The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

Pyridine nucleotide cycling and control of intracellular redox state in relation to poly (ADP-ribose) polymerase activity and nuclear localization of glutathione during exponential growth of Arabidopsis cells in culture.

Science.gov (United States)

Pellny, Till K; Locato, Vittoria; Vivancos, Pedro Diaz; Markovic, Jelena; De Gara, Laura; Pallardó, Federico V; Foyer, Christine H

2009-05-01

Pyridine nucleotides, ascorbate and glutathione are major redox metabolites in plant cells, with specific roles in cellular redox homeostasis and the regulation of the cell cycle. However, the regulation of these metabolite pools during exponential growth and their precise functions in the cell cycle remain to be characterized. The present analysis of the abundance of ascorbate, glutathione, and pyridine nucleotides during exponential growth of Arabidopsis cells in culture provides evidence for the differential regulation of each of these redox pools. Ascorbate was most abundant early in the growth cycle, but glutathione was low at this point. The cellular ascorbate to dehydroascorbate and reduced glutathione (GSH) to glutathione disulphide ratios were high and constant but the pyridine nucleotide pools were largely oxidized over the period of exponential growth and only became more reduced once growth had ceased. The glutathione pool increased in parallel with poly (ADP-ribose) polymerase (PARP) activities and with increases in the abundance of PARP1 and PARP2 mRNAs at a time of high cell cycle activity as indicated by transcriptome information. Marked changes in the intracellular partitioning of GSH between the cytoplasm and nucleus were observed. Extension of the exponential growth phase by dilution or changing the media led to increases in the glutathione and nicotinamide adenine dinucleotide, oxidized form (NAD)-plus-nicotinamide adenine dinucleotide, reduced form (NADH) pools and to higher NAD/NADH ratios but the nicotinamide adenine dinucleotide phosphate, oxidized form (NADP)-plus-nicotinamide adenine dinucleotide phosphate, reduced form (NADPH) pool sizes, and NAPD/NADPH ratios were much less affected. The ascorbate, glutathione, and pyridine nucleotide pools and PARP activity decreased before the exponential growth phase ended. We conclude that there are marked changes in intracellular redox state during the growth cycle but that redox homeostasis is

Structural Basis of Substrate Recognition in Human Nicotinamide N-Methyltransferase

Energy Technology Data Exchange (ETDEWEB)

Peng, Yi; Sartini, Davide; Pozzi, Valentina; Wilk, Dennis; Emanuelli, Monica; Yee, Vivien C. (Case Western); (Politecnica Valencia)

2012-05-02

Nicotinamide N-methyltransferase (NNMT) catalyzes the N-methylation of nicotinamide, pyridines, and other analogues using S-adenosyl-L-methionine as donor. NNMT plays a significant role in the regulation of metabolic pathways and is expressed at markedly high levels in several kinds of cancers, presenting it as a potential molecular target for cancer therapy. We have determined the crystal structure of human NNMT as a ternary complex bound to both the demethylated donor S-adenosyl-L-homocysteine and the acceptor substrate nicotinamide, to 2.7 {angstrom} resolution. These studies reveal the structural basis for nicotinamide binding and highlight several residues in the active site which may play roles in nicotinamide recognition and NNMT catalysis. The functional importance of these residues was probed by mutagenesis. Of three residues near the nicotinamide's amide group, substitution of S201 and S213 had no effect on enzyme activity while replacement of D197 dramatically decreased activity. Substitutions of Y20, whose side chain hydroxyl interacts with both the nicotinamide aromatic ring and AdoHcy carboxylate, also compromised activity. Enzyme kinetics analysis revealed k{sub cat}/K{sub m} decreases of 2-3 orders of magnitude for the D197A and Y20A mutants, confirming the functional importance of these active site residues. The mutants exhibited substantially increased K{sub m} for both NCA and AdoMet and modestly decreased k{sub cat}. MD simulations revealed long-range conformational effects which provide an explanation for the large increase in K{sub m}(AdoMet) for the D197A mutant, which interacts directly only with nicotinamide in the ternary complex crystal structure.

4-Hydroxy-3-methoxybenzaldehyde–nicotinamide (1/1

Directory of Open Access Journals (Sweden)

Fiona N.-F. How

2011-12-01

Full Text Available In the title compound, C6H6N2O·C8H8O3, an equimolar co-crystal of nicotinamide and vanillin, the aromatic ring and the amide fragment of the nicotinamide molecule make a dihedral angle of 32.6 (2°. The vanillin molecule is almost planar, with an r.m.s. deviation for all non-H atoms of 0.0094 Å. The vaniline and nicotinamide aromatic rings are nearly coplanar, the dihedral angle between them being 3.20 (9°. In the crystal, the two components are linked through N—H...O and O—H...N hydrogen bonds into chains along the a axis. The chains are connected via C—H...O interactions, forming a three-dimensional polymeric structure.

The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-11-28

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization of CobB kinetics and inhibition by nicotinamide.

Directory of Open Access Journals (Sweden)

Julia Gallego-Jara

Full Text Available Lysine acetylation has emerged as a global protein regulation system in all domains of life. Sirtuins, or Sir2-like enzymes, are a family of histone deacetylases characterized by their employing NAD+ as a co-substrate. Sirtuins can deacetylate several acetylated proteins, but a consensus substrate recognition sequence has not yet been established. Product inhibition of many eukaryotic sirtuins by nicotinamide and its analogues has been studied in vitro due to their potential role as anticancer agents. In this work, the kinetics of CobB, the main Escherichia coli deacetylase, have been characterized. To our knowledge, this is the first kinetic characterization of a sirtuin employing a fully acetylated and natively folded protein as a substrate. CobB deacetylated several acetyl-CoA synthetase acetylated lysines with a single kinetic rate. In addition, in vitro nicotinamide inhibition of CobB has been characterized, and the intracellular nicotinamide concentrations have been determined under different growth conditions. The results suggest that nicotinamide can act as a CobB regulator in vivo. A nicotinamidase deletion strain was thus phenotypically characterized, and it behaved similarly to the ΔcobB strain. The results of this work demonstrate the potential regulatory role of the nicotinamide metabolite in vivo.

Characterization of CobB kinetics and inhibition by nicotinamide.

Science.gov (United States)

Gallego-Jara, Julia; Écija Conesa, Ana; de Diego Puente, Teresa; Lozano Terol, Gema; Cánovas Díaz, Manuel

2017-01-01

Lysine acetylation has emerged as a global protein regulation system in all domains of life. Sirtuins, or Sir2-like enzymes, are a family of histone deacetylases characterized by their employing NAD+ as a co-substrate. Sirtuins can deacetylate several acetylated proteins, but a consensus substrate recognition sequence has not yet been established. Product inhibition of many eukaryotic sirtuins by nicotinamide and its analogues has been studied in vitro due to their potential role as anticancer agents. In this work, the kinetics of CobB, the main Escherichia coli deacetylase, have been characterized. To our knowledge, this is the first kinetic characterization of a sirtuin employing a fully acetylated and natively folded protein as a substrate. CobB deacetylated several acetyl-CoA synthetase acetylated lysines with a single kinetic rate. In addition, in vitro nicotinamide inhibition of CobB has been characterized, and the intracellular nicotinamide concentrations have been determined under different growth conditions. The results suggest that nicotinamide can act as a CobB regulator in vivo. A nicotinamidase deletion strain was thus phenotypically characterized, and it behaved similarly to the ΔcobB strain. The results of this work demonstrate the potential regulatory role of the nicotinamide metabolite in vivo.

Nicotinamide dependence of uropathogenic Escherichia coli UTI89 and application of nadB as a neutral insertion site.

Science.gov (United States)

Li, Zhaoli; Bouckaert, Julie; Deboeck, Francine; De Greve, Henri; Hernalsteens, Jean-Pierre

2012-03-01

NAD and NADP are ubiquitous in the metabolism of Escherichia coli K-12. NAD auxotrophy can be rendered by mutation in any of the three genes nadB, nadA and nadC. The nadB and nadA genes were defined as antivirulence loci in Shigella spp., as a mutation (mainly in nadB) disrupting the synthesis of quinolinate is required for virulence. Uropathogenic E. coli (UPEC) isolates from acute cystitis patients, exhibiting nicotinamide auxotrophy, were of serotype O18 : K1 : H7. E. coli UTI89, the model uropathogenic and O18 : K1 : H7 strain, requires nicotinamide or quinolinate for growth. A mutation in the nadB gene, encoding L-aspartate oxidase, was shown to be responsible for the nicotinamide requirement of UTI89. This was further confirmed by complementation of UTI89 with a recombinant plasmid harbouring the nadB gene of E. coli K-12. An Ala28Val point mutant of the recombinant plasmid failed to support the growth of UTI89 in minimal medium. This proves that the Ala28Val mutation in the NadB gene of UTI89 completely impedes de novo synthesis of nicotinamide. In spontaneous prototrophic revertants of UTI89, the nadB gene has a Val28Ala mutation. Both analyses implicate that the nicotinamide auxotrophy of UTI89 is caused by a single Ala28Val mutation in NadB. We showed that the same mutation is also present in other NAD auxotrophic E. coli O18 strains. No significant differences were observed between the virulence of isogenic NAD auxotrophic and prototrophic strains in the murine ascending urinary tract infection model. Considering these data, we applied the nadB locus as a neutral site for DNA insertions in the bacterial chromosome. We successfully restored the parental phenotype of a fimH mutant by inserting fimH, with a synthetic em7 promoter, into the nadB gene. This neutral insertion site is of significance for further research on the pathogenicity of UPEC.

pHP-Tethered N-Acyl Carbamate: A Photocage for Nicotinamide.

Science.gov (United States)

Salahi, Farbod; Purohit, Vatsal; Ferraudi, Guillermo; Stauffacher, Cynthia; Wiest, Olaf; Helquist, Paul

2018-05-04

The synthesis of a new photocaged nicotinamide having an N-acyl carbamate linker and a p-hydroxyphenacyl (pHP) chromophore is described. The photophysical and photochemical studies showed an absorption maximum at λ = 330 nm and a quantum yield for release of 11% that are dependent upon both pH and solvent. While the acyl carbamate releases nicotinamide efficiently, a simpler amide linker was inert to photocleavage. This photocaged nicotinamide has significant advantages with respect to quantum yield, absorbance wavelength, rate of release, and solubility that make it the first practical example of a photocaged amide.

Nicotinamide nucleotide transhydrogenase (Nnt) links the substrate requirement in brain mitochondria for hydrogen peroxide removal to the thioredoxin/peroxiredoxin (Trx/Prx) system.

Science.gov (United States)

Lopert, Pamela; Patel, Manisha

2014-05-30

Mitochondrial reactive oxygen species are implicated in the etiology of multiple neurodegenerative diseases, including Parkinson disease. Mitochondria are known to be net producers of ROS, but recently we have shown that brain mitochondria can consume mitochondrial hydrogen peroxide (H2O2) in a respiration-dependent manner predominantly by the thioredoxin/peroxiredoxin system. Here, we sought to determine the mechanism linking mitochondrial respiration with H2O2 catabolism in brain mitochondria and dopaminergic cells. We hypothesized that nicotinamide nucleotide transhydrogenase (Nnt), which utilizes the proton gradient to generate NADPH from NADH and NADP(+), provides the link between mitochondrial respiration and H2O2 detoxification through the thioredoxin/peroxiredoxin system. Pharmacological inhibition of Nnt in isolated brain mitochondria significantly decreased their ability to consume H2O2 in the presence, but not absence, of respiration substrates. Nnt inhibition in liver mitochondria, which do not require substrates to detoxify H2O2, had no effect. Pharmacological inhibition or lentiviral knockdown of Nnt in N27 dopaminergic cells (a) decreased H2O2 catabolism, (b) decreased NADPH and increased NADP(+) levels, and (c) decreased basal, spare, and maximal mitochondrial oxygen consumption rates. Nnt-deficient cells possessed higher levels of oxidized mitochondrial Prx, which rendered them more susceptible to steady-state increases in H2O2 and cell death following exposure to subtoxic levels of paraquat. These data implicate Nnt as the critical link between the metabolic and H2O2 antioxidant function in brain mitochondria and suggests Nnt as a potential therapeutic target to improve the redox balance in conditions of oxidative stress associated with neurodegenerative diseases. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Prevention of photoimmunosuppression and photocarcinogenesis by topical nicotinamide

International Nuclear Information System (INIS)

Gensler, H.L.

1997-01-01

Ultraviolet (UV) B irradiation leads to a potent immunosuppression of the capacity to reject syngeneic, antigenic tumors. If this immunosuppression is critical for the development of most skin tumors, then its prevention should result in prevention of photocarcinogenesis. We previously showed a correlation between the inhibition of photoimmunosuppression and prevention of photocarcinogenesis by dl-alpha-tocopherol, tannic acid, or alpha-difluoro methylornithine. The current study was designed to determine whether topical nicotinamide, the active form of vitamin B-3, or niacin, prevents immunosuppression and skin cancer in UV-irradiated mice. In a passive transfer assay for immunosuppression, splenocytes from UV-irradiated mice enhanced the growth of antigenic tumor challenges in recipient mice. Treatment of the UV-irradiated mice with 40 micromoles of nicotinamide twice weekly starting two weeks before UV irradiation and throughout the experiment prevented this immunosuppresion. UVB irradiation consisted of five weekly 30-minute exposures to banks of six FS40 Westinghouse fluorescent sunlamps. Mice received approximatety 6.2 x 10(5) J/m(2) in the passive transfer assays and 1.09 x 10(6) J/m(2) in the photocarcinogenesis studies. Application of nicotinamide to UV-irradiated mice reduced skin tumor incidence from 75% to 42.5% (p = 0.016, Cox proportional hazards analysis). Thus topical nicotinamide prevented the immunosuppression and skin tumor induction by UVB irradiation

Cyclic voltammetric response of nicotinic acid and nicotinamide on a polycrystalline gold electrode

International Nuclear Information System (INIS)

Wang Xiaoxia; Yang Nianjun; Wan Qijin

2006-01-01

The oxidation of nicotinic acid and nicotinamide on a polycrystalline gold electrode occurred at almost same potentials but their reduction did at different peak potentials. The redox reaction mechanisms of nicotinic acid and nicotinamide were rationalized by the formation/disappearance of the new nitrogen-oxygen bonds in the pyridine rings by means of cyclic voltammetry and bulk electrolysis. The anodic currents of nicotinic acid and nicotinamide were controlled by diffusion, while the cathodic ones by adsorption. The difference in the cathodic peak potentials of nicotinic acid and nicotinamide on the polycrystalline gold electrode is attributed to the effect of the electron densities of remote substituents on the pyridine rings. The cathodic peak currents at about 0.20 V were linear with their concentrations in the range of 2.4 mM to 2.7 μM and 2.4 mM to 3.3 μM with detection limits of 0.27 and 0.33 μM for nicotinic acid and nicotinamide, respectively. Voltammetry was then adopted for the selective monitoring the content of nicotinic acid and nicotinamide in pharmaceuticals

European Nicotinamide Diabetes Intervention Trial (ENDIT)

DEFF Research Database (Denmark)

Gale, E A M; Bingley, P J; Emmett, C L

2004-01-01

with a pseudorandom number generator and we used size balanced blocks of four and stratified by age and national group. Primary outcome was development of diabetes, as defined by WHO criteria. Analysis was done on an intention-to-treat basis. FINDINGS: There was no difference in the development of diabetes between...... secretion. INTERPRETATION: Large-scale controlled trials of interventions designed to prevent the onset of type 1 diabetes are feasible, but nicotinamide was ineffective at the dose we used.......BACKGROUND: Results of studies in animals and human beings suggest that type 1 diabetes is preventable. Nicotinamide prevents autoimmune diabetes in animal models, possibly through inhibition of the DNA repair enzyme poly-ADP-ribose polymerase and prevention of beta-cell NAD depletion. We aimed...

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Meat and Nicotinamide: A Causal Role in Human Evolution, History, and Demographics

Directory of Open Access Journals (Sweden)

Adrian C Williams

2017-04-01

Full Text Available Hunting for meat was a critical step in all animal and human evolution. A key brain-trophic element in meat is vitamin B 3 /nicotinamide. The supply of meat and nicotinamide steadily increased from the Cambrian origin of animal predators ratcheting ever larger brains. This culminated in the 3-million-year evolution of Homo sapiens and our overall demographic success. We view human evolution, recent history, and agricultural and demographic transitions in the light of meat and nicotinamide intake. A biochemical and immunological switch is highlighted that affects fertility in the ‘de novo’ tryptophan-to-kynurenine-nicotinamide ‘immune tolerance’ pathway. Longevity relates to nicotinamide adenine dinucleotide consumer pathways. High meat intake correlates with moderate fertility, high intelligence, good health, and longevity with consequent population stability, whereas low meat/high cereal intake (short of starvation correlates with high fertility, disease, and population booms and busts. Too high a meat intake and fertility falls below replacement levels. Reducing variances in meat consumption might help stabilise population growth and improve human capital.

Deracemization of Axially Chiral Nicotinamides by Dynamic Salt Formation with Enantiopure Dibenzoyltartaric Acid (DBTA

Directory of Open Access Journals (Sweden)

Fumitoshi Yagishita

2013-11-01

Full Text Available Dynamic atroposelective resolution of chiral salts derived from oily racemic nicotinamides and enantiopure dibenzoyltartaric acid (DBTA was achieved by crystallization. The absolute structures of the axial chiral nicotinamides were determined by X-ray structural analysis. The chirality could be controlled by the selection of enantiopure DBTA as a chiral auxiliary. The axial chirality generated by dynamic salt formation was retained for a long period after dissolving the chiral salt in solution even after removal of the chiral acid. The rate of racemization of nicotinamides could be controlled based on the temperature and solvent properties, and that of the salts was prolonged compared to free nicotinamides, as the molecular structure of the pyridinium ion in the salts was different from that of acid-free nicotinamides.

Nicotinamide induces differentiation of embryonic stem cells into insulin-secreting cells

International Nuclear Information System (INIS)

Vaca, Pilar; Berna, Genoveva; Araujo, Raquel; Carneiro, Everardo M.; Bedoya, Francisco J.; Soria, Bernat; Martin, Franz

2008-01-01

The poly(ADP-ribose) polymerase (PARP) inhibitor, nicotinamide, induces differentiation and maturation of fetal pancreatic cells. In addition, we have previously reported evidence that nicotinamide increases the insulin content of cells differentiated from embryonic stem (ES) cells, but the possibility of nicotinamide acting as a differentiating agent on its own has never been completely explored. Islet cell differentiation was studied by: (i) X-gal staining after neomycin selection; (ii) BrdU studies; (iii) single and double immunohistochemistry for insulin, C-peptide and Glut-2; (iv) insulin and C-peptide content and secretion assays; and (v) transplantation of differentiated cells, under the kidney capsule, into streptozotocin (STZ)-diabetic mice. Here we show that undifferentiated mouse ES cells treated with nicotinamide: (i) showed an 80% decrease in cell proliferation; (ii) co-expressed insulin, C-peptide and Glut-2; (iii) had values of insulin and C-peptide corresponding to 10% of normal mouse islets; (iv) released insulin and C-peptide in response to stimulatory glucose concentrations; and (v) after transplantation into diabetic mice, normalized blood glucose levels over 7 weeks. Our data indicate that nicotinamide decreases ES cell proliferation and induces differentiation into insulin-secreting cells. Both aspects are very important when thinking about cell therapy for the treatment of diabetes based on ES cells

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

Radiotherapy and chemotherapy with or without carbogen and nicotinamide in inoperable biopsy-proven glioblastoma multiforme

International Nuclear Information System (INIS)

Simon, Jean-Marc; Noeel, Georges; Chiras, Jacques; Khe, H.-X.; Delattre, Jean-Yves; Baillet, Francois; Mazeron, Jean-Jacques

2003-01-01

Background: Nicotinamide and carbogen have been shown to enhance the radiation effect in tumour models. Purpose: Prospective evaluation of the toxicity and efficacy of carbogen and nicotinamide with external beam radiotherapy in the management of inoperable glioblastoma. Patients and methods: From April 1995 to December 1997, 33 patients with inoperable biopsy-proven glioblastoma multiforme (GBM) were enrolled in a phase II trial, to undergo radiotherapy (59.4 Gy in 1.8 Gy/fraction), intra-arterial cerebral chemotherapy (ACNU 100 mg/m 2 , three cycles), carbogen breathing (15 l/min), and nicotinamide (85 mg/kg). This experimental group was compared to a control group of 38 patients with inoperable GBM treated with radiotherapy and three cycles of nitrosourea-based chemotherapy from January 1990 to March 1995, in our institution. Results: In the experimental group, carbogen breathing was well tolerated, but only 51.5% of patients completed daily nicotinamide over the 6.5-week treatment period. Nausea and vomiting were the most frequent side effects of nicotinamide. No significant difference in overall survival was observed among the two treatment groups: median survival times were 36.7 and 35.3 weeks for patients treated with carbogen and nicotinamide, and for those treated in the control group, respectively. Conclusion: The association of carbogen and nicotinamide with radiotherapy is feasible, but tolerable only in 51.5% of patients with GBM. Carbogen and nicotinamide did not appear to modify the evolution of glioblastoma

Glaucoma as a Metabolic Optic Neuropathy: Making the Case for Nicotinamide Treatment in Glaucoma.

Science.gov (United States)

Williams, Pete A; Harder, Jeffrey M; John, Simon W M

2017-12-01

Mitochondrial dysfunction may be an important, if not essential, component of human glaucoma. Using transcriptomics followed by molecular and neurobiological techniques, we have recently demonstrated that mitochondrial dysfunction within retinal ganglion cells is an early feature in the DBA/2J mouse model of inherited glaucoma. Guided by these findings, we discovered that the retinal level of nicotinamide adenine dinucleotide (NAD, a key molecule for mitochondrial health) declines in an age-dependent manner. We hypothesized that this decline in NAD renders retinal ganglion cells susceptible to damage during periods of elevated intraocular pressure. To replete NAD levels in this glaucoma, we administered nicotinamide (the amide of vitamin B3). At the lowest dose tested, nicotinamide robustly protected from glaucoma (~70% of eyes had no detectable glaucomatous neurodegeneration). At this dose, nicotinamide had no influence on intraocular pressure and so its effect was neuroprotective. At the highest dose tested, 93% of eyes had no detectable glaucoma. This represents a ~10-fold decrease in the risk of developing glaucoma. At this dose, intraocular pressure still became elevated but there was a reduction in the degree of elevation showing an additional benefit. Thus, nicotinamide is unexpectedly potent at preventing this glaucoma and is an attractive option for glaucoma therapeutics. Our findings demonstrate the promise for both preventing and treating glaucoma by interventions that bolster metabolism during increasing age and during periods of elevated intraocular pressure. Nicotinamide prevents age-related declines in NAD (a decline that occurs in different genetic contexts and species). NAD precursors are reported to protect from a variety of neurodegenerative conditions. Thus, nicotinamide may provide a much needed neuroprotective treatment against human glaucoma. This manuscript summarizes human data implicating mitochondria in glaucoma, and argues for studies to

Nicotinamide induces mitochondrial-mediated apoptosis through oxidative stress in human cervical cancer HeLa cells.

Science.gov (United States)

Feng, Yi; Wang, Yonghua; Jiang, Chengrui; Fang, Zishui; Zhang, Zhiqiang; Lin, Xiaoying; Sun, Liwei; Jiang, Weiying

2017-07-15

Nicotinamide participates in energy metabolism and influences cellular redox status and modulates multiple pathways related with both cellular survival and death. Recent studies have shown that it induced proliferation inhibition and apoptosis in many cancer cells. However, little is known about the effects of nicotinamide on human cervical cancer cells. We aimed to evaluate the effects of the indicated concentrations nicotinamide on cell proliferation, apoptosis and redox-related parameters in HeLa cells and investigated the apoptotic mechanism. After the treatment of the indicated concentrations nicotinamide, HeLa cell proliferation was evaluated by the CCK-8 assay and the production of ROS (reactive oxygen species) was measured using 2',7'-Dichlorofluorescin diacetate. The apoptotic effect was confirmed by observing the cellular and nuclear morphologies with fluorescence microscope and apoptotic rate of HeLa cell apoptosis was measured by flow cytometry using Annexin-V method. Moreover, we examined the mitochondrial membrane potential by JC-1 method and measured the expression of apoptosis related genes using qRT-PCR and immunoblotting. Nicotinamide restrained the HeLa cell proliferation and significantly increased the accumulation of ROS and depletion of GSH at relatively high concentrations. Furthermore, nicotinamide promoted HeLa cell apoptosis via the intrinsic mitochondrial apoptotic pathway. Our study revealed that nicotinamide induced the apoptosis through oxidative stress and intrinsic mitochondrial apoptotic pathways in HeLa cell. The results emerge that nicotinamide may be an inexpensive, safe and promising therapeutic agent or a neoadjuvant chemotherapy for cervical cancer patients, as well useful to find new drugs for cervical cancer therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

Concentrations of Nicotinamide in Plasma by RP-HPLC With Fluorescence Detection

Directory of Open Access Journals (Sweden)

Pan Zhipeng

2016-01-01

Full Text Available The purpose of this study is to establish a new method for detecting nicotinamide concentration in plasma. In the experiment, the high performance liquid chromatography (HPLC method was used, with a fluorescence detector. The nicotinamide in the plasma was first converted to N1- methylnicotinamide, then reacted with acetophenone under certain conditions to produce fluorescent derivatives for testing. The method is a kind of highly sensitive detection, of which the lower limit is 10 ng/mL, the recovery rate is between 92.75% and 105.13%, and the relative standard deviation (RSD is between 3.76% and 4.43%. The results showed that this measurement method is accurate, sensitive and rapid. It meets the requirements of the experiment, and applies to the detection of nicotinamide concentration in plasma.

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

OpenAIRE

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

Cocrystal of Ibuprofen–Nicotinamide: Solid-State Characterization and In Vivo Analgesic Activity Evaluation

Directory of Open Access Journals (Sweden)

Yori Yuliandra

2018-06-01

Full Text Available Ibuprofen is classified as a BCS class II drug which has low solubility and high permeability. We conducted the formation of the cocrystalline phase of ibuprofen with coformer nicotinamide to increase its solubility. The purpose of this study was to characterize the solid state of cocrystalline phase of ibuprofen-nicotinamide, determine the solubility, and evaluate its in vivo analgesic activity. The cocrystal of ibuprofen-nicotinamide was prepared by a slow evaporation method. The solid-state characterization was conducted by powder X-ray diffraction (PXRD analysis, differential thermal analysis (DTA, and scanning electron microscopy (SEM. To investigate the in vivo analgesic activity, 28 male Swiss-Webster mice were injected with acetic acid 0.5% following oral administration of intact ibuprofen, physical mixture, and its cocrystalline phase with nicotinamide (equivalent to 26 mg/kg ibuprofen. The number of writhes was counted, and pain inhibition was calculated. All data were analyzed with one-way ANOVA followed by Duncan’s Multiple Range Test (95% confidence interval. The results revealed that a new cocrystalline phase was successfully formed. The solubility testing showed that the cocrystal formation enhanced the solubility significantly as compared with the physical mixture and intact ibuprofen. A significant increase in the analgesic activity of cocrystal ibuprofen-nicotinamide was also confirmed.

Nicotinamide inhibits vasculogenic mimicry, an alternative vascularization pathway observed in highly aggressive melanoma.

Directory of Open Access Journals (Sweden)

Orit Itzhaki

Full Text Available Vasculogenic mimicry (VM describes functional vascular channels composed only of tumor cells and its presence predicts poor prognosis in melanoma patients. Inhibition of this alternative vascularization pathway might be of clinical importance, especially as several anti-angiogenic therapies targeting endothelial cells are largely ineffective in melanoma. We show the presence of VM structures histologically in a series of human melanoma lesions and demonstrate that cell cultures derived from these lesions form tubes in 3D cultures ex vivo. We tested the ability of nicotinamide, the amide form of vitamin B3 (niacin, which acts as an epigenetic gene regulator through unique cellular pathways, to modify VM. Nicotinamide effectively inhibited the formation of VM structures and destroyed already formed ones, in a dose-dependent manner. Remarkably, VM formation capacity remained suppressed even one month after the complete withdrawal of Nicotimamid. The inhibitory effect of nicotinamide on VM formation could be at least partially explained by a nicotinamide-driven downregulation of vascular endothelial cadherin (VE-Cadherin, which is known to have a central role in VM. Further major changes in the expression profile of hundreds of genes, most of them clustered in biologically-relevant clusters, were observed. In addition, nicotinamide significantly inhibited melanoma cell proliferation, but had an opposite effect on their invasion capacity. Cell cycle analysis indicated moderate changes in apoptotic indices. Therefore, nicotinamide could be further used to unravel new biological mechanisms that drive VM and tumor progression. Targeting VM, especially in combination with anti-angiogenic strategies, is expected to be synergistic and might yield substantial anti neoplastic effects in a variety of malignancies.

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

Big Brains, Meat, Tuberculosis, and the Nicotinamide Switches: Co-Evolutionary Relationships with Modern Repercussions?

Directory of Open Access Journals (Sweden)

Adrian C. Williams

2013-01-01

Full Text Available Meat-eating was a game changer for human evolution. We suggest that the limiting factors for expanding brains earlier were scarcities of nicotinamide and tryptophan. In humans and some other omnivores, lack of meat causes these deficiencies. Nicotinamide adenine dinucleotide (NADH is necessary to synthesize adenosine triphosphate (ATP via either glycolysis or via the mitochondrial respiratory chain. NAD consumption is also necessary for developmental and repair circuits. Inadequate supplies result in “de-evolutionary” brain atrophy, as seen with pellagra. If trophic nicotinamide/tryptophan was a “prime mover” in building bigger brains, back-up mechanisms should have evolved. One strategy may be to recruit extra gut symbionts that produce NADH precursors or export nicotinamide (though this may cause diarrhea. We propose a novel supplier TB that co-evolved early, which did not originally and does not now inevitably cause disease. TB has highly paradoxical immunology for a pathogen, and secretes and is inhibited by nicotinamide and its analogue, isoniazid. Sharp declines in TB and diarrhea correlated with increased meat intake in the past, suggesting that dietary vitamin B 3 and tryptophan deficiencies (also associated with poor cognition and decreased lifespans are still common where meat is unaffordable.

A therapeutic benefit from combining normobaric carbogen or oxygen with nicotinamide in fractionated X-ray treatments

International Nuclear Information System (INIS)

Kjellen, E.; Joiner, M.C.; Collier, J.M.; Johns, H.; Rojas, A.

1991-01-01

The ability of normobaric oxygen and carbogen (95 percent O 2 + 5 percent CO 2 ) combined with nicotinamide to enhance the radiosensitivity of two rodent adenocarcinomas and of mouse skin and kidneys was compared with the effects of radiation in air and without the drug. A comparison of the results in tumors and normal tissues showed that significant therapeutic benefit was obtained with normobaric oxygen and carbogen combined with nicotinamide. Toxic side effects of the treatment are unlikely, as prolonged administration of nicotinamide is well tolerated in man. The combination of normobaric carbogen with nicotinamide could be an effective method of enhancing tumor radiosensitivity in clinical radiotherapy where hypoxia limits the outcome of treatment. (author). 45 refs.; 4 fig.; 4 tabs

New function for Escherichia coli xanthosine phophorylase (xapA): genetic and biochemical evidences on its participation in NAD+ salvage from nicotinamide

Science.gov (United States)

2014-01-01

Background In an effort to reconstitute the NAD+ synthetic pathway in Escherichia coli (E. coli), we produced a set of gene knockout mutants with deficiencies in previously well-defined NAD+de novo and salvage pathways. Unexpectedly, the mutant deficient in NAD+de novo and salvage pathway I could grow in M9/nicotinamide medium, which was contradictory to the proposed classic NAD+ metabolism of E. coli. Such E. coli mutagenesis assay suggested the presence of an undefined machinery to feed nicotinamide into the NAD+ biosynthesis. We wanted to verify whether xanthosine phophorylase (xapA) contributed to a new NAD+ salvage pathway from nicotinamide. Results Additional knockout of xapA further slowed down the bacterial growth in M9/nicotinamide medium, whereas the complementation of xapA restored the growth phenotype. To further validate the new function of xapA, we cloned and expressed E. coli xapA as a recombinant soluble protein. Biochemical assay confirmed that xapA was capable of using nicotinamide as a substrate for nicotinamide riboside formation. Conclusions Both the genetic and biochemical evidences indicated that xapA could convert nicotinamide to nicotinamide riboside in E. coli, albeit with relatively weak activity, indicating that xapA may contribute to a second NAD+ salvage pathway from nicotinamide. We speculate that this xapA-mediated NAD+ salvage pathway might be significant in some bacteria lacking NAD+de novo and NAD+ salvage pathway I or II, to not only use nicotinamide riboside, but also nicotinamide as precursors to synthesize NAD+. However, this speculation needs to be experimentally tested. PMID:24506841

Radiosensitization effects of nicotinamide on malignant and normal mouse tissue

International Nuclear Information System (INIS)

Jonsson, G.G.; Kjellen, E.; Pero, R.W.; Cameron, R.

1985-01-01

Inhibitors of the chromatin-associated enzyme adenosine diphosphate ribosyltransferase have been found to inhibit DNA strand rejoining and to potentiate lethality of DNA-damaging agents both in vivo and in vitro. The authors have in this work examined the radiosensitizing potential of one such inhibitor, nicotinamide, on tumor tissue by using transplanted C3H mouse mammary adenocarcinomas and on normal tissue in a tail-stunting experiment using BALB/cA mice. The data indicate a radiosensitizing effect of nicotinamide on tumor cells as well as on normal tissue. The data indicate a possible role of adenosine diphosphate ribosyltransferase inhibitors as a sensitizing agent in the radiotherapy of malignant tumors

Biosynthesis of NAD from nicotinic acid and nicotinamide by resting cells of Arthrobacter globiformis

International Nuclear Information System (INIS)

Kuwahara, Masaaki

1978-01-01

Isotopically labeled nicotinic acid and nicotinamide were incorporated into the metabolites of nicotinic acid-dependent pathway (Preiss-Handler pathway) of the NAD biosynthesis by resting cells of Arthrobacter globiformis. Azaserine and adenosine markedly stimulated the accumulation of NAD in the cells. Radioactive nicotinic acid and nicotinamide were also incorporated into an unknown compound when the cells were incubated in the presence of azaserine. Cell-free extract of the organism showed the NAD synthetase activity, which required ammonium ion and ATP for the amidation of deamido-NAD. Adenosine inhibited the enzyme activity. The organism possessed nicotinamidase, suggesting deamidation is the first step in the biosynthesis of NAD from nicotinamide. The activity was inhibited by NAD, NADP and NMN. (auth.)

Simvastatin-nicotinamide co-crystal: design, preparation and ...

African Journals Online (AJOL)

Purpose: To improve the solubility of simvastatin (SV) by co-crystallization using nicotinamide (Nic) as co-crystal agent (co-former). Methods: In silico molecular modeling of Nic counter to SV were investigated using Auto Dock 4.2. Cocrystal of Nic-SV was obtained by solvent evaporation (SE) using an equimolar ratio of Nic ...

Different effects of histone deacetylase inhibitors nicotinamide and trichostatin A (TSA) in C17.2 neural stem cells.

