Zhang, Fawen; Benson, Chelsea; Cahn, Steven J

2013-01-01

Most cochlear implant (CI) users describe music as a noise-like and unpleasant sound. Using behavioral tests, most prior studies have shown that perception of pitch-based melody and timbre is poor in CI users. This article will focus on cortical encoding of timbre changes in CI users, which may allow us to find solutions to further improve CI benefits. Furthermore, the value of using objective measures to reveal neural encoding of timbre changes may be reflected in this study. A case-control study of the mismatch negativity (MMN) using electrophysiological technique was conducted. To derive MMNs, three randomly arranged oddball paradigms consisting of standard/deviant instrumental pairs: saxophone/piano, cello/trombone, and flute/French horn, respectively, were presented. Ten CI users and ten normal-hearing (NH) listeners participated in this study. After filtering, epoching, and baseline correction, independent component analysis (ICA) was performed to remove artifacts. The averaged waveforms in response to the standard stimuli (STANDARD waveform) and the deviant stimuli (DEVIANT waveform) in each condition were separately derived. The responses from nine electrodes in the fronto-central area were averaged to form one waveform. The STANDARD waveform was subtracted from the DEVIANT waveform to derive the difference waveform, for which the MMN was judged to be present or absent. The measures used to evaluate the MMN included the MMN peak latency and amplitude as well as MMN duration. The MMN, which reflects the ability to automatically detect acoustic changes, was present in all NH listeners but only approximately half of CI users. In CI users with present MMNs, the MMN peak amplitude and duration were significantly smaller and shorter compared to those in NH listeners. Our electrophysiological results were consistent with prior behavioral results that CI users' performance in timbre perception was significantly poorer than that in NH listeners. Our results may

Parallel encoders for pixel detectors

International Nuclear Information System (INIS)

Nikityuk, N.M.

1991-01-01

A new method of fast encoding and determining the multiplicity and coordinates of fired pixels is described. A specific example construction of parallel encodes and MCC for n=49 and t=2 is given. 16 refs.; 6 figs.; 2 tabs

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN): could retinoids play a causative role?

Science.gov (United States)

Mawson, Anthony R; Eriator, Ike; Karre, Sridhar

2015-01-12

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.

Blind encoding into qudits

International Nuclear Information System (INIS)

Shaari, J.S.; Wahiddin, M.R.B.; Mancini, S.

2008-01-01

We consider the problem of encoding classical information into unknown qudit states belonging to any basis, of a maximal set of mutually unbiased bases, by one party and then decoding by another party who has perfect knowledge of the basis. Working with qudits of prime dimensions, we point out a no-go theorem that forbids 'shift' operations on arbitrary unknown states. We then provide the necessary conditions for reliable encoding/decoding

Encoder designed to work in harsh environments

Energy Technology Data Exchange (ETDEWEB)

Toop, L.

2007-05-15

Dynapar has developed the Acuro AX71 absolute encoder for use on offshore or land-based oil rig operations. It provides feedback on the operation of automated systems such as draw works, racking systems, rotary tables and top drives. By ensuring that automated systems function properly, this encoder responds to a need by the oil and gas industry to keep workers safe and improve efficiency, particularly for operations in rugged situations. The encoder provides feedback from motor systems to controllers, giving information about position and speed of downhole drill bits. This newly developed encoder is better than commonly used incremental encoders which are not precise in strong electrical noise environments. Rather, the absolute encoder uses a different method of reporting to the controller. A digital signal is transmitted constantly as the device operates. It is less susceptible to noise issues. It is highly accurate, tolerant of noise and is not affected by power outages. However, the absolute encoder is generally more delicate in drilling applications with high ambient temperatures and shock levels. Dynapar addressed this issue by developing compact stainless steel housing that is useful for corrosion resistance in marine applications. The AX71 absolute encoder can withstand up to 100 G of mechanical shock and ambient temperatures of up to 60 degrees C. The encoder is ATEX certified without barriers, and offers the high resolution feedback of 4,000 counts of multiturn rotation and 16,000 counts of position. 1 fig.

Environmental regulations: their impact on the battery and lead industries

Science.gov (United States)

Ainley, John R.

This paper presents a general overview of the past and current position of the lead industry in relation to environmental legislation and its impact. The lead industry has watched environmental lead levels being steadily reduced down to levels that, ten years ago, would have been considered unachievable. Nevertheless, the industry has managed to survive the effect of the ever-increasing demands of environmental controls. During the last ten to twenty years, lead producers and users have had to assess their future positions, as the cost implications of environmental laws have had a significant impact on their bottom lines. Without doubt, this consideration most definitely affected the viability of many plants. The need to be aware of the existence of new and proposed legislation is of paramount importance, as the threat from the vast array of EEC legislation is ever apparent. Lead companies have all considered environmental legislation to have no more than a nuisance value, but it is of vital importance to the future of the industry that such legislation is approached in a positive and sensible way in order to demonstrate a full commitment to protecting both employees and the general environment. Lead must receive the credit that it so richly deserves.

Leadership among people who use AAC: ISAAC's Project LEAD

CSIR Research Space (South Africa)

Bryen, DN

2008-08-01

Full Text Available stream_source_info Bryen_2008.pdf.txt stream_content_type text/plain stream_size 23272 Content-Encoding UTF-8 stream_name Bryen_2008.pdf.txt Content-Type text/plain; charset=UTF-8 Leadership in ISAAC: Leading the Way... Diane Nelson Bryen, USA Sarah Lever, USA Sayomdeb Mujherjee, India Martin Pistorius, South Africa Melinda Smith, Australia Leading the Way � square6 Powerful conference title square6 Important call for leadership development Across the Globe...

Lead-210, polonium-210, and stable lead in the food-chain lichen, reindeer and man

International Nuclear Information System (INIS)

Persson, B.R.

1972-01-01

The measurements of stable lead and the natural fallout radionuclides lead-210 and polonium-210 in communities of lichen (Cladonia alpestris) in central Sweden from 1961 to 1970 indicate a quite constant level. The average lead-210 content per unit area in lichen carpets was found to be 15 +- 2 nCi m -2 , the average lead-210 activity concentration 6.7 +- 0.9 nCi per kg dry weight and the lead-210 specific activity 630 +- 60 nCi per g of stable lead. The polonium-210/lead-210 activity ratio was about 0.9 +- 0.1. The vertical distribution of lead-210 in the lichen carpet showed a maximum concentration in the top layer. The distribution was similar during 1967 and 1968 but the low amount of precipitation during 1968 and 1969 disturbed the distribution pattern in 1969 and 1970. The transfer of lead-210, polonium-210 and stable lead through the food chain: lichen, reindeer, and man was characterized. The absorbed dose rate in Lapps due to polonium-210 was estimated to be about 6 to 8 mrad per year in gonads and 8 to 20 mrad per year in bone tissues. This is about ten percent of their entire absorbed dose contribution from all natural radiation sources. (U.S.)

Low-Complexity Hierarchical Mode Decision Algorithms Targeting VLSI Architecture Design for the H.264/AVC Video Encoder

Directory of Open Access Journals (Sweden)

Guilherme Corrêa

2012-01-01

Full Text Available In H.264/AVC, the encoding process can occur according to one of the 13 intraframe coding modes or according to one of the 8 available interframes block sizes, besides the SKIP mode. In the Joint Model reference software, the choice of the best mode is performed through exhaustive executions of the entire encoding process, which significantly increases the encoder's computational complexity and sometimes even forbids its use in real-time applications. Considering this context, this work proposes a set of heuristic algorithms targeting hardware architectures that lead to earlier selection of one encoding mode. The amount of repetitions of the encoding process is reduced by 47 times, at the cost of a relatively small cost in compression performance. When compared to other works, the fast hierarchical mode decision results are expressively more satisfactory in terms of computational complexity reduction, quality, and bit rate. The low-complexity mode decision architecture proposed is thus a very good option for real-time coding of high-resolution videos. The solution is especially interesting for embedded and mobile applications with support to multimedia systems, since it yields good compression rates and image quality with a very high reduction in the encoder complexity.

Posterior parietal cortex and episodic encoding: insights from fMRI subsequent memory effects and dual-attention theory.

Science.gov (United States)

Uncapher, Melina R; Wagner, Anthony D

2009-02-01

The formation of episodic memories--memories for life events--is affected by attention during event processing. A leading neurobiological model of attention posits two separate yet interacting systems that depend on distinct regions in lateral posterior parietal cortex (PPC). From this dual-attention perspective, dorsal PPC is thought to support the goal-directed allocation of attention, whereas ventral PPC is thought to support reflexive orienting to information that automatically captures attention. To advance understanding of how parietal mechanisms may impact event encoding, we review functional MRI studies that document the relationship between lateral PPC activation during encoding and subsequent memory performance (e.g., later remembering or forgetting). This review reveals that (a) encoding-related activity is frequently observed in human lateral PPC, (b) increased activation in dorsal PPC is associated with later memory success, and (c) increased activation in ventral PPC predominantly correlates with later memory failure. From a dual-attention perspective, these findings suggest that allocating goal-directed attention during event processing increases the probability that the event will be remembered later, whereas the capture of reflexive attention during event processing may have negative consequences for event encoding. The prevalence of encoding-related activation in parietal cortex suggests that neurobiological models of episodic memory should consider how parietal-mediated attentional mechanisms regulate encoding.

CYSTINURIA - A TEN-YEAR FOLLOW-UP OF THE PATIENTS

Directory of Open Access Journals (Sweden)

Anđelka Slavković

2001-09-01

Full Text Available In the period from 1991 to 2001 there were four patients followed up who suffered from cystinuria and cystine calcinosis. The therapy consisting of the cystine dilution in the urine by a great taking-in of liquids and the urine alkalization was combined with alphamercaptopropione glycine and captoprile that bind cystine as well as a respective diet. Alphamercaptopropione glycine leads to the reduction of the already-formed calculus and their easier treatment in the case of a possible need for extracorporeal lithotripsy (ESWEL. During the ten-year follow-up of a small series of patients there were no complications related to the medicament treatment.

ALGORITHMS FOR TETRAHEDRAL NETWORK (TEN) GENERATION

Institute of Scientific and Technical Information of China (English)

无

2000-01-01

The Tetrahedral Network(TEN) is a powerful 3-D vector structure in GIS, which has a lot of advantages such as simple structure, fast topological relation processing and rapid visualization. The difficulty of TEN application is automatic creating data structure. Al though a raster algorithm has been introduced by some authors, the problems in accuracy, memory requirement, speed and integrity are still existent. In this paper, the raster algorithm is completed and a vector algorithm is presented after a 3-D data model and structure of TEN have been introducted. Finally, experiment, conclusion and future work are discussed.

The five times ten things everyone should have had in their hands before they are ten and two years old.

Science.gov (United States)

Hut, R.; Poot, A.

2017-12-01

To train the young ones to become people that make stuff, I present the five times ten things we use a lot that everyone should have used before they are ten and two years old. I will bring at least two times ten of these things and show them live to you! And: I will bring a large paper for you to bring home with those five times ten things on it to put in the hands of your kids!

The HADES project - ten years of civil engineering practice in a plastic clay formation

International Nuclear Information System (INIS)

De Bruyn, D.J.; Neerdael, B.A.

1991-01-01

Various civil engineering works and underground experiments have been performed during the last ten years in Belgium to assess the technical feasibility of building a repository for high level waste (HLW) disposal in a plastic clay formation; they lead to the conclusion that the construction of tunnels for this purpose may now be considered as technically and economically feasible. (author)

Reducing constraints on quantum computer design by encoded selective recoupling

International Nuclear Information System (INIS)

Lidar, D.A.; Wu, L.-A.

2002-01-01

The requirement of performing both single-qubit and two-qubit operations in the implementation of universal quantum logic often leads to very demanding constraints on quantum computer design. We show here how to eliminate the need for single-qubit operations in a large subset of quantum computer proposals: those governed by isotropic and XXZ , XY -type anisotropic exchange interactions. Our method employs an encoding of one logical qubit into two physical qubits, while logic operations are performed using an analogue of the NMR selective recoupling method

Advantages and limitations of the use of optogenetic approach in studying fast-scale spike encoding.

Directory of Open Access Journals (Sweden)

Aleksey Malyshev

Full Text Available Understanding single-neuron computations and encoding performed by spike-generation mechanisms of cortical neurons is one of the central challenges for cell electrophysiology and computational neuroscience. An established paradigm to study spike encoding in controlled conditions in vitro uses intracellular injection of a mixture of signals with fluctuating currents that mimic in vivo-like background activity. However this technique has two serious limitations: it uses current injection, while synaptic activation leads to changes of conductance, and current injection is technically most feasible in the soma, while the vast majority of synaptic inputs are located on the dendrites. Recent progress in optogenetics provides an opportunity to circumvent these limitations. Transgenic expression of light-activated ionic channels, such as Channelrhodopsin2 (ChR2, allows induction of controlled conductance changes even in thin distant dendrites. Here we show that photostimulation provides a useful extension of the tools to study neuronal encoding, but it has its own limitations. Optically induced fluctuating currents have a low cutoff (~70 Hz, thus limiting the dynamic range of frequency response of cortical neurons. This leads to severe underestimation of the ability of neurons to phase-lock their firing to high frequency components of the input. This limitation could be worked around by using short (2 ms light stimuli which produce membrane potential responses resembling EPSPs by their fast onset and prolonged decay kinetics. We show that combining application of short light stimuli to different parts of dendritic tree for mimicking distant EPSCs with somatic injection of fluctuating current that mimics fluctuations of membrane potential in vivo, allowed us to study fast encoding of artificial EPSPs photoinduced at different distances from the soma. We conclude that dendritic photostimulation of ChR2 with short light pulses provides a powerful tool to

An Unusual Phage Repressor Encoded by Mycobacteriophage BPs.

Directory of Open Access Journals (Sweden)

Valerie M Villanueva

Full Text Available Temperate bacteriophages express transcription repressors that maintain lysogeny by down-regulating lytic promoters and confer superinfection immunity. Repressor regulation is critical to the outcome of infection-lysogenic or lytic growth-as well as prophage induction into lytic replication. Mycobacteriophage BPs and its relatives use an unusual integration-dependent immunity system in which the phage attachment site (attP is located within the repressor gene (33 such that site-specific integration leads to synthesis of a prophage-encoded product (gp33103 that is 33 residues shorter at its C-terminus than the virally-encoded protein (gp33136. However, the shorter form of the repressor (gp33103 is stable and active in repression of the early lytic promoter PR, whereas the longer virally-encoded form (gp33136 is inactive due to targeted degradation via a C-terminal ssrA-like tag. We show here that both forms of the repressor bind similarly to the 33-34 intergenic regulatory region, and that BPs gp33103 is a tetramer in solution. The BPs gp33103 repressor binds to five regulatory regions spanning the BPs genome, and regulates four promoters including the early lytic promoter, PR. BPs gp33103 has a complex pattern of DNA recognition in which a full operator binding site contains two half sites separated by a variable spacer, and BPs gp33103 induces a DNA bend at the full operator site but not a half site. The operator site structure is unusual in that one half site corresponds to a 12 bp palindrome identified previously, but the other half site is a highly variable variant of the palindrome.

Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

Science.gov (United States)

Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

2015-05-14

In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

Tens bij bevallingen

NARCIS (Netherlands)

Tuin-Nuis, F.D.F.

2000-01-01

TENS (Transcutane Electrische Neuro Stimulatie) is een pijnverlichtingsmethode die berust op de Gate Control Theory van Melzack en Wall. Door middel van electrische pulsen via de huid zou de geleiding van nociceptieve signalen (pijnprikkels) worden beïnvloed en zou het lichaam endorfinen aanmaken:

High-definition, single-scan 2D MRI in inhomogeneous fields using spatial encoding methods.

Science.gov (United States)

Ben-Eliezer, Noam; Shrot, Yoav; Frydman, Lucio

2010-01-01

An approach has been recently introduced for acquiring two-dimensional (2D) nuclear magnetic resonance images in a single scan, based on the spatial encoding of the spin interactions. This article explores the potential of integrating this spatial encoding together with conventional temporal encoding principles, to produce 2D single-shot images with moderate field of views. The resulting "hybrid" imaging scheme is shown to be superior to traditional schemes in non-homogeneous magnetic field environments. An enhancement of previously discussed pulse sequences is also proposed, whereby distortions affecting the image along the spatially encoded axis are eliminated. This new variant is also characterized by a refocusing of T(2)(*) effects, leading to a restoration of high-definition images for regions which would otherwise be highly dephased and thus not visible. These single-scan 2D images are characterized by improved signal-to-noise ratios and a genuine T(2) contrast, albeit not free from inhomogeneity distortions. Simple postprocessing algorithms relying on inhomogeneity phase maps of the imaged object can successfully remove most of these residual distortions. Initial results suggest that this acquisition scheme has the potential to overcome strong field inhomogeneities acting over extended acquisition durations, exceeding 100 ms for a single-shot image.

Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA.

Science.gov (United States)

Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas

2014-02-27

Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

Fast entrainment of human electroencephalogram to a theta-band photic flicker during successful memory encoding

Directory of Open Access Journals (Sweden)

Naoyuki eSato

2013-05-01

Full Text Available Theta band power (4-8Hz in the scalp electroencephalogram (EEG is thought to be stronger during memory encoding for subsequently remembered items than for forgotten items. According to simultaneous EEG-functional magnetic resonance imaging (fMRI measurements, the memory-dependent EEG theta is associated with multiple regions of the brain. This suggests that the multiple regions cooperate with EEG theta synchronization during successful memory encoding. However, a question still remains: What kind of neural dynamic organizes such a memory-dependent global network? In this study, the modulation of the EEG theta entrainment property during successful encoding was hypothesized to lead to EEG theta synchronization among a distributed network. Then, a transient response of EEG theta to a theta-band photic flicker with a short duration was evaluated during memory encoding. In the results, flicker-induced EEG power increased and decreased with a time constant of several hundred milliseconds following the onset and the offset of the flicker, respectively. Importantly, the offset response of EEG power was found to be significantly decreased during successful encoding. Moreover, the offset response of the phase locking index was also found to associate with memory performance. According to computational simulations, the results are interpreted as a smaller time constant (i.e., faster response of a driven harmonic oscillator rather than a change in the spontaneous oscillatory input. This suggests that the fast response of EEG theta forms a global EEG theta network among memory-related regions during successful encoding, and it contributes to a flexible formation of the network along the time course.

Fast entrainment of human electroencephalogram to a theta-band photic flicker during successful memory encoding.

Science.gov (United States)

Sato, Naoyuki

2013-01-01

Theta band power (4-8 Hz) in the scalp electroencephalogram (EEG) is thought to be stronger during memory encoding for subsequently remembered items than for forgotten items. According to simultaneous EEG-functional magnetic resonance imaging (fMRI) measurements, the memory-dependent EEG theta is associated with multiple regions of the brain. This suggests that the multiple regions cooperate with EEG theta synchronization during successful memory encoding. However, a question still remains: What kind of neural dynamic organizes such a memory-dependent global network? In this study, the modulation of the EEG theta entrainment property during successful encoding was hypothesized to lead to EEG theta synchronization among a distributed network. Then, a transient response of EEG theta to a theta-band photic flicker with a short duration was evaluated during memory encoding. In the results, flicker-induced EEG power increased and decreased with a time constant of several hundred milliseconds following the onset and the offset of the flicker, respectively. Importantly, the offset response of EEG power was found to be significantly decreased during successful encoding. Moreover, the offset response of the phase locking index was also found to associate with memory performance. According to computational simulations, the results are interpreted as a smaller time constant (i.e., faster response) of a driven harmonic oscillator rather than a change in the spontaneous oscillatory input. This suggests that the fast response of EEG theta forms a global EEG theta network among memory-related regions during successful encoding, and it contributes to a flexible formation of the network along the time course.

Video encoder/decoder for encoding/decoding motion compensated images

NARCIS (Netherlands)

1996-01-01

Video encoder and decoder, provided with a motion compensator for motion-compensated video coding or decoding in which a picture is coded or decoded in blocks in alternately horizontal and vertical steps. The motion compensator is provided with addressing means (160) and controlled multiplexers

Posterior Parietal Cortex and Episodic Encoding: Insights from fMRI Subsequent Memory Effects and Dual Attention Theory

Science.gov (United States)

Uncapher, Melina; Wagner, Anthony D.

2010-01-01

The formation of episodic memories –– memories for life events –– is affected by attention during event processing. A leading neurobiological model of attention posits two separate yet interacting systems that depend on distinct regions in lateral posterior parietal cortex (PPC). From this dual-attention perspective, dorsal PPC is thought to support the goal-directed allocation of attention, whereas ventral PPC is thought to support reflexive orienting to information that automatically captures attention. To advance understanding of how parietal mechanisms may impact event encoding, we review functional MRI studies that document the relationship between lateral PPC activation during encoding and subsequent memory performance (e.g., later remembering or forgetting). This review reveals that (a) encoding-related activity is frequently observed in human lateral PPC, (b) increased activation in dorsal PPC is associated with later memory success, and (c) increased activation in ventral PPC predominantly correlates with later memory failure. From a dual-attention perspective, these findings suggest that allocating goal-directed attention during event processing increases the probability that the event will be remembered later, whereas the capture of reflexive attention during event processing may have negative consequences for event encoding. The prevalence of encoding-related activation in parietal cortex suggests that neurobiological models of episodic memory should consider how parietal-mediated attentional mechanisms regulate encoding. PMID:19028591

Increasing intensity of TENS prevents analgesic tolerance in rats

Science.gov (United States)

Sato, Karina L.; Sanada, Luciana S.; Rakel, Barbara A.; Sluka, Kathleen A.

2012-01-01

Transcutaneous electrical nerve stimulation (TENS) reduces hyperalgesia and pain. Both low frequency (LF) and high frequency (HF) TENS, delivered at the same intensity (90% motor threshold (MT)) daily, result in analgesic tolerance with repeated use by the 5th day of treatment. Thecurrentstudytestedif 1) increasingintensityby 10% per daypreventsthedevelopmentoftolerance to repeated TENS, and 2) iflowerintensity TENS (50 % MT) produces an equivalentreduction in hyperalgesia when compared to 90% MT TENS. Sprague-Dawley rats with unilateral knee joint inflammation (3% carrageenan) were separated according to the intensity of TENS used: Sham, 50% LF, 50% HF, 90% LF, 90% HF, and increased intensity by 10% per day (LF and HF). The reduced mechanical withdrawal threshold following the induction of inflammation was reversed by application of TENS applied at 90% MT and increasing intensity for the first 4 days. On the 5th day, the groups that received 90% MT intensity showed tolerance. Nevertheless, the group that received an increased intensity on each day still showed a reversal of the mechanical withdrawal threshold with TENS. These results show that the development of tolerance can be delayed by increasing intensity of TENS. PMID:22858165

Negative base encoding in optical linear algebra processors

Science.gov (United States)

Perlee, C.; Casasent, D.

1986-01-01

In the digital multiplication by analog convolution algorithm, the bits of two encoded numbers are convolved to form the product of the two numbers in mixed binary representation; this output can be easily converted to binary. Attention is presently given to negative base encoding, treating base -2 initially, and then showing that the negative base system can be readily extended to any radix. In general, negative base encoding in optical linear algebra processors represents a more efficient technique than either sign magnitude or 2's complement encoding, when the additions of digitally encoded products are performed in parallel.

Encoding entanglement-assisted quantum stabilizer codes

International Nuclear Information System (INIS)

Wang Yun-Jiang; Bai Bao-Ming; Li Zhuo; Xiao He-Ling; Peng Jin-Ye

2012-01-01

We address the problem of encoding entanglement-assisted (EA) quantum error-correcting codes (QECCs) and of the corresponding complexity. We present an iterative algorithm from which a quantum circuit composed of CNOT, H, and S gates can be derived directly with complexity O(n 2 ) to encode the qubits being sent. Moreover, we derive the number of each gate consumed in our algorithm according to which we can design EA QECCs with low encoding complexity. Another advantage brought by our algorithm is the easiness and efficiency of programming on classical computers. (general)

Data Encoding using Periodic Nano-Optical Features

Science.gov (United States)

Vosoogh-Grayli, Siamack

Successful trials have been made through a designed algorithm to quantize, compress and optically encode unsigned 8 bit integer values in the form of images using Nano optical features. The periodicity of the Nano-scale features (Nano-gratings) have been designed and investigated both theoretically and experimentally to create distinct states of variation (three on states and one off state). The use of easy to manufacture and machine readable encoded data in secured authentication media has been employed previously in bar-codes for bi-state (binary) models and in color barcodes for multiple state models. This work has focused on implementing 4 states of variation for unit information through periodic Nano-optical structures that separate an incident wavelength into distinct colors (variation states) in order to create an encoding system. Compared to barcodes and magnetic stripes in secured finite length storage media the proposed system encodes and stores more data. The benefits of multiple states of variation in an encoding unit are 1) increased numerically representable range 2) increased storage density and 3) decreased number of typical set elements for any ergodic or semi-ergodic source that emits these encoding units. A thorough investigation has targeted the effects of the use of multi-varied state Nano-optical features on data storage density and consequent data transmission rates. The results show that use of Nano-optical features for encoding data yields a data storage density of circa 800 Kbits/in2 via the implementation of commercially available high resolution flatbed scanner systems for readout. Such storage density is far greater than commercial finite length secured storage media such as Barcode family with maximum practical density of 1kbits/in2 and highest density magnetic stripe cards with maximum density circa 3 Kbits/in2. The numerically representable range of the proposed encoding unit for 4 states of variation is [0 255]. The number of

Lead intoxication in dogs: risk assessment of feeding dogs trimmings of lead-shot game.

Science.gov (United States)

Høgåsen, Helga R; Ørnsrud, Robin; Knutsen, Helle K; Bernhoft, Aksel

2016-07-25

Expanding lead-based bullets, commonly used for hunting of big game, produce a scattering of lead particles in the carcass around the wound channel. Trimmings around this channel, which are sometimes fed to dogs, may contain lead particles. The aim of this study was to assess potential health effects of feeding dogs such trimmings. Lead ingestion most commonly causes gastrointestinal and neurological clinical signs, although renal, skeletal, haematological, cardiovascular and biochemical effects have also been reported. Experimental data indicate that a daily dose of around 1 mg lead as lead acetate/kg body weight for ten days may be considered as a Lowest Observed Effect Level in dogs. Acute toxicity documentation from the Centers for Disease Control and Prevention indicates 300 mg/kg body weight as the lowest dose of lead acetate causing death in dogs after oral ingestion. Our assessment suggests that dogs fed trimmings of lead-shot game may be affected by the amounts of lead present, and that even deadly exposure could occasionally occur. The intestinal absorption of lead from bullets was assumed to be 10-80 % of that of lead acetate, reflecting both the variability in particle size and uncertainty about the bioavailability of metallic lead in dogs. Despite data gaps, this study indicates that feeding dogs trimmings of lead-shot game may represent a risk of lead intoxication. More research is needed to assess the exact consequences, if lead-based bullets are still to be used. Meanwhile, we recommend that trimmings close to the wound channel should be made inaccessible to dogs, as well as to other domestic or wild animals.

Targeted deletion of kidney glucose-6 phosphatase leads to nephropathy

NARCIS (Netherlands)

Clar, Julie; Gri, Blandine; Calderaro, Julien; Birling, Marie-Christine; Herault, Yann; Smit, G. Peter A.; Mithieux, Gilles; Rajas, Fabienne

2014-01-01

Renal failure is a major complication that arises with aging in glycogen storage disease type 1a and type 1b patients. In the kidneys, glucose-6 phosphatase catalytic subunit (encoded by G6pc) deficiency leads to the accumulation of glycogen, an effect resulting in marked nephromegaly and

Sustainability and the UK’s Leading Retailers

Directory of Open Access Journals (Sweden)

Peter Jones

2015-06-01

Full Text Available This paper provides a review of the sustainability commitments and achievements currently being publicly reported by the UK’s leading retailers and of the nature of the reporting process, and also offers some reflections on the ways these retailers are addressing and pursuing sustainability agendas. The paper begins with a short discussion of the characteristics of sustainability and draws its empirical material from the most recent information on sustainability posted on the top ten UK retailer’s corporate websites. The findings reveal that the top ten UK retailers’ sustainability commitments and achievements embrace a wide range of environmental, social and economic issues but that the reporting process has a number of weaknesses that undermine its transparency and integrity. More critically, the authors argue that these commitments are principally driven by the search for efficiency gains and that they are couched within existing business models centered on continuing growth. Thus, the leading UK retailers are, at best, currently pursuing a “weak” rather than a “strong” model of sustainability; in pursuing continuing growth, they are effectively ignoring the fact the current patterns of consumption may be unsustainable in the long term. The paper provides an accessible review of the sustainability agendas being pursued by the UK’s leading retailers and as such it will interest academics, students and practitioners interested in retailing and corporate sustainability.

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Aging and memory as discrimination: Influences of encoding specificity, cue overload, and prior knowledge.

Science.gov (United States)

Badham, Stephen P; Poirier, Marie; Gandhi, Navina; Hadjivassiliou, Anna; Maylor, Elizabeth A

2016-11-01

From the perspective of memory-as-discrimination, whether a cue leads to correct retrieval simultaneously depends on the cue's relationship to (a) the memory target and (b) the other retrieval candidates. A corollary of the view is that increasing encoding-retrieval match may only help memory if it improves the cue's capacity to discriminate the target from competitors. Here, age differences in this discrimination process were assessed by manipulating the overlap between cues present at encoding and retrieval orthogonally with cue-target distinctiveness. In Experiment 1, associative memory differences for cue-target sets between young and older adults were minimized through training and retrieval efficiency was assessed through response time. In Experiment 2, age-group differences in associative memory were left to vary and retrieval efficiency was assessed through accuracy. Both experiments showed age-invariance in memory-as-discrimination: cues increasing encoding-retrieval match did not benefit memory unless they also improved discrimination between the target and competitors. Predictions based on the age-related associative deficit were also supported: prior knowledge alleviated age-related associative deficits (Experiment 1), and increasing encoding-retrieval match benefited older more than young adults (Experiment 2). We suggest that the latter occurred because older adults' associative memory deficits reduced the impact of competing retrieval candidates-hence the age-related benefit was not attributable to encoding-retrieval match per se, but rather it was a joint function of an increased probability of the cue connecting to the target combined with a decrease in competing retrieval candidates. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Aging and Memory as Discrimination: Influences of Encoding Specificity, Cue Overload, and Prior Knowledge

Science.gov (United States)

2016-01-01

From the perspective of memory-as-discrimination, whether a cue leads to correct retrieval simultaneously depends on the cue’s relationship to (a) the memory target and (b) the other retrieval candidates. A corollary of the view is that increasing encoding-retrieval match may only help memory if it improves the cue’s capacity to discriminate the target from competitors. Here, age differences in this discrimination process were assessed by manipulating the overlap between cues present at encoding and retrieval orthogonally with cue–target distinctiveness. In Experiment 1, associative memory differences for cue–target sets between young and older adults were minimized through training and retrieval efficiency was assessed through response time. In Experiment 2, age-group differences in associative memory were left to vary and retrieval efficiency was assessed through accuracy. Both experiments showed age-invariance in memory-as-discrimination: cues increasing encoding-retrieval match did not benefit memory unless they also improved discrimination between the target and competitors. Predictions based on the age-related associative deficit were also supported: prior knowledge alleviated age-related associative deficits (Experiment 1), and increasing encoding-retrieval match benefited older more than young adults (Experiment 2). We suggest that the latter occurred because older adults’ associative memory deficits reduced the impact of competing retrieval candidates—hence the age-related benefit was not attributable to encoding-retrieval match per se, but rather it was a joint function of an increased probability of the cue connecting to the target combined with a decrease in competing retrieval candidates. PMID:27831714

In vitro quality evaluation of leading brands of ciprofloxacin tablets available in Bangladesh.

Science.gov (United States)

Uddin, Md Sahab; Mamun, Abdullah Al; Hossain, Md Saddam; Asaduzzaman, Md; Sarwar, Md Shahid; Rashid, Mamunur; Herrera-Calderon, Oscar

2017-05-30

Ciprofloxacin is a broad-spectrum antibiotic that acts against a number of bacterial infections. The study was carried out to examine the in vitro quality control tests for ten leading brands of ciprofloxacin hydrochloride 500 mg tablet formulation, registered in Bangladesh by Directorate General of Drug Administration. The quality control parameters of ten different brands of ciprofloxacin hydrochloride 500 mg tablets were determined by weight variation, friability, hardness, disintegration, dissolution and assay tests. All the tablets were evaluated for conformity with United States Pharmacopoeia-National Formulary (USP-NF) and British Pharmacopoeia (BP) standards. Among ten brands of tablets Brand C had lower mean weight variation of 1.59% and Brand E had highest mean weight variation of 3.32%. For friability test Brand F had lowest mean friability (0.27%) and Brand G had highest mean friability (0.54%). Among ten brands mean lowest and highest hardness were founded in Brand G (4.49 kg/cm 2 ) and Brand F (7.13 kg/cm 2 ) respectively. The disintegration time for ten brands of ciprofloxacin tablet obtained were in the subsequent order: Brand G (8.19 min) leading brands of this tablet met the quality control parameters as per pharmacopoeial specifications except dissolution test for four brands (Brand J, Brand H, Brand I, and Brand F).

Molecular mechanisms for protein-encoded inheritance

Science.gov (United States)

Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

2013-01-01

Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598

Beyond initial encoding: Measures of the post-encoding status of memory traces predict long-term recall in infancy

OpenAIRE

Pathman, Thanujeni; Bauer, Patricia J.

2012-01-01

The first years of life are witness to rapid changes in long-term recall ability. In the present research, we contributed to explanation of the changes by testing the absolute and relative contributions to long-term recall of encoding and post-encoding processes. Using elicited imitation, we sampled the status of 16-, 20-, and 24-month-old infants’ memory representations at various time points after experience of events. In Experiment 1, infants were tested immediately, 1 week after encoding,...

Transcutaneous electrical nerve stimulation (TENS) for pain relief in labour.

Science.gov (United States)

Dowswell, Therese; Bedwell, Carol; Lavender, Tina; Neilson, James P

2009-04-15

Transcutaneous nerve stimulation (TENS) has been proposed as a means of reducing pain in labour. The TENS unit emits low-voltage electrical impulses which vary in frequency and intensity. During labour, TENS electrodes are generally placed on the lower back, although TENS may be used to stimulate acupuncture points or other parts of the body. The physiological mechanisms whereby TENS relieves pain are uncertain. The TENS unit is frequently operated by women, which may increase sense of control in labour. To assess the effects of TENS on pain in labour. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (November 2008). Randomised controlled trials comparing women receiving TENS for pain relief in labour versus routine care, alternative pharmacological methods of pain relief, or placebo devices. We included all types of TENS machines. Two review authors assessed for inclusion all trials identified by the search strategy, carried out data extraction and assessed risk of bias. We have recorded reasons for excluding studies. The search identified 25 studies; we excluded six and included 19 studies including 1671 women. Fifteen examined TENS applied to the back, two to acupuncture points and two to the cranium. Overall, there was little difference in pain ratings between TENS and control groups, although women receiving TENS to acupuncture points were less likely to report severe pain (risk ratio 0.41, 95% confidence interval 0.32 to 0.55). The majority of women using TENS said they would be willing to use it again in a future labour. Where TENS was used as an adjunct to epidural analgesia there was no evidence that it reduced pain. There was no consistent evidence that TENS had any impact on interventions and outcomes in labour. There was little information on outcomes for mothers and babies. No adverse events were reported. There is only limited evidence that TENS reduces pain in labour and it does not seem to have any impact (either positive or

Dual beam encoded extended fractional Fourier transform security ...

Indian Academy of Sciences (India)

This paper describes a simple method for making dual beam encoded extended fractional Fourier transform (EFRT) security holograms. The hologram possesses different stages of encoding so that security features are concealed and remain invisible to the counterfeiter. These concealed and encoded anticounterfeit ...

The effect of Phonological Encoding Complexity on Speech Fluency of Stuttering and Non-Stuttering Children

Directory of Open Access Journals (Sweden)

Sara Ramezani

2012-01-01

Full Text Available Objective: Stuttering is a fairly common speech disorder. However, the etiology is poorly understood and is likely to be heterogeneous. The aim of this research is to investigate phonological encoding complexity on speech fluency in 6-9 year old stuttering children in comparison with non-stutterers in Tehran. Materials & Methods: This cross-sectional, descriptive analytic research was done on 18 stuttering children with profound and severe level and 18 non-stuttering children. The stuttering subjects were selected by convenience and normal subjects were matched to stuttering subjects by gender, age and geographics. A non-word test comprising 87 non-words was used to investigate phonological encoding and phonological complexity effects on speech fluency. Stimuli were presented in random order with approximately 5 seconds between items, using a computer via external Toshiba SOMIC SM-818 headphone and requested subject was asked to repeat them.  Results: The results indicated that speech fluency decreased significantly (P<0.05 by increasing phonological complexity comparing to controls. Conclusion: The findings of the present research seem to suggest that, stuttering children may have deficits in phonological encoding. The deficit has been increased with phonological encoding complexity. Based on covert repair hypothesis, phonological difficulty may cause covert self- repair and leads to different patterns of stuttering.

The Arabic Diatessaron Project: Digitalizing, Encoding, Lemmatization

Directory of Open Access Journals (Sweden)

Giuliano Lancioni

2016-04-01

Full Text Available The Arabic Diatessaron Project (henceforth ADP is an international research project in Digital Humanities that aims to collect, digitalise and encode all known manuscripts of the Arabic Diatessaron (henceforth AD, a text that has been relatively neglected in scholarly research. ADP’s final goal is to provide a number of tools that can enable scholars to effectively query, compare and investigate all known variants of the text that will be encoded as far as possible in compliance with the Text Encoding Initiative (TEI guidelines. The paper addresses a number of issues involved in the process of digitalising manuscripts included in the two existing editions (Ciasca 1888 and Marmardji 1935, adding variants in unedited manuscripts, encoding and lemmatising the text. Issues involved in the design of the ADP include presentation of variants, choice of the standard text, applicability of TEI guidelines, automatic translation between different encodings, cross-edition concordances and principles of lemmatisation.

Using XML to encode TMA DES metadata

Directory of Open Access Journals (Sweden)

Oliver Lyttleton

2011-01-01

Full Text Available Background: The Tissue Microarray Data Exchange Specification (TMA DES is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

Using XML to encode TMA DES metadata.

Science.gov (United States)

Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

2011-01-01

The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

Using XML to encode TMA DES metadata

Science.gov (United States)

Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

2011-01-01

Background: The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs. PMID:21969921

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

The Vixen Star Book user guide how to use the star book ten and the original star book

CERN Document Server

Chen, James

2016-01-01

This book is for anyone who owns, or is thinking of owning, a Vixen Star Book Ten telescope mount or its predecessor. A revolution in amateur astronomy has occurred in the past decade with the wide availability of high tech, computer-driven, Go-To telescopes. Vixen Optics is leading the way by offering the Star Book Ten system, with its unique star map graphics software. The Star Book Ten is the latest version of computer telescope control using star map graphics as a user interface, first introduced in the original Star Book first offered in 2003. The increasingly complicated nature of this software means that learning to optimize this program is not straightforward, and yet the resulting views when all features are correctly deployed can be phenomenal. After a short history of computerized Go-To telescopes for the consumer amateur astronomer market, Chen offers a treasury of technical information. His advice, tips, and solutions aid the user in getting the most out of the Star Book Ten system in observing s...

The effect of structural design parameters on FPGA-based feed-forward space-time trellis coding-orthogonal frequency division multiplexing channel encoders

Science.gov (United States)

Passas, Georgios; Freear, Steven; Fawcett, Darren

2010-08-01

Orthogonal frequency division multiplexing (OFDM)-based feed-forward space-time trellis code (FFSTTC) encoders can be synthesised as very high speed integrated circuit hardware description language (VHDL) designs. Evaluation of their FPGA implementation can lead to conclusions that help a designer to decide the optimum implementation, given the encoder structural parameters. VLSI architectures based on 1-bit multipliers and look-up tables (LUTs) are compared in terms of FPGA slices and block RAMs (area), as well as in terms of minimum clock period (speed). Area and speed graphs versus encoder memory order are provided for quadrature phase shift keying (QPSK) and 8 phase shift keying (8-PSK) modulation and two transmit antennas, revealing best implementation under these conditions. The effect of number of modulation bits and transmit antennas on the encoder implementation complexity is also investigated.

Aerobic Exercise During Encoding Impairs Hippocampus-Dependent Memory.

Science.gov (United States)

Soga, Keishi; Kamijo, Keita; Masaki, Hiroaki

2017-08-01

We investigated how aerobic exercise during encoding affects hippocampus-dependent memory through a source memory task that assessed hippocampus-independent familiarity and hippocampus-dependent recollection processes. Using a within-participants design, young adult participants performed a memory-encoding task while performing a cycling exercise or being seated. The subsequent retrieval phase was conducted while sitting on a chair. We assessed behavioral and event-related brain potential measures of familiarity and recollection processes during the retrieval phase. Results indicated that source accuracy was lower for encoding with exercise than for encoding in the resting condition. Event-related brain potential measures indicated that the parietal old/new effect, which has been linked to recollection processing, was observed in the exercise condition, whereas it was absent in the rest condition, which is indicative of exercise-induced hippocampal activation. These findings suggest that aerobic exercise during encoding impairs hippocampus-dependent memory, which may be attributed to inefficient source encoding during aerobic exercise.

Transcutaneous electrical nerve stimulation (TENS) for pain management in labour

Science.gov (United States)

Dowswell, Therese; Bedwell, Carol; Lavender, Tina; Neilson, James P

2014-01-01

Background Transcutaneous nerve stimulation (TENS) has been proposed as a means of reducing pain in labour. The TENS unit emits low-voltage electrical impulses which vary in frequency and intensity. During labour, TENS electrodes are generally placed on the lower back, although TENS may be used to stimulate acupuncture points or other parts of the body. The physiological mechanisms whereby TENS relieves pain are uncertain. TENS machines are frequently operated by women, which may increase a sense of control in labour. Objectives To assess the effects of TENS on pain in labour. Search methods We searched the Cochrane Pregnancy and Childbirth Group’s Trials Register (30 April 2011) and reference lists of retrieved papers. Selection criteria Randomised controlled trials comparing women receiving TENS for pain management in labour versus routine care, alternative non-pharmacological methods of pain relief, or placebo devices. We included all types of TENS machines. Data collection and analysis Two review authors assessed for inclusion all trials identified by the search strategy, carried out data extraction and assessed risk of bias. We have recorded reasons for excluding studies. Main results Seventeen trials with 1466 women contribute data to the review. Thirteen examined TENS applied to the back, two to acupuncture points, and two to the cranium. Overall, there was little difference in pain ratings between TENS and control groups, although women receiving TENS to acupuncture points were less likely to report severe pain (average risk ratio 0.41, 95% confidence interval 0.31 to 0.54; measured in two studies). The majority of women using TENS said they would be willing to use it again in a future labour. Where TENS was used as an adjunct to epidural analgesia there was no evidence that it reduced pain. There was no consistent evidence that TENS had any impact on interventions and outcomes in labour. There was little information on outcomes for mothers and babies. No

Transcutaneous electrical nerve stimulation (TENS) for neuropathic pain in adults.

Science.gov (United States)

Gibson, William; Wand, Benedict M; O'Connell, Neil E

2017-09-14

Neuropathic pain, which is due to nerve disease or damage, represents a significant burden on people and society. It can be particularly unpleasant and achieving adequate symptom control can be difficult. Non-pharmacological methods of treatment are often employed by people with neuropathic pain and may include transcutaneous electrical nerve stimulation (TENS). This review supersedes one Cochrane Review 'Transcutaneous electrical nerve stimulation (TENS) for chronic pain' (Nnoaham 2014) and one withdrawn protocol 'Transcutaneous electrical nerve stimulation (TENS) for neuropathic pain in adults' (Claydon 2014). This review replaces the original protocol for neuropathic pain that was withdrawn. To determine the analgesic effectiveness of TENS versus placebo (sham) TENS, TENS versus usual care, TENS versus no treatment and TENS in addition to usual care versus usual care alone in the management of neuropathic pain in adults. We searched CENTRAL, MEDLINE, Embase, PsycINFO, AMED, CINAHL, Web of Science, PEDro, LILACS (up to September 2016) and various clinical trials registries. We also searched bibliographies of included studies for further relevant studies. We included randomised controlled trials where TENS was evaluated in the treatment of central or peripheral neuropathic pain. We included studies if they investigated the following: TENS versus placebo (sham) TENS, TENS versus usual care, TENS versus no treatment and TENS in addition to usual care versus usual care alone in the management of neuropathic pain in adults. Two review authors independently screened all database search results and identified papers requiring full-text assessment. Subsequently, two review authors independently applied inclusion/exclusion criteria to these studies. The same review authors then independently extracted data, assessed for risk of bias using the Cochrane standard tool and rated the quality of evidence using GRADE. We included 15 studies with 724 participants. We found a

Convolutional over Recurrent Encoder for Neural Machine Translation

Directory of Open Access Journals (Sweden)

Dakwale Praveen

2017-06-01

Full Text Available Neural machine translation is a recently proposed approach which has shown competitive results to traditional MT approaches. Standard neural MT is an end-to-end neural network where the source sentence is encoded by a recurrent neural network (RNN called encoder and the target words are predicted using another RNN known as decoder. Recently, various models have been proposed which replace the RNN encoder with a convolutional neural network (CNN. In this paper, we propose to augment the standard RNN encoder in NMT with additional convolutional layers in order to capture wider context in the encoder output. Experiments on English to German translation demonstrate that our approach can achieve significant improvements over a standard RNN-based baseline.

