Energy Technology Data Exchange (ETDEWEB)
Chi, Yayun; Hong, Yi; Zong, Hongliang; Wang, Yanlin; Zou, Weiying; Yang, Junwu; Kong, Xiangfei; Yun, Xiaojing [Gene Research Center, Shanghai Medical College and Institutes of Biomedical, Shanghai 200032 (China); Gu, Jianxin, E-mail: jxgu@shmu.edu.cn [Gene Research Center, Shanghai Medical College and Institutes of Biomedical, Shanghai 200032 (China)
2009-08-28
Vitamin D receptor (VDR) is a member of the nuclear receptor superfamily and regulates transcription of target genes. In this study, we identified CDK11{sup p58} as a novel protein involved in the regulation of VDR. CDK11{sup p58}, a member of the large family of p34cdc2-related kinases, is associated with cell cycle progression, tumorigenesis, and apoptotic signaling. Our study demonstrated that CDK11{sup p58} interacted with VDR and repressed VDR-dependent transcriptional activation. Furthermore, overexpression of CDK11{sup p58} decreased the stability of VDR through promoting its ubiquitin-proteasome-mediated degradation. Taken together, these results suggest that CDK11{sup p58} is involved in the negative regulation of VDR.
Energy Technology Data Exchange (ETDEWEB)
Yuanda, Wang; Xiuming, Bao; Zhiqiang, Mao; Rongfang, Yuan; Keling, Wen; Binyin, Huang; Zhifu, Wang; Shuming, Li; Jianan, Wang; Zuxun, Sun; others, and
1985-11-01
The differential cross sections are measured using 26.0 MeV ..cap alpha.. particle for /sup 58,62/Ni(..cap alpha.., ..cap alpha..) /sup 58,62/Ni and /sup 58,62/Ni(..cap alpha..,p) /sup 61,65/Cu reactions as well as 25.4 MeV ..cap alpha.. particle for /sup 60/Ni(..cap alpha.., ..cap alpha..)/sup 69/Ni and /sup 60/Ni(..cap alpha.., p)/sup 63/Cu reactions. Consistent calculations with optical model and ZR DWBA are made for (..cap alpha.., ..cap alpha..) and (..cap alpha.., p) reactions by using of single, two, three and four nucleon optical potential parameters. For elastic scattering due to the ..cap alpha.. optical potential ambiguities, all the above optical potential can reproduce the experimental angular distributions. However, the single, two and three nucleon potential, including the Baird's mass systematics and the Chang's energy systematics of ..cap alpha.. potentials, obviously can not provide a reasonable fitting with the (..cap alpha..,p) reaction experimental data. Only the results from the four nucleon potential is in good agreement with the (..cap alpha..,p) reaction experimental data. This reveals that in the ..cap alpha..-particle induced transfer reactions, the real depth of the ..cap alpha..-nucleus optical potential should be rather deep.
Neutron enrichment at midrapidity in {sup 58}Ni + {sup 58}Ni at 52 MeV/u
Energy Technology Data Exchange (ETDEWEB)
Theriault, D; Vallee, A; Gingras, L; Larochelle, Y; Roy, R; April, A; Beaulieu, L; Grenier, F; Lemieux, F; Moisan, J; Samri, M; Saint-Pierre, C; Turbide, S [Laval Univ., Lab. de Physique Nucleaire, Dept. de Physique, Quebec City, PQ (Canada); Yennello, S J; Martin, E; Winchester, E [Texas A and M Univ., College Station, TX (United States). Cyclotron Inst.
2003-07-01
By combining data from a charged particle {sup 58}Ni + {sup 58}Ni experiment at 52 MeV/u with an {sup 36}Ar + {sup 58}Ni experiment at 50 MeV/u for which free neutrons have been detected, an increase in the neutron to proton ratio of the whole nuclear material at midrapidity has been experimentally observed in the reaction {sup 58}Ni + {sup 58}Ni at 52 MeV/u. The neutron to proton ratio is measured above the initial neutron to proton ratio of the system. Neutron to proton ratio of the quasi-projectile emission is analysed for the same reactions and is seen to decrease below the ratio of the initial system. (authors)
Energy Technology Data Exchange (ETDEWEB)
Iliadis, C; Schange, T; Rolfs, C; Schroeder, U; Somorjai, E; Trautvetter, H P; Wolke, K [Muenster Univ. (Germany, F.R.). Inst. fuer Kernphysik; Endt, P M; Kikstra, S W [Rijksuniversiteit Utrecht (Netherlands). Robert van de Graaff Lab.; Champagne, A E [Princeton Univ., NJ (USA). Dept. of Physics; Arnould, M; Paulus, G [Universite Libre de Bruxelles (Belgium). Inst. d' Astronomie et d' Astrophysique
1990-06-11
Gamma-ray decay schemes have been measured with bare and Compton-suppressed Ge detectors at low-energy resonances (E{sub p}<340 keV) in the (p, {gamma}) reactions on {sup 25}Mg, {sup 26}Mg and {sup 27}Al. Althogether 58 new decay branches have been observed and a new {sup 26}Mg(p, {gamma}){sup 27}Al resonance has been found at E{sub p}=154.5{plus minus}1.0 keV. The new branchings lead to J{sup {pi}}; T determinations (or limitations) for two states in {sup 26}Al and four states in {sup 28}Si. The absolute strengths of the {sup 25}Mg(p, {gamma}){sup 26}Al and {sup 26}Mg(p, {gamma}){sup 27}Al resonances have also been obtained, and the uncertainties of the stellar rates, deduced from the available data for both reactions, are significantly reduced. Some astrophysical consequences are discussed. (orig.).
Evaluation of the (n,p) cross sections for natural Ni and its isotopes {sup 58,60,61,62,64}Ni
Energy Technology Data Exchange (ETDEWEB)
Gonggui, Ma; Shiming, Wang; Kun, Zhang [Sichuan Univ., Chengdu (China). Inst. of Nuclear Science and Technology
1996-06-01
Nickel is a very important structure material in nuclear engineering. The neutron activation cross section of the (n,p) reaction is very important for fusion reactor from the view point of monitoring neutron field. The cross sections {sup 58,60,61,62,64}Ni(n,p){sup 58,60,61,62,64}Co were evaluated based on measured data and theoretical calculation from threshold to 20 MeV. The present evaluations agree well with the measured data of Ni isotopes. (6 figs.).
Analyzing power measurements in the (p,α) reaction on sup(58,60,62)Ni and 54Fe
International Nuclear Information System (INIS)
Katori, K.; Tagishi, Y.; Toba, Y.; Sasagase, M.; Sato, M.
1980-01-01
Two topics are discussed: (1) Analyzing powers for the (p, α) reactions on sup(58,60,62)Ni at E sub(p) = 22 MeV and (2) Excitation of the analog state in the 54 Fe(p, α) 51 Mn reaction at E sub(p) = 21 MeV. For the first topic, isotope (sup(58,60,62)Ni) and orbit (0f sub(7/2), 1s sub(1/2) and 0d sub(3/2)) dependences on angular distributions were compared for analyzing powers and cross sections. All the measured analyzing powers could not be reproduced within the frame work of a simple DWBA calculation. For the second topic, spin and parity of a state at 4.459 MeV in 51 Mn (the analog of the ground state of the 51 Cr nucleus) were assigned to be 7/2 - by the measurements of the analyzing power and cross section. (author)
The crystal structure of the human co-chaperone P58(IPK.
Directory of Open Access Journals (Sweden)
Maria Svärd
Full Text Available P58(IPK is one of the endoplasmic reticulum- (ER- localised DnaJ (ERdj proteins which interact with the chaperone BiP, the mammalian ER ortholog of Hsp70, and are thought to contribute to the specificity and regulation of its diverse functions. P58(IPK, expression of which is upregulated in response to ER stress, has been suggested to act as a co-chaperone, binding un- or misfolded proteins and delivering them to BiP. In order to give further insights into the functions of P58(IPK, and the regulation of BiP by ERdj proteins, we have determined the crystal structure of human P58(IPK to 3.0 Å resolution using a combination of molecular replacement and single wavelength anomalous diffraction. The structure shows the human P58(IPK monomer to have a very elongated overall shape. In addition to the conserved J domain, P58(IPK contains nine N-terminal tetratricopeptide repeat motifs, divided into three subdomains of three motifs each. The J domain is attached to the C-terminal end via a flexible linker, and the structure shows the conserved Hsp70-binding histidine-proline-aspartate (HPD motif to be situated on the very edge of the elongated protein, 100 Å from the putative binding site for unfolded protein substrates. The residues that comprise the surface surrounding the HPD motif are highly conserved in P58(IPK from other organisms but more varied between the human ERdj proteins, supporting the view that their regulation of different BiP functions is facilitated by differences in BiP-binding.
Energy Technology Data Exchange (ETDEWEB)
Anderson, R E; Kraushaar, J J; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Comfort, J R [Indiana Univ., Bloomington (USA). Dept. of Physics
1978-01-01
The (p,d) reaction has been studied on /sup 58/Ni, /sup 90/Zr and /sup 208/Pb at 121 MeV in order to test the applicability of the usual DWBA methods to higher energy data. The calculations describe the angular distribution for the strongly excited low-lying states reasonably well when adiabatic-deuteron optical potentials are used. Some discrepancies in shape persist, however, and some values of the spectroscopic factors differ from lower energy data in spite of many variations in the calculations. By use of exact finite-range calculations a value of D/sup 2//sub 0/ = 1.23 x 10/sup 4/ MeV/sup 2/.fm/sup 3/ was found for use at 121 MeV. Deuteron D-state contributions were negligible at forward angles and two-step contributions do not appear more significant than for data at lower energy.
Energy Technology Data Exchange (ETDEWEB)
Martinez Q, E.; Aguilera, E.F.; Garcia M, H.; Lizcano, D. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)
2004-07-01
Inside the systematic studies of nuclear reactions with radioactive beams carried out by our group, using the installation TWINSOL of the University of Notre Dame, it was carried out an experiment where the fusion of the system {sup 8} B + {sup 58} Ni was measured to investigate the effects of the proton halo of the radioactive nuclei {sup 8} B to the interactionate with a target of {sup 58} Ni. The protons were detected taken place in the reaction and values were determined for the fusion cross section. (Author)
/sup 58/Ni(/sup 16/O, /sup 12/C)/sup 62/Zn reaction at an incident energy 80 MeV
Energy Technology Data Exchange (ETDEWEB)
Okuma, Yasuhiko [Osaka Univ., Suita (Japan). Research Center for Nuclear Physics; Motobayashi, Tooru; Takimoto, Kiyohiko; Shimoura, Susumu; Ogino, Kouya; Fukada, Mamoru; Suehiro, Teruo; Matsuki, Seishi; Yanabu, Takuji
1983-03-01
Cross section angular distributions for the /sup 16/O + /sup 58/Ni elastic scattering and the /sup 58/Ni(/sup 16/O, /sup 12/C)/sup 62/Zn- 3.8416 MeV reaction leading to the discrete and continuum states at an incident energy Esub(lab)(/sup 16/O) = 80 MeV have been measured. The eight low-lying single and double energy levels were observed in the energy spectra of the /sup 58/Ni(/sup 16/O, /sup 12/C)/sup 62/Zn reaction. Populations of these levels have the cross sections of 1-200 ..mu..b/sr. The ground state cross section was proved to change with the incident energy by comparing the present data with the other 46 and 60 MeV data. The cross section angular distribution for the ground state transition changes also with the incident energy. The data points for the 46 MeV show a typical bell shape angular distribution. The angular distribution for the 60 MeV reveals a forward peaked and pronounced oscillation pattern, while that for the 80 MeV shows an oscillation damping with the angle and then a monotonous fall on the angle. Optical model parameters were deduced from the best fit to the measurements of the /sup 16/O + /sup 58/Ni elastic scattering. The EFR-DWBA calculations of the (/sup 16/O, /sup 12/C) results were performed with reasonable fits for the cross section angular distributions of observed energy levels. The optical model parameters giving good representations of the ..cap alpha..-transfer data have the property that the real diffuseness parameter has a large value almost equal to the radius parameter. The inclusion of Coulomb correction in the transfer interaction causes a reduction of 0.9 times in cross section, but no change in angular distribution. The dependence of the angular distribution shape on the incident energy can be reproduced by the EFR-DWBA calculation even if only one parameter set is used in the calculation over the wide incident energy range.
Dynamics of {sup 58}Ni + {sup 54}Fe → {sup 112}Xe* reaction across the Coulomb barrier
Energy Technology Data Exchange (ETDEWEB)
Kaur, Manpreet; Sharma, Manoj K. [Thapar University, School of Physics and Materials Science, Patiala (India)
2014-03-15
The dynamical cluster-decay model (DCM) has been applied to study the decay of the {sup 112}Xe* compound nucleus formed in the massive heavy-ion reaction {sup 58}Ni + {sup 54}Fe at energies across the Coulomb barrier with E{sub c.m.} ∼ 85-110 MeV. The calculations are done for spherical fragmentation as well as by including deformation and orientation degrees of freedom of the decaying fragments. DCM-based cross sections give a nice description of the experimental fusion excitation function σ{sub ER}, within one parameter fitting, the neck length parameter (ΔR), whose value remains within the range of nuclear proximity interaction. The barrier height corresponding to the neck length parameter brings into the picture the barrier modification which enables us to address the data particularly at below barrier energies. The role of excitation energy (or temperature), deformations, orientations, angular momentum and diffuseness parameter is investigated to understand the dynamics of the {sup 58}Ni + {sup 54}Fe reaction. Finally the N/Z dependence of the fragmentation structure of different compound systems formed via {sup 58}Ni beam (projectile) is explored. (orig.)
Elastic scattering and total reaction cross section for the {sup 6}He+{sup 58}Ni system
Energy Technology Data Exchange (ETDEWEB)
Morcelle, V. [Instituto de Física - Universidade Federal Fluminense, 24210-346, Rio de Janeiro, Brazil and Universidade Federal de Itajubá, 35900-030, Itabira (Brazil); Lichtenthäler, R.; Lépine-Szily, A.; Guimarães, V.; Gasques, L.; Scarduelli, V.; Condori, R. Pampa; Leistenschneider, E. [Depto de Física Nuclear, Universidade de São Paulo, C.P. 66318, 05389-970, São Paulo (Brazil); Mendes Jr, D. R.; Faria, P. N. de [Instituto de Física - Universidade Federal Fluminense, 24210-346, Rio de Janeiro (Brazil); Pires, K. C. C. [Universidade Tecnológica Federal do Paraná, 86300-000, Cornélio Procópio (Brazil); Barioni, A. [Instituto de Física, Universidade Federal da Bahia, 40210-340, Bahia (Brazil); Morais, M. C. [Centro Brasileiro de Pesquisas Físicas, 22290-180, Rio de Janeiro (Brazil); Shorto, J. M. B. [Instituto de Pesquisas Energéticas e Nucleares- IPEN, 05508-000, São Paulo (Brazil); Zamora, J. C. [Departament of Physics, Technische Universität Darmstadt (Germany)
2014-11-11
Elastic scattering measurements of {sup 6}He + {sup 58}Ni system have been performed at the laboratory energy of 21.7 MeV. The {sup 6}He secondary beam was produced by a transfer reaction {sup 9}Be ({sup 7}Li, {sup 6}He) and impinged on {sup 58}Ni and {sup 197}Au targets, using the Radioactive Ion Beam (RIB) facility, RIBRAS, installed in the Pelletron Laboratory of the Institute of Physics of the University of São Paulo, Brazil. The elastic angular distribution was obtained in the angular range from 15° to 80° in the center of mass frame. Optical model calculations have been performed using a hybrid potential to fit the experimental data. The total reaction cross section was derived.
Energy Technology Data Exchange (ETDEWEB)
Thisgaard, H.; Elema, D.R.; Jensen, M. [PET and Cyclotron Unit, Nuclear Medicine Department, Odense University Hospital, Sdr. Boulevard 29, DK-5000 Odense, Denmark and Institute of Clinical Research, University of Southern Denmark, Winsloewparken 19, DK-5000 Odense (Denmark); The Hevesy Laboratory, Risoe National Laboratory for Sustainable Energy, Technical University of Denmark, P.O. Box 49, DK-4000 Roskilde (Denmark)
2011-08-15
Purpose: Based on theoretical calculations, the Auger emitter {sup 58m}Co has been identified as a potent nuclide for targeted radionuclide therapy of small tumors. During the production of this isotope, the coproduction of the long-lived ground state {sup 58g}Co is unfortunately unavoidable, as is ingrowth of the ground state following the isomeric decay of {sup 58m}Co. The impact of {sup 58g}Co as a {beta}{sup +}- and {gamma}-emitting impurity should be included in the dosimetric analysis. The purpose of this study was to investigate this critical part of dosimetry based on experimentally determined production yields of {sup 58m}Co and {sup 58g}Co using a low-energy cyclotron. Also, the cellular S-values for {sup 58m}Co have been calculated and are presented here for the first time. Methods: {sup 58m}Co was produced via the {sup 58}Fe(p,n){sup 58m}Co nuclear reaction on highly enriched {sup 58}Fe metal. In addition, radiochemical separations of produced radio-cobalt from {sup nat}Fe target material were performed. The theoretical subcellular dosimetry calculations for {sup 58m}Co and {sup 58g}Co were performed using the MIRD formalism, and the impact of the increasing ground state impurity on the tumor-to-normal-tissue dose ratios (TND) per disintegration as a function of time after end of bombardment (EOB) was calculated. Results: 192 {+-} 8 MBq of {sup 58m}Co was produced in the irradiation corresponding to a production yield of 10.7 MBq/{mu}Ah. The activity of {sup 58g}Co was measured to be 0.85% {+-} 0.04% of the produced {sup 58m}Co activity at EOB. The radio-cobalt yields in the rapid separations were measured to be >97% with no detectable iron contaminations in the cobalt fractions. Due to the unavoidable coproduction and ingrowth of the long-lived ground state {sup 58g}Co, the TND and the potency of the {sup 58m}Co decrease with time after EOB. If a future treatment with a {sup 58m}Co labeled compound is not initiated before, e.g., 21 h after EOB, the
Energy Technology Data Exchange (ETDEWEB)
Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.
1987-11-01
A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na/sup +/, K/sup +/-ATPase ..cap alpha.. subunit was cloned from human placenta and its sequence was identical to that encoding the ..cap alpha.. subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na/sup +/, K/sup +/-ATPase gene from various human tissues and cell lines revealed only one band (approx. = 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) lambdagt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the ..cap alpha.. subunit is on the short is on the short arm (band p11-p13) of chromosome 1.
Nagatsu, K; Suzuki, K
1999-01-01
For the production of sup 3 sup 8 K, excitation functions of the sup 4 sup 0 Ar(p,3n) sup 3 sup 8 K reaction and its accompanying reactions sup 4 sup 0 Ar(p,2pn) sup 3 sup 8 Cl, and sup 4 sup 0 Ar(p,2p) sup 3 sup 9 Cl were measured at the proton energy of 20.5-39.5 MeV to determine the optimum conditions of irradiation. Target cells containing argon gas were prepared using specially developed tools in an argon-replaced glove box. In the sup 4 sup 0 Ar(p,3n) sup 3 sup 8 K, sup 4 sup 0 Ar(p,2pn) sup 3 sup 8 Cl, and sup 4 sup 0 Ar(p,2p) sup 3 sup 9 Cl reactions, the maximum cross sections were 6.7+-0.7, 34+-3.3 and 11+-1.2mbarn at 37.6, 39.5 and 32.0 MeV, respectively, and the saturation thick target yields were calculated to be 560, 2200, and 1300 sup * MBq/mu A, respectively, at an incident energy of 39.5 MeV ( sup * integral yield above 21 MeV).
Energy Technology Data Exchange (ETDEWEB)
Ruiz S, A. [Facultad de Ciencias, UAEM, Toluca, Estado de Mexico (Mexico); Martinez Q, E.; Aguilera R, E.F.; Murillo O, G.; Lizcano C, D.; Gomez C, A. [Departamento de Aceleradores, ININ, 52750 La Marquesa, Estado de Mexico (Mexico)
2007-07-01
The experimental angular distributions of elastic scattering for the projectiles {sup 6}Li, {sup 7}Be, {sup 8}B in {sup 58}Ni were obtained. Using the Optical model with a Woods-Saxon potential form, as much for the real part as for the imaginary one, an adjustment to the experimental data varying only the depth of the imaginary part of the potential is made. A comparison of the results obtained for each projectile is made. (Author)
Energy Technology Data Exchange (ETDEWEB)
Lee, Jae Sung; Nam, Hyun Woo; Lee, Dong Soo; Lee, Sang Kun; Jang, Myoung Jin; Ahn, Ji Young; Park, Kwang Suk; Chung, June Key; Lee, Myung Chul [Seoul National Univ., Seoul (Korea, Republic of)
2000-02-01
Episodic memory is described as an 'autobiographical' memory responsible for storing a record of the events in our lives. We performed functional brain activation study using H{sub 2}{sup 1}5O PET to reveal the neural basis of the encoding and the retrieval of episodic memory in human normal volunteers. Four repeated H{sub 2}{sup 1}5O PET scans with two reference and two activation tasks were performed on 6 normal volunteers to activate brain areas engaged in encoding and retrieval with verbal materials. Images from the same subject were spatially registered and normalized using linear and nonlinear transformation. Using the means and variances for every condition which were adjusted with analysis of covariance, t-statistic analysis were performed voxel-wise. Encoding of episodic memory activated the opercular and triangular parts of left inferior frontal gyrus, right prefrontal cortex, medial frontal area, cingulate gyrus, posterior middle and inferior temporal gyri, and cerebellum, and both primary visual and visual association areas. Retrieval of episodic memory activated the triangular part of left inferior frontal gyrus and inferior temporal gyrus, right prefrontal cortex and medial temporal ares, and both cerebellum and primary visual and visual association areas. The activations in the opercular part of left inferior frontal gyrus and the right prefrontal cortex meant the essential role of these areas in the encoding and retrieval of episodic memeory. We could localize the neural basis of the encoding and retrieval of episodic memory using H{sub 2}{sup 1}5O PET, which was partly consistent with the hypothesis of hemispheric encoding/retrieval asymmetry.