Science.gov (United States)

Wang, Haifeng; Cheng, Hua; Wang, Kai; Wen, Tieqiao

2012-11-01

Histone deacetylase inhibitors are involved in proliferation, apoptosis, cell cycle, mRNA transcription, and protein expression in various cells. However, the molecular mechanism underlying such functions is still not fully clear. In this study, we used C17.2 neural stem cell (NSC) line as a model to evaluate the effects of nicotinamide and trichostatin A (TSA) on cell characteristics. Results show that nicotinamide and TSA greatly inhibit cell growth, lead to cell morphology changes, and effectively induce cell apoptosis in a dose-dependent manner. Western blot analyses confirmed that nicotinamide significantly decreases the expression of bcl-2 and p38. Further insight into the molecular mechanisms shows the suppression of phosphorylation in eukaryotic initiation factor 4E-binding protein 1 (4EBP1) by nicotinamide, whereas, an increased expression of bcl-2 and p38 and phosphorylation of 4EBP1 by TSA. However, both nicotinamide and TSA significantly increase the expression of cytochrome c (cyt c). These results strongly suggest that bcl-2, p38, cyt c, and p-4EBP1 could suppress proliferation and induce apoptosis of C17.2 NSCs mediated by histone deacetylase inhibitors, nicotinamide and TSA, involving different molecular mechanisms.

21 CFR 172.315 - Nicotinamide-ascorbic acid complex.

Science.gov (United States)

2010-04-01

... 172.315 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.315 Nicotinamide-ascorbic acid complex...

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

A Rapid and Efficient Assay for the Characterization of Substrates and Inhibitors of Nicotinamide N-Methyltransferase

NARCIS (Netherlands)

van Haren, Matthijs J; Sastre Torano, Javier; Sartini, Davide; Emanuelli, Monica; Parsons, Richard B; Martin, Nathaniel I

2016-01-01

Nicotinamide N-methyltransferase (NNMT) is one of the most abundant small molecule methyltransferases in the human body and is primarily responsible for the N-methylation of the nicotinamide (vitamin B3). Employing the cofactor S-adenosyl-l-methionine, NNMT transfers a methyl group to the pyridine

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

Science.gov (United States)

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-10-11

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

Science.gov (United States)

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

Plasmid-encoded diacetyl (acetoin) reductase in Leuconostoc pseudomesenteroides

DEFF Research Database (Denmark)

Rattray, Fergal P; Myling-Petersen, Dorte; Larsen, Dianna

2003-01-01

A plasmid-borne diacetyl (acetoin) reductase (butA) from Leuconostoc pseudomesenteroides CHCC2114 was sequenced and cloned. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 257 amino acids which had high identity at the amino acid level to diacetyl (acetoin...

[The influence of fasting, of a hyperprotein diet and of nicotinamide on hepatic L-threonine deaminase].

Science.gov (United States)

Aleo, M F; Casella, A; Marinello, E

1981-09-15

The induction of L-threonine deaminase, following nicotinamide injection has been studied: the effect of fasting and of hyperproteic diet have been also taken in consideration. Maximal induction is observed after 5 days hyperproteic diet, and is additional only with nicotinamide treatment. Results are interpreted assuming a different hepatic content and behavior of multiple forms of the enzyme.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

Hyperthermophilic Archaeon Thermococcus kodakarensis Utilizes a Four-Step Pathway for NAD+ Salvage through Nicotinamide Deamination.

Science.gov (United States)

Hachisuka, Shin-Ichi; Sato, Takaaki; Atomi, Haruyuki

2018-06-01

Many organisms possess pathways that regenerate NAD + from its degradation products, and two pathways are known to salvage NAD + from nicotinamide (Nm). One is a four-step pathway that proceeds through deamination of Nm to nicotinic acid (Na) by Nm deamidase and phosphoribosylation to nicotinic acid mononucleotide (NaMN), followed by adenylylation and amidation. Another is a two-step pathway that does not involve deamination and directly proceeds with the phosphoribosylation of Nm to nicotinamide mononucleotide (NMN), followed by adenylylation. Judging from genome sequence data, the hyperthermophilic archaeon Thermococcus kodakarensis is supposed to utilize the four-step pathway, but the fact that the adenylyltransferase encoded by TK0067 recognizes both NMN and NaMN also raises the possibility of a two-step salvage mechanism. Here, we examined the substrate specificity of the recombinant TK1676 protein, annotated as nicotinic acid phosphoribosyltransferase. The TK1676 protein displayed significant activity toward Na and phosphoribosyl pyrophosphate (PRPP) and only trace activity with Nm and PRPP. We further performed genetic analyses on TK0218 (quinolinic acid phosphoribosyltransferase) and TK1650 (Nm deamidase), involved in de novo biosynthesis and four-step salvage of NAD + , respectively. The ΔTK0218 mutant cells displayed growth defects in a minimal synthetic medium, but growth was fully restored with the addition of Na or Nm. The ΔTK0218 ΔTK1650 mutant cells did not display growth in the minimal medium, and growth was restored with the addition of Na but not Nm. The enzymatic and genetic analyses strongly suggest that NAD + salvage in T. kodakarensis requires deamination of Nm and proceeds through the four-step pathway. IMPORTANCE Hyperthermophiles must constantly deal with increased degradation rates of their biomolecules due to their high growth temperatures. Here, we identified the pathway that regenerates NAD + from nicotinamide (Nm) in the

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

A two year observational study of nicotinamide and intensive insulin therapy in patients with recent onset type 1 diabetes mellitus.

Science.gov (United States)

Crinó, A; Schiaffini, R; Ciampalini, P; Suraci, M C; Manfrini, S; Visalli, N; Matteoli, M C; Patera, P; Buzzetti, R; Guglielmi, C; Spera, S; Costanza, F; Fioriti, E; Pitocco, D; Pozzilli, P

2005-08-01

A number of trials have evaluated residual beta-cell function in patients with recent onset type 1 diabetes mellitus (DM1) treated with nicotinamide in addition to intensive insulin therapy (IIT). In most studies, only a slight decline of C-peptide secretion was observed 12 months after diagnosis; however, no data is available on C-peptide secretion and metabolic control in patients continuing nicotinamide and IIT for up to 2 years after diagnosis. We retrospectively analysed data from 25 patients (mean age 14.7 years +/- 5 SD) with DM1 in whom nicotinamide at a dose of 25 mg/kg b. wt. was added from diagnosis (< 4 weeks) to IIT (three injections of regular insulin at meals + one NPH at bed time) and continued for up to 2 years after diagnosis. Data were also analysed from patients (n = 27) in whom IIT was introduced at diagnosis and who were similarly followed for 2 years. Baseline C-peptide as well as insulin dose and HbA1c levels were evaluated at 12 and 24 months after diagnosis. In the course of the follow-up, patients on nicotinamide + IIT or IIT alone did not significantly differ in terms of C-peptide secretion (values at 24 months in the two groups were 0.19 +/- 0.24 nM vs 0.19 +/- 0.13 nM, respectively). Insulin requirement (0.6 +/- 0.3 U/kg/day vs 0.7 +/- 0.2 U/kg/day at 24 months, respectively) did not differ between the two groups. However, HbA1c was significantly lower 2 years after diagnosis in patients treated with nicotinamide + IIT (6.09 +/- 0.9% vs 6.98 +/- 0.9%, respectively, p < 0.01). No adverse effects were observed in patients receiving nicotinamide for 2 years. Implementation of IIT with the addition of nicotinamide at diagnosis continued for 2 years improves metabolic control as assessed by HbA1c. In both nicotinamide and control patients, no decline in C-peptide was detected 2 years after diagnosis, indicating that IIT preserves C-peptide secretion. We conclude that nicotinamide + IIT at diagnosis of DM1 prolonged for up to 2 years can be

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Effects of radiosensitising agent nicotinamide on relative tissue perfusion and kidney junction in C3H mice

International Nuclear Information System (INIS)

Honess, D.J.; Bleehen, N.M.

1993-01-01

Nicotinamide is an effective radiosensitiser of murine tumours, functioning by improving tumour perfusion by decreasing the proportion of intermittently closed capillaries. The effect of nicotinamide on relative tissue perfusion of RIF-1 tumour and normal skin, muscle, lung, liver, kidney and spleen were investigated using the 86 Rb extraction technique. A dose of 1000 mg/kg was shown to have transient effects on tumour, skin and lung perfusion but to have sustained effects on muscle (a drop to 80% of control), liver, kidney and spleen (with increased ranging from 165% to 280% of control) from 0.5 to 4 h after treatment i.e. during the period of maximum radiosensitisation. These increases were evident at doses as low as 100 mg/kg. The data suggest that the radiosensitisation induced by nicotinamide in the mouse may be associated with these perfusion changes. Nicotinamide was also shown to have a substantial inhibitory effect on renal function, inhibiting 51 CrEDTA clearance by a factor (± 2 SE) of 2.56 ± 0.19 and 125 I-iodohippurate clearance by a factor of 2.07 ± 0.45 at 1000 mg/kg. These effects were shown to be dose-related, and to be evident at doses from 400 mg/kg upwards. This suggests that nicotinamide potentiation of co-administered cytotoxic agents may be mediated by reduced renal clearance of the cytotoxic drug, thus increasing the plasma half-life. (author)

Increasing NAD Synthesis in Muscle via Nicotinamide Phosphoribosyltransferase Is Not Sufficient to Promote Oxidative Metabolism*

Science.gov (United States)

Frederick, David W.; Davis, James G.; Dávila, Antonio; Agarwal, Beamon; Michan, Shaday; Puchowicz, Michelle A.; Nakamaru-Ogiso, Eiko; Baur, Joseph A.

2015-01-01

The NAD biosynthetic precursors nicotinamide mononucleotide and nicotinamide riboside are reported to confer resistance to metabolic defects induced by high fat feeding in part by promoting oxidative metabolism in skeletal muscle. Similar effects are obtained by germ line deletion of major NAD-consuming enzymes, suggesting that the bioavailability of NAD is limiting for maximal oxidative capacity. However, because of their systemic nature, the degree to which these interventions exert cell- or tissue-autonomous effects is unclear. Here, we report a tissue-specific approach to increase NAD biosynthesis only in muscle by overexpressing nicotinamide phosphoribosyltransferase, the rate-limiting enzyme in the salvage pathway that converts nicotinamide to NAD (mNAMPT mice). These mice display a ∼50% increase in skeletal muscle NAD levels, comparable with the effects of dietary NAD precursors, exercise regimens, or loss of poly(ADP-ribose) polymerases yet surprisingly do not exhibit changes in muscle mitochondrial biogenesis or mitochondrial function and are equally susceptible to the metabolic consequences of high fat feeding. We further report that chronic elevation of muscle NAD in vivo does not perturb the NAD/NADH redox ratio. These studies reveal for the first time the metabolic effects of tissue-specific increases in NAD synthesis and suggest that critical sites of action for supplemental NAD precursors reside outside of the heart and skeletal muscle. PMID:25411251

Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

African Journals Online (AJOL)

The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

Science.gov (United States)

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Validation of diffuse correlation spectroscopy sensitivity to nicotinamide-induced blood flow elevation in the murine hindlimb using the fluorescent microsphere technique

Science.gov (United States)

Proctor, Ashley R.; Ramirez, Gabriel A.; Han, Songfeng; Liu, Ziping; Bubel, Tracy M.; Choe, Regine

2018-03-01

Nicotinamide has been shown to affect blood flow in both tumor and normal tissues, including skeletal muscle. Intraperitoneal injection of nicotinamide was used as a simple intervention to test the sensitivity of noninvasive diffuse correlation spectroscopy (DCS) to changes in blood flow in the murine left quadriceps femoris skeletal muscle. DCS was then compared with the gold-standard fluorescent microsphere (FM) technique for validation. The nicotinamide dose-response experiment showed that relative blood flow measured by DCS increased following treatment with 500- and 1000-mg / kg nicotinamide. The DCS and FM technique comparison showed that blood flow index measured by DCS was correlated with FM counts quantified by image analysis. The results of this study show that DCS is sensitive to nicotinamide-induced blood flow elevation in the murine left quadriceps femoris. Additionally, the results of the comparison were consistent with similar studies in higher-order animal models, suggesting that mouse models can be effectively employed to investigate the utility of DCS for various blood flow measurement applications.

Metabolomics analysis of metabolic effects of nicotinamide phosphoribosyltransferase (NAMPT inhibition on human cancer cells.

Directory of Open Access Journals (Sweden)

Vladimir Tolstikov

Full Text Available Nicotinamide phosphoribosyltransferase (NAMPT plays an important role in cellular bioenergetics. It is responsible for converting nicotinamide to nicotinamide adenine dinucleotide, an essential molecule in cellular metabolism. NAMPT has been extensively studied over the past decade due to its role as a key regulator of nicotinamide adenine dinucleotide-consuming enzymes. NAMPT is also known as a potential target for therapeutic intervention due to its involvement in disease. In the current study, we used a global mass spectrometry-based metabolomic approach to investigate the effects of FK866, a small molecule inhibitor of NAMPT currently in clinical trials, on metabolic perturbations in human cancer cells. We treated A2780 (ovarian cancer and HCT-116 (colorectal cancer cell lines with FK866 in the presence and absence of nicotinic acid. Significant changes were observed in the amino acids metabolism and the purine and pyrimidine metabolism. We also observed metabolic alterations in glycolysis, the citric acid cycle (TCA, and the pentose phosphate pathway. To expand the range of the detected polar metabolites and improve data confidence, we applied a global metabolomics profiling platform by using both non-targeted and targeted hydrophilic (HILIC-LC-MS and GC-MS analysis. We used Ingenuity Knowledge Base to facilitate the projection of metabolomics data onto metabolic pathways. Several metabolic pathways showed differential responses to FK866 based on several matches to the list of annotated metabolites. This study suggests that global metabolomics can be a useful tool in pharmacological studies of the mechanism of action of drugs at a cellular level.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

OpenAIRE

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Clinical study of 89Sr therapy with radiosensitization by nicotinamide and carbogen in multiple bone metastasis of malignant neoplasms

International Nuclear Information System (INIS)

Liu Yajie; Wang Shubin; Guo Yiling; Chen Zuowei; Zhang Yingnan

2005-01-01

Objective: To evaluate the curative effect and side effects of 89 Sr therapy with radiosensitization by nicotinamide and carbogen in multiple bone metastasis of malignant neoplasms. Methods: Ninety-seven patients were divided into 4 groups respectively: group A, 89 Sr + nicotinamide + carbogen (24 patients); group B, 89 Sr + nicotinamide(22 patients); group C, 89 Sr + carbogen (25 patients); group D, 89 Sr, (26 patients). 89 SrCl was intravenously injected at a dose of 1.48-2.22 MBq/kg. Nicotinamide was taken orally 1 hour before 89 SrCl injection, 6 g/day, tid, d1-d5. Aspiration of carbogen(95%O 2 + 5%CO 2 ) gases, 6 L/min, 10 minutes, qd, d1-d5. Results: The effective rate of pain control and QOL improvement in A group were higher than in groups B, C and D (91.7% VS 77.3%, 76.0% and 69.2%, P=0.048). The lesions assessed by SPECT imaging in every group was not significantly different at three months after treatment. I to II degree toxic effect on bone marrow appeared in every group and there were no significantly inter-group differences. Conclusions: Combinative therapy using 89 Sr + nicotinamide + carbogen is more effective to treat multiple metastatic bone pain and for improvement of QOL. The side effects are not increased. (authors)

Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

Directory of Open Access Journals (Sweden)

Enying Zhang

Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-04-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

Nicotinamide and other benzamide analogs as agents for overcoming hypoxic cell radiation resistance in tumours

International Nuclear Information System (INIS)

Horsman, M.

1996-01-01

Oxygen deficient hypoxic cells, which are resistant to sparsely ionising radiation, have now been identified in most animal and some human solid tumours and will influence the response of those tumours to radiation treatment. This hypoxia can be either chronic, arising from an oxygen diffusion limitation, or acute, resulting from transient stoppages in microregional blood flow. Extensive experimental studies, especially in the last decade, have shown that nicotinamide and structurally related analogs can effectively sensitize murine tumours to both single and fractionated radiation treatments and that they do so in preference to the effects seen in mouse normal tissues. The earliest studies suggested that this enhancement of radiation damage was the result of an inhibition of the repair mechanisms. However, recent studies in mouse tumours have shown that these drugs prevent transient cessations in blood flow, thus inhibiting the development of acute hypoxia. This novel discovery led to the suggestion that the potential role of these agents as radiosensitizers would be when combined with treatments that overcame chronic hypoxia. The combined nicotinamide with hyperthermia proved that the enhancement of radiation damage by both agents together was greater than that seen with each agent alone. Similar results were later seen for nicotinamide combined with a perfluorochemical emulsion, carbogen breathing, and pentoxifylline, and in all these studies the effects in tumours were always greater than those seen in appropriate normal tissues. Of all the analogs, it is nicotinamide itself which has been the most extensively studied as a radiosensitizer in vivo and the one that shows the greatest effect in animal tumours. It is also an agent that has been well established clinically, with daily doses of up to 6 g, associated with a low incidence of side effects. This human dose is equivalent to 100-200 mg/kg in mice and such doses will maximally sensitize murine tumours to

Analytical Method Validation and Determination of Pyridoxine, Nicotinamide, and Caffeine in Energy Drinks Using Thin Layer Chromatography-Densitometry

Directory of Open Access Journals (Sweden)

Florentinus Dika Octa Riswanto

2015-03-01

Full Text Available Food supplement which contains vitamins and stimulants such as caffeine were classified as energy drink. TLC-densitometry method was chosen to determine the pyridoxine, nicotinamide, and caffeine in the energy drink sample. TLC plates of silica gel 60 F254 was used as the stationary phase and methanol : ethyl acetate : ammonia 25% (134:77:10 was used as the mobile phase. The correlation coefficient for each pyridoxine, nicotinamide, and caffeine were 0.9982, 0.9997, and 0.9966, respectively. Detection and quantitation limits of from the three analytes were 4.05 and 13.51 µg/mL; 13.15 and 43.83 µg/mL; 5.43 and 18.11 µg/mL, respectively. The recovery of pyridoxine, nicotinamide, and caffeine were within the required limit range of 95-105%. The percent of RSD were below the limit value of 5.7% for caffeine and nicotinamide and 8% for pyridoxine. The content amount of pyridoxine in the sample 1 and 2 were 33.59 ± 0.981 and 30.29 ± 2.061 µg/mL, respectively. The content amount of nicotinamide in the sample 1 and 2 were 106.53 ± 3.521 and 98.20 ± 3.648 µg/mL, respectively. The content amount of caffeine in the sample 1 and 2 were 249.50 ± 5.080 and 252.80 ± 2.640 µg/mL, respectively. Robustness test results showed that the most optimal method conditions should be applied for the analysis.

Congenital malformations in embryos of female mice exposed to alcohol and nicotinamide

Directory of Open Access Journals (Sweden)

Natasha Soares Simões dos Santos

2009-03-01

Full Text Available Objective: To compare the incidence of congenital malformations among the offspring of female mice exposed to alcohol or alcohol plus nicotinamide. Methods: Three groups of pregnant C57BL/6J mice were studied; G1 received alcohol (5 g/kg in saline solution (20% - vol/vol; G2 received nicotinamide, 50 mg/ml associated to alcohol; and G3, only saline solution; all by intraperitoneal injection on the seventh day of pregnancy. The animals were killed in a CO2 chamber on day 18 of pregnancy. The intrauterine content was assessed and the number of complete and reabsorbed fetuses was counted. The complete fetuses had their weight and crown-rump length measured and malformations were identified. Rresults: G1 showed the highest number of malformations: micrognathia, low set ears, hypertrophic nose, scoliosis, and atrophy of the lower and upper limbs. Weight was significantly different among the groups (p = 0.0139, and in G1 it was below average as compared to G3 (p = 0.3133. As for length, the lowest values were found in G2 and G3 showed the highest ones. There was a significant difference among the groups (p = 0.0145. Cconclusions: Ethanol, when administered to pregnant mice was teratogenic. However, length of G1 fetuses was, in average, higher than that of other groups. Nicotinamide decreased the number of malformations and may be a possible protector against alcohol effects.

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

Science.gov (United States)

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Nucleotide sequence of the human N-myc gene

International Nuclear Information System (INIS)

Stanton, L.W.; Schwab, M.; Bishop, J.M.

1986-01-01

Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

OpenAIRE

Kim, K S; Chilton, W S; Farrand, S K

1996-01-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

Maternal intake of fat, riboflavin and nicotinamide and the risk of having offspring with congenital heart defects.

Science.gov (United States)

Smedts, Huberdina P M; Rakhshandehroo, Maryam; Verkleij-Hagoort, Anna C; de Vries, Jeanne H M; Ottenkamp, Jaap; Steegers, Eric A P; Steegers-Theunissen, Régine P M

2008-10-01

With the exception of studies on folic acid, little evidence is available concerning other nutrients in the pathogenesis of congenital heart defects (CHDs). Fatty acids play a central role in embryonic development, and the B-vitamins riboflavin and nicotinamide are co-enzymes in lipid metabolism. To investigate associations between the maternal dietary intake of fats, riboflavin and nicotinamide, and CHD risk in the offspring. A case-control family study was conducted in 276 mothers of a child with a CHD comprising of 190 outflow tract defects (OTD) and 86 non-outflow tract defects (non-OTD) and 324 control mothers of a non-malformed child. Mothers filled out general and food frequency questionnaires at 16 months after the index-pregnancy, as a proxy of the habitual food intake in the preconception period. Nutrient intakes (medians) were compared between cases and controls by Mann-Whitney U test. Odds ratios (OR) for the association between CHDs and nutrient intakes were estimated in a logistic regression model. Case mothers, in particular mothers of a child with OTD, had higher dietary intakes of saturated fat, 30.9 vs. 29.8 g/d; P riboflavin and nicotinamide were lower in mothers of a child with an OTD than in controls (1.32 vs. 1.41 mg/d; P riboflavin (riboflavin and nicotinamide seems to contribute to CHD risk, in particular OTDs.

Polypeptide structure and encoding location of the adenovirus serotype 2 late, nonstructural 33K protein

International Nuclear Information System (INIS)

Oosterom-Dragon, E.A.; Anderson, C.W.

1983-01-01

Radiochemical microsequence analysis of selected tryptic peptides of the adenovirus type 2 33K nonstructural protein has revealed the precise region of the genomic nucleotide sequence that encodes this protein. The initiation codon for the 33K protein lies 606 nucleotides to the right of the EcoRI restriction site at 70.7 map units and 281 nucleotides to the left of the postulated carboxyterminal codon of the adenovirus 100K protein. The coding regions for these two proteins thus overlap; however, the 33K protein is derived from the +1 frame with respect to the postulated 100K reading frame. Our results contradict an earlier published report suggesting that these two proteins share extensive amino acid sequence homology. The published nucleotide sequence of the Ad2 EcoRI-F fragment (70.7 to 75.9 map units) cannot accomodate in a single reading frame the peptide sequences of the 33K protein that we have determined. Sequence analysis of DNA fragments derived from virus has confirmed the published nucleotide sequence in all critical regions with respect to the coding region for the 33K protein. Consequently, our data are only consistent with the existence of an mRNA splice within the coding for 33K. Consensus donor and acceptor splice sequences have been located that would predict the removal of 202 nucleotides from the transcripts for the 33K protein. Removal of these nucleotides would explain the structure of a peptide that cannot otherwise be directly encoded by the EcoRI-F fragment. Identification of the precise splice points by peptide sequencing has permitted a prediction of the complete amino acid sequence for the 33K protein

Generation of 1:1 Carbamazepine:Nicotinamide cocrystals by spray drying.

Science.gov (United States)

Patil, Shashank P; Modi, Sameer R; Bansal, Arvind K

2014-10-01

The present study investigates the potential of spray drying as a technique for generation of pharmaceutical cocrystals. Carbamazepine-Nicotinamide cocrystal (CNC) was chosen as model cocrystal system for this study. Firstly, CNC was generated using liquid assisted grinding and used for generation of phase solubility diagram (PSD) and ternary phase diagram (TPD). Both PSD and TPD were carefully evaluated for phase behavior of CNC when equilibrated with solvent. The undersaturated region with respect to CNC, as depicted by TPD, was selected as target region to initiate cocrystallization experiments. Various points in this region, representative of different compositions of Carbamazepine, Nicotinamide and CNC, were selected and spray drying was carried out. The spray dried product was characterized for solid state properties and was compared with CNC generated by liquid assisted grinding. Spray drying successfully generated CNC of similar quality as those generated by liquid assisted grinding. Moreover, there was no significant impact of process variables on formation of CNC. Spray drying, owing to its simplicity and industrial scalability, can be a promising method for large scale cocrystal generation. Copyright © 2014 Elsevier B.V. All rights reserved.

Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

Directory of Open Access Journals (Sweden)

Benjamin C Thompson

Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

Scambio, a novel guanine nucleotide exchange factor for Rho

Directory of Open Access Journals (Sweden)

Groffen John

2004-04-01

Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

Nicotinamidase modulation of NAD+ biosynthesis and nicotinamide levels separately affect reproductive development and cell survival in C. elegans.

Science.gov (United States)

Vrablik, Tracy L; Huang, Li; Lange, Stephanie E; Hanna-Rose, Wendy

2009-11-01

Nicotinamide adenine dinucleotide (NAD(+)) is a central molecule in cellular metabolism and an obligate co-substrate for NAD(+)-consuming enzymes, which regulate key biological processes such as longevity and stress responses. Although NAD(+) biosynthesis has been intensely studied, little analysis has been done in developmental models. We have uncovered novel developmental roles for a nicotinamidase (PNC), the first enzyme in the NAD(+) salvage pathway of invertebrates. Mutations in the Caenorhabditis elegans nicotinamidase PNC-1 cause developmental and functional defects in the reproductive system; the development of the gonad is delayed, four uterine cells die by necrosis and the mutant animals are egg-laying defective. The temporal delay in gonad development results from depletion of the salvage pathway product NAD(+), whereas the uv1 cell necrosis and egg-laying defects result from accumulation of the substrate nicotinamide. Thus, regulation of both substrate and product level is key to the biological activity of PNC-1. We also find that diet probably affects the levels of these metabolites, as it affects phenotypes. Finally, we identified a secreted isoform of PNC-1 and confirmed its extracellular localization and functional activity in vivo. We demonstrate that nicotinamide phosphoribosyltransferase (Nampt), the equivalent enzyme in nicotinamide recycling to NAD(+) in vertebrates, can functionally substitute for PNC-1. As Nampt is also secreted, we postulate an evolutionarily conserved extracellular role for NAD(+) biosynthetic enzymes during development and physiology.

Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

NARCIS (Netherlands)

Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

Energy Technology Data Exchange (ETDEWEB)

Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

1983-01-01

Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

Science.gov (United States)

van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

2012-01-01

Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

Single nucleotide polymorphism in gene encoding transcription factor Prep1 is associated with HIV-1-associated dementia.

Directory of Open Access Journals (Sweden)

Sebastiaan M Bol

Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

Interactive effects of salinity stress and nicotinamide on physiological and biochemical parameters of Faba bean plant

International Nuclear Information System (INIS)

Abdelhamid, Magdi T; Sadak, Mervat Sh; Schmidhalter, Urs; El Saady, Abdel Kareem M.

2013-01-01

A possible survival strategy for plants under saline conditions is to use some compounds that could alleviate the salt stress effect. One of these compounds is nicotinamide (vitamin B3/niacin). The effect of exogenous application of nicotinamide with different concentrations (0,200 or 400 mg l-1) on faba bean (Vicia faba L.) plant grown at different NaCl levels (0,50 or 100 mM) was investigated in the wire house of the National Research Centre, Cairo, Egypt. Salinity stress significantly reduced the photosynthetic pigments, polysaccharides, total carbohydrates, total-N contents of shoot, plant height, leaves number, fresh and dry weights of shoot, seed yield, total carbohydrates and total crude protein of the yielded seeds compared with those of the control plants. In contrast, salinity induced marked increases in sucrose, total soluble sugars, total free amino acids, proline, lipid peroxidation product (MDA) and some oxidative enzymes (polyphenol-oxidase and peroxidase). Also, salinity stress increased Na+ contents with the decreases of other macro and micro elements contents (P, K+, Mg_2+, Ca_2+, Fe_2+, Mn_2+, Zn_2+ and Cu_2+) of shoots and the yielded seeds of faba bean. Foliar spraying of nicotinamide alleviated the adverse effects of salinity stress through increased the photosynthetic pigments, polysaccharides, total carbohydrates, total N concentration of shoot, plant height, leaves number, fresh and dry weights of shoot, and seed yield as well as, sucrose, total soluble sugars, total free amino acids and proline, compared with those of the corresponding salinity levels, while decreased lipid peroxidation product as malondialdehyde (MDA) and the oxidative enzymes (polyphenol oxidase and peroxidase enzymes). Nicotinamide inhibited the uptake of Na+ and accelerated the accumulation of P, K+, Mg_2+, Ca_2+, Fe_2+, Mn_2+, Zn_2+ and Cu_2+ concentrations in the shoots of salt stressed plants and enhanced total carbohydrate and total crude protein percentage and

L-glutamine supplementation prevents the development of experimental diabetic cardiomyopathy in streptozotocin-nicotinamide induced diabetic rats.

Directory of Open Access Journals (Sweden)

Sachin L Badole

Full Text Available The objective of the present investigation was to evaluate the effect of L-glutamine on cardiac myopathy in streptozotocin-nicotinamide induced diabetic rats. Diabetes was induced in overnight fasted Sprague Dawely rats by using intraperitonial injection of streptozotocin (55 mg/kg. Nicotinamide (100 mg/kg, i.p. was administered 20 min before administration of streptozotocin. Experimental rats were divided into Group I: non-diabetic control (distilled water; 10 ml/kg, p.o., II: diabetic control (distilled water, 10 ml/kg, p.o., III: L-glutamine (500 mg/kg, p.o. and IV: L-glutamine (1000 mg/kg, p.o.. All groups were diabetic except group I. The plasma glucose level, body weight, electrocardiographic abnormalities, hemodynamic changes and left ventricular contractile function, biological markers of cardiotoxicity, antioxidant markers were determined after 4 months after STZ with nicotinamide injection. Histopathological changes of heart tissue were carried out by using H and E stain. L-glutamine treatment improved the electrocardiographic, hemodynamic changes; LV contractile function; biological markers; oxidative stress parameters and histological changes in STZ induced diabetic rats. Results from the present investigation demonstrated that L-glutamine has seemed a cardioprotective activity.

Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

Science.gov (United States)

Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

2014-08-28

The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

Directory of Open Access Journals (Sweden)

Chakrabarti Mrinmay

2010-08-01

Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Synthesis and antifungal activity of nicotinamide derivatives as succinate dehydrogenase inhibitors.

Science.gov (United States)

Ye, Yong-Hao; Ma, Liang; Dai, Zhi-Cheng; Xiao, Yu; Zhang, Ying-Ying; Li, Dong-Dong; Wang, Jian-Xin; Zhu, Hai-Liang

2014-05-07

Thirty-eight nicotinamide derivatives were designed and synthesized as potential succinate dehydrogenase inhibitors (SDHI) and precisely characterized by (1)H NMR, ESI-MS, and elemental analysis. The compounds were evaluated against two phytopathogenic fungi, Rhizoctonia solani and Sclerotinia sclerotiorum, by mycelia growth inhibition assay in vitro. Most of the compounds displayed moderate activity, in which, 3a-17 exhibited the most potent antifungal activity against R. solani and S. sclerotiorum with IC50 values of 15.8 and 20.3 μM, respectively, comparable to those of the commonly used fungicides boscalid and carbendazim. The structure-activity relationship (SAR) of nicotinamide derivatives demonstrated that the meta-position of aniline was a key position contributing to the antifungal activity. Inhibition activities against two fungal SDHs were tested and achieved the same tendency with the data acquired from in vitro antifungal assay. Significantly, 3a-17 was demonstrated to successfully suppress disease development in S. sclerotiorum infected cole in vivo. In the molecular docking simulation, sulfur and chlorine of 3a-17 were bound with PHE291 and PRO150 of the SDH homology model, respectively, which could explain the probable mechanism of action between the inhibitory and target protein.

Meat Intake and the Dose of Vitamin B – Nicotinamide: Cause of the Causes of Disease Transitions, Health Divides, and Health Futures?

Directory of Open Access Journals (Sweden)

Lisa J Hill

2017-05-01

Full Text Available Meat and vitamin B 3 – nicotinamide – intake was high during hunter-gatherer times. Intake then fell and variances increased during and after the Neolithic agricultural revolution. Health, height, and IQ deteriorated. Low dietary doses are buffered by ‘welcoming’ gut symbionts and tuberculosis that can supply nicotinamide, but this co-evolved homeostatic metagenomic strategy risks dysbioses and impaired resistance to pathogens. Vitamin B 3 deficiency may now be common among the poor billions on a low-meat diet. Disease transitions to non-communicable inflammatory disorders (but longer lives may be driven by positive ‘meat transitions’. High doses of nicotinamide lead to reduced regulatory T cells and immune intolerance. Loss of no longer needed symbiotic ‘old friends’ compounds immunological over-reactivity to cause allergic and auto-immune diseases. Inhibition of nicotinamide adenine dinucleotide consumers and loss of methyl groups or production of toxins may cause cancers, metabolic toxicity, or neurodegeneration. An optimal dosage of vitamin B 3 could lead to better health, but such a preventive approach needs more equitable meat distribution. Some people may require personalised doses depending on genetic make-up or, temporarily, when under stress.

Nicotinamide Inhibits Ethanol-Induced Caspase-3 and PARP-1 Over-activation and Subsequent Neurodegeneration in the Developing Mouse Cerebellum.

Science.gov (United States)

Ieraci, Alessandro; Herrera, Daniel G

2018-06-01

Fetal alcohol spectrum disorder (FASD) is the principal preventable cause of mental retardation in the western countries resulting from alcohol exposure during pregnancy. Ethanol-induced massive neuronal cell death occurs mainly in immature neurons during the brain growth spurt period. The cerebellum is one of the brain areas that are most sensitive to ethanol neurotoxicity. Currently, there is no effective treatment that targets the causes of these disorders and efficient treatments to counteract or reverse FASD are desirable. In this study, we investigated the effects of nicotinamide on ethanol-induced neuronal cell death in the developing cerebellum. Subcutaneous administration of ethanol in postnatal 4-day-old mice induced an over-activation of caspase-3 and PARP-1 followed by a massive neurodegeneration in the developing cerebellum. Interestingly, treatment with nicotinamide, immediately or 2 h after ethanol exposure, diminished caspase-3 and PARP-1 over-activation and reduced ethanol-induced neurodegeneration. Conversely, treatment with 3-aminobenzadine, a specific PARP-1 inhibitor, was able to completely block PARP-1 activation, but not caspase-3 activation or ethanol-induced neurodegeneration in the developing cerebellum. Our results showed that nicotinamide reduces ethanol-induced neuronal cell death and inhibits both caspase-3 and PARP-1 alcohol-induced activation in the developing cerebellum, suggesting that nicotinamide might be a promising and safe neuroprotective agent for treating FASD and other neurodegenerative disorders in the developing brain that shares similar cell death pathways.

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

A case of vesicular cutaneous lupus erythematosus in a Border collie successfully treated with topical tacrolimus and nicotinamide-tetracycline.