The TEN-T core network and the Fehmarnbelt region

DEFF Research Database (Denmark)

Guasco, Clement Nicolas

This note is a snapshot picture, taken in early 2014, that places the Green STRING corridor project within the context of the TEN-T strategy and gives a summarized overview on the impact of this strategy in the region. Chapter 1 contains a summary of the TEN-T strategy today, chapter 2 presents...... the sources used for this note, chapter 3 presents all the relevant EU regulations with direct impact on the development of TEN-T corridors, chapter 4 gives practical examples of the challenges for the development of TEN-T corridors, chapter 5 pre-sents the national initiatives related to the TEN-T corridor...

Noticing relevant problem features: activating prior knowledge affects problem solving by guiding encoding

Science.gov (United States)

Crooks, Noelle M.; Alibali, Martha W.

2013-01-01

This study investigated whether activating elements of prior knowledge can influence how problem solvers encode and solve simple mathematical equivalence problems (e.g., 3 + 4 + 5 = 3 + __). Past work has shown that such problems are difficult for elementary school students (McNeil and Alibali, 2000). One possible reason is that children's experiences in math classes may encourage them to think about equations in ways that are ultimately detrimental. Specifically, children learn a set of patterns that are potentially problematic (McNeil and Alibali, 2005a): the perceptual pattern that all equations follow an “operations = answer” format, the conceptual pattern that the equal sign means “calculate the total”, and the procedural pattern that the correct way to solve an equation is to perform all of the given operations on all of the given numbers. Upon viewing an equivalence problem, knowledge of these patterns may be reactivated, leading to incorrect problem solving. We hypothesized that these patterns may negatively affect problem solving by influencing what people encode about a problem. To test this hypothesis in children would require strengthening their misconceptions, and this could be detrimental to their mathematical development. Therefore, we tested this hypothesis in undergraduate participants. Participants completed either control tasks or tasks that activated their knowledge of the three patterns, and were then asked to reconstruct and solve a set of equivalence problems. Participants in the knowledge activation condition encoded the problems less well than control participants. They also made more errors in solving the problems, and their errors resembled the errors children make when solving equivalence problems. Moreover, encoding performance mediated the effect of knowledge activation on equivalence problem solving. Thus, one way in which experience may affect equivalence problem solving is by influencing what students encode about the

Exploring the influence of encoding format on subsequent memory.

Science.gov (United States)

Turney, Indira C; Dennis, Nancy A; Maillet, David; Rajah, M Natasha

2017-05-01

Distinctive encoding is greatly influenced by gist-based processes and has been shown to suffer when highly similar items are presented in close succession. Thus, elucidating the mechanisms underlying how presentation format affects gist processing is essential in determining the factors that influence these encoding processes. The current study utilised multivariate partial least squares (PLS) analysis to identify encoding networks directly associated with retrieval performance in a blocked and intermixed presentation condition. Subsequent memory analysis for successfully encoded items indicated no significant differences between reaction time and retrieval performance and presentation format. Despite no significant behavioural differences, behaviour PLS revealed differences in brain-behaviour correlations and mean condition activity in brain regions associated with gist-based vs. distinctive encoding. Specifically, the intermixed format encouraged more distinctive encoding, showing increased activation of regions associated with strategy use and visual processing (e.g., frontal and visual cortices, respectively). Alternatively, the blocked format exhibited increased gist-based processes, accompanied by increased activity in the right inferior frontal gyrus. Together, results suggest that the sequence that information is presented during encoding affects the degree to which distinctive encoding is engaged. These findings extend our understanding of the Fuzzy Trace Theory and the role of presentation format on encoding processes.

Source-constrained retrieval influences the encoding of new information.

Science.gov (United States)

Danckert, Stacey L; MacLeod, Colin M; Fernandes, Myra A

2011-11-01

Jacoby, Shimizu, Daniels, and Rhodes (Psychonomic Bulletin & Review, 12, 852-857, 2005) showed that new words presented as foils among a list of old words that had been deeply encoded were themselves subsequently better recognized than new words presented as foils among a list of old words that had been shallowly encoded. In Experiment 1, by substituting a deep-versus-shallow imagery manipulation for the levels-of-processing manipulation, we demonstrated that the effect is robust and that it generalizes, also occurring with a different type of encoding. In Experiment 2, we provided more direct evidence for context-related encoding during tests of deeply encoded words, showing enhanced priming for foils presented among deeply encoded targets when participants made the same deep-encoding judgments on those items as had been made on the targets during study. In Experiment 3, we established that the findings from Experiment 2 are restricted to this specific deep judgment task and are not a general consequence of these foils being associated with deeply encoded items. These findings provide support for the source-constrained retrieval hypothesis of Jacoby, Shimizu, Daniels, and Rhodes: New information can be influenced by how surrounding items are encoded and retrieved, as long as the surrounding items recruit a coherent mode of processing.

Transcutaneous electric nerve stimulation (TENS) in dentistry- A review.

Science.gov (United States)

Kasat, Vikrant; Gupta, Aditi; Ladda, Ruchi; Kathariya, Mitesh; Saluja, Harish; Farooqui, Anjum-Ara

2014-12-01

Transcutaneous electric nerve stimulation (TENS) is a non-pharmacological method which is widely used by medical and paramedical professionals for the management of acute and chronic pain in a variety of conditions. Similarly, it can be utilized for the management of pain during various dental procedures as well as pain due to various conditions affecting maxillofacial region. This review aims to provide an insight into clinical research evidence available for the analgesic and non analgesic uses of TENS in pediatric as well as adult patients related to the field of dentistry. Also, an attempt is made to briefly discuss history of therapeutic electricity, mechanism of action of TENS, components of TENs equipment, types, techniques of administration, advantages and contradictions of TENS. With this we hope to raise awareness among dental fraternity regarding its dental applications thereby increasing its use in dentistry. Key words:Dentistry, pain, TENS.

Hall effect encoding of brushless dc motors

Science.gov (United States)

Berard, C. A.; Furia, T. J.; Goldberg, E. A.; Greene, R. C.

1970-01-01

Encoding mechanism integral to the motor and using the permanent magnets embedded in the rotor eliminates the need for external devices to encode information relating the position and velocity of the rotating member.

Multichannel compressive sensing MRI using noiselet encoding.

Directory of Open Access Journals (Sweden)

Kamlesh Pawar

Full Text Available The incoherence between measurement and sparsifying transform matrices and the restricted isometry property (RIP of measurement matrix are two of the key factors in determining the performance of compressive sensing (CS. In CS-MRI, the randomly under-sampled Fourier matrix is used as the measurement matrix and the wavelet transform is usually used as sparsifying transform matrix. However, the incoherence between the randomly under-sampled Fourier matrix and the wavelet matrix is not optimal, which can deteriorate the performance of CS-MRI. Using the mathematical result that noiselets are maximally incoherent with wavelets, this paper introduces the noiselet unitary bases as the measurement matrix to improve the incoherence and RIP in CS-MRI. Based on an empirical RIP analysis that compares the multichannel noiselet and multichannel Fourier measurement matrices in CS-MRI, we propose a multichannel compressive sensing (MCS framework to take the advantage of multichannel data acquisition used in MRI scanners. Simulations are presented in the MCS framework to compare the performance of noiselet encoding reconstructions and Fourier encoding reconstructions at different acceleration factors. The comparisons indicate that multichannel noiselet measurement matrix has better RIP than that of its Fourier counterpart, and that noiselet encoded MCS-MRI outperforms Fourier encoded MCS-MRI in preserving image resolution and can achieve higher acceleration factors. To demonstrate the feasibility of the proposed noiselet encoding scheme, a pulse sequences with tailored spatially selective RF excitation pulses was designed and implemented on a 3T scanner to acquire the data in the noiselet domain from a phantom and a human brain. The results indicate that noislet encoding preserves image resolution better than Fouirer encoding.

Low Complexity HEVC Encoder for Visual Sensor Networks

Directory of Open Access Journals (Sweden)

Zhaoqing Pan

2015-12-01

Full Text Available Visual sensor networks (VSNs can be widely applied in security surveillance, environmental monitoring, smart rooms, etc. However, with the increased number of camera nodes in VSNs, the volume of the visual information data increases significantly, which becomes a challenge for storage, processing and transmitting the visual data. The state-of-the-art video compression standard, high efficiency video coding (HEVC, can effectively compress the raw visual data, while the higher compression rate comes at the cost of heavy computational complexity. Hence, reducing the encoding complexity becomes vital for the HEVC encoder to be used in VSNs. In this paper, we propose a fast coding unit (CU depth decision method to reduce the encoding complexity of the HEVC encoder for VSNs. Firstly, the content property of the CU is analyzed. Then, an early CU depth decision method and a low complexity distortion calculation method are proposed for the CUs with homogenous content. Experimental results show that the proposed method achieves 71.91% on average encoding time savings for the HEVC encoder for VSNs.

Targeted/exome sequencing identified mutations in ten Chinese patients diagnosed with Noonan syndrome and related disorders

Directory of Open Access Journals (Sweden)

Shanshan Xu

2017-10-01

Full Text Available Abstract Background Noonan syndrome (NS and Noonan syndrome with multiple lentigines (NSML are autosomal dominant developmental disorders. NS and NSML are caused by abnormalities in genes that encode proteins related to the RAS-MAPK pathway, including PTPN11, RAF1, BRAF, and MAP2K. In this study, we diagnosed ten NS or NSML patients via targeted sequencing or whole exome sequencing (TS/WES. Methods TS/WES was performed to identify mutations in ten Chinese patients who exhibited the following manifestations: potential facial dysmorphisms, short stature, congenital heart defects, and developmental delay. Sanger sequencing was used to confirm the suspected pathological variants in the patients and their family members. Results TS/WES revealed three mutations in the PTPN11 gene, three mutations in RAF1 gene, and four mutations in BRAF gene in the NS and NSML patients who were previously diagnosed based on the abovementioned clinical features. All the identified mutations were determined to be de novo mutations. However, two patients who carried the same mutation in the RAF1 gene presented different clinical features. One patient with multiple lentigines was diagnosed with NSML, while the other patient without lentigines was diagnosed with NS. In addition, a patient who carried a hotspot mutation in the BRAF gene was diagnosed with NS instead of cardiofaciocutaneous syndrome (CFCS. Conclusions TS/WES has emerged as a useful tool for definitive diagnosis and accurate genetic counseling of atypical cases. In this study, we analyzed ten Chinese patients diagnosed with NS and related disorders and identified their correspondingPTPN11, RAF1, and BRAF mutations. Among the target genes, BRAF showed the same degree of correlation with NS incidence as that of PTPN11 or RAF1.

Ten steps to successful software process improvement

Science.gov (United States)

Kandt, R. K.

2003-01-01

This paper identifies ten steps for managing change that address organizational and cultural issues. Four of these steps are critical, that if not done, will almost guarantee failure. This ten-step program emphasizes the alignment of business goals, change process goals, and the work performed by the employees of an organization.

Negative affect promotes encoding of and memory for details at the expense of the gist: affect, encoding, and false memories.

Science.gov (United States)

Storbeck, Justin

2013-01-01

I investigated whether negative affective states enhance encoding of and memory for item-specific information reducing false memories. Positive, negative, and neutral moods were induced, and participants then completed a Deese-Roediger-McDermott (DRM) false-memory task. List items were presented in unique spatial locations or unique fonts to serve as measures for item-specific encoding. The negative mood conditions had more accurate memories for item-specific information, and they also had fewer false memories. The final experiment used a manipulation that drew attention to distinctive information, which aided learning for DRM words, but also promoted item-specific encoding. For the condition that promoted item-specific encoding, false memories were reduced for positive and neutral mood conditions to a rate similar to that of the negative mood condition. These experiments demonstrated that negative affective cues promote item-specific processing reducing false memories. People in positive and negative moods encode events differently creating different memories for the same event.

Evaluation of color encodings for high dynamic range pixels

Science.gov (United States)

Boitard, Ronan; Mantiuk, Rafal K.; Pouli, Tania

2015-03-01

Traditional Low Dynamic Range (LDR) color spaces encode a small fraction of the visible color gamut, which does not encompass the range of colors produced on upcoming High Dynamic Range (HDR) displays. Future imaging systems will require encoding much wider color gamut and luminance range. Such wide color gamut can be represented using floating point HDR pixel values but those are inefficient to encode. They also lack perceptual uniformity of the luminance and color distribution, which is provided (in approximation) by most LDR color spaces. Therefore, there is a need to devise an efficient, perceptually uniform and integer valued representation for high dynamic range pixel values. In this paper we evaluate several methods for encoding colour HDR pixel values, in particular for use in image and video compression. Unlike other studies we test both luminance and color difference encoding in a rigorous 4AFC threshold experiments to determine the minimum bit-depth required. Results show that the Perceptual Quantizer (PQ) encoding provides the best perceptual uniformity in the considered luminance range, however the gain in bit-depth is rather modest. More significant difference can be observed between color difference encoding schemes, from which YDuDv encoding seems to be the most efficient.

Security enhanced BioEncoding for protecting iris codes

Science.gov (United States)

Ouda, Osama; Tsumura, Norimichi; Nakaguchi, Toshiya

2011-06-01

Improving the security of biometric template protection techniques is a key prerequisite for the widespread deployment of biometric technologies. BioEncoding is a recently proposed template protection scheme, based on the concept of cancelable biometrics, for protecting biometric templates represented as binary strings such as iris codes. The main advantage of BioEncoding over other template protection schemes is that it does not require user-specific keys and/or tokens during verification. Besides, it satisfies all the requirements of the cancelable biometrics construct without deteriorating the matching accuracy. However, although it has been shown that BioEncoding is secure enough against simple brute-force search attacks, the security of BioEncoded templates against more smart attacks, such as record multiplicity attacks, has not been sufficiently investigated. In this paper, a rigorous security analysis of BioEncoding is presented. Firstly, resistance of BioEncoded templates against brute-force attacks is revisited thoroughly. Secondly, we show that although the cancelable transformation employed in BioEncoding might be non-invertible for a single protected template, the original iris code could be inverted by correlating several templates used in different applications but created from the same iris. Accordingly, we propose an important modification to the BioEncoding transformation process in order to hinder attackers from exploiting this type of attacks. The effectiveness of adopting the suggested modification is validated and its impact on the matching accuracy is investigated empirically using CASIA-IrisV3-Interval dataset. Experimental results confirm the efficacy of the proposed approach and show that it preserves the matching accuracy of the unprotected iris recognition system.

The origin of the future ten questions for the next ten years

CERN Document Server

Gribbin, John

2006-01-01

How did the universe begin? Where do galaxies come from? How do stars and planets form? Where do the material particles we are made of come from? How did life begin? Today we have only provisional answers to such questions. But scientific progress will improve these answers dramatically over the next ten years, predicts John Gribbin in this riveting book. He focuses on what we know—or think we know—about ten controversial, unanswered issues in the physical sciences and explains how current cutting-edge research may yield solutions in the very near future. With his trademark facility for engaging readers with or without a scientific background, the author explores ideas concerning the creation of the universe, the possibility of other forms of life, and the fate of the expanding cosmos. He examines “theories of everything,” including grand unified theories and string theory, and he discusses the Big Bang theory, the origin of structure and patterns of matter in the galaxies, and dark mass and dark ene...

Deep and shallow encoding effects on face recognition: an ERP study.

Science.gov (United States)

Marzi, Tessa; Viggiano, Maria Pia

2010-12-01

Event related potentials (ERPs) were employed to investigate whether and when brain activity related to face recognition varies according to the processing level undertaken at encoding. Recognition was assessed when preceded by a "shallow" (orientation judgement) or by a "deep" study task (occupation judgement). Moreover, we included a further manipulation by presenting at encoding faces either in the upright or inverted orientation. As expected, deeply encoded faces were recognized more accurately and more quickly with respect to shallowly encoded faces. The ERP showed three main findings: i) as witnessed by more positive-going potentials for deeply encoded faces, at early and later processing stage, face recognition was influenced by the processing strategy adopted during encoding; ii) structural encoding, indexed by the N170, turned out to be "cognitively penetrable" showing repetition priming effects for deeply encoded faces; iii) face inversion, by disrupting configural processing during encoding, influenced memory related processes for deeply encoded faces and impaired the recognition of faces shallowly processed. The present study adds weight to the concept that the depth of processing during memory encoding affects retrieval. We found that successful retrieval following deep encoding involved both familiarity- and recollection-related processes showing from 500 ms a fronto-parietal distribution, whereas shallow encoding affected only earlier processing stages reflecting perceptual priming. Copyright © 2010 Elsevier B.V. All rights reserved.

Review of Random Phase Encoding in Volume Holographic Storage

Directory of Open Access Journals (Sweden)

Wei-Chia Su

2012-09-01

Full Text Available Random phase encoding is a unique technique for volume hologram which can be applied to various applications such as holographic multiplexing storage, image encryption, and optical sensing. In this review article, we first review and discuss diffraction selectivity of random phase encoding in volume holograms, which is the most important parameter related to multiplexing capacity of volume holographic storage. We then review an image encryption system based on random phase encoding. The alignment of phase key for decryption of the encoded image stored in holographic memory is analyzed and discussed. In the latter part of the review, an all-optical sensing system implemented by random phase encoding and holographic interconnection is presented.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Grammatical constraints on phonological encoding in speech production.

Science.gov (United States)

Heller, Jordana R; Goldrick, Matthew

2014-12-01

To better understand the influence of grammatical encoding on the retrieval and encoding of phonological word-form information during speech production, we examine how grammatical class constraints influence the activation of phonological neighbors (words phonologically related to the target--e.g., MOON, TWO for target TUNE). Specifically, we compare how neighbors that share a target's grammatical category (here, nouns) influence its planning and retrieval, assessed by picture naming latencies, and phonetic encoding, assessed by word productions in picture names, when grammatical constraints are strong (in sentence contexts) versus weak (bare naming). Within-category (noun) neighbors influenced planning time and phonetic encoding more strongly in sentence contexts. This suggests that grammatical encoding constrains phonological processing; the influence of phonological neighbors is grammatically dependent. Moreover, effects on planning times could not fully account for phonetic effects, suggesting that phonological interaction affects articulation after speech onset. These results support production theories integrating grammatical, phonological, and phonetic processes.

Two Pathways to Stimulus Encoding in Category Learning?

Science.gov (United States)

Davis, Tyler; Love, Bradley C.; Maddox, W. Todd

2008-01-01

Category learning theorists tacitly assume that stimuli are encoded by a single pathway. Motivated by theories of object recognition, we evaluate a dual-pathway account of stimulus encoding. The part-based pathway establishes mappings between sensory input and symbols that encode discrete stimulus features, whereas the image-based pathway applies holistic templates to sensory input. Our experiments use rule-plus-exception structures in which one exception item in each category violates a salient regularity and must be distinguished from other items. In Experiment 1, we find that discrete representations are crucial for recognition of exceptions following brief training. Experiments 2 and 3 involve multi-session training regimens designed to encourage either part or image-based encoding. We find that both pathways are able to support exception encoding, but have unique characteristics. We speculate that one advantage of the part-based pathway is the ability to generalize across domains, whereas the image-based pathway provides faster and more effortless recognition. PMID:19460948

Modular verification of chemical reaction network encodings via serializability analysis

Science.gov (United States)

Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

2015-01-01

Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

Transcutaneous electrical nerve stimulation (TENS) for chronic low back pain.

Science.gov (United States)

Milne, S; Welch, V; Brosseau, L; Saginur, M; Shea, B; Tugwell, P; Wells, G

2001-01-01

Low back pain (LBP) affects a large proportion of the population. Transcutaneous electrical nerve stimulation (TENS) was introduced more than 30 years ago as an alternative therapy to pharmacological treatments for chronic pain. However, despite its widespread use, the effectiveness of TENS is still controversial. The aim of this systematic review was to determine the efficacy of TENS in the treatment of chronic LBP. We searched MEDLINE, EMBASE, PEDro and the Cochrane Controlled Trials Register up to June 1, 2000. Only randomized controlled clinical trials of TENS for the treatment of patients with a clinical diagnosis of chronic LBP were included. Abstracts were excluded unless further data could be obtained from the authors. Two reviewers independently selected trials and extracted data using predetermined forms. Heterogeneity was tested with Cochran's Q test. A fixed effects model was used throughout for continuous variables, except where heterogeneity existed, in which case, a random effects model was used. Results are presented as weighted mean differences (WMD) with 95% confidence intervals (95% CI), where the difference between the treated and control groups was weighted by the inverse of the variance. Standardized mean differences (SMD) were calculated by dividing the difference between the treated and control by the baseline variance. SMD were used when different scales were used to measure the same concept. Dichotomous outcomes were analyzed with odds ratios. Five trials were included, with 170 subjects randomized to the placebo group receiving sham-TENS and 251 subjects receiving active TENS (153 for conventional mode, 98 for acupuncture-like TENS). The schedule of treatments varied greatly between studies ranging from one treatment/day for two consecutive days, to three treatments/day for four weeks. There were no statistically significant differences between the active TENS group when compared to the placebo TENS group for any outcome measures

High-Efficient Parallel CAVLC Encoders on Heterogeneous Multicore Architectures

Directory of Open Access Journals (Sweden)

H. Y. Su

2012-04-01

Full Text Available This article presents two high-efficient parallel realizations of the context-based adaptive variable length coding (CAVLC based on heterogeneous multicore processors. By optimizing the architecture of the CAVLC encoder, three kinds of dependences are eliminated or weaken, including the context-based data dependence, the memory accessing dependence and the control dependence. The CAVLC pipeline is divided into three stages: two scans, coding, and lag packing, and be implemented on two typical heterogeneous multicore architectures. One is a block-based SIMD parallel CAVLC encoder on multicore stream processor STORM. The other is a component-oriented SIMT parallel encoder on massively parallel architecture GPU. Both of them exploited rich data-level parallelism. Experiments results show that compared with the CPU version, more than 70 times of speedup can be obtained for STORM and over 50 times for GPU. The implementation of encoder on STORM can make a real-time processing for 1080p @30fps and GPU-based version can satisfy the requirements for 720p real-time encoding. The throughput of the presented CAVLC encoders is more than 10 times higher than that of published software encoders on DSP and multicore platforms.

The dependence of neuronal encoding efficiency on Hebbian plasticity and homeostatic regulation of neurotransmitter release

Directory of Open Access Journals (Sweden)

Faramarz eFaghihi

2015-04-01

Full Text Available Synapses act as information filters by different molecular mechanisms including retrograde messenger that affect neuronal spiking activity. One of the well-known effects of retrograde messenger in presynaptic neurons is a change of the probability of neurotransmitter release. Hebbian learning describe a strengthening of a synapse between a presynaptic input onto a postsynaptic neuron when both pre- and postsynaptic neurons are coactive. In this work, a theory of homeostatic regulation of neurotransmitter release by retrograde messenger and Hebbian plasticity in neuronal encoding is presented. Encoding efficiency was measured for different synaptic conditions. In order to gain high encoding efficiency, the spiking pattern of a neuron should be dependent on the intensity of the input and show low levels of noise. In this work, we represent spiking trains as zeros and ones (corresponding to non-spike or spike in a time bin, respectively as words with length equal to three. Then the frequency of each word (here eight words is measured using spiking trains. These frequencies are used to measure neuronal efficiency in different conditions and for different parameter values. Results show that neurons that have synapses acting as band-pass filters show the highest efficiency to encode their input when both Hebbian mechanism and homeostatic regulation of neurotransmitter release exist in synapses. Specifically, the integration of homeostatic regulation of feedback inhibition with Hebbian mechanism and homeostatic regulation of neurotransmitter release in the synapses leads to even higher efficiency when high stimulus intensity is presented to the neurons. However, neurons with synapses acting as high-pass filters show no remarkable increase in encoding efficiency for all simulated synaptic plasticity mechanisms.

Indirect Encoding in Neuroevolutionary Ship Handling

Directory of Open Access Journals (Sweden)

Miroslaw Lacki

2018-03-01

Full Text Available In this paper the author compares the efficiency of two encoding schemes for artificial intelligence methods used in the neuroevolutionary ship maneuvering system. This may be also be seen as the ship handling system that simulates a learning process of a group of artificial helmsmen - autonomous control units, created with an artificial neural network. The helmsman observes input signals derived form an enfironment and calculates the values of required parameters of the vessel maneuvering in confined waters. In neuroevolution such units are treated as individuals in population of artificial neural networks, which through environmental sensing and evolutionary algorithms learn to perform given task efficiently. The main task of this project is to evolve a population of helmsmen with indirect encoding and compare results of simulation with direct encoding method.

What is a "good" encoding of guarded choice?

DEFF Research Database (Denmark)

Nestmann, Uwe

2000-01-01

into the latter that preserves divergence-freedom and symmetries. This paper argues that there are nevertheless "good" encodings between these calculi. In detail, we present a series of encodings for languages with (1) input-guarded choice, (2) both input and output-guarded choice, and (3) mixed-guarded choice......, and investigate them with respect to compositionality and divergence-freedom. The first and second encoding satisfy all of the above criteria, but various "good" candidates for the third encoding-inspired by an existing distributed implementation-invalidate one or the other criterion, While essentially confirming...... Palamidessi's result, our study suggests that the combination of strong compositionality and divergence-freedom is too strong for more practical purposes. (C) 2000 Academic Press....

Does the lead white on graphic art have a dark future?

DEFF Research Database (Denmark)

Vila, Anna; Ryhl-Svendsen, Morten; Buti, David

in the formation of lead sulphide (galena, PbS) [3]. Although the galena is the most frequently found degradation product associated to lead carbonate, brown lead dioxide (plattnerite, PbO2) can also be detected. Records from the last ten years on the Statens Museum for Kunst (SMK) graphic art collection revealed...... the formation, in a very short time, of different types of dark spots on the lead white highlights. A recent systematic survey at SMK and the Danish Royal Library (RL) mapped the occurrence and degree of degradation on graphic art and photography and allowed to classify the lead white phenomena. Watercolor mock......, D., et al., Spectroscopic studies on the darkening of lead white. Applied spectroscopy, 2003. 57(11): p. 1393-1398....

Analysis of the Spectral Efficiency of Frequency-Encoded OCDMA Systems With Incoherent Sources

Science.gov (United States)

Rochette, Martin; Ayotte, Simon; Rusch, Leslie A.

2005-04-01

This paper presents the spectral efficiency of frequency-encoded (FE) optical code-division multiple-access (OCDMA) systems with incoherent sources. The spectral efficiency of five code families compatible with FE-OCDMA is calculated as a function of the number of users. Analytical equations valid in the limiting case of Gaussian noise are also developed for the bit-error rate and the spectral efficiency. Among the code families considered, the modified quadratic congruence code leads to the maximum achievable spectral efficiency.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Encoding specificity manipulations do affect retrieval from memory.

Science.gov (United States)

Zeelenberg, René

2005-05-01

In a recent article, P.A. Higham (2002) [Strong cues are not necessarily weak: Thomson and Tulving (1970) and the encoding specificity principle revisited. Memory &Cognition, 30, 67-80] proposed a new way to analyze cued recall performance in terms of three separable aspects of memory (retrieval, monitoring, and report bias) by comparing performance under both free-report and forced-report instructions. He used this method to derive estimates of these aspects of memory in an encoding specificity experiment similar to that reported by D.M. Thomson and E. Tulving (1970) [Associative encoding and retrieval: weak and strong cues. Journal of Experimental Psychology, 86, 255-262]. Under forced-report instructions, the encoding specificity manipulation did not affect performance. Higham concluded that the manipulation affected monitoring and report bias, but not retrieval. I argue that this interpretation of the results is problematic because the Thomson and Tulving paradigm is confounded, and show in three experiments using a more appropriate design that encoding specificity manipulations do affect performance in forced-report cued recall. Because in Higham's framework forced-report performance provides a measure of retrieval that is uncontaminated by monitoring and report bias it is concluded that encoding specificity manipulations do affect retrieval from memory.

Encoding of electrophysiology and other signals in MR images

DEFF Research Database (Denmark)

Hanson, Lars G; Lund, Torben E; Hanson, Christian G

2007-01-01

to the "magstripe" technique used for encoding of soundtracks in motion pictures, the electrical signals are in this way encoded as artifacts appearing in the MR images or spectra outside the region of interest. The encoded signals are subsequently reconstructed from the signal recorded by the scanner. RESULTS...

A Ten-Year Reflection

Science.gov (United States)

Phillip, Cyndi

2016-01-01

Five initiatives launched during Cyndi Phillip's term as American Association of School Librarians (AASL) President (2006-2007) continue to have an impact on school librarians ten years later. They include the rewriting of AASL's learning standards, introduction of the SKILLS Act, the presentation of the Crystal Apple Award to Scholastic Library…

Spatially multiplexed orbital-angular-momentum-encoded single photon and classical channels in a free-space optical communication link.

Science.gov (United States)

Ren, Yongxiong; Liu, Cong; Pang, Kai; Zhao, Jiapeng; Cao, Yinwen; Xie, Guodong; Li, Long; Liao, Peicheng; Zhao, Zhe; Tur, Moshe; Boyd, Robert W; Willner, Alan E

2017-12-01

We experimentally demonstrate spatial multiplexing of an orbital angular momentum (OAM)-encoded quantum channel and a classical Gaussian beam with a different wavelength and orthogonal polarization. Data rates as large as 100 MHz are achieved by encoding on two different OAM states by employing a combination of independently modulated laser diodes and helical phase holograms. The influence of OAM mode spacing, encoding bandwidth, and interference from the co-propagating Gaussian beam on registered photon count rates and quantum bit error rates is investigated. Our results show that the deleterious effects of intermodal crosstalk effects on system performance become less important for OAM mode spacing Δ≥2 (corresponding to a crosstalk value of less than -18.5  dB). The use of OAM domain can additionally offer at least 10.4 dB isolation besides that provided by wavelength and polarization, leading to a further suppression of interference from the classical channel.

Beyond Initial Encoding: Measures of the Post-Encoding Status of Memory Traces Predict Long-Term Recall during Infancy

Science.gov (United States)

Pathman, Thanujeni; Bauer, Patricia J.

2013-01-01

The first years of life are witness to rapid changes in long-term recall ability. In the current research we contributed to an explanation of the changes by testing the absolute and relative contributions to long-term recall of encoding and post-encoding processes. Using elicited imitation, we sampled the status of 16-, 20-, and 24-month-old…

Incremental phonological encoding during unscripted sentence production

Directory of Open Access Journals (Sweden)

Florian T Jaeger

2012-11-01

Full Text Available We investigate phonological encoding during unscripted sentence production, focusing on the effect of phonological overlap on phonological encoding. Previous work on this question has almost exclusively employed isolated word production or highly scripted multiword production. These studies have led to conflicting results: some studies found that phonological overlap between two words facilitates phonological encoding, while others found inhibitory effects. One worry with many of these paradigms is that they involve processes that are not typical to everyday language use, which calls into question to what extent their findings speak to the architectures and mechanisms underlying language production. We present a paradigm to investigate the consequences of phonological overlap between words in a sentence while leaving speakers much of the lexical and structural choices typical in everyday language use. Adult native speakers of English described events in short video clips. We annotated the presence of disfluencies and the speech rate at various points throughout the sentence, as well as the constituent order. We find that phonological overlap has an inhibitory effect on phonological encoding. Specifically, if adjacent content words share their phonological onset (e.g., hand the hammer, they are preceded by production difficulty, as reflected in fluency and speech rate. We also find that this production difficulty affects speakers’ constituent order preferences during grammatical encoding. We discuss our results and previous works to isolate the properties of other paradigms that resulted in facilitatory or inhibitory results. The data from our paradigm also speak to questions about the scope of phonological planning in unscripted speech and as to whether phonological and grammatical encoding interact.

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Supersymmetric gauged scale covariance in ten and lower dimensions

International Nuclear Information System (INIS)

Nishino, Hitoshi; Rajpoot, Subhash

2004-01-01

We present globally supersymmetric models of gauged scale covariance in ten, six, and four dimensions. This is an application of a recent similar gauging in three dimensions for a massive self-dual vector multiplet. In ten dimensions, we couple a single vector multiplet to another vector multiplet, where the latter gauges the scale covariance of the former. Due to scale covariance, the system does not have a Lagrangian formulation, but has only a set of field equations, like Type IIB supergravity in ten dimensions. As by-products, we construct similar models in six dimensions with N=(2,0) supersymmetry, and four dimensions with N=1 supersymmetry. We finally get a similar model with N=4 supersymmetry in four dimensions with consistent interactions that have never been known before. We expect a series of descendant theories in dimensions lower than ten by dimensional reductions. This result also indicates that similar mechanisms will work for other vector and scalar multiplets in space-time lower than ten dimensions

Improved entropy encoding for high efficient video coding standard

Directory of Open Access Journals (Sweden)

B.S. Sunil Kumar

2018-03-01

Full Text Available The High Efficiency Video Coding (HEVC has better coding efficiency, but the encoding performance has to be improved to meet the growing multimedia applications. This paper improves the standard entropy encoding by introducing the optimized weighing parameters, so that higher rate of compression can be accomplished over the standard entropy encoding. The optimization is performed using the recently introduced firefly algorithm. The experimentation is carried out using eight benchmark video sequences and the PSNR for varying rate of data transmission is investigated. Comparative analysis based on the performance statistics is made with the standard entropy encoding. From the obtained results, it is clear that the originality of the decoded video sequence is preserved far better than the proposed method, though the compression rate is increased. Keywords: Entropy, Encoding, HEVC, PSNR, Compression

Effects of pointing compared with naming and observing during encoding on item and source memory in young and older adults.

Science.gov (United States)

Ouwehand, Kim; van Gog, Tamara; Paas, Fred

2016-10-01

Research showed that source memory functioning declines with ageing. Evidence suggests that encoding visual stimuli with manual pointing in addition to visual observation can have a positive effect on spatial memory compared with visual observation only. The present study investigated whether pointing at picture locations during encoding would lead to better spatial source memory than naming (Experiment 1) and visual observation only (Experiment 2) in young and older adults. Experiment 3 investigated whether response modality during the test phase would influence spatial source memory performance. Experiments 1 and 2 supported the hypothesis that pointing during encoding led to better source memory for picture locations than naming or observation only. Young adults outperformed older adults on the source memory but not the item memory task in both Experiments 1 and 2. In Experiments 1 and 2, participants manually responded in the test phase. Experiment 3 showed that if participants had to verbally respond in the test phase, the positive effect of pointing compared with naming during encoding disappeared. The results suggest that pointing at picture locations during encoding can enhance spatial source memory in both young and older adults, but only if the response modality is congruent in the test phase.

The dependence of neuronal encoding efficiency on Hebbian plasticity and homeostatic regulation of neurotransmitter release

Science.gov (United States)

Faghihi, Faramarz; Moustafa, Ahmed A.

2015-01-01

Synapses act as information filters by different molecular mechanisms including retrograde messenger that affect neuronal spiking activity. One of the well-known effects of retrograde messenger in presynaptic neurons is a change of the probability of neurotransmitter release. Hebbian learning describe a strengthening of a synapse between a presynaptic input onto a postsynaptic neuron when both pre- and postsynaptic neurons are coactive. In this work, a theory of homeostatic regulation of neurotransmitter release by retrograde messenger and Hebbian plasticity in neuronal encoding is presented. Encoding efficiency was measured for different synaptic conditions. In order to gain high encoding efficiency, the spiking pattern of a neuron should be dependent on the intensity of the input and show low levels of noise. In this work, we represent spiking trains as zeros and ones (corresponding to non-spike or spike in a time bin, respectively) as words with length equal to three. Then the frequency of each word (here eight words) is measured using spiking trains. These frequencies are used to measure neuronal efficiency in different conditions and for different parameter values. Results show that neurons that have synapses acting as band-pass filters show the highest efficiency to encode their input when both Hebbian mechanism and homeostatic regulation of neurotransmitter release exist in synapses. Specifically, the integration of homeostatic regulation of feedback inhibition with Hebbian mechanism and homeostatic regulation of neurotransmitter release in the synapses leads to even higher efficiency when high stimulus intensity is presented to the neurons. However, neurons with synapses acting as high-pass filters show no remarkable increase in encoding efficiency for all simulated synaptic plasticity mechanisms. This study demonstrates the importance of cooperation of Hebbian mechanism with regulation of neurotransmitter release induced by rapid diffused retrograde

Testing for lead in toys at day care centers.

Science.gov (United States)

Sanders, Martha; Stolz, Julie; Chacon-Baker, Ashley

2013-01-01

Exposure to lead-based paint or material has been found to impact children's cognitive and behavioral development at blood lead levels far below current standards. The purpose of the project was to screen for lead in toy items in daycare centers in order to raise awareness of inside environmental lead exposures and minimize lead-based exposures for children. Occupational therapy students in a service learning class tested for lead in ten daycare or public centers using the XRF Thermo Scientific Niton XL3t, a method accepted by the Consumer Product Safety Commission (CPSC). A total of 460 items were tested over a two-month period for an average of 66 toys per setting. Fifty six (56) items tested > 100 ppm, which represented 12% of the entire sample. Items with high lead levels included selected toys constructed with lead-based paint, lead metals, plastics using lead as a color enhancer, and decorative objects. While the actual number of lead-based products is small, the cumulative exposure or habitual use may pose an unnecessary risk to children. Indoor exposures occurred for all day care centers regardless of socio-economic levels. Recommendations to minimize exposures are provided.

Affordances: Ten Years On

Science.gov (United States)

Brown, Jill P.; Stillman, Gloria

2014-01-01

Ten years ago the construct, affordance, was rising in prominence in scholarly literature. A proliferation of different uses and meanings was evident. Beginning with its origin in the work of Gibson, we traced its development and use in various scholarly fields. This paper revisits our original question with respect to its utility in mathematics…

Effect of Lead on Human Middle Ear Epithelial Cells

Directory of Open Access Journals (Sweden)

Shin Hye Kim

2018-01-01

Full Text Available Lead is a ubiquitous metal in the environment, but no studies have examined lead toxicity on the middle ear. Here, we investigated lead toxicity and its mechanism in human middle ear epithelial cells (HMEECs. Moreover, we investigated the protective effects of amniotic membrane extract (AME and chorionic membrane extract (CME against lead toxicity in HMEECs. Cell viability was analyzed using the cell counting kit, and reactive oxygen species (ROS activity was measured using a cellular ROS detection kit. After lead(II acetate trihydrate treatment, mRNA levels of various genes were assessed by semiquantitative real-time polymerase chain reaction. Following treatment with AME or CME after lead exposure, the changes in cell viability, ROS activity, and gene expression were analyzed. Exposure to >100 μg/mL of lead(II acetate trihydrate caused a significant decrease in cell viability and increased ROS production in HMEECs. Lead exposure significantly increased the mRNA expression of genes encoding inflammatory cytokines and mucins. Administration of AME or CME restored cell viability, reduced ROS activity, and ameliorated mRNA levels. Our findings suggest that environmental lead exposure is related to the development of otitis media, and AME and CME may have antioxidative and anti-inflammatory effects against lead toxicity.

Accelerated radial Fourier-velocity encoding using compressed sensing

Energy Technology Data Exchange (ETDEWEB)

Hilbert, Fabian; Han, Dietbert [Wuerzburg Univ. (Germany). Inst. of Radiology; Wech, Tobias; Koestler, Herbert [Wuerzburg Univ. (Germany). Inst. of Radiology; Wuerzburg Univ. (Germany). Comprehensive Heart Failure Center (CHFC)

2014-10-01

Purpose:Phase Contrast Magnetic Resonance Imaging (MRI) is a tool for non-invasive determination of flow velocities inside blood vessels. Because Phase Contrast MRI only measures a single mean velocity per voxel, it is only applicable to vessels significantly larger than the voxel size. In contrast, Fourier Velocity Encoding measures the entire velocity distribution inside a voxel, but requires a much longer acquisition time. For accurate diagnosis of stenosis in vessels on the scale of spatial resolution, it is important to know the velocity distribution of a voxel. Our aim was to determine velocity distributions with accelerated Fourier Velocity Encoding in an acquisition time required for a conventional Phase Contrast image. Materials and Methods:We imaged the femoral artery of healthy volunteers with ECG - triggered, radial CINE acquisition. Data acquisition was accelerated by undersampling, while missing data were reconstructed by Compressed Sensing. Velocity spectra of the vessel were evaluated by high resolution Phase Contrast images and compared to spectra from fully sampled and undersampled Fourier Velocity Encoding. By means of undersampling, it was possible to reduce the scan time for Fourier Velocity Encoding to the duration required for a conventional Phase Contrast image. Results:Acquisition time for a fully sampled data set with 12 different Velocity Encodings was 40 min. By applying a 12.6 - fold retrospective undersampling, a data set was generated equal to 3:10 min acquisition time, which is similar to a conventional Phase Contrast measurement. Velocity spectra from fully sampled and undersampled Fourier Velocity Encoded images are in good agreement and show the same maximum velocities as compared to velocity maps from Phase Contrast measurements. Conclusion: Compressed Sensing proved to reliably reconstruct Fourier Velocity Encoded data. Our results indicate that Fourier Velocity Encoding allows an accurate determination of the velocity

Accelerated radial Fourier-velocity encoding using compressed sensing

International Nuclear Information System (INIS)

Hilbert, Fabian; Han, Dietbert

2014-01-01

Purpose:Phase Contrast Magnetic Resonance Imaging (MRI) is a tool for non-invasive determination of flow velocities inside blood vessels. Because Phase Contrast MRI only measures a single mean velocity per voxel, it is only applicable to vessels significantly larger than the voxel size. In contrast, Fourier Velocity Encoding measures the entire velocity distribution inside a voxel, but requires a much longer acquisition time. For accurate diagnosis of stenosis in vessels on the scale of spatial resolution, it is important to know the velocity distribution of a voxel. Our aim was to determine velocity distributions with accelerated Fourier Velocity Encoding in an acquisition time required for a conventional Phase Contrast image. Materials and Methods:We imaged the femoral artery of healthy volunteers with ECG - triggered, radial CINE acquisition. Data acquisition was accelerated by undersampling, while missing data were reconstructed by Compressed Sensing. Velocity spectra of the vessel were evaluated by high resolution Phase Contrast images and compared to spectra from fully sampled and undersampled Fourier Velocity Encoding. By means of undersampling, it was possible to reduce the scan time for Fourier Velocity Encoding to the duration required for a conventional Phase Contrast image. Results:Acquisition time for a fully sampled data set with 12 different Velocity Encodings was 40 min. By applying a 12.6 - fold retrospective undersampling, a data set was generated equal to 3:10 min acquisition time, which is similar to a conventional Phase Contrast measurement. Velocity spectra from fully sampled and undersampled Fourier Velocity Encoded images are in good agreement and show the same maximum velocities as compared to velocity maps from Phase Contrast measurements. Conclusion: Compressed Sensing proved to reliably reconstruct Fourier Velocity Encoded data. Our results indicate that Fourier Velocity Encoding allows an accurate determination of the velocity

Accelerated radial Fourier-velocity encoding using compressed sensing.