Energy Technology Data Exchange (ETDEWEB)
Longequeue, J P [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires
1963-11-15
This work is made up of two parts. In the first part the differential cross-sections have been determined of the reactions {sup 11}B (p,{alpha}) from 130 to 500 keV thus confirming, at the 163 keV resonance, the (2{sup +}) characteristics of the 16.11 MeV level of {sup 12}C. Furthermore, the experimental results in the neighbourhood of the 163 keV resonance can be explained by the interference of the {sup 12}C levels: 2{sup +} at 16.11 MeV and 1{sup -} at 17.23 MeV for the {alpha}{sub 0}, 2{sup +} at 16.11 MeV and 2{sup -} at 16.58 MeV for the {alpha}{sub 1}. In the second part the ({alpha}{sup -8Be}) disintegration process of {sup 12}C has been studied in the neighbourhood of the 16.11 MeV level. It is shown that, if the ({alpha}{sup -8Be}) mode of disintegration is preponderant outside the E{sub p} = 163 keV resonance, it is also preponderant at this same resonance; a direct disintegration of the {sup 12}C to 3 {alpha}, with an approximate magnitude of 40 per cent has however not been excluded. (author) [French] Ce travail comprend deux parties: Dans la premiere, on a determine la section efficace differentielle des reactions {sup 11}B (p,{alpha}) de 130 a 500 keV, confirmant, a la resonance de 163 keV, les caracteristiques (2{sup +}) du niveau de 16,11 MeV du {sup 12}C. En outre, les resultats experimentaux au voisinage de la resonance de 163 keV sont explicables par l'interference des niveaux du {sup 12}C: 2{sup +} a 16,11 MeV et 1{sup -} a 17,23 MeV pour les {alpha}{sub 0}, 2{sup +} a 16,11 MeV et 2{sup -} a 16,58 MeV pour les {alpha}{sub 1}. Dans la deuxieme partie, on a etudie le mode de desintegration ({alpha}{sup -8Be}) du {sup 12}C au voisinage du niveau de 16,11 MeV. On a montre que, si le mode de desintegration ({alpha}{sup -8Be}) est preponderant en dehors de la resonance E{sub p} = 163 keV, il est egalement preponderant a cette resonance; une desintegration directe en 3{alpha} du {sup 12}C, dont l'ordre de grandeur maximum serait de 40 pour cent, n
Energy Technology Data Exchange (ETDEWEB)
Carette, T; Godefroid, M R, E-mail: tcarette@ulb.ac.be, E-mail: mrgodef@ulb.ac.be [Chimie Quantique et Photophysique, CP160/09, Universite Libre de Bruxelles, Avenue FD Roosevelt 50, B-1050 Brussels (Belgium)
2011-05-28
We present highly correlated multi-configuration Hartree-Fock (MCHF) calculations of the hyperfine structure of the 3p{sup 5} {sup 2}P{sup o}{sub J} levels of {sup 33}S{sup -} and {sup 35,} {sup 37}Cl. We obtain good agreement with observation. The hyperfine structure of the neutral sulphur {sup 33}S 3p{sup 4} {sup 3}P{sub J} lowest multiplet that has never been measured to the knowledge of the authors is also estimated theoretically. We discuss some interesting observations made on the description of the atomic core in MCHF theory.
Energy Technology Data Exchange (ETDEWEB)
Baosheng, Yu; Qingbiao, Shen; Dunjiu, Cai [Chinese Nuclear Data Center, Beijing, BJ (China)
1996-06-01
The neutron monitor cross sections for {sup 59}Co(n,x){sup 56,57,58}Co, {sup 52,54,56}Mn, {sup 59}Fe reactions were evaluated based on recent experimental data and theoretical calculations from threshold energy to 100 MeV. (8 figs.).
Ischemic stroke progress evaluation by {sup 31}P NMR-based metabonomic of human serum
Energy Technology Data Exchange (ETDEWEB)
Grandizoli, Caroline W.P.S.; Barison, Andersson, E-mail: andernmr@ufpr.br [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Departamento de Quimica. Centro de RMN; Lange, Marcos C.; Novak, Felipe T. M. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Hospital de Clínicas. Divisao de Neurologia; Campos, Francinete R. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Departmento de Farmacia
2014-07-01
In this work, chemometric analyses over {sup 31}P{"1"H} NMR (nuclear magnetic resonance) spectra of human blood serum permitted to discriminated ischemic stroke patients from health individuals due to changes in the chemical composition of phosphorus-containing compounds. These results indicate that {sup 31}P NMR-based metabonomic allowed insights over the mechanism triggered by ischemic stroke. (author)
Central {sup 112}Sn + {sup 58}Ni, {sup 124}Sn + {sup 64}Ni collisions in the Reverse Experiment
Energy Technology Data Exchange (ETDEWEB)
Geraci, E.; Bruno, M.; D' Agostino, M.; Vannini, G. [Bologna Univ., Dipartimento di Fisica (Italy); Anzalone, A.; Baran, V.; Bonasera, A.; Cavallaro, S.; Colonna, M.; Di Toro, M.; Giustolisi, F.; Iacono-Manno, M.; La Guidara, E.; Lanzalone, G.; Porto, F.; Russotto, P.; Maiolino, C.; Sperduto, M.I. [Catania Univ., INFN-LNS and Dipartimento di Fisica e Astronomia (Italy); Alderighi, M.; Bartolucci, M.; Sechi, G. [INFN and Istituto di Fisica Cosmica, CNR, Milano (Italy); Auditore, L.; Trifiro, A.; Rimarchi, M. [Messina Univ., INFN and Dipartimento di Fisica (Italy); Berceanu, I.; Petrovici, M.; Simion, S. [Institute for Physics and Nuclear Engineering, Bucharest (Romania); Guazzoni, P.; Russo, S.; Manfredi, G.; Zetta, L. [Milano Univ., INFN and Dipartimento di Fisica (Italy); Blicharska, J.; Grzeszczuk, A.; Kowalski, S.; Paduszynski, T.; Zipper, W. [Silesia Univ., Institute of Physics, Katowice (Poland); Borderie, B.; Le Neindre, N.; Rivet, M.F. [Institut de Physique nucleaire, IN2P3-CNRS, 91 - Orsay (France); Bougault, B.R.; Steckmeyer, J.C. [Caen Univ., LPC, ENSI, 14 (France); Brzychczyk, J.; Majka, Z. [Jagellonian Univ., M.Smoluchowski Institute of Physics, Cracow (Poland); Cardella, G.; Filippo, E. de; Lanzano, G.; Li, S.; Lo Nigro, S.; Pagano, A.; Papa, M.; Pirrone, S.; Politi, G. [Catania Univ., INFN and Dipartimento di Fisica e Astronomia (Italy); Chbihi, A.; Wieleczko, J.P. [GANIL, CEA, IN2P3-CNRS, 14 - Caen (France); Cibor, J. [H. Niewodniczanski Institute of Nuclear Physics, Cracov (Poland); Guinet, D. [Institut de Physique nucleaire, IN2P3-CNRS, 69 - Lyon (France); Wu, H.; Xiao, Z. [Institute of Modern Physics Lanzhou (China); Piasecki, E. [Warsaw Univ., Institute of Experimental Physics (Poland); Rosato, E.; Vigilante, M. [Napoli Univ., INFN and Dipartimento di Fisica (Italy); Wilczynski, J. [Institute for Nuclear Studies, Otwock-Swierk (Poland)
2003-07-01
{sup 112}Sn + {sup 58}Ni and {sup 124}Sn + {sup 64}Ni reactions at 35 AMeV incident energy were studied using the 688 Si-CsI(Tl) telescopes of the forward part (1 {<=} {theta} {<=} 30 degrees) of CHIMERA multi-detector. The most central part of the total measured cross section was selected by means of a multidimensional analysis of the experimental observables. The characteristics of the source formed in the central collisions, as size, temperature and volume, were inspected. The detected isotopes of light fragments (3 {<=} Z {<=} 8) provided information on breakup temperatures of the emitting sources. The space-time structure of these sources was deduced from the two-fragment velocity correlation functions. Isotope yield ratios were used to extract the freeze-out unbound relative neutron and proton densities and the neutron to proton density of both studied reactions, indicating for a possible isospin distillation mechanism. (authors)
Energy Technology Data Exchange (ETDEWEB)
Geraci, E.; Alderighi, M.; Anzalone, A.; Auditore, L.; Baran, V.; Bartolucci, M.; Berceanu, I.; Blicharska, J.; Bonasera, A.; Borderie, B.; Bougault, R.; Bruno, M.; Brzychczyk, J.; Cardella, G.; Cavallaro, S.; Chbihi, A.; Cibor, J.; Colonna, M.; D' Agostino, M.; De Filippo, E.; Di Toro, M.; Giustolisi, F.; Grzeszczuk, A.; Guazzoni, P.; Guinet, D.; Iacono-Manno, M.; Kowalski, S.; La Guidara, E.; Lanzalone, G.; Lanzano, G.; Le Neindre, N.; Li, S.; Lo Nigro, S.; Maiolino, C.; Majka, Z.; Manfredi, G.; Paduszynski, T.; Pagano, A.; Papa, M.; Petrovici, M.; Piasecki, E.; Pirrone, S.; Politi, G.; Pop, A.; Porto, F.; Rivet, M.F.; Rosato, E.; Russo, S.; Russotto, P.; Sechi, G.; Simion, V.; Sperduto, M.L.; Steckmeyer, J.C.; Trifiro, A.; Trimarchi, M.; Vannini, G.; Vigilante, M.; Wieleczko, J.P.; Wilczynski, J.; Wu, H.; Xiao, Z.; Zetta, L.; Zipper, W
2004-04-05
{sup 124}Sn+{sup 64}Ni and {sup 112}Sn+{sup 58}Ni reactions at 35 AMeV incident energy were studied with the forward part of CHIMERA multi-detector. The most central collisions were selected by means of a multidimensional analysis. The characteristics of the source formed in the central collisions, as size, temperature and volume, were inspected. The measured isotopes of light fragments (3 {<=} Z {<=} 8) were used to examine isotope yield ratios that provide information on the free neutron to proton densities.
Energy Technology Data Exchange (ETDEWEB)
Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA)
1977-09-12
A model in which Q/sub 1/ and Q/sub 2/ resonance contributions add coherently to a Gaussian background is shown to reproduce the mass dependence of the Jsup(P)=1/sup +/K*..pi.. and rhoK partial waves in K/sup + -/p..-->..K/sup + -/..pi../sup +/..pi../sup -/p at 13 GeV/c. Through a fit to the data, the mass and total width for Q/sub 1/ are found to be m=1289+-3+-(25) MeV, GAMMA=150+-9(+-70) MeV and for Q/sub 2/, m=1404+-3(+-10) MeV, GAMMA=142+-4(+-15) MeV, where estimated systematic errors are given in parentheses. While a significant background is required for the 1/sup +/K*..pi.. system, none is needed for the 1/sup +/rhoK system.
{sup 31}P MR spectroscopic measurement of intracellular pH in normal human hearts
Energy Technology Data Exchange (ETDEWEB)
Kwon, Jae Hyun; Lee, Hui Joong; Jang, Yong Min [Kyungpook National Univ., Taegu (Korea, Republic of)] [and others
2002-05-01
To assess the usefulness of intracellular pH (pHi), calculated by determining the shift of a high-energy metabolite such as inorganic phosphate (Pi) of {gamma}-ATP after performing MRS with ECG-gated two-dimensional {sup 31}P CSI (chemical shift imaging), as a parameter for the overall state of the intracellular milieu. Proto decoupled {sup 31}P CSI was performed on a 1.5-T scanner using a {sup 1}H{sup 31}P dual-tuned surface coil. Cardiac MRS data were obtained from eight normal volunteers aged 24-32 years with no history of heart disease. From the spectra obtained from several regions of the heart, peack position and peak area were estimated. The metabolic ratios of {alpha}-, {beta}-, {gamma}-ATP, PCr, Pi, phosphodiester and diphosphoglycerate were calculated, and pHi was estimated from the chemical shift of Pi and {gamma}-ATP resonance. We then compared the data for the anterior myocardium with those previously published. The major phosphorous metabolites identified in these human hearts were as follows: PCr, at -0.1 to +0.1 ppm; three phosphate peaks from ATP, with a chemical shift centered at about -2.7 ppm ({gamma}-ATP), -7.8 ppm ({alpha}-ATP), and -16.3 ppm ({beta}-ATP); and phosphodiester (PDE) at 2-3 ppm, inorganic phosphate (Pi) at 4.5-5.4 ppm, and diphosphoglycerate (DPG) at 5.4-6.3 ppm. The PCr/{beta}-ATP ratio was 2.20{+-}0.17 and the PDE/{beta}-ATP ratio, 1.04{+-}0.09 pHi readings were 7.31{+-}0.23 (calculated by the shift of Pi) and 6.81{+-}0.20 (calculated by the shift of {gamma}-ATP). Pi/PCR was 0.539, a ratio higher than that mentioned in previously published reports. The measurement of intracellular metabolism was affected by various kinds of factors. We believe, however, that pHi readings indicate the overall state of the cardiac intracellular milieu. An unexpected pHi readings, seen at MRS, may reflect errors in the MR procedure itself and, or in the analytical method.
Energy Technology Data Exchange (ETDEWEB)
Morcelle, V.; Lichtenthaeler, R.; Guimaraes, V.; Lepine-Szily, A.; Faria, P.N.; Camargo, O.; Barioni, A.; Mendes Junior, D.R.; Condori, R.P.; Zamora, J.C.; Morais, M.C.; Pires, K.C.C.; Scarduelli, V.; Leistenschneider, E.; Zagatto, V.A.B. [Universidade de Sao Paulo (USP), SP (Brazil); Shorto, J.M.B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2011-07-01
Full text: Elastic scattering angular distributions and total reaction cross sections of the neutron halo projectile nucleus {sup 6}He on a {sup 58}Ni target at energies around the Coulomb barrier are presented. The measurements were obtained at pelletron accelerator at the University of Sao Paulo (Brazil) and the {sup 6}He radioactive secondary beam has been produced in the RIBRAS system through the {sup 9}Be({sup 7}Li, {sup 6}He){sup 10}B production reaction. The elastic scattering angular distributions obtained at E{sub Lab}= 12.5, 16.5 and 21.0 MeV, have been analysed by using optical model, using the Sao Paulo and Wood-Saxon potentials and the respective total reaction cross sections have been obtained. The total reaction cross sections have been reduced using the Wong formula and the UFF equation and are compared with other stable and unstable systems from the literature. (author)
Energy Technology Data Exchange (ETDEWEB)
Xu, Hao [Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Xie, Ju-Jun [Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); Institute of Theoretical Physics, Chinese Academy of Sciences, State Key Laboratory of Theoretical Physics, Beijing (China); Liu, Xiang [Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Institute of Theoretical Physics, Chinese Academy of Sciences, State Key Laboratory of Theoretical Physics, Beijing (China)
2016-04-15
We study the charmonium p anti p → ψ(3770)π{sup 0} reaction using the effective Lagrangian approach where the contributions from well-established N* states are considered, and all parameters are fixed in the process of e{sup +}e{sup -} → p anti pπ{sup 0} at center of mass energy √(s) = 3.773 GeV. The experimental data on the line shape of the mass distribution of the e{sup +}e{sup -} → p anti pπ{sup 0} can be well reproduced. Based on the study of e{sup +}e{sup -} → p anti pπ{sup 0}, the total and differential cross sections of the p anti p → ψ(3770)π{sup 0} reaction are predicted. At the same time we evaluated also the cross sections of the p anti p → ψ(3686)π{sup 0} reaction. It is shown that the contribution of the nucleon pole to this reaction is largest close to the reaction threshold. However, the interference between nucleon pole and the other nucleon resonance can still change the angle distributions significantly. Those theoretical results may be tested by the future experiments at PANDA. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Rehm, K.E.; Jiang, C.L.; Esbensen, H. [and others
1995-08-01
High resolution experiments performed during the past few years demonstrated that the various reaction modes occurring in heavy ion collisions can strongly influence each other. This interrelation of the different reaction modes brings a nuclear structure dependence to the fusion and deep-inelastic channels that were previously described in the framework of pure statistical models. In order to fully understand the interrelation between these reaction channels, a complete set of measurements including elastic and inelastic scattering, few-nucleon transfer and fusion is required. In continuation of our earlier measurements of the fusion cross sections in the system {sup 58,64}Ni + {sup 92,100}Mo we finished the studies of the quasielastic process in these systems. The experiments were done in inverse reaction kinematics using the split-pole spectrograph with its hybrid focal-plane detector for particle identification. The experiments with {sup 100}Mo beams were performed previously. First test runs with {sup 92}Mo showed the possible interference with {sup 98}Mo ions which could be eliminated by using the 13{sup +} charge state from the ECR source. The data from these experiments were completely analyzed. The smallest transfer cross sections are observed for the systems {sup 64}Ni + {sup 100}Mo and {sup 58}Ni + {sup 92}Mo, i.e., the most neutron-rich and neutron-deficient systems, respectively. For the other systems, {sup 64}Ni + {sup 92}Mo and {sup 58}Ni + {sup 100}Mo, the transfer cross sections at energies close to the barrier are about of equal magnitude. This observation does not correlate with the deviation of the experimental fusion cross sections from the coupled-channels predictions. While for {sup 58}Ni + {sup 100}Mo discrepancies between the experimental and theoretical fusion cross sections are observed, the system {sup 64}Ni + {sup 92}Mo which shows about the same transfer yields, is quite well described by the coupled-channels calculations.
Measurements of fusion cross sections in the systems {sup 58,64}Ni +, {sup 78,86}Kr
Energy Technology Data Exchange (ETDEWEB)
Rehm, K.E.; Jiang, C.L.; Esbensen, H. [and others
1995-08-01
We investigated the nuclear structure dependence of the sub-barrier fusion enhancement in heavy-ion induced reactions by studying the systems {sup 58,64}Ni + {sup 78,86}Kr at energies in the vicinity of the Coulomb barrier. These {sup 78,86}Kr selected because, similar to the Mo case discussed isotopes were above, there are strong changes in nuclear structure as a function of the neutron number. However, contrary to Mo, where the {open_quotes}softness{close_quotes} of the nucleus increases with higher neutron number, the most collective nucleus for the Kr case is the neutron-deficient {sup 78}Kr. The experiment was performed with Kr beams from the positive-ion injector using enriched {sup 78,86}Kr gas in the ECR ion source. The separation of evaporation residues from the elastically-scattered particles was achieved by using their difference in time-of-flight and magnetic rigidity in the gas-filled spectrograph. The excitation functions for the four systems were compared to coupled-channels calculations including inelastic excitations of one- and two-phonon states in projectile and target. For systems involving {sup 86}Kr, good agreement between theory and experiment is obtained, while for {sup 78}Kr + {sup 58,64}Ni an additional enhancement of the cross sections persisted at the lowest energies. It was found that this fusion enhancement correlates with the nuclear structure of the individual nucleus. Characterizing the structure of vibrational even-even nuclei by their restoring force parameter C{sub 2}, which can be calculated from the energy of the lowest 2{sup +} state and the associated B(E2) value, one observes that nuclei with small C{sub 2} values exhibit a large sub-barrier fusion enhancement, while nuclei with high values of C{sub 2} (usually closed-shell nuclei), show smaller fusion yields.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Energy Technology Data Exchange (ETDEWEB)
Tsaris, Aristedis [Florida Intl Univ., Miami, FL (United States)
2016-02-22
Apart from the mesons that the constituent quark model predicts, QCD allows for additional states beyond the qq system. Previous experiments have performed partial wave analysis on pion-production data and claim observation of an exotic J<sup>PC> = 1<sup>-+> state decaying via p-π. The g12 experiment took place at Jefferson Lab using the CLAS spectrometer, a liquid hydrogen target was used and a tagged photon beam. By studying the reactions γp → n<sup>-π+π+π-> and γp → Δ<sup>++π+π-π->, the photoproduction of mesons decaying to 3-pi was studied using two different but complimentary channels. Events are selected with low four-momentum transfer to the baryon, in order to enhance one pion exchange production. For both 3-pi systems the data exhibit two intermediate decays, p-pi and f2π. For the γp → n<sup>-π+π+π-> reaction over 600k events were acquired resulting in the largest 3 photoproduction dataset to date. The exotic J<sup>PC> = 1<sup>-+> partial wave does not show resonant behavior and more so it is strongly consistent with a non-resonant non-interfering wave relative to a resonant π2(1670). Furthermore, the partial wave analysis shows production of the a2(1320) and π2(1670) mesons. For the first time we report observation of a photoproduced a1(1260) meson. For the γp → Δ<sup>++π+π-π-> reaction nearly 350k events were analyzed. A partial wave analysis was performed for the first time on this channel. The a1(1260), a2(1320), and the 2(1670) mesons were observed. Observation of the a1(1260) confirms the result first reported in γp → n<sup>-π+π+π-> reaction.
Proton form factor ratio, μpGEP/GMP> from double spin asymmetry
Energy Technology Data Exchange (ETDEWEB)
Habarakada Liyanage, Anusha Pushpakumari [Hampton Univ., Hampton, VA (United States)
2013-08-01
The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q<sup>2sup> between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q<sup>2sup> = 5.66 (GeV/c)<sup>2sup> using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio G<sup>pE/Gp>M at high-momentum transfer, Q<sup>2sup>= 5.66 (GeV/c)<sup>2sup>. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract G<sup>pE/Gp>M at low Q<sup>2sup>= 2.06 (GeV/c)<sup>2sup>. This alternative measurement of G<sup>pE/Gp>M has verified and confirmed the dramatic discrepancy at high Q<sup>2sup> between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q<sup>2sup> = 2
Excitation of the giant quadrupole resonance in /sup 58/Ni with /sup 20/Ne
Bohlen, H G; Ingold, G; Lettau, H; Ossenbrink, H; von Oertzen, W
1981-01-01
The heavy-ion induced excitation of the quadrupole resonance in /sup 58/Ni has been studied with /sup 20/Ne beams of 14.5 and 19.6 MeV/N incident energy. The broad resonance structure is clearly observed; the strength exhausts 44% and 60% of the energy weighted sum rule (EWSR) at the two incident energies, respectively. The background is partly explained by a three-body reaction mechanism, which is based on the one-nucleon pick-up reaction into unbound states followed by one- nucleon emission. The remaining part is interpreted as inelastic excitation of other multipoles. (11 refs).
Isoscaling in central {sup 124}Sn+{sup 64}Ni, {sup 112}Sn+{sup 58}Ni collisions at 35 A MeV
Energy Technology Data Exchange (ETDEWEB)
Geraci, E.; Bruno, M.; D' Agostino, M. E-mail: dagostino@bo.infn.it; De Filippo, E.; Pagano, A.; Vannini, G.; Alderighi, M.; Anzalone, A.; Auditore, L.; Baran, V.; Barna, R.; Bartolucci, M.; Berceanu, I.; Blicharska, J.; Bonasera, A.; Borderie, B.; Bougault, R.; Brzychczyk, J.; Cardella, G.; Cavallaro, S.; Chbihi, A.; Cibor, J.; Colonna, M.; De Pasquale, D.; Di Toro, M.; Giustolisi, F.; Grzeszczuk, A.; Guazzoni, P.; Guinet, D.; Iacono-Manno, M.; Italiano, A.; Kowalski, S.; La Guidara, E.; Lanzalone, G.; Lanzano, G.; Le Neindre, N.; Li, S.; Lo Nigro, S.; Maiolino, C.; Majka, Z.; Manfredi, G.; Paduszynski, T.; Papa, M.; Petrovici, M.; Piasecki, E.; Pirrone, S.; Politi, G.; Pop, A.; Porto, F.; Rivet, M.F.; Rosato, E.; Russo, S.; Russotto, P.; Sechi, G.; Simion, V.; Sperduto, M.L.; Steckmeyer, J.C.; Trifiro, A.; Trimarchi, M.; Vigilante, M.; Wieleczko, J.P.; Wilczynski, J.; Wu, H.; Xiao, Z.; Zetta, L.; Zipper, W
2004-02-23
{sup 124}Sn+{sup 64}Ni and {sup 112}Sn+{sup 58}Ni reactions at 35 A MeV incident energy were studied by using the 688 Si-CsI telescopes of the forward part (1 deg. {<=}{theta}{sub lab}{<=}30 deg.) of CHIMERA multi-detector. The most central part, 1% of the total measured cross section was selected by means of a multidimensional analysis of the experimental observables. The detected isotopes of light fragments (3{<=}Z{<=}8) provided information on breakup temperatures of the emitting sources. The space-time structure of these sources was deduced from fragment correlations. An odd-even effect in the fragment production, enhanced by the isospin of the entrance channel, was observed. Freeze-out unbound neutron-to-proton relative densities for both studied reactions have been deduced, indicating for a possible isospin distillation mechanism related to a phenomenon of the liquid-gas phase transition in asymmetric systems.
gamma-decay of resonance-like structure observed in sup 3 sup 0 Si(p,gamma) sup 3 sup 1 P reaction
Kachan, A S; Korda, L P; Mishchenko, V M; Korda, V Y
2002-01-01
gamma-Decay of a resonance-like structure observed in the reaction sup 3 sup 0 Si (p, gamma) sup 3 sup 1 P in the energy region E sub p = 1.4 - 2.7 MeV of accelerated protons is studied. The M1 resonance built on the ground state of sup 3 sup 1 P is identified. The position of the M1 resonance is explained taking into account pairing forces.