Science.gov (United States)

Lehner, Georg M; Linek, Monika

2013-12-01

Canine vesicular cutaneous lupus erythematosus (VCLE) is an autoimmune skin disease of the Shetland sheepdog and rough collie, which manifests as an erosive dermatitis of sparsely haired skin of the ventrum and concave pinnae. Reported treatment consists of immunosuppression with glucocorticoids alone or in combination with azathioprine, but successful treatment is unpredictable. To report on the treatment of VCLE in a Border collie dog with topical 0.1% tacrolimus and nicotinamide in combination with tetracycline. An 8-year-old male neutered Border collie was presented with multiple coalescing erosions on the ventral abdomen, groin and axillae and ulceration on the oral commissures. Clinical presentation, routine diagnostics, histology and immunohistochemistry were consistent with VCLE. Remission was achieved with topical 0.1% tacrolimus and combination therapy of nicotinamide and tetracycline. This dog responded well to treatment with topical 0.1% tacrolimus, nicotinamide-tetracycline and sun avoidance. Complete remission was achieved after 2.5 months, and the dog was lesion free during a 1 year follow-up period. © 2013 ESVD and ACVD.

Nicotinamide mononucleotide inhibits post-ischemic NAD(+) degradation and dramatically ameliorates brain damage following global cerebral ischemia.

Science.gov (United States)

Park, Ji H; Long, Aaron; Owens, Katrina; Kristian, Tibor

2016-11-01

Nicotinamide adenine dinucleotide (NAD(+)) is an essential cofactor for multiple cellular metabolic reactions and has a central role in energy production. Brain ischemia depletes NAD(+) pools leading to bioenergetics failure and cell death. Nicotinamide mononucleotide (NMN) is utilized by the NAD(+) salvage pathway enzyme, nicotinamide adenylyltransferase (Nmnat) to generate NAD(+). Therefore, we examined whether NMN could protect against ischemic brain damage. Mice were subjected to transient forebrain ischemia and treated with NMN or vehicle at the start of reperfusion or 30min after the ischemic insult. At 2, 4, and 24h of recovery, the proteins poly-ADP-ribosylation (PAR), hippocampal NAD(+) levels, and expression levels of NAD(+) salvage pathway enzymes were determined. Furthermore, animal's neurologic outcome and hippocampal CA1 neuronal death was assessed after six days of reperfusion. NMN (62.5mg/kg) dramatically ameliorated the hippocampal CA1 injury and significantly improved the neurological outcome. Additionally, the post-ischemic NMN treatment prevented the increase in PAR formation and NAD(+) catabolism. Since the NMN administration did not affect animal's temperature, blood gases or regional cerebral blood flow during recovery, the protective effect was not a result of altered reperfusion conditions. These data suggest that administration of NMN at a proper dosage has a strong protective effect against ischemic brain injury. Published by Elsevier Inc.

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

International Nuclear Information System (INIS)

Szopa, J.

1995-01-01

The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

Formation of nicotinamide ribose diphosphate ribose, a new metabolite of the NAD pathway, by growing mycelium of Aspergillus niger

International Nuclear Information System (INIS)

Kuwahara, Masaaki

1976-01-01

A new step of NAD metabolism was shown in Aspergillus niger. Radioactive nicotinic acid and nicotinamide were incorporated into nicotinamide ribose diphosphate ribose (NAm-RDPR), which had been isolated from the culture filtrate. Its content in the culture medium increased with an increase of culture time, and this compound was proved to be a terminal metabolite in the NAD pathway. The experimental results also showed that the Preiss-Handler pathway and the NAD cycling system function in the NAD biosynthesis in A. niger. A part of the radioactive precursors was also incorporated into an unknown compound. (auth.)

Eugenosedin-A improves glucose metabolism and inhibits MAPKs expression in streptozotocin/nicotinamide-induced diabetic rats

Directory of Open Access Journals (Sweden)

Kuo-Ping Shen

2018-03-01

Full Text Available This study examined the effects of eugenosedin-A (Eu-A in a streptozotocin (STZ/nicotinamide-induced rat model of type II diabetes mellitus (T2DM. Six-week-old Sprague–Dawley rats were randomly divided into three groups: (1 RD group, normal rats fed a regular diet (RD, (2 DM group, T2DM rats fed a high-fat diet, and (3 Eu-A group, T2DM rats fed a high fat diet plus oral Eu-A (5 mg/kg/day. After 30 days, the DM group had higher body weight, higher blood glucose and lower insulin levels than the RD group. The DM group also had increased protein expression of glycogen synthase kinase (GSK in liver and skeletal muscle and decreased protein expression of insulin receptor (IR, insulin receptor substrate-1 (IRS-1, IRS-2, AMP-activated protein kinase (AMPK, glucose transporter-4 (GLUT-4, glucokinase (GCK, and peroxisome proliferator-activated receptor γ (PPAR-γ. STZ/nicotinamide-induced T2DM increased the expression of mitogen-activated protein kinases (MAPKs: p38, ERK, JNK and inflammatory p65 protein. In the Eu-A treated T2DM rats, however, blood glucose was attenuated and the insulin concentration stimulated. Changes in IR, IRS-1 and IRS-2 proteins as well as AMPK, GLUT-4, GCK, GSK, PPAR-γ, MAPKs, and inflammatory p65 proteins were ameliorated. These results suggested that Eu-A alleviates STZ/nicotinamide-induced hyperglycemia by improving insulin levels and glucose metabolism, and inhibiting the MAPKs- and p65-mediated inflammatory pathway.

NUCLEOTIDES IN INFANT FEEDING

Directory of Open Access Journals (Sweden)

L.G. Mamonova

2007-01-01

Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

Nucleotide Metabolism

DEFF Research Database (Denmark)

Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

2011-01-01

Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

International Nuclear Information System (INIS)

Kiick, D.M.; Harris, B.G.; Cook, P.F.

1986-01-01

The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction

Uptake of [14C]nicotinic acid and [14C]nicotinamide by Bordetella pertussis

International Nuclear Information System (INIS)

McPheat, W.L.; Wardlaw, A.C.

1980-01-01

Bordetella pertussis has an absolute requirement for either nicotinic acid (NA) or nicotinamide (ND), both being equally effective in supporting growth. The results of an investigation to compare the rates of uptake of NA and ND, to determine the influence of factors such as energy source and temperature on uptake, and to measure the Ksub(m) and Vsub(max) values are reported. (Auth.)

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

Directory of Open Access Journals (Sweden)

Shenglong Tan

2012-01-01

Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

Science.gov (United States)

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

DEFF Research Database (Denmark)

Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi

2010-01-01

It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...

Density and viscosity study of nicotinic acid and nicotinamide in dilute aqueous solutions at and around the temperature of the maximum density of water

International Nuclear Information System (INIS)

Dhondge, Sudhakar S.; Dahasahasra, Prachi N.; Paliwal, Lalitmohan J.; Deshmukh, Dinesh W.

2014-01-01

Highlights: • Volumetric and transport behaviour of aqueous solutions of important vitamins are reported. • Various interactions of nicotinic acid and nicotinamide with water have been reported. • The temperature dependence of interactions between solute and solvent is discussed. • The study indicates that nicotinamide is more hydrated as compared to nicotinic acid. - Abstract: In the present study, we report experimental densities (ρ) and viscosities (η) of aqueous solutions of nicotinic acid and nicotinamide within the concentration range (0 to 0.1) mol · kg −1 at T = (275.15, 277.15 and 279.15) K. These parameters are then used to obtain thermodynamic and transport functions such as apparent molar volume of solute (V ϕ ), limiting apparent molar volume of solute (V ϕ 0 ), limiting apparent molar expansivity of solute (E ϕ 0 ), coefficient of thermal expansion (α ∗ ), Jones–Dole equation viscosity A, B and D coefficients, temperature derivative of B coefficient i.e. (dB/dT) and hydration number (n H ), etc. The activation parameters of viscous flow for the binary mixtures have been determined and discussed in terms of Eyring’s transition state theory. These significant parameters are helpful to study the structure promoting or destroying tendency of solute and various interactions present in (nicotinic acid + water) and (nicotinamide + water) binary mixtures

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Protein Engineering for Nicotinamide Coenzyme Specificity in Oxidoreductases: Attempts and Challenges.

Science.gov (United States)

Chánique, Andrea M; Parra, Loreto P

2018-01-01

Oxidoreductases are ubiquitous enzymes that catalyze an extensive range of chemical reactions with great specificity, efficiency, and selectivity. Most oxidoreductases are nicotinamide cofactor-dependent enzymes with a strong preference for NADP or NAD. Because these coenzymes differ in stability, bioavailability and costs, the enzyme preference for a specific coenzyme is an important issue for practical applications. Different approaches for the manipulation of coenzyme specificity have been reported, with different degrees of success. Here we present various attempts for the switching of nicotinamide coenzyme preference in oxidoreductases by protein engineering. This review covers 103 enzyme engineering studies from 82 articles and evaluates the accomplishments in terms of coenzyme specificity and catalytic efficiency compared to wild type enzymes of different classes. We analyzed different protein engineering strategies and related them with the degree of success in inverting the cofactor specificity. In general, catalytic activity is compromised when coenzyme specificity is reversed, however when switching from NAD to NADP, better results are obtained. In most of the cases, rational strategies were used, predominantly with loop exchange generating the best results. In general, the tendency of removing acidic residues and incorporating basic residues is the strategy of choice when trying to change specificity from NAD to NADP, and vice versa . Computational strategies and algorithms are also covered as helpful tools to guide protein engineering strategies. This mini review aims to give a general introduction to the topic, giving an overview of tools and information to work in protein engineering for the reversal of coenzyme specificity.

YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

DEFF Research Database (Denmark)

Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

2009-01-01

The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...

Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

NARCIS (Netherlands)

Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

2005-01-01

The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

Combined experimental and computational studies of pyrazinamide and nicotinamide in the context of crystal engineering and thermodynamics

DEFF Research Database (Denmark)

Jarzembska, Katarzyna N.; Hoser, Anna Agnieszka; Kamiński, Radosław

2014-01-01

and computational analysis of the β form of pyrazinamide and α form of nicotinamide. Static electron density distribution is obtained through application of Hansen and Coppens multipolar formalism, and further analyzed via Baders quantum theory of atoms in molecules (QTAIM). Geometrical and electron density...

Maternal intake of fat, riboflavin and nicotinamide and the risk of having offspring with congenital heart defects

NARCIS (Netherlands)

Smedts, H.P.M.; Rakhshandehroo, M.; Verkleij-Hagoort, A.C.; Vries, de J.H.M.; Ottenkamp, J.; Steegers, E.A.P.; Steegers-Theunissen, R.P.M.

2008-01-01

With the exception of studies on folic acid, little evidence is available concerning other nutrients in the pathogenesis of congenital heart defects (CHDs). Fatty acids play a central role in embryonic development, and the B-vitamins riboflavin and nicotinamide are co-enzymes in lipid metabolism.

Maternal intake of fat, riboflavin and nicotinamide and the risk of having offspring with congenital heart defects

NARCIS (Netherlands)

Smedts, Huberdina P. M.; Rakhshandehroo, Maryam; Verkleij-Hagoort, Anna C.; de Vries, Jeanne H. M.; Ottenkamp, Jaap; Steegers, Eric A. P.; Steegers-Theunissen, Régine P. M.

2008-01-01

BACKGROUND: With the exception of studies on folic acid, little evidence is available concerning other nutrients in the pathogenesis of congenital heart defects (CHDs). Fatty acids play a central role in embryonic development, and the B-vitamins riboflavin and nicotinamide are co-enzymes in lipid

Variation in the gene encoding Krüppel-like factor 7 influences body fat: studies of 14 818 Danes

DEFF Research Database (Denmark)

Zobel, Dorit P; Andreasen, Camilla H; Burgdorf, Kristoffer S

2009-01-01

OBJECTIVE: KLF7 encodes Krüppel-like factor (KLF) 7, a member of the KLF family of transcription factors, initially shown to play important roles in cellular development and differentiation, and reported to be specifically involved in adipogenesis. Several single nucleotide polymorphisms (SNPs...

Synthesis and evaluation of novel radioiodinated nicotinamides for malignant melanoma

Energy Technology Data Exchange (ETDEWEB)

Liu Xiang; Pham, Tien Q.; Berghofer, Paula; Chapman, Janette; Greguric, Ivan; Mitchell, Peter; Mattner, Filomena; Loc' h, Christian [Radiopharmaceuticals Research Institute, Australian Nuclear Science and Technology Organisation, Sydney, NSW 2234 (Australia); Katsifis, Andrew [Radiopharmaceuticals Research Institute, Australian Nuclear Science and Technology Organisation, Sydney, NSW 2234 (Australia)], E-mail: akx@ansto.gov.au

2008-10-15

Introduction: A series of iodonicotinamides based on the melanin-binding iodobenzamide compound N-2-diethylaminoethyl-4-iodobenzamide was prepared and evaluated for the potential imaging and staging of disseminated metastatic melanoma. Methods: [{sup 123}I]Iodonicotinamides were prepared by iododestannylation reactions using no-carrier-added iodine-123 and evaluated in vivo by biodistribution and competition studies and by single photon emission computed tomography (SPECT) imaging in black and albino nude mice bearing B16F0 murine melanotic and A375 human amelanotic melanoma tumours, respectively. Results: The iodonicotinamides displayed low-affinity binding for {sigma}{sub 1}-{sigma}{sub 2} receptors (K{sub i}>300 nM). In biodistribution studies in mice, N-(2-(diethylamino)ethyl)-5-[{sup 123}I]iodonicotinamide ([{sup 123}I]1) exhibited the fastest and highest uptake of the nicotinamide series in the B16F0 tumour at 1 h ({approx}8% ID/g), decreasing slowly over time. No uptake was observed in the A375 tumour. Clearance from the animals by urinary excretion was more rapid for N-alkyl-nicotinamides than for piperazinyl derivatives. At 1 h postinjection, the urinary excretion was 66% ID for [{sup 123}I]1, while the gastrointestinal tract amounted to 17% ID. Haloperidol was unable to reduce the uptake of [{sup 123}I]1 in pigmented mice, indicating that this uptake was likely due to an interaction with melanin. SPECT imaging of [{sup 123}I]1 in black mice bearing the B16F0 melanoma indicated that the radioactivity was predominately located in the tumour and eyes. No specific localisation was observed in nude mice bearing A375 amelanotic tumours. Conclusion: These findings suggest that [{sup 123}I]1, which displays high tumour uptake with rapid clearance from the body, could be a promising imaging agent for the detection of melanotic tumours.

Guanylic nucleotide starvation affects Saccharomyces cerevisiae mother-daughter separation and may be a signal for entry into quiescence

Directory of Open Access Journals (Sweden)

Sagot Isabelle

2005-05-01

Full Text Available Abstract Background Guanylic nucleotides are both macromolecules constituents and crucial regulators for a variety of cellular processes. Therefore, their intracellular concentration must be strictly controlled. Consistently both yeast and mammalian cells tightly correlate the transcription of genes encoding enzymes critical for guanylic nucleotides biosynthesis with the proliferation state of the cell population. Results To gain insight into the molecular relationships connecting intracellular guanylic nucleotide levels and cellular proliferation, we have studied the consequences of guanylic nucleotide limitation on Saccharomyces cerevisiae cell cycle progression. We first utilized mycophenolic acid, an immunosuppressive drug that specifically inhibits inosine monophosphate dehydrogenase, the enzyme catalyzing the first committed step in de novo GMP biosynthesis. To approach this system physiologically, we next developed yeast mutants for which the intracellular guanylic nucleotide pools can be modulated through changes of growth conditions. In both the pharmacological and genetic approaches, we found that guanylic nucleotide limitation generated a mother-daughter separation defect, characterized by cells with two unseparated daughters. We then showed that this separation defect resulted from cell wall perturbations but not from impaired cytokinesis. Importantly, cells with similar separation defects were found in a wild type untreated yeast population entering quiescence upon nutrient limitation. Conclusion Our results demonstrate that guanylic nucleotide limitation slows budding yeast cell cycle progression, with a severe pause in telophase. At the cellular level, guanylic nucleotide limitation causes the emergence of cells with two unseparated daughters. By fluorescence and electron microscopy, we demonstrate that this phenotype arises from defects in cell wall partition between mother and daughter cells. Because cells with two unseparated

The B vitamins nicotinamide (B3) and riboflavin (B2) stimulate metamorphosis in larvae of the deposit-feeding polychaete Capitella teleta: implications for a sensory ligand-gated ion channel.

Science.gov (United States)

Burns, Robert T; Pechenik, Jan A; Biggers, William J; Scavo, Gia; Lehman, Christopher

2014-01-01

Marine sediments can contain B vitamins, presumably incorporated from settled, decaying phytoplankton and microorganisms associated with decomposition. Because B vitamins may be advantageous for the energetically intensive processes of metamorphosis, post-metamorphic growth, and reproduction, we tested several B vitamins to determine if they would stimulate larvae of the deposit-feeding polychaete Capitella teleta to settle and metamorphose. Nicotinamide and riboflavin individually stimulated larvae of C. teleta to settle and metamorphose, generally within 1-2 hours at nicotinamide concentrations as low as 3 µM and riboflavin concentrations as low as 50 µM. More than 80% of the larvae metamorphosed within 30 minutes at a nicotinamide concentration of 7 µM. The pyridine channel agonist pyrazinecarboxamide also stimulated metamorphosis at very low concentrations. In contrast, neither lumichrome, thiamine HCl, pyridoxine HCl, nor vitamin B12 stimulated larvae of C. teleta to metamorphose at concentrations as high as 500 µM. Larvae also did not metamorphose in response to either nicotinamide or pyrazinecarboxamide in calcium-free seawater or with the addition of 4-acetylpyridine, a competitive inhibitor of the pyridine receptor. Together, these results suggest that larvae of C. teleta are responding to nicotinamide and riboflavin via a chemosensory pyridine receptor similar to that previously reported to be present on crayfish chela and involved with food recognition. Our data are the first to implicate B vitamins as possible natural chemical settlement cues for marine invertebrate larvae.

The B Vitamins Nicotinamide (B3) and Riboflavin (B2) Stimulate Metamorphosis in Larvae of the Deposit-Feeding Polychaete Capitella teleta: Implications for a Sensory Ligand-Gated Ion Channel

Science.gov (United States)

Burns, Robert T.; Pechenik, Jan A.; Biggers, William J.; Scavo, Gia; Lehman, Christopher

2014-01-01

Marine sediments can contain B vitamins, presumably incorporated from settled, decaying phytoplankton and microorganisms associated with decomposition. Because B vitamins may be advantageous for the energetically intensive processes of metamorphosis, post-metamorphic growth, and reproduction, we tested several B vitamins to determine if they would stimulate larvae of the deposit-feeding polychaete Capitella teleta to settle and metamorphose. Nicotinamide and riboflavin individually stimulated larvae of C. teleta to settle and metamorphose, generally within 1–2 hours at nicotinamide concentrations as low as 3 µM and riboflavin concentrations as low as 50 µM. More than 80% of the larvae metamorphosed within 30 minutes at a nicotinamide concentration of 7 µM. The pyridine channel agonist pyrazinecarboxamide also stimulated metamorphosis at very low concentrations. In contrast, neither lumichrome, thiamine HCl, pyridoxine HCl, nor vitamin B12 stimulated larvae of C. teleta to metamorphose at concentrations as high as 500 µM. Larvae also did not metamorphose in response to either nicotinamide or pyrazinecarboxamide in calcium-free seawater or with the addition of 4-acetylpyridine, a competitive inhibitor of the pyridine receptor. Together, these results suggest that larvae of C. teleta are responding to nicotinamide and riboflavin via a chemosensory pyridine receptor similar to that previously reported to be present on crayfish chela and involved with food recognition. Our data are the first to implicate B vitamins as possible natural chemical settlement cues for marine invertebrate larvae. PMID:25390040

Nicotinamide: a vitamin able to shift macrophage differentiation toward macrophages with restricted inflammatory features.

Science.gov (United States)

Weiss, Ronald; Schilling, Erik; Grahnert, Anja; Kölling, Valeen; Dorow, Juliane; Ceglarek, Uta; Sack, Ulrich; Hauschildt, Sunna

2015-11-01

The differentiation of human monocytes into macrophages is influenced by environmental signals. Here we asked in how far nicotinamide (NAM), a vitamin B3 derivative known to play a major role in nicotinamide adenine dinucleotide (NAD)-mediated signaling events, is able to modulate monocyte differentiation into macrophages developed in the presence of granulocyte macrophage colony-stimulating factor (GM-MØ) or macrophage colony-stimulating factor (M-MØ). We found that GM-MØ undergo biochemical, morphological and functional modifications in response to NAM, whereas M-MØ were hardly affected. GM-MØ exposed to NAM acquired an M-MØ-like structure while the LPS-induced production of pro-inflammatory cytokines and COX-derived eicosanoids were down-regulated. In contrast, NAM had no effect on the production of IL-10 or the cytochrome P450-derived eicosanoids. Administration of NAM enhanced intracellular NAD concentrations; however, it did not prevent the LPS-mediated drain on NAD pools. In search of intracellular molecular targets of NAM known to be involved in LPS-induced cytokine and eicosanoid synthesis, we found NF-κB activity to be diminished. In conclusion, our data show that vitamin B3, when present during the differentiation of monocytes into GM-MØ, interferes with biochemical pathways resulting in strongly reduced pro-inflammatory features. © The Author(s) 2015.

YCL047C/POF1 is a novel nicotinamide mononucleotide adenylyltransferase (NMNAT) in Saccharomyces cerevisiae.

Science.gov (United States)

Kato, Michiko; Lin, Su-Ju

2014-05-30

NAD(+) is an essential metabolic cofactor involved in various cellular biochemical processes. Nicotinamide riboside (NR) is an endogenously produced key pyridine metabolite that plays important roles in the maintenance of NAD(+) pool. Using a NR-specific cell-based screen, we identified mutants that exhibit altered NR release phenotype. Yeast cells lacking the ORF YCL047C/POF1 release considerably more NR compared with wild type, suggesting that POF1 plays an important role in NR/NAD(+) metabolism. The amino acid sequence of Pof1 indicates that it is a putative nicotinamide mononucleotide adenylyltransferase (NMNAT). Unlike other yeast NMNATs, Pof1 exhibits NMN-specific adenylyltransferase activity. Deletion of POF1 significantly lowers NAD(+) levels and decreases the efficiency of NR utilization, resistance to oxidative stress, and NR-induced life span extension. We also show that NR is constantly produced by multiple nucleotidases and that the intracellular NR pools are likely to be compartmentalized, which contributes to the regulation of NAD(+) homeostasis. Our findings may contribute to the understanding of the molecular basis and regulation of NAD(+) metabolism in higher eukaryotes. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

SAR and characterization of non-substrate isoindoline urea inhibitors of nicotinamide phosphoribosyltransferase (NAMPT)

Energy Technology Data Exchange (ETDEWEB)

Curtin, Michael L.; Heyman, H. Robin; Clark, Richard F.; Sorensen, Bryan K.; Doherty, George A.; Hansen, T. Matthew; Frey, Robin R.; Sarris, Kathy A.; Aguirre, Ana L.; Shrestha, Anurupa; Tu, Noah; Woller, Kevin; Pliushchev, Marina A.; Sweis, Ramzi F.; Cheng, Min; Wilsbacher, Julie L.; Kovar, Peter J.; Guo, Jun; Cheng, Dong; Longenecker, Kenton L.; Raich, Diana; Korepanova, Alla V.; Soni, Nirupama B.; Algire, Mikkel A.; Richardson, Paul L.; Marin, Violeta L.; Badagnani, Ilaria; Vasudevan, Anil; Buchanan, F.Greg; Maag, David; Chiang, Gary G.; Tse, Chris; Michaelides, Michael R. (AbbVie)

2017-08-01

Herein we disclose SAR studies that led to a series of isoindoline ureas which we recently reported were first-in-class, non-substrate nicotinamide phosphoribosyltransferase (NAMPT) inhibitors. Modification of the isoindoline and/or the terminal functionality of screening hit 5 provided inhibitors such as 52 and 58 with nanomolar antiproliferative activity and preclinical pharmacokinetics properties which enabled potent antitumor activity when dosed orally in mouse xenograft models. X-ray crystal structures of two inhibitors bound in the NAMPT active-site are discussed.

Nicotinamide and carbogen: relationship between pO2 and radiosensitivity in three tumour lines

International Nuclear Information System (INIS)

Martin, L.M.; Thomas, C.D.; Guichard, M.

1994-01-01

The effects of carbogen breathing, nicotinamide injection and their combination on tumour radiosensitivity were correlated with changes in tumour O 2 tension to determine the relationship between radiosensitivity and measured pO 2 . The radiosensitivity (in vivo-in vitro colony assay) and O 2 tension (computerized pO 2 histograph KIMOC 6650) of two human xenografted tumours (HRT18 and NA11 +) and one murine tumour (EMT6) were measured under similar experimental conditions. (author)

Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

Science.gov (United States)

Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

2010-09-01

The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Antinociceptive effect of purine nucleotides.

Science.gov (United States)

Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

1996-10-01

The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

1H NMR analysis of complexation of hydrotropic agents nicotinamide and caffeine with aromatic biologically active molecules in aqueous solution

Science.gov (United States)

Lantushenko, Anastasia O.; Mukhina, Yulia V.; Veselkov, Kyrill A.; Davies, David B.; Veselkov, Alexei N.

2004-07-01

NMR spectroscopy has been used to elucidate the molecular mechanism of solubilization action of hydrotropic agents nicotinamide (NA) and caffeine (CAF). Hetero-association of NA with riboflavine-mononucleotide (FMN) and CAF with low soluble in aqueous solution synthetic analogue of antibiotic actinomycin D, actinocyl-bis-(3-dimethylaminopropyl) amine (Actill), has been investigated by 500 MHz 1H NMR spectroscopy. Concentration and temperature dependences of proton chemical shifts have been analysed in terms of a statistical-thermodynamic model of indefinite self- and heteroassociation of aromatic molecules. The obtained results enable to conclude that NA-FMN and CAF-Actill intermolecular complexes are mainly stabilized by the stacking interactions of the aromatic chromophores. Hetero-association of the investigated molecules plays an important role in solubilization of aromatic drugs by hydrotropic agents nicotinamide and caffeine.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth

2016-05-11

Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Disruption of Pyridine Nucleotide Redox Status During Oxidative Challenge at Normal and Low-Glucose States: Implications for Cellular Adenosine Triphosphate, Mitochondrial Respiratory Activity, and Reducing Capacity in Colon Epithelial Cells

Science.gov (United States)

Circu, Magdalena L.; Maloney, Ronald E.

2011-01-01

Abstract We recently demonstrated that menadione (MQ), a redox cycling quinone, mediated the loss of mitochondrial glutathione/glutathione disulfide redox balance. In this study, we showed that MQ significantly disrupted cellular pyridine nucleotide (NAD+/NADH, NADP+/NADPH) redox balance that compromised cellular ATP, mitochondrial respiratory activity, and NADPH-dependent reducing capacity in colonic epithelial cells, a scenario that was exaggerated by low glucose. In the cytosol, MQ induced NAD+ loss concurrent with increased NADP+ and NAD kinase activity, but decreased NADPH. In the mitochondria, NADH loss occurred in conjunction with increased nicotinamide nucleotide transhydrogenase activity and NADP+, and decreased NADPH. These results are consistent with cytosolic NAD+-to-NADP+ and mitochondrial NADH-to-NADPH shifts, but compromised NADPH availability. Thus, despite the sacrifice of NAD+/NADH in favor of NADPH generation, steady-state NADPH levels were not maintained during MQ challenge. Impairments of cellular bioenergetics were evidenced by ATP losses and increased mitochondrial O2 dependence of pyridine nucleotide oxidation–reduction; half-maximal oxidation (P50) was 10-fold higher in low glucose, which was lowered by glutamate or succinate supplementation. This exaggerated O2 dependence is consistent with increased O2 diversion to nonmitochondrial O2 consumption by MQ-semiquinone redox cycling secondary to decreased NADPH-dependent MQ detoxication at low glucose, a situation that was corrected by glucose-sparing mitochondrial substrates. Antioxid. Redox Signal. 14, 2151–2162. PMID:21083422

Nicotinamide adenosine dinucleotide level in dimethylsulfate-treated or UV-irradiated mouse epidermis

International Nuclear Information System (INIS)

Balard, B.; Giacomoni, P.U.

1989-01-01

The level of nicotinamide (NAD) has been determined in the epidermis of 30 mice. Its value is 0.63+-0.15 μg/mg protein. Upon treatment with dimethylsulfate (DMS), the level of NAD drops in a dosedependent fashion. This diminution is reversible when low doses of DMS are used. Upon irradiation with ultraviolet light, the level of NAD drops in the irradiated epidermis, the treshold of saturation being below 1200 J/m 2 . There is also a drop in the level of NAD in the epidermis protected against irradiation with a black rubber sheet. (author). 17 refs.; 6 figs.; 1 tab

Nicotinamide Phosphoribosyltransferase Upregulation by Phenylephrine Reduces Radiation Injury in Submandibular Gland

International Nuclear Information System (INIS)

Xiang, Bin; Han, Lichi; Wang, Xinyue; Tang, Ling; Li, Kailiang; Li, Xiuxiu; Zhao, Xibo; Xia, Miaomiao; Zhou, Xixi; Zhang, Fuyin; Liu, Ke Jian

2016-01-01

Purpose: Radiation therapy for head and neck cancer commonly leads to radiation sialadenitis. Emerging evidence has indicated that phenylephrine pretreatment reduces radiosensitivity in the salivary gland; however, the underlying cytoprotective mechanism remains unclear. Nicotinamide phosphoribosyltransferase (NAMPT) is not only a key enzyme for the nicotinamide adenine dinucleotide salvage pathway, but also a cytokine participating in cell survival, metabolism, and longevity, with a broad effect on cellular functions in physiology and pathology. However, the regulatory events of NAMPT in response to the irradiated salivary gland are unknown. Methods and Materials: The cell viability of primary cultured submandibular gland cells was determined using the PrestoBlue assay. NAMPT expression was measured using reverse transcriptase polymerase chain reaction and Western blotting in vitro and in vivo. Silent information regulator 1 (SIRT1) and phosphorylated Akt protein levels were examined by Western blotting. The cellular locations of NAMPT and SIRT1 were detected by immunohistochemistry. NAMPT promoter activity was assessed using the luciferase reporter gene assay. Results: NAMPT was mainly distributed in the cytoplasm of granular convoluted tubule cells and ductal cells in normal submandibular glands. mRNA and protein expression of NAMPT was downregulated after radiation but upregulated with phenylephrine pretreatment both in vivo and in vitro. Moreover, the protein expression of phosphorylated Akt and SIRT1 was decreased in irradiated glands, and phenylephrine pretreatment restored the expression of both. SIRT1 was mainly located in the cell nucleus and cytoplasm in the normal submandibular gland. Phenylephrine dramatically enhanced the expression of SIRT1, which was significantly reduced by radiation. Furthermore, phenylephrine induced a marked increase of NAMPT promoter activity. Conclusions: These findings reveal the regulatory mechanisms of NAMPT expression

Nicotinamide Phosphoribosyltransferase Upregulation by Phenylephrine Reduces Radiation Injury in Submandibular Gland

Energy Technology Data Exchange (ETDEWEB)

Xiang, Bin, E-mail: xiangbin72@163.com [Laboratory of Oral and Maxillofacial Disease, Second Hospital of Dalian Medical University, Dalian (China); Han, Lichi [Department of Oral Medicine and Medical Research Center of Medical College, Dalian University, Dalian (China); Wang, Xinyue [Laboratory of Oral and Maxillofacial Disease, Second Hospital of Dalian Medical University, Dalian (China); Tang, Ling [Life Sciences and Technology College, Dalian University, Dalian (China); Li, Kailiang [Department of Oral and Maxillofacial Surgery, Second Hospital of Dalian Medical University, Dalian (China); Li, Xiuxiu [Department of Oral Medicine and Medical Research Center of Medical College, Dalian University, Dalian (China); Zhao, Xibo [Department of Oral and Maxillofacial Surgery, Second Hospital of Dalian Medical University, Dalian (China); Xia, Miaomiao [Department of Oral Medicine and Medical Research Center of Medical College, Dalian University, Dalian (China); Zhou, Xixi [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, New Mexico (United States); Zhang, Fuyin [Department of Oral and Maxillofacial Surgery, Second Hospital of Dalian Medical University, Dalian (China); Liu, Ke Jian, E-mail: kliu@salud.unm.edu [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, New Mexico (United States)

2016-11-01

Purpose: Radiation therapy for head and neck cancer commonly leads to radiation sialadenitis. Emerging evidence has indicated that phenylephrine pretreatment reduces radiosensitivity in the salivary gland; however, the underlying cytoprotective mechanism remains unclear. Nicotinamide phosphoribosyltransferase (NAMPT) is not only a key enzyme for the nicotinamide adenine dinucleotide salvage pathway, but also a cytokine participating in cell survival, metabolism, and longevity, with a broad effect on cellular functions in physiology and pathology. However, the regulatory events of NAMPT in response to the irradiated salivary gland are unknown. Methods and Materials: The cell viability of primary cultured submandibular gland cells was determined using the PrestoBlue assay. NAMPT expression was measured using reverse transcriptase polymerase chain reaction and Western blotting in vitro and in vivo. Silent information regulator 1 (SIRT1) and phosphorylated Akt protein levels were examined by Western blotting. The cellular locations of NAMPT and SIRT1 were detected by immunohistochemistry. NAMPT promoter activity was assessed using the luciferase reporter gene assay. Results: NAMPT was mainly distributed in the cytoplasm of granular convoluted tubule cells and ductal cells in normal submandibular glands. mRNA and protein expression of NAMPT was downregulated after radiation but upregulated with phenylephrine pretreatment both in vivo and in vitro. Moreover, the protein expression of phosphorylated Akt and SIRT1 was decreased in irradiated glands, and phenylephrine pretreatment restored the expression of both. SIRT1 was mainly located in the cell nucleus and cytoplasm in the normal submandibular gland. Phenylephrine dramatically enhanced the expression of SIRT1, which was significantly reduced by radiation. Furthermore, phenylephrine induced a marked increase of NAMPT promoter activity. Conclusions: These findings reveal the regulatory mechanisms of NAMPT expression

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

Science.gov (United States)

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Deficits in discrimination after experimental frontal brain injury are mediated by motivation and can be improved by nicotinamide administration.

Science.gov (United States)

Vonder Haar, Cole; Maass, William R; Jacobs, Eric A; Hoane, Michael R

2014-10-15

One of the largest challenges in experimental neurotrauma work is the development of models relevant to the human condition. This includes both creating similar pathophysiology as well as the generation of relevant behavioral deficits. Recent studies have shown that there is a large potential for the use of discrimination tasks in rats to detect injury-induced deficits. The literature on discrimination and TBI is still limited, however. The current study investigated motivational and motor factors that could potentially contribute to deficits in discrimination. In addition, the efficacy of a neuroprotective agent, nicotinamide, was assessed. Rats were trained on a discrimination task and motivation task, given a bilateral frontal controlled cortical impact TBI (+3.0 AP, 0.0 ML from bregma), and then reassessed. They were also assessed on motor ability and Morris water maze (MWM) performance. Experiment 1 showed that TBI resulted in large deficits in discrimination and motivation. No deficits were observed on gross motor measures; however, the vehicle group showed impairments in fine motor control. Both injured groups were impaired on the reference memory MWM, but only nicotinamide-treated rats were impaired on the working memory MWM. Nicotinamide administration improved performance on discrimination and motivation measures. Experiment 2 evaluated retraining on the discrimination task and suggested that motivation may be a large factor underlying discrimination deficits. Retrained rats improved considerably on the discrimination task. The tasks evaluated in this study demonstrate robust deficits and may improve the detection of pharmaceutical effects by being very sensitive to pervasive cognitive deficits that occur after frontal TBI.