Science.gov (United States)

Hilbert, Fabian; Wech, Tobias; Hahn, Dietbert; Köstler, Herbert

2014-09-01

Phase Contrast Magnetic Resonance Imaging (MRI) is a tool for non-invasive determination of flow velocities inside blood vessels. Because Phase Contrast MRI only measures a single mean velocity per voxel, it is only applicable to vessels significantly larger than the voxel size. In contrast, Fourier Velocity Encoding measures the entire velocity distribution inside a voxel, but requires a much longer acquisition time. For accurate diagnosis of stenosis in vessels on the scale of spatial resolution, it is important to know the velocity distribution of a voxel. Our aim was to determine velocity distributions with accelerated Fourier Velocity Encoding in an acquisition time required for a conventional Phase Contrast image. We imaged the femoral artery of healthy volunteers with ECG-triggered, radial CINE acquisition. Data acquisition was accelerated by undersampling, while missing data were reconstructed by Compressed Sensing. Velocity spectra of the vessel were evaluated by high resolution Phase Contrast images and compared to spectra from fully sampled and undersampled Fourier Velocity Encoding. By means of undersampling, it was possible to reduce the scan time for Fourier Velocity Encoding to the duration required for a conventional Phase Contrast image. Acquisition time for a fully sampled data set with 12 different Velocity Encodings was 40 min. By applying a 12.6-fold retrospective undersampling, a data set was generated equal to 3:10 min acquisition time, which is similar to a conventional Phase Contrast measurement. Velocity spectra from fully sampled and undersampled Fourier Velocity Encoded images are in good agreement and show the same maximum velocities as compared to velocity maps from Phase Contrast measurements. Compressed Sensing proved to reliably reconstruct Fourier Velocity Encoded data. Our results indicate that Fourier Velocity Encoding allows an accurate determination of the velocity distribution in vessels in the order of the voxel size. Thus

Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

Science.gov (United States)

Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

2017-07-01

The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

Hypoalgesia in response to transcutaneous electrical nerve stimulation (TENS) depends on stimulation intensity.

Science.gov (United States)

Moran, Fidelma; Leonard, Tracey; Hawthorne, Stephanie; Hughes, Ciara M; McCrum-Gardner, Evie; Johnson, Mark I; Rakel, Barbara A; Sluka, Kathleen A; Walsh, Deirdre M

2011-08-01

Transcutaneous electrical nerve stimulation (TENS) is an electrophysical modality used for pain management. This study investigated the dose response of different TENS intensities on experimentally induced pressure pain. One hundred and thirty TENS naïve healthy individuals (18-64 years old; 65 males, 65 females) were randomly allocated to 5 groups (n = 26 per group): Strong Non Painful TENS; Sensory Threshold TENS; Below Sensory Threshold TENS; No Current Placebo TENS; and Transient Placebo TENS. Active TENS (80 Hz) was applied to the forearm for 30 minutes. Transient Placebo TENS was applied for 42 seconds after which the current amplitude automatically reset to 0 mA. Pressure pain thresholds (PPT) were recorded from 2 points on the hand and forearm before and after TENS to measure hypoalgesia. There were significant differences between groups at both the hand and forearm (ANOVA; P = .005 and .002). At 30 minutes, there was a significant hypoalgesic effect in the Strong Non Painful TENS group compared to: Below Sensory Threshold TENS, No Current Placebo TENS and Transient Placebo TENS groups (P TENS and No Current Placebo TENS groups at the hand (P = .001). There was no significant difference between Strong Non Painful TENS and Sensory Threshold TENS groups. The area under the curve for the changes in PPT significantly correlated with the current amplitude (r(2) = .33, P = .003). These data therefore show that there is a dose-response effect of TENS with the largest effect occurring with the highest current amplitudes. This study shows a dose response for the intensity of TENS for pain relief with the strongest intensities showing the greatest effect; thus, we suggest that TENS intensity should be titrated to achieve the strongest possible intensity to achieve maximum pain relief. Copyright © 2011 American Pain Society. Published by Elsevier Inc. All rights reserved.

Multiple-stage pure phase encoding with biometric information

Science.gov (United States)

Chen, Wen

2018-01-01

In recent years, many optical systems have been developed for securing information, and optical encryption/encoding has attracted more and more attention due to the marked advantages, such as parallel processing and multiple-dimensional characteristics. In this paper, an optical security method is presented based on pure phase encoding with biometric information. Biometric information (such as fingerprint) is employed as security keys rather than plaintext used in conventional optical security systems, and multiple-stage phase-encoding-based optical systems are designed for generating several phase-only masks with biometric information. Subsequently, the extracted phase-only masks are further used in an optical setup for encoding an input image (i.e., plaintext). Numerical simulations are conducted to illustrate the validity, and the results demonstrate that high flexibility and high security can be achieved.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

proteins and is likely to become a standard tool for pharmaceutical hit discovery, lead expansion, and Chemical Biology research. The introduction of new methodologies for library encoding and for compound synthesis in the presence of DNA is an exciting research field and will crucially contribute to the performance and the propagation of the technology.

Lead concentrations and risk exposure assessment in surface soils ...

African Journals Online (AJOL)

This study investigated lead concentrations in < 250 μm and < 75 μm of deposited dust and< 2000 μm, < 250 μm, and < 75 μm of surface soils at undeveloped residential lands leased to auto-mechanic artisans for a minimum of ten years and estimated exposure risk for children that will reside on the polluted lands after the ...

Ten Things Every Professor Should Know about Assessment

Science.gov (United States)

Wolf, Kenneth; Dunlap, Joanna; Stevens, Ellen

2012-01-01

This article describes ten key assessment practices for advancing student learning that all professors should be familiar with and strategically incorporate in their classrooms and programs. Each practice or concept is explained with examples and guidance for putting it into practice. The ten are: learning outcomes, performance assessments,…

Comparison of the refractive error changes among young children in ten years interval

Directory of Open Access Journals (Sweden)

Hai-Yan Li

2013-07-01

Full Text Available AIM: To compare the optometric examination results of myopic young children between those diagnosed in the period from 1998 to 2000 and those diagnosed in the period from 2008 to 2010; and to find out the causes of myopia and factors that worsen the condition, and suggest methods of its prevention and treatment.METHODS: This study was a retrospective case study. We randomly selected sample from out-patient department register of cases and divided them into two main groups, ‘ten year before group'(TYBG(1998/2000 year casesand ‘ten years later group'(2008/2010 year cases(TYLG. Each group was further subdivided into three sub-groups by age: under-six years old children group(CG, seven-twelve years old primary-school group(PSGand thirteen-eighteen years old middle-school group(MSG. The optometric examination results were statistically analyzed.RESULTS: The difference of the mean dioptre between the TYBG and TYLG was strongly statistically significant, also forward-lead trend of age when children suffered from myopia was found(P0.01. There was a significant increase of dioptre among PSG and MSG in TYLG compared to TYBG(PCONCLUSION: Our study shows that the age of getting myopia was forward lead, the dioptre increases by 1.00 degree and the prevalence of myopia is increasing gradually. This situation may due to the modern life style and changes of living standard of the population. Therefore, prevention of myopia should concentrate more on younger children at kindergarten and primary school stage students.

Large scale exact quantum dynamics calculations: Ten thousand quantum states of acetonitrile

Science.gov (United States)

Halverson, Thomas; Poirier, Bill

2015-03-01

'Exact' quantum dynamics (EQD) calculations of the vibrational spectrum of acetonitrile (CH3CN) are performed, using two different methods: (1) phase-space-truncated momentum-symmetrized Gaussian basis and (2) correlated truncated harmonic oscillator basis. In both cases, a simple classical phase space picture is used to optimize the selection of individual basis functions-leading to drastic reductions in basis size, in comparison with existing methods. Massive parallelization is also employed. Together, these tools-implemented into a single, easy-to-use computer code-enable a calculation of tens of thousands of vibrational states of CH3CN to an accuracy of 0.001-10 cm-1.

Analysis of different atmospheric physical parameterizations in COAWST modeling system for the Tropical Storm Nock-ten application

DEFF Research Database (Denmark)

Ren, Danqin; Du, Jianting; Hua, Feng

2016-01-01

the storm center area. As a result, using Kain–Fritsch cumulus scheme, Goddard shortwave radiation scheme and RRTM longwave radiation scheme in WRF may lead to much larger wind intensity, significant wave height, current intensity, as well as lower SST and sea surface pressure. Thus......A coupled ocean–atmosphere–wave–sediment transport modeling system was applied to study the atmosphere and ocean dynamics during Tropical Storm Nock-ten. Different atmospheric physical parameterizations in WRF model were investigated through ten groups of numerical experiments. Results...... of atmosphere, ocean wave and current features were compared with storm observations, ERA-Interim data, NOAA sea surface temperature data, AVISO current data and HYCOM data, respectively. It was found that the storm track and intensity are sensitive to the cumulus and radiation schemes in WRF, especially around...

TRANSCUTANEOUS ELECTRICAL NERVE-STIMULATION (TENS) IN RAYNAUDS-PHENOMENON

NARCIS (Netherlands)

MULDER, P; DOMPELING, EC; VANSLOCHTERENVANDERBOOR, JC; KUIPERS, WD; SMIT, AJ

Transcutaneous nerve stimulation (TENS) has been described as resulting in vasodilatation. The effect of 2 Hz TENS of the right hand during forty-five minutes on skin temperature and plethysmography of the third digit of both hands and feet and on transcutaneous oxygen tension (TcpO2) of the right

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Science.gov (United States)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

An Exonic Insertion Encodes an Alanine Stretch in Porcine Synapsin I

DEFF Research Database (Denmark)

Hedegaard, Claus; Bendixen, Emøke; Jensen, Poul Henning

2009-01-01

regulatory roles in linking the vesicles to the cytoskeleton, supported by the identified abilities of the syns to bind both phospholipids (Schiebler et al. 1986 ) and tubulin/actin (Baines and Bennett 1986 ; Bähler and Greengard 1987 ). Originating from an alternatively spliced common transcript, syn Ia...... experiments, a nonsense mutation leading to a truncated form of syn I, without domain D and E/F, was identified in a family with frequent cases of X-linked epilepsy (Garcia et al. 2004 ). This study reports molecular cloning and characterization of the coding sequence of the porcine ortholog of syn I......, including identification and verification at the protein level of an alanine-encoding insert...

ABACC ten years applying safeguards

International Nuclear Information System (INIS)

Palacios, Elias

2001-01-01

The Argentinian-Brazilian Agency for Accounting and Control of nuclear special materials has been in operations for ten years. The rational behind the creation and the work performed by the Agency during the last decade is described. (author)

Graph Regularized Auto-Encoders for Image Representation.

Science.gov (United States)

Yiyi Liao; Yue Wang; Yong Liu

2017-06-01

Image representation has been intensively explored in the domain of computer vision for its significant influence on the relative tasks such as image clustering and classification. It is valuable to learn a low-dimensional representation of an image which preserves its inherent information from the original image space. At the perspective of manifold learning, this is implemented with the local invariant idea to capture the intrinsic low-dimensional manifold embedded in the high-dimensional input space. Inspired by the recent successes of deep architectures, we propose a local invariant deep nonlinear mapping algorithm, called graph regularized auto-encoder (GAE). With the graph regularization, the proposed method preserves the local connectivity from the original image space to the representation space, while the stacked auto-encoders provide explicit encoding model for fast inference and powerful expressive capacity for complex modeling. Theoretical analysis shows that the graph regularizer penalizes the weighted Frobenius norm of the Jacobian matrix of the encoder mapping, where the weight matrix captures the local property in the input space. Furthermore, the underlying effects on the hidden representation space are revealed, providing insightful explanation to the advantage of the proposed method. Finally, the experimental results on both clustering and classification tasks demonstrate the effectiveness of our GAE as well as the correctness of the proposed theoretical analysis, and it also suggests that GAE is a superior solution to the current deep representation learning techniques comparing with variant auto-encoders and existing local invariant methods.

EEG Correlates of Ten Positive Emotions.

Science.gov (United States)

Hu, Xin; Yu, Jianwen; Song, Mengdi; Yu, Chun; Wang, Fei; Sun, Pei; Wang, Daifa; Zhang, Dan

2017-01-01

Compared with the well documented neurophysiological findings on negative emotions, much less is known about positive emotions. In the present study, we explored the EEG correlates of ten different positive emotions (joy, gratitude, serenity, interest, hope, pride, amusement, inspiration, awe, and love). A group of 20 participants were invited to watch 30 short film clips with their EEGs simultaneously recorded. Distinct topographical patterns for different positive emotions were found for the correlation coefficients between the subjective ratings on the ten positive emotions per film clip and the corresponding EEG spectral powers in different frequency bands. Based on the similarities of the participants' ratings on the ten positive emotions, these emotions were further clustered into three representative clusters, as 'encouragement' for awe, gratitude, hope, inspiration, pride, 'playfulness' for amusement, joy, interest, and 'harmony' for love, serenity. Using the EEG spectral powers as features, both the binary classification on the higher and lower ratings on these positive emotions and the binary classification between the three positive emotion clusters, achieved accuracies of approximately 80% and above. To our knowledge, our study provides the first piece of evidence on the EEG correlates of different positive emotions.

A Monte Carlo study of the acceptance to scattered events in a depth encoding PET camera

International Nuclear Information System (INIS)

Moisan, C.; Tupper, P.; Rogers, J.G.; DeJong, J.K.

1995-10-01

We present a Monte Carlo study of acceptance to scattered events in a Depth Encoding Large Aperture Camera (DELAC), a hypothetical PET scanner with the capacity to encode the depth-of-interaction (DOI) of incident γ-rays. The simulation is initially validated against the measured energy resolution and scatter fraction of the ECAT-953B scanner. It is then used to assess the response to scattered events in a PET camera made of position encoding blocks of the EXACT HR PLUS type, modified to have DOI resolution through a variation in the photopeak pulse height. The detection efficiency for 511 keV γ-rays, as well as for those that scattered in the object or left only part of their energy in the block, is studied for several combinations of DOI sensitivities and block thicknesses. The scatter fraction predicted by the simulation for DELACs of various ring radii is compared to that of the ECAT-953B as a function of the energy threshold. The results indicate that the poorer discrimination of object scatters with depth sensitive blocks does not lead to a dramatic increase of the scatter fraction. (author). 10 refs., 1 tab., 5 figs

Quantum Logical Operations on Encoded Qubits

International Nuclear Information System (INIS)

Zurek, W.H.; Laflamme, R.

1996-01-01

We show how to carry out quantum logical operations (controlled-not and Toffoli gates) on encoded qubits for several encodings which protect against various 1-bit errors. This improves the reliability of these operations by allowing one to correct for 1-bit errors which either preexisted or occurred in the course of operation. The logical operations we consider allow one to carry out the vast majority of the steps in the quantum factoring algorithm. copyright 1996 The American Physical Society

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Using TENS for pain control: the state of the evidence

Science.gov (United States)

Vance, Carol GT; Dailey, Dana L; Rakel, Barbara A; Sluka, Kathleen A

2014-01-01

Summary Transcutaneous electrical nerve stimulation (TENS) is a nonpharmacological intervention that activates a complex neuronal network to reduce pain by activating descending inhibitory systems in the central nervous system to reduce hyperalgesia. The evidence for TENS efficacy is conflicting and requires not only description but also critique. Population-specific systemic reviews and meta-analyses are emerging, indicating both HF and LF TENS being shown to provide analgesia, specifically when applied at a strong, nonpainful intensity. The purpose of this article is to provide a critical review of the latest basic science and clinical evidence for TENS. Additional research is necessary to determine if TENS has effects specific to mechanical stimuli and/or beyond reduction of pain and will improve activity levels, function and quality of life. PMID:24953072

"Take ten minutes": a dedicated ten minute medication review reduces polypharmacy in the elderly.

LENUS (Irish Health Repository)

Walsh, E K

2012-02-01

Multiple and inappropriate medications are often the cause for poor health status in the elderly. Medication reviews can improve prescribing. This study aimed to determine if a ten minute medication review by a general practitioner could reduce polypharmacy and inappropriate prescribing in elderly patients. A prospective, randomised study was conducted. Patients over the age of 65 (n = 50) underwent a 10-minute medication review. Inappropriate medications, dosage errors, and discrepancies between prescribed versus actual medication being consumed were recorded. A questionnaire to assess satisfaction was completed following review. The mean number of medications taken by patients was reduced (p < 0.001). A medication was stopped in 35 (70%) patients. Inappropriate medications were detected in 27 (54%) patients and reduced (p < 0.001). Dose errors were detected in 16 (32%). A high level of patient satisfaction was reported. A ten minute medication review reduces polypharmacy, improves prescribing and is associated with high levels of patient satisfaction.

"Take ten minutes": a dedicated ten minute medication review reduces polypharmacy in the elderly.

LENUS (Irish Health Repository)

Walsh, E K

2010-09-01

Multiple and inappropriate medications are often the cause for poor health status in the elderly. Medication reviews can improve prescribing. This study aimed to determine if a ten minute medication review by a general practitioner could reduce polypharmacy and inappropriate prescribing in elderly patients. A prospective, randomised study was conducted. Patients over the age of 65 (n = 50) underwent a 10-minute medication review. Inappropriate medications, dosage errors, and discrepancies between prescribed versus actual medication being consumed were recorded. A questionnaire to assess satisfaction was completed following review. The mean number of medications taken by patients was reduced (p < 0.001). A medication was stopped in 35 (70%) patients. Inappropriate medications were detected in 27 (54%) patients and reduced (p < 0.001). Dose errors were detected in 16 (32%). A high level of patient satisfaction was reported. A ten minute medication review reduces polypharmacy, improves prescribing and is associated with high levels of patient satisfaction.

Thought probes during prospective memory encoding: Evidence for perfunctory processes

Science.gov (United States)

McDaniel, Mark A.; Dasse, Michelle N.; Lee, Ji hae; Kurinec, Courtney A.; Tami, Claudina; Krueger, Madison L.

2018-01-01

For nearly 50 years, psychologists have studied prospective memory, or the ability to execute delayed intentions. Yet, there remains a gap in understanding as to whether initial encoding of the intention must be elaborative and strategic, or whether some components of successful encoding can occur in a perfunctory, transient manner. In eight studies (N = 680), we instructed participants to remember to press the Q key if they saw words representing fruits (cue) during an ongoing lexical decision task. They then typed what they were thinking and responded whether they encoded fruits as a general category, as specific exemplars, or hardly thought about it at all. Consistent with the perfunctory view, participants often reported mind wandering (42.9%) and hardly thinking about the prospective memory task (22.5%). Even though participants were given a general category cue, many participants generated specific category exemplars (34.5%). Bayesian analyses of encoding durations indicated that specific exemplars came to mind in a perfunctory manner rather than via strategic, elaborative mechanisms. Few participants correctly guessed the research hypotheses and changing from fruit category cues to initial-letter cues eliminated reports of specific exemplar generation, thereby arguing against demand characteristics in the thought probe procedure. In a final experiment, encoding duration was unrelated to prospective memory performance; however, specific-exemplar encoders outperformed general-category encoders with no ongoing task monitoring costs. Our findings reveal substantial variability in intention encoding, and demonstrate that some components of prospective memory encoding can be done “in passing.” PMID:29874277

Ten Tips for Parents to Help Their Children Avoid Teen Pregnancy

Science.gov (United States)

... we do » Resource library » Ten tips for parents Ten Tips for Parents to Help Their Children Avoid Teen Pregnancy Publication Created with Sketch. Ten Tips for Parents to Help Their Children Avoid ...

Impact of a Computer System and the Encoding Staff Organization on the Encoding Stays and on Health Institution Financial Production in France.

Science.gov (United States)

Sarazin, Marianne; El Merini, Amine; Staccini, Pascal

2016-01-01

In France, medicalization of information systems program (PMSI) is an essential tool for the management planning and funding of health. The performance of encoding data inherent to hospital stays has become a major challenge for health institutions. Some studies have highlighted the impact of organizations set up on encoding quality and financial production. The aim of this study is to evaluate a computerized information system and new staff organization impact for treatment of the encoded information.

Color Image Authentication and Recovery via Adaptive Encoding

Directory of Open Access Journals (Sweden)

Chun-Hung Chen

2014-01-01

Full Text Available We describe an authentication and recovery scheme for color image protection based on adaptive encoding. The image blocks are categorized based on their contents and different encoding schemes are applied according to their types. Such adaptive encoding results in better image quality and more robust image authentication. The approximations of the luminance and chromatic channels are carefully calculated, and for the purpose of reducing the data size, differential coding is used to encode the channels with variable size according to the characteristic of the block. The recovery data which represents the approximation and the detail of the image is embedded for data protection. The necessary data is well protected by using error correcting coding and duplication. The experimental results demonstrate that our technique is able to identify and localize image tampering, while preserving high quality for both watermarked and recovered images.

Re-engaging with the past: recapitulation of encoding operations during retrieval

Directory of Open Access Journals (Sweden)

Alexa eMorcom

2014-05-01

Full Text Available Recollection of events is accompanied by selective reactivation of cortical regions which responded to specific sensory and cognitive dimensions of the original events. This reactivation is thought to reflect the reinstatement of stored memory representations and therefore to reflect memory content, but it may also reveal processes which support both encoding and retrieval. The present study used event-related functional magnetic resonance imaging (fMRI to investigate whether regions selectively engaged in encoding face and scene context with studied words are also re-engaged when the context is later retrieved. As predicted, encoding face and scene context with visually presented words elicited activity in distinct, context-selective regions. Retrieval of face and scene context also re-engaged some of the regions which had shown successful encoding effects. However, this recapitulation of encoding activity did not show the same context selectivity observed at encoding. Successful retrieval of both face and scene context re-engaged regions which had been associated with encoding of the other type of context, as well as those associated with encoding the same type of context. This recapitulation may reflect retrieval attempts which are not context-selective, but use shared retrieval cues to re-engage encoding operations in service of recollection.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Directory of Open Access Journals (Sweden)

Alicia Lundby

2008-06-01

Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Wavelength-encoded OCDMA system using opto-VLSI processors.

Science.gov (United States)

Aljada, Muhsen; Alameh, Kamal

2007-07-01

We propose and experimentally demonstrate a 2.5 Gbits/sper user wavelength-encoded optical code-division multiple-access encoder-decoder structure based on opto-VLSI processing. Each encoder and decoder is constructed using a single 1D opto-very-large-scale-integrated (VLSI) processor in conjunction with a fiber Bragg grating (FBG) array of different Bragg wavelengths. The FBG array spectrally and temporally slices the broadband input pulse into several components and the opto-VLSI processor generates codewords using digital phase holograms. System performance is measured in terms of the autocorrelation and cross-correlation functions as well as the eye diagram.

Wavelength-encoded OCDMA system using opto-VLSI processors

Science.gov (United States)

Aljada, Muhsen; Alameh, Kamal

2007-07-01

We propose and experimentally demonstrate a 2.5 Gbits/sper user wavelength-encoded optical code-division multiple-access encoder-decoder structure based on opto-VLSI processing. Each encoder and decoder is constructed using a single 1D opto-very-large-scale-integrated (VLSI) processor in conjunction with a fiber Bragg grating (FBG) array of different Bragg wavelengths. The FBG array spectrally and temporally slices the broadband input pulse into several components and the opto-VLSI processor generates codewords using digital phase holograms. System performance is measured in terms of the autocorrelation and cross-correlation functions as well as the eye diagram.

The new INRIM rotating encoder angle comparator (REAC)

International Nuclear Information System (INIS)

Pisani, Marco; Astrua, Milena

2017-01-01

A novel angle comparator has been built and tested at INRIM. The device is based on a double air bearing structure embedding a continuously rotating encoder, which is read by two heads: one fixed to the base of the comparator and a second fixed to the upper moving part of the comparator. The phase measurement between the two heads’ signals is proportional to the relative angle suspended between them (and, therefore, the angle between the base and the upper, movable part of the comparator). The advantage of this solution is to reduce the encoder graduation errors and to cancel the cyclic errors due to the interpolation of the encoder lines. By using only two pairs of reading heads, we have achieved an intrinsic accuracy of  ±0.04″ (rectangular distribution) that can be reduced through self-calibration. The residual cyclic errors have shown to be less than 0.01″ peak-to-peak. The random fluctuations are less than 0.01″ rms on a 100 s time interval. A further advantage of the rotating encoder is the intrinsic knowledge of the absolute position without the need of a zeroing procedure. Construction details of the rotating encoder angle comparator (REAC), characterization tests, and examples of practical use are given. (paper)

Chernobyl ten years after

International Nuclear Information System (INIS)

1996-01-01

The accident in the fourth reactor plant in Chernobyl in Ukraine occurred ten years years ago, caused the death of 31 people while the health consequences have turned out to be difficult to assess. This review describes the accident, its consequences and effects to health, studies carried out at the present state as well as the comparison with the other accidents and disaster. (author)

Frequency of diabetic retinopathy in patients after ten years of diagnosis of type 2 diabetes mellitus

International Nuclear Information System (INIS)

Shaikh, M.A.; Yakta, D.E.

2010-01-01

Background: Diabetic retinopathy is one of the most common and serious complications of type 2 diabetes mellitus and a leading cause of blindness not only in Pakistan but also worldwide. So we conducted this study to record the frequency of diabetic retinopathy in known diabetic patients ten years after diagnosis of type 2 diabetes mellitus. Methods: The study was conducted at Liaquat University of Medical and Health Sciences, Jamshoro, Pakistan for a period of 1 year from January 2008 to January 2010. The study group comprised of 200 patients of type 2 diabetes mellitus attending the medical clinic. All patients who were diagnosed as type 2 diabetes mellitus since ten years duration were included in the study. Retinopathy was graded into background, pre proliferative and proliferative retinopathy. Type 2 diabetes was diagnosed using the WHO criteria. Statistical analysis was carried out using the SPSS-11. Results: Diabetic retinopathy was found in 25.5% of the total Type 2 patients after ten years of diagnosis, and of these 4% of patients had proliferative retinopathy. Conclusion: Type 2 diabetic patients should be screened as early as possible to prevent permanent visual loss by timely management of diabetic retinopathy because diabetes is one of most common preventable cause of blindness in the world. (author)

ANALGETSKI UCINAK TRANSAKUTNE ELEKTRICNE NERVNE STIMULACIJE (TENS)

OpenAIRE

ĆURKOVIĆ, B.

1984-01-01

Transkutana električna nervna stimulacija. (TENS) danas je široko prihvaćen terapijski postupak za suzbijanje boli. Način njezina djelovanja nije još jasno definiran, premda se većina autora priklanja centralnom mehranizmu smanjenja boli. Rezultati, u literaturi, variraju od nesignifikantno boljeg učinka od placeba do 95°/o dobrog analgetskog djelovanja. U Zavodu za reumatske bolesti i rehabilitaciju Kliničkog bolničkog centra, Zagreb, evaluiran je učinak TENS-a u bolesnika s križ...

Giant virus Megavirus chilensis encodes the biosynthetic pathway for uncommon acetamido sugars.

Science.gov (United States)

Piacente, Francesco; De Castro, Cristina; Jeudy, Sandra; Molinaro, Antonio; Salis, Annalisa; Damonte, Gianluca; Bernardi, Cinzia; Abergel, Chantal; Tonetti, Michela G

2014-08-29

Giant viruses mimicking microbes, by the sizes of their particles and the heavily glycosylated fibrils surrounding their capsids, infect Acanthamoeba sp., which are ubiquitous unicellular eukaryotes. The glycans on fibrils are produced by virally encoded enzymes, organized in gene clusters. Like Mimivirus, Megavirus glycans are mainly composed of virally synthesized N-acetylglucosamine (GlcNAc). They also contain N-acetylrhamnosamine (RhaNAc), a rare sugar; the enzymes involved in its synthesis are encoded by a gene cluster specific to Megavirus close relatives. We combined activity assays on two enzymes of the pathway with mass spectrometry and NMR studies to characterize their specificities. Mg534 is a 4,6-dehydratase 5-epimerase; its three-dimensional structure suggests that it belongs to a third subfamily of inverting dehydratases. Mg535, next in the pathway, is a bifunctional 3-epimerase 4-reductase. The sequential activity of the two enzymes leads to the formation of UDP-l-RhaNAc. This study is another example of giant viruses performing their glycan synthesis using enzymes different from their cellular counterparts, raising again the question of the origin of these pathways. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Noise level and MPEG-2 encoder statistics

Science.gov (United States)

Lee, Jungwoo

1997-01-01

Most software in the movie and broadcasting industries are still in analog film or tape format, which typically contains random noise that originated from film, CCD camera, and tape recording. The performance of the MPEG-2 encoder may be significantly degraded by the noise. It is also affected by the scene type that includes spatial and temporal activity. The statistical property of noise originating from camera and tape player is analyzed and the models for the two types of noise are developed. The relationship between the noise, the scene type, and encoder statistics of a number of MPEG-2 parameters such as motion vector magnitude, prediction error, and quant scale are discussed. This analysis is intended to be a tool for designing robust MPEG encoding algorithms such as preprocessing and rate control.

The effect of encoding duration on implicit and explicit eyewitness memory.

Science.gov (United States)

Carol, Rolando N; Schreiber Compo, Nadja

2018-05-01

The present study investigated the effect of encoding duration on implicit and explicit eyewitness memory. Participants (N = 227) viewed a mock crime (brief, 15-s vs. long, 30-s vs. irrelevant/control) and were then tested with both implicit and explicit memory prompts or with explicit memory prompts only. Brief-encoding participants revealed more critical details implicitly than long-encoding or control participants. Further, the number and percentage of accurate details recalled explicitly were higher for long-encoding than for brief-encoding participants. Implicit testing prior to explicit recall-as compared to completing a filler task-was detrimental to free recall performance. Interestingly, brief-encoding participants were significantly more likely to remember critical details implicitly but not explicitly than long-encoding participants. This is the first study to investigate implicit eyewitness memory for a multimodal mock crime. Findings are theoretically consistent with prior research on cognition while expanding upon the extant eyewitness memory and investigative interviewing literature. Published by Elsevier Inc.

Universal Quantum Computing with Arbitrary Continuous-Variable Encoding.

Science.gov (United States)

Lau, Hoi-Kwan; Plenio, Martin B

2016-09-02

Implementing a qubit quantum computer in continuous-variable systems conventionally requires the engineering of specific interactions according to the encoding basis states. In this work, we present a unified formalism to conduct universal quantum computation with a fixed set of operations but arbitrary encoding. By storing a qubit in the parity of two or four qumodes, all computing processes can be implemented by basis state preparations, continuous-variable exponential-swap operations, and swap tests. Our formalism inherits the advantages that the quantum information is decoupled from collective noise, and logical qubits with different encodings can be brought to interact without decoding. We also propose a possible implementation of the required operations by using interactions that are available in a variety of continuous-variable systems. Our work separates the "hardware" problem of engineering quantum-computing-universal interactions, from the "software" problem of designing encodings for specific purposes. The development of quantum computer architecture could hence be simplified.

Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

Science.gov (United States)

Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

2012-09-01

It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method.

Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

International Nuclear Information System (INIS)

Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

2012-01-01

It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method. (paper)

Encoded libraries of chemically modified peptides.

Science.gov (United States)

Heinis, Christian; Winter, Greg

2015-06-01

The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.

Both differences in encoding processes and monitoring at retrieval reduce false alarms when distinctive information is studied.

Science.gov (United States)

Hanczakowski, Maciej; Mazzoni, Giuliana

2011-04-01

A reduction in false alarms to critical lures is observed in the DRM paradigm (Roediger & McDermott, 1995) when distinctive information is presented at encoding. Two mechanisms have been proposed to account for this reduction. According to the monitoring theory (e.g., the distinctiveness heuristic), lack of diagnostic recollection serves as a basis for discarding non-presented lures. According to the encoding theory, presenting distinctive information at study leads to impoverished relational processing, which results in a reduction in memorial information elicited by critical lures. In the present study a condition was created in which the use of the distinctiveness heuristic was precluded by associating, within the same study, lures with distinctive information in a context different from the study session. Under that condition reduction in false alarms to distinctive critical lures was still observed. This result supports the predictions of the encoding theory. However, when in the same study the use of the distinctiveness heuristic was not precluded, reductions in false alarms to unrelated lures were also observed when distinctive information was presented at study, indicating that both mechanisms are likely to contribute to the rejection of false memories.

Analysis of Program Obfuscation Schemes with Variable Encoding Technique

Science.gov (United States)

Fukushima, Kazuhide; Kiyomoto, Shinsaku; Tanaka, Toshiaki; Sakurai, Kouichi

Program analysis techniques have improved steadily over the past several decades, and software obfuscation schemes have come to be used in many commercial programs. A software obfuscation scheme transforms an original program or a binary file into an obfuscated program that is more complicated and difficult to analyze, while preserving its functionality. However, the security of obfuscation schemes has not been properly evaluated. In this paper, we analyze obfuscation schemes in order to clarify the advantages of our scheme, the XOR-encoding scheme. First, we more clearly define five types of attack models that we defined previously, and define quantitative resistance to these attacks. Then, we compare the security, functionality and efficiency of three obfuscation schemes with encoding variables: (1) Sato et al.'s scheme with linear transformation, (2) our previous scheme with affine transformation, and (3) the XOR-encoding scheme. We show that the XOR-encoding scheme is superior with regard to the following two points: (1) the XOR-encoding scheme is more secure against a data-dependency attack and a brute force attack than our previous scheme, and is as secure against an information-collecting attack and an inverse transformation attack as our previous scheme, (2) the XOR-encoding scheme does not restrict the calculable ranges of programs and the loss of efficiency is less than in our previous scheme.

How the Big Ten West Was Won: Football Recruiting

Directory of Open Access Journals (Sweden)

Diehl Kevin A.

2017-06-01

Full Text Available The paper analyses the 2017 Big Ten West Division football cycle models recruiting. The top ten recruit scores [(Rivals.com * 100 + [100 (outside surrounding; 75 (surrounding] + extra credit walk-ons (100; 75] allow proper ranking: Iowa, Nebraska, Wisconsin, Northwestern, Illinois, Minnesota, and Purdue.

Effect of tobacco craving cues on memory encoding and retrieval in smokers.

Science.gov (United States)

Heishman, Stephen J; Boas, Zachary P; Hager, Marguerite C; Taylor, Richard C; Singleton, Edward G; Moolchan, Eric T

2006-07-01

Previous studies have shown that cue-elicited tobacco craving disrupted performance on cognitive tasks; however, no study has examined directly the effect of cue-elicited craving on memory encoding and retrieval. A distinction between encoding and retireval has been reported such that memory is more impaired when attention is divided at encoding than at retrieval. This study tested the hypothesis that active imagery of smoking situations would impair encoding processes, but have little effect on retrieval. Imagery scripts (cigarette craving and neutral content) were presented either before presentation of a word list (encoding trials) or before word recall (retrieval trials). A working memory task at encoding and free recall of words were assessed. Results indicated that active imagery disrupted working memory on encoding trials, but not on retrieval trials. There was a trend toward impaired working memory following craving scripts compared with neutral scripts. These data support the hypothesis that the cognitive underpinnings of encoding and retrieval processes are distinct.

Emotion experienced during encoding enhances odor retrieval cue effectiveness.

Science.gov (United States)

Herz, R S

1997-01-01

Emotional potentiation may be a key variable in the formation of odor-associated memory. Two experiments were conducted in which a distinctive ambient odor was present or absent during encoding and retrieval sessions and subjects were in an anxious or neutral mood during encoding. Subjects' mood at retrieval was not manipulated. The laboratory mood induction used in Experiment 1 suggested that anxiety might increase the effectiveness of an odor retrieval cue. This trend was confirmed in Experiment 2 by capturing a naturally stressful situation. Subjects who had an ambient odor cue available and were in a preexam state during encoding recalled more words than subjects in any other group. These data are evidence that heightened emotion experienced during encoding with an ambient odor can enhance the effectiveness of an odor as a cue to memory.

Distinctiveness of Encoding and Memory for Learning Tasks.

Science.gov (United States)

Glover, John A.; And Others

1982-01-01

A distinctiveness of encoding hypothesis, as applied to the facilitative effects that higher order objectives have on readers' prose recall, was evaluated in three experiments. Results suggest that distinctiveness of encoding may offer a theoretical basis for the effects of adjunct aids as well as a guide to their construction. (Author/GK)

2012 Ten-year scheme of network development

International Nuclear Information System (INIS)

2012-01-01

RTE, an independent subsidiary of EDF, is the French electricity transmission system operator. It is a public service company responsible for operating, maintaining and developing the high and extra high voltage network. It guarantees the reliability and proper operation of the power network. RTE transports electricity between electricity suppliers (French and European) and consumers, whether they are electricity distributors or industrial consumers directly connected to the transmission system. The mission of RTE is to balance the electricity supply and demand in real time. With the support of the government authorities, RTE prepares a ten-year scheme of network development in France; This document presents the main electricity transport infrastructures to foresee within the ten coming years and lists the network development investments which must be realised and implemented within 3 years. The document is updated each year and comes to complement at the national level the European ten year network development plan (TYNDP) and the European regional plans as provided for in the 2009/72/CE European directive

Ten-year scheme of network development - 2011

International Nuclear Information System (INIS)

2011-01-01

RTE, an independent subsidiary of EDF, is the French electricity transmission system operator. It is a public service company responsible for operating, maintaining and developing the high and extra high voltage network. It guarantees the reliability and proper operation of the power network. RTE transports electricity between electricity suppliers (French and European) and consumers, whether they are electricity distributors or industrial consumers directly connected to the transmission system. The mission of RTE is to balance the electricity supply and demand in real time. With the support of the government authorities, RTE prepares a ten-year scheme of network development in France; This document presents the main electricity transport infrastructures to foresee within the ten coming years and lists the network development investments which must be realised and implemented within 3 years. The document is updated each year and comes to complement at the national level the European ten year network development plan (TYNDP) and the European regional plans as provided for in the 2009/72/CE European directive

A hybrid bit-encoding for SAT planning based on clique-partitioning

Science.gov (United States)

Tapia, Cristóbal; San Segundo, Pablo; Galán, Ramón

2017-09-01

Planning as satisfiability is one of the most efficient ways to solve classic automated planning problems. In SAT planning, the encoding used to convert the problem to a SAT formula is critical for the performance of the SAT solver. This paper presents a novel bit-encoding that reduces the number of bits required to represent actions in a SAT-based automated planning problem. To obtain such encoding we first build a conflict graph, which represents incompatibilities of pairs of actions, and bitwise encode the subsets of actions determined by a clique partition. This reduces the number of Boolean variables and clauses of the SAT encoding, while preserving the possibility of parallel execution of compatible (non-neighbor) actions. The article also describes an appropriate algorithm for selecting the clique partition for this application and compares the new encodings obtained over some standard planning problems.

The herpesvirus 8-encoded chemokine vMIP-II, but not the poxvirus-encoded chemokine MC148, inhibits the CCR10 receptor

DEFF Research Database (Denmark)

Lüttichau, H R; Lewis, I C; Gerstoft, J

2001-01-01

The viral chemokine antagonist vMIP-II encoded by human herpesvirus 8 (HHV8) and MC148 encoded by the poxvirus - Molluscum contagiosum - were tested against the newly identified chemokine receptor CCR10. As the CCR10 ligand ESkine / CCL27 had the highest identity to MC148 and because both...

Construction of type-II QC-LDPC codes with fast encoding based on perfect cyclic difference sets

Science.gov (United States)

Li, Ling-xiang; Li, Hai-bing; Li, Ji-bi; Jiang, Hua

2017-09-01

In view of the problems that the encoding complexity of quasi-cyclic low-density parity-check (QC-LDPC) codes is high and the minimum distance is not large enough which leads to the degradation of the error-correction performance, the new irregular type-II QC-LDPC codes based on perfect cyclic difference sets (CDSs) are constructed. The parity check matrices of these type-II QC-LDPC codes consist of the zero matrices with weight of 0, the circulant permutation matrices (CPMs) with weight of 1 and the circulant matrices with weight of 2 (W2CMs). The introduction of W2CMs in parity check matrices makes it possible to achieve the larger minimum distance which can improve the error- correction performance of the codes. The Tanner graphs of these codes have no girth-4, thus they have the excellent decoding convergence characteristics. In addition, because the parity check matrices have the quasi-dual diagonal structure, the fast encoding algorithm can reduce the encoding complexity effectively. Simulation results show that the new type-II QC-LDPC codes can achieve a more excellent error-correction performance and have no error floor phenomenon over the additive white Gaussian noise (AWGN) channel with sum-product algorithm (SPA) iterative decoding.

Top-Ten IT Issues: 2009

Science.gov (United States)

Agee, Anne Scrivener; Yang, Catherine

2009-01-01

This article presents the top-ten IT-related issues in terms of strategic importance to the institution, as revealed by the tenth annual EDUCAUSE Current Issues Survey. These IT-related issues include: (1) Funding IT; (2) Administrative/ERP Information Systems; (3) Security; (4) Infrastructure/Cyberinfrastructure; (5) Teaching and Learning with…

The medium-term effects of diadynamic currents in chronic low back pain; TENS versus diadynamic currents: A randomised, follow-up study.

Science.gov (United States)

Sayilir, Selcuk; Yildizgoren, Mustafa Turgut

2017-11-01

The aims of the study were to evaluate the medium-term effects of diadynamic (DD) currents on relieving symptoms/improving physical functionality in patients with chronic low back pain (LBP) and to compare the efficacy of DD versus TENS. The patients were divided into two groups as the TENS group (n = 26) and the DD group (n = 29). Additional treatment of hot pack + therapeutic ultrasound was applied to all patients. The therapy programs were administered as a total of 10 sessions over a period of 2 weeks. Roland Morris Disability Questionnaire (RDQ), Oswestry Disability Index and Visual Analog Scale (VAS) values were recorded. Both groups showed significant improvements in VAS and RDQ scores after one month of the therapies (all p TENS and DD currents in chronic LBP can lead to reduced pain, and improved physical functions. Hence, DD currents can be used as an adjuvant therapy for rehabilitation of chronic LBP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Quantum-dots-encoded-microbeads based molecularly imprinted polymer.

Science.gov (United States)

Liu, Yixi; Liu, Le; He, Yonghong; He, Qinghua; Ma, Hui

2016-03-15

Quantum dots encoded microbeads have various advantages such as large surface area, superb optical properties and the ability of multiplexing. Molecularly imprinted polymer that can mimic the natural recognition entities has high affinity and selectivity for the specific analyte. Here, the concept of utilizing the quantum dots encoded microbeads as the supporting material and the polydopamine as the functional monomer to form the core-shell molecular imprinted polymer was proposed for the first time. The resulted imprinted polymer can provide various merits: polymerization can complete in aqueous environment; fabrication procedure is facile and universal; the obvious economic advantage; the thickness of the imprinting layer is highly controllable; polydopamine coating can improve the biocompatibility of the quantum dot encoded microbeads. The rabbit IgG binding and flow cytometer experiment result showed the distinct advantages of this strategy: cost-saving, facile and fast preparation procedure. Most importantly, the ability for the multichannel detection, which makes the imprinted polydopamine modified encoded-beads very attractive in protein pre-concentration, recognition, separation and biosensing. Copyright © 2015 Elsevier B.V. All rights reserved.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Current practices in generation of small molecule new leads.

Science.gov (United States)

Goodnow, R A

2001-01-01

The current drug discovery processes in many pharmaceutical companies require large and growing collections of high quality lead structures for use in high throughput screening assays. Collections of small molecules with diverse structures and "drug-like" properties have, in the past, been acquired by several means: by archive of previous internal lead optimization efforts, by purchase from compound vendors, and by union of separate collections following company mergers. More recently, many drug discovery companies have established dedicated efforts to effect synthesis by internal and/or outsourcing efforts of targeted compound libraries for new lead generation. Although high throughput/combinatorial chemistry is an important component in the process of new lead generation, the selection of library designs for synthesis and the subsequent design of library members has evolved to a new level of challenge and importance. The potential benefits of screening multiple small molecule compound library designs against multiple biological targets offers substantial opportunity to discover new lead structures. Subsequent optimization of such compounds is often accelerated because of the structure-activity relationship (SAR) information encoded in these lead generation libraries. Lead optimization is often facilitated due to the ready applicability of high-throughput chemistry (HTC) methods for follow-up synthesis. Some of the strategies, trends, and critical issues central to the success of lead generation processes are discussed below. Copyright 2002 Wiley-Liss, Inc.

Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

Directory of Open Access Journals (Sweden)

Li Shen

2013-06-01

Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

Science.gov (United States)

Azad, Kimi; Banerjee, Manidipa; Johnson, John E

2017-09-29

Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

Fabrication of ten-fold photonic quasicrystalline structures

Directory of Open Access Journals (Sweden)

XiaoHong Sun

2015-05-01

Full Text Available Compared to periodic crystals, quasicrystals have higher point group symmetry and are more favorable in achieving complete band-gaps. In this report, a top-cut prism interferometer is designed to fabricate ten-fold photonic quasicrystalline structures. By optimizing the exposing conditions and material characteristics, appropriate quasicrystals have been obtained in the SU8 photoresist films. Atomic Force Microscopy and laser diffraction are used to characterize the fabricated structures. The measurement results show the consistence between the theoretical design and experiments. This will provide guidance for the large-area and fast production of ten-fold quasicrystalline structures with high quality.