Measurement of the {sup 26}Si(p,γ){sup 27}P cross section via the Coulomb dissociation of {sup 27}P
Energy Technology Data Exchange (ETDEWEB)
Marganiec, Justyna [TU Darmstadt (Germany); EMMI-GSI Darmstadt (Germany); GSI Darmstadt (Germany); Beceiro-Novo, Saul; Cortina Gil, Dolores [Universidade de Santiago de Compostela (Spain); Typel, Stefan; Heil, Michael; Suemmerer, Klaus [GSI Darmstadt (Germany); Wimmer, Christine [Goethe-Universitaet, Frankfurt am Main (Germany); Aumann, Thomas [TU Darmstadt (Germany); GSI Darmstadt (Germany); Collaboration: R3B-Collaboration
2015-07-01
The reaction {sup 26}Si(p,γ){sup 27}P can, under certain conditions, be significant in the context of the astrophysical rp process. Since {sup 26}Si has a short half-life, the reaction was investigated via the time-reversed process, the Coulomb dissociation (CD) of {sup 27}P into {sup 26}Si and proton. The differential CD cross sections can be converted to radiative-capture cross sections via virtual-photon theory and detailed balance. The experiment was performed at the LAND/R{sup 3}B setup at GSI Darmstadt. The secondary {sup 27}P beam was produced by fragmentation of {sup 36}Ar and impinged onto a Pb target. The incoming beam particles and outgoing reaction products were identified and tracked event by event. Corrections were applied to select only transitions directly to the {sup 26}Si ground state and to remove contributions from nuclear processes and reactions in layers outside the target. The results are compared to potential-model calculations of the CD of {sup 27}P. Consequences for the astrophysical rp process are discussed.
In-beam γ-ray Spectroscopy of {sup 30}P via the {sup 28}Si({sup 3}He,pγ){sup 30}P Reaction
Energy Technology Data Exchange (ETDEWEB)
Mcneice, E.; Setoodehnia, K. [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Singh, B., E-mail: ndgroup@mcmaster.ca [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Abe, Y. [Institute of Physics, University of Tsukuba, Tennodai 1-1-1, Tsukuba, Ibaraki 305-8577 (Japan); Binh, D.N. [Center for Nuclear Study (CNS), the University of Tokyo, Wako Branch at RIKEN, Wako, Saitama 351-0198 (Japan); Chen, A.A.; Chen, J. [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Cherubini, S. [INFN-Laboratori Nazionali del Sud and Dipartimento di Fisica ed Astronomia, Università di Catania, 95123 Catania (Italy); Center for Nuclear Study (CNS), the University of Tokyo, Wako Branch at RIKEN, Wako, Saitama 351-0198 (Japan); Fukuoka, S. [Institute of Physics, University of Tsukuba, Tennodai 1-1-1, Tsukuba, Ibaraki 305-8577 (Japan); Hashimoto, T. [Center for Nuclear Study (CNS), the University of Tokyo, Wako Branch at RIKEN, Wako, Saitama 351-0198 (Japan); Hayakawa, T. [Japan Atomic Energy Agency (JAEA), Tokai–mura, Ibaraki 319-1195 (Japan); Ishibashi, Y.; Ito, Y. [Institute of Physics, University of Tsukuba, Tennodai 1-1-1, Tsukuba, Ibaraki 305-8577 (Japan); Kahl, D. [Center for Nuclear Study (CNS), the University of Tokyo, Wako Branch at RIKEN, Wako, Saitama 351-0198 (Japan); Komatsubara, T. [Institute of Physics, University of Tsukuba, Tennodai 1-1-1, Tsukuba, Ibaraki 305-8577 (Japan); Kubono, S. [Nishina Center, the Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-0198 (Japan); Moriguchi, T.; Nagae, D.; Nishikiori, R.; Niwa, T. [Institute of Physics, University of Tsukuba, Tennodai 1-1-1, Tsukuba, Ibaraki 305-8577 (Japan); and others
2014-06-15
The level structure of {sup 30}P up to 8.25 MeV was investigated via in-beam γ-ray spectroscopy using the {sup 28}Si({sup 3}He,pγ){sup 30}P reaction at 9 MeV at the University of Tsukuba Tandem Accelerator Complex in Japan. An energy level scheme was deduced from γ-γ coincidence measurements. 47 new transitions have been observed from the previously known states (mostly resonances), thereby reducing the uncertainties in the excitation energies of 17 states from 3 to 10 keV to values of < 1 keV. Furthermore, spin assignments based on measurements of γ-ray angular distributions and γ-γ directional correlation of oriented nuclei (DCO ratios) were made for several observed levels of {sup 30}P.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
Energy Technology Data Exchange (ETDEWEB)
Devereux, M.J.
1979-05-01
Elastic pion scattering from /sup 9/Be, /sup 28/Si, /sup 58/Ni, and /sup 208/Pb at 162 MeV is analyzed and compared with an optical model theory which incorporates a pion--nucleon range. Excellent fits to the data are obtained in all but one case. The fitted values of the pion--nucleon range, as well as other fitted values are listed. 108 references.
Critical role of CDK11p58 in human breast cancer growth and angiogenesis
International Nuclear Information System (INIS)
Chi, Yayun; Huang, Sheng; Peng, Haojie; Liu, Mengying; Zhao, Jun; Shao, Zhiming; Wu, Jiong
2015-01-01
A capillary network is needed in cancer growth and metastasis. Induction of angiogenesis represents one of the major hallmarks of cancer. CDK11 p58 , a Ser/Thr kinase that belongs to the Cell Division Cycle 2-like 1 (CDC2L1) subfamily is associated with cell cycle progression, tumorigenesis, sister chromatid cohesion and apoptotic signaling. However, its role in breast cancer proliferation and angiogenesis remains unclear. Tumorigenicity assays and blood vessel assessment in athymic mice were used to assess the function of CDK11 p58 in tumor proliferation and angiogenesis. CCK-8 assay was used to detect breast cancer cell growth. Immunohistochemistry was used to detect the expression of vascular endothelial growth factor (VEGF), CD31 and CD34 in CDK11 positive patient breast cancer tissues. Dual-Luciferase array was used to analyze the function of CDK11 p58 in the regulation of VEGF promoter activity. Western blot was used to detect related protein expression levels. CDK11 p58 inhibited breast cancer growth and angiogenesis in breast cancer cells and in nude mice transplanted with tumors. Immunohistochemistry confirmed that CDK11 p58 was negatively associated with angiogenesis-related proteins such as VEGF, CD31 and CD34 in breast cancer patients. Real-time PCR and dual-luciferase assay showed CDK11 p58 inhibited the mRNA levels of VEGF and the promoter activity of VEGF. As CDK11 p58 is a Ser/Thr kinase, the kinase-dead mutant failed to inhibit VEGF mRNA and promoter activity. Western blot analysis showed the same pattern of related protein expression. The data suggested angiogenesis inhibition was dependent on CDK11 p58 kinase activity. This study indicates that CDK11 p58 inhibits the growth and angiogenesis of breast cancer dependent on its kinase activity. The online version of this article (doi:10.1186/s12885-015-1698-7) contains supplementary material, which is available to authorized users
Energy Technology Data Exchange (ETDEWEB)
Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)
2003-09-01
Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor
Energy Technology Data Exchange (ETDEWEB)
Griffin, G.D.; Yang, W.K.; Novelli, G.D.
1976-01-01
Transfer ribonucleic acid (tRNA) profiles in human lymphocytes stimulated by various mitogens have been compared with profiles from nonstimulated cells and from leukemic cells using reversed-phase chromatography. Comparisons of (/sup 3/H)- or (/sup 11/C)uridine- or (/sup 32/P)phosphate-labeled tRNAs showed that the greatest changes in tRNA composition upon phytohemagglutinin (PHA) stimulation occurred in the first 8 h after mitogen addition. Stimulation of lymphocytes by pokeweed mitogen, anti-human immunoglobulin, or bacterial lipopolysaccharide resulted in tRNA species which showed distinct differences from each other and also from the tRNAs produced by phytohemagglutinin stimulation. Leukemic lymphocyte tRNAs showed the most extensive differences in profile when compared with chromatograms from non-neoplastic cells stimulated by a variety of mitogens. Specific isoaccepting species of tyrosyl-, aspartyl-, and phenylalanyl-tRNAs were also compared in PHA-stimulated and resting lymphocytes and no differences were found. When these same species were studied in leukemic cells, tyrosyl-tRNA profiles were shifted to elute at a lower salt concentration, while the aspartyl-tRNA profile showed a new peak not present in noncancerous cells.
p27{sup Kip1} inhibits tissue factor expression
Energy Technology Data Exchange (ETDEWEB)
Breitenstein, Alexander, E-mail: alexander.breitenstein@usz.ch [Cardiology, University Heart Center, University Hospital Zurich (Switzerland); Cardiovascular Research, Physiology Institute, University of Zurich (Switzerland); Center for Integrative Human Physiology (ZHIP), University of Zurich (Switzerland); Akhmedov, Alexander; Camici, Giovanni G.; Lüscher, Thomas F.; Tanner, Felix C. [Cardiology, University Heart Center, University Hospital Zurich (Switzerland); Cardiovascular Research, Physiology Institute, University of Zurich (Switzerland); Center for Integrative Human Physiology (ZHIP), University of Zurich (Switzerland)
2013-10-04
Highlights: •p27{sup Kip1}regulates the expression of tissue factor at the transcriptional level. •This inhibitory effect of p27{sup Kip1} is independently of its cell regulatory action. •The current study provides new insights into a pleiotrophic function of p27{sup Kip1}. -- Abstract: Background: The cyclin-dependent kinase inhibitor (CDKI) p27{sup Kip1} regulates cell proliferation and thus inhibits atherosclerosis and vascular remodeling. Expression of tissue factor (TF), the key initator of the coagulation cascade, is associated with atherosclerosis. Yet, it has not been studied whether p27{sup Kip1} influences the expression of TF. Methods and results: p27{sup Kip1} overexpression in human aortic endothelial cells was achieved by adenoviral transfection. Cells were rendered quiescent for 24 h in 0.5% fetal-calf serum. After stimulation with TNF-α (5 ng/ml), TF protein expression and activity was significantly reduced (n = 4; P < 0.001) in cells transfected with p27{sup Kip1}. In line with this, p27{sup Kip1} overexpression reduced cytokine-induced TF mRNA expression (n = 4; P < 0.01) and TF promotor activity (n = 4; P < 0.05). In contrast, activation of the MAP kinases p38, ERK and JNK was not affected by p27{sup Kip1} overexpression. Conclusion: This in vitro study suggests that p27{sup Kip1} inhibits TF expression at the transcriptional level. These data indicate an interaction between p27{sup Kip1} and TF in important pathological alterations such as atherosclerosis and vascular remodeling.
Study of the D{sup 0}p amplitude in Λ{sub b}{sup 0}→D{sup 0}pπ{sup −} decays
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Ajaltouni, Z. [Clermont Université, Université Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Collaboration: The LHCb collaboration; and others
2017-05-05
An amplitude analysis of the decay Λ{sub b}{sup 0}→D{sup 0}pπ{sup −} is performed in the part of the phase space containing resonances in the D{sup 0}p channel. The study is based on a data sample corresponding to an integrated luminosity of 3.0 fb{sup −1} of pp collisions recorded by the LHCb experiment. The spectrum of excited Λ{sub c}{sup +} states that decay into D{sup 0}p is studied. The masses, widths and quantum numbers of the Λ{sub c}(2880){sup +} and Λ{sub c}(2940){sup +} resonances are measured. The constraints on the spin and parity for the Λ{sub c}(2940){sup +} state are obtained for the first time. A near-threshold enhancement in the D{sup 0}p amplitude is investigated and found to be consistent with a new resonance, denoted the Λ{sub c}(2860){sup +}, of spin 3/2 and positive parity.
Energy Technology Data Exchange (ETDEWEB)
Bordenave-Montesquieu, A.; Benoit-Cattin, P.; Gleizes, A.; Merchez, H.
1976-02-01
Absolute values of Shore and Fano parameters are tabulated for the helium atom 2s/sup 2/ /sup 1/S, 2p/sup 2/ /sup 1/D, and 2s 2p /sup 1/P resonances produced by a proton beam. Observations were made on the spectra of ejected electrons. The important variation of the shape of the resonances with ejection angle is illustrated for E/sub p/ = 100 keV; the variation with proton energy is shown at 30/sup 0/.
Benkheiri, P; D'Almagne, B; De Rosny, G; Eisenstein, B I; Ferrer, A; Fleury, P; Jacholkowski, A; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Thénard, J M; Treille, D; Volte, A; Yoshida, H
1977-01-01
The backward production of mesons is studied in the reaction pi /sup - /p to p rho /sup -/. The differential cross section and the rho /sup - / density matrix are obtained using a Monte Carlo analysis of high statistics CERN experimental data on pi /sup -/p to p pi /sup -/ pi /sup 0/ reactions at 9 and 12 GeV/c. (10 refs).
International Nuclear Information System (INIS)
Arai, Eiichi; Ogawa, Masao
1976-01-01
Differential cross sections were measured at four angles for proton scattering on sup(58,60,62)Ni at energies from 3.0 to 4.0 MeV by using a high-resolution beam from the Tokyo Institute of Technology 4 MV Van de Graaff. An overall resolution of 400 eV (FWHM) was realized using thin solid targets. (author)
Energy Technology Data Exchange (ETDEWEB)
Estabrooks, P [McGill Univ., Montreal, Quebec (Canada); Carnegie, R K [Carleton Univ., Ottawa, Ontario (Canada); Martin, A D [Durham Univ. (UK); Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S. [Stanford Linear Accelerator Center, Calif. (USA)
1978-02-27
An elastic K..pi.. partial-wave analysis is presented. It is based on high-statistics data for the reactions K/sup + -/p ..-->.. K/sup + -/..pi../sup +/n and K/sup + -/p ..-->.. K/sup + -/..pi../sup -/..delta../sup + +/ at 13 GeV obtained in a spectrometer experiment performed at SLAC. For each reaction, a t-dependent parametrization of the production amplitudes provides information on both the K..pi.. mass dependence of the production mechanisms and on K..pi.. scattering. Knowledge of the t-dependence then allows a calculation of the K..pi.. partial-wave amplitudes for K..pi.. masses from 0.7 to 1.9 GeV. The results of such analyses using data for (i) the neutral recoil reactions, (ii) the ..delta../sup + +/ recoil reactions, and (iii) both neutron and ..delta../sup + +/ recoil reactions simultaneously are presented.
Directory of Open Access Journals (Sweden)
Jan Oleszczuk
2012-05-01
Full Text Available The aim of our study was to estimate the surface expressions of CD95 (APO-1/Fas antigen and the intracellular expressions of anti-apoptotic protein Bcl-2 and pro-apoptotic protein Bax in CD4<sup>+>CD25<sup>+FoxP3<sup>+> T regulatory lymphocytes (Tregs as well as the percentage of CD8<sup>+>CD28<sup>+> T cytotoxic cells in peripheral blood of patients with pre-eclampsia in comparison with healthy pregnant women in the third trimester of physiological pregnancy. Twenty-four women with pre-eclampsia and 20 normal third trimester pregnant women were included in the study. The lymphocytes were isolated from peripheral blood samples and labeled with monoclonal antibodies. The expressions of surface antigens and intracellular proteins were estimated using flow cytometry. The population of CD4<sup>+>CD25<sup>+FoxP3<sup>+> Treg cells was significantly lower in peripheral blood of patients with pre-eclampsia when compared to normal third trimester pregnant women. The percentages of CD4<sup>+>CD25<sup>+FoxP3<sup>+> Treg cells that express Bcl-2 protein were significantly lower in peripheral blood of patients with pre-eclampsia when compared to healthy pregnant women, whereas the percentages of CD4<sup>+>CD25<sup>+FoxP3<sup>+> Treg cells with the expressions of Bax protein did not differ in both groups. Moreover, the mean fluorescence intensity (MFI of Bcl-2 protein in CD4<sup>+>CD25<sup>+FoxP3<sup>+> Treg cells was significantly lower and MFI of Bax protein significantly higher in pre-eclampsia when compared to the control group. The percentage of CD8<sup>+>CD28<sup>+> T cells did not differ in both studied groups but MFI of CD28 antigen on T CD8<sup>+> cells was significantly higher in pre-eclampsia when compared to the control group. The obtained results suggest that the deficit of CD4<sup>+>CD25<sup>+FoxP3<sup>+> Treg
Energy Technology Data Exchange (ETDEWEB)
Eswaran, M A; Gove, H E; Cook, R; Sikora, B [Rochester Univ., NY (USA). Nuclear Structure Research Lab.
1979-08-13
The ..cap alpha..-transfer reactions /sup 27/Al(/sup 6/Li,d)/sup 31/P,/sup 29/Si(/sup 6/Li,d) /sup 33/S and /sup 31/P(Li,d)/sup 35/Cl have been studied at a /sup 6/Li energy of 36 MeV. Absolute cross sections and angular distributions have been measured and an exact finite-range distorted-wave Born approximation analysis assuming a direct cluster transfer has been used to extract from the data ..cap alpha..-particle spectroscopic strengths for levels populated in /sup 31/P, /sup 33/S and /sup 35/Cl in three reactions respectively. The results show that in the case of most of the low-lying excited states of /sup 31/P a single value of L of the transferred ..cap alpha..-particle contributes, though a multiplicity of L-values are allowed by angular momentum selection rules. It is also found that the ..cap alpha..-particle spectroscopic strength of the ground state of /sup 31/P is a factor of 2 more than the strengths of the ground states of /sup 33/S and /sup 35/Cl. The ..cap alpha..-spectroscopic strengths of ground states of these, as well as other odd-A s-d shell nuclei, are compared with the presently available shell model calculations.
International Nuclear Information System (INIS)
Planeta, R.; Zhou, S.H.; Kwiatkowski, K.
1988-01-01
Nuclide distributions have been measured for damped collision products formed in the reaction of E/A = 8.5 MeV /sup 58/Ni and /sup 64/Ni ions with /sup 238/U. The data demonstrate that in these very asymmetric systems the evolution of the nucleon-exchange process as a function of energy loss depends strongly on the N/Z value of the projectile and the corresponding gradient in the potential-energy surface. Comparison of the data with transport model calculations shows qualitative agreement with the N and Z centroids, variances, and correlation coefficients. However, absolute discrepancies exist which suggest the need for improvement in the model
Observation of the suppressed decay Λ{sub b}{sup 0}→pπ{sup −}μ{sup +}μ{sup −}
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Ajaltouni, Z. [Clermont Université, Université Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Collaboration: LHCb Collaboration; and others
2017-04-06
The suppressed decay Λ{sub b}{sup 0}→pπ{sup −}μ{sup +}μ{sup −}, excluding the J/ψ and ψ(2S)→μ{sup +}μ{sup −} resonances, is observed for the first time with a significance of 5.5 standard deviations. The analysis is performed with proton-proton collision data corresponding to an integrated luminosity of 3 fb{sup −1} collected with the LHCb experiment. The Λ{sub b}{sup 0}→pπ{sup −}μ{sup +}μ{sup −} branching fraction is measured relative to the Λ{sub b}{sup 0}→J/ψ(→μ{sup +}μ{sup −})pπ{sup −} branching fraction giving ((B(Λ{sub b}{sup 0}→pπ{sup −}μ{sup +}μ{sup −}))/(B(Λ{sub b}{sup 0}→J/ψ(→μ{sup +}μ{sup −})pπ{sup −})))=0.044±0.012±0.007, where the first uncertainty is statistical and the second is systematic. This is the first observation of a b→d transition in a baryonic decay.
A clinical application of {sup 31}P and {sup 1}H-MR spectroscopy in cerebrovascular disease
Energy Technology Data Exchange (ETDEWEB)
Uchimura, Koichi; Asakura, Tetsuhiko; Kadota, Koki; Niiro, Masaki; Terada, Kousaku; Hirakawa, Wataru [Kagoshima Univ. (Japan). Faculty of Medicine; Haruzono, Akihiro
1995-12-01
Due to the development of non-invasive magnetic resonance spectroscopy (MRS) techniques, metabolic and functional data on the ischemic human brain have been obtained. We serially evaluated patients with cerebral infarction 5 hours-5 years after the onset by {sup 31}P and {sup 1}H-MRS. {sup 31}P-MRS in patients with acute cerebral infarction showed a marked increase in inorganic phosphate (Pi), decreases in phosphocreatine (PCr) and adenosine triphosphate (ATP), and a decrease in intracellular pH. On the other hand, {sup 1}H-MRS revealed an increase in lactate and a decrease in N-acetyl aspartate (NAA). Since these changes could be detected 5 hours after the onset, MRS is useful for the early diagnosis of cerebral infarction. {sup 123}I-IMP SPECT and {sup 31}P-MRS were performed before and after acetazolamide administration in 10 patients with occlusion of the main trunk or marked stenosis without extensive infarction in its perfusion area on MRI. In the group showing a decrease in cerebral blood flow after acetazolamide administration, intracellular pH also significantly decreased. These results suggest that MRS is also useful for evaluating the reserve capacity of cerebral blood flow and metabolism in chronically ischemic areas. (author).