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

An encoding device and a method of encoding

DEFF Research Database (Denmark)

2012-01-01

The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Science.gov (United States)

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

Science.gov (United States)

Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

2012-01-01

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

Science.gov (United States)

Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

2012-02-03

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

Energy Technology Data Exchange (ETDEWEB)

Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

1988-08-11

The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

Genetically encoded probes for NAD+/NADH monitoring.

Science.gov (United States)

Bilan, Dmitry S; Belousov, Vsevolod V

2016-11-01

NAD + and NADH participate in many metabolic reactions. The NAD + /NADH ratio is an important parameter reflecting the general metabolic and redox state of different types of cells. For a long time, in situ and in vivo NAD + /NADH monitoring has been hampered by the lack of suitable tools. The recent development of genetically encoded indicators based on fluorescent proteins linked to specific nucleotide-binding domains has already helped to address this monitoring problem. In this review, we will focus on four available indicators: Peredox, Frex family probes, RexYFP and SoNar. Each indicator has advantages and limitations. We will also discuss the most important points that should be considered when selecting a suitable indicator for certain experimental conditions. Copyright © 2016 Elsevier Inc. All rights reserved.

S-Adenosyl-L-Homocysteine Hydrolase Inhibition by a Synthetic Nicotinamide Cofactor Biomimetic

Directory of Open Access Journals (Sweden)

Lyn L. Kailing

2018-03-01

Full Text Available S-adenosyl-L-homocysteine (SAH hydrolases (SAHases are involved in the regulation of methylation reactions in many organisms and are thus crucial for numerous cellular functions. Consequently, their dysregulation is associated with severe health problems. The SAHase-catalyzed reaction is reversible and both directions depend on the redox activity of nicotinamide adenine dinucleotide (NAD+ as a cofactor. Therefore, nicotinamide cofactor biomimetics (NCB are a promising tool to modulate SAHase activity. In the present in vitro study, we investigated 10 synthetic truncated NAD+ analogs against a SAHase from the root-nodulating bacterium Bradyrhizobium elkanii. Among this set of analogs, one was identified to inhibit the SAHase in both directions. Isothermal titration calorimetry (ITC and crystallography experiments suggest that the inhibitory effect is not mediated by a direct interaction with the protein. Neither the apo-enzyme (i.e., deprived of the natural cofactor, nor the holo-enzyme (i.e., in the NAD+-bound state were found to bind the inhibitor. Yet, enzyme kinetics point to a non-competitive inhibition mechanism, where the inhibitor acts on both, the enzyme and enzyme-SAH complex. Based on our experimental results, we hypothesize that the NCB inhibits the enzyme via oxidation of the enzyme-bound NADH, which may be accessible through an open molecular gate, leaving the enzyme stalled in a configuration with oxidized cofactor, where the reaction intermediate can be neither converted nor released. Since the reaction mechanism of SAHase is quite uncommon, this kind of inhibition could be a viable pharmacological route, with a low risk of off-target effects. The NCB presented in this work could be used as a template for the development of more potent SAHase inhibitors.

Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

Energy Technology Data Exchange (ETDEWEB)

Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

1981-09-01

The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

Science.gov (United States)

Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

2010-01-01

Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

International Nuclear Information System (INIS)

Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

1998-01-01

To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

The influence of nalidixic acid and nicotinamide of the radiation-induced cytogenetic injury to hexaploid wheat varities contrast by radioresistance

International Nuclear Information System (INIS)

Selezneva, E.M.; Sarapul'tsev, B.I.

1990-01-01

Nalidixic acid modifies the cytogenetic injury when only applied to seeds of a radiosensitive variety, Moskovskaya 35. The radioprotective effect of nicotinamide on both radiosensitive and radioresistant hexaploid wheat varities is observed being dependent on the extent which the genetic apparatus is impaired

Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

Science.gov (United States)

Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

2016-03-01

The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

Science.gov (United States)

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

2016-01-01

Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

NARCIS (Netherlands)

ENGEL, H; KAZEMIER, B; KECK, W

The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

Science.gov (United States)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

Science.gov (United States)

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Influence of Feature Encoding and Choice of Classifier on Disease Risk Prediction in Genome-Wide Association Studies.

Directory of Open Access Journals (Sweden)

Florian Mittag

Full Text Available Various attempts have been made to predict the individual disease risk based on genotype data from genome-wide association studies (GWAS. However, most studies only investigated one or two classification algorithms and feature encoding schemes. In this study, we applied seven different classification algorithms on GWAS case-control data sets for seven different diseases to create models for disease risk prediction. Further, we used three different encoding schemes for the genotypes of single nucleotide polymorphisms (SNPs and investigated their influence on the predictive performance of these models. Our study suggests that an additive encoding of the SNP data should be the preferred encoding scheme, as it proved to yield the best predictive performances for all algorithms and data sets. Furthermore, our results showed that the differences between most state-of-the-art classification algorithms are not statistically significant. Consequently, we recommend to prefer algorithms with simple models like the linear support vector machine (SVM as they allow for better subsequent interpretation without significant loss of accuracy.

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

Science.gov (United States)

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

Influence of Sodium Lauryl Sulfate and Tween 80 on Carbamazepine–Nicotinamide Cocrystal Solubility and Dissolution Behaviour

OpenAIRE

Ke Wang; Ning Qiao; Mingzhong Li

2013-01-01

The influence of the surfactants of sodium lauryl sulfate (SLS) and Tween 80 on carbamazepine–nicotinamide (CBZ–NIC) cocrystal solubility and dissolution behaviour has been studied in this work. The solubility of the CBZ–NIC cocrystal was determined by measuring the eutectic concentrations of the drug and the coformer. Evolution of the intrinsic dissolution rate (IDR) of the CBZ–NIC cocrystal was monitored by the UV imaging dissolution system during dissolution. Experimental results indicated...

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

Cyclic nucleotides and radioresistnace

International Nuclear Information System (INIS)

Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

1982-01-01

The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

Isolation and characterisation of mRNA encoding the salmon- and chicken-II type gonadotrophin-releasing hormones in the teleost fish Rutilus rutilus (Cyprinidae).

Science.gov (United States)

Penlington, M C; Williams, M A; Sumpter, J P; Rand-Weaver, M; Hoole, D; Arme, C

1997-12-01

The complementary DNAs (cDNA) encoding the [Trp7,Leu8]-gonadotrophin-releasing hormone (salmon-type GnRH; sGnRH:GeneBank accession no. u60667) and the [His5,Trp7,Tyr8]-GnRH (chicken-II-type GnRH; cGnRH-II: GeneBank accession no. u60668) precursor in the roach (Rutilus rutilus) were isolated and sequenced following reverse transcription and rapid amplification of cDNA ends (RACE). The sGnRH and cGnRH-II precursor cDNAs consisted of 439 and 628 bp, and included open reading frames of 282 and 255 bp respectively. The structures of the encoded peptides were the same as GnRHs previously identified in other vertebrates. The sGnRH and cGnRH-II precursor cDNAs, including the non-coding regions, had 88.6 and 79.9% identity respectively, to those identified in goldfish (Carassius auratus). However, significant similarity was not observed between the non-coding regions of the GnRH cDNAs of Cyprinidae and other fish. The presumed third exon, encoding partial sGnRH associated peptide (GAP) of roach, demonstrated significant nucleotide and amino acid similarity with the appropriate regions in the goldfish, but not with other species, and this may indicate functional differences of GAP between different families of fish. cGnRH-II precursor cDNAs from roach had relatively high nucleotide similarity across this GnRH variant. Cladistic analysis classified the sGnRH and cGnRH-II precursor cDNAs into three and two groups respectively. However, the divergence between nucleotide sequences within the sGnRH variant was greater than those encoding the cGnRH-II precursors. Consistent with the consensus developed from previous studies, Northern blot analysis demonstrated that expression of sGnRH and cGnRH-II was restricted to the olfactory bulbs and midbrain of roach respectively. This work forms the basis for further study on the mechanisms by which the tapeworm, Ligula intestinalis, interacts with the pituitary-gonadal axis of its fish host.

Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

International Nuclear Information System (INIS)

Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

1989-01-01

Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

A Single-Nucleotide Polymorphism in Serine-Threonine Kinase 11, the Gene Encoding Liver Kinase B1, Is a Risk Factor for Multiple Sclerosis

Directory of Open Access Journals (Sweden)

Anne I. Boullerne

2015-02-01

Full Text Available We identified a family in which five siblings were diagnosed with multiple sclerosis (MS or clinically isolated syndrome. Several women in the maternal lineage have comorbidities typically associated with Peutz Jeghers Syndrome, a rare autosomal-dominant disease caused by mutations in the serine-threonine-kinase 11 (STK11 gene, which encodes liver kinase B1. Sequence analysis of DNA from one sibling identified a single-nucleotide polymorphism (SNP within STK11 intron 5. This SNP (dbSNP ID: rs9282860 was identified by TaqMan polymerase chain reaction (PCR assays in DNA samples available from two other siblings. Further screening was carried out in samples from 654 relapsing-remitting MS patients, 100 primary progressive MS patients, and 661 controls. The STK11-SNP has increased frequency in all female patients versus controls (odds ratio = 1.66, 95% CI = 1.05, 2.64, p = .032. The STK11-SNP was not associated with disease duration or onset; however, it was significantly associated with reduced severity (assessed by MS severity scores, with the lowest scores in patients who also harbored the HLA-DRB1*1501 allele. In vitro studies showed that peripheral blood mononuclear cells from members of the family were more sensitive to the mitochondrial inhibitor metformin than cells from MS patients with the major STK11 allele. The increased association of SNP rs9282860 in women with MS defines this variant as a genetic risk factor. The lower disease severity observed in the context of HLA-DRB1*1501 combined with limited in vitro studies raises the provocative possibility that cells harboring the STK11-SNP could be targeted by drugs which increase metabolic stress.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Disruption of O-GlcNAc cycling in C. elegans perturbs Nucleotide Sugar pools and Complex Glycans

Directory of Open Access Journals (Sweden)

Salil K Ghosh

2014-11-01

Full Text Available The carbohydrate modification of serine and threonine residues with O-linked beta-N-acetylglucosamine (O-GlcNAc is ubiquitous and governs cellular processes ranging from cell signaling to apoptosis. The O-GlcNAc modification along with other carbohydrate modifications, including N-linked and O-linked glycans, glycolipids, and sugar polymers, all require the use of the nucleotide sugar UDP-GlcNAc, the end product of the hexosamine biosynthetic pathway. In this paper, we describe the biochemical consequences resulting from perturbation of the O-GlcNAc pathway in C. elegans lacking O-GlcNAc transferase and O-GlcNAcase activities. In ogt-1 null animals, steady-state levels of UDP-GlcNAc/UDP-GalNAc and UDP-glucose were substantially elevated. Transcripts of genes encoding for key members in the Hexosamine Biosynthetic Pathway (gfat-2, gna-2, C36A4.4 and trehalose metabolism (tre-1, tre-2, and tps-2 were elevated in ogt-1 null animals. While there is no evidence to suggest changes in the profile of N-linked glycans in the ogt-1 and oga-1 mutants, glycans insensitive to PNGase digestion (including O-linked glycans, glycolipids, and glycopolymers were altered in these strains. Our data supports that changes in O-GlcNAcylation alters nucleotide sugar production, overall glycan composition, and transcription of genes encoding glycan processing enzymes. These data along with our previous findings that disruption in O-GlcNAc cycling alters macronutrient storage underscores the noteworthy influence this posttranslational modification plays in nutrient sensing.

Nicotinamide Improves Aspects of Healthspan, but Not Lifespan, in Mice.

Science.gov (United States)

Mitchell, Sarah J; Bernier, Michel; Aon, Miguel A; Cortassa, Sonia; Kim, Eun Young; Fang, Evandro F; Palacios, Hector H; Ali, Ahmed; Navas-Enamorado, Ignacio; Di Francesco, Andrea; Kaiser, Tamzin A; Waltz, Tyler B; Zhang, Ning; Ellis, James L; Elliott, Peter J; Frederick, David W; Bohr, Vilhelm A; Schmidt, Mark S; Brenner, Charles; Sinclair, David A; Sauve, Anthony A; Baur, Joseph A; de Cabo, Rafael

2018-03-06

The role in longevity and healthspan of nicotinamide (NAM), the physiological precursor of NAD + , is elusive. Here, we report that chronic NAM supplementation improves healthspan measures in mice without extending lifespan. Untargeted metabolite profiling of the liver and metabolic flux analysis of liver-derived cells revealed NAM-mediated improvement in glucose homeostasis in mice on a high-fat diet (HFD) that was associated with reduced hepatic steatosis and inflammation concomitant with increased glycogen deposition and flux through the pentose phosphate and glycolytic pathways. Targeted NAD metabolome analysis in liver revealed depressed expression of NAM salvage in NAM-treated mice, an effect counteracted by higher expression of de novo NAD biosynthetic enzymes. Although neither hepatic NAD + nor NADP + was boosted by NAM, acetylation of some SIRT1 targets was enhanced by NAM supplementation in a diet- and NAM dose-dependent manner. Collectively, our results show health improvement in NAM-supplemented HFD-fed mice in the absence of survival effects. Published by Elsevier Inc.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

Directory of Open Access Journals (Sweden)

Benjamin C Hitz

Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus

OpenAIRE

Gazanion, Elodie; Seblova, V.; Votypka, J.; Vergnes, Baptiste; Garcia, Deborah; Volf, P.; Sereno, Denis

2012-01-01

Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinic acid to ensure Nicotinamide-Adenine-Dinucleotide (NAD(+)) biosynthesis. We were curious to explore the role of this enzyme during L infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L infantum at the early time points post their ingestion withi...

Nucleotide sequence preservation of human mitochondrial DNA

International Nuclear Information System (INIS)

Monnat, R.J. Jr.; Loeb, L.A.

1985-01-01

Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

Effects of garlic extract on TNF-α expression and oxidative stress status in the kidneys of rats with STZ + nicotinamide-induced diabetes.

Science.gov (United States)

Ziamajidi, Nasrin; Nasiri, Abolfazl; Abbasalipourkabir, Roghayeh; Sadeghi Moheb, Somayeh

2017-12-01

Allium sativum L. (Liliaceae) (garlic) is a medicinal plant that is widely used in herbal medicine. Nephropathy is a complication of diabetes that is induced by long-term hyperglycaemia. The effects of aqueous extract of garlic (AGE) on the expression of tumour necrosis factor-alpha (TNF-α) and oxidative stress status were studied in the kidneys of rats with streptozotocin (STZ) + nicotinamide-induced diabetes. Twenty-four Wistar rats were divided into four groups: control rats, rats with STZ + nicotinamide-induced diabetes that received a single dose of STZ (65 mg/kg) and nicotinamide (110 mg/kg) intraperitoneally, diabetic rats that were treated with garlic (2 g/kg/d, gavage), and normal rats that received garlic (2 g/kg/d, gavage). The glucose level was determined in the start of study, 7 d after induction of diabetes and 33 d after treatment with garlic. At the end of the treatment period, urea, uric acid and creatinine levels were estimated in sera. Malondialdehyde (MDA), total oxidant status (TOS), nitric oxide (NO) levels and TNF-α gene and protein expression were measured in the renal tissues of the rats. The glucose, uric acid, and urea levels increased in the serum of diabetic rats compared with control rats, and decreased in garlic-treated diabetic rats compared with diabetic rats (p garlic-treated diabetic rats compared with diabetic rats (p garlic, it was close to the normal level (p garlic extract has hypoglycaemic, antioxidant and anti-inflammatory properties; therefore, it can be useful for the alleviation of diabetic complications.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

DEFF Research Database (Denmark)

Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar

2013-01-01

The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer...... dinucleotide (FAD)-binding domain of HvNTR2 to strongly affect the interaction with Trx. In particular, Trp42 and Met43 play key roles for recognition of the endogenous HvTrxh2. Trx from Arabidopsis thaliana is also efficiently recycled by HvNTR2 but turnover in this case appears to be less dependent...

Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

Science.gov (United States)

Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

2003-01-01

A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

Expression patterns of nicotinamide phosphoribosyltransferase and nicotinic acid phosphoribosyltransferase in human malignant lymphomas

DEFF Research Database (Denmark)

Olesen, Uffe Høgh; Hastrup, Nina; Sehested, Maxwell

2011-01-01

The purpose of the study was to determine in human malignant lymphomas the expression patterns of nicotinamide phosphoribosyltransferase (NAMPT) and nicotinic acid phosphoribosyltransferase (NAPRT), the primary, rate-limiting enzymes in the synthesis of NAD+. NAMPT is a potential biomarker...... for sensitivity to NAMPT inhibitors and NAPRT is a biomarker for the use of nicotinic acid as a chemoprotectant in treatment with NAMPT inhibitors. The NAMPT inhibitor, APO866, is currently in clinical phase II trials in lymphomas. The expression of NAMPT and NAPRT was investigated in 53 samples of malignant.......0024). In conclusion, FL are a promising target for NAMPT inhibitors whereas substantial subsets of malignant lymphomas especially in Hodgkin lymphoma may be suitable for a combination treatment with nicotinic acid and NAMPT inhibitors....

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

Science.gov (United States)

Kim, K S; Chilton, W S; Farrand, S K

1996-06-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.

YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

DEFF Research Database (Denmark)

Andersen, Niels Møller; Douthwaite, Stephen

2006-01-01

generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

The Adsorption of Calmoduline via Nicotinamide Immobilized Poly(HEMA-GMA Cryogels

Directory of Open Access Journals (Sweden)

Kadir Erol

2016-12-01

Full Text Available The separation and purification methods for the isolation of an important biomolecule calmoduline protein is extremely important. Among these methods, the adsorption technique is extremely popular, and the cryogels as adsorbents with the macro porous structure and interconnected flow channels cryogel they have are preferred in this field. In this study, the adsorption of calmoduline via Ca(II immobilized poly (2-hydroxyethyl methacrylate-glycidyl methacrylate, poly (HEMA-GMA, cryogels through changing interaction time, calmoduline initial concentration and temperature conditions. For the characterization of cryogels, the swelling test, Fourier Transform Infrared (FT-IR Spectroscopy, Scanning Electron Microscopy (SEM, surface area (BET, elemental analysis and ICP-OES methods were performed. Nicotinamide molecule was used as Ca (II chelating agent and the adsorption capacity of the cryogels was estimated as 1.812 mg calmoduline / g cryogel. The adsorption models of the adsorption reaction were examined by the Langmuir and Freundlich isotherm models and was determined to be more appropriate for Langmuir isotherm model.

The Association between Genetic Variations of CHI3L1, Levels of the Encoded Glycoprotein YKL-40 and the Lipid Profile in a Danish Population

DEFF Research Database (Denmark)

Thomsen, Stine Brinkløv; Rathcke, Camilla Noelle; Skaaby, Tea

2012-01-01

The inflammatory biomarker YKL-40 seems to play a role in atherosclerosis and is elevated in patients with obesity, cardiovascular disease and type 2 diabetes. Single nucleotide polymorphisms (SNPs) of the YKL-40 encoding gene, CHI3L1, are associated with inter-individual YKL-40 levels. One study...... of the differentiated lipid profile in a Danish general population....

Development of a simple and efficient method for assaying cytidine monophosphate sialic acid synthetase activity using an enzymatic reduced nicotinamide adenine dinucleotide/oxidized nicotinamide adenine dinucleotide converting system.

Science.gov (United States)

Fujita, Akiko; Sato, Chihiro; Münster-Kühnel, Anja-K; Gerardy-Schahn, Rita; Kitajima, Ken

2005-02-01

A new reliable method to assay the activity of cytidine monophosphate sialic acid (CMP-Sia) synthetase (CSS) has been developed. The activation of sialic acids (Sia) to CMP-Sia is a prerequisite for the de novo synthesis of sialoglycoconjugates. In vertebrates, CSS has been cloned from human, mouse, and rainbow trout, and the crystal structure has been resolved for the mouse enzyme. The mouse and rainbow trout enzyme have been compared with respect to substrate specificity, demonstrating that the mouse enzyme exhibits a pronounced specificity for N-acetylneuraminic acid (Neu5Ac), while the rainbow trout CSS is equally active with either of three Sia species, Neu5Ac, N-glycolylneuraminic acid (Neu5Gc), and deaminoneuraminic acid (KDN). However, molecular details that explain the pronounced substrate specificities are unknown. Understanding the catalytic mechanisms of these enzymes is of major importance, since CSSs play crucial roles in cellular sialylation patterns and thus are potential drug targets in a number of pathophysiological situations. The availability of the cDNAs and the obtained structural data enable rational approaches; however, these efforts are limited by the lack of a reliable high-throughput assay system. Here we describe a new assay system that allows product quantification in a reduced nicotinamide adenine dinucleotide (NADH)-dependent color reaction. The activation reaction catalyzed by CSS, CTP+Sia-->CMP-Sia+pyrophosphate, was evaluated by a consumption of Sia, which corresponds to that of NADH on the following two successive reactions: (i) Sia-->pyruvate+ManNAc (or Man), catalyzed by a sialic acid lyase (SAL), and (ii) pyruvate+NADH-->lactate+oxidized nicotinamide adenine dinucleotide (NAD+), catalyzed by a lactate dehydrogenase (LDH). Consumption of NADH can be photometrically monitored on a microtiter plate reader for a number of test samples at the same time. Furthermore, based on the quantification of CSS used in the SAL/LDH assay

A primary survey on bryophyte species reveals two novel classes of nucleotide-binding site (NBS genes.

Directory of Open Access Journals (Sweden)

Jia-Yu Xue

Full Text Available Due to their potential roles in pathogen defense, genes encoding nucleotide-binding site (NBS domain have been particularly surveyed in many angiosperm genomes. Two typical classes were found: one is the TIR-NBS-LRR (TNL class and the other is the CC-NBS-LRR (CNL class. It is seldom known, however, what kind of NBS-encoding genes are mainly present in other plant groups, especially the most ancient groups of land plants, that is, bryophytes. To fill this gap of knowledge, in this study, we mainly focused on two bryophyte species: the moss Physcomitrella patens and the liverwort Marchantia polymorpha, to survey their NBS-encoding genes. Surprisingly, two novel classes of NBS-encoding genes were discovered. The first novel class is identified from the P. patens genome and a typical member of this class has a protein kinase (PK domain at the N-terminus and a LRR domain at the C-terminus, forming a complete structure of PK-NBS-LRR (PNL, reminiscent of TNL and CNL classes in angiosperms. The second class is found from the liverwort genome and a typical member of this class possesses an α/β-hydrolase domain at the N-terminus and also a LRR domain at the C-terminus (Hydrolase-NBS-LRR, HNL. Analysis on intron positions and phases also confirmed the novelty of HNL and PNL classes, as reflected by their specific intron locations or phase characteristics. Phylogenetic analysis covering all four classes of NBS-encoding genes revealed a closer relationship among the HNL, PNL and TNL classes, suggesting the CNL class having a more divergent status from the others. The presence of specific introns highlights the chimerical structures of HNL, PNL and TNL genes, and implies their possible origin via exon-shuffling during the quick lineage separation processes of early land plants.

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women

Directory of Open Access Journals (Sweden)

Jéssica de Oliveira

2017-05-01

Full Text Available Abstract Butyrylcholinesterase (BChE activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs in the BCHE gene: -116G > A (rs1126680, 1615GA (rs1803274, 1914A 0.05. The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Supplementary Material for: The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

2016-01-01

Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Vesicular nucleotide transporter (VNUT): appearance of an actress on the stage of purinergic signaling.

Science.gov (United States)

Moriyama, Yoshinori; Hiasa, Miki; Sakamoto, Shohei; Omote, Hiroshi; Nomura, Masatoshi

2017-09-01

Vesicular storage of ATP is one of the processes initiating purinergic chemical transmission. Although an active transport mechanism was postulated to be involved in the processes, a transporter(s) responsible for the vesicular storage of ATP remained unidentified for some time. In 2008, SLC17A9, the last identified member of the solute carrier 17 type I inorganic phosphate transporter family, was found to encode the vesicular nucleotide transporter (VNUT) that is responsible for the vesicular storage of ATP. VNUT transports various nucleotides in a membrane potential-dependent fashion and is expressed in the various ATP-secreting cells. Mice with knockout of the VNUT gene lose vesicular storage and release of ATP from neurons and neuroendocrine cells, resulting in blockage of the initiation of purinergic chemical transmission. Thus, VNUT plays an essential role in the vesicular storage and release of ATP. The VNUT knockout mice exhibit resistance for neuropathic pain and a therapeutic effect against diabetes by way of increased insulin sensitivity. Thus, VNUT inhibitors and suppression of VNUT gene expression may be used for therapeutic purposes through suppression of purinergic chemical transmission. This review summarizes the studies to date on VNUT and discusses what we have learned about the relevance of vesicular ATP release as a potential drug target.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

Science.gov (United States)

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

Science.gov (United States)

Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

2005-04-01

Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

A preclinical study on the rescue of normal tissue by nicotinic acid in high-dose treatment with APO866, a specific nicotinamide phosphoribosyltransferase inhibitor

DEFF Research Database (Denmark)

Olesen, Uffe Høgh; Thougaard, Annemette V; Jensen, Peter Buhl

2010-01-01

Inhibitor of nicotinamide phosphoribosyltransferase APO866 is a promising cancer drug currently in phase II clinical trials in oncology. Here, we present a strategy for increasing the therapeutic potential of APO866 through the rescue of normal tissues by coadministration of nicotinic acid (Vitam...

Nicotinamide Phosphoribosyltransferase in Smooth Muscle Cells Maintains Genome Integrity, Resists Aortic Medial Degeneration, and Is Suppressed in Human Thoracic Aortic Aneurysm Disease.

Science.gov (United States)

Watson, Alanna; Nong, Zengxuan; Yin, Hao; O'Neil, Caroline; Fox, Stephanie; Balint, Brittany; Guo, Linrui; Leo, Oberdan; Chu, Michael W A; Gros, Robert; Pickering, J Geoffrey

2017-06-09

The thoracic aortic wall can degenerate over time with catastrophic consequences. Vascular smooth muscle cells (SMCs) can resist and repair artery damage, but their capacities decline with age and stress. Recently, cellular production of nicotinamide adenine dinucleotide (NAD + ) via nicotinamide phosphoribosyltransferase (Nampt) has emerged as a mediator of cell vitality. However, a role for Nampt in aortic SMCs in vivo is unknown. To determine whether a Nampt-NAD + control system exists within the aortic media and is required for aortic health. Ascending aortas from patients with dilated aortopathy were immunostained for NAMPT, revealing an inverse relationship between SMC NAMPT content and aortic diameter. To determine whether a Nampt-NAD + control system in SMCs impacts aortic integrity, mice with Nampt -deficient SMCs were generated. SMC- Nampt knockout mice were viable but with mildly dilated aortas that had a 43% reduction in NAD + in the media. Infusion of angiotensin II led to aortic medial hemorrhage and dissection. SMCs were not apoptotic but displayed senescence associated-ß-galactosidase activity and upregulated p16, indicating premature senescence. Furthermore, there was evidence for oxidized DNA lesions, double-strand DNA strand breaks, and pronounced susceptibility to single-strand breakage. This was linked to suppressed poly(ADP-ribose) polymerase-1 activity and was reversible on resupplying NAD + with nicotinamide riboside. Remarkably, we discovered unrepaired DNA strand breaks in SMCs within the human ascending aorta, which were specifically enriched in SMCs with low NAMPT. NAMPT promoter analysis revealed CpG hypermethylation within the dilated human thoracic aorta and in SMCs cultured from these tissues, which inversely correlated with NAMPT expression. The aortic media depends on an intrinsic NAD + fueling system to protect against DNA damage and premature SMC senescence, with relevance to human thoracic aortopathy. © 2017 American Heart

Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

International Nuclear Information System (INIS)

Martin del Campo, Julia S.; Patino, Rodrigo

2011-01-01

Research highlights: → The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. → A spectrophotometric method is proposed for kinetic and thermodynamic analysis. → The pH and the temperature influences are reported on physical chemical properties. → Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49) from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD ox ) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD ox as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, Δ f G o = -1784 ± 5 kJ mol -1 .

Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

Energy Technology Data Exchange (ETDEWEB)

Martin del Campo, Julia S. [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico); Patino, Rodrigo, E-mail: rtarkus@mda.cinvestav.mx [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico)

2011-04-20

Research highlights: {yields} The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. {yields} A spectrophotometric method is proposed for kinetic and thermodynamic analysis. {yields} The pH and the temperature influences are reported on physical chemical properties. {yields} Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49) from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD{sub ox}) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD{sub ox} as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, {Delta}{sub f}G{sup o} = -1784 {+-} 5 kJ mol{sup -1}.

Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

Directory of Open Access Journals (Sweden)

Chen Yuan

2005-05-01

Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

Energy Technology Data Exchange (ETDEWEB)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

1987-02-01

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

Red algae (Gelidium amansii) reduces adiposity via activation of lipolysis in rats with diabetes induced by streptozotocin-nicotinamide

OpenAIRE

Tsung-Han Yang; Hsien-Tsung Yao; Meng-Tsan Chiang

2015-01-01

Gelidium amansii (GA) is an edible red algae that is distributed mainly in northeastern Taiwan. This study was designed to investigate the effects of GA on plasma glucose, lipids, and adipocytokines in rats with streptozotocin-nicotinamide-induced diabetes. Rats were divided into four groups: (1) rats without diabetes fed a high-fat diet (control group); (2) rats with diabetes fed a high-fat diet; (3) rats with diabetes fed a high-fat diet with thiazolidinedione in the diet; and (4) rats with...

Combination of hydrotropic nicotinamide with nanoparticles for enhancing tacrolimus percutaneous delivery

Directory of Open Access Journals (Sweden)

Pan W

2016-08-01

Full Text Available Wenhui Pan, Mengyao Qin, Guoguang Zhang, Yueming Long, Wenyi Ruan, Jingtong Pan, Zushuai Wu, Tao Wan, Chuanbin Wu, Yuehong Xu Department of Pharmaceutics, School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, People’s Republic of China Abstract: Tacrolimus (FK506, an effective immunosuppressant for treating inflammatory skin diseases, hardly penetrates into and through the skin owing to its high hydrophobicity and molecular weight. The aim of this study was to develop a hybrid system based on nicotinamide (NIC and nanoparticles (NPs encapsulating FK506, such as FK506–NPs–NIC, for facilitating percutaneous delivery, which exploited virtues of both NIC and NPs to obtain the synergetic effect. Solubility and percutaneous permeation studies were carried out. The results showed that NIC could increase the solubility and permeability of FK506 and that 20% (w/v NIC presented higher FK506 permeability and was thus chosen as the hydrotropic solution to solubilize FK506 and prepare FK506–NPs–NIC. Hyaluronic acid (HA was chemically conjugated with cholesterol (Chol to obtain amphiphilic conjugate of HA–Chol, which self-assembled NPs in 20% NIC solution containing FK506. The particle size, zeta potential, and morphology of NPs were characterized. The encapsulation efficiency and in vitro percutaneous permeation of NPs were evaluated in the presence and absence of NIC. The results demonstrated that hydrotropic solubilizing FK506 was readily encapsulated into NPs with a higher encapsulation efficiency of 79.2%±4.2%, and the combination of NPs with NIC exhibited a significantly synergistic effect on FK506 deposition within the skin (2.39±0.53 µg/cm2 and penetration through the skin (13.38±2.26 µg/cm2. The effect of the combination of NPs with NIC on drug permeation was further visualized by confocal laser scanning microscope through in vivo permeation studies, and the results confirmed that NPs–NIC synergistically enhanced

Nicotinamidase participates in the salvage pathway of NAD biosynthesis in Arabidopsis.

Science.gov (United States)

Wang, Guodong; Pichersky, Eran

2007-03-01

Nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP), which is derived from NAD, have important roles as a redox carriers in metabolism. A combination of de novo and salvage pathways contribute to the biosynthesis of NAD in all organisms. The pathways and enzymes of the NAD salvage pathway in yeast and animals, which diverge at nicotinamide, have been extensively studied. Yeast cells convert nicotinamide to nicotinic acid, while mammals lack the enzyme nicotinamidase and instead convert nicotinamide to nicotinamide mononucleotide. Here we show that Arabidopsis thaliana gene At2g22570 encodes a nicotinamidase, which is expressed in all tissues, with the highest levels observed in roots and stems. The 244-residue protein, designated AtNIC1, converts nicotinamide to nicotinic acid and has a Km value of 118 +/- 17 microM and a Kcat value of 0.93 +/- 0.13 sec(-1). Plants homozygous for a null AtNIC1 allele, nic1-1, have lower levels of NAD and NADP under normal growth conditions, indicating that AtNIC1 participates in a yeast-type NAD salvage pathway. Mutant plants also exhibit hypersensitivity to treatments of abscisic acid and NaCl, which is correlated with their inability to increase the cellular levels of NAD(H) under these growth conditions, as occurs in wild-type plants. We also show that the growth of the roots of wild-type but not nic1-1 mutant plants is inhibited and distorted by nicotinamide.

Enzymatic synthesis of 13N-β-nicotinamide adenine dinucleotide

International Nuclear Information System (INIS)

Lambrecht, R.H.D.; Slegers, G.; Claeys, A.; Vandecasteele, C.

1985-01-01

Nitrogen-13-labelled β-nicotinamide adenine dinucleotide ( 13 N-NAD) is an interesting new compound for positron emission tomography. A semi-automatic production method is developed that yields a solution of 13 N-NAD of radiopharmaceutical quality, suitable for human intravenous administration. The 13 N-NAD is prepared enzymatically in one step from cyclotron-produced 13 NH 3 and nicotinic acid adenine dinucleotide (deamido-NAD). The enzyme NAD synthetase (E.C. 6.3.1.5), catalysing this reaction, is extracted and purified from Escherichia coli. The purified enzyme is immobilized by glutaraldehyde coupling to γ-aminopropylsilane-coated porous glass beads. The enzyme-loaded glass beads are packed in a column. The kinetic properties of the column are optimized. For synthetizing 13 N-NAD, the mixture of co-factors and substrates, containing 13 NH 3 , is pumped over the enzyme column. The unreacted 13 NH 3 is separated from 13 N-NAD by on-line passage over a cation exchanger. After passing over a millipore filter, a sterile solution of radiochemically pure 13 N-NAD is obtained, containing 70 mCi in 10 mL. The total synthesis time is 10 minutes. The specific activity is about 120 mCi/μmol at EOB. Quality control includes sterility and pyrogen tests, HPLC and HPTLC analysis. (author)

ERP Correlates of Encoding Success and Encoding Selectivity in Attention Switching

Science.gov (United States)

Yeung, Nick

2016-01-01

Long-term memory encoding depends critically on effective processing of incoming information. The degree to which participants engage in effective encoding can be indexed in electroencephalographic (EEG) data by studying event-related potential (ERP) subsequent memory effects. The current study investigated ERP correlates of memory success operationalised with two different measures—memory selectivity and global memory—to assess whether previously observed ERP subsequent memory effects reflect focused encoding of task-relevant information (memory selectivity), general encoding success (global memory), or both. Building on previous work, the present study combined an attention switching paradigm—in which participants were presented with compound object-word stimuli and switched between attending to the object or the word across trials—with a later recognition memory test for those stimuli, while recording their EEG. Our results provided clear evidence that subsequent memory effects resulted from selective attentional focusing and effective top-down control (memory selectivity) in contrast to more general encoding success effects (global memory). Further analyses addressed the question of whether successful encoding depended on similar control mechanisms to those involved in attention switching. Interestingly, differences in the ERP correlates of attention switching and successful encoding, particularly during the poststimulus period, indicated that variability in encoding success occurred independently of prestimulus demands for top-down cognitive control. These results suggest that while effects of selective attention and selective encoding co-occur behaviourally their ERP correlates are at least partly dissociable. PMID:27907075

Genetical and functional investigation of fliC genes encoding flagellar serotype H4 in wildtype strains of Escherichia coli and in a laboratory E. coli K-12 strain expressing flagellar antigen type H48

Directory of Open Access Journals (Sweden)

Schaudinn Christoph

2005-01-01

Full Text Available Abstract Background Serotyping of O-(lipopolysaccharide and H-(flagellar antigens is a wideley used method for identification of pathogenic strains and clones of Escherichia coli. At present, 176 O- and 53 H-antigens are described for E. coli which occur in different combinations in the strains. The flagellar antigen H4 is widely present in E. coli strains of different O-serotypes and pathotypes and we have investigated the genetic relationship between H4 encoding fliC genes by PCR, nucleotide sequencing and expression studies. Results The complete nucleotide sequence of fliC genes present in E. coli reference strains U9-41 (O2:K1:H4 and P12b (O15:H17 was determined and both were found 99.3% (1043 of 1050 nucleotides identical in their coding sequence. A PCR/RFLP protocol was developed for typing of fliC-H4 strains and 88 E. coli strains reacting with H4 antiserum were investigated. Nucleotide sequencing of complete fliC genes of six E. coli strains which were selected based on serum agglutination titers, fliC-PCR genotyping and reference data revealed 96.6 to 100% identity on the amino acid level. The functional expression of flagellin encoded by fliC-H4 from strain U9-41 and from our strain P12b which is an H4 expressing variant type was investigated in the E. coli K-12 strain JM109 which encodes flagellar type H48. The fliC recombinant plasmid carrying JM109 strains reacted with both H4 and H48 specific antisera whereas JM109 reacted only with the H48 antiserum. By immunoelectron microscopy, we could show that the flagella made by the fliC-H4 recombinant plasmid carrying strain are constituted of H48 and H4 flagellins which are co-assembled into functional flagella. Conclusion The flagellar serotype H4 is encoded by closely related fliC genes present in serologically different types of E. coli strainswhich were isolated at different time periods and geographical locations. Our expression studies show for the first time, that flagellins of

Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

Directory of Open Access Journals (Sweden)

Alice Kira Zelman

2012-05-01

Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

KAUST Repository

Zelman, Alice K.