The astonishingly holistic role of urban soil in the exposure of children to lead.

Science.gov (United States)

Mielke, Howard; Gonzales, Christopher; Powell, Eric

2017-04-01

The long-term resilience and sustainability of urban communities is associated with its environmental quality. One major impediment to community welfare is children's exposure to lead because it is a root cause of disparity and chronic conditions including health, learning, and behavioral differences. There is no safe level of lead exposure and this revelation is confounded by the lack of an effective intervention after exposure takes place. In August, 2005, Hurricane Katrina flooded 80% of New Orleans. This report explores the natural experiment of the dynamic changes of soil and children's blood lead in New Orleans before and ten years after the flood. Matched pre- and post-Hurricane soil lead and children's blood lead results were stratified by 172 communities of New Orleans. GIS methods were used to organize, describe, and map the pre- and post-Katrina data. Comparing pre- and post-Katrina results, simultaneous decreases occurred in soil lead and children's blood lead response. Health and welfare disparities continue to exist between environments and children's exposure living in interior compared with outer communities of the city. At the scale of a city this investigation demonstrates that declining soil lead effectively reduces children's blood lead. The astonishingly holistic role of soil relates to its position as a lead dust deposition reservoir and, at the same time, as an open source of ingestible and inhalable lead dust. Decreasing the soil lead on play areas of urban communities is beneficial and economical as a method for effective lead intervention and primary prevention. References Mielke, H.W.; Gonzales, C.R.; Powell, E.T.; Mielke, P.W. Jr. Spatiotemporal dynamic transformations of soil lead and children's blood lead ten years after Hurricane Katrina: New grounds for primary prevention. Environ. Int. 2016, DOI: 10.1016/j.envint.2016.06.017. Mielke, H.W.; Gonzales, C.R.; Powell, E.T. In review. The dynamic lead exposome and children's health in New

Macroencapsulated and elemental lead mixed waste sites report

International Nuclear Information System (INIS)

Kalia, A.; Jacobson, R.

1996-09-01

The purpose of this study was to compile a list of the Macroencapsulated (MACRO) and Elemental Lead (EL) Mixed Wastes sites that will be treated and require disposal at the Nevada Test Site within the next five to ten years. The five sites selected were: Hanford Site, Richland, Washington; Idaho National Engineering Laboratory (INEL), Idaho Falls, Idaho; Oak Ridge National Laboratory (ORNL), Oak Ridge, Tennessee; Rocky Flats Environmental Technology (RF), Golden, Colorado; and Savannah River (SRS), Charleston, South Carolina. A summary of total lead mixed waste forms at the five selected DOE sites is described in Table E-1. This table provides a summary of total waste and grand total of the current inventory and five-year projected generation of lead mixed waste for each site. This report provides conclusions and recommendations for further investigations. The major conclusions are: (1) the quantity of lead mixed current inventory waste is 500.1 m 3 located at the INEL, and (2) the five sites contain several other waste types contaminated with mercury, organics, heavy metal solids, and mixed sludges

An Information Theoretic Characterisation of Auditory Encoding

Science.gov (United States)

Overath, Tobias; Cusack, Rhodri; Kumar, Sukhbinder; von Kriegstein, Katharina; Warren, Jason D; Grube, Manon; Carlyon, Robert P; Griffiths, Timothy D

2007-01-01

The entropy metric derived from information theory provides a means to quantify the amount of information transmitted in acoustic streams like speech or music. By systematically varying the entropy of pitch sequences, we sought brain areas where neural activity and energetic demands increase as a function of entropy. Such a relationship is predicted to occur in an efficient encoding mechanism that uses less computational resource when less information is present in the signal: we specifically tested the hypothesis that such a relationship is present in the planum temporale (PT). In two convergent functional MRI studies, we demonstrated this relationship in PT for encoding, while furthermore showing that a distributed fronto-parietal network for retrieval of acoustic information is independent of entropy. The results establish PT as an efficient neural engine that demands less computational resource to encode redundant signals than those with high information content. PMID:17958472

The effects of age on the neural correlates of episodic encoding.

Science.gov (United States)

Grady, C L; McIntosh, A R; Rajah, M N; Beig, S; Craik, F I

1999-12-01

Young and old adults underwent positron emission tomographic scans while encoding pictures of objects and words using three encoding strategies: deep processing (a semantic living/nonliving judgement), shallow processing (size judgement) and intentional learning. Picture memory exceeded word memory in both young and old groups, and there was an age-related decrement only in word recognition. During the encoding tasks three brain activity patterns were found that differentiated stimulus type and the different encoding strategies. The stimulus-specific pattern was characterized by greater activity in extrastriate and medial temporal cortices during picture encoding, and greater activity in left prefrontal and temporal cortices during encoding of words. The older adults showed this pattern to a significantly lesser degree. A pattern distinguishing deep processing from intentional learning of words and pictures was identified, characterized mainly by differences in prefrontal cortex, and this pattern also was of significantly lesser magnitude in the old group. A final pattern identified areas with increased activity during deep processing and intentional learning of pictures, including left prefrontal and bilateral medial temporal regions. There was no group difference in this pattern. These results indicate age-related dysfunction in several encoding networks, with sparing of one specifically involved in more elaborate encoding of pictures. These age-related changes appear to affect verbal memory more than picture memory.

Re-engaging with the past: recapitulation of encoding operations during episodic retrieval

Science.gov (United States)

Morcom, Alexa M.

2014-01-01

Recollection of events is accompanied by selective reactivation of cortical regions which responded to specific sensory and cognitive dimensions of the original events. This reactivation is thought to reflect the reinstatement of stored memory representations and therefore to reflect memory content, but it may also reveal processes which support both encoding and retrieval. The present study used event-related functional magnetic resonance imaging to investigate whether regions selectively engaged in encoding face and scene context with studied words are also re-engaged when the context is later retrieved. As predicted, encoding face and scene context with visually presented words elicited activity in distinct, context-selective regions. Retrieval of face and scene context also re-engaged some of the regions which had shown successful encoding effects. However, this recapitulation of encoding activity did not show the same context selectivity observed at encoding. Successful retrieval of both face and scene context re-engaged regions which had been associated with encoding of the other type of context, as well as those associated with encoding the same type of context. This recapitulation may reflect retrieval attempts which are not context-selective, but use shared retrieval cues to re-engage encoding operations in service of recollection. PMID:24904386

Ten into four won't go

International Nuclear Information System (INIS)

Freedman, D.Z.; West, P.C.

1989-01-01

It is shown that nontrivial spontaneous compactification of ten-dimensional N = 1 supergravity with or without Yang-Mills matter is not possible unless maximal symmetry (i.e. Lorentz invariance) is violated in the four-dimensional spacetime

Encoding and Retrieval Interference in Sentence Comprehension: Evidence from Agreement

Directory of Open Access Journals (Sweden)

Sandra Villata

2018-01-01

Full Text Available Long-distance verb-argument dependencies generally require the integration of a fronted argument when the verb is encountered for sentence interpretation. Under a parsing model that handles long-distance dependencies through a cue-based retrieval mechanism, retrieval is hampered when retrieval cues also resonate with non-target elements (retrieval interference. However, similarity-based interference may also stem from interference arising during the encoding of elements in memory (encoding interference, an effect that is not directly accountable for by a cue-based retrieval mechanism. Although encoding and retrieval interference are clearly distinct at the theoretical level, it is difficult to disentangle the two on empirical grounds, since encoding interference may also manifest at the retrieval region. We report two self-paced reading experiments aimed at teasing apart the role of each component in gender and number subject-verb agreement in Italian and English object relative clauses. In Italian, the verb does not agree in gender with the subject, thus providing no cue for retrieval. In English, although present tense verbs agree in number with the subject, past tense verbs do not, allowing us to test the role of number as a retrieval cue within the same language. Results from both experiments converge, showing similarity-based interference at encoding, and some evidence for an effect at retrieval. After having pointed out the non-negligible role of encoding in sentence comprehension, and noting that Lewis and Vasishth’s (2005 ACT-R model of sentence processing, the most fully developed cue-based retrieval approach to sentence processing does not predict encoding effects, we propose an augmentation of this model that predicts these effects. We then also propose a self-organizing sentence processing model (SOSP, which has the advantage of accounting for retrieval and encoding interference with a single mechanism.

Encoding and Retrieval Interference in Sentence Comprehension: Evidence from Agreement

Science.gov (United States)

Villata, Sandra; Tabor, Whitney; Franck, Julie

2018-01-01

Long-distance verb-argument dependencies generally require the integration of a fronted argument when the verb is encountered for sentence interpretation. Under a parsing model that handles long-distance dependencies through a cue-based retrieval mechanism, retrieval is hampered when retrieval cues also resonate with non-target elements (retrieval interference). However, similarity-based interference may also stem from interference arising during the encoding of elements in memory (encoding interference), an effect that is not directly accountable for by a cue-based retrieval mechanism. Although encoding and retrieval interference are clearly distinct at the theoretical level, it is difficult to disentangle the two on empirical grounds, since encoding interference may also manifest at the retrieval region. We report two self-paced reading experiments aimed at teasing apart the role of each component in gender and number subject-verb agreement in Italian and English object relative clauses. In Italian, the verb does not agree in gender with the subject, thus providing no cue for retrieval. In English, although present tense verbs agree in number with the subject, past tense verbs do not, allowing us to test the role of number as a retrieval cue within the same language. Results from both experiments converge, showing similarity-based interference at encoding, and some evidence for an effect at retrieval. After having pointed out the non-negligible role of encoding in sentence comprehension, and noting that Lewis and Vasishth’s (2005) ACT-R model of sentence processing, the most fully developed cue-based retrieval approach to sentence processing does not predict encoding effects, we propose an augmentation of this model that predicts these effects. We then also propose a self-organizing sentence processing model (SOSP), which has the advantage of accounting for retrieval and encoding interference with a single mechanism. PMID:29403414

A SSVEP Stimuli Encoding Method Using Trinary Frequency-Shift Keying Encoded SSVEP (TFSK-SSVEP

Directory of Open Access Journals (Sweden)

Xing Zhao

2017-06-01

Full Text Available SSVEP is a kind of BCI technology with advantage of high information transfer rate. However, due to its nature, frequencies could be used as stimuli are scarce. To solve such problem, a stimuli encoding method which encodes SSVEP signal using Frequency Shift–Keying (FSK method is developed. In this method, each stimulus is controlled by a FSK signal which contains three different frequencies that represent “Bit 0,” “Bit 1” and “Bit 2” respectively. Different to common BFSK in digital communication, “Bit 0” and “Bit 1” composited the unique identifier of stimuli in binary bit stream form, while “Bit 2” indicates the ending of a stimuli encoding. EEG signal is acquired on channel Oz, O1, O2, Pz, P3, and P4, using ADS1299 at the sample rate of 250 SPS. Before original EEG signal is quadrature demodulated, it is detrended and then band-pass filtered using FFT-based FIR filtering to remove interference. Valid peak of the processed signal is acquired by calculating its derivative and converted into bit stream using window method. Theoretically, this coding method could implement at least 2n−1 (n is the length of bit command stimulus while keeping the ITR the same. This method is suitable to implement stimuli on a monitor and where the frequency and phase could be used to code stimuli is limited as well as implementing portable BCI devices which is not capable of performing complex calculations.

Critical Studies on Men in Ten European Countries

DEFF Research Database (Denmark)

Pringle, Keith; Hearn, Jeff (and 13 other network partners)

2002-01-01

This article is one the work of The European Research Network on Men in Europe project “The Social Problem and Societal Problematization of Men and Masculinities” (2000-2003), funded by the European Commission. The Network comprises women and men researchers with range of disciplinary backgrounds...... of statistical sources on men's practices in the ten countries, are presented. This is the second of four articles reviewing critical studies on men in the ten countries through different methods and approaches....

Nonresponse Error in Mail Surveys: Top Ten Problems

Directory of Open Access Journals (Sweden)

Jeanette M. Daly

2011-01-01

Full Text Available Conducting mail surveys can result in nonresponse error, which occurs when the potential participant is unwilling to participate or impossible to contact. Nonresponse can result in a reduction in precision of the study and may bias results. The purpose of this paper is to describe and make readers aware of a top ten list of mailed survey problems affecting the response rate encountered over time with different research projects, while utilizing the Dillman Total Design Method. Ten nonresponse error problems were identified, such as inserter machine gets sequence out of order, capitalization in databases, and mailing discarded by postal service. These ten mishaps can potentiate nonresponse errors, but there are ways to minimize their frequency. Suggestions offered stem from our own experiences during research projects. Our goal is to increase researchers' knowledge of nonresponse error problems and to offer solutions which can decrease nonresponse error in future projects.

Noise and neuronal populations conspire to encode simple waveforms reliably

Science.gov (United States)

Parnas, B. R.

1996-01-01

Sensory systems rely on populations of neurons to encode information transduced at the periphery into meaningful patterns of neuronal population activity. This transduction occurs in the presence of intrinsic neuronal noise. This is fortunate. The presence of noise allows more reliable encoding of the temporal structure present in the stimulus than would be possible in a noise-free environment. Simulations with a parallel model of signal processing at the auditory periphery have been used to explore the effects of noise and a neuronal population on the encoding of signal information. The results show that, for a given set of neuronal modeling parameters and stimulus amplitude, there is an optimal amount of noise for stimulus encoding with maximum fidelity.

Design and Evaluation on the Mobile Application of Transcutaneous Electrical Nerve Stimulation (TENS).

Science.gov (United States)

Cheng, Ching-Lung; Lee, Li-Hui; Cheng, Yu-Ting

2017-01-01

This study aims to design a transcutaneous electrical nerve stimulation Application (TENS App) according to the suggestions from potential users. To the best of our knowledge, this is the first App including meridian and acupoints for TENS. After its development, there are eight participants recruited for evaluating the usability. Despite two out of eight users reporting that the typical TENS system requires lower cost and has better functionality than TENS App, the results show that almost seventy percent of participants have a better perception of TENS App on price, functionality, convenience, operational ability, and quality. However, participants still reported concerns about the safety issue of adopting TENS App. Therefore, for people who are the first time or unfamiliar with TENS App, instructions from occupational or physical therapists are recommended. We conclude that by using TENS App, users can not only use the portable electrotherapy devices at anyplace, but also reduce their outpatient visits.

Transcutaneous electrical nerve stimulation (TENS) for chronic low-back pain.

Science.gov (United States)

Khadilkar, A; Milne, S; Brosseau, L; Robinson, V; Saginur, M; Shea, B; Tugwell, P; Wells, G

2005-07-20

Chronic low-back pain (LBP) affects a significant proportion of the population. Transcutaneous electrical nerve stimulation (TENS) was introduced more than 30 years ago as an adjunct to the pharmacological management of pain. However, despite its widespread use, the usefulness of TENS in chronic LBP is still controversial. The aim of this systematic review was to determine the effectiveness of TENS in the management of chronic LBP. We searched the Cochrane Central Register of Controlled Trials (Issue 2, 2005), MEDLINE, EMBASE and PEDro up to April 1, 2005. Only randomized controlled clinical trials (RCTs) evaluating the effect of TENS on chronic LBP were included. Abstracts were excluded unless further data could be obtained from the authors. Two reviewers independently selected trials and extracted data using predetermined forms. Heterogeneity was tested with Cochrane's Q test. A fixed effect model was used throughout for calculating continuous variables, except where heterogeneity existed, in which case, a random effects model was used. Results are presented as weighted mean differences (WMD) with 95% confidence intervals (95% CI), where the difference between the treated and control groups was weighted by the inverse of the variance. Standardized mean differences (SMD) were calculated by dividing the difference between the treated and control by the baseline variance. SMD were used when different scales were used to measure the same concept. Dichotomous outcomes were analyzed with odds ratios. The only two RCTs (175 patients) meeting eligibility criteria differed in study design, methodological quality, inclusion and exclusion criteria, type and method of TENS application, treatment schedule, co-interventions and final outcomes. In one RCT, TENS produced significantly greater pain relief than the placebo control. However, in the other RCT, no statistically significant differences between treatment and control groups were shown for multiple outcome measures. Pre

Deficiencies of effectiveness of intervention studies in veterinary medicine: a cross-sectional survey of ten leading veterinary and medical journals

NARCIS (Netherlands)

Di Girolamo, Nicola; Meursinge Reynders, Reint

2016-01-01

The validity of studies that assess the effectiveness of an intervention (EoI) depends on variables such as the type of study design, the quality of their methodology, and the participants enrolled. Five leading veterinary journals and 5 leading human medical journals were hand-searched for EoI

Latency Performance of Encoding with Random Linear Network Coding

DEFF Research Database (Denmark)

Nielsen, Lars; Hansen, René Rydhof; Lucani Rötter, Daniel Enrique

2018-01-01

the encoding process can be parallelized based on system requirements to reduce data access time within the system. Using a counting argument, we focus on predicting the effect of changes of generation (number of original packets) and symbol size (number of bytes per data packet) configurations on the encoding...... latency on full vector and on-the-fly algorithms. We show that the encoding latency doubles when either the generation size or the symbol size double and confirm this via extensive simulations. Although we show that the theoretical speed gain of on-the-fly over full vector is two, our measurements show...

Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

Directory of Open Access Journals (Sweden)

S. S. Hasson

2010-01-01

Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

On The Designed And Constructed Feedback Shift-Register Encoder

African Journals Online (AJOL)

An encoder capable of cyclical shifting of data, and which can therefore be used for Bose-Chaudhuri and Hocquenghem (BCH) coding, has been designed and constructed using discrete components. It comprises basically four bistable multivibrators and an exclusive-OR device. On completion, the encoder performed ...

The sports results of leading pentathlonists during 2000-2010.

OpenAIRE

Pityn M.P.; Stetskovich S.R.

2011-01-01

The result sports changes of leading sportsmen of the world in modern pentathlon are considered in the paper. During the investigation process the competition rules changes were determined and what have affected on the sports result in the modern pentathlon. The winner results changes and top ten sportsmen of the world championships and the Olympic Games were characterized during 2000-2010. The rules changes influence of the competition holding on the results of competitive activity of high q...

Mid-term evaluation of ten National Research schools

DEFF Research Database (Denmark)

Gustafsson, Göran; Dahl, Hanne Marlene; Gustafsson, Christina

the scheme was launched, the Research Council has issued three calls for proposals and allocated grants to a total of 22 national research schools. Five were started up in 2009, ten in 2013 and seven in 2015. A Nordic scientific programme committee was appointed in 2013, with responsibility for assessing...... grant applications, monitoring the progress of the FORSKERSKOLER scheme and serving as the evaluation panel for the mid-term evaluation in 2013 and in 2016/2017. The task of the evaluation panel has been to: 1) evaluate the quality of and progress achieved by the ten research schools which were awarded...... funding in 2012 and launched in 2013; and 2) to provide recommendations as to whether funding should be continued to cover the full eight-year period or terminated after five years. Continued funding is recommended for all ten schools to cover the full eight-year period, according to the proposed budget...

Is TENS purely a placebo effect? A controlled study on chronic low back pain.

Science.gov (United States)

Marchand, S; Charest, J; Li, J; Chenard, J R; Lavignolle, B; Laurencelle, L

1993-07-01

Although high-frequency low-intensity transcutaneous electric nerve stimulation (TENS) has been extensively used to relieve low back pain, experimental studies of its effectiveness have yielded contradictory findings mainly due to methodological problems in pain evaluation and placebo control. In the present study, separate visual analog scales (VAS) were used to measure the sensory-discriminative and motivational-affective components of low back pain. Forty-two subjects were randomly assigned to 1 of 3 groups: TENS, placebo-TENS, and no treatment (control). In order to measure the short-term effect of TENS, VAS pain ratings were taken before and after each treatment session. Also, to measure long-term effects, patients rated their pain at home every 2 h throughout a 3-day period before and 1 week, 3 months and 6 months after the treatment sessions. In comparing the pain evaluations made immediately before and after each treatment session, TENS and placebo-TENS significantly reduced both the intensity and unpleasantness of chronic low back pain. TENS was significantly more efficient than placebo-TENS in reducing pain intensity but not pain unpleasantness. TENS also produced a significant additive effect over repetitive treatment sessions for pain intensity and relative pain unpleasantness. This additive effect was not found for placebo-TENS. When evaluated at home, pain intensity was significantly reduced more by TENS than placebo-TENS 1 week after the end of treatment, but not 3 months and 6 months later. At home evaluation of pain unpleasantness in the TENS group was never different from the placebo-TENS group.(ABSTRACT TRUNCATED AT 250 WORDS)

ENCODE whole-genome data in the UCSC genome browser (2011 update).

Science.gov (United States)

Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

2011-01-01

The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

Dynamic Information Encoding With Dynamic Synapses in Neural Adaptation

Science.gov (United States)

Li, Luozheng; Mi, Yuanyuan; Zhang, Wenhao; Wang, Da-Hui; Wu, Si

2018-01-01

Adaptation refers to the general phenomenon that the neural system dynamically adjusts its response property according to the statistics of external inputs. In response to an invariant stimulation, neuronal firing rates first increase dramatically and then decrease gradually to a low level close to the background activity. This prompts a question: during the adaptation, how does the neural system encode the repeated stimulation with attenuated firing rates? It has been suggested that the neural system may employ a dynamical encoding strategy during the adaptation, the information of stimulus is mainly encoded by the strong independent spiking of neurons at the early stage of the adaptation; while the weak but synchronized activity of neurons encodes the stimulus information at the later stage of the adaptation. The previous study demonstrated that short-term facilitation (STF) of electrical synapses, which increases the synchronization between neurons, can provide a mechanism to realize dynamical encoding. In the present study, we further explore whether short-term plasticity (STP) of chemical synapses, an interaction form more common than electrical synapse in the cortex, can support dynamical encoding. We build a large-size network with chemical synapses between neurons. Notably, facilitation of chemical synapses only enhances pair-wise correlations between neurons mildly, but its effect on increasing synchronization of the network can be significant, and hence it can serve as a mechanism to convey the stimulus information. To read-out the stimulus information, we consider that a downstream neuron receives balanced excitatory and inhibitory inputs from the network, so that the downstream neuron only responds to synchronized firings of the network. Therefore, the response of the downstream neuron indicates the presence of the repeated stimulation. Overall, our study demonstrates that STP of chemical synapse can serve as a mechanism to realize dynamical neural

Least-squares reverse time migration of marine data with frequency-selection encoding

KAUST Repository

Dai, Wei; Huang, Yunsong; Schuster, Gerard T.

2013-01-01

The phase-encoding technique can sometimes increase the efficiency of the least-squares reverse time migration (LSRTM) by more than one order of magnitude. However, traditional random encoding functions require all the encoded shots to share

BANDWIDTH AND EFFICIENT ENCODING SCHEME COMBINING TCM-UGM TO STBC

OpenAIRE

ABDELMOUNAIM MOULAY LAKHDAR; MOHAMMED BELADGHAM; ABDESSELAM BASSOU,; MOHAMED BENAISSA

2011-01-01

In this paper, a bandwidth efficient encoding scheme is proposed. It combines the modified version of trellis coded-modulation (called trellis coded-modulation with Ungerboeck-Gray mapping, TCM-UGM) to space-time block code (STBC). The performance of this encoding scheme is investigated over memoryless Rayleigh fading (MRF) channel for throughput 2 bits/s/Hz. The simulation result, using 2/3 rate 16-state TCM-UGM encoder, two transmit antennas and two receive antennas, shows clearly that the ...

Ten out of ten for LHC decapole magnets

CERN Multimedia

2001-01-01

CERN's Albert Ijspeert (left) and Avinash Puntambekar of the Indian CAT laboratory with the ten Indian decapole magnets on the test bench. Tests will be carried out by the LHC-MTA group. A batch of 10 superconducting decapole magnets for the LHC has just arrived at CERN from India. These will be used to correct for slight imperfections in the dipole magnets that will steer proton beams around CERN's new accelerator. All magnets have slight imperfections in the fields they produce, and in the LHC dipoles these will be corrected for using sextupoles and decapoles. The sextupoles were the first LHC magnets to be given the production green-light following successful tests of pre-series magnets last year (Bulletin 21/2000, 22 May 2000). Now it is the turn of pre-series decapoles to go on trial at CERN. Of the LHC's 1232 dipole magnets, half will use sextupole correctors only and the other half will use both sextupoles and decapoles. That means that a total of 616 pairs of decapoles are needed. Like the sextupole...

Encoding, training and retrieval in ferroelectric tunnel junctions

Science.gov (United States)

Xu, Hanni; Xia, Yidong; Xu, Bo; Yin, Jiang; Yuan, Guoliang; Liu, Zhiguo

2016-05-01

Ferroelectric tunnel junctions (FTJs) are quantum nanostructures that have great potential in the hardware basis for future neuromorphic applications. Among recently proposed possibilities, the artificial cognition has high hopes, where encoding, training, memory solidification and retrieval constitute a whole chain that is inseparable. However, it is yet envisioned but experimentally unconfirmed. The poor retention or short-term store of tunneling electroresistance, in particular the intermediate states, is still a key challenge in FTJs. Here we report the encoding, training and retrieval in BaTiO3 FTJs, emulating the key features of information processing in terms of cognitive neuroscience. This is implemented and exemplified through processing characters. Using training inputs that are validated by the evolution of both barrier profile and domain configuration, accurate recalling of encoded characters in the retrieval stage is demonstrated.

DNA-encoded chemical libraries - achievements and remaining challenges.

Science.gov (United States)

Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

2018-04-23

DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

The role of depth of encoding in attentional capture

NARCIS (Netherlands)

Sasin, Edyta; Nieuwenstein, Mark; Johnson, Addie

2015-01-01

The aim of the current study was to examine whether depth of encoding influences attentional capture by recently attended objects. In Experiment 1, participants first had to judge whether a word referred to a living or a nonliving thing (deep encoding condition) or whether the word was written in

Decoding and Encoding Facial Expressions in Preschool-Age Children.

Science.gov (United States)

Zuckerman, Miron; Przewuzman, Sylvia J.

1979-01-01

Preschool-age children drew, decoded, and encoded facial expressions depicting five different emotions. Accuracy of drawing, decoding and encoding each of the five emotions was consistent across the three tasks; decoding ability was correlated with drawing ability among female subjects, but neither of these abilities was correlated with encoding…

Optical encoder based on a nondiffractive beam

International Nuclear Information System (INIS)

Lutenberg, Ariel; Perez-Quintian, Fernando; Rebollo, Maria A.

2008-01-01

Optical encoders are used in industrial and laboratory motion equipment to measure rotations and linear displacements. We introduce a design of an optical encoder based on a nondiffractive beam. We expect that the invariant profile and radial symmetry of the nondiffractive beam provide the design with remarkable tolerance to mechanical perturbations. We experimentally demonstrate that the proposed design generates a suitable output sinusoidal signal with low harmonic distortion. Moreover, we present a numerical model of the system based on the angular spectrum approximation whose predictions are in excellent agreement with the experimental results

Dissociable effects of top-down and bottom-up attention during episodic encoding

Science.gov (United States)

Uncapher, Melina R.; Hutchinson, J. Benjamin; Wagner, Anthony D.

2011-01-01

It is well established that the formation of memories for life’s experiences—episodic memory—is influenced by how we attend to those experiences, yet the neural mechanisms by which attention shapes episodic encoding are still unclear. We investigated how top-down and bottom-up attention contribute to memory encoding of visual objects in humans by manipulating both types of attention during functional magnetic resonance imaging (fMRI) of episodic memory formation. We show that dorsal parietal cortex—specifically, intraparietal sulcus (IPS)—was engaged during top-down attention and was also recruited during the successful formation of episodic memories. By contrast, bottom-up attention engaged ventral parietal cortex—specifically, temporoparietal junction (TPJ)—and was also more active during encoding failure. Functional connectivity analyses revealed further dissociations in how top-down and bottom-up attention influenced encoding: while both IPS and TPJ influenced activity in perceptual cortices thought to represent the information being encoded (fusiform/lateral occipital cortex), they each exerted opposite effects on memory encoding. Specifically, during a preparatory period preceding stimulus presentation, a stronger drive from IPS was associated with a higher likelihood that the subsequently attended stimulus would be encoded. By contrast, during stimulus processing, stronger connectivity with TPJ was associated with a lower likelihood the stimulus would be successfully encoded. These findings suggest that during encoding of visual objects into episodic memory, top-down and bottom-up attention can have opposite influences on perceptual areas that subserve visual object representation, suggesting that one manner in which attention modulates memory is by altering the perceptual processing of to-be-encoded stimuli. PMID:21880922

Minimal-memory realization of pearl-necklace encoders of general quantum convolutional codes

International Nuclear Information System (INIS)

Houshmand, Monireh; Hosseini-Khayat, Saied

2011-01-01

Quantum convolutional codes, like their classical counterparts, promise to offer higher error correction performance than block codes of equivalent encoding complexity, and are expected to find important applications in reliable quantum communication where a continuous stream of qubits is transmitted. Grassl and Roetteler devised an algorithm to encode a quantum convolutional code with a ''pearl-necklace'' encoder. Despite their algorithm's theoretical significance as a neat way of representing quantum convolutional codes, it is not well suited to practical realization. In fact, there is no straightforward way to implement any given pearl-necklace structure. This paper closes the gap between theoretical representation and practical implementation. In our previous work, we presented an efficient algorithm to find a minimal-memory realization of a pearl-necklace encoder for Calderbank-Shor-Steane (CSS) convolutional codes. This work is an extension of our previous work and presents an algorithm for turning a pearl-necklace encoder for a general (non-CSS) quantum convolutional code into a realizable quantum convolutional encoder. We show that a minimal-memory realization depends on the commutativity relations between the gate strings in the pearl-necklace encoder. We find a realization by means of a weighted graph which details the noncommutative paths through the pearl necklace. The weight of the longest path in this graph is equal to the minimal amount of memory needed to implement the encoder. The algorithm has a polynomial-time complexity in the number of gate strings in the pearl-necklace encoder.

Dissociative effects of true and false recall as a function of different encoding strategies.

Science.gov (United States)

Goodwin, Kerri A

2007-01-01

Goodwin, Meissner, and Ericsson (2001) proposed a path model in which elaborative encoding predicted the likelihood of verbalisation of critical, nonpresented words at encoding, which in turn predicted the likelihood of false recall. The present study tested this model of false recall experimentally with a manipulation of encoding strategy and the implementation of the process-tracing technique of protocol analysis. Findings indicated that elaborative encoding led to more verbalisations of critical items during encoding than rote rehearsal of list items, but false recall rates were reduced under elaboration conditions (Experiment 2). Interestingly, false recall was more likely to occur when items were verbalised during encoding than not verbalised (Experiment 1), and participants tended to reinstate their encoding strategies during recall, particularly after elaborative encoding (Experiment 1). Theoretical implications for the interplay of encoding and retrieval processes of false recall are discussed.

Prefrontal activity and impaired memory encoding strategies in schizophrenia.

Science.gov (United States)

Guimond, Synthia; Hawco, Colin; Lepage, Martin

2017-08-01

Schizophrenia patients have significant memory difficulties that have far-reaching implications in their daily life. These impairments are partly attributed to an inability to self-initiate effective memory encoding strategies, but its core neurobiological correlates remain unknown. The current study addresses this critical gap in our knowledge of episodic memory impairments in schizophrenia. Schizophrenia patients (n = 35) and healthy controls (n = 23) underwent a Semantic Encoding Memory Task (SEMT) during an fMRI scan. Brain activity was examined for conditions where participants were a) prompted to use semantic encoding strategies, or b) not prompted but required to self-initiate such strategies. When prompted to use semantic encoding strategies, schizophrenia patients exhibited similar recognition performance and brain activity as healthy controls. However, when required to self-initiate these strategies, patients had significant reduced recognition performance and brain activity in the left dorsolateral prefrontal cortex, as well as in the left temporal gyrus, left superior parietal lobule, and cerebellum. When patients were divided based on performance on the SEMT, the subgroup with more severe deficits in self-initiation also showed greater reduction in left dorsolateral prefrontal activity. These results suggest that impaired self-initiation of elaborative encoding strategies is a driving feature of memory deficits in schizophrenia. We also identified the neural correlates of impaired self-initiation of semantic encoding strategies, in which a failure to activate the left dorsolateral prefrontal cortex plays a key role. These findings provide important new targets in the development of novel treatments aiming to improve memory and ultimately patients' outcome. Copyright © 2017. Published by Elsevier Ltd.

Least-squares reverse time migration of marine data with frequency-selection encoding

KAUST Repository

Dai, Wei

2013-06-24

The phase-encoding technique can sometimes increase the efficiency of the least-squares reverse time migration (LSRTM) by more than one order of magnitude. However, traditional random encoding functions require all the encoded shots to share the same receiver locations, thus limiting the usage to seismic surveys with a fixed spread geometry. We implement a frequency-selection encoding strategy that accommodates data with a marine streamer geometry. The encoding functions are delta functions in the frequency domain, so that all the encoded shots have unique nonoverlapping frequency content, and the receivers can distinguish the wavefield from each shot with a unique frequency band. Because the encoding functions are orthogonal to each other, there will be no crosstalk between different shots during modeling and migration. With the frequency-selection encoding method, the computational efficiency of LSRTM is increased so that its cost is comparable to conventional RTM for the Marmousi2 model and a marine data set recorded in the Gulf of Mexico. With more iterations, the LSRTM image quality is further improved by suppressing migration artifacts, balancing reflector amplitudes, and enhancing the spatial resolution. We conclude that LSRTM with frequency-selection is an efficient migration method that can sometimes produce more focused images than conventional RTM. © 2013 Society of Exploration Geophysicists.

Ten years after the Jali Commission

African Journals Online (AJOL)

Ten years have lapsed since the Jali Commission's final report became publicly available, and it is therefore an .... as the 'core business' of the department. This was seen as .... the 2009/10–2013/14 DCS Strategic Plan did the department ...

Validation of a Real-time AVS Encoder on FPGA

Directory of Open Access Journals (Sweden)

Qun Fang Yuan

2014-01-01

Full Text Available A whole I frame AVS real-time video encoder is designed and implemented on FPGA platform in this paper. The system uses the structure of the flow calculation, coupled with a dual-port RAM memory between/among the various functional modules. Reusable design and pipeline design are used to optimize various encoding module and to ensure the efficient operation of the pipeline. Through the simulation of ISE software and the verification of Xilinx Vritex-4 pro platform, it can be seen that the highest working frequency can be up to 110 MHz, meeting the requirements of the whole I frame real- time encoding of AVS in CIF resolution.

Early Predictors of Ten-Year Course in First-Episode Psychosis

DEFF Research Database (Denmark)

Friis, Svein; Melle, Ingrid; Johannessen, Jan Olav

2016-01-01

, five, and ten years (N=186 at ten years). Time in psychosis was defined as time with scores ≥4 on any of the Positive and Negative Syndrome Scale items P1, P3, P5, P6, and G9. Evaluations were retrospective, based on clinical interviews and all available clinical information. During the first two years......, patients were also evaluated by their clinicians at least biweekly. Baseline and early-course predictors of long-term course were identified with linear mixed-model analyses. RESULTS: Four variables provided significant, additive predictions of longer time in psychosis during the ten-year follow...

The multiscale classification system and grid encoding mode of ecological land in China

Science.gov (United States)

Wang, Jing; Liu, Aixia; Lin, Yifan

2017-10-01

Ecological land provides goods and services that have direct or indirect benefic to eco-environment and human welfare. In recent years, researches on ecological land have become important in the field of land changes and ecosystem management. In the study, a multi-scale classification scheme of ecological land was developed for land management based on combination of the land-use classification and the ecological function zoning in China, including eco-zone, eco-region, eco-district, land ecosystem, and ecological land-use type. The geographical spatial unit leads toward greater homogeneity from macro to micro scale. The term "ecological land-use type" is the smallest one, being important to maintain the key ecological processes in land ecosystem. Ecological land-use type was categorized into main-functional and multi-functional ecological land-use type according to its ecological function attributes and production function attributes. Main-functional type was defined as one kind of land-use type mainly providing ecological goods and function attributes, such as river, lake, swampland, shoaly land, glacier and snow, while multi-functional type not only providing ecological goods and function attributes but also productive goods and function attributes, such as arable land, forestry land, and grassland. Furthermore, a six-level grid encoding mode was proposed for modern management of ecological land and data update under cadastral encoding. The six-level irregular grid encoding from macro to micro scale included eco-zone, eco-region, eco-district, cadastral area, land ecosystem, land ownership type, ecological land-use type, and parcel. Besides, the methodologies on ecosystem management were discussed for integrated management of natural resources in China.

Ten years of nuclear power

Energy Technology Data Exchange (ETDEWEB)

NONE

1964-08-15

Ten years have elapsed since the world's first nuclear power station began to supply electricity in Russia, and this in turn marked the end of a twelve year stage following the first controlled nuclear chain reaction at Chicago. These periods mark major stages in the development of atomic energy from the realm of abstract ideas to that of everyday industrial application. They followed a period of fundamental research and laboratory work, culminating in Enrico Fermi's demonstration of a system whereby the forces of the atom could be brought under control. Then it was necessary to find ways and means of using the chain reaction for practical purposes and on an industrial scale. And after this had been shown in 1954 to be technically possible, it had still to be developed into an economic process. The nuclear power station has proved itself from the technical and engineering standpoint. The third phase of development has been to bring it to the stage of being economically competitive with alternative sources of energy, and it would appear that we are now reaching that goal - though more slowly than had been envisaged ten years ago

Von Blüten, Göttern und Gelehrten

OpenAIRE

Zotter, Astrid

2013-01-01

Der Sanskrittext Puṣpacintāmaṇi (PuCi) behandelt Blüten als Darbringungen (upacāra) im wichtigsten hinduistischen Verehrungsritual, der pūjā. In ca. 400 Strophen werden über 200 Namen von Blüten genannt und für verschiedene Gottheiten und pūjās als geeignete oder ungeeignete Gaben vorgeschrieben. Der Text ist eine Kompilation (Nibandha), in der die Inhalte aus 47 namentlich genannten Quellentexten referiert werden. Ziel der Dissertation ist es nicht nur, diesen Text, der 1966 zum ersten Ma...

[Analysis of quality of life in patiens with low back pain after receiving transcutaneous electrical nerve stimulation (TENS)].

Science.gov (United States)

Zaniewska, Renata; Okurowska-Zawada, Bozena; Kułak, Wojciech; Domian, Karolina

2012-01-01

Low back pain (LBP) is one of the most common disorders affecting office employees working with a computer, which inevitably leads to lower quality of life. The aim of this study was to analyze the quality of life of patients with LBP after application of TENS (Transcutaneous Electrical Nervous Stimulation). The study group included 30 computer workers (26 females and 4 males) aged 30-60 years (45 +/- 12). The quality of life was assessed using the World Health Organization Quality of Life instrument-Abbreviated version (WHOQOL-Bref) before and after 10 applications of TENS. Outcomes were evaluated with a visual analog score (VAS) for pain and Schober's test to measure the ability of a patient to flex his or her lower back. The mean VAS value decreased significantly from 3.83 +/- 1.31 cm at baseline to 3.36 +/- 1.21 cm after treatment. Patients reported pain relief. The highest quality of life scores in terms of social relationships were found in the social category evaluating personal relationships, social support and sexual activity (15.91 +/- 2.07) and mental health (14.32 +/- 1.59). After treatment a significant increase in the flexion of lower back was observed in the majority of patients. No significant correlations between the quality of life and the intensity of pain and the flexion of lower back before and after treatment were found. TENS therapy is an effective technique for pain relief in patients with LBP. TENS can also be used with other methods of LBP treatment and may improve the patients' quality of life.

A Neural Signature Encoding Decisions under Perceptual Ambiguity.

Science.gov (United States)

Sun, Sai; Yu, Rongjun; Wang, Shuo

2017-01-01

People often make perceptual decisions with ambiguous information, but it remains unclear whether the brain has a common neural substrate that encodes various forms of perceptual ambiguity. Here, we used three types of perceptually ambiguous stimuli as well as task instructions to examine the neural basis for both stimulus-driven and task-driven perceptual ambiguity. We identified a neural signature, the late positive potential (LPP), that encoded a general form of stimulus-driven perceptual ambiguity. In addition to stimulus-driven ambiguity, the LPP was also modulated by ambiguity in task instructions. To further specify the functional role of the LPP and elucidate the relationship between stimulus ambiguity, behavioral response, and the LPP, we employed regression models and found that the LPP was specifically associated with response latency and confidence rating, suggesting that the LPP encoded decisions under perceptual ambiguity. Finally, direct behavioral ratings of stimulus and task ambiguity confirmed our neurophysiological findings, which could not be attributed to differences in eye movements either. Together, our findings argue for a common neural signature that encodes decisions under perceptual ambiguity but is subject to the modulation of task ambiguity. Our results represent an essential first step toward a complete neural understanding of human perceptual decision making.

Encoding and decoding messages with chaotic lasers

International Nuclear Information System (INIS)

Alsing, P.M.; Gavrielides, A.; Kovanis, V.; Roy, R.; Thornburg, K.S. Jr.

1997-01-01

We investigate the structure of the strange attractor of a chaotic loss-modulated solid-state laser utilizing return maps based on a combination of intensity maxima and interspike intervals, as opposed to those utilizing Poincare sections defined by the intensity maxima of the laser (I=0,Ie<0) alone. We find both experimentally and numerically that a simple, intrinsic relationship exists between an intensity maximum and the pair of preceding and succeeding interspike intervals. In addition, we numerically investigate encoding messages on the output of a chaotic transmitter laser and its subsequent decoding by a similar receiver laser. By exploiting the relationship between the intensity maxima and the interspike intervals, we demonstrate that the method utilized to encode the message is vital to the system close-quote s ability to hide the signal from unwanted deciphering. In this work alternative methods are studied in order to encode messages by modulating the magnitude of pumping of the transmitter laser and also by driving its loss modulation with more than one frequency. copyright 1997 The American Physical Society

Encoding Effects on First-Graders' Use of Manipulatives

Science.gov (United States)

Osana, Helena P.; Przednowek, Katarzyna; Cooperman, Allyson; Adrien, Emmanuelle

2018-01-01

The effects of prior encodings of manipulatives (red and blue plastic chips) on children's ability to use them as representations of quantity were tested. First graders (N = 73) were assigned to four conditions in which the encoding of plastic chips was experimentally manipulated. All children then participated in an addition activity that relied…

On The Designed And Constructed Feedback Shift-Register Encoder

African Journals Online (AJOL)

Information transmission in noisy channels can be achieved with vanishingly small probability of error by proper coding of the information as long as the encoding rate is less than the channel capacity. An encoder capable of cyclical shifting of data, and which can therefore be used for Bose-Chaudhuri and Hocquenghem ...

Audiovisual semantic congruency during encoding enhances memory performance.

Science.gov (United States)

Heikkilä, Jenni; Alho, Kimmo; Hyvönen, Heidi; Tiippana, Kaisa

2015-01-01

Studies of memory and learning have usually focused on a single sensory modality, although human perception is multisensory in nature. In the present study, we investigated the effects of audiovisual encoding on later unisensory recognition memory performance. The participants were to memorize auditory or visual stimuli (sounds, pictures, spoken words, or written words), each of which co-occurred with either a semantically congruent stimulus, incongruent stimulus, or a neutral (non-semantic noise) stimulus in the other modality during encoding. Subsequent memory performance was overall better when the stimulus to be memorized was initially accompanied by a semantically congruent stimulus in the other modality than when it was accompanied by a neutral stimulus. These results suggest that semantically congruent multisensory experiences enhance encoding of both nonverbal and verbal materials, resulting in an improvement in their later recognition memory.

Giant piezoelectricity in potassium-sodium niobate lead-free ceramics.