Human skeletal uptake of natural alpha radioactivity from {sup 210}Pb-supported {sup 210}Po
Energy Technology Data Exchange (ETDEWEB)
Oyedepo, A.C
1998-06-01
This thesis contributes to increasing knowledge on the dosimetry of natural alpha-particle radiation in skeletal tissues, particularly in utero, and associated risks of malignancy. Alpha-particle radiation is an established aetiological factor of cancer. In the human body, polonium-210 decayed from skeletal lead-210 ({sup 210}Pb/{sup 210}Po) is the predominant natural alpha-emitter. {sup 210}Pb displaces calcium (Ca) in mineral hydroxyapatite, especially during periods of rapid bone growth and remodelling when Ca is laid down. It was therefore necessary to study alpha activity uptake and calcification concurrently within bone. Human studies were undertaken on: fetal vertebrae, 17 - 42 weeks of gestation, 74 samples; adult vertebrae, 40 - 95 years, 40 samples; and adult ribs, 20 - 95 years, 51 samples. Specimens were unconcentrated and weighed <5 g each. TASTRAK alpha-particle autoradiography was used to assess the bone activity concentration and spatial microdistribution of {sup 210}Pb/{sup 210}Po. Alpha track data were resolved by specially written software named SPATS (Selection Program for Analysing Track Structures). Ca and phosphorus (P) were biochemically determined. Results were examined for trends in bone type, gender and chronological ageing in humans. The main research findings were: 1) The Ca content of fetal vertebrae increased linearly at a weekly rate of 0.2g Ca 100 g{sup -1} wet bone (typical values of 2, 4, 6 g 100 g{sup -1} at 16, 26 and 36 weeks). 2) The P concentration also increased with advancing fetal age. 3) The Ca:P bone weight ratio rose from 1.7 to 2.2 by 32 gestational weeks. 4) The overall range in bone {sup 210}Pb/{sup 210}Po alpha activity was 0.25 - 1.1 Bq kg{sup -1} with correlation between activity concentration and fetal age (0.47 {+-} 0.05 Bq kg{sup -1} for 17 - 26 weeks, 0.67 {+-} 0.04 Bq kg{sup -1} for 32 - 42 weeks). 5) The correlation between increased alpha radioactivity and increased Ca concentration approximating to 0
Study of the dissipative binary channels in the {sup 107}Ag + {sup 58}Ni reaction at 52 MeV/nucleon
Energy Technology Data Exchange (ETDEWEB)
Steckmeyer, J.C. [Caen Univ., 14 (France). Lab. de Physique Corpusculaire; Aiello, S. [Catania Univ., INFN (Italy); Anzalone, A. [Catania Univ., LNS (Italy)] [and others
2002-03-01
The binary dissipative channels are characterized by the presence of two main fragments in the exit channel. They have been studied in the {sup 107}Ag+{sup 58}Ni reaction at 52 MeV/nucleon of bombarding energy. For that purpose a modified version of the Indra multidetector has been used in conjunction with a part of the Chimera multidetector. Preliminary results on the excitation energy and intrinsic angular momentum of the quasi-projectile are reported and compared to a dynamical calculation. (authors)
Energy Technology Data Exchange (ETDEWEB)
Engler, A; Keyes, G; Kraemer, R W; Schlereth, J; Tanaka, M [Carnegie-Mellon Univ., Pittsburgh, Pa. (USA); Cho, Y; Derrick, M; Lissauer, D; Miller, R J; Smith, R P [Argonne National Lab., Ill. (USA)
1976-07-19
The reactions K/sup 0/sup(L)p..-->..K/sup 0/sub(S)p, ..pi../sup +/..lambda.., ..pi../sup +/..sigma../sup 0/ have been measured for center-of-mass energies from 1540 to 1610 MeV. Channel cross sections and coefficients of the Legendre polynomial expansion of the differential cross sections and hyperon polarizations are presented. No evidence is seen in the ..pi lambda.. channel for the suggested 3/2/sup -/ resonance at 1580 MeV. The cross section for the K/sup 0/sub(S)p channel shows an energy dependence which is not predicted by the existing phase shift solutions based on charged kaon data.
Energy Technology Data Exchange (ETDEWEB)
Behairy, Kassem O., E-mail: drkasemomar@yahoo.com [Physics Department, Aswan University (Egypt); Mahmoud, Zakaria M.M.; Hassanain, M.A. [Physics Department, Faculty of Science, Assiut University (Egypt)
2015-12-15
Real double-folding optical potentials are calculated using the S1Y effective nucleon-nucleon (NN) interaction and the tρρ approximation in order to analyze elastic and inelastic scattering of α-particles from {sup 58}Ni, {sup 116}Sn, and {sup 208}Pb targets at 288, 340, 480, and 699 MeV. The relativistic corrections for momenta and reduced masses are performed to investigate the data at the energies 480 and 699 MeV. The second-order (double-scattering) correction to the tρρ potential is also considered. The inelastic scattering to low-lying excited states (2{sup +}) is investigated using the distorted wave born approximation (DWBA) and the coupled-channel (CC) techniques. (author)
Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors
Energy Technology Data Exchange (ETDEWEB)
Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.
1995-12-01
Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.
Energy Technology Data Exchange (ETDEWEB)
Comas, V.F.; Heinz, S.; Ackermann, D.; Heredia, J.A.; Hessberger, F.P.; Khuyagbaatar, J.; Kindler, B.; Lommel, B.; Mann, R. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Hofmann, S. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Goethe-Universitaet Frankfurt, Institut fuer Physik, Frankfurt (Germany)
2013-09-15
We investigated multi-nucleon transfer reactions in collisions of {sup 58}Ni + {sup 207}Pb and {sup 64}Ni + {sup 207}Pb at Coulomb barrier energies. The new aspect is that we used a velocity filter (SHIP at GSI) for the separation of the heavy target-like transfer products from background events. The isotopic identification was performed via the {alpha} decay properties of the reaction products. The goal of the experiment was to study the characteristics of multi-nucleon transfer reactions in the region of heavy nuclei and the applicability of existing separation and detection techniques, which are usually used for identification of heavy fusion-evaporation residues, to heavy transfer products. This was motivated by recent theoretical results from macroscopic-microscopic models which suggest deep inelastic transfer reactions in heavy systems as a means to produce new neutron-rich isotopes in the region of N = 126 and in the region of superheavy nuclei. In this paper we present the isotopic yields, the excitation functions and the excitation energies of the heavy transfer products with Z > 82 as well as the influence of shell effects on the reaction products. The influence of the different neutron numbers of the projectiles is also discussed. (orig.)
Phosphatidylcholine contributes to in vivo {sup 31}P MRS signal from the human liver
Energy Technology Data Exchange (ETDEWEB)
Chmelik, Marek; Bogner, Wolfgang; Gajdosik, Martin; Gruber, Stephan; Trattnig, Siegfried [Medical University of Vienna, MR Centre of Excellence, Department of Biomedical Imaging and Image-guided Therapy, Vienna (Austria); Valkovic, Ladislav [Medical University of Vienna, MR Centre of Excellence, Department of Biomedical Imaging and Image-guided Therapy, Vienna (Austria); Institute of Measurement Science, Slovak Academy of Sciences, Department of Imaging Methods, Bratislava (Slovakia); Wolf, Peter; Krebs, Michael [Medical University of Vienna, Division of Endocrinology and Metabolism, Department of Internal Medicine III, Vienna (Austria); Halilbasic, Emina; Trauner, Michael [Medical University of Vienna, Division of Gastroenterology and Hepatology, Department of Internal Medicine III, Vienna (Austria); Krssak, Martin [Medical University of Vienna, MR Centre of Excellence, Department of Biomedical Imaging and Image-guided Therapy, Vienna (Austria); Medical University of Vienna, Division of Endocrinology and Metabolism, Department of Internal Medicine III, Vienna (Austria)
2015-07-15
To demonstrate the overlap of the hepatic and bile phosphorus ({sup 31}P) magnetic resonance (MR) spectra and provide evidence of phosphatidylcholine (PtdC) contribution to the in vivo hepatic {sup 31}P MRS phosphodiester (PDE) signal, suggested in previous reports to be phosphoenolpyruvate (PEP). Phantom measurements to assess the chemical shifts of PEP and PtdC signals were performed at 7 T. A retrospective analysis of hepatic 3D {sup 31}P MR spectroscopic imaging (MRSI) data from 18 and five volunteers at 3 T and 7 T, respectively, was performed. Axial images were inspected for the presence of gallbladder, and PDE signals in representative spectra were quantified. Phantom experiments demonstrated the strong pH-dependence of the PEP chemical shift and proved the overlap of PtdC and PEP (∝2 ppm relative to phosphocreatine) at hepatic pH. Gallbladder was covered in seven of 23 in vivo 3D-MRSI datasets. The PDE{sub gall}/γ-ATP{sub liver} ratio was 4.8-fold higher (p = 0.001) in the gallbladder (PDE{sub gall}/γ-ATP{sub liver} = 3.61 ± 0.79) than in the liver (PDE{sub liver}/γ-ATP{sub liver} = 0.75 ± 0.15). In vivo 7 T {sup 31}P MRSI allowed good separation of PDE components. The gallbladder is a strong source of contamination in adjacent {sup 31}P MR hepatic spectra due to biliary phosphatidylcholine. In vivo {sup 31}P MR hepatic signal at 2.06 ppm may represent both phosphatidylcholine and phosphoenolpyruvate, with a higher phosphatidylcholine contribution due to its higher concentration. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Barradas, N.P., E-mail: nunoni@ctn.ist.utl.pt [Centro de Ciências e Tecnologias Nucleares, Instituto Superior Técnico, Unversidade de Lisboa, Estrada Nacional 10 ao km 139.7, 2695-066 Bobadela LRS (Portugal); Bergmaier, A. [Institut für Angewandte Physik und Messtechnik, Fakultät für Luft und Raumfahrttechnik, Werner-Heisenberg-Weg 39, D-85577 Neubiberg (Germany); Mizohata, K. [Department of Physics, University of Helsinki, P.O. Box 43, FI-00014 University of Helsinki (Finland); Msimanga, M. [iThemba LABS Gauteng, National Research Foundation, Private Bag 11, WITS 2050, Johannesburg (South Africa); Department of Physics, Tshwane University of Technology, Private Bag X680, Pretoria 0001 (South Africa); Räisänen, J. [Department of Physics, University of Helsinki, P.O. Box 43, FI-00014 University of Helsinki (Finland); Sajavaara, T. [Department of Physics, University of Jyväskylä, Survontie 9, 40014 Jyväskylä (Finland); Simon, A. [International Atomic Energy Agency, Division of Physical and Chemical Sciences, Vienna International Centre, P.O. Box 100, A-1400 Vienna (Austria); Institute of Nuclear Research of the Hungarian Academy of Sciences, (ATOMKI), P.O. Box 51, H-4001 Debrecen (Hungary)
2015-10-01
Silicon nitride is a technologically important material in a range of applications due to a combination of important properties. Ion beam analysis techniques, and in particular, heavy ion elastic recoil detection analysis can be used to determine the stoichiometry of silicon nitride films, which often deviates from the ideal Si{sub 3}N{sub 4}, as well as the content of impurities such as hydrogen, even in the presence of other materials or in a matrix containing heavier elements. Accurate quantification of IBA results depends on the basic data used in the data analysis. Quantitative depth profiling relies on the knowledge of the stopping power cross sections of the materials studied for the ions involved, which in the case of HI-ERDA is both the primary beam, and the recoiled species. We measured the stopping cross section of {sup 12}C, {sup 16}O, {sup 28}Si, {sup 35}Cl, {sup 58}Ni, {sup 79}Br, and {sup 127}I in a well-characterised silicon nitride membrane. The measurements were made by independent groups utilising different experimental setups and methods. In some cases there is extensive overlap of the energy range in different experiments, allowing a comparison of the different results. The four independent data sets reported in this work are in excellent agreement with each other, in the cases where similar energy ranges were measured. On the other hand, the data are in most cases higher than calculations made with the interpolative schemes SRIM and MSTAR together with the Bragg rule. Better agreement is found with MSTAR in some of the cases studied. This work is a significant extension of the heavy ion stopping power data base for silicon nitride.
(p,. pi. /sup -/) reaction and. delta. /sup + +/ components of nuclei
Energy Technology Data Exchange (ETDEWEB)
Kisslinger, L S; Miller, G A [Carnegie-Mellon Univ., Pittsburgh, Pa. (USA). Dept. of Physics
1975-12-08
The use of the (p,..pi../sup -/) reaction as a probe to determine ..delta../sup + +/(1232) components of nuclear wave functions is examined within the framework of a model which treats baryon resonances on the same footing as nucleons. Nuclear structure properties which affect the ..delta..-probability are discussed. Estimates of cross sections, at several energies, are made for the ..delta../sup + +/ transfer contribution as well as for the competing processes: proton charge exchange (p,n) followed by an (n,..gamma../sup -/) reaction; emission of a ..pi../sup 0/ followed by pion charge exchange (..pi../sup -/,..pi../sup 0/). Even with ..delta..-probabilities as small as 0.0001 the ..delta..-transfer process can compete with ordinary background charge-exchange reactions.
Energy Technology Data Exchange (ETDEWEB)
Gueray, R T; Oezkan, N; Yalcin, C [Kocaeli University, Kocaeli (Turkey); Goerres, J; DeBoer, R; Palumbo, A; Tan, W P; Wiescher, M [University of Notre Dame, (United States); Fueloep, Zs; Somorjai, E [Institute of Nuclear Research ATOMKI (Hungary); Lee, H Y [Argonne National Laboratory (United States)
2009-07-01
Astrophysical S-factors for the {sup 1}20Te(p,{gamma}){sup 1}21I and {sup 1}20Te(p,n){sup 1}20I reactions have been measured in the effective center-of-mass energies between 2.47 MeV and 7.93 MeV. Experimental data have been compared with the Hauser-Fesbach statistical model calculations obtained with the model codes NON-SMOKER and TALYS. The discrepancies between the experimental results and calculations can mainly be attributed to the optical model potentials used in the codes.
Measurement of D{sup *{+-}} meson produciton in e{sup {+-}}p scattering at low Q{sup 2}
Energy Technology Data Exchange (ETDEWEB)
Chekanov, S.; Derrick, M.; Magill, S. [Argonne National Laboratory, Argonne, IL (US)] (and others)
2007-02-15
The production of D{sup *{+-}}(2010) mesons in e{sup {+-}}p scattering in the range of exchanged photon virtuality 0.05sup 2}<0.7 GeV{sup 2} has been measured with the ZEUS detector at HERA using an integrated luminosity of 82 pb{sup -1}. The decay channels D{sup *+}{yields}D{sup 0}{pi}{sup +} with D{sup 0}{yields}K{sup -}{pi}{sup +} and corresponding antiparticle decay were used to identify D{sup *} mesons and the ZEUS beampipe calorimeter was used to identify the scattered electron. Differential D{sup *} cross sections as functions of Q{sup 2}, inelasticity, y, transverse momentum of the D{sup *} meson, p{sub T}(D{sup *}), and pseudorapidity of the D{sup *} meson, {eta}(D{sup *}), have been measured in the kinematic region 0.02
/sup 54/Fe(p vector,d)/sup 53/Fe and /sup 140/Ce(p vector,d)/sup 139/Ce reactions at 122 MeV
Energy Technology Data Exchange (ETDEWEB)
Dickey, S A; Kraushaar, J J; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Miller, D W; Jacobs, W W; Jones, W P [Indiana Univ., Bloomington (USA). Dept. of Physics
1985-08-05
The /sup 54/Fe(p vector,d)/sup 53/Fe and /sup 140/Ce(p vector,d)/sup 139/Ce reactions have been studied at a proton energy of 122 MeV. Analyzing powers and angular distributions were obtained for outgoing deuterons to the strong low-lying single-particle states in both nuclei. These data along with the data of others at 26, 29, 41, 52 and 24, 35, 55 MeV for /sup 54/Fe and /sup 140/Ce respectively, have been compared with exact-finite-range DWBA calculations carried out in a consistent fashion to determine the energy dependence of the spectroscopic factors. A strong energy dependence was noticed for the spectroscopic factors when the l-values were large.
Energy Technology Data Exchange (ETDEWEB)
Maksimovic, Peter [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)
1998-02-01
We present a study of time dependent B<sup>0sup>-$\\bar{B}$>0sup> mixing in p$\\bar{p}$ collisions at 1.8 TeV using 110 pb<sup>-1sup> collected with the CDF detector at the Fermilab Tevatron Collider. B mesons are partially reconstructed using the semileptonic decays B<sup>0sup>→l+D*->X and B<sup>+→l+$\\bar{D}$>0sup>X (and their charge conjugates). B meson-charged pion correlations are used in order to determine the flavor of the B meson at t=0. Such correlations are expected to arise from pions produced in the fragmentation chain and also from B** decays. We measure the efficiency and purity of this flavor tagging method for both charged and neutral B mesons.
Energy Technology Data Exchange (ETDEWEB)
Tadaki, Daisuke [Graduate School of Biomedical Engineering, Tohoku University, Sendai 980-8579 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Sendai 980-8577 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Ma, Teng; Niwano, Michio, E-mail: niwano@riec.tohoku.ac.jp [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Sendai 980-8577 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Zhang, Jinyu; Iino, Shohei [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Sendai 980-8577 (Japan); Hirano-Iwata, Ayumi [Graduate School of Biomedical Engineering, Tohoku University, Sendai 980-8579 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kimura, Yasuo [CREST, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Tokyo University of Technology, Hachioji, Tokyo 192-0982 (Japan); Rosenberg, Richard A. [Advanced Photon Source, Argonne National Laboratory, Lemont, Illinois 60439 (United States)
2016-04-21
Organic thin film transistors (OTFTs) have been explored because of their advantageous features such as light-weight, flexible, and large-area. For more practical application of organic electronic devices, it is very important to realize OTFTs that are composed only of organic materials. In this paper, we have fabricated p{sup +}-i-p{sup +} type of OTFTs in which an intrinsic (i) regioregular poly (3-hexylthiophene) (P3HT) layer is used as the active layer and highly doped p-type (p{sup +}) P3HT is used as the source and drain electrodes. The 2,3,5,6-tetrafluoro-7,7,8,8-tetracyanoquinodimethane (F{sub 4}-TCNQ) was used as the p-type dopant. A fabricating method of p{sup +}-i-p{sup +} OTFTs has been developed by using SiO{sub 2} and aluminum films as capping layers for micro-scaled patterning of the p{sup +}-P3HT electrodes. The characteristics of the OTFTs were examined using the photoelectron spectroscopy and electrical measurements. We demonstrated that the fabricated p{sup +}-i-p{sup +} OTFTs work with carrier injection through a built-in potential at p{sup +}/i interfaces. We found that the p{sup +}-i-p{sup +} OTFTs exhibit better FET characteristics than the conventional P3HT-OTFT with metal (Au) electrodes, indicating that the influence of a carrier injection barrier at the interface between the electrode and the active layer was suppressed by replacing the metal electrodes with p{sup +}-P3HT layers.
Evaluation of the Fluence Conversion Factor for <sup>32sup>P in Sulfur
Energy Technology Data Exchange (ETDEWEB)
Wong, C. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-03-18
When <sup>32sup>S is exposed to neutrons it undergoes a <sup>32sup>S(n,p)>32sup>P reaction with a neutron cross section as shown in Figure 1. This reaction may be used to characterize the neutron fluence for neutrons greater than 3 MeV.
Elastic {pi}{sup +}p and {pi}{sup +}{pi}{sup +} scattering at LHC
Energy Technology Data Exchange (ETDEWEB)
Sobol, A.E.; Ryutin, R.A.; Petrov, V.A. [Institute for High Energy Physics, Protvino (Russian Federation); Murray, M.J. [University of Kansas, Lawrence (United States)
2010-10-15
We discuss the possibility of measuring leading neutron production at the LHC. These data could be used to extract from it {pi}{sup +}p and {pi}{sup +}{pi}{sup +} cross sections. In this note we give some estimates for the case of elastic cross sections and discuss related problems and prospects. (orig.)
Investigation of phosphorous in thin films using the {sup 31}P(α,p){sup 34}S nuclear reaction
Energy Technology Data Exchange (ETDEWEB)
Pitthan, E., E-mail: eduardo.pitthan@ufrgs.br [PGMICRO, UFRGS, 91509-900 Porto Alegre, RS (Brazil); Gobbi, A.L. [Laboratório Nacional de Nanotecnologia, 13083-100 Campinas, SP (Brazil); Stedile, F.C. [PGMICRO, UFRGS, 91509-900 Porto Alegre, RS (Brazil); Instituto de Química, UFRGS, 91509-900 Porto Alegre, RS (Brazil)
2016-03-15
Phosphorus detection and quantification were obtained, using the {sup 31}P(α,p){sup 34}S nuclear reaction and Rutherford Backscattering Spectrometry, in deposited silicon oxide films containing phosphorus and in carbon substrates implanted with phosphorus. It was possible to determine the total amount of phosphorus using the resonance at 3.640 MeV of the {sup 31}P(α,p){sup 34}S nuclear reaction in samples with phosphorus present in up to 23 nm depth. Phosphorous amounts as low as 4 × 10{sup 14} cm{sup −2} were detected. Results obtained by nuclear reaction were in good agreement with those from RBS measurements. Possible applications of phosphorus deposition routes used in this work are discussed.
Energy Technology Data Exchange (ETDEWEB)
Palmerini, S.; Sergi, M. L.; La Cognata, M.; Pizzone, R. G.; Spitaleri, C. [INFN-Laboratori Nazionali del Sud, Catania (Italy); Lamia, L. [Dipartimento di Fisica e Astronomia, Universita di Catania, Catania (Italy)
2013-02-20
In recent years, the Trojan Horse Method (THM) has been used to investigate the low-energy cross sections of proton-induced reactions on A = 17 and A = 18 oxygen isotopes, overcoming extrapolation procedures and enhancement effects due to electron screening. In particular, the strengths of the 20 keV and 65 keV resonances in the {sup 18}O(p, {alpha}){sup 15}N and {sup 17}O(p, {alpha}){sup 14}N reactions, respectively, have been extracted, as well as the contribution of the tail of the broad 656 keV resonance in the {sup 18}O(p, {alpha}){sup 15}N reaction inside the Gamow window. The strength of the 65 keV resonance in the {sup 17}O(p, {alpha}){sup 14}N reaction, measured by means of the THM, has been used to renormalize the corresponding resonance strength in the {sup 17}O + p radiative capture channel. As a result, more accurate reaction rates for the {sup 18}O(p, {alpha}){sup 15}N, {sup 17}O(p, {alpha}){sup 14}N, and {sup 17}O(p, {gamma}){sup 18}F processes have been deduced, devoid of systematic errors due to extrapolation or the electron screening effect. Such rates have been introduced into state-of-the-art red giant branch and asymptotic giant branch (AGB) models for proton-capture nucleosynthesis coupled with extra-mixing episodes. The predicted abundances have been compared with isotopic compositions provided by geochemical analysis of presolar grains. As a result, an improved agreement is found between the models and the isotopic mix of oxide grains of AGB origins, whose composition is the signature of low-temperature proton-capture nucleosynthesis. The low {sup 14}N/{sup 15}N found in SiC grains cannot be explained by the revised nuclear reaction rates and remains a serious problem that has not been satisfactorily addressed.