2012-05-29

Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

Science.gov (United States)

Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

1995-06-01

cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

Sequence-Based Appraisal of the Genes Encoding Neck and Carbohydrate Recognition Domain of Conglutinin in Blackbuck (Antilope cervicapra and Goat (Capra hircus

Directory of Open Access Journals (Sweden)

Sasmita Barik

2014-01-01

Full Text Available Conglutinin, a collagenous C-type lectin, acts as soluble pattern recognition receptor (PRR in recognition of pathogens. In the present study, genes encoding neck and carbohydrate recognition domain (NCRD of conglutinin in goat and blackbuck were amplified, cloned, and sequenced. The obtained 488 bp ORFs encoding NCRD were submitted to NCBI with accession numbers KC505182 and KC505183. Both nucleotide and predicted amino acid sequences were analysed with sequences of other ruminants retrieved from NCBI GenBank using DNAstar and Megalign5.2 software. Sequence analysis revealed maximum similarity of blackbuck sequence with wild ruminants like nilgai and buffalo, whereas goat sequence displayed maximum similarity with sheep sequence at both nucleotide and amino acid level. Phylogenetic analysis further indicated clear divergence of wild ruminants from the domestic ruminants in separate clusters. The predicted secondary structures of NCRD protein in goat and blackbuck using SWISSMODEL ProtParam online software were found to possess 6 beta-sheets and 3 alpha-helices which are identical to the result obtained in case of sheep, cattle, buffalo, and nilgai. However, quaternary structure in goat, sheep, and cattle was found to differ from that of buffalo, nilgai, and blackbuck, suggesting a probable variation in the efficiency of antimicrobial activity among wild and domestic ruminants.

beta-1,2,3-Triazolyl-Nucleosides as Nicotinamide Riboside Mimics

Czech Academy of Sciences Publication Activity Database

Amigues, E.J.; Armstrong, E.; Dvořáková, Marcela; Migaud, M.E.; Huang, M.

2009-01-01

Roč. 28, č. 3 (2009), s. 238-259 ISSN 1525-7770 Institutional research plan: CEZ:AV0Z50380511 Keywords : Nucleoside * nucleotide * sirtuin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.768, year: 2009

Hydrotropic solubilization of lipophilic drugs for oral delivery: The effects of urea and nicotinamide on carbamazepine solubility-permeability interplay

Directory of Open Access Journals (Sweden)

Avital Beig

2016-10-01

Full Text Available Hydrotropy refers to increasing the water solubility of otherwise poorly soluble compound by the presence of small organic molecules. While it can certainly increase the apparent solubility of a lipophilic drug, the effect of hydrotropy on the drugs' permeation through the intestinal membrane has not been studied. The purpose of this work was to investigate the solubility-permeability interplay when using hydrotropic drug solubilization. The concentration-dependent effects of the commonly used hydrotropes urea and nicotinamide, on the solubility and the permeability of the lipophilic antiepileptic drug carbamazepine were studied. Then, the solubility-permeability interplay was mathematically modeled, and was compared to the experimental data. Both hydrotropes allowed significant concentration-dependent carbamazepine solubility increase (up to ~30-fold. A concomitant permeability decrease was evident both in-vitro and in-vivo (~17-fold for nicotinamide and ~9-fold for urea, revealing a solubility-permeability tradeoff when using hydrotropic drug solubilization. A relatively simplified simulation approach based on proportional opposite correlation between the solubility increase and the permeability decrease at a given hydrotrope concentration allowed excellent prediction of the overall solubility-permeability tradeoff. In conclusion, when using hydrotropic drug solubilization it is prudent to not focus solely on solubility, but to account for the permeability as well; achieving optimal solubility-permeability balance may promote the overall goal of the formulation to maximize oral drug exposure.

Hydrotropic Solubilization of Lipophilic Drugs for Oral Delivery: The Effects of Urea and Nicotinamide on Carbamazepine Solubility–Permeability Interplay

Science.gov (United States)

Beig, Avital; Lindley, David; Miller, Jonathan M.; Agbaria, Riad; Dahan, Arik

2016-01-01

Hydrotropy refers to increasing the water solubility of otherwise poorly soluble compound by the presence of small organic molecules. While it can certainly increase the apparent solubility of a lipophilic drug, the effect of hydrotropy on the drugs’ permeation through the intestinal membrane has not been studied. The purpose of this work was to investigate the solubility–permeability interplay when using hydrotropic drug solubilization. The concentration-dependent effects of the commonly used hydrotropes urea and nicotinamide, on the solubility and the permeability of the lipophilic antiepileptic drug carbamazepine were studied. Then, the solubility–permeability interplay was mathematically modeled, and was compared to the experimental data. Both hydrotropes allowed significant concentration-dependent carbamazepine solubility increase (up to ∼30-fold). A concomitant permeability decrease was evident both in vitro and in vivo (∼17-fold for nicotinamide and ∼9-fold for urea), revealing a solubility–permeability tradeoff when using hydrotropic drug solubilization. A relatively simplified simulation approach based on proportional opposite correlation between the solubility increase and the permeability decrease at a given hydrotrope concentration allowed excellent prediction of the overall solubility–permeability tradeoff. In conclusion, when using hydrotropic drug solubilization it is prudent to not focus solely on solubility, but to account for the permeability as well; achieving optimal solubility–permeability balance may promote the overall goal of the formulation to maximize oral drug exposure. PMID:27826241

Comparative metagenomic analysis of plasmid encoded functions in the human gut microbiome

Directory of Open Access Journals (Sweden)

Marchesi Julian R

2010-01-01

Full Text Available Abstract Background Little is known regarding the pool of mobile genetic elements associated with the human gut microbiome. In this study we employed the culture independent TRACA system to isolate novel plasmids from the human gut microbiota, and a comparative metagenomic analysis to investigate the distribution and relative abundance of functions encoded by these plasmids in the human gut microbiome. Results Novel plasmids were acquired from the human gut microbiome, and homologous nucleotide sequences with high identity (>90% to two plasmids (pTRACA10 and pTRACA22 were identified in the multiple human gut microbiomes analysed here. However, no homologous nucleotide sequences to these plasmids were identified in the murine gut or environmental metagenomes. Functions encoded by the plasmids pTRACA10 and pTRACA22 were found to be more prevalent in the human gut microbiome when compared to microbial communities from other environments. Among the most prevalent functions identified was a putative RelBE toxin-antitoxin (TA addiction module, and subsequent analysis revealed that this was most closely related to putative TA modules from gut associated bacteria belonging to the Firmicutes. A broad phylogenetic distribution of RelE toxin genes was observed in gut associated bacterial species (Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, but no RelE homologues were identified in gut associated archaeal species. We also provide indirect evidence for the horizontal transfer of these genes between bacterial species belonging to disparate phylogenetic divisions, namely Gram negative Proteobacteria and Gram positive species from the Firmicutes division. Conclusions The application of a culture independent system to capture novel plasmids from the human gut mobile metagenome, coupled with subsequent comparative metagenomic analysis, highlighted the unexpected prevalence of plasmid encoded functions in the gut microbial ecosystem. In

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

Science.gov (United States)

Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

2016-10-01

The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

Characterization of a Novel Nicotine Hydroxylase from Pseudomonas sp. ZZ-5 That Catalyzes the Conversion of 6-Hydroxy-3-Succinoylpyridine into 2,5-Dihydroxypyridine

Directory of Open Access Journals (Sweden)

Tao Wei

2017-08-01

Full Text Available A novel nicotine hydroxylase was isolated from Pseudomonas sp. ZZ-5 (HSPHZZ. The sequence encoding the enzyme was 1206 nucleotides long, and encoded a protein of 401 amino acids. Recombinant HSPHZZ was functionally overexpressed in Escherichia coli BL21-Codon Plus (DE3-RIL cells and purified to homogeneity after Ni-NTA affinity chromatography. Liquid chromatography-mass spectrometry (LC-MS analyses indicated that the enzyme could efficiently catalyze the conversion of 6-hydroxy-3-succinoylpyridine (HSP into 2,5-dihydroxypyridine (2,5-DHP and succinic acid in the presence of nicotinamide adenine dinucleotide (NADH and flavin adenine dinucleotide (FAD. The kinetic constants (Km, kcat, and kcat/Km of HSPHZZ toward HSP were 0.18 mM, 2.1 s−1, and 11.7 s−1 mM−1, respectively. The optimum temperature, pH, and optimum concentrations of substrate and enzyme for 2,5-DHP production were 30 °C, 8.5, 1.0 mM, and 1.0 μM, respectively. Under optimum conditions, 85.3 mg/L 2,5-DHP was produced in 40 min with a conversion of 74.9%. These results demonstrated that HSPHZZ could be used for the enzymatic production of 2,5-DHP in biotechnology applications.

Diaquabis(4-bromobenzoato-κObis(nicotinamide-κN1copper(II

Directory of Open Access Journals (Sweden)

Hacali Necefoğlu

2011-07-01

Full Text Available The asymmetric unit of the title mononuclear CuII complex, [Cu(C7H4BrO22(C6H6N2O2(H2O2], contains one half-molecule, the CuII atom being located on an inversion center. The unit cell contains two nicotinamide (NA, two 4-bromobenzoate (PBB ligands and two coordinated water molecules. The four O atoms in the equatorial plane around the CuII ion form a slightly distorted square-planar arrangement, while the slightly distorted octahedral coordination is completed by the two N atoms of the NA ligands in the axial positions. The dihedral angle between the carboxylate group and the adjacent benzene ring is 22.17 (16°, while the pyridine ring and the benzene ring are oriented at a dihedral angle of 82.80 (6°. In the crystal, N—H...O, O—H...O and C—H...O hydrogen bonds link the molecules into a three-dimensional network. A weak C—H...π interaction is also observed.

Mitochondrial specialization revealed by single muscle fiber proteomics

DEFF Research Database (Denmark)

Schiaffino, S; Reggiani, C; Kostrominova, T Y

2015-01-01

to buffering the H2 O2 produced by the respiratory chain. Nicotinamide nucleotide transhydrogenase (NNT), the other major mito-chondrial enzyme involved in NADPH generation, is also more abundant in type 1 fibers. We suggest that the continuously active type 1 fibers are endowed with a more efficient H2 O2...

Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

International Nuclear Information System (INIS)

Aalto, T.K.; Raivio, K.O.

1990-01-01

Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

Main: Nucleotide Analysis [KOME

Lifescience Database Archive (English)

Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

Enhancing NAD+ Salvage Pathway Reverts the Toxicity of Primary Astrocytes Expressing Amyotrophic Lateral Sclerosis-linked Mutant Superoxide Dismutase 1 (SOD1)*

Science.gov (United States)

Harlan, Benjamin A.; Pehar, Mariana; Sharma, Deep R.; Beeson, Gyda; Beeson, Craig C.; Vargas, Marcelo R.

2016-01-01

Nicotinamide adenine dinucleotide (NAD+) participates in redox reactions and NAD+-dependent signaling pathways. Although the redox reactions are critical for efficient mitochondrial metabolism, they are not accompanied by any net consumption of the nucleotide. On the contrary, NAD+-dependent signaling processes lead to its degradation. Three distinct families of enzymes consume NAD+ as substrate: poly(ADP-ribose) polymerases, ADP-ribosyl cyclases (CD38 and CD157), and sirtuins (SIRT1–7). Because all of the above enzymes generate nicotinamide as a byproduct, mammalian cells have evolved an NAD+ salvage pathway capable of resynthesizing NAD+ from nicotinamide. Overexpression of the rate-limiting enzyme in this pathway, nicotinamide phosphoribosyltransferase, increases total and mitochondrial NAD+ levels in astrocytes. Moreover, targeting nicotinamide phosphoribosyltransferase to the mitochondria also enhances NAD+ salvage pathway in astrocytes. Supplementation with the NAD+ precursors nicotinamide mononucleotide and nicotinamide riboside also increases NAD+ levels in astrocytes. Amyotrophic lateral sclerosis (ALS) is caused by the progressive degeneration of motor neurons in the spinal cord, brain stem, and motor cortex. Superoxide dismutase 1 (SOD1) mutations account for up to 20% of familial ALS and 1–2% of apparently sporadic ALS cases. Primary astrocytes isolated from mutant human superoxide dismutase 1-overexpressing mice as well as human post-mortem ALS spinal cord-derived astrocytes induce motor neuron death in co-culture. Increasing total and mitochondrial NAD+ content in ALS astrocytes increases oxidative stress resistance and reverts their toxicity toward co-cultured motor neurons. Taken together, our results suggest that enhancing the NAD+ salvage pathway in astrocytes could be a potential therapeutic target to prevent astrocyte-mediated motor neuron death in ALS. PMID:27002158

The kinetic analysis of the N-methylation of 4-phenylpyridine by nicotinamide N-methyltransferase: Evidence for a novel mechanism of substrate inhibition.

Science.gov (United States)

van Haren, Matthijs J; Thomas, Martin G; Sartini, Davide; Barlow, David J; Ramsden, David B; Emanuelli, Monica; Klamt, Fábio; Martin, Nathaniel I; Parsons, Richard B

2018-03-13

The N-methylation of 4-phenylpyridine produces the neurotoxin 1-methyl-4-phenylpyridinium ion (MPP+). We investigated the kinetics of 4-phenylpyridine N-methylation by nicotinamide N-methyltransferase (NNMT) and its effect upon 4-phenylpyridine toxicity in vitro. Human recombinant NNMT possessed 4-phenylpyridine N-methyltransferase activity, with a specific activity of 1.7 ± 0.03 nmol MPP+ produced/h/mg NNMT. Although the K m for 4-phenylpyridine was similar to that reported for nicotinamide, its k cat of 9.3 × 10 -5  ± 2 × 10 -5  s -1 and specificity constant, k cat /K m , of 0.8 ± 0.8 s -1  M -1 were less than 0.15% of the respective values for nicotinamide, demonstrating that 4-phenylpyridine is a poor substrate for NNMT. At low (N-methylation was competitively inhibited by dimethylsulphoxide, with a K i of 34 ± 8 mM. At high (>2.5 mM) substrate concentration, enzyme activity followed substrate inhibition kinetics, with a K i of 4 ± 1 mM. In silico molecular docking suggested that 4-phenylpyridine binds to the active site of NNMT in two non-redundant poses, one a substrate binding mode and the other an inhibitory mode. Finally, the expression of NNMT in the SH-SY5Y cell-line had no effect cell death, viability, ATP content or mitochondrial membrane potential. These data demonstrate that 4-phenylpyridine N-methylation by NNMT is unlikely to serve as a source of MPP+. The possibility for competitive inhibition by dimethylsulphoxide should be considered in NNMT-based drug discovery studies. The potential for 4-phenylpyridine to bind to the active site in two binding orientations using the same active site residues is a novel mechanism of substrate inhibition. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of a wide range of dietary nicotinamide riboside (NR) concentrations on metabolic flexibility and white adipose tissue (WAT) of mice fed a mildly obesogenic diet

NARCIS (Netherlands)

Shi, W.; Hegeman, M.A.; Dartel, van D.A.M.; Tang, J.; Suarez, M.; Swarts, H.; Hee, van der B.; Arola, L.; Keijer, J.

2017-01-01

Scope: Metabolic flexibility is the ability to switch metabolism between carbohydrate oxidation (CHO) and fatty acid oxidation (FAO) and is a biomarker for metabolic health. The effect on metabolic health of nicotinamide riboside (NR) as an exclusive source of vitamin B3 is unknown and is examined

Displacement encoder

International Nuclear Information System (INIS)

Hesketh, T.G.

1983-01-01

In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

Mutations in the nucleotide binding pocket of MreB can alter cell curvature and polar morphology in Caulobacter.

Science.gov (United States)

Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A

2011-07-01

The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues

OpenAIRE

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...

Genotypic and phenotypic spectrum of pyridoxine-dependent epilepsy (ALDH7A1 deficiency)

NARCIS (Netherlands)

Mills, P.B.; Footitt, E.J.; Mills, K.A.; Tuschl, K.; Aylett, S.; Varadkar, S.; Hemingway, C.; Marlow, N.; Rennie, J.; Baxter, P.; Dulac, O.; Nabbout, R.; Craigen, W.J.; Schmitt, B.; Feillet, F.; Christensen, E.; de Lonlay, P.; Pike, M.G.; Hughes, M.I.; Struijs, E.A.; Jakobs, C.; Zuberi, S.M.; Clayton, P.T.

2010-01-01

Pyridoxine-dependent epilepsy was recently shown to be due to mutations in the ALDH7A1 gene, which encodes antiquitin, an enzyme that catalyses the nicotinamide adenine dinucleotide-dependent dehydrogenation of l-α-aminoadipic semialdehyde/l-Δ

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Modulatory effects of garlic, ginger, turmeric and their mixture on hyperglycaemia, dyslipidaemia and oxidative stress in streptozotocin-nicotinamide diabetic rats.

Science.gov (United States)

Madkor, Hafez R; Mansour, Sherif W; Ramadan, Gamal

2011-04-01

Spices which show hypoglycaemic, hypolipidaemic and antioxidant activities may have a role in the treatment of diabetes and its complications. The present study aimed to compare the modulatory effects of garlic, ginger, turmeric and their mixture on the metabolic syndrome and oxidative stress in streptozotocin (STZ)-nicotinamide diabetic rats. Diabetes was induced in overnight fasted rats by a single intraperitoneal injection of STZ (65 mg/kg body weight) and nicotinamide (110 mg/kg body weight, 15 min before STZ injection). Diabetic rats orally received either distilled water (as vehicle) or 200 mg/kg body weight of garlic bulb, ginger rhizome or turmeric rhizome powder suspension separately or mixed together (GGT mixture) for twenty-eight consecutive days. The results showed that these spices and their mixture significantly alleviated (80-97 %, P diabetic rats by increasing the production of insulin (26-37 %), enhancing the antioxidant defence system (31-52 %, especially GSH) and decreasing lipid peroxidation (60-97 %). The greatest modulation was seen in diabetic rats that received garlic and the GGT mixture (10-23 % more than that in the ginger and turmeric groups). In conclusion, garlic or the mix including garlic appears to have an impact on each of the measures more effectively than ginger and turmeric and may have a role in alleviating the risks of the metabolic syndrome and cardiovascular complications.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Directory of Open Access Journals (Sweden)

Meiler Arno

2012-09-01

Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Science.gov (United States)

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

Science.gov (United States)

Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

2010-11-19

Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

An open-label, non-randomized study of the pharmacokinetics of the nutritional supplement nicotinamide riboside (NR) and its effects on blood NAD+ levels in healthy volunteers.

Science.gov (United States)

Airhart, Sophia E; Shireman, Laura M; Risler, Linda J; Anderson, Gail D; Nagana Gowda, G A; Raftery, Daniel; Tian, Rong; Shen, Danny D; O'Brien, Kevin D

2017-01-01

The co-primary objectives of this study were to determine the human pharmacokinetics (PK) of oral NR and the effect of NR on whole blood nicotinamide adenine dinucleotide (NAD+) levels. Though mitochondrial dysfunction plays a critical role in the development and progression of heart failure, no mitochondria-targeted therapies have been translated into clinical practice. Recent murine studies have reported associations between imbalances in the NADH/NAD+ ratio with mitochondrial dysfunction in multiple tissues, including myocardium. Moreover, an NAD+ precursor, nicotinamide mononucleotide, improved cardiac function, while another NAD+ precursor, nicotinamide riboside (NR), improved mitochondrial function in muscle, liver and brown adipose. Thus, PK studies of NR in humans is critical for future clinical trials. In this non-randomized, open-label PK study of 8 healthy volunteers, 250 mg NR was orally administered on Days 1 and 2, then uptitrated to peak dose of 1000 mg twice daily on Days 7 and 8. On the morning of Day 9, subjects completed a 24-hour PK study after receiving 1000 mg NR at t = 0. Whole-blood levels of NR, clinical blood chemistry, and NAD+ levels were analyzed. Oral NR was well tolerated with no adverse events. Significant increases comparing baseline to mean concentrations at steady state (Cave,ss) were observed for both NR (p = 0.03) and NAD+ (p = 0.001); the latter increased by 100%. Absolute changes from baseline to Day 9 in NR and NAD+ levels correlated highly (R2 = 0.72, p = 0.008). Because NR increases circulating NAD+ in humans, NR may have potential as a therapy in patients with mitochondrial dysfunction due to genetic and/or acquired diseases.

An open-label, non-randomized study of the pharmacokinetics of the nutritional supplement nicotinamide riboside (NR and its effects on blood NAD+ levels in healthy volunteers.

Directory of Open Access Journals (Sweden)

Sophia E Airhart

Full Text Available The co-primary objectives of this study were to determine the human pharmacokinetics (PK of oral NR and the effect of NR on whole blood nicotinamide adenine dinucleotide (NAD+ levels.Though mitochondrial dysfunction plays a critical role in the development and progression of heart failure, no mitochondria-targeted therapies have been translated into clinical practice. Recent murine studies have reported associations between imbalances in the NADH/NAD+ ratio with mitochondrial dysfunction in multiple tissues, including myocardium. Moreover, an NAD+ precursor, nicotinamide mononucleotide, improved cardiac function, while another NAD+ precursor, nicotinamide riboside (NR, improved mitochondrial function in muscle, liver and brown adipose. Thus, PK studies of NR in humans is critical for future clinical trials.In this non-randomized, open-label PK study of 8 healthy volunteers, 250 mg NR was orally administered on Days 1 and 2, then uptitrated to peak dose of 1000 mg twice daily on Days 7 and 8. On the morning of Day 9, subjects completed a 24-hour PK study after receiving 1000 mg NR at t = 0. Whole-blood levels of NR, clinical blood chemistry, and NAD+ levels were analyzed.Oral NR was well tolerated with no adverse events. Significant increases comparing baseline to mean concentrations at steady state (Cave,ss were observed for both NR (p = 0.03 and NAD+ (p = 0.001; the latter increased by 100%. Absolute changes from baseline to Day 9 in NR and NAD+ levels correlated highly (R2 = 0.72, p = 0.008.Because NR increases circulating NAD+ in humans, NR may have potential as a therapy in patients with mitochondrial dysfunction due to genetic and/or acquired diseases.

Bacterial nucleotide-based second messengers.

Science.gov (United States)

Pesavento, Christina; Hengge, Regine

2009-04-01

In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

Science.gov (United States)

Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

2013-07-22

Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

Flipped-Adversarial AutoEncoders

OpenAIRE

Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

2018-01-01

We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

NARCIS (Netherlands)

Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

a permutation encoding te algorithm solution of reso tation encoding

African Journals Online (AJOL)

eobe

Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

Science.gov (United States)

Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-08-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

Science.gov (United States)

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

The generation of myricetin-nicotinamide nanococrystals by top down and bottom up technologies.

Science.gov (United States)

Liu, Mingyu; Hong, Chao; Li, Guowen; Ma, Ping; Xie, Yan

2016-09-30

Myricetin-nicotinamide (MYR-NIC) nanococrystal preparation methods were developed and optimized using both top down and bottom up approaches. The grinding (top down) method successfully achieved nanococrystals, but there were some micrometer range particles and aggregation. The key consideration of the grinding technology was to control the milling time to determine a balance between the particle size and distribution. In contrast, a modified bottom up approach based on a solution method in conjunction with sonochemistry resulted in a uniform MYR-NIC nanococrystal that was confirmed by powder x-ray diffraction, scanning electron microscopy, dynamic light scattering, and differential scanning calorimeter, and the particle dissolution rate and amount were significantly greater than that of MYR-NIC cocrystal. Notably, this was a simple method without the addition of any non-solvent. We anticipate our findings will provide some guidance for future nanococrystal preparation as well as its application in both chemical and pharmaceutical area.

Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

Science.gov (United States)

Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

2017-12-14

A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Enhancing NAD+ Salvage Pathway Reverts the Toxicity of Primary Astrocytes Expressing Amyotrophic Lateral Sclerosis-linked Mutant Superoxide Dismutase 1 (SOD1).

Science.gov (United States)

Harlan, Benjamin A; Pehar, Mariana; Sharma, Deep R; Beeson, Gyda; Beeson, Craig C; Vargas, Marcelo R

2016-05-13

Nicotinamide adenine dinucleotide (NAD(+)) participates in redox reactions and NAD(+)-dependent signaling pathways. Although the redox reactions are critical for efficient mitochondrial metabolism, they are not accompanied by any net consumption of the nucleotide. On the contrary, NAD(+)-dependent signaling processes lead to its degradation. Three distinct families of enzymes consume NAD(+) as substrate: poly(ADP-ribose) polymerases, ADP-ribosyl cyclases (CD38 and CD157), and sirtuins (SIRT1-7). Because all of the above enzymes generate nicotinamide as a byproduct, mammalian cells have evolved an NAD(+) salvage pathway capable of resynthesizing NAD(+) from nicotinamide. Overexpression of the rate-limiting enzyme in this pathway, nicotinamide phosphoribosyltransferase, increases total and mitochondrial NAD(+) levels in astrocytes. Moreover, targeting nicotinamide phosphoribosyltransferase to the mitochondria also enhances NAD(+) salvage pathway in astrocytes. Supplementation with the NAD(+) precursors nicotinamide mononucleotide and nicotinamide riboside also increases NAD(+) levels in astrocytes. Amyotrophic lateral sclerosis (ALS) is caused by the progressive degeneration of motor neurons in the spinal cord, brain stem, and motor cortex. Superoxide dismutase 1 (SOD1) mutations account for up to 20% of familial ALS and 1-2% of apparently sporadic ALS cases. Primary astrocytes isolated from mutant human superoxide dismutase 1-overexpressing mice as well as human post-mortem ALS spinal cord-derived astrocytes induce motor neuron death in co-culture. Increasing total and mitochondrial NAD(+) content in ALS astrocytes increases oxidative stress resistance and reverts their toxicity toward co-cultured motor neurons. Taken together, our results suggest that enhancing the NAD(+) salvage pathway in astrocytes could be a potential therapeutic target to prevent astrocyte-mediated motor neuron death in ALS. © 2016 by The American Society for Biochemistry and Molecular

The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

Science.gov (United States)

Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

1992-12-01

The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Influence of Sodium Lauryl Sulfate and Tween 80 on Carbamazepine–Nicotinamide Cocrystal Solubility and Dissolution Behaviour

Science.gov (United States)

Li, Mingzhong; Qiao, Ning; Wang, Ke

2013-01-01

The influence of the surfactants of sodium lauryl sulfate (SLS) and Tween 80 on carbamazepine–nicotinamide (CBZ–NIC) cocrystal solubility and dissolution behaviour has been studied in this work. The solubility of the CBZ–NIC cocrystal was determined by measuring the eutectic concentrations of the drug and the coformer. Evolution of the intrinsic dissolution rate (IDR) of the CBZ–NIC cocrystal was monitored by the UV imaging dissolution system during dissolution. Experimental results indicated that SLS and Tween 80 had little influence upon the solubility of the CBZ–NIC cocrystal but they had totally opposite effects on the IDR of the CBZ–NIC cocrystal during dissolution. SLS significantly increased the IDR of the CBZ–NIC cocrystal while Tween 80 decreased its IDR. PMID:24300560

Influence of Sodium Lauryl Sulfate and Tween 80 on Carbamazepine–Nicotinamide Cocrystal Solubility and Dissolution Behaviour

Directory of Open Access Journals (Sweden)

Ke Wang

2013-10-01

Full Text Available The influence of the surfactants of sodium lauryl sulfate (SLS and Tween 80 on carbamazepine–nicotinamide (CBZ–NIC cocrystal solubility and dissolution behaviour has been studied in this work. The solubility of the CBZ–NIC cocrystal was determined by measuring the eutectic concentrations of the drug and the coformer. Evolution of the intrinsic dissolution rate (IDR of the CBZ–NIC cocrystal was monitored by the UV imaging dissolution system during dissolution. Experimental results indicated that SLS and Tween 80 had little influence upon the solubility of the CBZ–NIC cocrystal but they had totally opposite effects on the IDR of the CBZ–NIC cocrystal during dissolution. SLS significantly increased the IDR of the CBZ–NIC cocrystal while Tween 80 decreased its IDR.

Influence of sodium lauryl sulfate and tween 80 on carbamazepine-nicotinamide cocrystal solubility and dissolution behaviour.

Science.gov (United States)

Li, Mingzhong; Qiao, Ning; Wang, Ke

2013-10-11

The influence of the surfactants of sodium lauryl sulfate (SLS) and Tween 80 on carbamazepine-nicotinamide (CBZ-NIC) cocrystal solubility and dissolution behaviour has been studied in this work. The solubility of the CBZ-NIC cocrystal was determined by measuring the eutectic concentrations of the drug and the coformer. Evolution of the intrinsic dissolution rate (IDR) of the CBZ-NIC cocrystal was monitored by the UV imaging dissolution system during dissolution. Experimental results indicated that SLS and Tween 80 had little influence upon the solubility of the CBZ-NIC cocrystal but they had totally opposite effects on the IDR of the CBZ-NIC cocrystal during dissolution. SLS significantly increased the IDR of the CBZ-NIC cocrystal while Tween 80 decreased its IDR.

Identification of cyclic nucleotide gated channels using regular expressions

KAUST Repository

Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

2013-01-01

Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

Nicotinamide nucleotide transhydrogenase (NNT deficiency dysregulates mitochondrial retrograde signaling and impedes proliferation

Directory of Open Access Journals (Sweden)

Hung-Yao Ho

2017-08-01

Full Text Available To study the physiological roles of NADH and NADPH homeostasis in cancer, we studied the effect of NNT knockdown on physiology of SK-Hep1 cells. NNT knockdown cells show limited abilities to maintain NAD+ and NADPH levels and have reduced proliferation and tumorigenicity. There is an increased dependence of energy production on oxidative phosphorylation. Studies with stable isotope tracers have revealed that under the new steady-state metabolic condition, the fluxes of TCA and glycolysis decrease while that of reductive carboxylation increases. Increased [α-ketoglutarate]/[succinate] ratio in NNT-deficient cells results in decrease in HIF-1α level and expression of HIF-1α regulated genes. Reduction in NADPH level leads to repression of HDAC1 activity and an increase in p53 acetylation. These findings suggest that NNT is essential to homeostasis of NADH and NADPH pools, anomalies of which affect HIF-1α- and HDAC1-dependent pathways, and hence retrograde response of mitochondria. Keywords: Transhydrogenase, Mitochondria, Metabolomics, HIF-1α, HDAC1

Nicotinamide starvation and inhibition of poly(ADP-Ribose) synthesis enhance the induced mutation in Chinese hamster V79 cells

International Nuclear Information System (INIS)

Okada, Gensaku; Kaneko, Ichiro; Mitsui, Hideki.

1987-01-01

The effects of nicotinamide (NA) deficiency and added NA and 3-aminobenzamide (3AB) on the cytotoxicity and the induction of mutations in Chinese hamster V79-14 cells were investigated. In NA deficiency the addition of NA (up to 4 mM) and 3AB (up to 7.5 mM) was not cytotoxic. The presence of NA prior to exposure to mitomycin C (MMC) or γ-rays produced a dose-dependent increase in the relative cloning ability of DNA-damaged cells. The lethality of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was significantly potentiated by pre-treatment with 5 mM 3AB, but no potentiation by 3AB was observed for MMC, ultraviolet (UV)-B light, or γ-rays. Among cells pre-cultured in NA-free medium there were increased frequencies of mutations at both the hypoxanthineguanine phosphoribosyltransferase (HGPRT) and the adenine phosphoribosyltransferase (APRT) loci following DNA damage. The enhancing effect by NA deficiency was time-dependent. Incubation with NA prior to DNA damage produced a significant reduction in the frequency of mutations. The addition of 3AB to the nicotinamide adenine dinucleotide (NAD + )-depleted cell cultures before or after the DNA damage also strongly increased the frequency of induced mutations, with increasing concentrations of 3AB up to 5 mM, but the frequency was reduced at higher concentrations. The interaction between NA deficiency and the addition of 3AB appears to act synergistically on mutation induction. A correlation was observed between the potential of inhibiting poly (ADP-ribose) polymerase and the enhancement of mutation frequency. (author)

Nucleotide Metabolism and its Control in Lactic Acid Bacteria

DEFF Research Database (Denmark)

Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

2005-01-01

Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

Science.gov (United States)

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

Science.gov (United States)

The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

OpenAIRE

Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

1989-01-01

A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

African Journals Online (AJOL)

PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

Identification of the RsmG methyltransferase target as 16S rRNA nucleotide G527 and characterization of Bacillus subtilis rsmG mutants

DEFF Research Database (Denmark)

Nishimura, Kenji; Johansen, Shanna K; Inaoka, Takashi

2007-01-01

The methyltransferase RsmG methylates the N7 position of nucleotide G535 in 16S rRNA of Bacillus subtilis (corresponding to G527 in Escherichia coli). Disruption of rsmG resulted in low-level resistance to streptomycin. A growth competition assay revealed that there are no differences in fitness...... between the rsmG mutant and parent strains under the various culture conditions examined. B. subtilis rsmG mutants emerged spontaneously at a relatively high frequency, 10(-6). Importantly, in the rsmG mutant background, high-level-streptomycin-resistant rpsL (encoding ribosomal protein S12) mutants...

Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

Science.gov (United States)

E, Chao; Duan, Baogen; Yu, Jin

2017-04-20

Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

Single Nucleotide Polymorphism

DEFF Research Database (Denmark)

Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

2014-01-01

Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

Acute Toxicity Profile and Compliance to Accelerated Radiotherapy Plus Carbogen and Nicotinamide for Clinical Stage T2–4 Laryngeal Cancer: Results of a Phase III Randomized Trial

International Nuclear Information System (INIS)

Janssens, Geert O.; Terhaard, Chris H.; Doornaert, Patricia A.; Bijl, Hendrik P.; Ende, Piet van den; Chin, Alim; Pop, Lucas A.; Kaanders, Johannes H.