Science.gov (United States)

Wang, Xiaopeng; Wu, Jiagang; Xiao, Dingquan; Zhu, Jianguo; Cheng, Xiaojing; Zheng, Ting; Zhang, Binyu; Lou, Xiaojie; Wang, Xiangjian

2014-02-19

Environment protection and human health concern is the driving force to eliminate the lead from commercial piezoelectric materials. In 2004, Saito et al. [ Saito et al., Nature , 2004 , 432 , 84 . ] developed an alkali niobate-based perovskite solid solution with a peak piezoelectric constant d33 of 416 pC/N when prepared in the textured polycrystalline form, intriguing the enthusiasm of developing high-performance lead-free piezoceramics. Although much attention has been paid on the alkali niobate-based system in the past ten years, no significant breakthrough in its d33 has yet been attained. Here, we report an alkali niobate-based lead-free piezoceramic with the largest d33 of ∼490 pC/N ever reported so far using conventional solid-state method. In addition, this material system also exhibits excellent integrated performance with d33∼390-490 pC/N and TC∼217-304 °C by optimizing the compositions. This giant d33 of the alkali niobate-based lead-free piezoceramics is ascribed to not only the construction of a new rhombohedral-tetragonal phase boundary but also enhanced dielectric and ferroelectric properties. Our finding may pave the way for "lead-free at last".

Quantum Darwinism Requires an Extra-Theoretical Assumption of Encoding Redundancy

Science.gov (United States)

Fields, Chris

2010-10-01

Observers restricted to the observation of pointer states of apparatus cannot conclusively demonstrate that the pointer of an apparatus mathcal{A} registers the state of a system of interest S without perturbing S. Observers cannot, therefore, conclusively demonstrate that the states of a system S are redundantly encoded by pointer states of multiple independent apparatus without destroying the redundancy of encoding. The redundancy of encoding required by quantum Darwinism must, therefore, be assumed from outside the quantum-mechanical formalism and without the possibility of experimental demonstration.

Universal Quantum Computing with Arbitrary Continuous-Variable Encoding

OpenAIRE

Lau, Hoi-Kwan; Plenio, Martin B.

2016-01-01

Implementing a qubit quantum computer in continuous-variable systems conventionally requires the engineering of specific interactions according to the encoding basis states. In this work, we present a unified formalism to conduct universal quantum computation with a fixed set of operations but arbitrary encoding. By storing a qubit in the parity of two or four qumodes, all computing processes can be implemented by basis state preparations, continuous-variable exponential-swap operations, and ...

Design and implementation of parallel video encoding strategies using divisible load analysis

NARCIS (Netherlands)

Li, Ping; Veeravalli, Bharadwaj; Kassim, A.A.

2005-01-01

The processing time needed for motion estimation usually accounts for a significant part of the overall processing time of the video encoder. To improve the video encoding speed, reducing the execution time for motion estimation process is essential. Parallel implementation of video encoding systems

On the number of encoder states for a type of RLL codes

NARCIS (Netherlands)

Cai, K.; Schouhamer Immink, K.A.

2006-01-01

The relationship between the number of encoder states and the probable size of certain runlength-limited (RLL) codes is derived analytically. By associating the number of encoder states with (generalized) Fibonacci numbers, the minimum number of encoder states is obtained, which maximizes the rate

Assessing the effects of transcutaneous electrical nerve stimulation (TENS) in post-thoracotomy analgesia.

Science.gov (United States)

Ferreira, Fabiana Cristina; Issy, Adriana Machado; Sakata, Rioko Kimiko

2011-01-01

Transcutaneous electrical nerve stimulation (TENS) is commonly used to treat musculoskeletal pain, but it may also be indicated for postoperative analgesia. The objective of this study was to evaluate the analgesic effects of TENS on post-thoracotomy. Thirty patients between 18 and 60 years of age undergoing thoracotomy for lung cancer resection on the second postoperative day were included in this study. Patients were divided into two groups (G1 and G2). G1 patients were treated with TENS; and in G2 (without TENS) electrodes were placed but the equipment was not turned on. TENS was maintained for one hour. The visual analogue scale was used to evaluate the analgesic effects on three moments: before TENS (M0), immediately after TENS (M1), and one hour later (M2), with the patient at rest, elevation of the upper limbs, change in decubitus, and coughing. The intensity of pain at rest was higher in G2 immediately after TENS, but not one hour after the procedure. There was no difference between both groups with elevation of the upper limbs, decubitus change, and coughing. With the use of TENS for one hour on the second post-thoracotomy day in patients who received fentanyl (50 μg) associated with bupivacaine (5 mL), a reduction in pain intensity was observed at rest immediately after TENS; with elevation of the upper limbs, change in decubitus, and coughing, a reduction in pain severity was not observed. Copyright © 2011 Elsevier Editora Ltda. All rights reserved.

Towards an Automatic Parameter-Tuning Framework for Cost Optimization on Video Encoding Cloud

Directory of Open Access Journals (Sweden)

Xiaowei Li

2012-01-01

Full Text Available The emergence of cloud encoding services facilitates many content owners, such as the online video vendors, to transcode their digital videos without infrastructure setup. Such service provider charges the customers only based on their resource consumption. For both the service provider and customers, lowering the resource consumption while maintaining the quality is valuable and desirable. Thus, to choose a cost-effective encoding parameter, configuration is essential and challenging due to the tradeoff between bitrate, encoding speed, and resulting quality. In this paper, we explore the feasibility of an automatic parameter-tuning framework, based on which the above objective can be achieved. We introduce a simple service model, which combines the bitrate and encoding speed into a single value: encoding cost. Then, we conduct an empirical study to examine the relationship between the encoding cost and various parameter settings. Our experiment is based on the one-pass Constant Rate Factor method in x264, which can achieve relatively stable perceptive quality, and we vary each parameter we choose to observe how the encoding cost changes. The experiment results show that the tested parameters can be independently tuned to minimize the encoding cost, which makes the automatic parameter-tuning framework feasible and promising for optimizing the cost on video encoding cloud.

Interaction Between Encoding and Retrieval Operations in Cued Recall

Science.gov (United States)

Fisher, Ronald P.; Craik, Fergus I. M.

1977-01-01

Three experiments are described in which the qualitative nature of memorial processing was manipulated at both input (encoding) and output (retrieval). As in earlier research, it was found that retention levels were highest when the same type of information was used as a retrieval cue. Concludes that the notions of encoding specificity and depth…

Least-squares reverse time migration of marine data with frequency-selection encoding

KAUST Repository

Dai, Wei

2013-08-20

The phase-encoding technique can sometimes increase the efficiency of the least-squares reverse time migration (LSRTM) by more than one order of magnitude. However, traditional random encoding functions require all the encoded shots to share the same receiver locations, thus limiting the usage to seismic surveys with a fixed spread geometry. We implement a frequency-selection encoding strategy that accommodates data with a marine streamer geometry. The encoding functions are delta functions in the frequency domain, so that all the en- coded shots have unique non-overlapping frequency content, and the receivers can distinguish the wavefield from each shot with a unique frequency band. Since the encoding functions are orthogonal to each other, there will be no crosstalk between different shots during modeling and migration. With the frequency-selection encoding method, the computational efficiency of LSRTM is increased so that its cost is compara- ble to conventional RTM for both the Marmousi2 model and a marine data set recorded in the Gulf of Mexico. With more iterations, the LSRTM image quality is further improved. We conclude that LSRTM with frequency-selection is an efficient migration method that can sometimes produce more focused images than conventional RTM.

Stimulus number, duration and intensity encoding in randomly connected attractor networks with synaptic depression

Directory of Open Access Journals (Sweden)

Paul eMiller

2013-05-01

Full Text Available Randomly connected recurrent networks of excitatory groups of neurons can possess a multitude of attractor states. When the internal excitatory synapses of these networks are depressing, the attractor states can be destabilized with increasing input. This leads to an itinerancy, where with either repeated transient stimuli, or increasing duration of a single stimulus, the network activity advances through sequences of attractor states. We find that the resulting network state, which persists beyond stimulus offset, can encode the number of stimuli presented via a distributed representation of neural activity with non-monotonic tuning curves for most neurons. Increased duration of a single stimulus is encoded via different distributed representations, so unlike an integrator, the network distinguishes separate successive presentations of a short stimulus from a single presentation of a longer stimulus with equal total duration. Moreover, different amplitudes of stimulus cause new, distinct activity patterns, such that changes in stimulus number, duration and amplitude can be distinguished from each other. These properties of the network depend on dynamic depressing synapses, as they disappear if synapses are static. Thus short-term synaptic depression allows a network to store separately the different dynamic properties of a spatially constant stimulus.

Role of Virus-Encoded microRNAs in Avian Viral Diseases

Directory of Open Access Journals (Sweden)

Yongxiu Yao

2014-03-01

Full Text Available With total dependence on the host cell, several viruses have adopted strategies to modulate the host cellular environment, including the modulation of microRNA (miRNA pathway through virus-encoded miRNAs. Several avian viruses, mostly herpesviruses, have been shown to encode a number of novel miRNAs. These include the highly oncogenic Marek’s disease virus-1 (26 miRNAs, avirulent Marek’s disease virus-2 (36 miRNAs, herpesvirus of turkeys (28 miRNAs, infectious laryngotracheitis virus (10 miRNAs, duck enteritis virus (33 miRNAs and avian leukosis virus (2 miRNAs. Despite the closer antigenic and phylogenetic relationship among some of the herpesviruses, miRNAs encoded by different viruses showed no sequence conservation, although locations of some of the miRNAs were conserved within the repeat regions of the genomes. However, some of the virus-encoded miRNAs showed significant sequence homology with host miRNAs demonstrating their ability to serve as functional orthologs. For example, mdv1-miR-M4-5p, a functional ortholog of gga-miR-155, is critical for the oncogenicity of Marek’s disease virus. Additionally, we also describe the potential association of the recently described avian leukosis virus subgroup J encoded E (XSR miRNA in the induction of myeloid tumors in certain genetically-distinct chicken lines. In this review, we describe the advances in our understanding on the role of virus-encoded miRNAs in avian diseases.

Kaluza-Klein supergravity in ten dimensions

International Nuclear Information System (INIS)

Huq, M.; Namazie, M.A.

1983-11-01

We construct a massive version of N=2 supergravity in ten dimensions by compactification of the eleven dimensional, N=1 theory. This theory describes the usual N=2 massless super-multiplet, in addition to which there is an infinite tower of massive, charged N=2 supermultiplets. (author)

Ten themes of viscous liquid dynamics

DEFF Research Database (Denmark)

Dyre, J. C.

2007-01-01

Ten ‘themes' of viscous liquid physics are discussed with a focus on how they point to a general description of equilibrium viscous liquid dynamics (i.e., fluctuations) at a given temperature. This description is based on standard time-dependent Ginzburg-Landau equations for the density fields...

Encoding information into precipitation structures

International Nuclear Information System (INIS)

Martens, Kirsten; Bena, Ioana; Droz, Michel; Rácz, Zoltan

2008-01-01

Material design at submicron scales would be profoundly affected if the formation of precipitation patterns could be easily controlled. It would allow the direct building of bulk structures, in contrast to traditional techniques which consist of removing material in order to create patterns. Here, we discuss an extension of our recent proposal of using electrical currents to control precipitation bands which emerge in the wake of reaction fronts in A + + B – → C reaction–diffusion processes. Our main result, based on simulating the reaction–diffusion–precipitation equations, is that the dynamics of the charged agents can be guided by an appropriately designed time-dependent electric current so that, in addition to the control of the band spacing, the width of the precipitation bands can also be tuned. This makes straightforward the encoding of information into precipitation patterns and, as an amusing example, we demonstrate the feasibility by showing how to encode a musical rhythm

Power calculation of linear and angular incremental encoders

Science.gov (United States)

Prokofev, Aleksandr V.; Timofeev, Aleksandr N.; Mednikov, Sergey V.; Sycheva, Elena A.

2016-04-01

Automation technology is constantly expanding its role in improving the efficiency of manufacturing and testing processes in all branches of industry. More than ever before, the mechanical movements of linear slides, rotary tables, robot arms, actuators, etc. are numerically controlled. Linear and angular incremental photoelectric encoders measure mechanical motion and transmit the measured values back to the control unit. The capabilities of these systems are undergoing continual development in terms of their resolution, accuracy and reliability, their measuring ranges, and maximum speeds. This article discusses the method of power calculation of linear and angular incremental photoelectric encoders, to find the optimum parameters for its components, such as light emitters, photo-detectors, linear and angular scales, optical components etc. It analyzes methods and devices that permit high resolutions in the order of 0.001 mm or 0.001°, as well as large measuring lengths of over 100 mm. In linear and angular incremental photoelectric encoders optical beam is usually formulated by a condenser lens passes through the measuring unit changes its value depending on the movement of a scanning head or measuring raster. Past light beam is converting into an electrical signal by the photo-detecter's block for processing in the electrical block. Therefore, for calculating the energy source is a value of the desired value of the optical signal at the input of the photo-detecter's block, which reliably recorded and processed in the electronic unit of linear and angular incremental optoelectronic encoders. Automation technology is constantly expanding its role in improving the efficiency of manufacturing and testing processes in all branches of industry. More than ever before, the mechanical movements of linear slides, rotary tables, robot arms, actuators, etc. are numerically controlled. Linear and angular incremental photoelectric encoders measure mechanical motion and

Ten-year scheme of network development - 2013 edition

International Nuclear Information System (INIS)

2013-01-01

RTE, an independent subsidiary of EDF, is the French electricity transmission system operator. It is a public service company responsible for operating, maintaining and developing the high and extra high voltage network. It guarantees the reliability and proper operation of the power network. RTE transports electricity between electricity suppliers (French and European) and consumers, whether they are electricity distributors or industrial consumers directly connected to the transmission system. The mission of RTE is to balance the electricity supply and demand in real time. With the support of the government authorities, RTE prepares a ten-year scheme of network development in France; This document presents the main electricity transport infrastructures to foresee within the ten coming years and lists the network development investments which must be realised and implemented within 3 years. The document is updated each year and comes to complement at the national level the European ten year network development plan (TYNDP) and the European regional plans as provided for in the 2009/72/CE European directive

Information transfer via implicit encoding with delay time modulation in a time-delay system

Energy Technology Data Exchange (ETDEWEB)

Kye, Won-Ho, E-mail: whkye@kipo.go.kr [Korean Intellectual Property Office, Government Complex Daejeon Building 4, 189, Cheongsa-ro, Seo-gu, Daejeon 302-701 (Korea, Republic of)

2012-08-20

A new encoding scheme for information transfer with modulated delay time in a time-delay system is proposed. In the scheme, the message is implicitly encoded into the modulated delay time. The information transfer rate as a function of encoding redundancy in various noise scales is presented and it is analyzed that the implicit encoding scheme (IES) has stronger resistance against channel noise than the explicit encoding scheme (EES). In addition, its advantages in terms of secure communication and feasible applications are discussed. -- Highlights: ► We propose new encoding scheme with delay time modulation. ► The message is implicitly encoded with modulated delay time. ► The proposed scheme shows stronger resistance against channel noise.

Low Complexity Encoder of High Rate Irregular QC-LDPC Codes for Partial Response Channels

Directory of Open Access Journals (Sweden)

IMTAWIL, V.

2011-11-01

Full Text Available High rate irregular QC-LDPC codes based on circulant permutation matrices, for efficient encoder implementation, are proposed in this article. The structure of the code is an approximate lower triangular matrix. In addition, we present two novel efficient encoding techniques for generating redundant bits. The complexity of the encoder implementation depends on the number of parity bits of the code for the one-stage encoding and the length of the code for the two-stage encoding. The advantage of both encoding techniques is that few XOR-gates are used in the encoder implementation. Simulation results on partial response channels also show that the BER performance of the proposed code has gain over other QC-LDPC codes.

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

A 10 Gbit/s OCDMA system based on electric encoding and optical transmission

Science.gov (United States)

Li, Chuan-qi; Hu, Jin-lin; He, Dong-dong; Chen, Mei-juan; Wang, Da-chi; Chen, Yan

2013-11-01

An electric encoded/optical transmission system of code division multiple access (CDMA) is proposed. It encodes the user signal in electric domain, and transfers the different code slice signals via the different wavelengths of light. This electric domain encoder/decoder is compared with current traditional encoder/decoder. Four-user modulation/demodulation optical CDMA (OCDMA) system with rate of 2.5 Gbit/s is simulated, which is based on the optical orthogonal code (OCC) designed in our laboratory. The results show that the structure of electric encoding/optical transmission can encode/decode signal correctly, and can achieve the chip rate equal to the user data rate. It can overcome the rate limitation of electronic bottleneck, and bring some potential applications in the electro-optical OCDMA system.

Divided attention reduces resistance to distraction at encoding but not retrieval.

Science.gov (United States)

Weeks, Jennifer C; Hasher, Lynn

2017-08-01

Older adults show implicit memory for previously seen distraction, an effect attributed to poor attentional control. It is unclear whether this effect results from lack of control over encoding during the distraction task, lack of retrieval constraint during the test task, or both. In the present study, we simulated poor distraction control in young adults using divided attention at encoding, at retrieval, at both times, or not at all. The encoding task was a 1-back task on pictures with distracting superimposed letter strings, some of which were words. The retrieval task was a word fragment completion task testing implicit memory for the distracting words. Attention was divided using an auditory odd digit detection task. Dividing attention at encoding, but not at retrieval, resulted in significant priming for distraction, which suggests that control over encoding processes is a primary determinant of distraction transfer in populations with low inhibitory control (e.g. older adults).

Factors affecting reorganisation of memory encoding networks in temporal lobe epilepsy

Science.gov (United States)

Sidhu, M.K.; Stretton, J.; Winston, G.P.; Symms, M.; Thompson, P.J.; Koepp, M.J.; Duncan, J.S.

2015-01-01

Summary Aims In temporal lobe epilepsy (TLE) due to hippocampal sclerosis reorganisation in the memory encoding network has been consistently described. Distinct areas of reorganisation have been shown to be efficient when associated with successful subsequent memory formation or inefficient when not associated with successful subsequent memory. We investigated the effect of clinical parameters that modulate memory functions: age at onset of epilepsy, epilepsy duration and seizure frequency in a large cohort of patients. Methods We studied 53 patients with unilateral TLE and hippocampal sclerosis (29 left). All participants performed a functional magnetic resonance imaging memory encoding paradigm of faces and words. A continuous regression analysis was used to investigate the effects of age at onset of epilepsy, epilepsy duration and seizure frequency on the activation patterns in the memory encoding network. Results Earlier age at onset of epilepsy was associated with left posterior hippocampus activations that were involved in successful subsequent memory formation in left hippocampal sclerosis patients. No association of age at onset of epilepsy was seen with face encoding in right hippocampal sclerosis patients. In both left hippocampal sclerosis patients during word encoding and right hippocampal sclerosis patients during face encoding, shorter duration of epilepsy and lower seizure frequency were associated with medial temporal lobe activations that were involved in successful memory formation. Longer epilepsy duration and higher seizure frequency were associated with contralateral extra-temporal activations that were not associated with successful memory formation. Conclusion Age at onset of epilepsy influenced verbal memory encoding in patients with TLE due to hippocampal sclerosis in the speech-dominant hemisphere. Shorter duration of epilepsy and lower seizure frequency were associated with less disruption of the efficient memory encoding network whilst

Transcutaneous electric nerve stimulation (TENS) for cancer pain in adults.

Science.gov (United States)

Hurlow, Adam; Bennett, Michael I; Robb, Karen A; Johnson, Mark I; Simpson, Karen H; Oxberry, Stephen G

2012-03-14

Cancer-related pain is complex and multi-dimensional but the mainstay of cancer pain management has predominantly used a biomedical approach. There is a need for non-pharmacological and innovative approaches. Transcutaneous Electric Nerve Stimulation (TENS) may have a role in pain management but the effectiveness of TENS is currently unknown. This is an update of the original review published in Issue 3, 2008. The aim of this systematic review was to determine the effectiveness of TENS for cancer-related pain in adults. The initial review searched The Cochrane Library, MEDLINE, EMBASE, CINAHL, PsychINFO, AMED and PEDRO databases in April 2008. We performed an updated search of CENTRAL, MEDLINE, EMBASE, CINAHL and PEDRO databases in November 2011. We included only randomised controlled trials (RCTS) investigating the use of TENS for the management of cancer-related pain in adults. The search strategy identified a further two studies for possible inclusion. One of the review authors screened each abstract using a study eligibility tool. Where eligibility could not be determined, a second author assessed the full paper. One author used a standardised data extraction sheet to collect information on the studies and independently assess the quality of the studies using the validated five-point Oxford Quality Scale. The small sample sizes and differences in patient study populations of the three included studies (two from the original review and a third included in this update) prevented meta-analysis. For the original review the search strategy identified 37 possible published studies; we divided these between two pairs of review authors who decided on study selection; all four review authors discussed and agreed final scores. Only one additional RCT met the eligibility criteria (24 participants) for this updated review. Although this was a feasibility study, not designed to investigate intervention effect, it suggested that TENS may improve bone pain on movement in a

Task-selective memory effects for successfully implemented encoding strategies.

Science.gov (United States)

Leshikar, Eric D; Duarte, Audrey; Hertzog, Christopher

2012-01-01

Previous behavioral evidence suggests that instructed strategy use benefits associative memory formation in paired associate tasks. Two such effective encoding strategies--visual imagery and sentence generation--facilitate memory through the production of different types of mediators (e.g., mental images and sentences). Neuroimaging evidence suggests that regions of the brain support memory reflecting the mental operations engaged at the time of study. That work, however, has not taken into account self-reported encoding task success (i.e., whether participants successfully generated a mediator). It is unknown, therefore, whether task-selective memory effects specific to each strategy might be found when encoding strategies are successfully implemented. In this experiment, participants studied pairs of abstract nouns under either visual imagery or sentence generation encoding instructions. At the time of study, participants reported their success at generating a mediator. Outside of the scanner, participants further reported the quality of the generated mediator (e.g., images, sentences) for each word pair. We observed task-selective memory effects for visual imagery in the left middle occipital gyrus, the left precuneus, and the lingual gyrus. No such task-selective effects were observed for sentence generation. Intriguingly, activity at the time of study in the left precuneus was modulated by the self-reported quality (vividness) of the generated mental images with greater activity for trials given higher ratings of quality. These data suggest that regions of the brain support memory in accord with the encoding operations engaged at the time of study.

Direct encoding of orientation variance in the visual system.

Science.gov (United States)

Norman, Liam J; Heywood, Charles A; Kentridge, Robert W

2015-01-01

Our perception of regional irregularity, an example of which is orientation variance, seems effortless when we view two patches of texture that differ in this attribute. Little is understood, however, of how the visual system encodes a regional statistic like orientation variance, but there is some evidence to suggest that it is directly encoded by populations of neurons tuned broadly to high or low levels. The present study shows that selective adaptation to low or high levels of variance results in a perceptual aftereffect that shifts the perceived level of variance of a subsequently viewed texture in the direction away from that of the adapting stimulus (Experiments 1 and 2). Importantly, the effect is durable across changes in mean orientation, suggesting that the encoding of orientation variance is independent of global first moment orientation statistics (i.e., mean orientation). In Experiment 3 it was shown that the variance-specific aftereffect did not show signs of being encoded in a spatiotopic reference frame, similar to the equivalent aftereffect of adaptation to the first moment orientation statistic (the tilt aftereffect), which is represented in the primary visual cortex and exists only in retinotopic coordinates. Experiment 4 shows that a neuropsychological patient with damage to ventral areas of the cortex but spared intact early areas retains sensitivity to orientation variance. Together these results suggest that orientation variance is encoded directly by the visual system and possibly at an early cortical stage.

Feedback-tuned, noise resilient gates for encoded spin qubits

Science.gov (United States)

Bluhm, Hendrik

Spin 1/2 particles form native two level systems and thus lend themselves as a natural qubit implementation. However, encoding a single qubit in several spins entails benefits, such as reducing the resources necessary for qubit control and protection from certain decoherence channels. While several varieties of such encoded spin qubits have been implemented, accurate control remains challenging, and leakage out of the subspace of valid qubit states is a potential issue. Optimal performance typically requires large pulse amplitudes for fast control, which is prone to systematic errors and prohibits standard control approaches based on Rabi flopping. Furthermore, the exchange interaction typically used to electrically manipulate encoded spin qubits is inherently sensitive to charge noise. I will discuss all-electrical, high-fidelity single qubit operations for a spin qubit encoded in two electrons in a GaAs double quantum dot. Starting from a set of numerically optimized control pulses, we employ an iterative tuning procedure based on measured error syndromes to remove systematic errors.Randomized benchmarking yields an average gate fidelity exceeding 98 % and a leakage rate into invalid states of 0.2 %. These gates exhibit a certain degree of resilience to both slow charge and nuclear spin fluctuations due to dynamical correction analogous to a spin echo. Furthermore, the numerical optimization minimizes the impact of fast charge noise. Both types of noise make relevant contributions to gate errors. The general approach is also adaptable to other qubit encodings and exchange based two-qubit gates.

Vadose Zone Journal: The first ten years

NARCIS (Netherlands)

Vrugt, J.A.; Or, D.; Young, M.H.

2013-01-01

Celebrating ten years of publication, the authors introduce a special section commemorating the anniversary of Vadose Zone Journal and reviewing the journal’s role in an evolving understanding of vadose zone science.

Dosimetry results for Big Ten and related benchmarks

International Nuclear Information System (INIS)

Hansen, G.E.; Gilliam, D.M.

1980-01-01

Measured average reaction cross sections for the Big Ten central flux spectrum are given together with calculated values based on the U.S. Evaluated Nuclear Data File ENDF/B-IV. Central reactivity coefficients for 233 U, 235 U, 239 Pu, 6 Li and 10 B are given to check consistency of bias between measured and calculated reaction cross sections for these isotopes. Spectral indexes for the Los Alamos 233 U, 235 U and 239 Pu metal critical assemblies are updated, utilizing the Big Ten measurements and interassembly calibrations, and their implications for inelastic scattering are reiterated

Nonlinear inversion of potential-field data using a hybrid-encoding genetic algorithm

Science.gov (United States)

Chen, C.; Xia, J.; Liu, J.; Feng, G.

2006-01-01

Using a genetic algorithm to solve an inverse problem of complex nonlinear geophysical equations is advantageous because it does not require computer gradients of models or "good" initial models. The multi-point search of a genetic algorithm makes it easier to find the globally optimal solution while avoiding falling into a local extremum. As is the case in other optimization approaches, the search efficiency for a genetic algorithm is vital in finding desired solutions successfully in a multi-dimensional model space. A binary-encoding genetic algorithm is hardly ever used to resolve an optimization problem such as a simple geophysical inversion with only three unknowns. The encoding mechanism, genetic operators, and population size of the genetic algorithm greatly affect search processes in the evolution. It is clear that improved operators and proper population size promote the convergence. Nevertheless, not all genetic operations perform perfectly while searching under either a uniform binary or a decimal encoding system. With the binary encoding mechanism, the crossover scheme may produce more new individuals than with the decimal encoding. On the other hand, the mutation scheme in a decimal encoding system will create new genes larger in scope than those in the binary encoding. This paper discusses approaches of exploiting the search potential of genetic operations in the two encoding systems and presents an approach with a hybrid-encoding mechanism, multi-point crossover, and dynamic population size for geophysical inversion. We present a method that is based on the routine in which the mutation operation is conducted in the decimal code and multi-point crossover operation in the binary code. The mix-encoding algorithm is called the hybrid-encoding genetic algorithm (HEGA). HEGA provides better genes with a higher probability by a mutation operator and improves genetic algorithms in resolving complicated geophysical inverse problems. Another significant

An electrophysiological investigation of memory encoding, depth of processing, and word frequency in humans.

Science.gov (United States)

Guo, Chunyan; Zhu, Ying; Ding, Jinhong; Fan, Silu; Paller, Ken A

2004-02-12

Memory encoding can be studied by monitoring brain activity correlated with subsequent remembering. To understand brain potentials associated with encoding, we compared multiple factors known to affect encoding. Depth of processing was manipulated by requiring subjects to detect animal names (deep encoding) or boldface (shallow encoding) in a series of Chinese words. Recognition was more accurate with deep than shallow encoding, and for low- compared to high-frequency words. Potentials were generally more positive for subsequently recognized versus forgotten words; for deep compared to shallow processing; and, for remembered words only, for low- than for high-frequency words. Latency and topographic differences between these potentials suggested that several factors influence the effectiveness of encoding and can be distinguished using these methods, even with Chinese logographic symbols.

Are animacy effects in episodic memory independent of encoding instructions?

Science.gov (United States)

Gelin, Margaux; Bugaiska, Aurélia; Méot, Alain; Bonin, Patrick

2017-01-01

The adaptive view of human memory [Nairne, J. S. 2010. Adaptive memory: Evolutionary constraints on remembering. In B. H. Ross (Ed.), The psychology of learning and motivation (Vol. 53 pp. 1-32). Burlington: Academic Press; Nairne, J. S., & Pandeirada, J. N. S. 2010a. Adaptive memory: Ancestral priorities and the mnemonic value of survival processing. Cognitive Psychology, 61, 1-22, 2010b; Memory functions. In The Corsini encyclopedia of psychology and behavioral science, (Vol 3, 4th ed. pp. 977-979). Hokoben, NJ: John Wiley & Sons] assumes that animates (e.g., baby, rabbit presented as words or pictures) are better remembered than inanimates (e.g., bottle, mountain) because animates are more important for fitness than inanimates. In four studies, we investigated whether the animacy effect in episodic memory (i.e., the better remembering of animates over inanimates) is independent of encoding instructions. Using both a factorial (Studies 1 and 3) and a multiple regression approach (Study 2), three studies tested whether certain contexts drive people to attend to inanimate more than to animate things (or the reverse), and therefore lead to differential animacy effects. The findings showed that animacy effects on recall performance were observed in the grassland-survival scenario used by Nairne, Thompson, and Pandeirada (2007. Adaptive memory: Survival processing enhances retention. Journal of Experimental Psychology: Learning, Memory, & Cognition, 33, 263-273) (Studies 1-3), when words were rated for their pleasantness (Study 2), and in explicit learning (Study 3). In the non-survival scenario of moving to a foreign land (Studies 1-2), animacy effects on recall rates were not reliable in Study 1, but were significant in Study 2, whereas these effects were reliable in the non-survival scenario of planning a trip as a tour guide (Study 3). A final (control) study (Study 4) was conducted to test specifically whether animacy effects are related to the more organised

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Error-free holographic frames encryption with CA pixel-permutation encoding algorithm

Science.gov (United States)

Li, Xiaowei; Xiao, Dan; Wang, Qiong-Hua

2018-01-01

The security of video data is necessary in network security transmission hence cryptography is technique to make video data secure and unreadable to unauthorized users. In this paper, we propose a holographic frames encryption technique based on the cellular automata (CA) pixel-permutation encoding algorithm. The concise pixel-permutation algorithm is used to address the drawbacks of the traditional CA encoding methods. The effectiveness of the proposed video encoding method is demonstrated by simulation examples.

Immediate effects of tongue trills associated with transcutaneous electrical nerve stimulation (TENS).

Science.gov (United States)

Fabron, Eliana Maria Gradim; Petrini, Andressa Schweitzer; Cardoso, Vanessa de Moraes; Batista, João Carlos Torgal; Motonaga, Suely Mayumi; Marino, Viviane Cristina de Castro

2017-06-08

To investigate vocal quality variability after applying tongue trills associated with transcutaneous electrical nerve stimulation (TENS) on the larynx of women with normal laryngeal function. Additionally, to verify the effect of this technique over time on voice quality. Participants were 40 women (average 23.4 years) without vocal complaints. The procedure involved tongue trills with or without TENS for 3 minutes, rest and repeating the technique for another 2 minutes. The participants' voices were recorded before (Pre), after three minutes (Post 3min) and after two additional minutes (Post 5min) applying the technique. TENS with two electrodes was used on the thyroid cartilage. Self-assessment, acoustic and perceptual analysis were performed. When comparing tongue trills in isolation and associated with TENS, a greater sense of stability in phonation (self-assessment) and improvement in voice quality (perceptual evaluation) was observed in the combination technique. There was no statistical difference in acoustics findings between tongue trills in isolation and associated with TENS. When comparing the time effect of tongue trills with TENS in self-assessment there was a perception of less muscle tension (3min) and greater comfort during phonation (5 min); in the acoustic analysis, there was an increase of F0 (3 and 5 min) and intensity (5 min) when compared to Pre-moment; in the perceptual evaluation, better voice quality (3min). Comparing tongue trills in isolation and associated with TENS, there were changes in the comfort and muscle tension perception, as well as in vocal quality. On the other hand, tongue trills associated with TENS performed in 3 or 5 minutes resulted in beneficial effects on the voice identified in the assessments.

Feasibility study of Transcutaneous Electrical Nerve Stimulation (TENS) for cancer bone pain.

Science.gov (United States)

Bennett, Michael I; Johnson, Mark I; Brown, Sarah R; Radford, Helen; Brown, Julia M; Searle, Robert D

2010-04-01

This multicenter study assessed the feasibility of conducting a phase III trial of transcutaneous electrical nerve stimulation (TENS) in patients with cancer bone pain recruited from palliative care services. Eligible patients received active and placebo TENS for 1 hour at site of pain in a randomized crossover design; median interval between applications 3 days. Responses assessed at 30 and 60 minutes included numerical and verbal ratings of pain at rest and on movement, and pain relief. Recruitment, tolerability, adverse events, and effectiveness of blinding were also evaluated. Twenty-four patients were randomised and 19 completed both applications. The intervention was well tolerated. Five patients withdrew: 3 due to deteriorating performance status, and 2 due to increased pain (1 each following active and placebo TENS). Confidence interval estimation around the differences in outcomes between active and placebo TENS suggests that TENS has the potential to decrease pain on movement more than pain on rest. Nine patients did not consider that a placebo was used; the remaining 10 correctly identified placebo TENS. Feasibility studies are important in palliative care prior to undertaking clinical trials. Our findings suggest that further work is required on recruitment strategies and refining the control arm before evaluating TENS in cancer bone pain. Cancer bone pain is common and severe, and partly mediated by hyperexcitability. Animal studies suggest that Transcutaneous Electrical Nerve Stimulation can reduce hyperalgesia. This study examined the feasibility of evaluating TENS in patients with cancer bone pain in order to optimize methods before a phase III trial. Copyright 2010 American Pain Society. Published by Elsevier Inc. All rights reserved.

Fluorescence-Based Multiplex Protein Detection Using Optically Encoded Microbeads

Directory of Open Access Journals (Sweden)

Dae Hong Jeong

2012-03-01

Full Text Available Potential utilization of proteins for early detection and diagnosis of various diseases has drawn considerable interest in the development of protein-based multiplex detection techniques. Among the various techniques for high-throughput protein screening, optically-encoded beads combined with fluorescence-based target monitoring have great advantages over the planar array-based multiplexing assays. This review discusses recent developments of analytical methods of screening protein molecules on microbead-based platforms. These include various strategies such as barcoded microbeads, molecular beacon-based techniques, and surface-enhanced Raman scattering-based techniques. Their applications for label-free protein detection are also addressed. Especially, the optically-encoded beads such as multilayer fluorescence beads and SERS-encoded beads are successful for generating a large number of coding.

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Verhalen sprokkelen langs de frontlijn. Een kritische blik op Ten Oorlog

Directory of Open Access Journals (Sweden)

Hans Boers

2015-03-01

Full Text Available Gathering Stories along the Front: A Critical Look at Ten Oorlog [To War]This article reflects critically on the popular television programme Ten Oorlog, thereby examining the field of tension between history and entertainment, between historians and ‘the public’. History can be addressed via various television formats as an historical documentary or a travel programme. An analysis indicates the extent to which Ten Oorlog is inspired by these formats. However, the popular television programme from the outset was not conceived as a classic historical documentary and perhaps can best be described as a historical human interest programme as part of the large-scale commemoration of the First World War. How do history and entertainment relate to one another in this programme? Is there more emphasis on the historical context or on anecdotal stories? This analysis of Ten Oorlog illustrates the tense relation between historians and ‘the public’.Dit artikel werpt een kritische blik op het populaire televisieprogramma Ten Oorlog en gaat daarbij in op het spanningsveld tussen geschiedenis en entertainment, tussen historici en ‘het publiek’. Geschiedenis kan via verschillende formats zoals een historische documentaire of een reisprogramma aan bod komen op televisie. Een analyse van deze formats geeft aan in welke mate Ten Oorlog hierop geïnspireerd is. Het populaire televisieprogramma was echter van begin af aan niet als een klassieke historische documentaire bedoeld en kan misschien het bestomschreven worden als een historisch human interest programma, in het kader van de grootschalige herdenking van de Eerste Wereldoorlog. Hoe verhoudengeschiedenis en entertainment zich daarin? Helt de balans meer over naar historische omkadering of naar anekdotische verhalen? Deze analyse van Ten Oorlog illustreert de gespannen relatie tussen historici en het grote publiek.

Age-related effects on perceptual and semantic encoding in memory.

Science.gov (United States)

Kuo, M C C; Liu, K P Y; Ting, K H; Chan, C C H

2014-03-07

This study examined the age-related subsequent memory effect (SME) in perceptual and semantic encoding using event-related potentials (ERPs). Seventeen younger adults and 17 older adults studied a series of Chinese characters either perceptually (by inspecting orthographic components) or semantically (by determining whether the depicted object makes sounds). The two tasks had similar levels of difficulty. The participants made studied or unstudied judgments during the recognition phase. Younger adults performed better in both conditions, with significant SMEs detected in the time windows of P2, N3, P550, and late positive component (LPC). In the older group, SMEs were observed in the P2 and N3 latencies in both conditions but were only detected in the P550 in the semantic condition. Between-group analyses showed larger frontal and central SMEs in the younger sample in the LPC latency regardless of encoding type. Aging effect appears to be stronger on influencing perceptual than semantic encoding processes. The effects seem to be associated with a decline in updating and maintaining representations during perceptual encoding. The age-related decline in the encoding function may be due in part to changes in frontal lobe function. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

Attention promotes episodic encoding by stabilizing hippocampal representations

Science.gov (United States)

Aly, Mariam; Turk-Browne, Nicholas B.

2016-01-01

Attention influences what is later remembered, but little is known about how this occurs in the brain. We hypothesized that behavioral goals modulate the attentional state of the hippocampus to prioritize goal-relevant aspects of experience for encoding. Participants viewed rooms with paintings, attending to room layouts or painting styles on different trials during high-resolution functional MRI. We identified template activity patterns in each hippocampal subfield that corresponded to the attentional state induced by each task. Participants then incidentally encoded new rooms with art while attending to the layout or painting style, and memory was subsequently tested. We found that when task-relevant information was better remembered, the hippocampus was more likely to have been in the correct attentional state during encoding. This effect was specific to the hippocampus, and not found in medial temporal lobe cortex, category-selective areas of the visual system, or elsewhere in the brain. These findings provide mechanistic insight into how attention transforms percepts into memories. PMID:26755611

Automatic Encoding and Language Detection in the GSDL

Directory of Open Access Journals (Sweden)

Otakar Pinkas

2014-10-01

Full Text Available Automatic detection of encoding and language of the text is part of the Greenstone Digital Library Software (GSDL for building and distributing digital collections. It is developed by the University of Waikato (New Zealand in cooperation with UNESCO. The automatic encoding and language detection in Slavic languages is difficult and it sometimes fails. The aim is to detect cases of failure. The automatic detection in the GSDL is based on n-grams method. The most frequent n-grams for Czech are presented. The whole process of automatic detection in the GSDL is described. The input documents to test collections are plain texts encoded in ISO-8859-1, ISO-8859-2 and Windows-1250. We manually evaluated the quality of automatic detection. To the causes of errors belong the improper language model predominance and the incorrect switch to Windows-1250. We carried out further tests on documents that were more complex.

Research and realization of ten-print data quality control techniques for imperial scale automated fingerprint identification system

Directory of Open Access Journals (Sweden)

Qian Wang

2017-01-01

Full Text Available As the first individualization-information processing equipment put into practical service worldwide, Automated Fingerprint Identification System (AFIS has always been regarded as the first choice in individualization of criminal suspects or those who died in mass disasters. By integrating data within the existing regional large-scale AFIS database, many countries are constructing an ultra large state-of-the-art AFIS (or Imperial Scale AFIS system. Therefore, it is very important to develop a series of ten-print data quality controlling process for this system of this type, which would insure a substantial matching efficiency, as the pouring data come into this imperial scale being. As the image quality of ten-print data is closely relevant to AFIS matching proficiency, a lot of police departments have allocated huge amount of human and financial resources over this issue by carrying out manual verification works for years. Unfortunately, quality control method above is always proved to be inadequate because it is an astronomical task involved, in which it has always been problematic and less affiant for potential errors. Hence, we will implement quality control in the above procedure with supplementary-acquisition effect caused by the delay of feedback instructions sent from the human verification teams. In this article, a series of fingerprint image quality supervising techniques has been put forward, which makes it possible for computer programs to supervise the ten-print image quality in real-time and more accurate manner as substitute for traditional manual verifications. Besides its prominent advantages in the human and financial expenditures, it has also been proved to obviously improve the image quality of the AFIS ten-print database, which leads up to a dramatic improvement in the AFIS-matching accuracy as well.

Encoding information using laguerre gaussian modes

CSIR Research Space (South Africa)

Trichili, A

2015-08-01

Full Text Available The authors experimentally demonstrate an information encoding protocol using the two degrees of freedom of Laguerre Gaussian modes having different radial and azimuthal components. A novel method, based on digital holography, for information...

Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

Science.gov (United States)

Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James

2015-01-01

Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

Extraordinarily adaptive properties of the genetically encoded amino acids.

Science.gov (United States)

Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H James

2015-03-24

Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or "chemistry space." Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

Parametric fMRI analysis of visual encoding in the human medial temporal lobe.

Science.gov (United States)

Rombouts, S A; Scheltens, P; Machielson, W C; Barkhof, F; Hoogenraad, F G; Veltman, D J; Valk, J; Witter, M P

1999-01-01

A number of functional brain imaging studies indicate that the medial temporal lobe system is crucially involved in encoding new information into memory. However, most studies were based on differences in brain activity between encoding of familiar vs. novel stimuli. To further study the underlying cognitive processes, we applied a parametric design of encoding. Seven healthy subjects were instructed to encode complex color pictures into memory. Stimuli were presented in a parametric fashion at different rates, thus representing different loads of encoding. Functional magnetic resonance imaging (fMRI) was used to assess changes in brain activation. To determine the number of pictures successfully stored into memory, recognition scores were determined afterwards. During encoding, brain activation occurred in the medial temporal lobe, comparable to the results obtained by others. Increasing the encoding load resulted in an increase in the number of successfully stored items. This was reflected in a significant increase in brain activation in the left lingual gyrus, in the left and right parahippocampal gyrus, and in the right inferior frontal gyrus. This study shows that fMRI can detect changes in brain activation during variation of one aspect of higher cognitive tasks. Further, it strongly supports the notion that the human medial temporal lobe is involved in encoding novel visual information into memory.

Key management of the double random-phase-encoding method using public-key encryption

Science.gov (United States)

Saini, Nirmala; Sinha, Aloka

2010-03-01

Public-key encryption has been used to encode the key of the encryption process. In the proposed technique, an input image has been encrypted by using the double random-phase-encoding method using extended fractional Fourier transform. The key of the encryption process have been encoded by using the Rivest-Shamir-Adelman (RSA) public-key encryption algorithm. The encoded key has then been transmitted to the receiver side along with the encrypted image. In the decryption process, first the encoded key has been decrypted using the secret key and then the encrypted image has been decrypted by using the retrieved key parameters. The proposed technique has advantage over double random-phase-encoding method because the problem associated with the transmission of the key has been eliminated by using public-key encryption. Computer simulation has been carried out to validate the proposed technique.

Toward a Better Compression for DNA Sequences Using Huffman Encoding.

Science.gov (United States)

Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

2017-04-01

Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

Task-selective memory effects for successfully implemented encoding strategies.

Directory of Open Access Journals (Sweden)

Eric D Leshikar

Full Text Available Previous behavioral evidence suggests that instructed strategy use benefits associative memory formation in paired associate tasks. Two such effective encoding strategies--visual imagery and sentence generation--facilitate memory through the production of different types of mediators (e.g., mental images and sentences. Neuroimaging evidence suggests that regions of the brain support memory reflecting the mental operations engaged at the time of study. That work, however, has not taken into account self-reported encoding task success (i.e., whether participants successfully generated a mediator. It is unknown, therefore, whether task-selective memory effects specific to each strategy might be found when encoding strategies are successfully implemented. In this experiment, participants studied pairs of abstract nouns under either visual imagery or sentence generation encoding instructions. At the time of study, participants reported their success at generating a mediator. Outside of the scanner, participants further reported the quality of the generated mediator (e.g., images, sentences for each word pair. We observed task-selective memory effects for visual imagery in the left middle occipital gyrus, the left precuneus, and the lingual gyrus. No such task-selective effects were observed for sentence generation. Intriguingly, activity at the time of study in the left precuneus was modulated by the self-reported quality (vividness of the generated mental images with greater activity for trials given higher ratings of quality. These data suggest that regions of the brain support memory in accord with the encoding operations engaged at the time of study.