Energy Technology Data Exchange (ETDEWEB)
Creelman, A.; Mcgregor, I.; Kassiou, M. [Sydney Univ., NSW (Australia); Thominiaux, C.; Chauveau, F.; Kuhnast, B.; Boutin, H.; Hantraye, P.; Tavitian, B.; Dolle, F. [Service Hospitalier Frederic Joliot 91 - Orsay (France); Fulton, R.; Henderson, D. [RPAH, NSW (Australia); Selleri, S. [Firenze Univ. (Italy)
2008-02-15
The translocator protein (18 kDa) (T.S.P.O.), formerly known as the peripheral benzodiazepine receptor (P.B.R.), is over expressed upon micro-glial activation. This study involved the evaluation of the pyrazolo-pyrimidine D.P.A.-715 (T.S.P.O. Ki = 16.4 nM) in behavioural studies and the radiolabelled form, [{sup 11}C]D.P.A.-715, in healthy non-human primate and A.M.P.A.-lesioned rats as a model of activated micro-glia using PET. The in vivo anxiolytic effects of D.P.A.-715 were assessed using the social interaction test which represents social anxiety in humans. [{sup 11}C]D.P.A.-715 was prepared using [{sup 11}C]CH{sub 3}I as the labelling intermediate from the phenolic precursor of D.P.A.-715 using T.B.A.H. and D.M.F. followed by H.P.L.C.. The non-human primate distribution studies were performed using a clinical PET scanner, and A.M.P.A.-lesioned rats using micro PET. Blocking studies were conducted using P.K.11195 (5 mg/kg).In the social interaction test a significant overall effect for the duration of time spent in general investigation, adjacent lying and rearing was observed. Post hoc analysis revealed a significantly greater time spent in general investigation and adjacent lying in the 20 mg/kg D.P.A.-715 treatment group compared to vehicle treated rats. The average non-decay corrected radiochemical yield of [{sup 11}C]D.P.A.-715 was 0.27 {+-} 0.05% with an average specific activity of 16.32 {+-} 4.01 GBq/mmol. The PET distribution studies revealed poor brain uptake. Pre-treatment with P.K.1195 resulted in no change of in the uptake of the radioligand, which suggests that brain uptake is representative of non-specific binding. In agreement with these results, the brain uptake in the A.M.P.A. lesioned model, depicted no significant differences between the lesioned striatum and the non-lesioned contralateral striatum. Although D.P.A.-715 does possess anxiolytic properties in vivo, [{sup 11}C]D.P.A.-715 does not possess the required properties for further
Energy Technology Data Exchange (ETDEWEB)
Apelgot, Sonia [Laboratoire Curie, Institut du Radium, Paris (France)
1968-06-15
The biological effect of decay of {sup 3}H, {sup 14}C and {sup 32}P incorporated into a bacterium depends on the nature of the organic molecule labelled, on the position of the isotope within it and on the isotope itself. In sum, results obtained to date show that: The decay of {sup 3}H atoms incorporated into certain macromolecules of a bacterium causes sterilization through ionization by the ss{sup -} particle emitted; transmutation is of negligible importance. This self-irradiation is comparable in effect with X-rays and is affected in a similar manner by the same factors: temperature, presence of a radioprotector, radiosensitivity of the strain. Decay of {sup 14}C or {sup 32}P atoms incorporated into bacterial DNA is lethal because of the transmutation effect; ionizations produced by emitted ss{sup -} particles may be disregarded. Survival curves for {sup 32}P transmutations depend on the experimental conditions. Some of the results obtained with {sup 32}P are similar to those obtained with X-rays, e.g. effects of temperature, radical capture and oxygen, while others are similar to those of u.v. light, e.g., effect of growth conditions. Comparative tests made with {sup 32}P indicate that the recoil energy of transmutation is not the phenomenon responsible for the lethal effect observed. Comparison of the results obtained after X-irradiation or decay of {sup 3}H or {sup 32}P incorporated into the DNA of bacteria of the same strain of E. coli shows that the efficiency of a {sup 32}P transmutation is about four times greater than that of an ionization produced at random within the same DNA. (author) [French] L'effet biologique de la desintegration de {sup 3}H, {sup 14}C et {sup 32}P incorpores dans une bacterie depend de la nature de la molecule organique marquee, de l'emplacement de l'isotope sur celle-ci et de la nature de l'isotope lui-meme. L'ensemble des resultats obtenus a ce jour montre que la desintegration des atomes de {sup 3}H incorpores dans certaines
Energy Technology Data Exchange (ETDEWEB)
Levon, A.I. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); De Boer, J. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Graw, G. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Hertenberger, R. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Hofer, D. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Kvasil, J. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Loesch, A. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Mueller-Zanotti, E. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Wuerkner, M. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Baltzer, H. (Institut fuer Strahlen- und Kernphysik, University of Bonn, D-53115 Bonn (Germany)); Grafen, V. (Institut fuer Strahlen- und Kernphysik, University of Bonn, D-53115 Bonn (Germany)); Guenther, C. (Institut fuer Strahlen- und Kernphysik, University of
1994-08-29
The level structure of the [sup 229]Pa nucleus has been investigated by means of the [sup 231]Pa(p,t)[sup 229]Pa and [sup 230]Th(p,2n[gamma])[sup 229]Pa reactions. Triton angular-distribution measurements were subjected to a CCBA analysis and combined with the results of in-beam conversion electron and [gamma]-ray spectroscopy to establish a level scheme. Two low-lying bands of opposite parity were observed up to spins (23/2)[sup -] and (17/2)[sup +], respectively. Rotational bands built on some 0[sup +] excitations of the even-even core can be assigned. The lowest states of three further low-lying bands are observed. The level scheme is interpreted in terms of an octupole-deformed core with an unpaired proton. From the E1/E2 branching ratio the electric dipole moment can be deduced vertical stroke D[sub 0]vertical stroke =(0.09 [+-]0.04) e .fm. ((orig.))
Energy Technology Data Exchange (ETDEWEB)
Zsembery, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1969-07-01
In the reaction {pi}{sup -}p {yields}{pi}{sup +}{pi}{sup -}n, we have measured the {pi}{sup +} momentum spectrum at various angles, from which the distributions (d{sup 2}{sigma}/dMd{omega}) of the ({pi}{sup -}n) system have been deduced. These distributions are compared with those obtained by a phenomenological model. This comparison allows a determination of the amplitude of the inelastic waves. It is found that the resonant waves D15 and F15 are no strongly coupled to the channel {delta}(1238) + {pi}. (author) [French] Dans la reaction {pi}{sup -}p {yields} {pi}{sup +}{pi}{sup -}n, nous avons mesure le spectre en impulsion des {pi}{sup +} a differents angles. Les distributions (d{sup 2}{sigma}/dMd{omega}) du systeme ({pi}{sup -}n) en ont ete deduites. Ces distributions sont comparees a celles obtenues par un modele phenomenologique. De la comparaison on determine l'amplitude des ondes inelastiques. Les ondes resonnantes D15 et FIS ne sont pas liees fortement a la voie {delta}(1238) + {pi}. (auteur)
Measurement of the d({sup 26}Al{sup m},p){sup 27}Al reaction for nuclear astrophysics
Energy Technology Data Exchange (ETDEWEB)
Roeder, B.T.; Trache, L.; Iacob, V.E.; McCleskey, M.; Simmons, E.; Spiridon, A.; Tribble, R.E. [Texas A and M Univ., TX (United States); Davinson, T.; Lotay, G.; Woods, P.J. [University of Edinburgh (United Kingdom); La Cognata, M.; Pizzone, R.G.; Rapisarda, G.G.; Sparta, R.; Spitaleri, C. [Istituto Nazionale di Fisica Nucleare (LNS/INFN), Catania (Italy). Lab. Nazionali del Sud
2012-07-01
Full text: The detection of gamma rays from the decay of the {sup 26}Al ground state in the galaxy gives evidence that nucleosynthesis is occurring in present-day stars, but its origin is not yet clear. This implies that reactions involving {sup 26}Al are important for astrophysical processes. In a recent experiment at the Cyclotron Institute at Texas A and M University, reactions with the ground state and isomeric state of {sup 26}Al were investigated with the Texas A and M-Edinburgh-Catania Silicon detector Array (TECSA). TECSA is a collaborative effort to build a high-efficiency detector Si array useful for measuring reactions of interest for nuclear astrophysics and nuclear structure. The array consists of up to 16 Micron Semiconductor YY1 detectors that are each 300 μm thick. Each detector has 16 annular ring sectors to measure the energy and the scattering angle of the detected particles. Using TECSA, we measured d({sup 26}Al{sup g},p){sup 27}Al and d({sup 26}Al{sup m},p){sup 27}Al with a {sup 26}Al secondary beam prepared in-flight with the MARS spectrometer. First, the composition of the {sup 26}Al beam was determined by measuring the ratio of beta-decays to {sup 26}Al ions produced. It was found that at different spectrometer rigidities, beams of 2/3 isomer to ground state ratio or vice-versa could be obtained. Then, in the second part of the experiment, angular distributions were measured for both reactions at backward angles with TECSA. The protons were measured in TECSA in coincidence with timing signals from the beam detected by a scintillator and with the cyclotron radio-frequency. Details of the experiment and preliminary results from the analysis of the d({sup 26}Al{sup m},p){sup 27}Al and d({sup 26}Al{sup g},p){sup 27}Al data will be presented. They will give information about the proton capture reactions {sup 26}Al{sup m}(p,γ){sup 27}Si and {sup 26}Al{sup g}(p,γ){sup 27}Si taking place in stars. (author)
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Determination of /sup 90/Sr and /sup 228/Ra in human teeth by age groups and in other substances
Energy Technology Data Exchange (ETDEWEB)
Neuzil, E F; Dysart, M E [Western Washington Univ., Bellingham (USA)
1984-12-01
The total /sup 90/Sr content of human teeth peaks at a value of 0.65 pCi/g calcium in the age group of 20-30 years. It is not present in those 50 years or older. Various other substances show extensive amounts of /sup 90/Sr especially in cow bones, bone meal and dry milk. The radionuclide /sup 228/Ra (daughter of /sup 232/Th) is present at a mean level of about 0.5 pCi/g Ca in all substances tested and in all age groups, but especially high in bone meal (5.60 pCi/g Ca) and calcium lactate tablets.
Energy Technology Data Exchange (ETDEWEB)
Unadkat, Jashvant D. [Department of Pharmaceutics, University of Washington, Box 357610, Seattle, WA 98195 (United States)], E-mail: jash@u.washington.edu; Chung, Francisco; Sasongko, Lucy; Whittington, Dale; Eyal, Sara [Department of Pharmaceutics, University of Washington, Box 357610, Seattle, WA 98195 (United States); Mankoff, David [Department of Radiology, University of Washington, Box 356004, Seattle, WA 98195 (United States); Collier, Ann C. [Department of Medicine, University of Washington, Box 359929, Seattle, WA 98195 (United States); Muzi, Mark; Link, Jeanne [Department of Radiology, University of Washington, Box 356004, Seattle, WA 98195 (United States)
2008-11-15
Introduction: P-glycoprotein (P-gp), an efflux transporter, is a significant barrier to drug entry into the brain and the fetus. The positron emission tomography (PET) ligand, [{sup 11}C]-verapamil, has been used to measure in vivo P-gp activity at various tissue-blood barriers of humans and animals. Since verapamil is extensively metabolized in vivo, it is important to quantify the extent of verapamil metabolism in order to interpret such P-gp activity. Therefore, we developed a rapid solid-phase extraction (SPE) method to separate, and then quantify, verapamil and its radiolabeled metabolites in plasma. Methods: Using high-performance liquid chromatography (HPLC), we established that the major identifiable circulating radioactive metabolite of [{sup 11}C]-verapamil in plasma of humans and the nonhuman primate, Macaca nemestrina, was [{sup 11}C]-D-617/717. Using sequential and differential pH elution on C{sub 8} SPE cartridges, we developed a rapid method to separate [{sup 11}C]-verapamil and [{sup 11}C]-D-617/717. Recovery was measured by spiking the samples with the corresponding nonradioactive compounds and assaying these compounds by HPLC. Results: Verapamil and D-617/717 recovery with the SPE method was >85%. When the method was applied to PET studies in humans and nonhuman primates, significant plasma concentration of D-617/717 and unknown polar metabolite(s) were observed. The SPE and the HPLC methods were not significantly different in the quantification of verapamil and D-617/717. Conclusions: The SPE method simultaneously processes multiple samples in less than 5 min. Given the short half-life of [{sup 11}C], this method provides a valuable tool to rapidly determine the concentration of [{sup 11}C]-verapamil and its [{sup 11}C]-metabolites in human and nonhuman primate plasma.
Energy Technology Data Exchange (ETDEWEB)
Galea, Cristina Florina [Radboud Univ. Nijmegen (Netherlands)
2008-01-25
The resonant production of tau-lepton pairs is as interesting for the study of Standard Model (SM) physics as the production of lighter leptons pairs. For new phenomena, such as Higgs boson production or in case new particles beyond the SM would arise, the detection of (resonant) pairs of tau leptons becomes much more interesting. This is due to the fact that tau leptons are much heavier than the other leptons, which increases the chance that these new phenomena would be observed first in this channel. Unfortunately their clean detection is far more difficult than that of muons or electrons. The cross section times branching ratio σ. Br for the process p$\\bar{p}$ → Z → τ<sup>+τ-> was measured at √s = 1.96 GeV using 1.0 fb<sup>-1sup> of data collected by the D0 experiment. This measurement was performed in the channel in which one of the tau leptons decays to a muon and neutrinos, while the other decays either hadronically or to an electron and neutrinos. A set of 1511 events, of which about 20% estimated background, passed all selection criteria. The trigger and muon reconstruction efficiencies, as well as the efficiency for track reconstruction were obtained from data using the 'tag and probe' method on Z → μ<sup>+μ-> events. The multijet background was estimated from the sample of events which passed all selection criteria but in which the muon and the tau candidate had the same charge. The W → μv + jets background was modeled by Monte Carlo simulations, but normalized to data. All the other backgrounds, as well as the efficiency for Z → τ<sup>+τ-> events were estimated using simulated events normalized to the theoretical calculations of cross sections at next-to-leading order or next-to-next-to-leading order. The energy of the tau candidates was corrected for the estimated response of the charged pions in the calorimeter, which is of the order 50-80%. Since the charged pion response
Energy Technology Data Exchange (ETDEWEB)
Scheidhauer, J; Chabidon, M [Commissariat a l' Energie Atomique, Centre de Production de Plutonium, Marcoule (France). Centre d' Etudes Nucleaires
1963-07-01
The problem of fast neutron dosimetry using activation is studied from the radio-protection point of view. The practical development of methods for analyzing phosphorus 32 produced by the activation of sulphur 32 in human hair by the reaction {sup 32}S(n, p){sup 32}P is described. The sensitivity obtained is 5 rad. A preliminary study was made of the variations in the natural sulphur and phosphorus concentrations. (authors) [French] Le probleme de la dosimetrie des neutrons rapides par activation est etudie sous l'angle de la radioprotectlon. Une mise au point pratique de methodes d'analyae du phosphore 32 induit par activation du soufre 32 des cheveux humains par reaction {sup 32}S(n, p){sup 32}P est exposee. La sensibilite obtenue est de 5 rad. Les variations du soufre et du phosphore naturels ont fait l'objet d'une etude preliminaire. (auteurs)
(. gamma. , p) reaction of /sup 51/V and /sup 54/Fe
Energy Technology Data Exchange (ETDEWEB)
Tsubota, H [Tohoku Univ., Sendai (Japan). Coll. of General Education; Oikawa, S; Uegaki, J; Tamae, T
1975-06-01
The (..gamma.., p) reaction cross sections of /sup 51/V and /sup 54/Fe were measured for studying the isospin and the nuclear deformation effects. An approximate method of the analysis of the isospin effect is presented. The form and intensity of the (..gamma.., p) and (..gamma.., n) reaction cross sections in the giant resonance region of /sup 51/V and /sup 54/Fe can be explained qualitatively with a compound nucleus model and the assumption of a quantum number of good isospin.
Application of a canine <sup>238sup>Pu dosimetry model to human bioassay data
Energy Technology Data Exchange (ETDEWEB)
Hickman, Jr., A. W. [Florida Univ., Gainesville, FL (United States)
1991-08-01
Associated with the use of 2<sup>238sup>Pu in thermoelectric power sources for space probes and power supplies for cardiac devices is the potential for human exposure to <sup>238sup>Pu, primarily by inhalation. In the event of human internal exposure, a means is needed for assessing the level of intake and calculating radiation doses. Several bioassay/dosimetry models have been developed for <sup>239sup>Pu. However, results from studies with laboratory animals have indicated that the biokinetics, and therefore the descriptive models, of <sup>238sup>Pu are significantly different from those for <sup>239sup>Pu. A canine model accounting for these differences has been applied in this work to urinary excretion data from seven humans occupationally exposed to low levels of an insoluble <sup>238sup>Pu compound. The modified model provides a good description of the urinary excretion kinetics observed in the exposed humans. The modified model was also used to provide estimates of the initial intakes of <sup>238sup>Pu for the seven individuals; these estimates ranged from 4.5 nCi (170 Bq) to 87 nCi (3200 Bq). Autopsy data on the amount and distribution of <sup>238sup>Pu retained in the organs may be used in the future to validate or refute both these estimates and the assumptions used to formulate the human model. Modification of the human model to simulate an injection exposure to <sup>239sup>Pu gave patterns of retention in the organs and urinary excretion comparable to those seen previously in humans; further modification of the model using fecal data (unavailable for the subjects of this study) is indicated.
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Energy Technology Data Exchange (ETDEWEB)
Saxena, Pooja; Ranjan, Kirti [Centre for Detector and Related Software Technology, Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Bhardwaj, Ashutosh, E-mail: abhardwaj@physics.du.ac.in [Centre for Detector and Related Software Technology, Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Shivpuri, R.K.; Bhattacharya, Satyaki [Centre for Detector and Related Software Technology, Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India)
2011-12-01
Silicon Detector (SiD) is one of the proposed detectors for the future International Linear Collider (ILC). In the innermost vertex of the ILC, Si micro-strip sensors will be exposed to the neutron background of around 1-1.6 Multiplication-Sign 10{sup 10} 1 MeV equivalent neutrons cm{sup -2} year{sup -1}. The p{sup +}n{sup -}n{sup +} double-sided Si strip sensors are supposed to be used as position sensitive sensors for SiD. The shortening due to electron accumulation on the n{sup +}n{sup -} side of these sensors leads to uniform spreading of signal over all the n{sup +} strips and thus ensuring good isolation between the n{sup +} strips becomes one of the major issues in these sensors. One of the possible solutions is the use of floating p-type implants introduced between the n{sup +} strips (p-stops) and another alternative is the use of uniform layer of p-type implant on the entire n-side (p-spray). However, pre-breakdown micro-discharge is reported because of the high electric field at the edge of the p-stop/p-spray. An optimization of the implant dose profile of the p-stop and p-spray is required to achieve good electrical isolation while ensuring satisfactory breakdown performance of the Si sensors. Preliminary results of the simulation study performed on the n{sup +}n{sup -} Si sensors having p-stop and p-spray using device simulation program, ATLAS, are presented.
Energy Technology Data Exchange (ETDEWEB)
Fraceto, Leonardo Fernandes; Paula, Eneida de [Universidade Estadual de Campinas, SP (Brazil). Inst. de Biologia. Dept. de Bioquimica]. E-mail: depaula@unicamp.br
2004-02-01
The literature carries many theories about the mechanism of action of local anesthetics (LA). We can highlight those focusing the direct effect of LA on the sodium channel protein and the ones that consider the interaction of anesthetic molecules with the lipid membrane phase. The interaction between local anesthetics and human erythrocyte membranes has been studied by {sup 1}H and {sup 31}P nuclear magnetic resonance spectroscopy. It was found that lidocaine (LDC) and benzocaine (BZC) bind to the membranes, increase the mobility of the protons of the phospholipids acyl chains, and decrease the mobility and/or change the structure of the polar head groups. The results indicate that lidocaine molecules are inserted across the polar and liquid interface of the membrane, establishing both electrostatic (charged form) and hydrophobic (neutral form) interactions. Benzocaine locates itself a little deeper in the bilayer, between the interfacial glycerol region and the hydrophobic core. These changes in mobility or conformation of membrane lipids could affect the Na{sup +}-channel protein insertion in the bilayer, stabilizing it in the inactivated state, thus causing anesthesia. (author)
Energy Technology Data Exchange (ETDEWEB)
Pereira, M C
1988-04-01
Sugar cane straw and/or P-fertilizer phosphorus-32 labelled were added to a Red Yellow podzolic soil from Goiana-PE. The treated samples were used in a pot experiment, growing sorghum plants for 4 and 6 weeks, and in an incubation experiment with incubation periods of 1, 2, 3, 4 and 6 weeks without plants in order to follow the dynamics of the P added. After each harvest and incubation period the soil were analysed for {sup 31} P and {sup 32} P in the microbial biomass and in sequential extracts with resin (Pi), 0.5 M Na H Co{sub 3} (Pi, Po) and 0.1 N NaOH (Pi, Po). The {sup 31} P and {sup 32} P contents of the sorghum in the pot experiment were also determined. (author).
Kinetics of the Reactions of O((sup 3)P) and Cl((sup 2)P) with HBr and Br2
Nicovich, J. M.; Wine, P. H.
1997-01-01
A laser flash photolysis-resonance fluorescence technique has been employed to study the kinetics of reactions (1)-(4) as a function of temperature. (1) O((sup 3)P) + Br2 yields BrO + Br((sup 2)P(sub 3/2)) at 255-350 K; (2) Cl((sup 2)P) + Br2 yields BrCl + Br((sup 2)P(sub 3/2)) at 298-401 K; (3) O((sup 3)P) + HBr yields OH + Br((sup 2)P(sub J)) at 250-402 K; (4) Cl((sup 2)P) + HBr yields HCl + Br((sup 2)P(sub J)) at 257-404 K. In all cases, the concentration of the excess reagent, i.e, HBr or Br2, was measured in situ in the slow flow system by UV-visible photometry. Heterogeneous dark reactions between XBr (X equals H or Br) and the photolytic precursors for Cl((sup 2)P) and O((sup 3)P) (Cl2 and O3, respectively) were avoided by injecting minimal amounts of precursor into the reaction mixture immediately upstream from the reaction zone. The following Arrhenius expressions summarize our results (errors are 2 sigma and represent precision only, units are cu cm/(molecule.s): k(sub 1) = (1.76 +/- 0.80) x 10(exp -11 exp[(40 +/- 100)/T]; k(sub 2) = (2.40 +/- 1.25) x 12(exp -10) exp[-(144 +/- 176)/T]; k(sub 3) = (5.11 +/- 2.82) x 10(exp -12) exp[-(1450 +/- 160)/T]; k(sub 4) = (2.25 +/- 0.56) x 10(exp -11) exp[-(400 +/- 80)/T]. The consistency (or lack thereof) of our results with those reported in previous kinetics and dynamics studies of reactions (1)-(4) is discussed.
/sup 40/Ar//sup 39/Ar and K-Ar dating of altered glassy volcanic rocks: the Dabi Volcanics, P. N. G
Energy Technology Data Exchange (ETDEWEB)
Walker, D.A. (Australian National Univ., Canberra. Dept. of Geology); McDougall, I. (Australian National Univ., Canberra. Research School of Earth Sciences)
1982-11-01
K-Ar and /sup 40/Ar//sup 39/Ar ages have been determined for altered submarine tholeiitic and boninite (high-Mg andesite) lavas from the Dabi Volcanics, Cape Vogel Peninsula, Papua New Guinea. /sup 40/Ar//sup 39/Ar whole rock total fusion and plateau ages identify a Late Paleocene age for the tholeiitic lavas (58.9 +- 1.1 Ma), and also for the boninitic lavas (58.8 +- 0.8 Ma). Apparent K-Ar ages for the same samples range from 27.2 +- 0.7 to 63.9 +- 4.5 Ma, and young K-Ar ages for glassy boninites are probably due to variable radiogenic /sup 40/Ar(/sup 40/Ar*) loss. These new ages effectively reconcile previously ambiguous age data for the Dabi Volcanics, and indicate contemporaneous tholeiitic and boninitic volcanism occurring in southeast PNG during the Late Paleocene. Smectites, developed as alteration products after glass in oceanic lavas commonly do not retain /sup 39/Ar during or subsequent to irradiation, but in some cases may contain /sup 40/Ar*. The results are discussed.
Energy Technology Data Exchange (ETDEWEB)
Miller, R.E.; Smith, D.L. [Argonne National Lab., IL (United States). Technology Development Div.
1997-11-01
This report documents a survey of the literature, and provides a compilation of data contained therein, for the {sup 31}P(p,{alpha}){sup 28}Si reaction. Attention is paid here to resonance states in the compound-nuclear system {sup 32}S formed by {sup 31}P + p, with emphasis on the alpha-particle decay channels, {sup 28}Si + {alpha} which populate specific levels in {sup 28}Si. The energy region near the proton separation energy for {sup 32}S is especially important in this context for applications in nuclear astrophysics. Properties of the excited states in {sup 28}Si are also considered. Summaries of all the located references are provided and numerical data contained in them are compiled in EXFOR format where applicable.