2012-01-01

Purpose: To report the acute toxicity profile and compliance from a randomized Phase III trial comparing accelerated radiotherapy (AR) with accelerated radiotherapy plus carbogen and nicotinamide (ARCON) in laryngeal cancer. Methods and Materials: From April 2001 to February 2008, 345 patients with cT2–4 squamous cell laryngeal cancer were randomized to AR (n = 174) and ARCON (n = 171). Acute toxicity was scored weekly until Week 8 and every 2–4 weeks thereafter. Compliance to carbogen and nicotinamide was reported. Results: Between both treatment arms (AR vs. ARCON) no statistically significant difference was observed for incidence of acute skin reactions (moist desquamation: 56% vs. 58%, p = 0.80), acute mucosal reactions (confluent mucositis: 79% vs. 85%, p = 0.14), and symptoms related to acute mucositis (severe pain on swallowing: 53% vs. 58%, p = 0.37; nasogastric tube feeding: 28% vs. 28%, p = 0.98; narcotic medicines required: 58% vs. 58%, p = 0.97). There was a statistically significant difference in median duration of confluent mucositis in favor of AR (2.0 vs 3.0 weeks, p = 0.01). There was full compliance with carbogen breathing and nicotinamide in 86% and 80% of the patients, with discontinuation in 6% and 12%, respectively. Adjustment of antiemesis prophylaxis was needed in 42% of patients. Conclusion: With the exception of a slight increase in median duration of acute confluent mucositis, the present data reveal a similar acute toxicity profile between both regimens and a good compliance with ARCON for clinical stage T2–4 laryngeal cancers. Treatment outcome and late morbidity will determine the real therapeutic benefit.

Selecting Operations for Assembler Encoding

Directory of Open Access Journals (Sweden)

Tomasz Praczyk

2010-04-01

Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

Genotypic and phenotypic spectrum of pyridoxine-dependent epilepsy (ALDH7A1 deficiency)

DEFF Research Database (Denmark)

Mills, Philippa B; Footitt, Emma J; Mills, Kevin A

2010-01-01

Pyridoxine-dependent epilepsy was recently shown to be due to mutations in the ALDH7A1 gene, which encodes antiquitin, an enzyme that catalyses the nicotinamide adenine dinucleotide-dependent dehydrogenation of l-alpha-aminoadipic semialdehyde/L-Delta1-piperideine 6-carboxylate. However, whilst t...

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Effects of Hydro-alcoholic Extract from Arctium lappa L. (Burdock) Root on Gonadotropins, Testosterone, and Sperm Count and Viability in Male Mice with Nicotinamide/ Streptozotocin-Induced Type 2 Diabetes.

Science.gov (United States)

Ahangarpour, Akram; Oroojan, Ali Akbar; Heidari, Hamid; Ghaedi, Ehsan; Taherkhani, Reza

2015-01-01

Reproductive dysfunction is a complication of diabetes. Arctium lappa (burdock) root has hypoglycemic and antioxidative properties, which are traditionally used for treatment of impotence and sterility. Therefore, the aim of this study is to investigate the effects of its hydro alcoholic extract on gonadotropin, testosterone, and sperm parameters in nicotinamide/ streptozotocin-induced diabetic mice. In this experimental study, 56 adult male Naval Medical Research Institute (NMRI) mice (30-35 g) were randomly divided into seven groups: control, diabetes, diabetes + glibenclamide (0.25 mg/kg), diabetes + extract (200 or 300 mg/kg), and extract (200 or 300 mg/kg). Diabetes was induced with intraperitoneal injection of nicotinamide (NA) and streptozotocin (STZ). Twenty-four hours after the last extract and drug administration, serum samples, testes, and cauda epididymis were removed immediately for experimental assessment. Body weight, serum luteinizing hormone (LH), follicle stimulating hormone (FSH), and testosterone levels, and sperm count (P lappa plant has an effect on the health of the reproductive system in order to improve diabetic conditions.

Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

Science.gov (United States)

Hendershot, Jenna M.; O'Brien, Patrick J.

2014-01-01

Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

Encoding asymmetry of the N-glycosylation motif facilitates glycoprotein evolution.

Directory of Open Access Journals (Sweden)

Ryan Williams

Full Text Available Protein N-glycosylation is found in all domains of life and has a conserved role in glycoprotein folding and stability. In animals, glycoproteins transit through the Golgi where the N-glycans are trimmed and rebuilt with sequences that bind lectins, an innovation that greatly increases structural diversity and redundancy of glycoprotein-lectin interaction at the cell surface. Here we ask whether the natural tension between increasing diversity (glycan-protein interactions and site multiplicity (backup and status quo might be revealed by a phylogenic examination of glycoproteins and NXS/T(X ≠ P N-glycosylation sites. Site loss is more likely by mutation at Asn encoded by two adenosine (A-rich codons, while site gain is more probable by generating Ser or Thr downstream of an existing Asn. Thus mutations produce sites at novel positions more frequently than the reversal of recently lost sites, and therefore more paths though sequence space are made available to natural selection. An intra-species comparison of secretory and cytosolic proteins revealed a departure from equilibrium in sequences one-mutation-away from NXS/T and in (A content, indicating strong selective pressures and exploration of N-glycosylation positions during vertebrate evolution. Furthermore, secretory proteins have evolved at rates proportional to N-glycosylation site number, indicating adaptive interactions between the N-glycans and underlying protein. Given the topology of the genetic code, mutation of (A is more often nonsynonomous, and Lys, another target of many PTMs, is also encoded by two (A-rich codons. An examination of acetyl-Lys sites in proteins indicated similar evolutionary dynamics, consistent with asymmetry of the target and recognition portions of modified sites. Our results suggest that encoding asymmetry is an ancient mechanism of evolvability that increases diversity and experimentation with PTM site positions. Strong selective pressures on PTMs may have

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

Science.gov (United States)

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

Science.gov (United States)

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

Effect of tetrahydrocurcumin on lipid peroxidation and lipids in streptozotocin-nicotinamide-induced diabetic rats.

Science.gov (United States)

Murugan, Pidaran; Pari, Leelavinothan

2006-08-01

Hyperlipidaemia is an associated complication of diabetes mellitus. We recently reported that tetrahydrocurcumin lowered the blood glucose in diabetic rats. In the present study, we have investigated the effect of tetrahydrocurcumin, one of the active metabolites of curcumin on lipid profile and lipid peroxidation in streptozotocin-nicotinamide-induced diabetic rats. Tetrahydrocurcumin 80 mg/kg body weight was administered orally to diabetic rats for 45 days, resulted a significant reduction in blood glucose and significant increase in plasma insulin in diabetic rats, which proved its antidiabetic effect. Tetrahydrocurcumin also caused a significant reduction in lipid peroxidation (thiobarbituric acid reactive substances and hydroperoxides) and lipids (cholesterol, triglycerides, free fatty acids and phospholipids) in serum and tissues, suggesting its role in protection against lipid peroxidation and its antihyperlipidemic effect. Tetrahydrocurcumin showed a better effect when compared with curcumin. Results of the present study indicate that tetrahydrocurcumin showed antihyperlipidaemic effect in addition to its antidiabetic effect in type 2 diabetic rats.

Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

Directory of Open Access Journals (Sweden)

Tobias Fromme

2018-02-01

Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

4-Pyridone-3-carboxamide-1-β-d-ribonucleoside Triphosphate (4PyTP, a Novel NAD+ Metabolite Accumulating in Erythrocytes of Uremic Children: A Biomarker for a Toxic NAD+ Analogue in Other Tissues?

Directory of Open Access Journals (Sweden)

Elizabeth A. Carrey

2011-06-01

Full Text Available We have identified a novel nucleotide, 4-pyridone 3/5-carboxamide ribonucleoside triphosphate (4PyTP, which accumulates in human erythrocytes during renal failure. Using plasma and erythrocyte extracts obtained from children with chronic renal failure we show that the concentration of 4PyTP is increased, as well as other soluble NAD+ metabolites (nicotinamide, N1-methylnicotinamide and 4Py-riboside and the major nicotinamide metabolite N1-methyl-2-pyridone-5-carboxamide (2PY, with increasing degrees of renal failure. We noted that 2PY concentration was highest in the plasma of haemodialysis patients, while 4PyTP was highest in erythrocytes of children undergoing peritoneal dialysis: its concentration correlated closely with 4Py-riboside, an authentic precursor of 4PyTP, in the plasma. In the dialysis patients, GTP concentration was elevated: similar accumulation was noted previously, as a paradoxical effect in erythrocytes during treatment with immunosuppressants such as ribavirin and mycophenolate mofetil, which deplete GTP through inhibition of IMP dehydrogenase in nucleated cells such as lymphocytes. We predict that 4Py-riboside and 4Py-nucleotides bind to this enzyme and alter its activity. The enzymes that regenerate NAD+ from nicotinamide riboside also convert the drugs tiazofurin and benzamide riboside into NAD+ analogues that inhibit IMP dehydrogenase more effectively than the related ribosides: we therefore propose that the accumulation of 4PyTP in erythrocytes during renal failure is a marker for the accumulation of a related toxic NAD+ analogue that inhibits IMP dehydrogenase in other cells.

DNA Nucleotides Detection via capacitance properties of Graphene

Science.gov (United States)

Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

2016-05-01

In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

International Nuclear Information System (INIS)

Harper, J.F.; Surowy, T.K.; Sussman, M.R.

1989-01-01

In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

Nucleotide excision repair is a potential therapeutic target in multiple myeloma

Science.gov (United States)

Szalat, R; Samur, M K; Fulciniti, M; Lopez, M; Nanjappa, P; Cleynen, A; Wen, K; Kumar, S; Perini, T; Calkins, A S; Reznichenko, E; Chauhan, D; Tai, Y-T; Shammas, M A; Anderson, K C; Fermand, J-P; Arnulf, B; Avet-Loiseau, H; Lazaro, J-B; Munshi, N C

2018-01-01

Despite the development of novel drugs, alkylating agents remain an important component of therapy in multiple myeloma (MM). DNA repair processes contribute towards sensitivity to alkylating agents and therefore we here evaluate the role of nucleotide excision repair (NER), which is involved in the removal of bulky adducts and DNA crosslinks in MM. We first evaluated NER activity using a novel functional assay and observed a heterogeneous NER efficiency in MM cell lines and patient samples. Using next-generation sequencing data, we identified that expression of the canonical NER gene, excision repair cross-complementation group 3 (ERCC3), significantly impacted the outcome in newly diagnosed MM patients treated with alkylating agents. Next, using small RNA interference, stable knockdown and overexpression, and small-molecule inhibitors targeting xeroderma pigmentosum complementation group B (XPB), the DNA helicase encoded by ERCC3, we demonstrate that NER inhibition significantly increases sensitivity and overcomes resistance to alkylating agents in MM. Moreover, inhibiting XPB leads to the dual inhibition of NER and transcription and is particularly efficient in myeloma cells. Altogether, we show that NER impacts alkylating agents sensitivity in myeloma cells and identify ERCC3 as a potential therapeutic target in MM. PMID:28588253

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

Directory of Open Access Journals (Sweden)

Desirée Villahermosa

2017-05-01

Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

Effect of aqueous bark extract of Garuga pinnata Roxb. in streptozotocin-nicotinamide induced type-II diabetes mellitus.

Science.gov (United States)

Shirwaikar, Annie; Rajendran, K; Barik, Rakesh

2006-09-19

A study was undertaken to evaluate the antihyperglycemic activity of aqueous extract of bark of Garuga pinnata Roxb. (Burseraceae). The various parameters studied included fasting blood sugar levels, serum lipid levels, liver glycogen content, serum insulin level and glycated hemoglobin in diabetic and normal rats. Streptozotocin-nicotinamide was used to induce type-II diabetes mellitus. Treatment with the extract at two dose levels showed a significant increase in the liver glycogen and serum insulin level and a significant decrease in fasting blood glucose and glycated hemoglobin levels. The total cholesterol and serum triglycerides levels were also significantly reduced and the HDL cholesterol levels were significantly increased upon treatment with the extract thus proving the potent antidiabetic property of the plant.

In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

African Journals Online (AJOL)

Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

Statistical properties and fractals of nucleotide clusters in DNA sequences

International Nuclear Information System (INIS)

Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

2004-01-01

Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

DNA Nucleotide Sequence Restricted by the RI Endonuclease

Science.gov (United States)

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

Directory of Open Access Journals (Sweden)

Deyana Gencheva Hristova

2018-03-01

Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

Detection of DNA nucleotides on pretreated boron doped diamond electrodes

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

2011-07-01

The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Phosphoribosylpyrophosphate (PRPP)-less mutants of Escherichia coli

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

1989-01-01

A DNA fragment encoding kanamycin resistance was inserted in vitro into a plasmid-borne prs gene encoding phosphoribosylpyrophosphate synthetase of Escherichia coli. The resulting plasmids were subsequently transferred to the chromosome by homologous recombination and the haploid strains prs-3::Kan......R and prs-4::KanR were obtained. These strains were fully viable, but required guanosine, uridine, histidine, tryptophan and nicotinamide mononucleotide. There was no phosphoribosylpyrophosphate synthetase activity or phosphoribosylpyrophosphate pool in the mutant strains. These results show...

Yield of DNA strand breaks and their relationship to DNA polymerase I-dependent repair synthesis and ligation following x-ray exposure of toluene-treated Escherichia coli

International Nuclear Information System (INIS)

Billen, D.

1981-01-01

In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is observed. This is an exaggerated repair synthesis which can be abruptly terminated by the addition of the DNA ligase cofactor, nicotinamide adenine dinucleotide. This communication describes experiments which bear on the relationship between measurable strand breaks, DNA polymerase I-directed, exaggerated repair synthesis, and strand-break repair

The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

International Nuclear Information System (INIS)

Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

1977-01-01

In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

Nicotinamidase activity is important for germination.

Science.gov (United States)

Hunt, Lee; Holdsworth, Michael J; Gray, Julie E

2007-08-01

It has been suggested that nicotinamide must be degraded during germination; however, the enzyme responsible and its physiological role have not been previously studied. We have identified an Arabidopsis gene, NIC2, that is expressed at relatively high levels in mature seed, and encodes a nicotinamidase enzyme with homology to yeast and bacterial nicotinamidases. Seed of a knockout mutant, nic2-1, had reduced nicotinamidase activity, retarded germination and impaired germination potential. nic2-1 germination was restored by after-ripening or moist chilling, but remained hypersensitive to application of nicotinamide or ABA. Nicotinamide is a known inhibitor of NAD-degrading poly(ADP-ribose) polymerases (PARP enzymes) that are implicated in DNA repair. We found reduced poly(ADP)ribosylation levels in nic2-1 seed, which were restored by moist chilling. Furthermore, nic2-1 seed had elevated levels of NAD, and germination was hypersensitive to methyl methanesulphonate (MMS), suggesting that PARP activity and DNA repair responses were impaired. We suggest that nicotinamide is normally metabolized by NIC2 during moist chilling or after-ripening, which relieves inhibition of PARP activity and allows DNA repair to occur prior to germination.

Clinical, functional, and genetic characterization of chronic granulomatous disease in 89 Turkish patients

NARCIS (Netherlands)

Köker, Mustafa Yavuz; Camcıoğlu, Yıldız; van Leeuwen, Karin; Kılıç, Sara Şebnem; Barlan, Işıl; Yılmaz, Mustafa; Metin, Ayşe; de Boer, Martin; Avcılar, Hüseyin; Patıroğlu, Türkan; Yıldıran, Alişan; Yeğin, Olcay; Tezcan, Ilhan; Sanal, Ozden; Roos, Dirk

2013-01-01

Chronic granulomatous disease (CGD) is a rare primary immunodeficiency disorder of phagocytes resulting in impaired killing of bacteria and fungi. A mutation in one of the 4 genes encoding the components p22(phox), p47(phox), p67(phox), and p40(phox) of the leukocyte nicotinamide dinucleotide

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

Science.gov (United States)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

A rapid microwave induced synthesis of [carboxyl-14C]-nicotinic acid (vitamin B3) and [carbonyl-14C]-nicotinamide using K14CN

International Nuclear Information System (INIS)

Ravi, S.; Mathew, K.M.; Sivaprasad, N.

2008-01-01

Microwave assisted direct aromatic substitution of 3-bromopyridine with K 14 CN as the cyanide source and catalytic amount of tetrabutylammonium bromide afforded [3- 14 C]-cyanopyridine 3 in 90% yield. Microwave assisted hydrolysis of 3 with a mixture of concentrated hydrochloric acid and propionic acid afforded [carboxyl- 14 C]-nicotinic acid in 95% yield whereas microwave assisted hydrolysis of 3 with a mixture of concentrated sulfuric acid and propionic acid afforded [carbonyl- 14 C]-nicotinamide in 85% yield. (author)

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Ultrasound assisted combined molecularly imprinted polymer for selective extraction of nicotinamide in human urine and milk samples: Spectrophotometric determination and optimization study.

Science.gov (United States)

Asfaram, Arash; Ghaedi, Mehrorang; Dashtian, Kheibar

2017-01-01

Ultrasound-assisted dispersive solid phase microextraction followed by UV-vis spectrophotometer (UA-DSPME-UV-vis) was designed for extraction and preconcentration of nicotinamide (vitamin B 3 ) by HKUST-1 metal organic framework (MOF) based molecularly imprinted polymer (MIP). This new material was characterized by FTIR and FE-SEM techniques. The preliminary Plackett-Burman design was used for screening and subsequently the central composite design justifies significant terms and possible construction of mathematical equation which give the individual and cooperative contribution of variables like HKUST-1-MOF-NA-MIP mass, sonication time, temperature, eluent volume, pH and vortex time. Accordingly the optimum condition was set as: 2.0mg HKUST-1-MOF-NA-MIP, 200μL eluent and 5.0min sonication time in center points other variables were determined as the best conditions to reach the maximum recovery of the analyte. The UA-DSPME-UV-vis method performances like excellent linearity (LR), limits of detection (LOD), limits of quantification of 10-5000μgL -1 with R 2 of 0.99, LOD (1.96ngmL -1 ), LOQ (6.53μgL -1 ), respectively show successful and accurate applicability of the present method for monitoring analytes with within- and between-day precision of 0.96-3.38%. The average absolute recoveries of the nicotinamide extracted from the urine, milk and water samples were 95.85-101.27%. Copyright © 2016 Elsevier B.V. All rights reserved.

The possible role of human milk nucleotides as sleep inducers.

Science.gov (United States)

Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

2009-02-01

Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

Science.gov (United States)

Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

2016-03-15

In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysing and Comparing Encodability Criteria

Directory of Open Access Journals (Sweden)

Kirstin Peters

2015-08-01

Full Text Available Encodings or the proof of their absence are the main way to compare process calculi. To analyse the quality of encodings and to rule out trivial or meaningless encodings, they are augmented with quality criteria. There exists a bunch of different criteria and different variants of criteria in order to reason in different settings. This leads to incomparable results. Moreover it is not always clear whether the criteria used to obtain a result in a particular setting do indeed fit to this setting. We show how to formally reason about and compare encodability criteria by mapping them on requirements on a relation between source and target terms that is induced by the encoding function. In particular we analyse the common criteria full abstraction, operational correspondence, divergence reflection, success sensitiveness, and respect of barbs; e.g. we analyse the exact nature of the simulation relation (coupled simulation versus bisimulation that is induced by different variants of operational correspondence. This way we reduce the problem of analysing or comparing encodability criteria to the better understood problem of comparing relations on processes.

Landscape encodings enhance optimization.

Directory of Open Access Journals (Sweden)

Konstantin Klemm

Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

Landscape Encodings Enhance Optimization

Science.gov (United States)

Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.

2012-01-01

Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

Stress as a mnemonic filter: Interactions between medial temporal lobe encoding processes and post-encoding stress.

Science.gov (United States)

Ritchey, Maureen; McCullough, Andrew M; Ranganath, Charan; Yonelinas, Andrew P

2017-01-01

Acute stress has been shown to modulate memory for recently learned information, an effect attributed to the influence of stress hormones on medial temporal lobe (MTL) consolidation processes. However, little is known about which memories will be affected when stress follows encoding. One possibility is that stress interacts with encoding processes to selectively protect memories that had elicited responses in the hippocampus and amygdala, two MTL structures important for memory formation. There is limited evidence for interactions between encoding processes and consolidation effects in humans, but recent studies of consolidation in rodents have emphasized the importance of encoding "tags" for determining the impact of consolidation manipulations on memory. Here, we used functional magnetic resonance imaging in humans to test the hypothesis that the effects of post-encoding stress depend on MTL processes observed during encoding. We found that changes in stress hormone levels were associated with an increase in the contingency of memory outcomes on hippocampal and amygdala encoding responses. That is, for participants showing high cortisol reactivity, memories became more dependent on MTL activity observed during encoding, thereby shifting the distribution of recollected events toward those that had elicited relatively high activation. Surprisingly, this effect was generally larger for neutral, compared to emotionally negative, memories. The results suggest that stress does not uniformly enhance memory, but instead selectively preserves memories tagged during encoding, effectively acting as mnemonic filter. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Effects of Hydro-alcoholic Extract from Arctium lappa L. (Burdock) Root on Gonadotropins, Testosterone, and Sperm Count and Viability in Male Mice with Nicotinamide/ Streptozotocin-Induced Type 2 Diabetes

OpenAIRE

AHANGARPOUR, Akram; OROOJAN, Ali Akbar; HEIDARI, Hamid; GHAEDI, Ehsan; TAHERKHANI, Reza

2015-01-01

Background: Reproductive dysfunction is a complication of diabetes. Arctium lappa (burdock) root has hypoglycemic and antioxidative properties, which are traditionally used for treatment of impotence and sterility. Therefore, the aim of this study is to investigate the effects of its hydro alcoholic extract on gonadotropin, testosterone, and sperm parameters in nicotinamide/ streptozotocin-induced diabetic mice.

The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

Energy Technology Data Exchange (ETDEWEB)

Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

2014-02-26

For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

Nicotinamide N-Methyltransferase Suppression Participates in Nickel-Induced Histone H3 Lysine9 Dimethylation in BEAS-2B Cells

Directory of Open Access Journals (Sweden)

Qian Li

2017-04-01

Full Text Available Background: Nickel compounds are well-established human carcinogens with weak mutagenic activity. Histone methylation has been proposed to play an important role in nickel-induced carcinogenesis. Nicotinamide N-methyltransferase (NNMT decreases histone methylation in several cancer cells by altering the cellular ratio of S-adenosylmethionine (SAM to S-adenosylhomocysteine (SAH. However, the role of NNMT in nickel-induced histone methylation remains unclear. Methods: BEAS-2B cells were exposed to different concentrations of nickel chloride (NiCl2 for 72 h or 200 μM NiCl2 for different time periods. Histone H3 on lysine 9 (H3K9 mono-, di-, and trimethylation and NNMT protein levels were measured by western blot analysis. Expressions of NNMT mRNA and the H3k9me2-associated genes, mitogen-activated protein kinase 3 (MAP2K3 and dickkopf1 (DKK1, were determined by qPCR analysis. The cellular ratio of nicotinamide adenine dinucleotide (NAD+ to reduced NAD (NADH and SAM/SAH ratio were determined. Results: Exposure of BEAS-2B cells to nickel increased H3K9 dimethylation (H3K9me2, suppressed the expressions of H3K9me2-associated genes (MAP2K3 and DKK1, and induced NNMT repression at both the protein and mRNA levels. Furthermore, over-expression of NNMT inhibited nickel-induced H3K9me2 and altered the cellular SAM/SAH ratio. Additionally, the NADH oxidant phenazine methosulfate (PMS not only reversed the nickel-induced reduction in NAD+/NADH but also inhibited the increase in H3K9me2. Conclusions: These findings indicate that the repression of NNMT may underlie nickel-induced H3K9 dimethylation by altering the cellular SAM/SAH ratio.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Progression to type 1 diabetes in islet cell antibody-positive relatives in the European Nicotinamide Diabetes Intervention Trial

DEFF Research Database (Denmark)

Bingley, P J; Gale, E A M; Reimers, Jesper Irving

2006-01-01

of development of diabetes within 5 years varied according to age, relationship to the proband, positivity for IAA, IA-2A and GADA, number and combination of islet antibodies, HLA class II genotype, baseline glucose tolerance, and first-phase insulin secretion, but not gender or incidence of childhood type 1...... of additional antibody markers, but not antibody type or genotype. Individuals diabetes within 5 years and these combined criteria identified 81% of the cases in the whole cohort. CONCLUSIONS/INTERPRETATION: We suggest that screening......AIMS/HYPOTHESIS: To examine the role of additional immune, genetic and metabolic risk markers in determining risk of diabetes in islet cell antibody (ICA)-positive individuals with a family history of type 1 diabetes recruited into the European Nicotinamide Diabetes Intervention Trial. METHODS...

Nucleotide excision repair in yeast

NARCIS (Netherlands)

Eijk, Patrick van

2012-01-01

Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

Science.gov (United States)

Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

2004-02-01

The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

Cerebral ischemia is exacerbated by extracellular nicotinamide phosphoribosyltransferase via a non-enzymatic mechanism.

Directory of Open Access Journals (Sweden)

Bing Zhao

Full Text Available Intracellular nicotinamide phosphoribosyltransferase (iNAMPT in neuron has been known as a protective factor against cerebral ischemia through its enzymatic activity, but the role of central extracellular NAMPT (eNAMPT is not clear. Here we show that eNAMPT protein level was elevated in the ischemic rat brain after middle-cerebral-artery occlusion (MCAO and reperfusion, which can be traced to at least in part from blood circulation. Administration of recombinant NAMPT protein exacerbated MCAO-induced neuronal injury in rat brain, while exacerbated oxygen-glucose-deprivation (OGD induced neuronal injury only in neuron-glial mixed culture, but not in neuron culture. In the mixed culture, NAMPT protein promoted TNF-α release in a time- and concentration-dependent fashion, while TNF-α neutralizing antibody protected OGD-induced, NAMPT-enhanced neuronal injury. Importantly, H247A mutant of NAMPT with essentially no enzymatic activity exerted similar effects on ischemic neuronal injury and TNF-α release as the wild type protein. Thus, eNAMPT is an injurious and inflammatory factor in cerebral ischemia and aggravates ischemic neuronal injury by triggering TNF-α release from glia cells, via a mechanism not related to NAMPT enzymatic activity.

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

Science.gov (United States)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Nucleotide diversity and phylogenetic relationships among ...

Indian Academy of Sciences (India)

2017-03-03

Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

Critical role of the virus-encoded microRNA-155 ortholog in the induction of Marek's disease lymphomas.

Directory of Open Access Journals (Sweden)

Yuguang Zhao

2011-02-01

Full Text Available Notwithstanding the well-characterised roles of a number of oncogenes in neoplastic transformation, microRNAs (miRNAs are increasingly implicated in several human cancers. Discovery of miRNAs in several oncogenic herpesviruses such as KSHV has further highlighted the potential of virus-encoded miRNAs to contribute to their oncogenic capabilities. Nevertheless, despite the identification of several possible cancer-related genes as their targets, the direct in vivo role of virus-encoded miRNAs in neoplastic diseases such as those induced by KSHV is difficult to demonstrate in the absence of suitable models. However, excellent natural disease models of rapid-onset Marek's disease (MD lymphomas in chickens allow examination of the oncogenic potential of virus-encoded miRNAs. Using viruses modified by reverse genetics of the infectious BAC clone of the oncogenic RB-1B strain of MDV, we show that the deletion of the six-miRNA cluster 1 from the viral genome abolished the oncogenicity of the virus. This loss of oncogenicity appeared to be primarily due to the single miRNA within the cluster, miR-M4, the ortholog of cellular miR-155, since its deletion or a 2-nucleotide mutation within its seed region was sufficient to inhibit the induction of lymphomas. The definitive role of this miR-155 ortholog in oncogenicity was further confirmed by the rescue of oncogenic phenotype by revertant viruses that expressed either the miR-M4 or the cellular homolog gga-miR-155. This is the first demonstration of the direct in vivo role of a virus-encoded miRNA in inducing tumors in a natural infection model. Furthermore, the use of viruses deleted in miRNAs as effective vaccines against virulent MDV challenge, enables the prospects of generating genetically defined attenuated vaccines.

Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

Science.gov (United States)

Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

2018-05-01

Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

International Nuclear Information System (INIS)

Vetter, I.R.; Reinstein, J.; Roesch, P.

1990-01-01

One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

Directory of Open Access Journals (Sweden)

Mullen Michael P

2011-01-01

Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

A model for visual memory encoding.

Directory of Open Access Journals (Sweden)

Rodolphe Nenert

Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

A model for visual memory encoding.

Science.gov (United States)

Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P

2014-01-01

Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

Science.gov (United States)

Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

2013-07-01

Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

Association of a specific major histocompatibility complex class IIβ single nucleotide polymorphism with resistance to lactococcosis in rainbow trout, Oncorhynchus mykiss (Walbaum).

Science.gov (United States)

Colussi, S; Prearo, M; Bertuzzi, S A; Scanzio, T; Peletto, S; Favaro, L; Modesto, P; Maniaci, M G; Ru, G; Desiato, R; Acutis, P L

2015-01-01

Major histocompatibility complex (MHC) loci encode glycoproteins that bind to foreign peptides and initiate immune responses through their interaction with T cells. MHC class II molecules are heterodimers consisting of α and β chains encoded by extremely variable genes; variation in exon 2 is responsible for the majority of observed polymorphisms, mostly concentrated in the codons specifying the peptide-binding region. Lactococcus garvieae is the causative agent of lactococcosis, a warm-water bacterial infection pathogenic for cultured freshwater and marine fish. It causes considerable economic losses, limiting the profitability and development of fish industries in general and the intensive production of rainbow trout, Oncorhynchus mykiss (Walbaum), in particular. The disease is currently controlled with vaccines and antibiotics; however, vaccines have short-term efficacy, and increasing concerns regarding antibiotic residues have called for alternative strategies. To explore the involvement of the MHC class II β-1 domain as a candidate gene for resistance to lactococcosis, we exposed 400 rainbow trout to naturally contaminated water. One single nucleotide polymorphism (SNP) and one haplotype were associated with resistance (P trout resistant to lactococcosis. © 2014 John Wiley & Sons Ltd.

Encoding of coordination complexes with XML.

Science.gov (United States)

Vinoth, P; Sankar, P

2017-09-01

An in-silico system to encode structure, bonding and properties of coordination complexes is developed. The encoding is achieved through a semantic XML markup frame. Composition of the coordination complexes is captured in terms of central atom and ligands. Structural information of central atom is detailed in terms of electron status of valence electron orbitals. The ligands are encoded with specific reference to the electron environment of ligand centre atoms. Behaviour of ligands to form low or high spin complexes is accomplished by assigning a Ligand Centre Value to every ligand based on the electronic environment of ligand centre atom. Chemical ontologies are used for categorization purpose and to control different hybridization schemes. Complexes formed by the central atoms of transition metal, non-transition elements belonging to s-block, p-block and f-block are encoded with a generic encoding platform. Complexes of homoleptic, heteroleptic and bridged types are also covered by this encoding system. Utility of the encoded system to predict redox electron transfer reaction in the coordination complexes is demonstrated with a simple application. Copyright © 2017 Elsevier Inc. All rights reserved.

Optimal higher-order encoder time-stamping

NARCIS (Netherlands)

Merry, R.J.E.; Molengraft, van de M.J.G.; Steinbuch, M.

2013-01-01

Optical incremental encoders are used to measure the position of motion control systems. The accuracy of the position measurement is determined and bounded by the number of slits on the encoder. The position measurement is affected by quantization errors and encoder imperfections. In this paper, an

The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

Science.gov (United States)

Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

2010-07-01

WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

Science.gov (United States)

Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

2010-01-01

WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

DEFF Research Database (Denmark)

Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

2011-01-01

A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Emotional arousal and memory after deep encoding.

Science.gov (United States)

Leventon, Jacqueline S; Camacho, Gabriela L; Ramos Rojas, Maria D; Ruedas, Angelica

2018-05-22

Emotion often enhances long-term memory. One mechanism for this enhancement is heightened arousal during encoding. However, reducing arousal, via emotion regulation (ER) instructions, has not been associated with reduced memory. In fact, the opposite pattern has been observed: stronger memory for emotional stimuli encoded with an ER instruction to reduce arousal. This pattern may be due to deeper encoding required by ER instructions. In the current research, we examine the effects of emotional arousal and deep-encoding on memory across three studies. In Study 1, adult participants completed a writing task (deep-encoding) for encoding negative, neutral, and positive picture stimuli, whereby half the emotion stimuli had the ER instruction to reduce the emotion. Memory was strong across conditions, and no memory enhancement was observed for any condition. In Study 2, adult participants completed the same writing task as Study 1, as well as a shallow-encoding task for one-third of negative, neutral, and positive trials. Memory was strongest for deep vs. shallow encoding trials, with no effects of emotion or ER instruction. In Study 3, adult participants completed a shallow-encoding task for negative, neutral, and positive stimuli, with findings indicating enhanced memory for negative emotional stimuli. Findings suggest that deep encoding must be acknowledged as a source of memory enhancement when examining manipulations of emotion-related arousal. Copyright © 2018. Published by Elsevier B.V.

Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

Directory of Open Access Journals (Sweden)

Simon Reed

2012-09-01

Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

Nucleotide excision repair in the test tube.

NARCIS (Netherlands)

N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

1995-01-01

textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

Science.gov (United States)

Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

1995-05-01

The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Kynureninase-type enzymes and the evolution of the aerobic tryptophan-to-nicotinamide adenine dinucleotide pathway

Energy Technology Data Exchange (ETDEWEB)

Gaertner, F.H.; Shetty, A.S.

1977-01-01

Kynureninase-type (L-kynurenine hydrolase, EC 3.7.1.3) activity has been found to be present in the livers of fish, amphibia, reptiles, and birds. In addition to past information concerning this enzyme activity in mammalian liver, it is now clear that all the major classes of vertebrates carry a highly specialized kynureninase-type enzyme, which we have termed a hydroxykynureninase. To compare the reactivities of these enzymes with L-kynurenine and L-3-hydroxykynurenine, ratios of tau values (K/sub m//V) were used. Based on this comparison, the bacterium Pseudomonas fluorescens carries the most efficient kynureninase, whereas the amphibian Xenopus laevis has the most efficient hydroxykynurenase. In these two cases, the ratio of tau values differs by a factor of 38,000. It is hypothesized that the tryptophan-to-nicotinamide adenine dinucleotide biosynthetic pathway evolved from a catabolic system of enzymes, and that the differences observed in the kynureninase-type enzymes between lower and higher organisms reflect the specialization of the function of these enzymes from a strictly catabolic role to an anabolic one during the course of evolution.

Multidimensionally encoded magnetic resonance imaging.

Science.gov (United States)

Lin, Fa-Hsuan

2013-07-01

Magnetic resonance imaging (MRI) typically achieves spatial encoding by measuring the projection of a q-dimensional object over q-dimensional spatial bases created by linear spatial encoding magnetic fields (SEMs). Recently, imaging strategies using nonlinear SEMs have demonstrated potential advantages for reconstructing images with higher spatiotemporal resolution and reducing peripheral nerve stimulation. In practice, nonlinear SEMs and linear SEMs can be used jointly to further improve the image reconstruction performance. Here, we propose the multidimensionally encoded (MDE) MRI to map a q-dimensional object onto a p-dimensional encoding space where p > q. MDE MRI is a theoretical framework linking imaging strategies using linear and nonlinear SEMs. Using a system of eight surface SEM coils with an eight-channel radiofrequency coil array, we demonstrate the five-dimensional MDE MRI for a two-dimensional object as a further generalization of PatLoc imaging and O-space imaging. We also present a method of optimizing spatial bases in MDE MRI. Results show that MDE MRI with a higher dimensional encoding space can reconstruct images more efficiently and with a smaller reconstruction error when the k-space sampling distribution and the number of samples are controlled. Copyright © 2012 Wiley Periodicals, Inc.