42 CFR 414.232 - Special payment rules for transcutaneous electrical nerve stimulators (TENS).

Science.gov (United States)

2010-10-01

... nerve stimulators (TENS). 414.232 Section 414.232 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES... Special payment rules for transcutaneous electrical nerve stimulators (TENS). (a) General payment rule. Except as provided in paragraph (b) of this section, payment for TENS is made on a purchase basis with...

AN ENCODING METHOD FOR COMPRESSING GEOGRAPHICAL COORDINATES IN 3D SPACE

Directory of Open Access Journals (Sweden)

C. Qian

2017-09-01

Full Text Available This paper proposed an encoding method for compressing geographical coordinates in 3D space. By the way of reducing the length of geographical coordinates, it helps to lessen the storage size of geometry information. In addition, the encoding algorithm subdivides the whole space according to octree rules, which enables progressive transmission and loading. Three main steps are included in this method: (1 subdividing the whole 3D geographic space based on octree structure, (2 resampling all the vertices in 3D models, (3 encoding the coordinates of vertices with a combination of Cube Index Code (CIC and Geometry Code. A series of geographical 3D models were applied to evaluate the encoding method. The results showed that this method reduced the storage size of most test data by 90 % or even more under the condition of a speed of encoding and decoding. In conclusion, this method achieved a remarkable compression rate in vertex bit size with a steerable precision loss. It shall be of positive meaning to the web 3d map storing and transmission.

Low-complexity video encoding method for wireless image transmission in capsule endoscope.

Science.gov (United States)

Takizawa, Kenichi; Hamaguchi, Kiyoshi

2010-01-01

This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

Decreased antibody formation in mice exposed to lead

Energy Technology Data Exchange (ETDEWEB)

Koller, L D; Kovacic, S

1974-07-12

Swiss Webster mice were given 1375, 137.5, or 13.75 ppM lead acetate in deionized water for 56 days. The control group was given deionized water orally. There were 120 mice in each group. The diet fed to all the mice was contaminated with 1.12 ppM lead. After 56 days, all mice were inoculated intraperitoneally with 0.2 ml of a 2% suspension of sheep red blood cells. Ten mice in each group were killed on days 3 to 7 to measure primary immune response (19S or IgM antibody) and on days 9 to 14 for the secondary response (7S or IgG antibody) after a second inoculation of sheep red blood cells while they remained on 137.5 ppM lead. The number of plaque forming cells was measured in the spleen. Erythrocytes were observed for basophilic stippling, packed cell volume was measured, serum was collected for hemolysin titration, and kidneys were examined for lead. Chronic exposure to lead produced a significant decrease in antibody synthesis, particularly IgG, indicating that the memory cell was involved. The results also indicated that the reduced antibody synthesis was responsible for the increased mortality from bacterial and viral diseases in animals that were chronically exposed to lead. Other environmental contaminants such as polychlorinated biphenyls, cadmium, mercury, DDT, and sulfur dioxide have also resulted in reduction of circulating antibodies in animals, in other experiments.

Similar patterns of neural activity predict memory function during encoding and retrieval.

Science.gov (United States)

Kragel, James E; Ezzyat, Youssef; Sperling, Michael R; Gorniak, Richard; Worrell, Gregory A; Berry, Brent M; Inman, Cory; Lin, Jui-Jui; Davis, Kathryn A; Das, Sandhitsu R; Stein, Joel M; Jobst, Barbara C; Zaghloul, Kareem A; Sheth, Sameer A; Rizzuto, Daniel S; Kahana, Michael J

2017-07-15

Neural networks that span the medial temporal lobe (MTL), prefrontal cortex, and posterior cortical regions are essential to episodic memory function in humans. Encoding and retrieval are supported by the engagement of both distinct neural pathways across the cortex and common structures within the medial temporal lobes. However, the degree to which memory performance can be determined by neural processing that is common to encoding and retrieval remains to be determined. To identify neural signatures of successful memory function, we administered a delayed free-recall task to 187 neurosurgical patients implanted with subdural or intraparenchymal depth electrodes. We developed multivariate classifiers to identify patterns of spectral power across the brain that independently predicted successful episodic encoding and retrieval. During encoding and retrieval, patterns of increased high frequency activity in prefrontal, MTL, and inferior parietal cortices, accompanied by widespread decreases in low frequency power across the brain predicted successful memory function. Using a cross-decoding approach, we demonstrate the ability to predict memory function across distinct phases of the free-recall task. Furthermore, we demonstrate that classifiers that combine information from both encoding and retrieval states can outperform task-independent models. These findings suggest that the engagement of a core memory network during either encoding or retrieval shapes the ability to remember the past, despite distinct neural interactions that facilitate encoding and retrieval. Copyright © 2017 Elsevier Inc. All rights reserved.

Semantic Congruence Accelerates the Onset of the Neural Signals of Successful Memory Encoding.

Science.gov (United States)

Packard, Pau A; Rodríguez-Fornells, Antoni; Bunzeck, Nico; Nicolás, Berta; de Diego-Balaguer, Ruth; Fuentemilla, Lluís

2017-01-11

As the stream of experience unfolds, our memory system rapidly transforms current inputs into long-lasting meaningful memories. A putative neural mechanism that strongly influences how input elements are transformed into meaningful memory codes relies on the ability to integrate them with existing structures of knowledge or schemas. However, it is not yet clear whether schema-related integration neural mechanisms occur during online encoding. In the current investigation, we examined the encoding-dependent nature of this phenomenon in humans. We showed that actively integrating words with congruent semantic information provided by a category cue enhances memory for words and increases false recall. The memory effect of such active integration with congruent information was robust, even with an interference task occurring right after each encoding word list. In addition, via electroencephalography, we show in 2 separate studies that the onset of the neural signals of successful encoding appeared early (∼400 ms) during the encoding of congruent words. That the neural signals of successful encoding of congruent and incongruent information followed similarly ∼200 ms later suggests that this earlier neural response contributed to memory formation. We propose that the encoding of events that are congruent with readily available contextual semantics can trigger an accelerated onset of the neural mechanisms, supporting the integration of semantic information with the event input. This faster onset would result in a long-lasting and meaningful memory trace for the event but, at the same time, make it difficult to distinguish it from plausible but never encoded events (i.e., related false memories). Conceptual or schema congruence has a strong influence on long-term memory. However, the question of whether schema-related integration neural mechanisms occur during online encoding has yet to be clarified. We investigated the neural mechanisms reflecting how the active

Emission properties of Sm(III) complex having ten-coordination structure

International Nuclear Information System (INIS)

Hasegawa, Yasuchika; Tsuruoka, Shin-ichi; Yoshida, Takahiko; Kawai, Hideki; Kawai, Tsuyoshi

2008-01-01

Sammarium(III) complex having ten-coordination structure, bis-(1,10-phenanthroline)tris-(hexafluoroacetylacetonato)samarium(III) (Sm(hfa) 3 (phen) 2 ) was prepared by chelation of tris-(hexafluoroacetylacetonato) samarium(III) (Sm(hfa) 3 (H 2 O) 2 ) with 1,10-phenantroline (phen). The characteristic ten-coordination structure of Sm(hfa) 3 (phen) 2 was determined by 1 H NMR and elemental analyses. Strong deep-red emission (λ max =643 nm) and narrow emission band (FWHM=5 nm) of Sm(hfa) 3 (phen) 2 originated from electronic allowed transition from characteristics ten coordinate structure. The emission quantum yields Sm(hfa) 3 (phen) 2 excited at absorption bands of ligands and Sm(III) ion were found to be 0.36 and 1.4%, respectively

Asymmetric synthesis using chiral-encoded metal

Science.gov (United States)

Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander

2016-08-01

The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity.

Physical exercise during encoding improves vocabulary learning in young female adults: a neuroendocrinological study.

Science.gov (United States)

Schmidt-Kassow, Maren; Deusser, Marie; Thiel, Christian; Otterbein, Sascha; Montag, Christian; Reuter, Martin; Banzer, Winfried; Kaiser, Jochen

2013-01-01

Acute physical activity has been repeatedly shown to improve various cognitive functions. However, there have been no investigations comparing the effects of exercise during verbal encoding versus exercise prior to encoding on long-term memory performance. In this current psychoneuroendocrinological study we aim to test whether light to moderate ergometric bicycling during vocabulary encoding enhances subsequent recall compared to encoding during physical rest and encoding after being physically active. Furthermore, we examined the kinetics of brain-derived neurotrophic factor (BDNF) in serum which has been previously shown to correlate with learning performance. We also controlled for the BDNF val66met polymorphism. We found better vocabulary test performance for subjects that were physically active during the encoding phase compared to sedentary subjects. Post-hoc tests revealed that this effect was particularly present in initially low performers. BDNF in serum and BDNF genotype failed to account for the current result. Our data indicates that light to moderate simultaneous physical activity during encoding, but not prior to encoding, is beneficial for subsequent recall of new items.

Low-dose Propofol–induced Amnesia Is Not due to a Failure of Encoding

OpenAIRE

Veselis, Robert A.; Pryor, Kane O.; Reinsel, Ruth A.; Mehta, Meghana; Pan, Hong; Johnson, Ray

2008-01-01

Background—Propofol may produce amnesia by affecting encoding. The hypothesis that propofol weakens encoding was tested by measuring regional cerebral blood flow during verbal encoding. Methods—17 volunteer participants (12 M, 30.4±6.5 years old) had regional cerebral blood flow measured using H2O15 positron emission tomography during complex and simple encoding tasks (deep vs. shallow level of processing), to identify a region of interest in the left inferior prefrontal cortex...

[Analysis of body mass index in different sector workers for over ten years].

Science.gov (United States)

Perbellini, L; Zonzin, C; Baldo, M

2010-01-01

A critical review of the literature on obesity and overweight underlines that a low educational level, a low social-economic status, certain working conditions, the lack of physical activity in leisure time, together with the availability of food, are the main factors favouring increased prevalence of obesity. Certain jobs also contribute significantly to this problem. Automation, the use of machines for heavy works and sedentary activities favour body weight increase. Jobs that are a source of stress, such as work with night shift can cause metabolic disorders leading to an increased prevalence of obesity. The main aim of this article is to study the trend of body weight in different working area during ten years, comparing this parameter to different factors such as job, blood pressure, smoke, alcool and health diseases.

Ten per cent more grain

Energy Technology Data Exchange (ETDEWEB)

NONE

1967-08-15

At a low estimate, ten per cent of stored grain is lost every year to insect pests. In this article, based on a lecture given earlier this year in Switzerland, Dr. Harry E. Goresline, Food Radiation Specialist of the Food and Agriculture Organisation, now assisting the Joint FAO/IAEA Division of Atomic Energy in Food and Agriculture, explains how use of radiation can help to prevent losses and the research which has taken place to ensure its safety

Effects of lead accumulation on the Azolla caroliniana-Anabaena association.

Science.gov (United States)

Roberts, Anne E; Boylen, Charles W; Nierzwicki-Bauer, Sandra A

2014-04-01

The effect of lead accumulation on photopigment production, mineral nutrition, and Anabaena vegetative cell size and heterocyst formation in Azolla caroliniana was investigated. Plants were exposed to 0, 1, 5, 10, and 20 mg L(-1) lead acetate for ten days. Lead accumulation increased when plants were treated with higher lead concentrations. Results revealed a statistically significant decline in total chlorophyll, chlorophyll a, chlorophyll b, and carotenoids in 5, 10, and 20 mg Pb L(-1) treatment groups as compared to plants with 0 or 1 mg Pb L(-1) treatments. No statistically significant change in anthocyanin production was observed. Calcium, magnesium, and zinc concentrations in plants decreased in increasing treatment groups, whereas sodium and potassium concentrations increased. Nitrogen and carbon were also found to decrease in plant tissue. Anabaena vegetative cells decreased in size and heterocyst frequency declined rapidly in a Pb dose-dependent manner. These results indicate that, while A. caroliniana removes lead from aqueous solution, the heavy metal causes physiological and biochemical changes by impairing photosynthesis, changing mineral nutrition, and impeding the growth and formation of heterocysts of the symbiotic cyanobacteria that live within leaf cavities of the fronds. Copyright © 2014. Published by Elsevier Inc.

Imaging of Intracellular pH in Tumor Spheroids Using Genetically Encoded Sensor SypHer2.

Science.gov (United States)

Zagaynova, Elena V; Druzhkova, Irina N; Mishina, Natalia M; Ignatova, Nadezhda I; Dudenkova, Varvara V; Shirmanova, Marina V

2017-01-01

Intracellular pH (pHi) is one of the most important parameters that regulate the physiological state of cells and tissues. pHi homeostasis is crucial for normal cell functioning. Cancer cells are characterized by having a higher (neutral to slightly alkaline) pHi and lower (acidic) extracellular pH (pHe) compared to normal cells. This is referred to as a "reversed" pH gradient, and is essential in supporting their accelerated growth rate, invasion and migration, and in suppressing anti-tumor immunity, the promotion of metabolic coupling with fibroblasts and in preventing apoptosis. Moreover, abnormal pH, both pHi and pHe, contribute to drug resistance in cancers. Therefore, the development of methods for measuring pH in living tumor cells is likely to lead to better understanding of tumor biology and to open new ways for cancer treatment. Genetically encoded, fluorescent, pH-sensitive probes represent promising instruments enabling the subcellular measurement of pHi with unrivaled specificity and high accuracy. Here, we describe a protocol for pHi imaging at a microscopic level in HeLa tumor spheroids, using the genetically encoded ratiometric (dual-excitation) pHi indicator, SypHer2.

Intelligent lead: a novel HRI sensor for guide robots.

Science.gov (United States)

Cho, Keum-Bae; Lee, Beom-Hee

2012-01-01

This paper addresses the introduction of a new Human Robot Interaction (HRI) sensor for guide robots. Guide robots for geriatric patients or the visually impaired should follow user's control command, keeping a certain desired distance allowing the user to work freely. Therefore, it is necessary to acquire control commands and a user's position on a real-time basis. We suggest a new sensor fusion system to achieve this objective and we will call this sensor the "intelligent lead". The objective of the intelligent lead is to acquire a stable distance from the user to the robot, speed-control volume and turn-control volume, even when the robot platform with the intelligent lead is shaken on uneven ground. In this paper we explain a precise Extended Kalman Filter (EKF) procedure for this. The intelligent lead physically consists of a Kinect sensor, the serial linkage attached with eight rotary encoders, and an IMU (Inertial Measurement Unit) and their measurements are fused by the EKF. A mobile robot was designed to test the performance of the proposed sensor system. After installing the intelligent lead in the mobile robot, several tests are conducted to verify that the mobile robot with the intelligent lead is capable of achieving its goal points while maintaining the appropriate distance between the robot and the user. The results show that we can use the intelligent lead proposed in this paper as a new HRI sensor joined a joystick and a distance measure in the mobile environments such as the robot and the user are moving at the same time.

An overview of the neuro-cognitive processes involved in the encoding, consolidation, and retrieval of true and false memories.

Science.gov (United States)

Straube, Benjamin

2012-07-24

Perception and memory are imperfect reconstructions of reality. These reconstructions are prone to be influenced by several factors, which may result in false memories. A false memory is the recollection of an event, or details of an episode, that did not actually occur. Memory formation comprises at least three different sub-processes: encoding, consolidation and the retrieval of the learned material. All of these sub-processes are vulnerable for specific errors and consequently may result in false memories. Whereas, processes like imagery, self-referential encoding or spreading activation can lead to the formation of false memories at encoding, semantic generalization during sleep and updating processes due to misleading post event information, in particular, are relevant at the consolidation stage. Finally at the retrieval stage, monitoring processes, which are assumed to be essential to reject false memories, are of specific importance. Different neuro-cognitive processes have been linked to the formation of true and false memories. Most consistently the medial temporal lobe and the medial and lateral prefrontal cortex have been reported with regard to the formation of true and false memories. Despite the fact that all phases entailing memory formation, consolidation of stored information and retrieval processes, are relevant for the forming of false memories, most studies focused on either memory encoding or retrieval. Thus, future studies should try to integrate data from all phases to give a more comprehensive view on systematic memory distortions. An initial outline is developed within this review to connect the different memory stages and research strategies.

An overview of the neuro-cognitive processes involved in the encoding, consolidation, and retrieval of true and false memories

Science.gov (United States)

2012-01-01

Perception and memory are imperfect reconstructions of reality. These reconstructions are prone to be influenced by several factors, which may result in false memories. A false memory is the recollection of an event, or details of an episode, that did not actually occur. Memory formation comprises at least three different sub-processes: encoding, consolidation and the retrieval of the learned material. All of these sub-processes are vulnerable for specific errors and consequently may result in false memories. Whereas, processes like imagery, self-referential encoding or spreading activation can lead to the formation of false memories at encoding, semantic generalization during sleep and updating processes due to misleading post event information, in particular, are relevant at the consolidation stage. Finally at the retrieval stage, monitoring processes, which are assumed to be essential to reject false memories, are of specific importance. Different neuro-cognitive processes have been linked to the formation of true and false memories. Most consistently the medial temporal lobe and the medial and lateral prefrontal cortex have been reported with regard to the formation of true and false memories. Despite the fact that all phases entailing memory formation, consolidation of stored information and retrieval processes, are relevant for the forming of false memories, most studies focused on either memory encoding or retrieval. Thus, future studies should try to integrate data from all phases to give a more comprehensive view on systematic memory distortions. An initial outline is developed within this review to connect the different memory stages and research strategies. PMID:22827854

Transcutaneous Electrical Nerve Stimulation (TENS) reduces pain, fatigue, and hyperalgesia while restoring central inhibition in primary fibromyalgia

Science.gov (United States)

Dailey, Dana L; Rakel, Barbara A; Vance, Carol GT; Liebano, Richard E; Anand, Amrit S; Bush, Heather M; Lee, Kyoung S; Lee, Jennifer E; Sluka, Kathleen A

2014-01-01

Because TENS works by reducing central excitability and activating central inhibition pathways, we tested the hypothesis that TENS would reduce pain and fatigue and improve function and hyperalgesia in people with fibromyalgia who have enhanced central excitability and reduced inhibition. The current study used a double-blinded randomized, placebo controlled cross-over design to test effects of a single treatment of TENS in people with fibromyalgia. Three treatments were assessed in random order: active TENS, placebo TENS, no TENS. The following measures were assessed before and after each TENS treatment: pain and fatigue at rest and movement, pressure pain thresholds (PPTs), 6 minute walk test (6MWT), range of motion (ROM), five time sit to stand test (FTSTS), and single leg stance (SLS). Conditioned pain modulation (CPM) was completed at end of testing. There was a significant decrease in pain and fatigue with movement for active TENS compared to placebo and no TENS. PPTs increased at site of TENS (spine) and outside site of TENS (leg) when compared to placebo TENS or no TENS. During Active TENS CPM was significantly stronger compared to placebo TENS and no TENS. No changes in functional tasks were observed with TENS. Thus, the current study suggests TENS has short-term efficacy in relieving symptoms of fibromyalgia while the stimulator is active. Future clinical trials should examine the effects of repeated daily delivery of TENS, similar to how TENS is used clinically, on pain, fatigue, function and quality of life in individuals with fibromyalgia. PMID:23900134

Ten key issues in modern flow chemistry.

Science.gov (United States)

Wegner, Jens; Ceylan, Sascha; Kirschning, Andreas

2011-04-28

Ten essentials of synthesis in the flow mode, a new enabling technology in organic chemistry, are highlighted as flashlighted providing an insight into current and future issues and developments in this field. © The Royal Society of Chemistry 2011

Age Group Comparisons of TENS Response Among Individuals With Chronic Axial Low Back Pain.

Science.gov (United States)

Simon, Corey B; Riley, Joseph L; Fillingim, Roger B; Bishop, Mark D; George, Steven Z

2015-12-01

Chronic low back pain (CLBP) is a highly prevalent and disabling musculoskeletal pain condition among older adults. Transcutaneous electrical nerve stimulation (TENS) is commonly used to treat CLBP, however response to TENS in older adults compared with younger adults is untested. In a dose-response study stratified by age, 60 participants with axial CLBP (20 young, 20 middle-aged, 20 older) received four 20-minute sessions of high-frequency high-intensity TENS over a 2- to 3-week period in a laboratory-controlled setting. Experimental measures of pain sensitivity (mechanical pressure pain detection threshold) and central pain excitability (phasic heat temporal summation and heat aftersensations) were assessed before and after TENS. Episodic or immediate axial CLBP relief was assessed after TENS via measures of resting pain, movement-evoked-pain, and self-reported disability. Cumulative or prolonged axial CLBP relief was assessed by comparing daily pain reports across sessions. Independent of age, individuals experienced episodic increase in the pressure pain detection threshold and reduction in aftersensation after TENS application. Similarly, all groups, on average, experienced episodic axial CLBP relief via improved resting pain, movement-evoked pain, and disability report. Under this design, no cumulative effect was observed as daily pain did not improve for any age group across the 4 sessions. However, older adults received higher TENS amplitude across all sessions to achieve TENS responses similar to those in younger adults. These findings suggest that older adults experience similar episodic axial CLBP relief to that of younger individuals after high-frequency, high-intensity TENS when higher dose parameters are used. This study examined age group differences in experimental and axial CLBP response to TENS, delivered under the current recommended parameters of strong, but tolerable amplitude. Older adults had comparable TENS response although at higher TENS

The Contribution of Encoding and Retrieval Processes to Proactive Interference

Science.gov (United States)

Kliegl, Oliver; Pastötter, Bernhard; Bäuml, Karl-Heinz T.

2015-01-01

Proactive interference (PI) refers to the finding that memory for recently studied (target) material can be impaired by the prior study of other (nontarget) material. Previous accounts of PI differed in whether they attributed PI to impaired retrieval or impaired encoding. Here, we suggest an integrated encoding-retrieval account, which assigns a…

Fuzzy Nonnative Phonolexical Representations Lead to Fuzzy Form-to-Meaning Mappings

Directory of Open Access Journals (Sweden)

Svetlana V Cook

2016-09-01

Full Text Available The present paper explores nonnative (L2 phonological encoding of lexical entries and dissociates the difficulties associated with L2 phonological and phonolexical encoding by focusing on similarly sounding L2 words that are not differentiated by difficult phonological contrasts. We test two main claims of the fuzzy lexicon hypothesis: (1 L2 fuzzy phonolexical representations are not fully specified and lack details at both phonological and phonolexical levels of representation (Experiment 1; and (2 fuzzy phonolexical representations can lead to establishing incorrect form-to-meaning mappings (Experiment 2.The Russian-English Translation Priming task (Experiment 1, TJT explores how the degree of phonolexical similarity between a word and its lexical competitor affects lexical access of Russian words. Words with smaller phonolexical distance (e.g., parent - parrot show longer reaction times and lower accuracy compared to words with a larger phonolexical distance (e.g., parent – parchment in lower-proficiency nonnative speakers, and, to a lesser degree, higher-proficiency speakers. This points to a lack of detail in nonnative phonolexical representations necessary for efficient lexical access. The Russian Pseudo-Semantic Priming task (Experiment 2, PSP addresses the vulnerability of form-to-meaning mappings as a consequence of fuzzy phonolexical representations in L2. We primed the target with a word semantically related to its phonological competitor, or a potentially confusable word. The findings of Experiment 2 extend the results of Experiment 1 that, unlike native speakers, nonnative speakers do not properly encode phonolexical information. As a result, they are prone to access an incorrect lexical representation of a competitor word, as indicated by a slowdown in the judgments to confusable words.The study provides evidence that fuzzy phonolexical representations result in unfaithful form-to-meaning mappings, which lead to retrieval of

Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

Science.gov (United States)

Han, Gil-Soo; Carman, George M

2017-08-11

The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Encoding color information for visual tracking: Algorithms and benchmark.

Science.gov (United States)

Liang, Pengpeng; Blasch, Erik; Ling, Haibin

2015-12-01

While color information is known to provide rich discriminative clues for visual inference, most modern visual trackers limit themselves to the grayscale realm. Despite recent efforts to integrate color in tracking, there is a lack of comprehensive understanding of the role color information can play. In this paper, we attack this problem by conducting a systematic study from both the algorithm and benchmark perspectives. On the algorithm side, we comprehensively encode 10 chromatic models into 16 carefully selected state-of-the-art visual trackers. On the benchmark side, we compile a large set of 128 color sequences with ground truth and challenge factor annotations (e.g., occlusion). A thorough evaluation is conducted by running all the color-encoded trackers, together with two recently proposed color trackers. A further validation is conducted on an RGBD tracking benchmark. The results clearly show the benefit of encoding color information for tracking. We also perform detailed analysis on several issues, including the behavior of various combinations between color model and visual tracker, the degree of difficulty of each sequence for tracking, and how different challenge factors affect the tracking performance. We expect the study to provide the guidance, motivation, and benchmark for future work on encoding color in visual tracking.

14q32-encoded microRNAs mediate an oligometastatic phenotype.

Science.gov (United States)

Uppal, Abhineet; Wightman, Sean C; Mallon, Stephen; Oshima, Go; Pitroda, Sean P; Zhang, Qingbei; Huang, Xiaona; Darga, Thomas E; Huang, Lei; Andrade, Jorge; Liu, Huiping; Ferguson, Mark K; Greene, Geoffrey L; Posner, Mitchell C; Hellman, Samuel; Khodarev, Nikolai N; Weichselbaum, Ralph R

2015-02-28

Oligometastasis is a clinically distinct subset of metastasis characterized by a limited number of metastases potentially curable with localized therapies. We analyzed pathways targeted by microRNAs over-expressed in clinical oligometastasis samples and identified suppression of cellular adhesion, invasion, and motility pathways in association with the oligometastatic phenotype. We identified miR-127-5p, miR-544a, and miR-655-3p encoded in the 14q32 microRNA cluster as co-regulators of multiple metastatic pathways through repression of shared target genes. These microRNAs suppressed cellular adhesion and invasion and inhibited metastasis development in an animal model of breast cancer lung colonization. Target genes, including TGFBR2 and ROCK2, were key mediators of these effects. Understanding the role of microRNAs expressed in oligometastases may lead to improved identification of and interventions for patients with curable metastatic disease, as well as an improved understanding of the molecular basis of this unique clinical entity.

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

How green are the TEN-T core network corridors?

DEFF Research Database (Denmark)

Panagakos, George; Psaraftis, Harilaos N.

defining this concept, identified the characteristics that distinguish a green corridor from an otherwise efficient one. The main thesis of this paper is that the „core network corridors‟ of the new TEN-T guidelines exhibit all these qualities and the vision of a green corridor network in Europe is close...... to reality. To support this thesis, and in continuation of the work of SuperGreen, the paper examines the proposed new „guidelines‟ for the development of the TEN-T after presenting a brief history of transport network development in Europe....

ENCODE: A Sourcebook of Epigenomes and Chromatin Language

Directory of Open Access Journals (Sweden)

Maryam Yavartanoo

2013-03-01

Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

DNA-Encoded Dynamic Combinatorial Chemical Libraries.

Science.gov (United States)

Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

2015-06-26

Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Czech, Slovak science ten years after split

CERN Multimedia

2003-01-01

Ten years after the split of Czechoslovakia Czech and Slovak science are facing the same difficulties: shortage of money for research, poor salaries, obsolete equipment and brain drain, especially of the young, according to a feature in the Daily Lidove Noviny (1 page).

Flexibility in faculty work-life policies at medical schools in the Big Ten conference.

Science.gov (United States)

Welch, Julie L; Wiehe, Sarah E; Palmer-Smith, Victoria; Dankoski, Mary E

2011-05-01

Women lag behind men in several key academic indicators, such as advancement, retention, and securing leadership positions. Although reasons for these disparities are multifactorial, policies that do not support work-life integration contribute to the problem. The objective of this descriptive study was to compare the faculty work-life policies among medical schools in the Big Ten conference. Each institution's website was accessed in order to assess its work-life policies in the following areas: maternity leave, paternity leave, adoption leave, extension of probationary period, part-time appointments, part-time benefits (specifically health insurance), child care options, and lactation policy. Institutions were sent requests to validate the online data and supply additional information if needed. Each institution received an overall score and subscale scores for family leave policies and part-time issues. Data were verified by the human resources office at 8 of the 10 schools. Work-life policies varied among Big Ten schools, with total scores between 9.25 and 13.5 (possible score: 0-21; higher scores indicate greater flexibility). Subscores were not consistently high or low within schools. Comparing the flexibility of faculty work-life policies in relation to other schools will help raise awareness of these issues and promote more progressive policies among less progressive schools. Ultimately, flexible policies will lead to greater equity and institutional cultures that are conducive to recruiting, retaining, and advancing diverse faculty.

Encoding of QC-LDPC Codes of Rank Deficient Parity Matrix

Directory of Open Access Journals (Sweden)

Mohammed Kasim Mohammed Al-Haddad

2016-05-01

Full Text Available the encoding of long low density parity check (LDPC codes presents a challenge compared to its decoding. The Quasi Cyclic (QC LDPC codes offer the advantage for reducing the complexity for both encoding and decoding due to its QC structure. Most QC-LDPC codes have rank deficient parity matrix and this introduces extra complexity over the codes with full rank parity matrix. In this paper an encoding scheme of QC-LDPC codes is presented that is suitable for codes with full rank parity matrix and rank deficient parity matrx. The extra effort required by the codes with rank deficient parity matrix over the codes of full rank parity matrix is investigated.

The first does the work, but the third time's the charm: the effects of massed repetition on episodic encoding of multimodal face-name associations.

Science.gov (United States)

Mangels, Jennifer A; Manzi, Alberto; Summerfield, Christopher

2010-03-01

In social interactions, it is often necessary to rapidly encode the association between visually presented faces and auditorily presented names. The present study used event-related potentials to examine the neural correlates of associative encoding for multimodal face-name pairs. We assessed study-phase processes leading to high-confidence recognition of correct pairs (and consistent rejection of recombined foils) as compared to lower-confidence recognition of correct pairs (with inconsistent rejection of recombined foils) and recognition failures (misses). Both high- and low-confidence retrieval of face-name pairs were associated with study-phase activity suggestive of item-specific processing of the face (posterior inferior temporal negativity) and name (fronto-central negativity). However, only those pairs later retrieved with high confidence recruited a sustained centro-parietal positivity that an ancillary localizer task suggested may index an association-unique process. Additionally, we examined how these processes were influenced by massed repetition, a mnemonic strategy commonly employed in everyday situations to improve face-name memory. Differences in subsequent memory effects across repetitions suggested that associative encoding was strongest at the initial presentation, and thus, that the initial presentation has the greatest impact on memory formation. Yet, exploratory analyses suggested that the third presentation may have benefited later memory by providing an opportunity for extended processing of the name. Thus, although encoding of the initial presentation was critical for establishing a strong association, the extent to which processing was sustained across subsequent immediate (massed) presentations may provide additional encoding support that serves to differentiate face-name pairs from similar (recombined) pairs by providing additional encoding opportunities for the less dominant stimulus dimension (i.e., name).

Simultaneous determination of ten compounds in two main ...

African Journals Online (AJOL)

Simultaneous determination of ten compounds in two main medicinal plant parts of Tibetan herb, Pterocephalus hookeri (CB Clarke) Höeck, by ultra-high performance liquid chromatography-photodiode array.

The influence of encoding strategy on episodic memory and cortical activity in schizophrenia.

Science.gov (United States)

Bonner-Jackson, Aaron; Haut, Kristen; Csernansky, John G; Barch, Deanna M

2005-07-01

Recent work suggests that episodic memory deficits in schizophrenia may be related to disturbances of encoding or retrieval. Schizophrenia patients appear to benefit from instruction in episodic memory strategies. We tested the hypothesis that providing effective encoding strategies to schizophrenia patients enhances encoding-related brain activity and recognition performance. Seventeen schizophrenia patients and 26 healthy comparison subjects underwent functional magnetic resonance imaging scans while performing incidental encoding tasks of words and faces. Subjects were required to make either deep (abstract/concrete) or shallow (alphabetization) judgments for words and deep (gender) judgments for faces, followed by subsequent recognition tests. Schizophrenia and comparison subjects recognized significantly more words encoded deeply than shallowly, activated regions in inferior frontal cortex (Brodmann area 45/47) typically associated with deep and successful encoding of words, and showed greater left frontal activation for the processing of words compared with faces. However, during deep encoding and material-specific processing (words vs. faces), participants with schizophrenia activated regions not activated by control subjects, including several in prefrontal cortex. Our findings suggest that a deficit in use of effective strategies influences episodic memory performance in schizophrenia and that abnormalities in functional brain activation persist even when such strategies are applied.

The relationship between visual attention and visual working memory encoding: A dissociation between covert and overt orienting.

Science.gov (United States)

Tas, A Caglar; Luck, Steven J; Hollingworth, Andrew

2016-08-01

There is substantial debate over whether visual working memory (VWM) and visual attention constitute a single system for the selection of task-relevant perceptual information or whether they are distinct systems that can be dissociated when their representational demands diverge. In the present study, we focused on the relationship between visual attention and the encoding of objects into VWM. Participants performed a color change-detection task. During the retention interval, a secondary object, irrelevant to the memory task, was presented. Participants were instructed either to execute an overt shift of gaze to this object (Experiments 1-3) or to attend it covertly (Experiments 4 and 5). Our goal was to determine whether these overt and covert shifts of attention disrupted the information held in VWM. We hypothesized that saccades, which typically introduce a memorial demand to bridge perceptual disruption, would lead to automatic encoding of the secondary object. However, purely covert shifts of attention, which introduce no such demand, would not result in automatic memory encoding. The results supported these predictions. Saccades to the secondary object produced substantial interference with VWM performance, but covert shifts of attention to this object produced no interference with VWM performance. These results challenge prevailing theories that consider attention and VWM to reflect a common mechanism. In addition, they indicate that the relationship between attention and VWM is dependent on the memorial demands of the orienting behavior. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

The Relationship between Visual Attention and Visual Working Memory Encoding: A Dissociation between Covert and Overt Orienting

Science.gov (United States)

Tas, A. Caglar; Luck, Steven J.; Hollingworth, Andrew

2016-01-01

There is substantial debate over whether visual working memory (VWM) and visual attention constitute a single system for the selection of task-relevant perceptual information or whether they are distinct systems that can be dissociated when their representational demands diverge. In the present study, we focused on the relationship between visual attention and the encoding of objects into visual working memory (VWM). Participants performed a color change-detection task. During the retention interval, a secondary object, irrelevant to the memory task, was presented. Participants were instructed either to execute an overt shift of gaze to this object (Experiments 1–3) or to attend it covertly (Experiments 4 and 5). Our goal was to determine whether these overt and covert shifts of attention disrupted the information held in VWM. We hypothesized that saccades, which typically introduce a memorial demand to bridge perceptual disruption, would lead to automatic encoding of the secondary object. However, purely covert shifts of attention, which introduce no such demand, would not result in automatic memory encoding. The results supported these predictions. Saccades to the secondary object produced substantial interference with VWM performance, but covert shifts of attention to this object produced no interference with VWM performance. These results challenge prevailing theories that consider attention and VWM to reflect a common mechanism. In addition, they indicate that the relationship between attention and VWM is dependent on the memorial demands of the orienting behavior. PMID:26854532

Measurements of total lead concentrations and of lead isotope ratios in whole blood by use of inductively coupled plasma source mass spectrometry

International Nuclear Information System (INIS)

Delves, H.T.; Campbell, M.J.

1988-01-01

Methods are described for the accurate and precise determination of total lead and its isotopic composition in whole blood using inductively coupled plasma source mass spectrometry (ICP-MS). Sensitivities of up to 3 x 10 6 counts s -1 for 208 Pb at a total lead concentration of 5 μmol l -1 (1 μg ml -1 ) enabled total blood lead levels to be measured in 4 min per sample, with a detection limit of 0.072 μmol l -1 (15 μg l -1 ). The agreement between ICP-MS and atomic absorption spectrometry (AAS) for this analysis was excellent: ICP-MS 0.996 x AAS -0.0165 μmol l -1 ; r 0.994. Isotope ratio measurements required 15 min to achieve the required accuracy and precision both of which were generally better than 0.5% for 206 Pb: 207 Pb and 208 Pb: 206 Pb isotopic lead ratios. The ICP-MS data for these ratios in ten quality control blood specimens has a mean bias relative to isotope dilution mass spectrometry of -0.412% for 206 Pb: 207 Pb ratios and of +0.055% for the 208 Pb: 206 Pb ratios. This level of accuracy and that of the total blood lead measurements is sufficient to permit application of these ICP-MS methods to environmental studies. (author)

Encoding circuit for transform coding of a picture signal and decoding circuit for encoding said signal

NARCIS (Netherlands)

1991-01-01

Encoding circuit for transforming a picture signal into blocks of, for example, 8*8 coefficients, in which each block of coefficients is read motion-adaptively. In the case of motion within a sub-picture, the block of coefficients is read in such an order that the obtained series of coefficients

Development and Synthesis of DNA-Encoded Benzimidazole Library.

Science.gov (United States)

Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

2018-04-25

Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

Non-deterministic quantum CNOT gate with double encoding

Science.gov (United States)

Gueddana, Amor; Attia, Moez; Chatta, Rihab

2013-09-01

We define an Asymmetric Partially Polarizing Beam Splitter (APPBS) to be a linear optical component having different reflectivity (transmittance) coefficients, on the upper and the lower arms, for horizontally and vertically Polarized incident photons. Our CNOT model is composed by two APPBSs, one Half Wave Plate (HWP), two Polarizing Beam Splitters (PBSs), a Beam Splitter (BS) and a -phase rotator for specific wavelength. Control qubit operates with dual rail encoding while target qubit is based on polarization encoding. To perform CNOT operation in 4/27 of the cases, input and target incoming photons are injected with different wavelengths.

Top Ten Concerns for Trustees in 1988.

Science.gov (United States)

Meyerson, Joel W.

1988-01-01

Ten issues most likely to influence institutions this year include tuition policy and financing, capital renewal and replacement, charitable giving, scientific equipment and laboratories, endowment management and spending policy, research funding, corporate contributions, minority enrollment and hiring, debt financing and debt capacity, and cost…

Frictional amyloidosis in Oman - A study of ten cases

Directory of Open Access Journals (Sweden)

Mysore Venkataram

2002-01-01

Full Text Available Macular amyloidosis is an important cause for cutaneous pigmentation, the aetiology of which is poorly understood. Friction has recently been implicated the causation of early lesions, referred to as frictional amyloidosis. Confirmation of diagnosis by the detect on of amyloid using histochemical stains is inconsistent. Ten patients with pigmentation suggestive of macular amyloidosis were studied with detailed history, clinical examination, biopsy for histochemistry and electron microscopy. Nine out of ten patients had a history of prolonged friction with various objects such as bath sponges, brushes, towels, plant sticks and leaves. Amyloid was demonstrated by histochemical staining in only six out of ten cases. In the remaining four cases, amyloid was detected by electron microscopy. These consisted of aggregates of non-branching, extracellular, intertwining fibres measuring between 200-500 nm in length and between 20-25 nm in diameter. The study confirms the role of friction in the causation of this condition. Histochemical stains are not always successful in the detection of amyloid and electron microscopy is helpful for confirming its presence. The term frictional amyloidosis aptly describes the condition.

Nucleic acid compositions and the encoding proteins

Science.gov (United States)

Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

2014-09-02

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

Dose-specific effects of transcutaneous electrical nerve stimulation (TENS) on experimental pain: a systematic review.

Science.gov (United States)

Claydon, Leica S; Chesterton, Linda S; Barlas, Panos; Sim, Julius

2011-09-01

To determine the hypoalgesic effects of transcutaneous electrical nerve stimulation (TENS) parameter combinations on experimental models in healthy humans. Searches were performed using the electronic databases Ovid MEDLINE, CINAHL, AMED, and Web of Science (from inception to December 2009). Manual searches of journals and reference lists of retrieved trials were also performed. Randomized controlled trials (RCTs) were included in the review if they compared the hypoalgesic effect of TENS relative with placebo and control, using an experimental pain model in healthy human participants. Two reviewers independently selected the trials, assessed their methodologic quality and extracted data. Forty-three RCTs were eligible for inclusion. A best evidence synthesis revealed: Overall "conflicting" (inconsistent findings in multiple RCTs) evidence of TENS efficacy on experimental pain irrespective of TENS parameters used. Overall intense TENS has "moderate" evidence of efficacy (1 high-quality and 2 low-quality trials). Conventional TENS has overall conflicting evidence of efficacy, this is derived from "strong" evidence of efficacy (generally consistent findings in multiple high-quality RCTs) on pressure pain but strong evidence of inefficacy on other pain models. "Limited" evidence (positive findings from 1 RCT) of hypoalgesia exists for some novel parameters. Low-intensity, low-frequency, local TENS has strong evidence of inefficacy. Inappropriate TENS (using "barely perceptible" intensities) has moderate evidence of inefficacy. The level of hypoalgesic efficacy of TENS is clearly dependent on TENS parameter combination selection (defined in terms of intensity, frequency, and stimulation site) and experimental pain model. Future clinical RCTs may consider these TENS dose responses.

DS-OCDMA Encoder/Decoder Performance Analysis Using Optical Low-Coherence Reflectometry

Science.gov (United States)

Fsaifes, Ihsan; Lepers, Catherine; Obaton, Anne-Francoise; Gallion, Philippe

2006-08-01

Direct-sequence optical code-division multiple-access (DS-OCDMA) encoder/decoder based on sampled fiber Bragg gratings (S-FBGs) is characterized using phase-sensitive optical low-coherence reflectometry (OLCR). The OLCR technique allows localized measurements of FBG wavelength and physical length inside one S-FBG. This paper shows how the discrepancies between specifications and measurements of the different FBGs have some impact on spectral and temporal pulse responses of the OCDMA encoder/decoder. The FBG physical lengths lower than the specified ones are shown to affect the mean optical power reflected by the OCDMA encoder/decoder. The FBG wavelengths that are detuned from each other induce some modulations of S-FBG reflectivity resulting in encoder/decoder sensitivity to laser wavelength drift of the OCDMA system. Finally, highlighted by this OLCR study, some solutions to overcome limitations in performance with the S-FBG technology are suggested.

Generation and associative encoding in young and old adults: the effect of the strength of association between cues and targets on a cued recall task.

Science.gov (United States)

Taconnat, Laurence; Froger, Charlotte; Sacher, Mathilde; Isingrini, Michel

2008-01-01

The generation effect (i.e., better recall of the generated items than the read items) was investigated with a between-list design in young and elderly participants. The generation task difficulty was manipulated by varying the strength of association between cues and targets. Overall, strong associates were better recalled than weak associates. However, the results showed different generation effect patterns according to strength of association and age, with a greater generation effect for weak associates in younger adults only. These findings suggest that generating weak associates leads to more elaborated encoding, but that elderly adults cannot use this elaborated encoding as well as younger adults to recall the target words at test.

High-performance fluorescence-encoded magnetic microbeads as microfluidic protein chip supports for AFP detection

Energy Technology Data Exchange (ETDEWEB)

Gong, Xiaoqun [School of Life Sciences, Tianjin Engineering Center of Micro-Nano Biomaterials and Detection-Treatment Technology, Collaborative Innovation Center of Chemical Science and Engineering, Tianjin University, Tianjin 300072 (China); Yan, Huan; Yang, Jiumin [Department of Laboratory Medicine, Tianjin Medical University General Hospital, Tianjin, 300052 (China); Wu, Yudong; Zhang, Jian; Yao, Yingyi [School of Life Sciences, Tianjin Engineering Center of Micro-Nano Biomaterials and Detection-Treatment Technology, Collaborative Innovation Center of Chemical Science and Engineering, Tianjin University, Tianjin 300072 (China); Liu, Ping [Bioscience (Tianjin) Diagnostic Technology CO., LTD, Tianjin, 300300 (China); Wang, Huiquan [Department of Biomedical Engineering, School of Electronics and Information Engineering, Tianjin Polytechnic University, Tianjin, 300387 (China); Hu, Zhidong, E-mail: huzhidong27@163.com [Department of Laboratory Medicine, Tianjin Medical University General Hospital, Tianjin, 300052 (China); Chang, Jin, E-mail: jinchang@tju.edu.cn [School of Life Sciences, Tianjin Engineering Center of Micro-Nano Biomaterials and Detection-Treatment Technology, Collaborative Innovation Center of Chemical Science and Engineering, Tianjin University, Tianjin 300072 (China)

2016-10-05

Fluorescence-encoded magnetic microbeads (FEMMs), with the fluorescence encoding ability of quantum dots (QDs) and magnetic enrichment and separation functions of Fe{sub 3}O{sub 4} nanoparticles, have been widely used for multiple biomolecular detection as microfluidic protein chip supports. However, the preparation of FEMMs with long-term fluorescent encoding and immunodetection stability is still a challenge. In this work, we designed a novel high-temperature chemical swelling strategy. The QDs and Fe{sub 3}O{sub 4} nanoparticles were effectively packaged into microbeads via the thermal motion of the polymer chains and the hydrophobic interaction between the nanoparticles and microbeads. The FEMMs obtained a highly uniform fluorescent property and long-term encoding and immunodetection stability and could be quickly magnetically separated and enriched. Then, the QD-encoded magnetic microbeads were applied to alpha fetoprotein (AFP) detection via sandwich immunoreaction. The properties of the encoded microspheres were characterized using a self-designed detecting apparatus, and the target molecular concentration in the sample was also quantified. The results suggested that the high-performance FEMMs have great potential in the field of biomolecular detection. - Graphical abstract: We designed a novel strategy to prepare a kind of high-performance fluorescence-encoded magnetic microbeads as microfluidic protein chip support with long-time fluorescent encoding and immunodetection stability for AFP detection. - Highlights: • A novel strategy combined the high temperature with chemical swelling technology is designed. • Based on hydrophobic interaction and polymer thermal motion, QDs and Fe{sub 3}O{sub 4} were effectively packaged into microbeads. • The fluorescence-encoded magnetic microbeads show long-term fluorescent encoding and immunodetection stability.