Energy Technology Data Exchange (ETDEWEB)
Alam, Todd M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wilson, Brendan W. [West Virginia Univ., Morgantown, WV (United States)
2015-07-24
During the summer of 2015, I participated in the DHS HS-STEM fellowship at Sandia National Laboratories (SNL, NM) under the supervision of Dr. Todd M. Alam in his Nuclear Magnetic Resonance (NMR) Spectroscopy research group. While with the group, my main project involved pursing various hydrolysis reactions with Diethyl Chlorophosphate (DECP), a surrogate for the agent Sarin (GB). Specifically, I performed different hydrolysis reactions, monitored and tracked the different phosphorous containing species using phosphorous (<sup>31sup>P) NMR spectroscopy. With the data collected, I performed kinetics studies mapping the rates of DECP hydrolysis. I also used the NMR of different nuclei such as <sup>1sup>H, <sup>13sup>C, <sup>17sup>O, and <sup>35sup>Cl to help understand the complexity of the reactions that take place. Finally, my last task at SNL was to work with Insensitive Nuclei Enhanced by Polarization Transfer (INEPT) NMR Spectroscopy optimizing conditions for <sup>19sup>F- <sup>31sup>P filtering NMR experiments.
Energy Technology Data Exchange (ETDEWEB)
Palmerini, S.; Sergi, M. L.; La Cognata, M.; Pizzone, R. G. [INFN-Laboratori Nazionali del Sud, Catania (Italy); Lamia, L. [Dipartimento di Fisica e Astronomia, Universitá degli Studi di Catania (Italy); Spitaleri, C. [INFN-Laboratori Nazionali del Sud, Catania, Italy and Dipartimento di Fisica e Astronomia, Universitá degli Studi di Catania (Italy)
2015-02-24
Presolar grains form in the cold and dusty envelopes of Asymptotic Giant Branch (AGB) stars. These solides, once that have been ejected by stellar winds, come to us as inclusions in meteorites providing invaluable benchmarks and constraints for our knowledge of low temeperature H-burning in stars. The Trojan Horse Method (THM) has been used to investigate the low-energy cross sections of the {sup 17}O(p,α){sup 14}N and {sup 18}O(p,α){sup 15}N reactions. Moreover, the strength of the 65 keV resonance in the {sup 17}O(p,α){sup 14}N reaction, measured by means of the THM, has been used to renormalize the corresponding resonance strength in the {sup 17}O+p radiative capture channel. The new estimates of the reaction rates have been introduced into calculations of AGB star nucleosynthesis and the results have been compared with geochemical analysis of 'presolar' grains to determine their impact on astrophysical environments.
/sup 13/C(p vector,d)/sup 12/C and /sup 208/Pb(p vector,d)/sup 207/Pb reactions at 123 MeV
Energy Technology Data Exchange (ETDEWEB)
Kraushaar, J J; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Miller, D W; Jacobs, W W; Jones, W P; Devins, D W [Indiana Univ., Bloomington (USA). Dept. of Physics
1983-02-01
Cross-section and analyzing power angular distributions have been measured for /sup 13/C(p vector,d) and /sup 208/Pb(p vector, d) at 123 MeV to the strong low-lying residual states in both final nuclei. The data have been compared with the results of both zero- and exact-finite-range distorted wave calculations and some serious discrepancies were noted for the analyzing powers. For the case of the /sup 13/C calculations, marked improvement in the description of the data was achieved with the use of a damping factor in the nuclear interior.
The reactions K/sup -/p to pi /sup -or+/ Sigma /sup +or-/(1385) at 42 GeV/c
Holmgren, S O; Barreiro, F; Hemingway, R J; Kittel, E W; Kluyver, J C; Losty, Michael J; Massaro, G G G; Van de Walle, R T; Worden, R P; Zatz, J
1977-01-01
The total and differential cross sections are presented. Amplitude analyses are performed and the complete sigma /sup +or-/(1385) helicity spin density matrices are extracted. The results are compared with the predictions of the additive quark model and exchange degeneracy. A substantial cross section is observed for the reaction K /sup -/p to pi /sup +/ Sigma /sup -/(1385) in the forward direction, which implies exotic meson quantum numbers in the t-channel. One possible interpretation of this process provides an explanation for the small but significant violations of the additive quark model predictions observed in the reaction K/sup -/p to pi /sup -/ Sigma /sup +/(1385) at low four-momentum transfer. In the backward direction unnatural parity exchange is shown to give a larger contribution to K /sup -/p to Sigma /sup -/(1385) pi /sup +/ than natural parity exchange. (25 refs).
Energy Technology Data Exchange (ETDEWEB)
Alitti, J [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France)
1967-07-01
A study of the reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} at 2.75 GeV/c was carried out in an 81 cm liquid hydrogen bubble chamber at the CERN proton synchrotron. One observes that the abundant N{sub 33}{sup *++} (1236 MeV) isobar production occurs predominantly backwards in the center of mass of the reaction. This feature suggests a peripheral production mechanism with {pi} exchange. The validity of this hypothesis, which allows the study of the {pi}{sup -}{pi}{sup -} interaction within the frame of the Chew and Low model, is verified. Among other results one finds for the isospin-2 state the values of the elastic {pi}{pi} cross section and of the S and D wave phase shifts. (author) [French] Etude de la reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} a 2.75 GeV/c, effectuee a l'aide de la chambre a bulles a hydrogene liquide de 81 cm de Saclay exposee aupres du synchrotron a protons du CERN. On observe une abondante production de l'isobare N{sub 33}{sup *++} a 1236 MeV, lequel est emis de preference vers l'arriere dans le centre de masse de la reaction. Ceci suggere un mecanisme de production peripherique avec echange d'un {pi}. Cette hypothese dont on a mis a l'epreuve la validite permet l'etude de l'interaction {pi}{sup -}{pi}{sup -} dans le cadre du modele de Chew et Low. Entre autres resultats, on donne, pour l'etat d'isospin I = 2, les valeurs de la section efficace de diffusion elastique {pi}{pi} et les dephasages des ondes S et D. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Campos, Valdevino; Costa, Valentim E. Uberti [Rio Grande do Sul Univ., Porto Alegre, RS (Brazil). Inst. de Quimica
1992-12-31
In the last years the development of phosphates analogues in the medical and agricultural pesticides has being very expressive. {sup 1} H, {sup 13} C and mainly {sup 31} P NMR are used for stereochemical and conformational analysis, and reactivity studies on the compounds resulting from those chemical processes 2 refs., 4 figs., 1 tab.
Experiments on multi-nucleon transfer reactions with the systems {sup 58,64}Ni+{sup 207}Pb at SHIP
Energy Technology Data Exchange (ETDEWEB)
Fernandovich Comas Lijachev, Victor
2012-07-01
This work presents experimental results on multi-nucleon transfer reactions in the collision systems {sup 58}Ni+{sup 207}Pb and {sup 64}Ni+{sup 207}Pb which were measured at the velocity filter SHIP at GSI. The reactions were performed at beam energies below and up to 10% above the Coulomb barrier. The work was motivated by theoretical predictions to apply multi-nucleon transfer reactions in heavy systems to synthesize new neutron-rich isotopes in the region of superheavy nuclei with Z>100 and in the region of the closed neutron shell N=126. The expected cross-sections for the production of these nuclei in transfer reactions are small and reach typically nanobarn and below. Therefore, efficient separation techniques have to be applied and the detection system must allow for the identification of single nuclei. A dedicated experimental setup to study such rare transfer products does not exist presently. But already existing facilities which are used for the synthesis of superheavy fusion products meet the requirements for the detection of rare reaction products. In this context, the velocity filter SHIP offers the possibility to separate heavy target-like transfer products from projectiles and projectile-like reaction products before they reach the detection system where the particles are identified by their alpha-decay properties. At SHIP, a cross-section limit of 10 pb can be reached at usual beam intensities. In the present work on collisions of {sup 58,64}Ni+{sup 207}Pb the influence of the projectile neutron number on the cross-sections, isotopic distributions and excitation energies of the transfer products was studied. Especially with the more neutron-rich {sup 64}Ni projectiles a transfer of up to seven protons and eight neutrons to the target nucleus was observed. The largest cross-sections for the most neutron-rich isotopes were reached at the beam energies around the Coulomb barrier. The transfer was accompanied by the full dissipation of the available
Energy Technology Data Exchange (ETDEWEB)
Baton, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1968-05-01
Study of the reaction {pi}{sup -}p {yields} {pi}{sup -}{pi}{sup 0} p at 2.77 GeV/c carried out in the CERN 2 meter large liquid hydrogen bubble chamber at the proton synchrotron, shows that 70 per cent of this reaction goes through {pi}{sup -}p {yields} {rho}{sup -}p channel. The high statistics allow us to specify the mass and the width of the {rho}{sup -} resonance. In other hand, if the {rho}{sup -} production parameters are independent of the {rho}{sup -} width, it is not the same case for the decay parameters. In the second part, the Chew-Low extrapolation method allows us to determine the {pi}{sup -}{pi}{sup 0} elastic cross section to the pole, and the phase shifts of the P waves in the isospin 1 state and S waves in the isospin 2 state. (author) [French] L'etude de la reaction {pi}{sup -}p {yields} {pi}{sup -}{pi}{sup 0} p a 2.77 GeV/c, effectuee a l'aide de la chambre a bulles a hydrogene liquide de 2 metres du CERN, exposee aupres du synchrotron a protons, montre que 70 pour cent de cette reaction passe par la voie {pi}{sup -}p {yields} {rho}{sup -}p. L'abondance de la statistique a permis de preciser la masse et la largeur de la resonance {rho}{sup -}. D'autre part, si les parametres de la production du {rho}{sup -} sont independants de la largeur de la resonance, il n'en est pas de meme des parametres de la desintegration. Dans la deuxieme partie, la methode d'extrapolation de Chew et Low permet de determiner la section efficace de diffusion elastique {pi}{sup -}{pi}{sup 0} au pole, ainsi que les dephasages des ondes P dans l'etat d'isospin 1 et S dans l'etat d'isospin 2. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Yenen, O.; McLaughlin, K.W.; Jaecks, D.H. [Univ. of Nebraska, Lincoln, NE (United States)] [and others
1997-04-01
The measurement of the polarization of radiation from satellite states of Ar{sup +} formed after the photoionization of Ar provides detailed information about the nature of doubly excited states, magnetic sublevel cross sections and partial wave ratios of the photo-ejected electrons. Since the formation of these satellite states is a weak process, it is necessary to use a high flux beam of incoming photons. In addition, in order to resolve the many narrow doubly excited Ar resonances, the incoming photons must have a high resolution. The characteristics of the beam line 9.0.1 of the Advanced Light Source fulfill these requirements. The authors determined the polarization of 4765 {Angstrom} fluorescence from the Ar{sup +} [{sup 3}P] 4p {sup 2}P{sub 3/2}{sup 0} satellite state formed after photoionization of Ar by photons from the 9.0.1 beam line of ALS in the 35.620-38.261 eV energy range using a resolution of approximately 12,700. This is accomplished by measuring the intensities of the fluorescent light polarized parallel (I{parallel}) and perpendicular (I{perpendicular}) to the polarization axis of the incident synchrotron radiation using a Sterling Optics 105MB polarizing filter. The optical system placed at 90{degrees} with respect to the polarization axis of the incident light had a narrow band interference filter ({delta}{lambda}=0.3 nm) to isolate the fluorescent radiation.
Ferrer, A; Bouquet, B; D'Almagne, B; De Rosny, G; Nguyen, H; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Treille, D; Volte, A; Yoshida, H
1981-01-01
The authors have analysed about 85000 fast Lambda /sup 0/ events, obtained in a fast proton triggered experiment performed at the CERN- Omega spectrometer at 9 and 12 GeV/c incident pi /sup -/ beam. Nearly 2500 Lambda /sup 0/K/sup +/ pi /sup -/ events have been isolated. They find strong production of quasi-two-body processes Lambda /sup 0/K* /sup 0/ and Sigma */sup -/K/sup +/ consistent with u-channel hyperon exchange. Results on Lambda /sup 0/ polarization, K*/sup 0/ decay parameters and differential cross sections are given for Lambda /sup 0 /K*/sup 0/(892) and Lambda /sup 0/K*/sup 0/(1430) final states. A comparison is made with the associated backward Lambda /sup 0/(1520)K* /sup 0/ production seen in the four-prong reaction pi /sup -/p to pK /sup -/K/sup +/ pi /sup -/ obtained in the same experiment. (13 refs).
The three-loop splitting functions P{sup (2)}{sub qg} and P{sup (2,N{sub F})}{sub gg}
Energy Technology Data Exchange (ETDEWEB)
Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Behring, A. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); RWTH Aachen Univ. (Germany). Inst. fuer Theoretische Teilchenphysik und Kosmologie; Bluemlein, J.; Freitas, A. de [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Von Manteuffel, A. [Michigan State Univ., East Lansing, MI (United States). Dept. of Physics and Astronomy
2017-04-15
We calculate the unpolarized twist-2 three-loop splitting functions P{sup (2)}{sub qg}(x) and P{sup (2,N{sub F})}{sub gg}(x) and the associated anomalous dimensions using massive three-loop operator matrix elements. While we calculate P{sup (2,N{sub F})}{sub gg}(x) directly, P{sup (2)}{sub qg}(x) is computed from 1200 even moments, without any structural prejudice, using a hierarchy of recurrences obtained for the corresponding operator matrix element. The largest recurrence to be solved is of order 12 and degree 191. We confirm results in the foregoing literature.
Energy Technology Data Exchange (ETDEWEB)
Hoeibraten, S.
1989-05-01
This thesis describes an experimental study of the (..pi../sup +/, ..pi../sup 0/p) reaction at incident energy T/sub ..pi../sup +// = 165 MeV. This work is part of the first experiment to detect neutral pions and protons in coincidence in kinematically complete measurements. The reaction was studied on /sup 16/O (using water targets) at several pion angles: theta/sub ..pi../sup 0// = 70/degree/, 80/degree/, 110/degree/, and 130/degree/. At theta/sub ..pi../sup 0// = 110/degree/ measurements were also made on /sup 56/Fe, /sup 120/Sn, and /sup 208/Pb. The neutral pions were detected with the LAMPF ..pi../sup 0/ spectrometer, while the protons were detected in a vertical array of plastic-scintillator ..delta..E-E telescopes, each spanning 8.5 msr. Energy spectra of the differential cross sections d/sup 4/sigma/dE/sub ..pi../sup 0// dE/sub p/d..cap omega../sub ..pi../sup 0//d..cap omega../sub p/ were obtained for each proton telescope and subsequently integrated over proton and pion energy and proton angle. The characteristics of these spectra are consistent with a quasi-free description of the (..pi../sup +/,..pi../sup 0/p) reaction. The angular dependence of dsigma/d..cap omega../sub ..pi../sup 0//(theta/sub ..pi../sup 0//) for /sup 16/O(..pi../sup +/,..pi../sup 0/p) was found to be in accordance with that of the cross section for the corresponding free reaction at backward ..pi../sup 0/ angles. For the /sup 16/O(..pi../sup +/,..pi../sup 0/p) reaction, events in which a p-shell nucleon had been removed were identified. The p-shell events were found to constitute only 40--50% of the total cross section for quasi-free one-nucleon removal. The (..pi../sup +/,..pi../sup 0/p) cross section at theta/sub ..pi../sup 0// = 110/degree/ proved to be almost the same for all target nuclei, possibly slightly decreasing as a function of A. 102 refs., 108 figs., 24 tabs.
A rapid chemical method of labelling human plasma proteins with sup(99m)Tc-pertechnetate at pH 7.4
International Nuclear Information System (INIS)
Wong, D.W.; Mishkin, F.; Lee, T.
1978-01-01
A successful method for labelling human plasma proteins with sup(99m)Tc-pertechnetate by chemical means is described. The labelling methodology involves the production of Sup(99m)Tc-(Sn)citrate complex species with high protein binding capacity at pH 7.4 condition following initial chemical reduction of sodium sup(99m)Tc-pertechnetate by stannous chloride. A combined labelling efficiency range of 95-99% for sup(99m)Tc-labelled fibrinogen, immune gamma globulin and serum albumin is achieved. The actual amount of labelled protein content in the product is found to be 85-95% when assayed by ITLC and 74-85% by TCAA protein precipitation. In vitro experimental data indicate that sup(99m)Tc-fibrinogen contains an average of 85% clottable protein with an average clottability of 95%. This strongly suggests that the radioactive proteins retain much of their biological and physiological activities after the labelling process. (author)
Energy Technology Data Exchange (ETDEWEB)
Cassacnou, Y [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1966-07-01
Neutrons and gamma rays from the reaction {sup 51}V(p,n){sup 51}Cr have been studied between 2.3 and 5.1 MeV Energy levels of {sup 51}Cr at 0.75, 1.15, 1.35, 1.47 and 1.56 MeV and unresolved levels at 1.94, 2.4, 2.75 and 2.9 MeV are observed. The gamma ray cascades of the low-lying states of {sup 51}Cr up to 2.5 MeV excitation energy have been completely determined through coincidence measurements. From the cascade ratios and gamma ray yields, excitation functions for the {sup 51}V(p,n){sup 51}Cr reactions, leading to the five lowest levels of {sup 51}Cr have been obtained from reaction threshold to 4.6 MeV. The analysis of cross section fluctuations with good resolution shows they are due to the excitation of unresolved compound nucleus isolated resonances. From the decay scheme and an Hauser-Feshbach calculation of the {sup 51}V(p,n) excitation functions, spin assignments of 3/2{sup -}, or 5/2{sup -} (0.75 MeV), 7/2{sup -} (1.15 MeV), 3/2{sup -} (1.35 MeV), 5/2{sup -} (1.47 MeV) are proposed. (author) [French] La reaction {sup 51}V(p,n){sup 51}Cr a ete etudiee entre 2,3 et 5,1 MeV en detectant les neutrons et le rayonnement gamma de desexcitation des niveaux de {sup 51}Cr a 0,75, 1,15, 1,35, 1,47 et 1,56 MeV et de groupes non resolus de niveaux a 1,94, 2,4, 2,75 et 2,9 MeV. Des mesures de coincidence ont permis de determiner completement les desexcitations en cascade dans {sup 51}Cr jusqu'a 2,5 MeV et d'etablir, a partir des mesures de rayonnement gamma, les fonctions d'excitation des reactions {sup 51}V(p,n){sup 51}Cr formant les cinq premiers niveaux de {sup 51}Cr depuis le seuil jusqu'a 4,6 MeV. L'analyse en bonne resolution des fluctuations observees sur les sections efficaces montrent qu'elles sont dues a des resonances isolees du noyau compose non resolubles dans cette experience. Le schema de desexcitation de {sup 51}Cr et un calcul Hauser-Feshbach des fonctions d'excitation conduisent a proposer les spins suivants: 3/2{sup -} ou 5/2{sup -} pour le niveau
Energy Technology Data Exchange (ETDEWEB)
Romeo, Megan M.; Ko, Bookyung; Kim, Janice; Brady, Rebecca; Heatley, Hayley C.; He, Jeffrey; Harrod, Carolyn K.; Barnett, Braden [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States); Ratner, Lee [Departments of Medicine and Molecular Microbiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Lairmore, Michael D. [University of California-Davis, School of Veterinary Medicine, One Shields Avenue, Davis, CA 95618 (United States); Martinez, Ernest [Department of Biochemistry, University of California, Riverside, CA 92521 (United States); Lüscher, Bernhard [Institute of Biochemistry, Klinikum, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen (Germany); Robson, Craig N. [Northern Institute for Cancer Research, Newcastle University, The Medical School, Newcastle upon Tyne, NE2 4HH (United Kingdom); Henriksson, Marie [Department of Microbiology, Cell and Tumor Biology, Karolinska Institutet, Stockholm (Sweden); Harrod, Robert, E-mail: rharrod@smu.edu [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States)
2015-02-15
The human T-cell leukemia retrovirus type-1 (HTLV-1) p30{sup II} protein is a multifunctional latency-maintenance factor that negatively regulates viral gene expression and deregulates host signaling pathways involved in aberrant T-cell growth and proliferation. We have previously demonstrated that p30{sup II} interacts with the c-MYC oncoprotein and enhances c-MYC-dependent transcriptional and oncogenic functions. However, the molecular and biochemical events that mediate the cooperation between p30{sup II} and c-MYC remain to be completely understood. Herein we demonstrate that p30{sup II} induces lysine-acetylation of the c-MYC oncoprotein. Acetylation-defective c-MYC Lys→Arg substitution mutants are impaired for oncogenic transformation with p30{sup II} in c-myc{sup −/−} HO15.19 fibroblasts. Using dual-chromatin-immunoprecipitations (dual-ChIPs), we further demonstrate that p30{sup II} is present in c-MYC-containing nucleoprotein complexes in HTLV-1-transformed HuT-102 T-lymphocytes. Moreover, p30{sup II} inhibits apoptosis in proliferating cells expressing c-MYC under conditions of genotoxic stress. These findings suggest that c-MYC-acetylation is required for the cooperation between p30{sup II}/c-MYC which could promote proviral replication and contribute to HTLV-1-induced carcinogenesis. - Highlights: • Acetylation of c-MYC is required for oncogenic transformation by HTLV-1 p30{sup II}/c-MYC. • Acetylation-defective c-MYC mutants are impaired for foci-formation by p30{sup II}/c-MYC. • The HTLV-1 p30{sup II} protein induces lysine-acetylation of c-MYC. • p30{sup II} is present in c-MYC nucleoprotein complexes in HTLV-1-transformed T-cells. • HTLV-1 p30{sup II} inhibits apoptosis in c-MYC-expressing proliferating cells.
Chu, S.
1976-10-01
A measurement of the 6{sup 2}P{sub ½} --> 7{sup 2}P{sub ½} forbidden magnetic dipole matrix element in atomic thallium is described. A pulsed, linearly polarized dye laser tuned to the transition frequency is used to excite the thallium vapor from the 6{sup 2}P{sub ½} ground state to the 7{sup 2}P{sub ½} excited state. Interference between the magnetic dipole M1 amplitude and a static electric field induced E1 amplitude results in an atomic polarization of the 7{sup 2}P{sub ½} state, and the subsequent circular polarization of 535 nm fluorescence. The circular polarization is seen to be proportional to / as expected, and measured for several transitions between hyperfine levels of the 6{sup 2}P{sub ½} and 7{sup 2}P{sub ½} states. The result is = -(2.11 +- 0.30) x 10{sup -5} parallel bar e parallel bar dirac constant/2mc, in agreement with theory.
Energy Technology Data Exchange (ETDEWEB)
Sadeghi, Mahdi; Karimi, Elham; Hosseini, S. Hamed [Agricultural, Medical and Industrial Research School, Nuclear Science and Technology Research Institute, P.O. Box 31485/498, Karaj (Iran, Islamic Republic of); Faculty of Engineering, Research and Science Campus, Islamic Azad University, P.O. Box 14155/4933, Tehran (Iran, Islamic Republic of)
2009-11-15
Purpose: In the radionuclide treatment of some forms of brain tumors such as craniopharyngiomas, the selection of the appropriate radionuclide for therapy is a key element in treatment planning. The aim was to study the influence by considering the beta-emitter radionuclide dose rate in an intracranial cyst. Methods: Dosimetry was performed using the MCNP4C radiation transport code. Analytical dosimetry was additionally performed using the Loevinger and the Berger formulas in the MATLAB software. Each result was compared under identical conditions. The advantages and disadvantages of using {sup 90}Y versus {sup 32}P and {sup 186}Re were investigated. Results: The dose rate at the inner surface of the cyst wall was estimated to be 400 mGy/h for a 1 MBq/ml concentration of {sup 90}Y. Under identical conditions of treatment, the corresponding dose rates were 300 mGy/h for {sup 32}P and 160 mGy/h for {sup 186}Re. For a well-defined cyst radius and identical wall thickness, higher dose rates resulted for {sup 90}Y. Conclusions: To achieve the same radiological burden, the required amount of physical activity of injectable solution is lower for {sup 32}P. This is found to be a consequence of both the radionuclide physical half-life and the pattern of energy deposition from the emitted radiation. According to the half-life and dose-rate results, {sup 90}Y would be a good substitute for {sup 32}P.