Preclinical evidence of mitochondrial nicotinamide adenine dinucleotide as an effective alarm parameter under hypoxia

Science.gov (United States)

Shi, Hua; Sun, Nannan; Mayevsky, Avraham; Zhang, Zhihong; Luo, Qingming

2014-01-01

Early detection of tissue hypoxia in the intensive care unit is essential for effective treatment. Reduced nicotinamide adenine dinucleotide (NADH) has been suggested to be the most sensitive indicator of tissue oxygenation at the mitochondrial level. However, no experimental evidence comparing the kinetics of changes in NADH and other physiological parameters has been provided. The aim of this study is to obtain the missing data in a systematic and reliable manner. We constructed four acute hypoxia models, including hypoxic hypoxia, hypemic hypoxia, circulatory hypoxia, and histogenous hypoxia, and measured NADH fluorescence, tissue reflectance, cerebral blood flow, respiration, and electrocardiography simultaneously from the induction of hypoxia until death. We found that NADH was not always the first onset parameter responding to hypoxia. The order of responses was mainly affected by the cause of hypoxia. However, NADH reached its alarm level earlier than the other monitored parameters, ranging from several seconds to >10 min. As such, we suggest that the NADH can be used as a hypoxia indicator, although the exact level that should be used must be further investigated. When the NADH alarm is detected, the body still has a chance to recover if appropriate and timely treatment is provided.

Parallel encoders for pixel detectors

International Nuclear Information System (INIS)

Nikityuk, N.M.

1991-01-01

A new method of fast encoding and determining the multiplicity and coordinates of fired pixels is described. A specific example construction of parallel encodes and MCC for n=49 and t=2 is given. 16 refs.; 6 figs.; 2 tabs

Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

Science.gov (United States)

Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

2017-12-01

Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

Science.gov (United States)

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

KAUST Repository

Rose, Nicholas D.; Regan, John M.

2015-01-01

© 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD⁺, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP⁺, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

KAUST Repository

Rose, Nicholas D.

2015-12-01

© 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD⁺, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP⁺, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

Directory of Open Access Journals (Sweden)

Arehart Eric

2009-03-01

Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

Science.gov (United States)

Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

2013-11-01

Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

Chronic low-dose ultraviolet-induced mutagenesis in nucleotide excision repair-deficient cells.

Science.gov (United States)

Haruta, Nami; Kubota, Yoshino; Hishida, Takashi

2012-09-01

UV radiation induces two major types of DNA lesions, cyclobutane pyrimidine dimers (CPDs) and 6-4 pyrimidine-pyrimidine photoproducts, which are both primarily repaired by nucleotide excision repair (NER). Here, we investigated how chronic low-dose UV (CLUV)-induced mutagenesis occurs in rad14Δ NER-deficient yeast cells, which lack the yeast orthologue of human xeroderma pigmentosum A (XPA). The results show that rad14Δ cells have a marked increase in CLUV-induced mutations, most of which are C→T transitions in the template strand for transcription. Unexpectedly, many of the CLUV-induced C→T mutations in rad14Δ cells are dependent on translesion synthesis (TLS) DNA polymerase η, encoded by RAD30, despite its previously established role in error-free TLS. Furthermore, we demonstrate that deamination of cytosine-containing CPDs contributes to CLUV-induced mutagenesis. Taken together, these results uncover a novel role for Polη in the induction of C→T transitions through deamination of cytosine-containing CPDs in CLUV-exposed NER deficient cells. More generally, our data suggest that Polη can act as both an error-free and a mutagenic DNA polymerase, depending on whether the NER pathway is available to efficiently repair damaged templates.

An Intensional Concurrent Faithful Encoding of Turing Machines

Directory of Open Access Journals (Sweden)

Thomas Given-Wilson

2014-10-01

Full Text Available The benchmark for computation is typically given as Turing computability; the ability for a computation to be performed by a Turing Machine. Many languages exploit (indirect encodings of Turing Machines to demonstrate their ability to support arbitrary computation. However, these encodings are usually by simulating the entire Turing Machine within the language, or by encoding a language that does an encoding or simulation itself. This second category is typical for process calculi that show an encoding of lambda-calculus (often with restrictions that in turn simulates a Turing Machine. Such approaches lead to indirect encodings of Turing Machines that are complex, unclear, and only weakly equivalent after computation. This paper presents an approach to encoding Turing Machines into intensional process calculi that is faithful, reduction preserving, and structurally equivalent. The encoding is demonstrated in a simple asymmetric concurrent pattern calculus before generalised to simplify infinite terms, and to show encodings into Concurrent Pattern Calculus and Psi Calculi.

Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

DEFF Research Database (Denmark)

Bross, Peter; Li, Zhijie; Hansen, Jakob

2007-01-01

for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...

Selective and membrane-permeable small molecule inhibitors of nicotinamide N-methyltransferase reverse high fat diet-induced obesity in mice.

Science.gov (United States)

Neelakantan, Harshini; Vance, Virginia; Wetzel, Michael D; Wang, Hua-Yu Leo; McHardy, Stanton F; Finnerty, Celeste C; Hommel, Jonathan D; Watowich, Stanley J

2018-01-01

There is a critical need for new mechanism-of-action drugs that reduce the burden of obesity and associated chronic metabolic comorbidities. A potentially novel target to treat obesity and type 2 diabetes is nicotinamide-N-methyltransferase (NNMT), a cytosolic enzyme with newly identified roles in cellular metabolism and energy homeostasis. To validate NNMT as an anti-obesity drug target, we investigated the permeability, selectivity, mechanistic, and physiological properties of a series of small molecule NNMT inhibitors. Membrane permeability of NNMT inhibitors was characterized using parallel artificial membrane permeability and Caco-2 cell assays. Selectivity was tested against structurally-related methyltransferases and nicotinamide adenine dinucleotide (NAD + ) salvage pathway enzymes. Effects of NNMT inhibitors on lipogenesis and intracellular levels of metabolites, including NNMT reaction product 1-methylnicotianamide (1-MNA) were evaluated in cultured adipocytes. Effects of a potent NNMT inhibitor on obesity measures and plasma lipid were assessed in diet-induced obese mice fed a high-fat diet. Methylquinolinium scaffolds with primary amine substitutions displayed high permeability from passive and active transport across membranes. Importantly, methylquinolinium analogues displayed high selectivity, not inhibiting related SAM-dependent methyltransferases or enzymes in the NAD + salvage pathway. NNMT inhibitors reduced intracellular 1-MNA, increased intracellular NAD + and S-(5'-adenosyl)-l-methionine (SAM), and suppressed lipogenesis in adipocytes. Treatment of diet-induced obese mice systemically with a potent NNMT inhibitor significantly reduced body weight and white adipose mass, decreased adipocyte size, and lowered plasma total cholesterol levels. Notably, administration of NNMT inhibitors did not impact total food intake nor produce any observable adverse effects. These results support development of small molecule NNMT inhibitors as therapeutics to

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

Energy Technology Data Exchange (ETDEWEB)

Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

2014-01-28

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

International Nuclear Information System (INIS)

Shin, Joong-Won; Bernstein, Elliot R.

2014-01-01

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

Pyrosequencing the transcriptome of the greenhouse whitefly, Trialeurodes vaporariorum reveals multiple transcripts encoding insecticide targets and detoxifying enzymes

Directory of Open Access Journals (Sweden)

Gorman Kevin

2011-01-01

Full Text Available Abstract Background The whitefly Trialeurodes vaporariorum is an economically important crop pest in temperate regions that has developed resistance to most classes of insecticides. However, the molecular mechanisms underlying resistance have not been characterised and, to date, progress has been hampered by a lack of nucleotide sequence data for this species. Here, we use pyrosequencing on the Roche 454-FLX platform to produce a substantial and annotated EST dataset. This 'unigene set' will form a critical reference point for quantitation of over-expressed messages via digital transcriptomics. Results Pyrosequencing produced around a million sequencing reads that assembled into 54,748 contigs, with an average length of 965 bp, representing a dramatic expansion of existing cDNA sequences available for T. vaporariorum (only 43 entries in GenBank at the time of this publication. BLAST searching of non-redundant databases returned 20,333 significant matches and those gene families potentially encoding gene products involved in insecticide resistance were manually curated and annotated. These include, enzymes potentially involved in the detoxification of xenobiotics and those encoding the targets of the major chemical classes of insecticides. A total of 57 P450s, 17 GSTs and 27 CCEs were identified along with 30 contigs encoding the target proteins of six different insecticide classes. Conclusion Here, we have developed new transcriptomic resources for T. vaporariorum. These include a substantial and annotated EST dataset that will serve the community studying this important crop pest and will elucidate further the molecular mechanisms underlying insecticide resistance.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

Science.gov (United States)

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

2016-01-01

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

2016-01-15

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Blind encoding into qudits

International Nuclear Information System (INIS)

Shaari, J.S.; Wahiddin, M.R.B.; Mancini, S.

2008-01-01

We consider the problem of encoding classical information into unknown qudit states belonging to any basis, of a maximal set of mutually unbiased bases, by one party and then decoding by another party who has perfect knowledge of the basis. Working with qudits of prime dimensions, we point out a no-go theorem that forbids 'shift' operations on arbitrary unknown states. We then provide the necessary conditions for reliable encoding/decoding

Subnanomole detection and quantitation of high specific activity 32P-nucleotides

International Nuclear Information System (INIS)

Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

1991-01-01

Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

Science.gov (United States)

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

Directory of Open Access Journals (Sweden)

Vera S Bogdanova

Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

Encoder designed to work in harsh environments

Energy Technology Data Exchange (ETDEWEB)

Toop, L.

2007-05-15

Dynapar has developed the Acuro AX71 absolute encoder for use on offshore or land-based oil rig operations. It provides feedback on the operation of automated systems such as draw works, racking systems, rotary tables and top drives. By ensuring that automated systems function properly, this encoder responds to a need by the oil and gas industry to keep workers safe and improve efficiency, particularly for operations in rugged situations. The encoder provides feedback from motor systems to controllers, giving information about position and speed of downhole drill bits. This newly developed encoder is better than commonly used incremental encoders which are not precise in strong electrical noise environments. Rather, the absolute encoder uses a different method of reporting to the controller. A digital signal is transmitted constantly as the device operates. It is less susceptible to noise issues. It is highly accurate, tolerant of noise and is not affected by power outages. However, the absolute encoder is generally more delicate in drilling applications with high ambient temperatures and shock levels. Dynapar addressed this issue by developing compact stainless steel housing that is useful for corrosion resistance in marine applications. The AX71 absolute encoder can withstand up to 100 G of mechanical shock and ambient temperatures of up to 60 degrees C. The encoder is ATEX certified without barriers, and offers the high resolution feedback of 4,000 counts of multiturn rotation and 16,000 counts of position. 1 fig.

Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

Energy Technology Data Exchange (ETDEWEB)

Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

1986-11-01

Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

International Nuclear Information System (INIS)

Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

1986-01-01

Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

International Nuclear Information System (INIS)

Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

1988-01-01

Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

Current trend of annotating single nucleotide variation in humans--A case study on SNVrap.

Science.gov (United States)

Li, Mulin Jun; Wang, Junwen

2015-06-01

As high throughput methods, such as whole genome genotyping arrays, whole exome sequencing (WES) and whole genome sequencing (WGS), have detected huge amounts of genetic variants associated with human diseases, function annotation of these variants is an indispensable step in understanding disease etiology. Large-scale functional genomics projects, such as The ENCODE Project and Roadmap Epigenomics Project, provide genome-wide profiling of functional elements across different human cell types and tissues. With the urgent demands for identification of disease-causal variants, comprehensive and easy-to-use annotation tool is highly in demand. Here we review and discuss current progress and trend of the variant annotation field. Furthermore, we introduce a comprehensive web portal for annotating human genetic variants. We use gene-based features and the latest functional genomics datasets to annotate single nucleotide variation (SNVs) in human, at whole genome scale. We further apply several function prediction algorithms to annotate SNVs that might affect different biological processes, including transcriptional gene regulation, alternative splicing, post-transcriptional regulation, translation and post-translational modifications. The SNVrap web portal is freely available at http://jjwanglab.org/snvrap. Copyright © 2014 Elsevier Inc. All rights reserved.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

2015-09-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

2015-01-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

Science.gov (United States)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

Directory of Open Access Journals (Sweden)

Johnson Peter W

2006-03-01

Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

DEFF Research Database (Denmark)

Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

2009-01-01

is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

On the immortality of television sets: "function" in the human genome according to the evolution-free gospel of ENCODE.

Science.gov (United States)

Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B R; Zufall, Rebecca A; Elhaik, Eran

2013-01-01

A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 - 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these "functional" regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means, chiefly by employing the seldom used "causal role" definition of biological function and then applying it inconsistently to different biochemical properties, by committing a logical fallacy known as "affirming the consequent," by failing to appreciate the crucial difference between "junk DNA" and "garbage DNA," by using analytical methods that yield biased errors and inflate estimates of functionality, by favoring statistical sensitivity over specificity, and by emphasizing statistical significance rather than the magnitude of the effect. Here, we detail the many logical and methodological transgressions involved in assigning functionality to almost every nucleotide in the human genome. The ENCODE results were predicted by one of its authors to necessitate the rewriting of textbooks. We agree, many textbooks dealing with marketing, mass-media hype, and public relations may well have to be rewritten.

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

Science.gov (United States)

Woolfitt, A R; Kellett, G L; Hoggett, J G

1988-01-29

The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

Science.gov (United States)

Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

1998-01-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

Science.gov (United States)

Allignet, J; Liassine, N; el Solh, N

1998-07-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Expression patterns of nicotinamide phosphoribosyltransferase and nicotinic acid phosphoribosyltransferase in human malignant lymphomas.

Science.gov (United States)

Olesen, Uffe Høgh; Hastrup, Nina; Sehested, Maxwell

2011-04-01

The purpose of the study was to determine in human malignant lymphomas the expression patterns of nicotinamide phosphoribosyltransferase (NAMPT) and nicotinic acid phosphoribosyltransferase (NAPRT), the primary, rate-limiting enzymes in the synthesis of NAD+. NAMPT is a potential biomarker for sensitivity to NAMPT inhibitors and NAPRT is a biomarker for the use of nicotinic acid as a chemoprotectant in treatment with NAMPT inhibitors. The NAMPT inhibitor, APO866, is currently in clinical phase II trials in lymphomas. The expression of NAMPT and NAPRT was investigated in 53 samples of malignant lymphomas (diffuse large B-cell lymphoma, follicular B-cell lymphoma, Hodgkin's lymphoma and peripheral T-cell lymphoma). The expression of NAMPT was generally high in the more aggressive malignant lymphomas, with >80% strong expression, whereas the expression in the more indolent follicular lymphoma (FL) was significantly lower (>75% moderate or low expression, p = 0.0002). NAMPT was very highly expressed in Hodgkin Reed-Sternberg cells in Hodgkin's lymphoma. NAPRT expression was more varied (p > 0.0001) with 30-50% low expression except for Hodgkin's lymphoma where 85% displayed low expression (p = 0.0024). In conclusion, FL are a promising target for NAMPT inhibitors whereas substantial subsets of malignant lymphomas especially in Hodgkin lymphoma may be suitable for a combination treatment with nicotinic acid and NAMPT inhibitors. © 2011 The Authors. APMIS © 2011 APMIS.

Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

International Nuclear Information System (INIS)

Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

2013-01-01

Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers†

Science.gov (United States)

Abbas, Charles A.; Sibirny, Andriy A.

2011-01-01

Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP. PMID:21646432

Genetic control of biosynthesis and transport of riboflavin and flavin nucleotides and construction of robust biotechnological producers.

Science.gov (United States)

Abbas, Charles A; Sibirny, Andriy A

2011-06-01

Riboflavin [7,8-dimethyl-10-(1'-d-ribityl)isoalloxazine, vitamin B₂] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP.

Chemical Space of DNA-Encoded Libraries.

Science.gov (United States)

Franzini, Raphael M; Randolph, Cassie

2016-07-28

In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

Crystal structure of trans-diaquabis(4-cyanobenzoato-κObis(nicotinamide-κN1cobalt(II

Directory of Open Access Journals (Sweden)

Gülçin Şefiye Aşkın

2015-05-01

Full Text Available In the title complex, [Co(C8H4NO22(C6H6N2O2(H2O2], the CoII atom is located on an inversion centre and is coordinated by two 4-cyanobenzoate (CNB anions, two nicotinamide (NA ligands and two water molecules. The four O atoms in the equatorial plane form a slightly distorted square-planar arrangement, while the slightly distorted octahedral coordination sphere is completed by the two N atoms of the NA ligands in the axial positions. The dihedral angle between the carboxylate group and the adjacent benzene ring is 22.11 (15°, while the pyridine and benzene rings are oriented at a dihedral angle of 89.98 (5°. In the crystal, intermolecular N—H...O and O—H...O hydrogen bonds link the molecules, enclosing R22(8 and R44(8 ring motifs, forming layers parallel to (100. The layers are linked via C—H...O and C—H...N hydrogen bonds, resulting in a three-dimensional network. A weak C—H...π interaction is also observed.

Video encoder/decoder for encoding/decoding motion compensated images

NARCIS (Netherlands)

1996-01-01

Video encoder and decoder, provided with a motion compensator for motion-compensated video coding or decoding in which a picture is coded or decoded in blocks in alternately horizontal and vertical steps. The motion compensator is provided with addressing means (160) and controlled multiplexers

WEB-server for search of a periodicity in amino acid and nucleotide sequences

Science.gov (United States)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Enhancement of in vivo Radiosensitization by Combination with Pentoxifylline and Nicotinamide

International Nuclear Information System (INIS)

Lee, In Tae; Cho, Moon June

1991-01-01

Pentoxifylline (PENTO) has been known to improve RBC fluidity, and thus improve the flux of RBC through narrow capillaries. Additionally, PENTO also decreases the O2 release from RBC. Nicotinamide (N4) has been reported to decrease the number of acutely hypoxic cells in tumors by temporarily increasing tumor blood flow. Therefore, the purpose of this study was to examine whether the combination of PENTO and NA (PENTO+NA) would reduce the radioresistance of the the FSa II murine fibrosarcoma by oxygenation the hypoxic cells. We observed a significantly enhanced radiation-induced growth delay of the FSa II tumors by PENTO-NA. Thus the enhancement ration was between 2.5 and 2.8 in growth delay assay. The TCD 50 of control tumors was about 57 Gy, but that of PENTO-NA treated tumors was about 32 Gy. The TCD50 was modified by a factor of 1.8. We also observed that PENTO+NA, changes in tumor blood flow and intratumor pO2 were measured using laser Doppler flowmetry and O2 microelectrode methods. The tumor blood flow significantly increased at 10 min. after injection of PENTO+NA. Furthermore, we also found that PENTO+NA significantly increased intratumor pO2 from 8 to 19 mmHg. We concluded that PENTO+NA was far more effective than NA alone or PENTO alone. The increase in the response of tumor in vivo to X-irradiation appeared to be due mainly to an increase in the tumor oxygenation. Further studies using various concentrations of PENTO alone and in combination with NA to obtain better sequencing and maximal radiosensitization are warranted

Current View on Phytoplasma Genomes and Encoded Metabolism

Directory of Open Access Journals (Sweden)

Michael Kube

2012-01-01

Full Text Available Phytoplasmas are specialised bacteria that are obligate parasites of plant phloem tissue and insects. These bacteria have resisted all attempts of cell-free cultivation. Genome research is of particular importance to analyse the genetic endowment of such bacteria. Here we review the gene content of the four completely sequenced ‘Candidatus Phytoplasma’ genomes that include those of ‘Ca. P. asteris’ strains OY-M and AY-WB, ‘Ca. P. australiense,’ and ‘Ca. P. mali’. These genomes are characterized by chromosome condensation resulting in sizes below 900 kb and a G + C content of less than 28%. Evolutionary adaption of the phytoplasmas to nutrient-rich environments resulted in losses of genetic modules and increased host dependency highlighted by the transport systems and limited metabolic repertoire. On the other hand, duplication and integration events enlarged the chromosomes and contribute to genome instability. Present differences in the content of membrane and secreted proteins reflect the host adaptation in the phytoplasma strains. General differences are obvious between different phylogenetic subgroups. ‘Ca. P. mali’ is separated from the other strains by its deviating chromosome organization, the genetic repertoire for recombination and excision repair of nucleotides or the loss of the complete energy-yielding part of the glycolysis. Apart from these differences, comparative analysis exemplified that all four phytoplasmas are likely to encode an alternative pathway to generate pyruvate and ATP.

Expression of the E.coli pntA and pntB genes encoding nicotinamide nucleotide transhydrogenase in Saccharomyces cerevisiae and its effect on product formation during anaerobic glucose fermentation

DEFF Research Database (Denmark)

Anderlund, M.; Nissen, Torben Lauesgaard; Nielsen, Jens Bredal

1999-01-01

was present. Unlike the situation in E. coli, however, most of the transhydrogenase activity was not present in the yeast plasma membrane; rather, the enzyme appeared to remain localized in the membrane of the endoplasmic reticulum. During anaerobic glucose fermentation we observed an increase...

A single nucleotide polymorphism (SNP) assay for population ...

African Journals Online (AJOL)

A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

Negative base encoding in optical linear algebra processors

Science.gov (United States)

Perlee, C.; Casasent, D.

1986-01-01

In the digital multiplication by analog convolution algorithm, the bits of two encoded numbers are convolved to form the product of the two numbers in mixed binary representation; this output can be easily converted to binary. Attention is presently given to negative base encoding, treating base -2 initially, and then showing that the negative base system can be readily extended to any radix. In general, negative base encoding in optical linear algebra processors represents a more efficient technique than either sign magnitude or 2's complement encoding, when the additions of digitally encoded products are performed in parallel.

Definition of novel GP6 polymorphisms and major difference in haplotype frequencies between populations by a combination of in-depth exon resequencing and genotyping with tag single nucleotide polymorphisms.

Science.gov (United States)

Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H

2006-06-01

Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.

Encoding entanglement-assisted quantum stabilizer codes

International Nuclear Information System (INIS)

Wang Yun-Jiang; Bai Bao-Ming; Li Zhuo; Xiao He-Ling; Peng Jin-Ye

2012-01-01

We address the problem of encoding entanglement-assisted (EA) quantum error-correcting codes (QECCs) and of the corresponding complexity. We present an iterative algorithm from which a quantum circuit composed of CNOT, H, and S gates can be derived directly with complexity O(n 2 ) to encode the qubits being sent. Moreover, we derive the number of each gate consumed in our algorithm according to which we can design EA QECCs with low encoding complexity. Another advantage brought by our algorithm is the easiness and efficiency of programming on classical computers. (general)

Data Encoding using Periodic Nano-Optical Features

Science.gov (United States)

Vosoogh-Grayli, Siamack

Successful trials have been made through a designed algorithm to quantize, compress and optically encode unsigned 8 bit integer values in the form of images using Nano optical features. The periodicity of the Nano-scale features (Nano-gratings) have been designed and investigated both theoretically and experimentally to create distinct states of variation (three on states and one off state). The use of easy to manufacture and machine readable encoded data in secured authentication media has been employed previously in bar-codes for bi-state (binary) models and in color barcodes for multiple state models. This work has focused on implementing 4 states of variation for unit information through periodic Nano-optical structures that separate an incident wavelength into distinct colors (variation states) in order to create an encoding system. Compared to barcodes and magnetic stripes in secured finite length storage media the proposed system encodes and stores more data. The benefits of multiple states of variation in an encoding unit are 1) increased numerically representable range 2) increased storage density and 3) decreased number of typical set elements for any ergodic or semi-ergodic source that emits these encoding units. A thorough investigation has targeted the effects of the use of multi-varied state Nano-optical features on data storage density and consequent data transmission rates. The results show that use of Nano-optical features for encoding data yields a data storage density of circa 800 Kbits/in2 via the implementation of commercially available high resolution flatbed scanner systems for readout. Such storage density is far greater than commercial finite length secured storage media such as Barcode family with maximum practical density of 1kbits/in2 and highest density magnetic stripe cards with maximum density circa 3 Kbits/in2. The numerically representable range of the proposed encoding unit for 4 states of variation is [0 255]. The number of

The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Stephen eSalton

2013-08-01

Full Text Available The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs, where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs, with neuropsychiatric, endocrine and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A of the human brain-derived neurotrophic factor (BDNF gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

The guanosine nucleotide (p)ppGpp initiates development and A-factor production in myxococcus xanthus.

Science.gov (United States)

Harris, B Z; Kaiser, D; Singer, M

1998-04-01

Guanosine 3'-di-5'-(tri)di-phosphate nucleotides [(p)ppGpp], synthesized in response to amino acid limitation, induce early gene expression leading to multicellular fruiting body formation in Myxococcus xanthus. A mutant (DK527) that fails to accumulate (p)ppGpp in response to starvation was found to be blocked in development prior to aggregation. By use of a series of developmentally regulated Tn5lac transcriptional fusion reporters, the time of developmental arrest in DK527 was narrowed to within the few hours of development, the period of starvation recognition. The mutant is also defective in the production of A-factor, an early extracellular cell-density signal. The relA gene from Escherichia coli, which encodes a ribosome-dependent (p)ppGpp synthetase, rescues this mutant. We also demonstrate that inactivation of the M. xanthus relA homolog blocks development and the accumulation of (p)ppGpp. Moreover, the wild-type allele of Myxococcus relA rescues DK527. These observations support a model in which accumulation of (p)ppGpp, in response to starvation, initiates the program of fruiting body development, including the production of A-factor.

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

Functional expression of human adenine nucleotide translocase 4 in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Takashi Hamazaki

2011-04-01

Full Text Available The adenine nucleotide translocase (ANT mediates the exchange of ADP and ATP across the inner mitochondrial membrane. The human genome encodes multiple ANT isoforms that are expressed in a tissue-specific manner. Recently a novel germ cell-specific member of the ANT family, ANT4 (SLC25A31 was identified. Although it is known that targeted depletion of ANT4 in mice resulted in male infertility, the functional biochemical differences between ANT4 and other somatic ANT isoforms remain undetermined. To gain insight into ANT4, we expressed human ANT4 (hANT4 in yeast mitochondria. Unlike the somatic ANT proteins, expression of hANT4 failed to complement an AAC-deficient yeast strain for growth on media requiring mitochondrial respiration. Moreover, overexpression of hANT4 from a multi-copy plasmid interfered with optimal yeast growth. However, mutation of specific amino acids of hANT4 improved yeast mitochondrial expression and supported growth of the AAC-deficient yeast on non-fermentable carbon sources. The mutations affected amino acids predicted to interact with phospholipids, suggesting the importance of lipid interactions for function of this protein. Each mutant hANT4 and the somatic hANTs exhibited similar ADP/ATP exchange kinetics. These data define common and distinct biochemical characteristics of ANT4 in comparison to ANT1, 2 and 3 providing a basis for study of its unique adaptation to germ cells.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

International Nuclear Information System (INIS)

Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

1986-01-01

14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

Directory of Open Access Journals (Sweden)

Elaine C Thomas

Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

Molecular mechanisms for protein-encoded inheritance

Science.gov (United States)

Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

2013-01-01

Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598

Association of Nicotinamide Phosphoribosyltransferase (NAMPT Gene Polymorphisms and of Serum NAMPT Levels with Dilated Cardiomyopathy in a Chinese Population

Directory of Open Access Journals (Sweden)

Qingyu Dou

2015-09-01

Full Text Available Nicotinamide phosphoribosyltransferase (NAMPT has crucial roles for myocardial development, cardiomyocyte energy metabolism and cell death/survival by regulating NAD+-dependent sirtuin-1 (SIRT1 deacetylase. This study aimed to determine if the single nucleotide polymorphisms (SNPs of the NAMPT gene may affect the susceptibility and prognosis for patients with dilated cardiomyopathy (DCM and to describe the association of serum NAMPT levels with clinical features of DCM. Three SNPs (rs61330082, rs2505568, and rs9034 were analyzed by the polymerase chain reaction-restriction fragment length polymorphism method in a case-control study of 394 DCM patients and 395 controls from China. Serum NAMPT levels were measured by enzyme-linked immunosorbent assay kits. The homozygote for the minor allele at rs2505568 and rs9034 could not be detected in this study. Rs9034 T allele and CT genotype were associated with increased DCM risk (OR: 1.63, 95% CI = 1.16–2.27, p = 0.005 and OR: 1.72, 95% CI = 1.20–2.50, p = 0.0027, respectively. Nominally significant decreased DCM risk was found to be associated with the A allele and AT genotype of rs2505568 (OR: 0.48, 95% CI = 0.35–0.67, p < 0.0001 and OR: 0.44, 95% CI = 0.31–0.62, p < 0.0001, respectively, but it should be interpreted with caution because of Hardy-Weinberg disequilibrium in the control group. Of five haplotypes constructed, TAC (rs61330082-rs2505568-rs9034 was a protective haplotype to DCM (OR: 0.22, 95% CI = 0.13–0.39, p = 1.84 × 10−8. The Cox multivariate survival analysis indicated that the rs9034 CT genotype (hazard ratio (HR: 0.59, 95% CI = 0.37–0.96, p = 0.03 was an independently multivariate predictor for longer overall survival in DCM patients. Serum NAMPT levels were significantly higher in the DCM group than controls (p < 0.0001 and gradually increased with the increase of New York Heart Association grade in DCM patients. However, there was a lack of association of the three

Beyond initial encoding: Measures of the post-encoding status of memory traces predict long-term recall in infancy

OpenAIRE

Pathman, Thanujeni; Bauer, Patricia J.

2012-01-01

The first years of life are witness to rapid changes in long-term recall ability. In the present research, we contributed to explanation of the changes by testing the absolute and relative contributions to long-term recall of encoding and post-encoding processes. Using elicited imitation, we sampled the status of 16-, 20-, and 24-month-old infants’ memory representations at various time points after experience of events. In Experiment 1, infants were tested immediately, 1 week after encoding,...

Study on the change of cyclic nucleotide in mice with yang vacuity disease

International Nuclear Information System (INIS)

Zhu Xinhua; Shen Ling; Wang Shuguang

2002-01-01

To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

International Nuclear Information System (INIS)

Welin, Martin; Nordlund, Paer

2010-01-01

Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

Science.gov (United States)

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Dual beam encoded extended fractional Fourier transform security ...

Indian Academy of Sciences (India)

This paper describes a simple method for making dual beam encoded extended fractional Fourier transform (EFRT) security holograms. The hologram possesses different stages of encoding so that security features are concealed and remain invisible to the counterfeiter. These concealed and encoded anticounterfeit ...

Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

Energy Technology Data Exchange (ETDEWEB)

Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

1989-06-12

The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

The Arabic Diatessaron Project: Digitalizing, Encoding, Lemmatization

Directory of Open Access Journals (Sweden)

Giuliano Lancioni

2016-04-01

Full Text Available The Arabic Diatessaron Project (henceforth ADP is an international research project in Digital Humanities that aims to collect, digitalise and encode all known manuscripts of the Arabic Diatessaron (henceforth AD, a text that has been relatively neglected in scholarly research. ADP’s final goal is to provide a number of tools that can enable scholars to effectively query, compare and investigate all known variants of the text that will be encoded as far as possible in compliance with the Text Encoding Initiative (TEI guidelines. The paper addresses a number of issues involved in the process of digitalising manuscripts included in the two existing editions (Ciasca 1888 and Marmardji 1935, adding variants in unedited manuscripts, encoding and lemmatising the text. Issues involved in the design of the ADP include presentation of variants, choice of the standard text, applicability of TEI guidelines, automatic translation between different encodings, cross-edition concordances and principles of lemmatisation.

Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

Science.gov (United States)

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-09-12

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

Science.gov (United States)

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-01-01

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

Using XML to encode TMA DES metadata

Directory of Open Access Journals (Sweden)

Oliver Lyttleton

2011-01-01

Full Text Available Background: The Tissue Microarray Data Exchange Specification (TMA DES is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

Using XML to encode TMA DES metadata.

Science.gov (United States)

Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

2011-01-01

The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

Using XML to encode TMA DES metadata

Science.gov (United States)

Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

2011-01-01

Background: The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs. PMID:21969921

Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

Energy Technology Data Exchange (ETDEWEB)

Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

1987-10-01

The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

Phenylacetic acid co-crystals with acridine, caffeine, isonicotinamide and nicotinamide: Crystal structures, thermal analysis, FTIR spectroscopy and Hirshfeld surface analysis

Science.gov (United States)

Amombo Noa, Francoise M.; Jacobs, Ayesha

2017-07-01

Co-crystals of phenylacetic acid (PAA) with acridine (ACR), caffeine (CAF), isonicotinamide (INM) and nicotinamide (NAM) have been successfully prepared and characterised by single crystal X-ray diffraction, FTIR spectroscopy, thermal analysis and Hirshfeld surface analysis. The ACR, INM and NAM co-crystals with PAA exhibit the carboxylic acid-pyridine heterosynthon. Furthermore the amide-amide supramolecular homosynthon is observed in the PAA co-crystals with INM and NAM as well as Nsbnd H⋯O interactions between the acid and the respective base. The CAF co-crystal exhibits hydrogen bonding between the imidazole nitrogen and the COOH group of the PAA. The compounds demonstrate different stoichiometries; for PAA·ACR and PAA·INM a 1:1 ratio is displayed, a 2:1 in 2PAA·CAF and a 2:2 in the case of 2PAA·2NAM.

Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

DEFF Research Database (Denmark)

Leonardsen, L; DeClue, J E; Lybaek, H

1996-01-01

The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

Fluorimetric study of the interaction between nicotinamide adenine dinucleotide phosphate and tetracycline-europium complex and its application

International Nuclear Information System (INIS)

Peng Qian; Hou Faju; Ge Xiaoxia; Jiang Chongqiu; Gong Shubo

2005-01-01

A new spectrofluorimetric method was developed for the determination of trace amount of nicotinamide adenine dinucleotide phosphate (NADP). Using europium (Eu 3+ )-tetracycline (TC) complex as a fluorescent probe, in the buffer solution of pH 7.60. NADP can remarkably enhance the fluorescence intensity of the Eu 3+ -TC complex at λ = 612 nm and the enhanced fluorescence intensity of Eu 3+ ion is in proportion to the concentration of NADP. Optimum conditions for the determination of NADP were also investigated. The dynamic range for the determination of NADP is 4.4 x 10 -7 to 2.2 x 10 -6 mol l -1 with detection limit of 6.9 x 10 -8 mol l -1 . This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of NADP in synthetic water samples and in serum samples. Moreover, the enhancement mechanisms of the fluorescence intensity in the Eu 3+ -TC system and the Eu 3+ -TC-NADP system have been also discussed

Antidiabetic Potential of Kefir Combination from Goat Milk and Soy Milk in Rats Induced with Streptozotocin-Nicotinamide.