Does long-term object priming depend on the explicit detection of object identity at encoding?

Directory of Open Access Journals (Sweden)

Carlos Alexandre Gomes

2015-03-01

Full Text Available It is currently unclear whether objects have to be explicitly identified at encoding for reliable behavioural long-term object priming to occur. We conducted two experiments that investigated long-term object and non-object priming using a selective-attention encoding manipulation that reduces explicit object identification. In Experiment 1, participants either counted dots flashed within an object picture (shallow encoding or engaged in an animacy task (deep encoding at study, whereas, at test, they performed an object-decision task. Priming, as measured by reaction times, was observed for both types of encoding, and was of equivalent magnitude. In Experiment 2, non-object priming (faster reaction times for studied relative to unstudied non-objects was also obtained under the same selective-attention encoding manipulation as in Experiment 1, and the magnitude of the priming effect was equivalent between experiments. In contrast, we observed a linear decrement in recognition memory accuracy across conditions (deep encoding of Experiment 1 > shallow encoding Experiment 1 > shallow encoding of Experiment 2, suggesting that priming was not contaminated by explicit memory strategies. We argue that our results are more consistent with the identification/production framework than the perceptual/conceptual distinction, and we conclude that priming of pictures largely ignored at encoding can be subserved by the automatic retrieval of two types of instances: one at the motor-level and another at an object-decision level.

Anti-stress effects of transcutaneous electrical nerve stimulation (TENS) on colonic motility in rats.

Science.gov (United States)

Yoshimoto, Sazu; Babygirija, Reji; Dobner, Anthony; Ludwig, Kirk; Takahashi, Toku

2012-05-01

Disorders of colonic motility may contribute to symptoms in patients with irritable bowel syndrome (IBS), and stress is widely believed to play a major role in developing IBS. Stress increases corticotropin releasing factor (CRF) of the hypothalamus, resulting in acceleration of colonic transit in rodents. In contrast, hypothalamic oxytocin (OXT) has an anti-stress effect via inhibiting CRF expression and hypothalamic-pituitary-adrenal axis activity. Although transcutaneous electrical nerve stimulation (TENS) and acupuncture have been shown to have anti-stress effects, the mechanism of the beneficial effects remains unknown. We tested the hypothesis that TENS upregulates hypothalamic OXT expression resulting in reduced CRF expression and restoration of colonic dysmotility in response to chronic stress. Male SD rats received different types of stressors for seven consecutive days (chronic heterotypic stress). TENS was applied to the bilateral hind limbs every other day before stress loading. Another group of rats did not receive TENS treatment. TENS significantly attenuated accelerated colonic transit induced by chronic heterotypic stress, which was antagonized by a central injection of an OXT antagonist. Immunohistochemical study showed that TENS increased OXT expression and decreased CRF expression at the paraventricular nucleus (PVN) following chronic heterotypic stress. It is suggested that TENS upregulates hypothalamic OXT expression which acts as an anti-stressor agent and mediates restored colonic dysmotility following chronic stress. TENS may be useful to treat gastrointestinal symptoms associated with stress.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Efficacy of the use of two simultaneously TENS devices for fibromyalgia pain.

Science.gov (United States)

Lauretti, Gabriela Rocha; Chubaci, Eliana Fazuoli; Mattos, Anita Leocadia

2013-08-01

Fibromyalgia is characterized by a range of symptoms that include muscle pain, fatigue and sleep disorders. Transcutaneous electrical nerve stimulation (TENS) is an established method for pain relief. The purpose of the study was to evaluate the effectiveness and safety of the use of two simultaneously new TENS devices for fibromyalgia pain. After Ethics approval and informed consent, 39 patients were prospectively divided into three groups to evaluate TENS device, applied simultaneously in each patient: (1) at the lower back (perpendicular to the vertebrae canal, at the level of the 5th lumbar vertebrae) and (2) centrally above and below the space between the C7 and T1 spinous processes. The devices were applied for 20 min at 12-h interval during 7 consecutive days. For the placebo group (PG), the devices did not transmitted electrical stimulus. The single-TENS group (STG) (n = 13) had one active and one placebo TENS. The DTG applied both active TENS devices at the low back and cervical areas. Diclofenac was used as rescue analgesic. The efficacy measures were pain relief, reduction in use of daily analgesic tablets, quality of sleep and fatigue. The evaluation within groups revealed that patients from DPG refereed no pain relief when compared to their previous VAS pain score (8 cm, p > 0.05), while patients from the STG refereed improvement of 2.5 cm in the pain VAS (previous 8.5 cm compared to 6 cm after treatment) (p pain (previous 8.5-4.3 cm) (p STG > PG (p TENS improved pain relief in fibromyalgia pain, pain and fatigue were further improved when two active devices were simultaneously applied at the low back and cervical area, with no side effects.

Astrophysical parameters of ten poorly studied open star clusters

International Nuclear Information System (INIS)

Tadross, Ashraf Latif; El-Bendary, Reda; Osman, Anas; Ismail, Nader; Bakry, Abdel Aziz

2012-01-01

We present the fundamental parameters of ten open star clusters, nominated from Kronberger et al. who presented some newly discovered stellar groups on the basis of the Two Micron All Sky Survey photometry and Digitized Sky Survey visual images. Star counts and photometric parameters (radius, membership, distance, color excess, age, luminosity function, mass function, total mass, and dynamical relaxation time) have been determined for these ten clusters for the first time. In order to calibrate our procedures, the main parameters (distance, age, and color excess) have been re-estimated for another five clusters, which are also studied by Kronberger et al. (research papers)

Ten PM Note of Organophosphae Poisoning- Successful outcome of a Medical Audit with complete seven steps

Directory of Open Access Journals (Sweden)

M D Bhattarai

2010-03-01

Full Text Available Medical audit in general consists of seven steps like choosing topic, setting criterion and standard, collecting first data, comparing data with standard, introducing change, collecting second data and reflecting. Its three basic premise are improvement of patient care by using existing knowledge, team work with ongoing educational process and change management and promotion of blame-free culture maintaining confidentiality. Audit mostly relates to a particular practice and is therefore not generalisable. An audit of residents' late evening routine notes of organophosphate poisoning patients is reported here, as the change introduced appears relevant to the situation of developing countries. Organophosphate poisoning patients should be managed in intensive care unit with close monitoring, as inadvertent stoppage or slowing of atropine infusion may occur, particularly at night, leading to reappearance of poisoning manifestations, which may cause respiratory failure and death. If they are managed in wards, residents-on-duty can check the clinical and intravenous drip status in the late evening and communicate with nurses and relatives to be particularly vigilant. In the audit done, such regular ten pm notes of organophosphate poisoning about the clinical and drip status and communication by residents were increased from 15.5% in the first to 81.7% in the second data collection (p < 0.01 after the introduction of the change. The ten pm note is being continued for about two years now. Implementation of ten pm note of organophosphate poisoning patients admitted in medical wards is feasible and appears useful to improve the quality of health care delivery and learning of residents. Keywords: atrophine, audit, audit steps, organophosphate mortality, organophosphate poisoning.

Processing and display of three-dimensional arrays of numerical data using octree encoding

International Nuclear Information System (INIS)

Amans, J.L.; Antoine, M.; Darier, P.

1986-04-01

The analysis of three-dimensional (3-D) arrays of numerical data from medical, industrial or scientific imaging, by synthetic generation of realistic images, has been widely developed. The Octree encoding, that organizes the volume data in a hierarchical tree structure, has some interesting features for 3-D arrays of data processing. The Octree encoding method, based on the recursive subdivision of a 3-D array, is an extension of the Quadtree encoding in the two-dimensional plane. We have developed a software package to validate the basic Octree encoding methodology for some manipulation and display operations of volume data. The contribution introduces the technique we have used (called ''overlay technique'') to make the projection operation of an Octree on a Quadtree encoded image plane. The application of this technique to the hidden surface display is presented [fr

Surviving the Lead Reliability Engineer Role in High Unit Value Projects

Science.gov (United States)

Perez, Reinaldo J.

2011-01-01

A project with a very high unit value within a company is defined as a project where a) the project constitutes one of a kind (or two-of-a-kind) national asset type of project, b) very large cost, and c) a mission failure would be a very public event that will hurt the company's image. The Lead Reliability engineer in a high visibility project is by default involved in all phases of the project, from conceptual design to manufacture and testing. This paper explores a series of lessons learned, over a period of ten years of practical industrial experience by a Lead Reliability Engineer. We expand on the concepts outlined by these lessons learned via examples. The lessons learned are applicable to all industries.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Ten-Competence: Life-Long Competence Development and Learning

NARCIS (Netherlands)

Koper, Rob; Specht, Marcus

2006-01-01

Koper, R., & Specht, M. (2008). Ten-Competence: Life-Long Competence Development and Learning. In M-A. Cicilia (Ed.), Competencies in Organizational e-learning: concepts and tools (pp. 234-252). Hershey: IGI-Global.

A fast improved fat tree encoder for wave union TDC in an FPGA

International Nuclear Information System (INIS)

Shen Qi; Zhao Lei; Liu Shubin; Qi Binxiang; Hu Xueye; An Qi; Liao Shengkai; Peng Chengzhi

2013-01-01

Up to now, the wave union method can achieve the best timing performance in FPGA-based TDC designs. However, it should be guaranteed in such a structure that the non-thermometer code to binary code (NTH2B) encoding process should be finished within just one system clock cycle. So the implementation of the NTH2B encoder is quite challenging considering the high speed requirement. Besides, the high resolution wave union TDC also demands that the encoder convert an ultra-wide input code to a binary code. We present a fast improved fat tree encoder (IFTE) to fulfill such requirements, in which bubble error suppression is also integrated. With this encoder scheme, a wave union TDC with 7.7 ps RMS and 3.8 ps effective bin size was implemented in an FPGA from Xilinx Virtex 5 family. An encoding time of 8.33 ns was achieved for a 276-bit non-thermometer code to a 9-bit binary code conversion. We conducted a series of tests on the oscillating period of the wave union launcher, as well as the overall performance of the TDC; test results indicate that the IFTE works well. In fact, in the implementation of this encoder, no manual routing or special constraints were required; therefore, this IFTE structure could also be further applied in other delay-chain-based FPGA TDCs. (authors)

A flow cytometric assay technology based on quantum dots-encoded beads

International Nuclear Information System (INIS)

Wang Haiqiao; Liu Tiancai; Cao Yuancheng; Huang Zhenli; Wang Jianhao; Li Xiuqing; Zhao Yuandi

2006-01-01

A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement

Security of BB84 with weak randomness and imperfect qubit encoding

Science.gov (United States)

Zhao, Liang-Yuan; Yin, Zhen-Qiang; Li, Hong-Wei; Chen, Wei; Fang, Xi; Han, Zheng-Fu; Huang, Wei

2018-03-01

The main threats for the well-known Bennett-Brassard 1984 (BB84) practical quantum key distribution (QKD) systems are that its encoding is inaccurate and measurement device may be vulnerable to particular attacks. Thus, a general physical model or security proof to tackle these loopholes simultaneously and quantitatively is highly desired. Here we give a framework on the security of BB84 when imperfect qubit encoding and vulnerability of measurement device are both considered. In our analysis, the potential attacks to measurement device are generalized by the recently proposed weak randomness model which assumes the input random numbers are partially biased depending on a hidden variable planted by an eavesdropper. And the inevitable encoding inaccuracy is also introduced here. From a fundamental view, our work reveals the potential information leakage due to encoding inaccuracy and weak randomness input. For applications, our result can be viewed as a useful tool to quantitatively evaluate the security of a practical QKD system.

Recognition memory is improved by a structured temporal framework during encoding

Directory of Open Access Journals (Sweden)

Sathesan eThavabalasingam

2016-01-01

Full Text Available In order to function optimally within our environment, we continuously extract temporal patterns from our experiences and formulate expectations that facilitate adaptive behavior. Given that our memories are embedded within spatiotemporal contexts, an intriguing possibility is that mnemonic processes are sensitive to the temporal structure of events. To test this hypothesis, in a series of behavioral experiments we manipulated the regularity of interval durations at encoding to create temporally structured and unstructured frameworks. Our findings revealed enhanced recognition memory (d’ for stimuli that were explicitly encoded within a temporally structured versus unstructured framework. Encoding information within a temporally structured framework was also associated with a reduction in the negative effects of proactive interference and was linked to greater recollective recognition memory. Furthermore, rhythmic temporal structure was found to enhance recognition memory for incidentally encoded information. Collectively, these results support the possibility that we possess a greater capacity to learn and subsequently remember temporally structured information.

47 CFR 11.32 - EAS Encoder.

Science.gov (United States)

2010-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL EMERGENCY ALERT SYSTEM (EAS) Equipment Requirements § 11... operation. (vi) Indicator Display. The encoder shall be provided with a visual and/or aural indicator which... to +50 degrees C and a range of relative humidity of up to 95%. (c) Primary Supply Voltage Variation...

Holovideo: Real-time 3D range video encoding and decoding on GPU

Science.gov (United States)

Karpinsky, Nikolaus; Zhang, Song

2012-02-01

We present a 3D video-encoding technique called Holovideo that is capable of encoding high-resolution 3D videos into standard 2D videos, and then decoding the 2D videos back into 3D rapidly without significant loss of quality. Due to the nature of the algorithm, 2D video compression such as JPEG encoding with QuickTime Run Length Encoding (QTRLE) can be applied with little quality loss, resulting in an effective way to store 3D video at very small file sizes. We found that under a compression ratio of 134:1, Holovideo to OBJ file format, the 3D geometry quality drops at a negligible level. Several sets of 3D videos were captured using a structured light scanner, compressed using the Holovideo codec, and then uncompressed and displayed to demonstrate the effectiveness of the codec. With the use of OpenGL Shaders (GLSL), the 3D video codec can encode and decode in realtime. We demonstrated that for a video size of 512×512, the decoding speed is 28 frames per second (FPS) with a laptop computer using an embedded NVIDIA GeForce 9400 m graphics processing unit (GPU). Encoding can be done with this same setup at 18 FPS, making this technology suitable for applications such as interactive 3D video games and 3D video conferencing.

Ten colour photometry of twelve Ap-stars

International Nuclear Information System (INIS)

Musielok, B.; Lange, D.; Schoeneich, W.; Hildebrandt, G.; Zelwanowa, E.; Hempelmann, A.; Salmanov, G.

1980-01-01

Ten-colour photoelectric observations are presented for twelve Ap-stars. Improved ephemeris for seven of them is given. Phase relations between the light curves and line intensity variations are discussed. The problem of the electromagnetic flux conctancy of IOTA Cas is approached from a qualitative point of view. (author)

Comparison between different encoding schemes for synthetic aperture imaging

DEFF Research Database (Denmark)

Nikolov, Svetoslav; Jensen, Jørgen Arendt

2002-01-01

and spatio-temporal encoding was investigated. Experiments on wire phantom in water were carried out to quantify the gain from the different encodings. The gain in SNR using an FM modulated pulse is 12 dB. The penetration depth of the images was studied using tissue mimicking phantom with frequency dependent......Synthetic transmit aperture ultrasound (STAU) imaging can create images with as low as 2 emissions, making it attractive for 3D real-time imaging. Two are the major problems to be solved: (1) complexity of the hardware involved, and (2) poor image quality due to low signal to noise ratio (SNR). We...... attenuation of 0.5 dB/(cm MHz). The combination of spatial and temporal encoding have highest penetration depth. Images to a depth of 110 mm, can successfully be made with contrast resolution comparable to that of a linear array image. The in-vivo scans show that the motion artifacts do not significantly...

Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen

DEFF Research Database (Denmark)

Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup

2012-01-01

Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...

Pareto-optimal multi-objective dimensionality reduction deep auto-encoder for mammography classification.

Science.gov (United States)

Taghanaki, Saeid Asgari; Kawahara, Jeremy; Miles, Brandon; Hamarneh, Ghassan

2017-07-01

Feature reduction is an essential stage in computer aided breast cancer diagnosis systems. Multilayer neural networks can be trained to extract relevant features by encoding high-dimensional data into low-dimensional codes. Optimizing traditional auto-encoders works well only if the initial weights are close to a proper solution. They are also trained to only reduce the mean squared reconstruction error (MRE) between the encoder inputs and the decoder outputs, but do not address the classification error. The goal of the current work is to test the hypothesis that extending traditional auto-encoders (which only minimize reconstruction error) to multi-objective optimization for finding Pareto-optimal solutions provides more discriminative features that will improve classification performance when compared to single-objective and other multi-objective approaches (i.e. scalarized and sequential). In this paper, we introduce a novel multi-objective optimization of deep auto-encoder networks, in which the auto-encoder optimizes two objectives: MRE and mean classification error (MCE) for Pareto-optimal solutions, rather than just MRE. These two objectives are optimized simultaneously by a non-dominated sorting genetic algorithm. We tested our method on 949 X-ray mammograms categorized into 12 classes. The results show that the features identified by the proposed algorithm allow a classification accuracy of up to 98.45%, demonstrating favourable accuracy over the results of state-of-the-art methods reported in the literature. We conclude that adding the classification objective to the traditional auto-encoder objective and optimizing for finding Pareto-optimal solutions, using evolutionary multi-objective optimization, results in producing more discriminative features. Copyright © 2017 Elsevier B.V. All rights reserved.

Distinct Reward Properties are Encoded via Corticostriatal Interactions.

Science.gov (United States)

Smith, David V; Rigney, Anastasia E; Delgado, Mauricio R

2016-02-02

The striatum serves as a critical brain region for reward processing. Yet, understanding the link between striatum and reward presents a challenge because rewards are composed of multiple properties. Notably, affective properties modulate emotion while informative properties help obtain future rewards. We approached this problem by emphasizing affective and informative reward properties within two independent guessing games. We found that both reward properties evoked activation within the nucleus accumbens, a subregion of the striatum. Striatal responses to informative, but not affective, reward properties predicted subsequent utilization of information for obtaining monetary reward. We hypothesized that activation of the striatum may be necessary but not sufficient to encode distinct reward properties. To investigate this possibility, we examined whether affective and informative reward properties were differentially encoded in corticostriatal interactions. Strikingly, we found that the striatum exhibited dissociable connectivity patterns with the ventrolateral prefrontal cortex, with increasing connectivity for affective reward properties and decreasing connectivity for informative reward properties. Our results demonstrate that affective and informative reward properties are encoded via corticostriatal interactions. These findings highlight how corticostriatal systems contribute to reward processing, potentially advancing models linking striatal activation to behavior.

Imaging dynamic redox processes with genetically encoded probes.

Science.gov (United States)

Ezeriņa, Daria; Morgan, Bruce; Dick, Tobias P

2014-08-01

Redox signalling plays an important role in many aspects of physiology, including that of the cardiovascular system. Perturbed redox regulation has been associated with numerous pathological conditions; nevertheless, the causal relationships between redox changes and pathology often remain unclear. Redox signalling involves the production of specific redox species at specific times in specific locations. However, until recently, the study of these processes has been impeded by a lack of appropriate tools and methodologies that afford the necessary redox species specificity and spatiotemporal resolution. Recently developed genetically encoded fluorescent redox probes now allow dynamic real-time measurements, of defined redox species, with subcellular compartment resolution, in intact living cells. Here we discuss the available genetically encoded redox probes in terms of their sensitivity and specificity and highlight where uncertainties or controversies currently exist. Furthermore, we outline major goals for future probe development and describe how progress in imaging methodologies will improve our ability to employ genetically encoded redox probes in a wide range of situations. This article is part of a special issue entitled "Redox Signalling in the Cardiovascular System." Copyright © 2014 Elsevier Ltd. All rights reserved.

Electroencephalographic brain dynamics of memory encoding in emotionally arousing context

Directory of Open Access Journals (Sweden)

Carlos Enrique eUribe

2011-06-01

Full Text Available Emotional content/context enhances declarative memory through modulation of encoding and retrieval mechanisms. At encoding, neurophysiological data have consistently demonstrated the subsequent memory effect in theta and gamma oscillations. Yet, the existing studies were focused on the emotional content effect and let the emotional context effect unexplored. We hypothesized that theta and gamma oscillations show higher evoked/induced activity during the encoding of visual stimuli when delivered in an emotionally arousing context. Twenty-five healthy volunteers underwent evoked potentials recordings using a 21 scalp electrodes montage. They attended to an audiovisual test of emotional declarative memory being randomly assigned to either emotionally arousing or neutral context. Visual stimulus presentation was used as the time-locking event. Grand-averages of the evoked potentials and evoked spectral perturbations were calculated for each volunteer. Evoked potentials showed a higher negative deflection from 80 to 140 ms for the emotional condition. Such effect was observed over central, frontal and prefrontal locations bilaterally. Evoked theta power was higher in left parietal, central, frontal and prefrontal electrodes from -50 to 300 ms in the emotional condition. Evoked gamma power was higher in the emotional condition with a spatial distribution that overlapped at some points with the theta topography. The early theta power increase could be related to expectancy induced by auditory information processing that facilitates visual encoding in emotional contexts. Together, our results suggest that declarative memory enhancement for both emotional content and emotional context are supported by similar neural mechanisms at encoding, and offer new evidence about the brain processing of relevant environmental stimuli.

Transcutaneous electrical nerve stimulation (TENS) versus placebo for chronic low-back pain.

Science.gov (United States)

Khadilkar, Amole; Odebiyi, Daniel Oluwafemi; Brosseau, Lucie; Wells, George A

2008-10-08

Transcutaneous electrical nerve stimulation (TENS) was introduced more than 30 years ago as a therapeutic adjunct to the pharmacological management of pain. However, despite widespread use, its effectiveness in chronic low-back pain (LBP) is still controversial. To determine whether TENS is more effective than placebo for the management of chronic LBP. The Cochrane Central Register of Controlled Trials, MEDLINE, EMBASE, PEDro and CINAHL were searched up to July 19, 2007. Only randomized controlled clinical trials (RCTs) comparing TENS to placebo in patients with chronic LBP were included. Two review authors independently selected the trials, assessed their methodological quality and extracted relevant data. If quantitative meta-analysis was not possible, a qualitative synthesis was performed, taking into consideration 5 levels of evidence as recommended by the Cochrane Collaboration Back Review Group. Four high-quality RCTs (585 patients) met the selection criteria. Clinical heterogeneity prevented the use of meta-analysis. Therefore, a qualitative synthesis was completed. There was conflicting evidence about whether TENS was beneficial in reducing back pain intensity and consistent evidence in two trials (410 patients) that it did not improve back-specific functional status. There was moderate evidence that work status and the use of medical services did not change with treatment. Conflicting results were obtained from two studies regarding generic health status, with one study showing no improvement on the modified Sickness Impact Profile and another study showing significant improvements on several, but not all subsections of the SF-36 questionnaire. Multiple physical outcome measures lacked statistically significant improvement relative to placebo. In general, patients treated with acupuncture-like TENS responded similarly to those treated with conventional TENS. However, in two of the trials, an inadequate stimulation intensity was used for acupuncture

Temporal information encoding in dynamic memristive devices

Energy Technology Data Exchange (ETDEWEB)

Ma, Wen; Chen, Lin; Du, Chao; Lu, Wei D., E-mail: wluee@eecs.umich.edu [Department of Electrical Engineering and Computer Science, University of Michigan, Ann Arbor, Michigan 48109 (United States)

2015-11-09

We show temporal and frequency information can be effectively encoded in memristive devices with inherent short-term dynamics. Ag/Ag{sub 2}S/Pd based memristive devices with low programming voltage (∼100 mV) were fabricated and tested. At weak programming conditions, the devices exhibit inherent decay due to spontaneous diffusion of the Ag atoms. When the devices were subjected to pulse train inputs emulating different spiking patterns, the switching probability distribution function diverges from the standard Poisson distribution and evolves according to the input pattern. The experimentally observed switching probability distributions and the associated cumulative probability functions can be well-explained using a model accounting for the short-term decay effects. Such devices offer an intriguing opportunity to directly encode neural signals for neural information storage and analysis.

The application of the 'ten-day rule' in radiopharmaceutical investigations

International Nuclear Information System (INIS)

Ellis, R.E.; Nordin, B.E.C.; Tothill, P.; Veall, N.

1977-01-01

The working party first classified subjects who are investigated using radiopharmaceuticals into three groups, being (a) patients and other subjects who are asked to volunteer as controls for research studies, (b) patients on whom research investigations are being conducted which are relevant to their clinical condition but which are not strictly necessary for their management, and (c) patients on whom investigations are required for their proper management. The application of the 'ten-day rule' in relation to the use of radiopharmaceuticals is complicated by the fact that the total radiation dose is received over a time given by the effective life of the radiopharmaceutical in the organ, which may be a substantial part or even longer of the menstrual cycle. The activities of the radiopharmaceuticals normally administered are tabulted together with their effective half-lives and resulting gonad doses, and those radiopharmaceuticals requiring consideration of the implementation of the 'ten-day rule' for patients in groups (b) and (c) are identified. When the administration of therapeutic quantities of radiopharmaceuticals is being contemplated it is particularly important to take into account the applicability or otherwise of the 'ten-day rule'. It is recommended that the 'ten-day rule' should be strictly applied to all radiopharmaceutical administrations to women of child-bearing age who are volunteers for research purposes (group(a)). (U.K.)

Encoding methods for B1+ mapping in parallel transmit systems at ultra high field

Science.gov (United States)

Tse, Desmond H. Y.; Poole, Michael S.; Magill, Arthur W.; Felder, Jörg; Brenner, Daniel; Jon Shah, N.

2014-08-01

Parallel radiofrequency (RF) transmission, either in the form of RF shimming or pulse design, has been proposed as a solution to the B1+ inhomogeneity problem in ultra high field magnetic resonance imaging. As a prerequisite, accurate B1+ maps from each of the available transmit channels are required. In this work, four different encoding methods for B1+ mapping, namely 1-channel-on, all-channels-on-except-1, all-channels-on-1-inverted and Fourier phase encoding, were evaluated using dual refocusing acquisition mode (DREAM) at 9.4 T. Fourier phase encoding was demonstrated in both phantom and in vivo to be the least susceptible to artefacts caused by destructive RF interference at 9.4 T. Unlike the other two interferometric encoding schemes, Fourier phase encoding showed negligible dependency on the initial RF phase setting and therefore no prior B1+ knowledge is required. Fourier phase encoding also provides a flexible way to increase the number of measurements to increase SNR, and to allow further reduction of artefacts by weighted decoding. These advantages of Fourier phase encoding suggest that it is a good choice for B1+ mapping in parallel transmit systems at ultra high field.

Determination of lead 210 in scales from industrial processes

International Nuclear Information System (INIS)

Faria, Lígia S.; Moreira, Rubens M.; Kastner, Geraldo F.; Barbosa, João B.S.

2017-01-01

Industrial processes such as oil and gas extraction and groundwater exploitation are examples of installations that can accumulate naturally occurring radioactive materials (NORM) during the extraction and production. Lead-210 deposits in the production can be formed by the same mechanisms that occur in the environment through the support of Radon-222, (where 210 Pb is produced at 222 Rn decay) or without support, as 210 Pb. The objective of this work is to evaluate the mineralogical characteristics and determine the activity of lead-210 in the scales using the X-Ray Diffraction and Gamma Spectrometry techniques. Were analyzed fifteen samples, four scales from oil industry, ten scales from groundwater conductors and one for groundwater supply pipe. The highest activity found in the oil scale and groundwater conductors scale was 0.30 ± 0.06 Bq g -1 and 3.80 ± 0.20 Bq g -1 , respectively. (author)

Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

Directory of Open Access Journals (Sweden)

Kevin Lai

Full Text Available Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal or concreteness (abstract vs. concrete of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

Science.gov (United States)

Lai, Kevin; She, Hsiao-Ching; Chen, Sheng-Chang; Chou, Wen-Chi; Huang, Li-Yu; Jung, Tzyy-Ping; Gramann, Klaus

2012-01-01

Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal) or concreteness (abstract vs. concrete) of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC) during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

Implementation-intention encoding in a prospective memory task enhances spontaneous retrieval of intentions.

Science.gov (United States)

Rummel, Jan; Einstein, Gilles O; Rampey, Hilary

2012-01-01

Although forming implementation intentions (Gollwitzer, 1999) has been demonstrated to generally improve prospective memory, the underlying cognitive mechanisms are not completely understood. It has been proposed that implementation-intention encoding encourages spontaneous retrieval (McDaniel & Scullin, 2010). Alternatively one could assume the positive effect of implementation-intention encoding is caused by increased or more efficient monitoring for target cues. To test these alternative explanations and to further investigate the cognitive mechanisms underlying implementation-intention benefits, in two experiments participants formed the intention to respond to specific target cues in a lexical decision task with a special key, but then had to suspend this intention during an intervening word-categorisation task. Response times on trials directly following the occurrence of target cues in the intervening task were significantly slower with implementation-intention encoding than with standard encoding, indicating that spontaneous retrieval was increased (Experiment 1). However, when activation of the target cues was controlled for, similar slowing was found with both standard and implementation-intention encoding (Experiment 2). The results imply that implementation-intention encoding as well as increased target-cue activation foster spontaneous retrieval processes.

Encoding qubits into oscillators with atomic ensembles and squeezed light

Science.gov (United States)

Motes, Keith R.; Baragiola, Ben Q.; Gilchrist, Alexei; Menicucci, Nicolas C.

2017-05-01

The Gottesman-Kitaev-Preskill (GKP) encoding of a qubit within an oscillator provides a number of advantages when used in a fault-tolerant architecture for quantum computing, most notably that Gaussian operations suffice to implement all single- and two-qubit Clifford gates. The main drawback of the encoding is that the logical states themselves are challenging to produce. Here we present a method for generating optical GKP-encoded qubits by coupling an atomic ensemble to a squeezed state of light. Particular outcomes of a subsequent spin measurement of the ensemble herald successful generation of the resource state in the optical mode. We analyze the method in terms of the resources required (total spin and amount of squeezing) and the probability of success. We propose a physical implementation using a Faraday-based quantum nondemolition interaction.

Breyten Breytenbach in een zijspiegel: Het vizier van H.C. ten Berge Transnationale laterale beweging en particuliere “hetero-images” van een literaire actor/ Breyten Breytenbach Through H.C. ten Berge’s Looking-Glass: Transnational Lateral Movement and Particular “Hetero-Images” of a Writer

Directory of Open Access Journals (Sweden)

T’Sjoen Yves

2015-06-01

Full Text Available At the end of the 1960s and in the beginning of the 1970s the South African poet Breyten Breytenbach had poetry and drawings published in the leading literary magazine Raster. The editor in charge at the time, H.C. ten Berge, gave the experimental writer and socially engaged Sestiger (the literary modernizing movement in South Africa in the sixties pride of place in the line-ups of the Dutch modernist periodical. In the seventies, Ten Berge contributed to Vingermaan (1980, a collection of poems by Dutch writers (Lucebert, Kopland, Kouwenaar, Schierbeek in support of the anti-apartheid activist. From 1975 Breytenbach was imprisoned in South Africa for political reasons. He served seven years of a nine year sentence. At that time, in the eighties, the Netherlands organized a cultural and economical boycott against the racist regime in Pretoria. Later on, Ten Berge presented his own poems dedicated to Breytenbach in his book of poetry Nieuwe gedichten (1981 and in the collection Materia prima: Gedichten 1963-1993 (1993. Before and during the imprisonment of Breytenbach Ten Berge played an important role in the introduction of the writer in the Low Countries. From a cultural-sociological point of view Breytenbach’s presence in the Dutch language area can be described, in the terminology of Francoise Lionnet and Shu-mei Shih and later on used by Louise Viljoen, as a transnational lateral movement in his writing career. This paper deals with the cultural transmission of an important political and experimental author in the literary system of Afrikaans and English in South Africa into the Dutch system. From a bibliographical viewpoint this paper affords special attention to the publication of Breytenbach’s volume of poetry in Skryt: Om ’n sinkende skip blou te verf ([1972] 1976, Vingermaan (1980 and Nieuwe gedichten ([1981] 1987. Ten Berge played an important role in the introduction of Breytenbach to the Low Countries in the way he presented the

Using Social Scientific Criteria to Evaluate Cultural Theories: Encoding/Decoding Evaluated

Directory of Open Access Journals (Sweden)

Evan L. Kropp

2015-12-01

Full Text Available This article transcends the issue of conflicting theoretical schools of thought to formulate a method of social scientific style theory evaluation for cultural studies. It is suggested that positivist social scientific models of theory critique can be used to assess cultural models of communication to determine if they should be classified as theories. A set of evaluation criteria is formulated as a guide and applied to Stuart Hall’s Encoding/Decoding to determine if it is a theory. Conclusions find the sharing of criteria between schools of thought is judicious, Encoding/Decoding fits the established criteria, and Encoding/Decoding should be referred to as a theory.

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

Aminolevulinate dehydrogenase polymorphisms did not modified lead serum and memory relationship

Directory of Open Access Journals (Sweden)

Lantip Rujito

2015-12-01

Full Text Available BACKGROUND Lead accumulation in the blood widely known affecting the formation of heme and oxygen transport processes in vital organs, Leading to organ failure including the brain synapses. Lead affinity has been recognized influenced by constitutional genotype of aminolevulinate dehydrogenase (ALAD, which encodes for heme synthesis. This research aimed to determine the relationship between plumbum (Pb and short term memory on each ALAD gene genotyping (ALAD 1-1, ALAD 1-2 or ALAD 2-2 in gas station workers. METHODS Seventy six probands from gas station workers were recruited to participate in this research. Each probands was carried out ALAD genotyping using polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP method, lead serum level using atomic absorbent spectrophotometer (AAS, and short term memory was measurement by intelligence structure test (IST. RESULTS Proportion of δ ALAD 1-1, 1-2, and 2-2 were 91.8%, 8.2% and 0% respectively. Lead serum showed 15.84 ppb in homozygous 1-1, and 20.79 ppb in heterozygous. Short term memory in the probands varied from 85 until 117, with average in 99.71. There was significant negative relationship between lead serum and short term memory (r=-0.24; p=0.038. However, we could not find any significant correlation in each δ ALAD genotypes. CONCLUSION The δ ALAD genotypes did not modified the relationship between serum lead level and short term memory in gas station workers.

Treatment of Idiopathic Chronic Orchialgia with Transcutaneous Electrical Nerve Stimulation (TENS:A Preliminary Result

Directory of Open Access Journals (Sweden)

Ekrem Akdeniz

2016-01-01

Full Text Available Purpose: Unilateral or bilateral testicular pain lasting more than 3 months is called as chronic orchialgia. Aproximately 25-50% of chronic orchialgia is idiopatic origin. This study aimed the effectiveness of Transcutaneous Electrical Nerve Stimulation (TENS therapy due to Idiopathic Chronic Orchialgia (ICO. Methods: Five patients were included into this study with ICO that diagnosed with physical examination, urine analyses, urinary system x-ray film, and scrotal doppler ultrasound. Medical history revealed that multiple conservative therapy attempts failed to alleviate the pain. Two of the patients had right sided ICO. Traditional TENS device is placed to the most painful points. TENS applied 3 times in a week with duration 30 minutes for 4 weeks. Before and after TENS application, patients were evaluated by using Visual Analog Scale (VAS at first and third months. Results: Median age of patients was 26.20±2.38 (22-30. Mean VAS value was 6.52 ± 0.89 before the procedure. After 1 month VAS value was 3.82 ± 0.83 (p0.05. None of the patients needed any analgesics after during the one month. No complications, hyperemia or hypoesthesia of the scrotal or penile skin, occurred after the procedure. Conclusion: TENS reduces pain by increasing endorphin release in the spinal cord dorsal horn. TENS is very effective method for first 1 month in patients with ICO but its effect reduces by the time. There is no standard therapeutic protocol for idiopathic chronic orchialgia. Therefore TENS may be an alternative for patients who do not benefit from medical therapy and do not want invasive procedures. Short-term use of TENS and low number of the patients are the limitations of this study. Randomized, placebo-controlled, and longer follow-up period studies are needed to better assess the efficacy of TENS for ICO.

Single-shot imaging with higher-dimensional encoding using magnetic field monitoring and concomitant field correction.

Science.gov (United States)

Testud, Frederik; Gallichan, Daniel; Layton, Kelvin J; Barmet, Christoph; Welz, Anna M; Dewdney, Andrew; Cocosco, Chris A; Pruessmann, Klaas P; Hennig, Jürgen; Zaitsev, Maxim

2015-03-01

PatLoc (Parallel Imaging Technique using Localized Gradients) accelerates imaging and introduces a resolution variation across the field-of-view. Higher-dimensional encoding employs more spatial encoding magnetic fields (SEMs) than the corresponding image dimensionality requires, e.g. by applying two quadratic and two linear spatial encoding magnetic fields to reconstruct a 2D image. Images acquired with higher-dimensional single-shot trajectories can exhibit strong artifacts and geometric distortions. In this work, the source of these artifacts is analyzed and a reliable correction strategy is derived. A dynamic field camera was built for encoding field calibration. Concomitant fields of linear and nonlinear spatial encoding magnetic fields were analyzed. A combined basis consisting of spherical harmonics and concomitant terms was proposed and used for encoding field calibration and image reconstruction. A good agreement between the analytical solution for the concomitant fields and the magnetic field simulations of the custom-built PatLoc SEM coil was observed. Substantial image quality improvements were obtained using a dynamic field camera for encoding field calibration combined with the proposed combined basis. The importance of trajectory calibration for single-shot higher-dimensional encoding is demonstrated using the combined basis including spherical harmonics and concomitant terms, which treats the concomitant fields as an integral part of the encoding. © 2014 Wiley Periodicals, Inc.

Reactor dosimetry calibrations in the Big Ten critical assembly

International Nuclear Information System (INIS)

Barr, D.W.; Hansen, G.E.

1977-01-01

Eleven irradiations of foil packs located in the central region of Big Ten were made for the Interlaboratory Reaction Rate Program. Each irradiation was at a nominal 10 15 fluence and the principal fluence monitor was the National Bureau of Standards' double fission chamber containing 235 U and 238 U deposits and located at the center of Big Ten. Secondary monitors consisted of three external fission chambers and two internal foil sets containing Au, In, and Al. Activities of one set were counted at the LASL and the other at the Hanford Engineering Developement Laboratory. The uncertainty in relative fluence for each irradiation was +-0.3%

Transcutaneous electrical nerve stimulation (TENS) for pain control after vaginal delivery and cesarean section.

Science.gov (United States)

Kayman-Kose, Seda; Arioz, Dagistan Tolga; Toktas, Hasan; Koken, Gulengul; Kanat-Pektas, Mine; Kose, Mesut; Yilmazer, Mehmet

2014-10-01

The present study aims to determine the efficiency and reliability of transcutaneous electrical nerve stimulation (TENS) in the management of pain related with uterine contractions after vaginal delivery and the pain related with both abdominal incision uterine contractions after cesarean section. A hundred healthy women who underwent cesarean section under general anesthesia were randomly assigned to the placebo group (Group 1) or the TENS group (Group 2), while 100 women who delivered by vaginal route without episiotomy were randomized into the placebo group (Group 3) or the TENS group (Group 4). The patients in Group 2 had statistically lower visual analog scale (VAS) and verbal numerical scale (VNS) scores than the patients in Group 1 (p TENS (p = 0.006). The need for analgesics at the eighth hour of vaginal delivery was statistically similar in the patients who were treated with TENS and the patients who received placebo (p = 0.830). TENS is an effective, reliable, practical and easily available modality of treatment for postpartum pain.

Distributed-phase OCDMA encoder-decoders based on fiber Bragg gratings

OpenAIRE

Zhang, Zhaowei; Tian, C.; Petropoulos, P.; Richardson, D.J.; Ibsen, M.

2007-01-01

We propose and demonstrate new optical code-division multiple-access (OCDMA) encoder-decoders having a continuous phase-distribution. With the same spatial refractive index distribution as the reconfigurable optical phase encoder-decoders, they are inherently suitable for the application in reconfigurable OCDMA systems. Furthermore, compared with conventional discrete-phase devices, they also have additional advantages of being more tolerant to input pulse width and, therefore, have the poten...

Selective Memories: Infants' Encoding Is Enhanced in Selection via Suppression

Science.gov (United States)

Markant, Julie; Amso, Dima

2013-01-01

The present study examined the hypothesis that inhibitory visual selection mechanisms play a vital role in memory by limiting distractor interference during item encoding. In Experiment 1a we used a modified spatial cueing task in which 9-month-old infants encoded multiple category exemplars in the contexts of an attention orienting mechanism…

Giant multipole resonances: perspectives after ten years

International Nuclear Information System (INIS)

Bertrand, F.E.

1980-01-01

Nearly ten years ago evidence was published for the first of the so-called giant multipole resonances, the giant quadrupole resonance. During the ensuing years research in this field has spread to many nuclear physics laboratories throughout the world. The present status of electric giant multipole resonances is reviewed. 24 figures, 1 table

A controlled trial of transcutaneous electrical nerve stimulation (TENS) and exercise for chronic low back pain.

Science.gov (United States)

Deyo, R A; Walsh, N E; Martin, D C; Schoenfeld, L S; Ramamurthy, S

1990-06-07

A number of treatments are widely prescribed for chronic back pain, but few have been rigorously evaluated. We examined the effectiveness of transcutaneous electrical nerve stimulation (TENS), a program of stretching exercises, or a combination of both for low back pain. Patients with chronic low back pain (median duration, 4.1 years) were randomly assigned to receive daily treatment with TENS (n = 36), sham TENS (n = 36), TENS plus a program of exercises (n = 37), or sham TENS plus exercises (n = 36). After one month no clinically or statistically significant treatment effect of TENS was found on any of 11 indicators of outcome measuring pain, function, and back flexion; there was no interactive effect of TENS with exercise. Overall improvement in pain indicators was 47 percent with TENS and 42 percent with sham TENS (P not significant). The 95 percent confidence intervals for group differences excluded a major clinical benefit of TENS for most outcomes. By contrast, after one month patients in the exercise groups had significant improvement in self-rated pain scores, reduction in the frequency of pain, and greater levels of activity as compared with patients in the groups that did not exercise. The mean reported improvement in pain scores was 52 percent in the exercise groups and 37 percent in the nonexercise groups (P = 0.02). Two months after the active intervention, however, most patients had discontinued the exercises, and the initial improvements were gone. We conclude that for patients with chronic low back pain, treatment with TENS is no more effective than treatment with a placebo, and TENS adds no apparent benefit to that of exercise alone.

Alpha Oscillations during Incidental Encoding Predict Subsequent Memory for New "Foil" Information.