Energy Technology Data Exchange (ETDEWEB)
Clajus, M.; Albert, J.; Bruno, M.; Egun, P.M.; Glockle, W.; Glombik, A.; Gruebler, W.; Hautle, P.; Kretschmer, W.; Rauscher, A.; Schmelzbach, P.A.; Slaus, I.; Weidmann, R.; Witala, H. [Inst. fuer Mittelenergiephys., Eidgenoessische Tech. Hochschule, Zurich (Switzerland)
1995-10-01
The polarization transfer coefficients K{sub x}{sup x}', K{sub y}{sup y}' and K{sub z}{sup x}' in the reaction {sup 2}H(p,p){sup 2}H have been measured at an incident proton energy of 22.5 MeV. The results are compared to predictions from Faddeev calculations using various nucleon-nucleon potential models. The overall agreement is rather good. The comparison in more detail shows a pronounced sensitivity of the results, especially for K{sub y}{sup y}', to the {sup 3}S{sub 1}-{sup 3}D{sub 1} and {sup 1}P{sub 1} NN force components. As in nucleon-nucleon scattering, however, these two parameters are correlated, thus hampering definite conclusions. (author)
Study of the impurity photoconductivity in p-InSb using epitaxial p{sup +} contacts
Energy Technology Data Exchange (ETDEWEB)
Eminov, Sh. O., E-mail: shikhamirem@gmail.com [National Academy of Sciences of Azerbaijan, Abdullaev Institute of Physics (Azerbaijan)
2016-08-15
The optical absorption coefficient α in p{sup +}-InSb layers (with hole concentrations of p ≈ 1 × 10{sup 17}–1.2 × 10{sup 19} cm{sup –3}), grown by liquid-phase epitaxy on p-InSb substrates, is measured in the spectral range of 5-12 µm at 90 K, and the impurity photoconductivity is measured (at 60 and 90 K) in p{sup +}–p structures. It is found that a in the p{sup +} layers reaches a value of 7000 cm{sup –1} (at p ≈ 2 × 10{sup 19} cm{sup –1}). It is shown that the measured substrate value of (α ≈1–3 cm{sup –1}) is overestimated in comparison with estimates (α ≈ 0.1 cm{sup –1}) based on comparing the photoconductivity data. This discrepancy is explained by the fact that the optical transitions of holes responsible for photoconductivity are obscured by the excitation of electrons to the conduction band. The photoionization cross section for these transitions does not exceed 1 × 10{sup –15} cm{sup 2}.
Energy Technology Data Exchange (ETDEWEB)
Iqbal, Sophia [California State Univ., Los Angeles, CA (United States)
2013-12-09
The structure and dynamics of <sup>4sup>He can be studied through <sup>4sup>He(e,e'p) coincidence measurements at high momentum transfers. Using the Hall A high resolution spectrometers and a cryogenic <sup>4sup>He target, the SRC (short range correlation) and E08009 experiments held at Jefferson Lab in April 2011 measured the entire range of missing momentum from 0.0 GeV/c to 0.9 GeV/c. The observables of interest in this experiment (E08009) are the missing energy and missing momenta for producing the triton (<sup>3sup>H) ground state. This thesis concentrates on missing momentum values of 153 and 353 MeV/c. Cross sections are calculated and compared to theory.
Chemical effects of /sup 32/P recoil atom
Energy Technology Data Exchange (ETDEWEB)
Matsuura, N [Tokyo Univ. (Japan). Coll. of General Education
1975-06-01
Szilard-Chalmers' effect of /sup 32/P were reviewed. The concentration method using Szilard-Chalmers' effect in production of radioisotope, circumstances such as exposure time in an atomic pile, states of target substances and the yields by them were discussed. Many kinds of chemical effects, such as chemical effects of /sup 32/P recoil atom in phosphorated glass, studies of the effect of adducts, the threshold of ..gamma..-ray effect, the oxidation number of /sup 32/P in phosphorated glass by exposure time in the pile and the labelling position of /sup 32/P, are associated with caryotransformation (nuclear transformation) by environmental factors. The abovementioned articles were explained concerning /sup 32/P.
Energy Technology Data Exchange (ETDEWEB)
Kestelman, A.J. [Laboratorio de Analisis por Activacion Neutronica, Centro Atomico Bariloche e Instituto Balseiro, Comision Nacional de Energia Atomica y Universidad Nacional de Cuyo, 8400 Bariloche (Argentina)]. E-mail: kestelma@cab.cnea.gov.ar; Ribeiro Guevara, S. [Laboratorio de Analisis por Activacion Neutronica, Centro Atomico Bariloche e Instituto Balseiro, Comision Nacional de Energia Atomica y Universidad Nacional de Cuyo, 8400 Bariloche (Argentina); Arribere, M.A. [Laboratorio de Analisis por Activacion Neutronica, Centro Atomico Bariloche e Instituto Balseiro, Comision Nacional de Energia Atomica y Universidad Nacional de Cuyo, 8400 Bariloche (Argentina); Cohen, I.M. [Universidad Tecnologica Nacional, Facultad Regional Buenos Aires, Medrano 951 (C1179AAQ) Buenos Aires (Argentina)
2007-07-15
Making use of the method developed in our laboratory for the simultaneous determination of cross sections leading to both the ground and metastable states, we have measured the {sup 68}Zn(n,p){sup 68g}Cu and {sup 68}Zn(n,p){sup 68m}Cu reactions, using Zn enriched to 99.4% in its isotope {sup 68}Zn. The measured cross sections are (15.04{+-}0.35) and (3.69{+-}0.30) {mu}b for the ground and metastable state, respectively. However, a direct determination of the cross section leading to the metastable state gives a value of (4.75{+-}0.38) {mu}b. A possible reason for this discrepancy-which is outside experimental uncertainties-is that some tabulated values used in our calculations for the decay parameters of {sup 68g}Cu and {sup 68m}Cu, have either larger than quoted, or unknown systematic, uncertainties.
Energy Technology Data Exchange (ETDEWEB)
Al-Abyad, M. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany); Cyclotron Facility, Nuclear Research Centre, Atomic Energy Authority, Cairo 13759 (Egypt); Comsan, M.N.H. [Cyclotron Facility, Nuclear Research Centre, Atomic Energy Authority, Cairo 13759 (Egypt); Qaim, S.M. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany)], E-mail: s.m.qaim@fz-juelich.de
2009-01-15
Excitation functions of the reactions {sup nat}Fe(p,xn){sup 55,56,57,58}Co, {sup nat}Fe(p,x){sup 51}Cr, {sup nat}Fe(p,x){sup 54}Mn, {sup 57}Fe(p,n){sup 57}Co and {sup 57}Fe(p,{alpha}){sup 54}Mn were measured from their respective thresholds up to 18.5 MeV, with particular emphasis on data for the production of the radionuclide {sup 57}Co (T{sub 1/2}=271.8 d). The conventional stacked-foil technique was used, and the samples for irradiation were prepared by an electroplating or sedimentation process. The measured excitation curves were compared with the data available in the literature as well as with results of nuclear model calculations. From the experimental data, the theoretical yields of the investigated radionuclides were calculated as a function of the proton energy. Over the energy range E{sub p}=15{yields}5 MeV the calculated yield of {sup 57}Co from the {sup 57}Fe(p,n){sup 57}Co process amounts to 1.2 MBq/{mu}A h and from the {sup nat}Fe(p,xn){sup 57}Co reaction to 0.025 MBq/{mu}A h. The radionuclidic impurity levels are discussed. Use of highly enriched {sup 57}Fe as target material would lead to formation of high-purity {sup 57}Co.
The [sup 26]Al(p,[gamma])[sup 27]Si reaction at low stellar temperature
Energy Technology Data Exchange (ETDEWEB)
Champagne, A E [North Carolina Univ., Chapel Hill, NC (United States). Dept. of Physics and Astronomy Duke Univ., Durham, NC (United States). Triangle Universities Nuclear Lab.; Brown, B A [Michigan State Univ., East Lansing, MI (United States). Dept. of Physics and Astronomy Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Sherr, R [Princeton Univ., NJ (United States). Dept. of Physics
1993-05-03
Shell-model calculations have been used to predict the locations of states in [sup 27]Si which are analogous to well-studied states in [sup 27]Al. From this, we have determined the resonance properties of the known states in [sup 27]Si near the [sup 26]Al+p threshold. The resulting thermonuclear reaction rate is uncertain by about a factor of ten at low temperatures, but it appears that the [sup 26]Al(p, [gamma])[sup 27]Si reaction is too slow to destroy a significant amount of [sup 26]Al at these temperatures. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Buehler, Marc [Univ. of Illinois, Chicago, IL (United States)
2005-01-01
A study of events with Z/γ* bosons and hadronic jets produced at the Tevatron in p$\\bar{p}$ collisions at a center of mass energy of 1.96 TeV is presented. The data consist of approximately 14,000 Z/γ* → e<sup>+e-> decay candidates from 343 pb<sup>-1sup> of integrated luminosity collected with the D0 detector. Cross sections and jet production properties have been measured for Z/γ* + ≥ 0 to 5 jet events. This measurement represents a significant improvement over previous measurements at the Tevatron, and it is the first at this center of mass energy with the D0 detector. The results are in good agreement with QCD predictions.
Energy Technology Data Exchange (ETDEWEB)
Johnston, Dale Morgan [Univ. of Nebraska, Lincoln, NE (United States)
2010-04-01
A search for the standard model Higgs boson in p$\\bar{p}$ collisions resulting in two muons and large missing transverse energy is presented. The analysis uses 4.2 fb<sup>-1sup> of integrated luminosity at a center-of-mass energy of √s = 1.96 TeV collected between April 2002 and December 2008 with the D0 detector at the Fermilab Tevatron collider. No significant excess above the background estimation is observed and limits are derived on Higgs boson production.
Reaction /sup 140/Ce (e, e'p), (2)
Energy Technology Data Exchange (ETDEWEB)
Saito, T; Shoda, K [Tohoku Univ., Sendai (Japan). Lab. of Nuclear Science
1975-06-01
An experiment was carried out to study the character of the resonance observed at 24.4 MeV in the /sup 140/Ce (..gamma.., p) /sup 139/La reaction. The (..gamma.., p/sub 0/ + p/sub 1/) cross section was measured at the angles of 54.7/sup 0/ and 125.3/sup 0/, at which the angle-dependent term of E1 becomes zero, for the energy range between 19 and 26 MeV. Existence of a peak due to the E2 resonance around 24.4 MeV was examined. The energy of incident electrons from a linear accelerator was changed between 20 and 26.7 MeV. The target was a Ce foil of 7.3 mg/cm/sup 2/ thick. The proton spectra due to the /sup 140/Ce (e, e' p) /sup 139/La reaction were measured with a broad range magnetic spectrometer. In the determined spectra of /sup 140/Ce (..gamma.., p/sub 0/+p/sub 1/) /sup 139/La, any remarkable peak, except one at 20.5 MeV, was not seen. From the observed spectra, the total cross section and the asymmetry factor due to interference were obtained as functions of energy. The values of the asymmetry factor were almost flat in the energy range between 19 and 26 MeV. The resonance at 24.4 MeV in the total cross section may be due to the E1 resonance, and is not due to the E2.
Tanida, H; Aoki, H; Ochiai, A
2003-01-01
We report unambiguous microscopic evidence from sup 3 sup 1 P NMR under H sub e sub x sub t approx = 7.3 T for significant ionic disorder in the Yb sup 3 sup + chain in Yb sub 4 (As sub 1 sub - sub x P sub x) sub 3 (x=0.05 and 0.40), which have similar characteristic chi(T) and C sub p (T, H sub e sub x sub t) behavior to the antiferromagnetic quantum spin chain (AFQSC) system Yb sub 4 As sub 3. Our conclusion is based on the observations only below the charge-ordering transition at T sub 0 approx = 292 K of clear structures in the spectrum, which can be fitted well by the superpositions of almost equally spaced five Gaussian components. Since perfect ordering of Yb sup 3 sup + in the chain sites would lead to a single-line spectrum also below T sub 0 , the structures should be ascribed to significant ionic disorder in the Yb sup 3 sup + chain and resulting distribution of local configurations of Yb sup 3 sup + in the eight nearest-neighboring Yb sites around sup 3 sup 1 P. Quantitative comparisons with a sim...
Csige, I
2003-01-01
sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn in the human environment are considered to be a risk factor because of the radiation dose due to the inhalation of their short-lived daughters. Main source of radon is usually the soil; therefore the measurement of fluxes of sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn on soil surfaces is often a relevant parameter to characterise building site radon potential. An etched track detector technique was developed to measure long-time average sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn fluxes. (R.P.)
{sup 2}H(d,p){sup 3}H and {sup 2}H(d,n){sup 3}He reactions at sub-coulomb energies
Energy Technology Data Exchange (ETDEWEB)
Tumino, A.; Spitaleri, C.; Mukhamedzhanov, A. M.; Typel, S.; Sparta, R.; Aliotta, M.; Kroha, V.; Hons, Z.; La Cognata, M.; Lamia, L.; Pizzone, R. G.; Mrazek, J.; Pizzone, R. G.; Rapisarda, G. G.; Romano, S.; Sergi, M. L. [Universita degli Studi di Enna Kore, and Laboratori Nazionali del Sud - INFN, via S. Sofia 62, 95123 Catania (Italy); Dipartimento di Fisica e Astronomia, Universita di Catania, and Laboratori Nazionali del Sud - INFN, via S. Sofia 62, 95123 Catania (Italy); Cyclotron Institute Texas A and M University - College Station, Texas (United States); Excellence Cluster Universe - Technische Universitaet Muenchen, Garching, Germany and GSI Helmholtzzentrum fuer Schwerionenforschung GmbH - Theorie Darmstadt (Germany); Dipartimento di Fisica e Astronomia, Universita di Catania, and Laboratori Nazionali del Sud - INFN, via S. Sofia 62, 95123 Catania (Italy); School of Physics and Astronomy - University of Edinburgh, SUPA (United Kingdom); Nuclear Physics Institute of ASCR - Rez near Prague (Czech Republic); Dipartimento di Fisica e Astronomia, Universita di Catania, and Laboratori Nazionali del Sud - INFN, via S. Sofia 62, 95123 Catania (Italy); Nuclear Physics Institute of ASCR - Rez near Prague (Czech Republic); Dipartimento di Fisica e Astronomia, Universita di Catania, and Laboratori Nazionali del Sud - INFN, via S. Sofia 62, 95123 Catania (Italy)
2012-11-20
The {sup 2}H({sup 3}He,p{sup 3}H){sup 1}H and {sup 2}H({sup 3}He,n{sup 3}He){sup 1}H processes have been measured in quasi free kinematics to investigate for the first time the {sup 2}H(d,p){sup 3}H and {sup 2}H(d,n){sup 3}He reactions by means of the Trojan Horse Method. The {sup 3}He+d experiment was performed at 18 MeV, corresponding the a d-d energy range from 1.5 MeV down to 2 keV. This range overlaps with the relevant region for Standard Big Bang Nucleosynthesis as well as with the thermal energies of future fusion reactors and deuterium burning in the Pre Main Sequence phase of stellar evolution. This is the first pioneering experiment in quasi free regime where the charged spectator is detected. Both the energy dependence and the absolute value of the bare nucleus S(E) factors have been extracted for the first time. They deviate by more than 15% from available direct data with new S(0) values of 57.4{+-}1.8 MeVb for {sup 3}H+p and 60.1{+-}1.9 MeVb for {sup 3}He+n. None of the existing fitting curves is able to provide the correct slope of the new data in the full range, thus calling for a revision of the theoretical description. This has consequences in the calculation of the reaction rates with more than a 25% increase at the temperatures of future fusion reactors.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez, J; Gaeta, R; Vano, E; Los Arcos, J M
1978-07-01
The excited levels in 233{sup P}a following the 237{sup N}p alpha decay have been studied, by performing different experiences to complete available data and supply new information. Thus, two direct alpha spectrum measurement, one alpha-gamma bidimensional coincidence experiment, three gamma-gamma and gamma-X ray coincidences and some other measurements of the gamma spectrum, direct and coincident with alpha-particles have been made. These last experiences have allowed to obviate usual radiochemical separation methods, the 233{sup P}a radioactive descendent interferences being eliminated by means of the coincidence technic. As a result, a primary decay scheme has been elaborated, including 15 new gamma transitions and two new levels, not observed in the most recent works. (Author) 60 refs.
Study of the reaction {gamma}p {yields} p{pi}{sup 0}{eta}
Energy Technology Data Exchange (ETDEWEB)
Horn, I.; Bartholomy, O.; Beck, R.; Ehmanns, A.; Ernst, J.; Fabry, I.; Fuchs, M.; Funke, C.; Gutz, E.; Junkersfeld, J.; Kalinowsky, H.; Klempt, E.; Lotz, J.; Pee, H. van; Schmidt, C.; Szczepanek, T.; Thoma, U.; Walther, D.; Weinheimer, C. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Anisovich, A.V.; Nikonov, V.A.; Sarantsev, A.V. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Anton, G.; Bogendoerfer, R.; Foesel, A.; Hoessl, J.; Suft, G. [Universitaet Erlangen, Physikalisches Institut, Erlangen (Germany); Bantes, R.; Gothe, R.; Hoeffgen, S.; Klein, F.; Konrad, M.; Langheinrich, J.; Menze, D.; Ostrick, M.; Schmieden, H.; Schoch, B. [Universitaet Bonn, Physikalisches Institut, Bonn (Germany); Beloglazov, Y.; Gridnev, A.; Lopatin, I.; Novinski, D.; Sumachev, V. [Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Castelijns, R.; Loehner, H. [Kernfysisch Versneller Instituut, Groningen (Netherlands); Crede, V. [Florida State University, Department of Physics, Tallahassee, FL (United States); Flemming, H.; Koch, H.; Kopf, B.; Matthaey, H. [Universitaet Bochum, Institut fuer Experimentalphysik I, Bochum (Germany); Krusche, B. [Universitaet Basel, Institut fuer Physik, Basel (Switzerland); Messchendorp, J.; Metag, V. [Universitaet Giessen, II. Physikalisches Institut, Giessen (Germany)
2008-11-15
The reaction {gamma}p {yields} p{pi}{sup 0}{eta} has been studied with the CBELSA detector at the tagged photon beam of the Bonn electron stretcher facility. The reaction shows contributions from {delta}{sup +}(1232){eta}, N(1535){sup +}{pi}{sup 0} and pa{sub 0}(980) as intermediate states. A partial-wave analysis suggests that the reaction proceeds via formation of six {delta} -resonances, {delta}(1600)P{sub 33}, {delta}(1920)P{sub 33}, {delta}(1700)D{sub 33}, {delta}(1940)D{sub 33}, {delta}(1905)F{sub 35}, {delta}(2360)D{sub 33}, and two nucleon resonances N(1880)P{sub 11} and N(2200)P{sub 13}, for which pole positions and decay branching ratios are given. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Sunitha, Y., E-mail: sunibarc@gmail.com; Kumar, Sanjiv
2017-06-01
A proton induced γ-ray emission method based on {sup 7}Li(p,γ){sup 8}Be proton capture reaction and a nuclear reaction analysis method involving {sup 7}Li(p,α){sup 4}He reaction are described for depth profiling Li in the electrode materials, graphite and lithium cobalt oxide for example, of a Li-ion battery. Depth profiling by {sup 7}Li(p,γ){sup 8}Be reaction is accomplished by the resonance at 441 keV and involves the measurement of 14.6 and 17.6 MeV γ-rays, characteristic of the reaction, by a NaI(Tl) detector. The method has a detection sensitivity of ∼0.2 at% and enables profiling up to a depth ≥20 µm with a resolution of ≥150 nm. The profiling to a fairly large depth is facilitated by the absence of any other resonance up to 1800 keV proton energy. The reaction has substantial off-resonance cross-sections. A procedure is outlined for evaluating the off-resonance yields. Interferences from fluorine and aluminium are major limitation of this depth profiling methodology. The depth profile measurement by {sup 7}Li(p,α){sup 4}He reaction, on the other hand, utilises 2–3 MeV protons and entails the detection of α-particles at 90° or 150° angles. The reaction exhibits inverse kinematics at 150°. This method, too, suffers interference from fluorine due to the simultaneous occurrence of {sup 19}F(p,α){sup 16}O reaction. Kinematical considerations show that the interference is minimal at 90° and thus is the recommended angle of detection. The method is endowed with a detection sensitivity of ∼0.1 at%, a depth resolution of ∼100 nm and a probing depth of about 30 µm in the absence and 5–8 µm in the presence of fluorine in the material. Both methods yielded comparable depth profiles of Li in the cathode (lithium cobalt oxide) and the anode (graphite) of a Li-ion battery.
Energy Technology Data Exchange (ETDEWEB)
Aziz, H.; Choi, K.; Sohn, C.; Yaes, R.; Rotman, M.
1986-06-01
We report a retrospective study of 15 patients with prostate carcinoma and diffuse bone metastases treated with sodium /sup 32/P for palliation of pain at Downstate Medical Center and Kings County Hospital from 1973 to 1978. The response rates, duration of response, and toxicities are compared with those of other series of patients treated with /sup 32/P and with sequential hemibody irradiation. The response rates and duration of response are similar with both modalities ranging from 58 to 95% with a duration of 3.3 to 6 months with /sup 32/P and from 75 to 86% with a median duration of 5.5 months with hemibody irradiation. There are significant differences in the patterns of response and in the toxicities of the two treatment methods. Both methods cause significant bone marrow depression. Acute radiation syndrome, radiation pneumonitis, and alopecia are seen with sequential hemibody irradiation and not with /sup 32/P, but their incidence can be reduced by careful treatment planning. Hemibody irradiation can provide pain relief within 24 to 48 h, while /sup 32/P may produce an initial exacerbation of pain. Lower hemibody irradiation alone is less toxic than either upper hemibody irradiation or /sup 32/P treatment.
Energy Technology Data Exchange (ETDEWEB)
Mokhtari Oranj, Leila [Division of Advanced Nuclear Engineering, POSTECH, Pohang 37673 (Korea, Republic of); Jung, Nam-Suk; Oh, Joo-Hee [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of); Lee, Hee-Seock, E-mail: lee@postech.ac.kr [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of)
2016-05-15
The proton beam intensity of a 100-MeV proton linac at the Korea Multi-purpose Accelerator Complex (KOMAC) was measured by an Au activation analysis using {sup 197}Au(p, pn){sup 196}Au and {sup 197}Au(p, p3n){sup 194}Au reactions to determine the accuracy and precision of beam intensity measurement using Gafchromic film dosimetry method. The target, irradiated by 100-MeV protons, was arranged in a stack consisting of Au, Al foils and Pb plates. The yields of produced radio-nuclei in Au foils were obtained by gamma-ray spectroscopy. The FLUKA code was employed to calculate the energy spectrum of protons onto the front surface of Au foils located at three different depth points of the target and also to investigate the condition of incident beam on the target. A good agreement was found between the beam intensity measurements using the activation analysis method at three different depth points of the target. An excellent agreement was also observed between the beam intensity measurements using the Au activation analysis method and the dosimetry method using Gafchromic film.