Science.gov (United States)

Nurliyani; Harmayani, Eni; Sunarti

2015-01-01

The study aimed to evaluate the effect of kefir combination from goat milk and soy milk on lipid profile, plasma glucose, glutathione peroxidase (GPx) activity and the improvement of pancreatic β-cell in diabetic rats. Male rats were divided into five treatments: normal control, diabetic control, goat milk kefir, combination of goat milk-soy milk kefir and soy milk kefir. All rats were induced by streptooztocin-nicotinamide (STZ-NA), except for normal control. After 35 d experiment, the rats were sampled for blood, sacrificed and sampled for pancreatic tissues. Results showed that diabetic rats fed kefir combination had higher (pkefir. Decreasing of plasma glucose in diabetic rats fed kefir combination was higher (pkefir. The activity of GPx in diabetic rats fed three kinds of kefir were higher (pkefir combination was the same as the normal control, but it was higher than diabetic control. It was concluded that kefir combination can be used as antidiabetic through maintaining in serum triglyceride, decreasing in plasma glucose, increasing in GPx activity and improving in pancreatic β-cells.

Aerobic Exercise During Encoding Impairs Hippocampus-Dependent Memory.

Science.gov (United States)

Soga, Keishi; Kamijo, Keita; Masaki, Hiroaki

2017-08-01

We investigated how aerobic exercise during encoding affects hippocampus-dependent memory through a source memory task that assessed hippocampus-independent familiarity and hippocampus-dependent recollection processes. Using a within-participants design, young adult participants performed a memory-encoding task while performing a cycling exercise or being seated. The subsequent retrieval phase was conducted while sitting on a chair. We assessed behavioral and event-related brain potential measures of familiarity and recollection processes during the retrieval phase. Results indicated that source accuracy was lower for encoding with exercise than for encoding in the resting condition. Event-related brain potential measures indicated that the parietal old/new effect, which has been linked to recollection processing, was observed in the exercise condition, whereas it was absent in the rest condition, which is indicative of exercise-induced hippocampal activation. These findings suggest that aerobic exercise during encoding impairs hippocampus-dependent memory, which may be attributed to inefficient source encoding during aerobic exercise.

Genetic variation in Hyperpolarization-activated cyclic nucleotide-gated (HCN channels and its relationship with neuroticism, cognition and risk of depression

Directory of Open Access Journals (Sweden)

Andrew Mark Mcintosh

2012-07-01

Full Text Available Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are encoded by four genes (HCN1-4 and, through activation by cyclic AMP (cAMP, represent a point of convergence for several psychosis risk genes. On the basis of positive preliminary data, we sought to test whether genetic variation in HCN1-4 conferred risk of depression or cognitive impairment in the Generation Scotland: Scottish Family Health Study. HCN1, HCN2, HCN3 and HCN4 were genotyped for 43 haplotype-tagging SNPs and tested for association with DSM-IV depression, neuroticism and a battery of cognitive tests assessing cognitive ability, memory, verbal fluency and psychomotor performance. No association was found between any HCN channel gene SNP and risk of depression, neuroticism or on any cognitive measure. The current study does not support a genetic role for HCN channels in conferring risk of depression or cognitive impairment in human subjects within the Scottish population.

Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

Science.gov (United States)

Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

2015-11-01

The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Convolutional over Recurrent Encoder for Neural Machine Translation

Directory of Open Access Journals (Sweden)

Dakwale Praveen

2017-06-01

Full Text Available Neural machine translation is a recently proposed approach which has shown competitive results to traditional MT approaches. Standard neural MT is an end-to-end neural network where the source sentence is encoded by a recurrent neural network (RNN called encoder and the target words are predicted using another RNN known as decoder. Recently, various models have been proposed which replace the RNN encoder with a convolutional neural network (CNN. In this paper, we propose to augment the standard RNN encoder in NMT with additional convolutional layers in order to capture wider context in the encoder output. Experiments on English to German translation demonstrate that our approach can achieve significant improvements over a standard RNN-based baseline.

Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

DEFF Research Database (Denmark)

Golan, O; Issan, Y; Isak, A

2011-01-01

assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

International Nuclear Information System (INIS)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

1990-01-01

We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

Energy Technology Data Exchange (ETDEWEB)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

Children at risk of diabetes type 1. Treatment with acetyl-L-carnitine plus nicotinamide - case reports.

Science.gov (United States)

Fernandez, Ivana Cristina; Del Carmen Camberos, María; Passicot, Gisel Anabel; Martucci, Lucía Camila; Cresto, Juan Carlos

2013-01-01

Abstract Objectives: The aim was to evaluate the treatment with acetyl-L-carnitine (50 mg/kg/day) and nicotinamide (25 mg/kg/day) in children at risk of type 1 diabetes. This treatment was effective and harmless in experimental type 1 diabetes in mice. Nine out of seventy healthy participants of the type 1 diabetes risk study were treated. They were typified for diabetes with HLA-DQB1 and positive autoantibodies. Children with a first peak of insulin response ≤48 µU were randomly distributed in control and treated patients. Children evolution was followed with an intravenous glucose tolerance test. Control children were treated when was another risk parameter was added. During their evolution all children were treated. Treatment periods differ (range: 120-16 months) because children began treatment at different times. During the treatment 4 patients recovered their parameters and the medication was suspended; 2 patients continued the treatment with favorable evolution. Two children evolved slowly with normal growth and development. One girl became diabetic because she was treated late. In children at risk, this treatment delays the development or remits the evolution of type 1 diabetes.

Nicotinamide-NAD sequence: redox process and related behavior, behavior and properties of intermediate and final products

International Nuclear Information System (INIS)

Elving, P.J.; Schmakel, C.O.; Santhanam, K.S.V.

1976-01-01

Illustrations of the application of analytical chemical techniques to the study of chemical phenomena are given. In particular, electrochemical techniques and methodology and, to a lesser extent, spectrophotometry were used to investigate the solution behavior, adsorption, redox processes including coupled chemical reactions, and allied aspects of biologically significant compounds and of their intermediate and final redox products, e.g., the behavior of the free radicals produced by initial one-electron processes. This approach is illustrated by the consideration of the behavior in aqueous and nonaqueous media of a sequence of compounds ranging from nicotinamide (3-carbamoylpyridine) to NAD + and NADP + ; the latter compounds function as coenzymes for the pyridinoproteins which are principal components in the Krebs citric acid cycle and in the electron transport chain in biological redox reactions. The discussion is presented under the following section headings: interpretation of electrochemical behavior; mechanistic patterns; kinetic aspects of charge-transfer and chemical reactions; correlation with theoretically calculated parameters; and, mechanisms of biological oxidation-reduction reactions. The use of pulse radiolysis, chronopotentiometric, and cyclic voltammetric methods in studies on free radical dimerization rates is reviewed in the discussion of the kinetic aspects of charge-transfer and chemical reactions. (188 references)

Exploring the influence of encoding format on subsequent memory.

Science.gov (United States)

Turney, Indira C; Dennis, Nancy A; Maillet, David; Rajah, M Natasha

2017-05-01

Distinctive encoding is greatly influenced by gist-based processes and has been shown to suffer when highly similar items are presented in close succession. Thus, elucidating the mechanisms underlying how presentation format affects gist processing is essential in determining the factors that influence these encoding processes. The current study utilised multivariate partial least squares (PLS) analysis to identify encoding networks directly associated with retrieval performance in a blocked and intermixed presentation condition. Subsequent memory analysis for successfully encoded items indicated no significant differences between reaction time and retrieval performance and presentation format. Despite no significant behavioural differences, behaviour PLS revealed differences in brain-behaviour correlations and mean condition activity in brain regions associated with gist-based vs. distinctive encoding. Specifically, the intermixed format encouraged more distinctive encoding, showing increased activation of regions associated with strategy use and visual processing (e.g., frontal and visual cortices, respectively). Alternatively, the blocked format exhibited increased gist-based processes, accompanied by increased activity in the right inferior frontal gyrus. Together, results suggest that the sequence that information is presented during encoding affects the degree to which distinctive encoding is engaged. These findings extend our understanding of the Fuzzy Trace Theory and the role of presentation format on encoding processes.

Source-constrained retrieval influences the encoding of new information.

Science.gov (United States)

Danckert, Stacey L; MacLeod, Colin M; Fernandes, Myra A

2011-11-01

Jacoby, Shimizu, Daniels, and Rhodes (Psychonomic Bulletin & Review, 12, 852-857, 2005) showed that new words presented as foils among a list of old words that had been deeply encoded were themselves subsequently better recognized than new words presented as foils among a list of old words that had been shallowly encoded. In Experiment 1, by substituting a deep-versus-shallow imagery manipulation for the levels-of-processing manipulation, we demonstrated that the effect is robust and that it generalizes, also occurring with a different type of encoding. In Experiment 2, we provided more direct evidence for context-related encoding during tests of deeply encoded words, showing enhanced priming for foils presented among deeply encoded targets when participants made the same deep-encoding judgments on those items as had been made on the targets during study. In Experiment 3, we established that the findings from Experiment 2 are restricted to this specific deep judgment task and are not a general consequence of these foils being associated with deeply encoded items. These findings provide support for the source-constrained retrieval hypothesis of Jacoby, Shimizu, Daniels, and Rhodes: New information can be influenced by how surrounding items are encoded and retrieved, as long as the surrounding items recruit a coherent mode of processing.

Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

Science.gov (United States)

Guirao-Rico, Sara; Aguadé, Montserrat

2013-01-01

In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

Effects of hydroalcoholic extract of Rhus coriaria seed on glucose and insulin related biomarkers, lipid profile, and hepatic enzymes in nicotinamide-streptozotocin-induced type II diabetic male mice.

Science.gov (United States)

Ahangarpour, Akram; Heidari, Hamid; Junghani, Majid Salehizade; Absari, Reza; Khoogar, Mehdi; Ghaedi, Ehsan

2017-10-01

Type 2 diabetes often leads to dislipidemia and abnormal activity of hepatic enzymes. The purpose of this study was to evaluate the antidiabetic and hypolipidemic properties of Rhus coriaria ( R. coriaria ) seed extrac on nicotinamide-streptozotocin induced type 2 diabetic mice. In this experimental study, 56 male Naval Medical Research Institute mice (30-35 g) were randomly separated into seven groups: control, diabetic group, diabetic mice treated with glibenclamide (0.25 mg/kg, as standard antidiabetic drug) or R. coriaria seed extract in doses of 200 and 300 mg/kg, and control groups received these two doses of extract orally for 28 days. Induction of diabetes was done by intraperitoneal injection of nicotinamide and streptozotocin. Ultimately, body weight of mice, blood levels of glucose, insulin, hepatic enzymes, leptin, and lipid profile were assayed. After induction of type 2 diabetes, level of glucose, cholesterol, low density lipoprotein, serum glutamic oxaloacetic transaminase, and serum glutamic pyruvic transaminase increased and level of insulin and high density lipoprotein decreased remarkably. Administration of both doses of extract decreased level of glucose and cholesterol significantly in diabetic mice. LDL level decreased in treated group with dose of 300 mg/kg of the extract. Although usage of the extract improved level of other lipid profiles, insulin and hepatic enzymes, changes weren't significant. This study showed R. coriaria seeds administration has a favorable effect in controlling some blood parameters in type 2 diabetes. Therefore it may be beneficial in the treatment of diabetes.

Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

Science.gov (United States)

Schechinger, Linda Sue

I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

Science.gov (United States)

Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

1978-01-01

Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

Hall effect encoding of brushless dc motors

Science.gov (United States)

Berard, C. A.; Furia, T. J.; Goldberg, E. A.; Greene, R. C.

1970-01-01

Encoding mechanism integral to the motor and using the permanent magnets embedded in the rotor eliminates the need for external devices to encode information relating the position and velocity of the rotating member.

Nucleotide excision repair II: From yeast to mammals

NARCIS (Netherlands)

J.H.J. Hoeijmakers (Jan)

1993-01-01

textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

Multichannel compressive sensing MRI using noiselet encoding.

Directory of Open Access Journals (Sweden)

Kamlesh Pawar

Full Text Available The incoherence between measurement and sparsifying transform matrices and the restricted isometry property (RIP of measurement matrix are two of the key factors in determining the performance of compressive sensing (CS. In CS-MRI, the randomly under-sampled Fourier matrix is used as the measurement matrix and the wavelet transform is usually used as sparsifying transform matrix. However, the incoherence between the randomly under-sampled Fourier matrix and the wavelet matrix is not optimal, which can deteriorate the performance of CS-MRI. Using the mathematical result that noiselets are maximally incoherent with wavelets, this paper introduces the noiselet unitary bases as the measurement matrix to improve the incoherence and RIP in CS-MRI. Based on an empirical RIP analysis that compares the multichannel noiselet and multichannel Fourier measurement matrices in CS-MRI, we propose a multichannel compressive sensing (MCS framework to take the advantage of multichannel data acquisition used in MRI scanners. Simulations are presented in the MCS framework to compare the performance of noiselet encoding reconstructions and Fourier encoding reconstructions at different acceleration factors. The comparisons indicate that multichannel noiselet measurement matrix has better RIP than that of its Fourier counterpart, and that noiselet encoded MCS-MRI outperforms Fourier encoded MCS-MRI in preserving image resolution and can achieve higher acceleration factors. To demonstrate the feasibility of the proposed noiselet encoding scheme, a pulse sequences with tailored spatially selective RF excitation pulses was designed and implemented on a 3T scanner to acquire the data in the noiselet domain from a phantom and a human brain. The results indicate that noislet encoding preserves image resolution better than Fouirer encoding.

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Low Complexity HEVC Encoder for Visual Sensor Networks

Directory of Open Access Journals (Sweden)

Zhaoqing Pan

2015-12-01

Full Text Available Visual sensor networks (VSNs can be widely applied in security surveillance, environmental monitoring, smart rooms, etc. However, with the increased number of camera nodes in VSNs, the volume of the visual information data increases significantly, which becomes a challenge for storage, processing and transmitting the visual data. The state-of-the-art video compression standard, high efficiency video coding (HEVC, can effectively compress the raw visual data, while the higher compression rate comes at the cost of heavy computational complexity. Hence, reducing the encoding complexity becomes vital for the HEVC encoder to be used in VSNs. In this paper, we propose a fast coding unit (CU depth decision method to reduce the encoding complexity of the HEVC encoder for VSNs. Firstly, the content property of the CU is analyzed. Then, an early CU depth decision method and a low complexity distortion calculation method are proposed for the CUs with homogenous content. Experimental results show that the proposed method achieves 71.91% on average encoding time savings for the HEVC encoder for VSNs.

Head to head comparison of short-term treatment with the NAD+ precursor nicotinamide mononucleotide (NMN and six weeks of exercise in obese female mice

Directory of Open Access Journals (Sweden)

Golam Mezbah Uddin

2016-08-01

Full Text Available Obesity is well known to be a major cause of several chronic metabolic diseases, which can be partially counteracted by exercise. This is due, in part, to an upregulation of mitochondrial activity through increased nicotinamide adenine dinucleotide (NAD+. Recent studies have shown that NAD+ levels can be increased by using the NAD+ precursor, nicotinamide mononucleotide (NMN leading to the suggestion that NMN could be a useful intervention in diet related metabolic disorders. In this study we compared the metabolic, and especially mitochondrial-associated, effects of exercise and NMN in ameliorating the consequences of high-fat diet (HFD induced obesity in mice. Sixty female 5 week old C57BL6/J mice were allocated across 5 interventions: Chow sedentary: CS; Chow exercise: CEX; HFD sedentary: HS; HFD NMN: HNMN; HFD exercise: HEX (12/group. After 6 weeks of diet, exercise groups underwent treadmill exercise (15 m/min for 45 minutes, 6 days per week for 6 weeks. NMN or vehicle (500 mg/kg body weight was injected (i.p. daily for the last 17 days. No significant alteration in body weight was observed in response to exercise or NMN. The HFD significantly altered adiposity, glucose tolerance, plasma insulin, NADH levels and citrate synthase activity in muscle and liver. HEX and HNMN groups both showed significantly improved glucose tolerance compared to the HS group. NAD+ levels were increased significantly both in muscle and liver by NMN whereas exercise increased NAD+ only in muscle. Both NMN and exercise ameliorated the HFD-induced reduction in liver citrate synthase activity. However, exercise, but not NMN, ameliorated citrate synthase activity in muscle. Overall these data suggest that while exercise and NMN-supplementation can induce similar reversal of the glucose intolerance induced by obesity, they are associated with tissue-specific effects and differential alterations to mitochondrial function in muscle and liver.

On the Immortality of Television Sets: “Function” in the Human Genome According to the Evolution-Free Gospel of ENCODE

Science.gov (United States)

Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

2013-01-01

A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 − 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these “functional” regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means, chiefly by employing the seldom used “causal role” definition of biological function and then applying it inconsistently to different biochemical properties, by committing a logical fallacy known as “affirming the consequent,” by failing to appreciate the crucial difference between “junk DNA” and “garbage DNA,” by using analytical methods that yield biased errors and inflate estimates of functionality, by favoring statistical sensitivity over specificity, and by emphasizing statistical significance rather than the magnitude of the effect. Here, we detail the many logical and methodological transgressions involved in assigning functionality to almost every nucleotide in the human genome. The ENCODE results were predicted by one of its authors to necessitate the rewriting of textbooks. We agree, many textbooks dealing with marketing, mass-media hype, and public relations may well have to be rewritten. PMID:23431001

Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

International Nuclear Information System (INIS)

Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

2005-01-01

The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

Directory of Open Access Journals (Sweden)

Michael E. Østergaard

2017-06-01

Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

Negative affect promotes encoding of and memory for details at the expense of the gist: affect, encoding, and false memories.

Science.gov (United States)

Storbeck, Justin

2013-01-01

I investigated whether negative affective states enhance encoding of and memory for item-specific information reducing false memories. Positive, negative, and neutral moods were induced, and participants then completed a Deese-Roediger-McDermott (DRM) false-memory task. List items were presented in unique spatial locations or unique fonts to serve as measures for item-specific encoding. The negative mood conditions had more accurate memories for item-specific information, and they also had fewer false memories. The final experiment used a manipulation that drew attention to distinctive information, which aided learning for DRM words, but also promoted item-specific encoding. For the condition that promoted item-specific encoding, false memories were reduced for positive and neutral mood conditions to a rate similar to that of the negative mood condition. These experiments demonstrated that negative affective cues promote item-specific processing reducing false memories. People in positive and negative moods encode events differently creating different memories for the same event.

Preparation of protected nucleotides usable in oligonucleotide synthesis

International Nuclear Information System (INIS)

Debiard, Jean-Pascal

1983-01-01

After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq.

Directory of Open Access Journals (Sweden)

Zhipeng Su

Full Text Available Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs, UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures. The transcriptional units

Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

2013-12-01

Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

Directory of Open Access Journals (Sweden)

Xu Wanhong

2008-12-01

Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

The Caenorhabditis elegans nicotinamidase PNC-1 enhances survival.

Science.gov (United States)

van der Horst, Armando; Schavemaker, Jolanda M; Pellis-van Berkel, Wendy; Burgering, Boudewijn M T

2007-04-01

In yeast, increasing the copy number of the nicotinamide adenine dinucleotide (NAD)-dependent deacetylase Sir2 extends lifespan, which can be inhibited by nicotinamide (Nam), the end-product of Sir2-mediated NAD-breakdown. Furthermore, the yeast pyrazinamidase/nicotinamidase PNC-1 can extend yeast lifespan by converting Nam. In Caenorhabditis elegans (C. elegans), increased dosage of the gene encoding SIR-2.1 also increases lifespan. Here, we report that knockdown of the C. elegans homologue of yeast PNC-1 as well as growing worms on Nam-containing medium significantly decreases adult lifespan. Accordingly, increased gene dosage of pnc-1 increases adult survival under conditions of oxidative stress. These data show for the first time the involvement of PNC-1/Nam in the survival of a multicellular organism and may also contribute to our understanding of lifespan regulation in mammals.

Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus.

Science.gov (United States)

Gazanion, Elodie; Seblova, Veronika; Votypka, Jan; Vergnes, Baptiste; Garcia, Déborah; Volf, Petr; Sereno, Denis

2012-04-01

Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinicacid to ensure Nicotinamide–Adenine–Dinucleotide (NAD+) biosynthesis. We were curious to explore the role of this enzyme during L. infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L. infantum at the early time points post their ingestion within the bloodmeal. In contrast, once the blood meal digestion was completed, the null mutants were unable to develop further and establish late-stage infections. Data highlight the importance of the nicotinamide degradation pathway for Leishmania development in sand flies. They indicate that the endogenous nicotinamidase is essential for Leishmania development in the sand fly after the blood meal has been digested and the remnants defecated.

Evaluation of color encodings for high dynamic range pixels

Science.gov (United States)

Boitard, Ronan; Mantiuk, Rafal K.; Pouli, Tania

2015-03-01

Traditional Low Dynamic Range (LDR) color spaces encode a small fraction of the visible color gamut, which does not encompass the range of colors produced on upcoming High Dynamic Range (HDR) displays. Future imaging systems will require encoding much wider color gamut and luminance range. Such wide color gamut can be represented using floating point HDR pixel values but those are inefficient to encode. They also lack perceptual uniformity of the luminance and color distribution, which is provided (in approximation) by most LDR color spaces. Therefore, there is a need to devise an efficient, perceptually uniform and integer valued representation for high dynamic range pixel values. In this paper we evaluate several methods for encoding colour HDR pixel values, in particular for use in image and video compression. Unlike other studies we test both luminance and color difference encoding in a rigorous 4AFC threshold experiments to determine the minimum bit-depth required. Results show that the Perceptual Quantizer (PQ) encoding provides the best perceptual uniformity in the considered luminance range, however the gain in bit-depth is rather modest. More significant difference can be observed between color difference encoding schemes, from which YDuDv encoding seems to be the most efficient.

Security enhanced BioEncoding for protecting iris codes

Science.gov (United States)

Ouda, Osama; Tsumura, Norimichi; Nakaguchi, Toshiya

2011-06-01

Improving the security of biometric template protection techniques is a key prerequisite for the widespread deployment of biometric technologies. BioEncoding is a recently proposed template protection scheme, based on the concept of cancelable biometrics, for protecting biometric templates represented as binary strings such as iris codes. The main advantage of BioEncoding over other template protection schemes is that it does not require user-specific keys and/or tokens during verification. Besides, it satisfies all the requirements of the cancelable biometrics construct without deteriorating the matching accuracy. However, although it has been shown that BioEncoding is secure enough against simple brute-force search attacks, the security of BioEncoded templates against more smart attacks, such as record multiplicity attacks, has not been sufficiently investigated. In this paper, a rigorous security analysis of BioEncoding is presented. Firstly, resistance of BioEncoded templates against brute-force attacks is revisited thoroughly. Secondly, we show that although the cancelable transformation employed in BioEncoding might be non-invertible for a single protected template, the original iris code could be inverted by correlating several templates used in different applications but created from the same iris. Accordingly, we propose an important modification to the BioEncoding transformation process in order to hinder attackers from exploiting this type of attacks. The effectiveness of adopting the suggested modification is validated and its impact on the matching accuracy is investigated empirically using CASIA-IrisV3-Interval dataset. Experimental results confirm the efficacy of the proposed approach and show that it preserves the matching accuracy of the unprotected iris recognition system.

Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

Science.gov (United States)

Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

1999-03-01

The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

Science.gov (United States)

Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

2017-07-25

We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

Histone displacement during nucleotide excision repair

DEFF Research Database (Denmark)

Dinant, C.; Bartek, J.; Bekker-Jensen, S.

2012-01-01

Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

Deep and shallow encoding effects on face recognition: an ERP study.

Science.gov (United States)

Marzi, Tessa; Viggiano, Maria Pia

2010-12-01

Event related potentials (ERPs) were employed to investigate whether and when brain activity related to face recognition varies according to the processing level undertaken at encoding. Recognition was assessed when preceded by a "shallow" (orientation judgement) or by a "deep" study task (occupation judgement). Moreover, we included a further manipulation by presenting at encoding faces either in the upright or inverted orientation. As expected, deeply encoded faces were recognized more accurately and more quickly with respect to shallowly encoded faces. The ERP showed three main findings: i) as witnessed by more positive-going potentials for deeply encoded faces, at early and later processing stage, face recognition was influenced by the processing strategy adopted during encoding; ii) structural encoding, indexed by the N170, turned out to be "cognitively penetrable" showing repetition priming effects for deeply encoded faces; iii) face inversion, by disrupting configural processing during encoding, influenced memory related processes for deeply encoded faces and impaired the recognition of faces shallowly processed. The present study adds weight to the concept that the depth of processing during memory encoding affects retrieval. We found that successful retrieval following deep encoding involved both familiarity- and recollection-related processes showing from 500 ms a fronto-parietal distribution, whereas shallow encoding affected only earlier processing stages reflecting perceptual priming. Copyright © 2010 Elsevier B.V. All rights reserved.

Review of Random Phase Encoding in Volume Holographic Storage

Directory of Open Access Journals (Sweden)

Wei-Chia Su

2012-09-01

Full Text Available Random phase encoding is a unique technique for volume hologram which can be applied to various applications such as holographic multiplexing storage, image encryption, and optical sensing. In this review article, we first review and discuss diffraction selectivity of random phase encoding in volume holograms, which is the most important parameter related to multiplexing capacity of volume holographic storage. We then review an image encryption system based on random phase encoding. The alignment of phase key for decryption of the encoded image stored in holographic memory is analyzed and discussed. In the latter part of the review, an all-optical sensing system implemented by random phase encoding and holographic interconnection is presented.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Grammatical constraints on phonological encoding in speech production.

Science.gov (United States)

Heller, Jordana R; Goldrick, Matthew

2014-12-01

To better understand the influence of grammatical encoding on the retrieval and encoding of phonological word-form information during speech production, we examine how grammatical class constraints influence the activation of phonological neighbors (words phonologically related to the target--e.g., MOON, TWO for target TUNE). Specifically, we compare how neighbors that share a target's grammatical category (here, nouns) influence its planning and retrieval, assessed by picture naming latencies, and phonetic encoding, assessed by word productions in picture names, when grammatical constraints are strong (in sentence contexts) versus weak (bare naming). Within-category (noun) neighbors influenced planning time and phonetic encoding more strongly in sentence contexts. This suggests that grammatical encoding constrains phonological processing; the influence of phonological neighbors is grammatically dependent. Moreover, effects on planning times could not fully account for phonetic effects, suggesting that phonological interaction affects articulation after speech onset. These results support production theories integrating grammatical, phonological, and phonetic processes.

Two Pathways to Stimulus Encoding in Category Learning?

Science.gov (United States)

Davis, Tyler; Love, Bradley C.; Maddox, W. Todd

2008-01-01

Category learning theorists tacitly assume that stimuli are encoded by a single pathway. Motivated by theories of object recognition, we evaluate a dual-pathway account of stimulus encoding. The part-based pathway establishes mappings between sensory input and symbols that encode discrete stimulus features, whereas the image-based pathway applies holistic templates to sensory input. Our experiments use rule-plus-exception structures in which one exception item in each category violates a salient regularity and must be distinguished from other items. In Experiment 1, we find that discrete representations are crucial for recognition of exceptions following brief training. Experiments 2 and 3 involve multi-session training regimens designed to encourage either part or image-based encoding. We find that both pathways are able to support exception encoding, but have unique characteristics. We speculate that one advantage of the part-based pathway is the ability to generalize across domains, whereas the image-based pathway provides faster and more effortless recognition. PMID:19460948

(Solid + liquid) phase diagram for (indomethacin + nicotinamide)-methanol or methanol/ethyl acetate mixture and solubility behavior of 1:1 (indomethacin + nicotinamide) co-crystal at T = (298.15 and 313.15) K

International Nuclear Information System (INIS)

Sun, Xiaowei; Yin, Qiuxiang; Ding, Suping; Shen, Zhiming; Bao, Ying; Gong, Junbo; Hou, Baohong; Hao, Hongxun; Wang, Yongli; Wang, Jingkang; Xie, Chuang

2015-01-01

Highlights: • Ternary phase diagrams of (IMC + NCT)-methanol or methanol/ethyl acetate mixture at T = (298.15 and 313.15) K were measured. • The effects of temperature and introduced ethyl acetate on solid phase stability were discussed. • Solubility of (IMC + NCT) cocrystals was first correlated using a model considering solubility product and complexation. • Solubility of (IMC + NCT) cocrystals as a function of co-former concentration was evaluated. - Abstract: (Solid + liquid) equilibrium data for indomethacin (IMC) and nicotinamide (NCT) in both methanol (MeOH) and methanol/ethyl acetate (EA) mixture were determined using a static method at T = (298.15 and 313.15) K under atmospheric pressure. The 1:1 (IMC + NCT) co-crystal and IMC·MeOH were found in both systems under conditions investigated. The solubility of the 1:1 (IMC + NCT) co-crystal was correlated using a mathematical model consisting of both solubility product and a complexation process. Solubility of (IMC + NCT) co-crystals as a function of co-former (NCT) concentration was evaluated. It was found that temperature has a significant effect on the formation of methanol solvate in the systems investigated. Solvate formation could be suppressed either by increasing temperature or using solvent mixtures. Additionally, the solvent mixture could level out the solubility differences between IMC and NCT, resulting in larger and more symmetric regions for the (IMC + NCT) co-crystal, which would be helpful to the development of the co-crystallization process for the 1:1 (IMC + NCT) co-crystal

Modular verification of chemical reaction network encodings via serializability analysis

Science.gov (United States)

Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

2015-01-01

Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

Computational identification of candidate nucleotide cyclases in higher plants

KAUST Repository

Wong, Aloysius Tze; Gehring, Christoph A

2013-01-01

In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

High-Efficient Parallel CAVLC Encoders on Heterogeneous Multicore Architectures

Directory of Open Access Journals (Sweden)

H. Y. Su

2012-04-01

Full Text Available This article presents two high-efficient parallel realizations of the context-based adaptive variable length coding (CAVLC based on heterogeneous multicore processors. By optimizing the architecture of the CAVLC encoder, three kinds of dependences are eliminated or weaken, including the context-based data dependence, the memory accessing dependence and the control dependence. The CAVLC pipeline is divided into three stages: two scans, coding, and lag packing, and be implemented on two typical heterogeneous multicore architectures. One is a block-based SIMD parallel CAVLC encoder on multicore stream processor STORM. The other is a component-oriented SIMT parallel encoder on massively parallel architecture GPU. Both of them exploited rich data-level parallelism. Experiments results show that compared with the CPU version, more than 70 times of speedup can be obtained for STORM and over 50 times for GPU. The implementation of encoder on STORM can make a real-time processing for 1080p @30fps and GPU-based version can satisfy the requirements for 720p real-time encoding. The throughput of the presented CAVLC encoders is more than 10 times higher than that of published software encoders on DSP and multicore platforms.

Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

Directory of Open Access Journals (Sweden)

Yang Ming

2012-07-01

Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

Indirect Encoding in Neuroevolutionary Ship Handling

Directory of Open Access Journals (Sweden)

Miroslaw Lacki

2018-03-01

Full Text Available In this paper the author compares the efficiency of two encoding schemes for artificial intelligence methods used in the neuroevolutionary ship maneuvering system. This may be also be seen as the ship handling system that simulates a learning process of a group of artificial helmsmen - autonomous control units, created with an artificial neural network. The helmsman observes input signals derived form an enfironment and calculates the values of required parameters of the vessel maneuvering in confined waters. In neuroevolution such units are treated as individuals in population of artificial neural networks, which through environmental sensing and evolutionary algorithms learn to perform given task efficiently. The main task of this project is to evolve a population of helmsmen with indirect encoding and compare results of simulation with direct encoding method.

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

Directory of Open Access Journals (Sweden)

Kristen K. Merritt

2014-10-01

Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

What is a "good" encoding of guarded choice?

DEFF Research Database (Denmark)

Nestmann, Uwe

2000-01-01

into the latter that preserves divergence-freedom and symmetries. This paper argues that there are nevertheless "good" encodings between these calculi. In detail, we present a series of encodings for languages with (1) input-guarded choice, (2) both input and output-guarded choice, and (3) mixed-guarded choice......, and investigate them with respect to compositionality and divergence-freedom. The first and second encoding satisfy all of the above criteria, but various "good" candidates for the third encoding-inspired by an existing distributed implementation-invalidate one or the other criterion, While essentially confirming...... Palamidessi's result, our study suggests that the combination of strong compositionality and divergence-freedom is too strong for more practical purposes. (C) 2000 Academic Press....

Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

International Nuclear Information System (INIS)

Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

1986-01-01

The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

Reversal of endothelial dysfunction in aorta of streptozotocin-nicotinamide-induced type-2 diabetic rats by S-Allylcysteine.

Science.gov (United States)

Brahmanaidu, Parim; Uddandrao, V V Sathibabu; Sasikumar, Vadivukkarasi; Naik, Ramavat Ravindar; Pothani, Suresh; Begum, Mustapha Sabana; Rajeshkumar, M Prasanna; Varatharaju, Chandrasekar; Meriga, Balaji; Rameshreddy, P; Kalaivani, A; Saravanan, Ganapathy

2017-08-01

Dietary measures and plant-based therapies as prescribed by native systems of medicine have gained attraction among diabetics with claims of efficacy. The present study investigated the effects of S-Allylcysteine (SAC) on body weight gain, glucose, insulin, insulin resistance, and nitric oxide synthase in plasma and argininosuccinate synthase (AS) and argininosuccinate lyase (ASL), lipid peroxides and antioxidant enzymes in aorta of control and streptozotocin-nicotinamide (STZ-NA)-induced diabetic rats. Changes in body weight, glucose, insulin, insulin resistance, and antioxidant profiles of aorta and mRNA expressions of nitric oxide synthase, AS, and ASL were observed in experimental rats. SAC (150 mg/kg b.w) showed its therapeutic effects similar to gliclazide in decreasing glucose, insulin resistance, lipid peroxidation, and increasing body weight; insulin, antioxidant enzymes, and mRNA levels of nitric oxide synthase, argininosuccinate synthase, and argininosuccinate lyase genes in STZ-NA rats. Histopathologic studies also revealed the protective nature of SAC on aorta. In conclusion, garlic and its constituents mediate the anti-diabetic potential through mitigating hyperglycemic status, changing insulin resistance by alleviating endothelial dysregulation in both plasma and tissues.

Classifying Coding DNA with Nucleotide Statistics

Directory of Open Access Journals (Sweden)

Nicolas Carels

2009-10-01

Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-17

Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

Statistical properties of nucleotides in human chromosomes 21 and 22

International Nuclear Information System (INIS)

Zhang Linxi; Sun Tingting

2005-01-01

In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

Encoding specificity manipulations do affect retrieval from memory.

Science.gov (United States)

Zeelenberg, René

2005-05-01

In a recent article, P.A. Higham (2002) [Strong cues are not necessarily weak: Thomson and Tulving (1970) and the encoding specificity principle revisited. Memory &Cognition, 30, 67-80] proposed a new way to analyze cued recall performance in terms of three separable aspects of memory (retrieval, monitoring, and report bias) by comparing performance under both free-report and forced-report instructions. He used this method to derive estimates of these aspects of memory in an encoding specificity experiment similar to that reported by D.M. Thomson and E. Tulving (1970) [Associative encoding and retrieval: weak and strong cues. Journal of Experimental Psychology, 86, 255-262]. Under forced-report instructions, the encoding specificity manipulation did not affect performance. Higham concluded that the manipulation affected monitoring and report bias, but not retrieval. I argue that this interpretation of the results is problematic because the Thomson and Tulving paradigm is confounded, and show in three experiments using a more appropriate design that encoding specificity manipulations do affect performance in forced-report cued recall. Because in Higham's framework forced-report performance provides a measure of retrieval that is uncontaminated by monitoring and report bias it is concluded that encoding specificity manipulations do affect retrieval from memory.

Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

Directory of Open Access Journals (Sweden)

Barry J Grant

2009-03-01

Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.