Science.gov (United States)

Vogelsang, David A; Gruber, Matthias; Bergström, Zara M; Ranganath, Charan; Simons, Jon S

2018-05-01

People can employ adaptive strategies to increase the likelihood that previously encoded information will be successfully retrieved. One such strategy is to constrain retrieval toward relevant information by reimplementing the neurocognitive processes that were engaged during encoding. Using EEG, we examined the temporal dynamics with which constraining retrieval toward semantic versus nonsemantic information affects the processing of new "foil" information encountered during a memory test. Time-frequency analysis of EEG data acquired during an initial study phase revealed that semantic compared with nonsemantic processing was associated with alpha decreases in a left frontal electrode cluster from around 600 msec after stimulus onset. Successful encoding of semantic versus nonsemantic foils during a subsequent memory test was related to decreases in alpha oscillatory activity in the same left frontal electrode cluster, which emerged relatively late in the trial at around 1000-1600 msec after stimulus onset. Across participants, left frontal alpha power elicited by semantic processing during the study phase correlated significantly with left frontal alpha power associated with semantic foil encoding during the memory test. Furthermore, larger left frontal alpha power decreases elicited by semantic foil encoding during the memory test predicted better subsequent semantic foil recognition in an additional surprise foil memory test, although this effect did not reach significance. These findings indicate that constraining retrieval toward semantic information involves reimplementing semantic encoding operations that are mediated by alpha oscillations and that such reimplementation occurs at a late stage of memory retrieval, perhaps reflecting additional monitoring processes.

Event-related rTMS at encoding affects differently deep and shallow memory traces.

Science.gov (United States)

Innocenti, Iglis; Giovannelli, Fabio; Cincotta, Massimo; Feurra, Matteo; Polizzotto, Nicola R; Bianco, Giovanni; Cappa, Stefano F; Rossi, Simone

2010-10-15

The "level of processing" effect is a classical finding of the experimental psychology of memory. Actually, the depth of information processing at encoding predicts the accuracy of the subsequent episodic memory performance. When the incoming stimuli are analyzed in terms of their meaning (semantic, or deep, encoding), the memory performance is superior with respect to the case in which the same stimuli are analyzed in terms of their perceptual features (shallow encoding). As suggested by previous neuroimaging studies and by some preliminary findings with transcranial magnetic stimulation (TMS), the left prefrontal cortex may play a role in semantic processing requiring the allocation of working memory resources. However, it still remains unclear whether deep and shallow encoding share or not the same cortical networks, as well as how these networks contribute to the "level of processing" effect. To investigate the brain areas casually involved in this phenomenon, we applied event-related repetitive TMS (rTMS) during deep (semantic) and shallow (perceptual) encoding of words. Retrieval was subsequently tested without rTMS interference. RTMS applied to the left dorsolateral prefrontal cortex (DLPFC) abolished the beneficial effect of deep encoding on memory performance, both in terms of accuracy (decrease) and reaction times (increase). Neither accuracy nor reaction times were instead affected by rTMS to the right DLPFC or to an additional control site excluded by the memory process (vertex). The fact that online measures of semantic processing at encoding were unaffected suggests that the detrimental effect on memory performance for semantically encoded items took place in the subsequent consolidation phase. These results highlight the specific causal role of the left DLPFC among the wide left-lateralized cortical network engaged by long-term memory, suggesting that it probably represents a crucial node responsible for the improved memory performance induced by

Ten Things Parents Can Do to Prevent Suicide

Science.gov (United States)

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... teen at risk for suicide . Spend some time reading these ten ways you can help prevent a ...

Differential effects of subcutaneous electrical stimulation (SQS) and transcutaneous electrical nerve stimulation (TENS) in rodent models of chronic neuropathic or inflammatory pain.

Science.gov (United States)

Vera-Portocarrero, Louis P; Cordero, Toni; Billstrom, Tina; Swearingen, Kim; Wacnik, Paul W; Johanek, Lisa M

2013-01-01

Electrical stimulation has been used for many years for the treatment of pain. Present-day research demonstrates that stimulation targets and parameters impact the induction of specific pain-modulating mechanisms. New targets are increasingly being investigated clinically, but the scientific rationale for a particular target is often not well established. This present study compares the behavioral effects of targeting peripheral axons by electrode placement in the subcutaneous space vs. electrode placement on the surface of the skin in a rodent model. Rodent models of inflammatory and neuropathic pain were used to investigate subcutaneous electrical stimulation (SQS) vs. transcutaneous electrical nerve stimulation (TENS). Electrical parameters and relative location of the leads were held constant under each condition. SQS had cumulative antihypersensitivity effects in both inflammatory and neuropathic pain rodent models, with significant inhibition of mechanical hypersensitivity observed on days 3-4 of treatment. In contrast, reduction of thermal hyperalgesia in the inflammatory model was observed during the first four days of treatment with SQS, and reduction of cold allodynia in the neuropathic pain model was seen only on the first day with SQS. TENS was effective in the inflammation model, and in agreement with previous studies, tolerance developed to the antihypersensitivity effects of TENS. With the exception of a reversal of cold hypersensitivity on day 1 of testing, TENS did not reveal significant analgesic effects in the neuropathic pain rodent model. The results presented show that TENS and SQS have different effects that could point to unique biologic mechanisms underlying the analgesic effect of each therapy. Furthermore, this study is the first to demonstrate in an animal model that SQS attenuates neuropathic and inflammatory-induced pain behaviors. © 2013 Medtronic, Inc.

Modification of the 'ten-day rule'

International Nuclear Information System (INIS)

Klempfner, G.

1985-01-01

In a 1964 decision the National Health and Medical Research Council recommended that radiological examinations of the lower abdomen and pelvis of women of childbearing age should be confined to the 10-day interval following the onset of menstruation. Recent evidence suggests that the first four weeks from the first day of the last menstrual period is not a critically radiosensitive period and consequently strict adherence to the ten-day rule is no longer indicated

Direct Pathogenic Effects of HERV-encoded Proteins

DEFF Research Database (Denmark)

Hansen, Dorte Tranberg; Møller-Larsen, Anné; Petersen, Thor

Background: Multiple sclerosis (MS) is a demyelinating, inflammatory disease of the central nervous system (CNS). MS is mediated by the immune system but the etiology of the disease remains unknown. Retroviral envelope (Env) proteins, encoded by human endogenous retroviruses (HERVs), are expressed...... in increased amounts on B cells from MS patients. Furthermore, the amount of anti-HERV antibodies in serum and cerebrospinal fluid from patients with MS is increased when compared with healthy controls. Aim: The overall aim of this project is to investigate the potential role of HERVs in the development of MS...... and the possible direct pathogenic effects of HERV-encoded Env proteins on the CNS. Methods: Construction and characterization of a panel of recombinant Env-proteins is initiated and their pathogenic potential will be investigated: Fusiogenic potential analyzed by flow cytometry and confocal microscopy. Analysis...

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Efficient Text Encryption and Hiding with Double-Random Phase-Encoding

Directory of Open Access Journals (Sweden)

Mohammad S. Alam

2012-10-01

Full Text Available In this paper, a double-random phase-encoding technique-based text encryption and hiding method is proposed. First, the secret text is transformed into a 2-dimensional array and the higher bits of the elements in the transformed array are used to store the bit stream of the secret text, while the lower bits are filled with specific values. Then, the transformed array is encoded with double-random phase-encoding technique. Finally, the encoded array is superimposed on an expanded host image to obtain the image embedded with hidden data. The performance of the proposed technique, including the hiding capacity, the recovery accuracy of the secret text, and the quality of the image embedded with hidden data, is tested via analytical modeling and test data stream. Experimental results show that the secret text can be recovered either accurately or almost accurately, while maintaining the quality of the host image embedded with hidden data by properly selecting the method of transforming the secret text into an array and the superimposition coefficient. By using optical information processing techniques, the proposed method has been found to significantly improve the security of text information transmission, while ensuring hiding capacity at a prescribed level.

Equal Learning Does Not Result in Equal Remembering: The Importance of Post-Encoding Processes

Science.gov (United States)

Bauer, Patricia J.; Guler, O. Evren; Starr, Rebecca M.; Pathman, Thanujeni

2011-01-01

Explanations of variability in long-term recall typically appeal to encoding and/or retrieval processes. However, for well over a century, it has been apparent that for memory traces to be stored successfully, they must undergo a post-encoding process of stabilization and integration. Variability in post-encoding processes is thus a potential…

Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges.

Science.gov (United States)

Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M

2011-08-05

We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.

Encoding mutually unbiased bases in orbital angular momentum for quantum key distribution

CSIR Research Space (South Africa)

Dudley, Angela L

2013-07-01

Full Text Available We encode mutually unbiased bases (MUBs) using the higher-dimensional orbital angular momentum (OAM) degree of freedom associated with optical fields. We illustrate how these states are encoded with the use of a spatial light modulator (SLM). We...

Encoders for block-circulant LDPC codes

Science.gov (United States)

Divsalar, Dariush (Inventor); Abbasfar, Aliazam (Inventor); Jones, Christopher R. (Inventor); Dolinar, Samuel J. (Inventor); Thorpe, Jeremy C. (Inventor); Andrews, Kenneth S. (Inventor); Yao, Kung (Inventor)

2009-01-01

Methods and apparatus to encode message input symbols in accordance with an accumulate-repeat-accumulate code with repetition three or four are disclosed. Block circulant matrices are used. A first method and apparatus make use of the block-circulant structure of the parity check matrix. A second method and apparatus use block-circulant generator matrices.

Divided attention can enhance early-phase memory encoding: the attentional boost effect and study trial duration.

Science.gov (United States)

Mulligan, Neil W; Spataro, Pietro

2015-07-01

Divided attention during encoding typically produces marked reductions in later memory. The attentional boost effect (ABE) is a surprising variation on this phenomenon. In this paradigm, each study stimulus (e.g., a word) is presented along with a target or a distractor (e.g., different colored circles) in a detection task. Later memory is better for stimuli co-occurring with targets. The present experiments indicate that the ABE arises during an early phase of memory encoding that involves initial stimulus perception and comprehension rather than at a later phase entailing controlled, elaborative rehearsal. Experiment 1 demonstrated that the ABE was robust at a short study duration (700 ms) and did not increase with increasing study trial durations (1,500 ms and 4,000 ms). Furthermore, the target condition is boosted to the level of memory performance in a full-attention condition for the short duration but not the long duration. Both results followed from the early-phase account. This account also predicts that for very short study times (limiting the influence of late-phase controlled encoding and thus minimizing the usual negative effect of divided attention), the target condition will produce better memory than will the full-attention condition. Experiment 2 used a study time of 400 ms and found that words presented with targets lead to greater recognition accuracy than do either words presented with distractors or words in the full-attention condition. Consistent with the early-phase account, a divided attention condition actually produced superior memory than did the full-attention condition, a very unusual but theoretically predicted result. (c) 2015 APA, all rights reserved.

Fast Coding Unit Encoding Mechanism for Low Complexity Video Coding

OpenAIRE

Gao, Yuan; Liu, Pengyu; Wu, Yueying; Jia, Kebin; Gao, Guandong

2016-01-01

In high efficiency video coding (HEVC), coding tree contributes to excellent compression performance. However, coding tree brings extremely high computational complexity. Innovative works for improving coding tree to further reduce encoding time are stated in this paper. A novel low complexity coding tree mechanism is proposed for HEVC fast coding unit (CU) encoding. Firstly, this paper makes an in-depth study of the relationship among CU distribution, quantization parameter (QP) and content ...

Neural Mechanisms Underlying Cross-Modal Phonetic Encoding.

Science.gov (United States)

Shahin, Antoine J; Backer, Kristina C; Rosenblum, Lawrence D; Kerlin, Jess R

2018-02-14

Audiovisual (AV) integration is essential for speech comprehension, especially in adverse listening situations. Divergent, but not mutually exclusive, theories have been proposed to explain the neural mechanisms underlying AV integration. One theory advocates that this process occurs via interactions between the auditory and visual cortices, as opposed to fusion of AV percepts in a multisensory integrator. Building upon this idea, we proposed that AV integration in spoken language reflects visually induced weighting of phonetic representations at the auditory cortex. EEG was recorded while male and female human subjects watched and listened to videos of a speaker uttering consonant vowel (CV) syllables /ba/ and /fa/, presented in Auditory-only, AV congruent or incongruent contexts. Subjects reported whether they heard /ba/ or /fa/. We hypothesized that vision alters phonetic encoding by dynamically weighting which phonetic representation in the auditory cortex is strengthened or weakened. That is, when subjects are presented with visual /fa/ and acoustic /ba/ and hear /fa/ ( illusion-fa ), the visual input strengthens the weighting of the phone /f/ representation. When subjects are presented with visual /ba/ and acoustic /fa/ and hear /ba/ ( illusion-ba ), the visual input weakens the weighting of the phone /f/ representation. Indeed, we found an enlarged N1 auditory evoked potential when subjects perceived illusion-ba , and a reduced N1 when they perceived illusion-fa , mirroring the N1 behavior for /ba/ and /fa/ in Auditory-only settings. These effects were especially pronounced in individuals with more robust illusory perception. These findings provide evidence that visual speech modifies phonetic encoding at the auditory cortex. SIGNIFICANCE STATEMENT The current study presents evidence that audiovisual integration in spoken language occurs when one modality (vision) acts on representations of a second modality (audition). Using the McGurk illusion, we show

Elliot Lake uranium mine reclamation, the first ten years

International Nuclear Information System (INIS)

Payne, R.A.

2000-01-01

In 1989, Rio Algom Limited finalized its plans for the closure and subsequent decommissioning of two of its then three operating mines in Elliot Lake as a result of market conditions. These two mines closed in August 1990. These mine closures had significant impacts. The principal mining operations of Rio Algom at that time were still in Elliot Lake and had been the very foundation of the company for about 40 years. The business impact on the Corporation was regarded as possibly severe. The resultant layoff of over 1,500 long-term, highly qualified, skilled and well-paid employees, a devastating blow to the affected employees and their families, would have a significant financial impact on the municipal economy, particularly as this announcement was seen as the first step in the early closure of all four operating mines in the region. At that time there was little precedence for such a high profile mine closure program and consequently the many unknowns relating to the mine decommissioning process, legislative requirements and society's expectations resulted in a perception of a significant yet ill-defined liability. In this atmosphere of understandable company, stakeholder and public concern, Rio Algom Limited embarked on what has turned out to be a long, rigorous, challenging yet ultimately reasonable and rewarding process of progressive reclamation of all its Elliot Lake mines, some ten in total (nine uranium, one copper). Over the past ten years, reclamation of all ten mines has been successfully completed, some $70 m plus has been expended in direct site reclamation works and the workforce has been reduced from over 2,500 to just 4. After ten years, the focus of attention is now on the long-term care, maintenance, monitoring and reporting required for the decommissioned mine sites, and the accomplishment of this in the best interests of all the stakeholders. (author)

Field experiments on seed dispersal by wind in ten umbelliferous species (Apiaceae)

NARCIS (Netherlands)

Jongejans, E.; Telenius, A.

2001-01-01

This report presents data from experiments on seed dispersal by wind for ten species of the family Apiaceae. Seed shadows were obtained in the field under natural conditions, using wind speeds between four and ten m/s. The flight of individual seeds was followed by eye, and seed shadows were

Radiation therapy of penile cancer: six to ten-year follow-up

International Nuclear Information System (INIS)

Grabstald, H.; Kelley, C.D.

1980-01-01

Ten patients with penile cancer were treated with radiation therapy between 1968 and 1973. Nine of ten remain free of disease though in 1 patient a new penile primary developed eight years after the radiation therapy and was treated by partial penectomy. One patient died following surgery for ''bleeding ulcer.'' He was free of penile cancer five years after radiation. The most common complication is urethral stricture and skin telangiectasia

Towards predicting the encoding capability of MR fingerprinting sequences.

Science.gov (United States)

Sommer, K; Amthor, T; Doneva, M; Koken, P; Meineke, J; Börnert, P

2017-09-01

Sequence optimization and appropriate sequence selection is still an unmet need in magnetic resonance fingerprinting (MRF). The main challenge in MRF sequence design is the lack of an appropriate measure of the sequence's encoding capability. To find such a measure, three different candidates for judging the encoding capability have been investigated: local and global dot-product-based measures judging dictionary entry similarity as well as a Monte Carlo method that evaluates the noise propagation properties of an MRF sequence. Consistency of these measures for different sequence lengths as well as the capability to predict actual sequence performance in both phantom and in vivo measurements was analyzed. While the dot-product-based measures yielded inconsistent results for different sequence lengths, the Monte Carlo method was in a good agreement with phantom experiments. In particular, the Monte Carlo method could accurately predict the performance of different flip angle patterns in actual measurements. The proposed Monte Carlo method provides an appropriate measure of MRF sequence encoding capability and may be used for sequence optimization. Copyright © 2017 Elsevier Inc. All rights reserved.

Lateral and medial prefrontal contributions to emotion generation by semantic elaboration during episodic encoding.

Science.gov (United States)

Kaneda, Takumi; Shigemune, Yayoi; Tsukiura, Takashi

2017-02-01

Memories for emotion-laden stimuli are remembered more accurately than those for neutral stimuli. Although this enhancement reflects stimulus-driven modulation of memory by emotions, functional neuroimaging evidence of the interacting mechanisms between emotions generated by intentional processes, such as semantic elaboration, and memory is scarce. The present fMRI study investigated how encoding-related activation is modulated by emotions generated during the process of semantic elaboration. During encoding with fMRI, healthy young adults viewed neutral (target) pictures either passively or with semantic elaboration. In semantic elaboration, participants imagined background stories related to the pictures. Encoding trials with semantic elaboration were subdivided into conditions in which participants imagined negative, positive, or neutral stories. One week later, memories for target pictures were tested. In behavioral results, memories for target pictures were significantly enhanced by semantic elaboration, compared to passive viewing, and the memory enhancement was more remarkable when negative or positive stories were imagined. fMRI results demonstrated that activations in the left inferior frontal gyrus and dorsal medial prefrontal cortex (dmPFC) were greater during the encoding of target pictures with semantic elaboration than those with passive viewing, and that these activations further increased during encoding with semantic elaboration of emotional stories than of neutral stories. Functional connectivity between the left inferior frontal gyrus and dmPFC/hippocampus during encoding significantly predicted retrieval accuracies of memories encoded with self-generated emotional stories. These findings suggest that networks including the left inferior frontal region, dmPFC, and hippocampus could contribute to the modulation of memories encoded with the emotion generation.

Effect of post-encoding emotion on recollection and familiarity for pictures.

Science.gov (United States)

Wang, Bo; Ren, Yanju

2017-07-01

Although prior studies have examined the effect of post-encoding emotional arousal on recognition memory for words, it is unknown whether the enhancement effect observed on words generalizes to pictures. Furthermore, prior studies using words have showed that the effect of emotional arousal can be modulated by stimuli valence and delay in emotion induction, but it is unclear whether such modulation can extend to pictures and whether other factors such as encoding method (incidental vs. intentional encoding) can be modulatory. Five experiments were conducted to answer these questions. In Experiment 1, participants encoded a list of neutral and negative pictures and then watched a 3-min neutral or negative video. The delayed test showed that negative arousal impaired recollection regardless of picture valence but had no effect on familiarity. Experiment 2 replicated the above findings. Experiment 3 was similar to Experiment 1 except that participants watched a 3-min neutral, negative, or positive video and conducted free recall before the recognition test. Unlike the prior two experiments, the impairment effect of negative arousal disappeared. Experiment 4, where the free recall task was eliminated, replicated the results from Experiment 3. Experiment 5 replicated Experiments 1 and 2 and further showed that the impairment effects of negative arousal could be modulated by delay in emotion induction but not by encoding method or stimuli valence. Taken together, the current study suggests that the enhancement effect observed on words may not generalize to pictures.

Lead chromate detected as a source of atmospheric Pb and Cr (VI) pollution

OpenAIRE

Lee, Pyeong-Koo; Yu, Soonyoung; Chang, Hye Jung; Cho, Hye Young; Kang, Min-Ju; Chae, Byung-Gon

2016-01-01

Spherical black carbon aggregates were frequently observed in dust dry deposition in Daejeon, Korea. They were tens of micrometers in diameter and presented a mixture of black carbon and several mineral phases. Transmission electron microscopy (TEM) observations with energy-dispersive X-ray spectroscopy (EDS) and selected area diffraction pattern (SADP) analyses confirmed that the aggregates were compact and included significant amounts of lead chromate (PbCrO4). The compositions and morpholo...

Multi-core events in cosmic-ray induced interactions with lead at around 10 TeV

International Nuclear Information System (INIS)

Amato, N.; Arata, N.

1989-01-01

The analysis is made on the cosmic-ray induced interactions with lead at around 10 TeV on the basis of emulsion chamber data at Chacaltaya. A special attention is paid to the events detected as multi-cores under the spatial resolution of a few tens of microns. The observation of six double-core events and two triple-core events with the average invariant mass of 1.8 GeV/c 2 leads to the estimation on production frequency of such multicores as about 5% at 10 TeV at the atmospheric depth 540 gr/cm 2 . (author)

Novitäten im Breslauer Stadttheater

OpenAIRE

Zduniak, Maria

2017-01-01

Am Anfang des 20. Jahrhunderts zählte das Breslauer Stadttheater, obwohl mit nur einer kleinen Orchester-Besetzung ausgestattet, zu den bemerkenswerten europäischen Opernbühnen. Es war aufgeschlossen für musikalische Novitäten. Als Beweis dafür sind u.a. die Breslauer Premieren Salome (1906) von Richard Strauss, L\\'Orfeo (1913) von Claudio Monteverdi und die Uraufführung der Oper Eros und Psyche (1917) von Ludomir Różycki zu nennen.

A low-latency, low-overhead encoder for data transmission in the ATLAS Liquid Argon Calorimeter trigger upgrade

Energy Technology Data Exchange (ETDEWEB)

Xiao, Le [Department of Physics, Central China Normal University, Wuhan, Hubei 430079 (China); Department of Physics, Southern Methodist University, Dallas, TX 75275 (United States); Li, Xiaoting [Department of Physics, Central China Normal University, Wuhan, Hubei 430079 (China); Gong, Datao, E-mail: dgong@mail.smu.edu [Department of Physics, Southern Methodist University, Dallas, TX 75275 (United States); Chen, Jinghong [Department of Electrical and Computer Engineering, University of Houston, Houston, TX 77004 (United States); Deng, Binwei [School of Electric and Electronic Information Engineering, Hubei Polytechnic University, Huangshi, Hubei 435003 (China); Fan, Qingjun; Feng, Yulang [Department of Electrical and Computer Engineering, University of Houston, Houston, TX 77004 (United States); Guo, Di [Department of Physics, Southern Methodist University, Dallas, TX 75275 (United States); State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Hefei, Anhui 230026 (China); He, Huiqin [Department of Physics, Central China Normal University, Wuhan, Hubei 430079 (China); Department of Physics, Southern Methodist University, Dallas, TX 75275 (United States); Shenzhen Polytechnic, Shenzhen 518055 (China); Hou, Suen [Institute of Physics, Academia Sinica, Nangang 11529, Taipei, Taiwan (China); Huang, Guangming, E-mail: gmhuang@phy.ccnu.edu.cn [Department of Physics, Central China Normal University, Wuhan, Hubei 430079 (China); Liu, Chonghan; Liu, Tiankuan [Department of Physics, Southern Methodist University, Dallas, TX 75275 (United States); Sun, Xiangming [Department of Physics, Central China Normal University, Wuhan, Hubei 430079 (China); Tang, Yuxuan [Department of Electrical and Computer Engineering, University of Houston, Houston, TX 77004 (United States); Teng, Ping-Kun [Institute of Physics, Academia Sinica, Nangang 11529, Taipei, Taiwan (China); and others

2016-09-21

In this paper, we present the design and test results of an encoder integrated circuit for the ATLAS Liquid Argon Calorimeter trigger upgrade. The encoder implements a low-latency and low-overhead line code called LOCic. The encoder operates at 320 MHz with a latency of no greater than 21 ns. The overhead of the encoder is 14.3%. The encoder is an important block of the transmitter ASIC LOCx2, which is prototyped with a commercial 0.25 μm Silicon-on-Sapphire CMOS technology and packaged in a 100-pin QFN package. - Highlights: • We present the design and test results of an encoder integrated circuit for the ATLAS Liquid Argon Calorimeter trigger upgrade. • The encoder implements a low-latency and low-overhead line code called LOCic. The encoder operates at 320 MHz with a latency of no greater than 21 ns. The overhead of the encoder is 14.3%. • The encoder is an important block of the transmitter ASIC LOCx2, which is prototyped with a commercial 0.25 μm Silicon-on-Sapphire CMOS technology for radiation-tolerance and packaged in a 100-pin QFN package.

Determination of lead 210 in scales from industrial processes

Energy Technology Data Exchange (ETDEWEB)

Faria, Lígia S.; Moreira, Rubens M.; Kastner, Geraldo F.; Barbosa, João B.S., E-mail: ligsfaria@gmail.com, E-mail: rubens@cdtn.br, E-mail: gfk@cdtn.br, E-mail: jbsb@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

2017-11-01

Industrial processes such as oil and gas extraction and groundwater exploitation are examples of installations that can accumulate naturally occurring radioactive materials (NORM) during the extraction and production. Lead-210 deposits in the production can be formed by the same mechanisms that occur in the environment through the support of Radon-222, (where {sup 210}Pb is produced at {sup 222}Rn decay) or without support, as {sup 210}Pb. The objective of this work is to evaluate the mineralogical characteristics and determine the activity of lead-210 in the scales using the X-Ray Diffraction and Gamma Spectrometry techniques. Were analyzed fifteen samples, four scales from oil industry, ten scales from groundwater conductors and one for groundwater supply pipe. The highest activity found in the oil scale and groundwater conductors scale was 0.30 ± 0.06 Bq g{sup -1} and 3.80 ± 0.20 Bq g{sup -1}, respectively. (author)

Determining the Neural Substrate for Encoding a Memory of Human Pain and the Influence of Anxiety.

Science.gov (United States)

Tseng, Ming-Tsung; Kong, Yazhuo; Eippert, Falk; Tracey, Irene

2017-12-06

To convert a painful stimulus into a briefly maintainable construct when the painful stimulus is no longer accessible is essential to guide human behavior and avoid dangerous situations. Because of the aversive nature of pain, this encoding process might be influenced by emotional aspects and could thus vary across individuals, but we have yet to understand both the basic underlying neural mechanisms as well as potential interindividual differences. Using fMRI in combination with a delayed-discrimination task in healthy volunteers of both sexes, we discovered that brain regions involved in this working memory encoding process were dissociable according to whether the to-be-remembered stimulus was painful or not, with the medial thalamus and the rostral anterior cingulate cortex encoding painful and the primary somatosensory cortex encoding nonpainful stimuli. Encoding of painful stimuli furthermore significantly enhanced functional connectivity between the thalamus and medial prefrontal cortex (mPFC). With regards to emotional aspects influencing encoding processes, we observed that more anxious participants showed significant performance advantages when encoding painful stimuli. Importantly, only during the encoding of pain, the interindividual differences in anxiety were associated with the strength of coupling between medial thalamus and mPFC, which was furthermore related to activity in the amygdala. These results indicate not only that there is a distinct signature for the encoding of a painful experience in humans, but also that this encoding process involves a strong affective component. SIGNIFICANCE STATEMENT To convert the sensation of pain into a briefly maintainable construct is essential to guide human behavior and avoid dangerous situations. Although this working memory encoding process is implicitly contained in the majority of studies, the underlying neural mechanisms remain unclear. Using fMRI in a delayed-discrimination task, we found that the

Ten-a affects the fusion of central complex primordia in Drosophila.

Directory of Open Access Journals (Sweden)

Xuebo Cheng

Full Text Available The central complex of Drosophila melanogaster plays important functions in various behaviors, such as visual and olfactory memory, visual orientation, sleep, and movement control. However little is known about the genes regulating the development of the central complex. Here we report that a mutant gene affecting central complex morphology, cbd (central brain defect, was mapped to ten-a, a type II trans-membrane protein coding gene. Down-regulation of ten-a in pan-neural cells contributed to abnormal morphology of central complex. Over-expression of ten-a by C767-Gal4 was able to partially restore the abnormal central complex morphology in the cbd mutant. Tracking the development of FB primordia revealed that C767-Gal4 labeled interhemispheric junction that separated fan-shaped body precursors at larval stage withdrew to allow the fusion of the precursors. While the C767-Gal4 labeled structure did not withdraw properly and detached from FB primordia, the two fan-shaped body precursors failed to fuse in the cbd mutant. We propose that the withdrawal of C767-Gal4 labeled structure is related to the formation of the fan-shaped body. Our result revealed the function of ten-a in central brain development, and possible cellular mechanism underlying Drosophila fan-shaped body formation.

The symmetric MSD encoder for one-step adder of ternary optical computer

Science.gov (United States)

Kai, Song; LiPing, Yan

2016-08-01

The symmetric Modified Signed-Digit (MSD) encoding is important for achieving the one-step MSD adder of Ternary Optical Computer (TOC). The paper described the symmetric MSD encoding algorithm in detail, and developed its truth table which has nine rows and nine columns. According to the truth table, the state table was developed, and the optical-path structure and circuit-implementation scheme of the symmetric MSD encoder (SME) for one-step adder of TOC were proposed. Finally, a series of experiments were designed and performed. The observed results of the experiments showed that the scheme to implement SME was correct, feasible and efficient.

Polynucleotides encoding polypeptides having beta-glucosidase activity

Science.gov (United States)

Harris, Paul; Golightly, Elizabeth

2010-03-02

The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Human visual system automatically encodes sequential regularities of discrete events.

Science.gov (United States)

Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki

2010-06-01

For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential

Encoding-related brain activity during deep processing of verbal materials: a PET study.

Science.gov (United States)

Fujii, Toshikatsu; Okuda, Jiro; Tsukiura, Takashi; Ohtake, Hiroya; Suzuki, Maki; Kawashima, Ryuta; Itoh, Masatoshi; Fukuda, Hiroshi; Yamadori, Atsushi

2002-12-01

The recent advent of neuroimaging techniques provides an opportunity to examine brain regions related to a specific memory process such as episodic memory encoding. There is, however, a possibility that areas active during an assumed episodic memory encoding task, compared with a control task, involve not only areas directly relevant to episodic memory encoding processes but also areas associated with other cognitive processes for on-line information. We used positron emission tomography (PET) to differentiate these two kinds of regions. Normal volunteers were engaged in deep (semantic) or shallow (phonological) processing of new or repeated words during PET. Results showed that deep processing, compared with shallow processing, resulted in significantly better recognition performance and that this effect was associated with activation of various brain areas. Further analyses revealed that there were regions directly relevant to episodic memory encoding in the anterior part of the parahippocampal gyrus, inferior frontal gyrus, supramarginal gyrus, anterior cingulate gyrus, and medial frontal lobe in the left hemisphere. Our results demonstrated that several regions, including the medial temporal lobe, play a role in episodic memory encoding.

Automatic semantic encoding in verbal short-term memory: evidence from the concreteness effect.

Science.gov (United States)

Campoy, Guillermo; Castellà, Judit; Provencio, Violeta; Hitch, Graham J; Baddeley, Alan D

2015-01-01

The concreteness effect in verbal short-term memory (STM) tasks is assumed to be a consequence of semantic encoding in STM, with immediate recall of concrete words benefiting from richer semantic representations. We used the concreteness effect to test the hypothesis that semantic encoding in standard verbal STM tasks is a consequence of controlled, attention-demanding mechanisms of strategic semantic retrieval and encoding. Experiment 1 analysed the effect of presentation rate, with slow presentations being assumed to benefit strategic, time-dependent semantic encoding. Experiments 2 and 3 provided a more direct test of the strategic hypothesis by introducing three different concurrent attention-demanding tasks. Although Experiment 1 showed a larger concreteness effect with slow presentations, the following two experiments yielded strong evidence against the strategic hypothesis. Limiting available attention resources by concurrent tasks reduced global memory performance, but the concreteness effect was equivalent to that found in control conditions. We conclude that semantic effects in STM result from automatic semantic encoding and provide tentative explanations for the interaction between the concreteness effect and the presentation rate.

Reliability and validity of ten consumer activity trackers

NARCIS (Netherlands)

Kooiman, Thea; Dontje, Manon L.; Sprenger, Siska; Krijnen, Wim; van der Schans, Cees; de Groot, Martijn

2015-01-01

Background: Activity trackers can potentially stimulate users to increase their physical activity behavior. The aim of this study was to examine the reliability and validity of ten consumer activity trackers for measuring step count in both laboratory and free-living conditions. Method: Healthy

Where to start? Bottom-up attention improves working memory by determining encoding order.

Science.gov (United States)

Ravizza, Susan M; Uitvlugt, Mitchell G; Hazeltine, Eliot

2016-12-01

The present study aimed to characterize the mechanism by which working memory is enhanced for items that capture attention because of their novelty or saliency-that is, via bottom-up attention. The first experiment replicated previous research by corroborating that bottom-up attention directed to an item is sufficient for enhancing working memory and, moreover, generalized the effect to the domain of verbal working memory. The subsequent 3 experiments sought to determine how bottom-up attention affects working memory. We considered 2 hypotheses: (1) Bottom-up attention enhances the encoded representation of the stimulus, similar to how voluntary attention functions, or (2) It affects the order of encoding by shifting priority onto the attended stimulus. By manipulating how stimuli were presented (simultaneous/sequential display) and whether the cue predicted the tested items, we found evidence that bottom-up attention improves working memory performance via the order of encoding hypothesis. This finding was observed across change detection and free recall paradigms. In contrast, voluntary attention improved working memory regardless of encoding order and showed greater effects on working memory. We conclude that when multiple information sources compete, bottom-up attention prioritizes the location at which encoding should begin. When encoding order is set, bottom-up attention has little or no benefit to working memory. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Visual short-term memory: activity supporting encoding and maintenance in retinotopic visual cortex.

Science.gov (United States)

Sneve, Markus H; Alnæs, Dag; Endestad, Tor; Greenlee, Mark W; Magnussen, Svein

2012-10-15

Recent studies have demonstrated that retinotopic cortex maintains information about visual stimuli during retention intervals. However, the process by which transient stimulus-evoked sensory responses are transformed into enduring memory representations is unknown. Here, using fMRI and short-term visual memory tasks optimized for univariate and multivariate analysis approaches, we report differential involvement of human retinotopic areas during memory encoding of the low-level visual feature orientation. All visual areas show weaker responses when memory encoding processes are interrupted, possibly due to effects in orientation-sensitive primary visual cortex (V1) propagating across extrastriate areas. Furthermore, intermediate areas in both dorsal (V3a/b) and ventral (LO1/2) streams are significantly more active during memory encoding compared with non-memory (active and passive) processing of the same stimulus material. These effects in intermediate visual cortex are also observed during memory encoding of a different stimulus feature (spatial frequency), suggesting that these areas are involved in encoding processes on a higher level of representation. Using pattern-classification techniques to probe the representational content in visual cortex during delay periods, we further demonstrate that simply initiating memory encoding is not sufficient to produce long-lasting memory traces. Rather, active maintenance appears to underlie the observed memory-specific patterns of information in retinotopic cortex. Copyright © 2012 Elsevier Inc. All rights reserved.

Examining the causes of memory strength variability: recollection, attention failure, or encoding variability?

Science.gov (United States)

Koen, Joshua D; Aly, Mariam; Wang, Wei-Chun; Yonelinas, Andrew P

2013-11-01

A prominent finding in recognition memory is that studied items are associated with more variability in memory strength than new items. Here, we test 3 competing theories for why this occurs-the encoding variability, attention failure, and recollection accounts. Distinguishing among these theories is critical because each provides a fundamentally different account of the processes underlying recognition memory. The encoding variability and attention failure accounts propose that old item variance will be unaffected by retrieval manipulations because the processes producing this effect are ascribed to encoding. The recollection account predicts that both encoding and retrieval manipulations that preferentially affect recollection will affect memory variability. These contrasting predictions were tested by examining the effect of response speeding (Experiment 1), dividing attention at retrieval (Experiment 2), context reinstatement (Experiment 3), and increased test delay (Experiment 4) on recognition performance. The results of all 4 experiments confirm the predictions of the recollection account and are inconsistent with the encoding variability account. The evidence supporting the attention failure account is mixed, with 2 of the 4 experiments confirming the account and 2 disconfirming the account. These results indicate that encoding variability and attention failure are insufficient accounts of memory variance and provide support for the recollection account. Several alternative theoretical accounts of the results are also considered. PsycINFO Database Record (c) 2013 APA, all rights reserved.

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

OpenAIRE

Kim, K S; Chilton, W S; Farrand, S K

1996-01-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

Chronic lead exposure induces cochlear oxidative stress and potentiates noise-induced hearing loss.

Science.gov (United States)

Jamesdaniel, Samson; Rosati, Rita; Westrick, Judy; Ruden, Douglas M

2018-08-01

Acquired hearing loss is caused by complex interactions of multiple environmental risk factors, such as elevated levels of lead and noise, which are prevalent in urban communities. This study delineates the mechanism underlying lead-induced auditory dysfunction and its potential interaction with noise exposure. Young-adult C57BL/6 mice were exposed to: 1) control conditions; 2) 2 mM lead acetate in drinking water for 28 days; 3) 90 dB broadband noise 2 h/day for two weeks; and 4) both lead and noise. Blood lead levels were measured by inductively coupled plasma mass spectrometry analysis (ICP-MS) lead-induced cochlear oxidative stress signaling was assessed using targeted gene arrays, and the hearing thresholds were assessed by recording auditory brainstem responses. Chronic lead exposure downregulated cochlear Sod1, Gpx1, and Gstk1, which encode critical antioxidant enzymes, and upregulated ApoE, Hspa1a, Ercc2, Prnp, Ccl5, and Sqstm1, which are indicative of cellular apoptosis. Isolated exposure to lead or noise induced 8-12 dB and 11-25 dB shifts in hearing thresholds, respectively. Combined exposure induced 18-30 dB shifts, which was significantly higher than that observed with isolated exposures. This study suggests that chronic exposure to lead induces cochlear oxidative stress and potentiates noise-induced hearing impairment, possibly through parallel pathways. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Study and realisation of a double integration charge encoder at VXI standard

International Nuclear Information System (INIS)

Leconte, A.

1994-07-01

The 16 channels charge encoder herein described equips the Phoswich scintillators which, associated with photomultiplier tubes, constitutes the first ring of the INDRA Multidetector. This 4 π Multidetector, located at GANIL at Caen, is first presented. In this encoder, two integrations are made, offering a distinction between the fast component of the signal from the detector and the slow one (decreasing times: 2,4 ns and 320ns respectively). This measurement is performed by the integration of each component within an adjustable time-gate. Apart from the two integrations, the encoder realizes the detection of the impulsion with a constant fraction discriminator, the generation of the two gates and a test function. The use of surface mounted components together with the choice of the VXI interconnection standard, also presented in this report, allowed highly integrated electronics. The encoder uses the sliding scale principle. It also includes the electronics for some programmable adjustments, the remote visualisation of important signals and the logic for the conversion. (author). 22 refs

The influence of transcutaneous electrical neurostimulation (TENS) on human cerebral blood flow velocities

NARCIS (Netherlands)

ter Laan, Mark; van Dijk, J. Marc C.; Elting, Jan-Willem J.; Fidler, Vaclav; Staal, Michiel J.

It has been shown that transcutaneous electrical neurostimulation (TENS) reduces sympathetic tone. Spinal cord stimulation (SCS) has proven qualities to improve coronary, peripheral, and cerebral blood circulation. Therefore, we postulate that TENS and SCS affect the autonomic nervous system in

Effects of transcutaneous electrical nerve stimulation (TENS) on cognition and behaviour in aging

NARCIS (Netherlands)

Scherder, E.J A; van Someren, E.W J; Bouma, J.M.; van der Berg, M

2000-01-01

In previous studies, transcutaneous electrical nerve stimulation (TENS) improved cognition and behaviour in patients with Alzheimer's disease (AD). The rationale underlying these studies was that TENS could activate, e.g. the septo-hippocampal region and the hypothalamus through direct and indirect

Effects of Transcutaneous Electrical Nerve Stimulation (TENS) on cognition and behaviour in aging

NARCIS (Netherlands)

Scherder, E.J.A.; Bouma, A.; van den Berg, M.

2000-01-01

In previous studies, transcutaneous electrical nerve stimulation (TENS) improved cognition and behaviour in patients with Alzheimer's disease (AD). The rationale underlying these studies was that TENS could activate, e.g. the septo-hippocampal region and the hypothalamus through direct and indirect

WHITE PANICLE3, a Novel Nucleus-Encoded Mitochondrial Protein, Is Essential for Proper Development and Maintenance of Chloroplasts and Mitochondria in Rice

Directory of Open Access Journals (Sweden)

Hongchang Li

2018-06-01

Full Text Available Mitochondria and chloroplasts are interacting organelles that play important roles in plant development. In addition to a small number proteins encoded by their own genomes, the majority of mitochondrial and chloroplast proteins are encoded in the cell nucleus and imported into the organelle. As a consequence, coordination between mitochondria, chloroplasts, and the nucleus is of crucial importance to plant cells. Variegated mutants are chloroplast-defective mutants and are considered to be ideal models for studying the intercommunication between these organelles. Here, we report the isolation of WHITE PANICLE3 (WP3, a nuclear gene involved in variegation, from a naturally occurring white panicle rice mutant. Disrupted expression of WP3 in the mutant leads to severe developmental defects in both chloroplasts and mitochondria, and consequently causes the appearance of white-striped leaves and white panicles in the mutant plants. Further investigation showed that WP3 encodes a protein most likely targeted to mitochondria and is specifically expressed in rice panicles. Interestingly, we demonstrate that the recessive white-panicle phenotype in the wp3 mutant is inherited in a typical Mendelian manner, while the white-striped leaf phenotype in wp3 is maternally inherited. Our data collectively suggest that the nucleus-encoded mitochondrial protein, WP3, plays an essential role in the regulation of chloroplast development in rice panicles by maintaining functional mitochondria. Therefore, the wp3 mutant is an excellent model in which to explore the communication between the nucleus, mitochondria, and chloroplasts in plant cells.

Ten Thousand Years of Solitude

Energy Technology Data Exchange (ETDEWEB)

Benford, G. (Los Alamos National Lab., NM (USA) California Univ., Irvine, CA (USA). Dept. of Physics); Kirkwood, C.W. (Los Alamos National Lab., NM (USA) Arizona State Univ., Tempe, AZ (USA). Coll. of Business Administration); Harry, O. (Los Alamos National Lab., NM (USA)); Pasqualetti, M.J. (Los Alamos National Lab., NM (USA) Arizona State Univ., Tempe, AZ (USA))

1991-03-01

This report documents the authors work as an expert team advising the US Department of Energy on modes of inadvertent intrusion over the next 10,000 years into the Waste Isolation Pilot Project (WIPP) nuclear waste repository. Credible types of potential future accidental intrusion into the WIPP are estimated as a basis for creating warning markers to prevent inadvertent intrusion. A six-step process is used to structure possible scenarios for such intrusion, and it is concluded that the probability of inadvertent intrusion into the WIPP repository over the next ten thousand years lies between one and twenty-five percent. 3 figs., 5 tabs.

Ten Thousand Years of Solitude?

International Nuclear Information System (INIS)

Benford, G.; Pasqualetti, M.J.

1991-03-01

This report documents the authors work as an expert team advising the US Department of Energy on modes of inadvertent intrusion over the next 10,000 years into the Waste Isolation Pilot Project (WIPP) nuclear waste repository. Credible types of potential future accidental intrusion into the WIPP are estimated as a basis for creating warning markers to prevent inadvertent intrusion. A six-step process is used to structure possible scenarios for such intrusion, and it is concluded that the probability of inadvertent intrusion into the WIPP repository over the next ten thousand years lies between one and twenty-five percent. 3 figs., 5 tabs

Ten questions on nuclear wastes

International Nuclear Information System (INIS)

Guillaumont, R.; Bacher, P.

2004-01-01

The authors give explanations and answers to ten issues related to nuclear wastes: when a radioactive material becomes a waste, how radioactive wastes are classified and particularly nuclear wastes in France, what are the risks associated with radioactive wastes, whether the present management of radioactive wastes is well controlled in France, which wastes are raising actual problems and what are the solutions, whether amounts and radio-toxicity of wastes can be reduced, whether all long life radionuclides or part of them can be transmuted, whether geologic storage of final wastes is inescapable, whether radioactive material can be warehoused over long durations, and how the information on radioactive waste management is organised

Functional characterization of the proteolytic activity of the tomato black ring nepovirus RNA-1-encoded polyprotein.

Science.gov (United States)

Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C

1995-01-10

Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.

RNAi suppressors encoded by pathogenic human viruses

NARCIS (Netherlands)

de Vries, Walter; Berkhout, Ben

2008-01-01

RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

Integrity test of lead apron and its effect on personnel and carers

Directory of Open Access Journals (Sweden)

Omojola Akintayo Daniel