Energy Technology Data Exchange (ETDEWEB)
Perepelitsa, V.F.; Mikhailichenko, V.I.; Nikitin, S.Ya.; Zhokin, A.S. (Institut Teoreticheskoj i Ehksperimental' noj Fiziki, Moscow (USSR)); Akopov, N.Z.; Grigoryan, A.A.; Karapetyan, V.V. (Erevanskij Fizicheskij Inst., Erevan (USSR)); Dorsaz, L.; Sonderegger, P. (European Organization for Nuclear Research, Geneva (Switzerland)); Ferrer, A. (Centro Mixto Valencia Univ./CSIC, Valencia (Spain). Inst. de Fisica Corpuscular)
1991-05-01
We have analyzed backward meson production in {pi}{sup +}p reactions at 20 GeV/c, which were measured in the CERN {Omega} spectrometer triggered by a fast proton (p{sub f}), in experiment WA 56. Production via baryon exchange of quasi-two-body final states {Delta}{sup ++}(1232) rho{sup 0}(770), {Delta}{sup ++}(1232) f{sub 2}(1270) and {Delta}{sup ++}(1232) rho{sub 3}{sup 0}(1690) is clearly identified. The density matrix elements of meson resonances and of {Delta}{sup ++}(1232) are analyzed. We have observed also the reactions {pi}{sup +}p->{Delta}{sup ++}(1232){pi}{sup 0} and {pi}{sup +}p->{Delta}{sup ++}(1232){omega} in the p{sub f}{pi}{sup +}{pi}{sup 0} and p{sub f}{pi}{sup +}{pi}{sup +}{pi}{sup -}{pi}{sup 0} final states. (orig.).
Energy Technology Data Exchange (ETDEWEB)
Molnar, Gy.; Pal, I.; Stuetzel, M.; Jaky, L. [Third Department of Medicine, University Medical School and Institute of Isotopes of the Hungarian Academy of Sciences, Budapest (Hungary)
1971-02-15
Some metal complexes are suitable for determination of the glomerular filtration rate (GFR). A series of labelled EDTA and DTPA complexes have been produced during the last two years by the Isotope Institute of the Hungarian Academy of Sciences. The common property of EDTA and DTPA complexes is their great stability, which is a major advantage over the iodinated compounds. We have demonstrated that none of the complexes used by us combine with plasma proteins or penetrate into the red blood cells. There is evidence that EDTA and DTPA leave the body exclusively by way of glomerular filtration. The results of more than 600 cases are presented. {sup 169}Yb EDTA was used in 315, {sup 51}Cr EDTA in 126, {sup 114m}In EDTA in 83, {sup 58}Co DTPA in 72 and {sup 115m}In EDTA in 28 cases for determination of GFR. The injected activity was 0.3 -4.0 {mu}Ci/kg body weight. In most cases the result has been compared with the 24-h endogenous creatine clearance, and in 50 cases with inulin clearance also. In general the single-shot method was used. Blood samples were taken about the first and the second hour after injection of the isotope. A formula is given for calculating GFR. In a few cases we administered the isotope in the same way as inulin (priming dose and constant plasma concentration sustained by an infusion pump). Our results show that the single-shot method is a very suitable one in routine clinical practice either in states of normal or reduced kidney function. Using the single-shot method for GFR determination is especially important in those cases where the collection of urine is impossible without using a catheter, which always entails the risk of infection. Results are reliable even in disorders of the urinary tract. During or after the procedure no side effects could be observed. (author)
International Nuclear Information System (INIS)
Zhang Weifang; Li Jing; Kanginakudru, Sriramana; Zhao Weiming; Yu Xiuping; Chen, Jason J.
2010-01-01
HPV type 58 (HPV-58) is the third most common HPV type in cervical cancer from Eastern Asia, yet little is known about how it promotes carcinogenesis. In this study, we demonstrate that HPV-58 E7 significantly promoted the proliferation and extended the lifespan of primary human keratinocytes (PHKs). HPV-58 E7 abrogated the G1 and the postmitotic checkpoints, although less efficiently than HPV-16 E7. Consistent with these observations, HPV-58 E7 down-regulated the cellular tumor suppressor pRb to a lesser extent than HPV-16 E7. Similar to HPV-16 E7 expressing PHKs, Cdk2 remained active in HPV-58 E7 expressing PHKs despite the presence of elevated levels of p53 and p21. Interestingly, HPV-58 E7 down-regulated p130 more efficiently than HPV-16 E7. Our study demonstrates a correlation between the ability of down-regulating pRb/p130 and abrogating cell cycle checkpoints by HPV-58 E7, which also correlates with the biological risks of cervical cancer progression associated with HPV-58 infection.
A study of pi /sup -/ pi /sup -/ scattering from pi /sup -/p interactions at 393 GeV/c
Losty, Michael J; Chaloupka, V; Ferrando, A; Gandois, B; Louie, J; Montanet, Lucien; Paul, E; Yaffe, D; Zieminski, A
1974-01-01
A modified Chew-Low extrapolation procedure is applied to the reaction pi /sup -/p to Delta /sup ++/ pi /sup -/ pi /sup -/ to extract the I=2 pi pi elastic cross sections from threshold to 1260 MeV. The predictions of the one-pion-exchange model are used to estimate the contributions from background processes of the type pi /sup -/p to Delta /sup 0/ rho /sup 0/. The moments of the pi /sup -/ pi /sup -/ angular distribution are also extrapolated to the pion pole and a phase shift analysis performed. The s-wave inelasticity is constrained using information on the inelastic cross section coming from six-body final states. The magnitude of the s-wave phase shift at the K/sup 0/ mass is found to be 7.2 degrees +or-1.0 degrees , increasing to 26.2 degrees +or-2.5 degrees at 1 GeV. d- and g-waves contribute above about 900 MeV, but the corresponding phase shifts are small compared with the s-wave. All three phase shifts have the same sign. (24 refs).
Energy Technology Data Exchange (ETDEWEB)
Mermaz, M. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1966-06-01
The two sets of angular distributions of (d,p) reactions on Al and Mg, measured between 2 and 6 MeV, have given the possibility to test, in analysing the statistical fluctuations of cross-section, the validity of the separation of their mean values in two parts, one 'direct', another given by the statistical mechanism. With the same method of analysis we have studied excitation functions for several alpha groups of the reaction {sup 24}Mg(d, {alpha}) {sup 22}Na and given an evidence for an intermediate structure for the alpha channel leading to the 3. excited state of {sup 22}Na. The angular distribution of the wide resonance at 15.9 MeV in {sup 26}Al has been obtained. (author) [French] Les deux ensembles de distributions angulaires des reactions (d,p) sur Al et Mg, mesures entre 2 et 6 MeV, nous ont permis, en analysant les fluctuations statistiques de sections efficaces, de verifier la possibilite de la separation de leurs valeurs moyennes en deux composantes: l'une 'directe', l'autre due au mecanisme statistique. Avec la meme methode d'analyse nous avons etudie les fonctions d'excitation des premiers groupes alpha de la reaction {sup 24}Mg(d,{alpha}) {sup 22}Na et mis en evidence une structure intermediaire pour la voie de reaction aboutissant au 3eme niveau de {sup 22}Na. Nous avons obtenu la distribution angulaire de la resonance large situee a une energie d'excitation de 15,9 MeV dans {sup 26}Al. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Mermaz, M [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1966-06-01
The two sets of angular distributions of (d,p) reactions on Al and Mg, measured between 2 and 6 MeV, have given the possibility to test, in analysing the statistical fluctuations of cross-section, the validity of the separation of their mean values in two parts, one 'direct', another given by the statistical mechanism. With the same method of analysis we have studied excitation functions for several alpha groups of the reaction {sup 24}Mg(d, {alpha}) {sup 22}Na and given an evidence for an intermediate structure for the alpha channel leading to the 3. excited state of {sup 22}Na. The angular distribution of the wide resonance at 15.9 MeV in {sup 26}Al has been obtained. (author) [French] Les deux ensembles de distributions angulaires des reactions (d,p) sur Al et Mg, mesures entre 2 et 6 MeV, nous ont permis, en analysant les fluctuations statistiques de sections efficaces, de verifier la possibilite de la separation de leurs valeurs moyennes en deux composantes: l'une 'directe', l'autre due au mecanisme statistique. Avec la meme methode d'analyse nous avons etudie les fonctions d'excitation des premiers groupes alpha de la reaction {sup 24}Mg(d,{alpha}) {sup 22}Na et mis en evidence une structure intermediaire pour la voie de reaction aboutissant au 3eme niveau de {sup 22}Na. Nous avons obtenu la distribution angulaire de la resonance large situee a une energie d'excitation de 15,9 MeV dans {sup 26}Al. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Toffoletti, Lorenzo; Landesfeind, Johannes; Klein, Wilhelm; Gasteiger, Hubert A.; Faessler, Thomas F. [Department of Chemistry, Technische Universitaet Muenchen, Lichtenbergstrasse 4, 85747, Garching bei Muenchen (Germany); Kirchhain, Holger; Wuellen, Leo van [Department of Physics, University of Augsburg, Universitaetsstrasse 1, 86159, Augsburg (Germany)
2016-12-05
The need to improve electrodes and Li-ion conducting materials for rechargeable all-solid-state batteries has drawn enhanced attention to the investigation of lithium-rich compounds. The study of the ternary system Li-Si-P revealed a series of new compounds, two of which, Li{sub 8}SiP{sub 4} and Li{sub 2}SiP{sub 2}, are presented. Both phases represent members of a new family of Li ion conductors that display Li ion conductivity in the range from 1.15(7) x 10{sup -6} Scm{sup -1} at 0 C to 1.2(2) x 10{sup -4} Scm{sup -1} at 75 C (Li{sub 8}SiP{sub 4}) and from 6.1(7) x 10{sup -8} Scm{sup -1} at 0 C to 6(1) x 10{sup -6} Scm{sup -1} at 75 C (Li{sub 2}SiP{sub 2}), as determined by impedance measurements. Temperature-dependent solid-state {sup 7}Li NMR spectroscopy revealed low activation energies of about 36 kJ mol{sup -1} for Li{sub 8}SiP{sub 4} and about 47 kJ mol{sup -1} for Li{sub 2}SiP{sub 2}. Both compounds were structurally characterized by X-ray diffraction analysis (single crystal and powder methods) and by {sup 7}Li, {sup 29}Si, and {sup 31}P MAS NMR spectroscopy. Both phases consist of tetrahedral SiP{sub 4} anions and Li counterions. Li{sub 8}SiP{sub 4} contains isolated SiP{sub 4} units surrounded by Li atoms, while Li{sub 2}SiP{sub 2} comprises a three-dimensional network based on corner-sharing SiP{sub 4} tetrahedra, with the Li ions located in cavities and channels. (copyright 2016 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)
New excited states in sd-shell nucleus {sup 33}P
Energy Technology Data Exchange (ETDEWEB)
Fu, B.; Reiter, P.; Arnswald, K.; Hess, H.; Hirsch, R.; Lewandowski, L.; Schneiders, D.; Seidlitz, M.; Siebeck, B.; Steinbach, T.; Vogt, A.; Wendt, A.; Wolf, K. [Institut fuer Kernphysik, Universitaet zu Koeln (Germany)
2015-07-01
Isospin-symmetry breaking in nuclear physics is mainly described by Mirror-Energy Differences (MED) for mirror nuclei or Triplet-Energy Differences (TED) for isobaric triplets. Modified USD-calculations successfully reproduce MED for T=1,3/2,2 sd-shell nuclei. Refined tests of theory are given by lifetime measurements in order to deduce transition-strength values. In order to study the mirror pair {sup 33}Ar and {sup 33}P, the fusion-evaporation reaction {sup 13}C+{sup 26}Mg at 46 MeV was measured at the Cologne tandem accelerator and the HORUS spectrometer employing the Doppler-Shift-Attenuation-Method (DSAM). First results yielded new γ-ray transitions in {sup 33}P and {sup 33}S. The level scheme of {sup 33}P was extended up to excitation energies of 10 MeV. Spins and parities of the new levels were determined exploiting γγ-angular correlations. Together with values from the proton-rich T{sub z} = - 3/2 partner, the levels are compared to shell model calculations, describing excitation energies of sd -shell mirror pairs. The understanding of isospin symmetry and isospin-symmetry breaking is a fundamental question in nuclear physics. Isospin-symmetry breaking is mainly described by Mirror-Energy Differences (MED) for mirror nuclei or Triplet-Energy Differences (TED) for isobaric triplets. Modified USD{sup m}{sub 1,2,3}-calculations successfully reproduced MED for the mirror nuclei {sup 33}Ar and {sup 33}P. Both {sup 33}P and {sup 33}S were produced at the Cologne FN tandem accelerator employing the fusion-evaporation reaction {sup 13}C+{sup 26}Mg at 46 MeV and spectroscopically investigated using 14 HPGe detectors. Several new energy states (in {sup 33}P) and γ-ray transitions (in {sup 33}P and {sup 33}S) were detected. Spins and parities of the new levels in {sup 33}P were determined exploiting γγ-angular correlations. The level scheme of {sup 33}P was extended up to excitation energies of 10 MeV.
International Nuclear Information System (INIS)
Studencki, A.B.; Wallace, R.B.
1984-01-01
The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence
Barreiro, F; Hemingway, R J; Holmgren, S O; Kluyver, J G; Losty, Michael J; Massaro, G G G; Timmermans, J; Van de Walle, R T; Zalewski, K
1977-01-01
Transversity amplitudes and spin density matrix elements are determined for the process K/sup -/p to ( pi /sup +/ pi /sup -/) Sigma /sup 0/(1385)/sub s-wave/. Predictions of the additive quark model and of duality diagrams are tested and found consistent with the data; this is the first information about the applicability of these models to processes where a scalar object is produced at the mesonic vertex. (5 refs).
A review on the current status and production technology of {sup 32,} {sup 33}P-orthophosphoric acid
Energy Technology Data Exchange (ETDEWEB)
Park, Ul Jae; Han, Hyun Soo; Cho, Woon Kap; Kuznetsov, Rostislav A
2000-10-01
The current status of {sup 32}, {sup 33}P-Orthophosphoric acid production technology is reviewed. The following aspects of the technology are covered: - production of phosphorus-32 and phosphorus-33 using various nuclear reactions; - chemical properties of sulfur and phosphorus effecting the technology of radioactive phosphorus production; - chemical state of {sup 32}, {sup 33}P in neutron irradiated sulfur; - the technology of radioactive phosphorus isolation from neutron irradiated target and orthophosphoric acid production; - purification of {sup 32}, {sup 33}P-orthophosphoric acid from impurities and some related problems, like the nature of impurities, the storage of the final product, etc. - the quality control procedures of carrier-free ({sup 32}, {sup 33}P)-orthophosphoric acid preparations.
Energy Technology Data Exchange (ETDEWEB)
Santos C, C.L.; Ferro F, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Murphy, C.A de [INCMNSZ, 14000 Mexico D.F. (Mexico); Cardena, E.; Pichardo R, P. [Departamento de Medicina Nuclear, Oncologia Centro Medico Siglo XXI, Mexico D.F. (Mexico)
2007-07-01
Full text: Bombesin (BN) receptor subtype 2 (GRP-r) is over-expressed on various human tumors including breast, prostate, small cell lung and pancreatic cancer. Recently we reported the {sup 99-}mTc-EDDA/HYNIC-[Lys{sup 3}]-Bombesin ({sup 99m}Tc-HYNIC-BN) complex as a new radiopharmaceutical with high stability in human serum, specific cell GRP-receptor binding and rapid internalization. The aim of this study was to evaluate the {sup 99m}Tc-HYNIC-BN biokinetics and dosimetry in 5-healthy and 3-breast cancer women. Whole-body images were acquired at 20, 90, 180 min and 24 h after {sup 99m}Tc-HYNIC-BN administration. Regions of interest (ROIs) were drawn around source' organs on each time frame. The same set of ROIs was used for all 8 scans and the cpm of each ROI was converted to activity using the conjugate view counting method. The image sequence was used to extrapolate {sup 99m}Tc-HYNIC-BN time activity curves in each organ, to calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation dose estimates. Images showed a rapid radiopharmaceutical blood clearance with predominantly renal excretion and minimal hepatobiliary elimination. {sup 99m}Tc-HYNIC-BN exhibited high in vivo affinity for GRP-r over-expression successfully visualized in breast cancer lesions and well differentiated from GRP-r expression in lungs and airways with normal GRP-r density (ratio 3:1). The equivalent doses for a study using 370 MBq were 7.38{+-}1.68, 0.59{+-}0.08, 2.07{+-}0.60, 0.58{+-}0.1, 0.75{+-}0.09 and 0.43{+-}0.07 mSv for kidneys, liver, lungs, ovaries, pancreas and red marrow respectively. The effective dose was 1.64{+-}0.25 mSv which is comparable with the doses known for most of the {sup 99m}Tc radiopharmaceutical studies in nuclear medicine. (Author)
Aguilar-Benítez, M; Hemingway, Richard J; Holmgren, S O; Losty, Michael J; Toet, D Z; Worden, R P; Zatz, J; Kluyver, J C; Massaro, G G G; Wolters, G F; Engelen, J J; Tiecke, H G; Vergeest, J S M; Van de Walle, R T
1977-01-01
Results are presented for the quasi two-body hypercharge exchange reactions of the type 0/sup -1///sub 2//sup +/ to 1/sup -3///sub 2 //sup +/, i.e. K/sup -/p to rho /sup -/ Sigma /sup +/(1385) or K/sup - /p to phi Sigma /sup 0/(1385), and 0/sup -1///sub 2//sup +/ to 1/sup -3///sub 2//sup -/, i.e. K/sup -/p to omega Lambda (1520) or K/sup -/p to phi Lambda (1520), using data from a high statistics bubble chamber experiment. Total and differential cross sections and the momentum transfer dependence of the meson and hyperon resonance single density matrix elements are discussed. Amplitude analyses are performed for the first two reactions. The results are compared with quark model and duality predictions and with those from other related reactions. (7 refs).
Directory of Open Access Journals (Sweden)
Zunlue Zhu
2012-07-01
Full Text Available The potential energy curves (PECs of the X<sup>2sup>Π and A<sup>2sup>Π electronic states of the SO<sup>+> ion are calculated using the complete active space self-consistent field method, which is followed by the internally contracted multireference configuration interaction (MRCI approach for internuclear separations from 0.08 to 1.06 nm. The spin-orbit coupling effect on the spectroscopic parameters is included using the Breit-Pauli operator. To improve the quality of PECs and spin-orbit coupling constant (A0, core-valence correlation and scalar relativistic corrections are included. To obtain more reliable results, the PECs obtained by the MRCI calculations are corrected for size-extensivity errors by means of the Davidson modification (MRCI+Q. At the MRCI+Q/aug-cc-pV5Z+CV+DK level, the A0 values of the SO<sup>+(X>2sup>Π1/2, 3/2 and SO<sup>+(A>2sup>Π1/2, 3/2 are 362.13 and 58.16 cm<sup>−1sup> when the aug-cc-pCVTZ basis set is used to calculate the spin-orbit coupling splitting, and the A0 of the SO<sup>+(X>2sup>Π1/2, 3/2 and SO<sup>+(A>2sup>Π1/2, 3/2 are 344.36 and 52.90 cm<sup>−1sup> when the aug-cc-pVTZ basis set is used to calculate the spin-orbit coupling splitting. The conclusion is drawn that the core-valence correlations correction makes the A0 slightly larger. The spectroscopic results are obtained and compared with those reported in the literature. Excellent agreement exists between the present results and the measurements. The vibrational manifolds are calculated, and those of the first 30 vibrational states are reported for the J = 0 case. Comparison with the measurements shows that the present vibrational manifolds are both reliable and accurate.
Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)
International Nuclear Information System (INIS)
Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.
1987-01-01
The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia
Search for narrow p states in the reaction pi /sup -/p to p pi /sup - /pp at 16 GeV/c
Chung, S U; Bensinger, J; Button-Shafer, J; Dhar, S; Dowd, J; Etkin, A; Fernow, R; Foley, K; Goldman, J H; Kern, W; Kirk, H; Kopp, J; Kramer, M A; Lesnik, A; Lichti, R; Lindenbaum, S J; Love, W; Mallik, U; Morris, T; Morris, W; Ozaki, S; Platner, E; Protopopescu, S D; Saulys, A; Weygand, D P; Wheeler, C D; Willen, E; Winik, M
1981-01-01
The authors have carried out a sensitive (>or approximately=5 events /nb) search for narrow pp states at the BNL Multiparticle Spectrometer. They found no evidence of narrow pp states at 2020 and 2200 MeV in the reaction pi /sup -/p to p pi /sup -/pp at 16 GeV/c. The authors quote 2 sigma upper limits of or approximately=5 sigma signals at 2020 and 2200 MeV. (5 refs).
J{sup P} = (1)/(2){sup +}, (3)/(2){sup +} masses in the statistical model
Energy Technology Data Exchange (ETDEWEB)
Kaur, Amanpreet; Upadhyay, Alka [Thapar University, School of Physics and Materials Science, Patiala (India)
2016-11-15
The mass formulae for the baryon octet and decuplet are calculated. These formulae are function of constituent quark masses and spin-spin interaction terms for the quarks inside the baryons. The coefficients in the mass formulae are estimated by the statistical model for J{sup P} = 1/2{sup +}, 3/2{sup +}, incorporating the contributions from the ''sea'' containing u anti u, d anti d, s anti s pairs and gluons. The measured masses are presented and found to be matching well with some of the experimental and theoretical data. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Youxiang, Zhuang [Chinese Nuclear Data Center, Beijing, BJ (China)
1996-06-01
The medical radioisotopes are used for diagnostic and therapeutic purposes, as well as metabolism and physiological function researches in modern medicine. The major applications are of functional imaging using PET agents for {sup 18}F, various therapeutic pharmaceuticals via auger electrons for {sup 77}Br, cancers diagnosis and therapy for {sup 186}Re. The evaluations of experimental data and theoretical calculations for {sup 18}O, {sup 77}Se, {sup 187}W(p,n) reactions up to 80 MeV are presented and analysed. The recommended values for {sup 18}O(p,n){sup 18}F, {sup 77}Se(p,n){sup 77}Br and {sup 186}W(p,n){sup 186}Re reaction cross sections are given. (6 figs.).
Energy Technology Data Exchange (ETDEWEB)
Smith, M S; Magnus, P V; Hahn, K I; Howard, A J; Parker, P D [A.W. Wright Nuclear Structure Lab., Yale Univ., New Haven, CT (United States); Champagne, A E; Mao, Z Q [Dept. of Physics, Princeton Univ., NJ (United States)
1992-01-13
A high-precision measurement of the {sup 20}Ne({sup 3}He,t){sup 20}Na reaction has been made using implanted {sup 20}Ne transmission targets to obtain pertinent information on the low-energy resonances in the {sup 19}Ne(p,{gamma}){sup 20}Na reaction. Resonance energies (447{+-}5, 658{+-}5, 787{+-}5, and 857{+-}5 keV) and upper limits on total intrinsic widths (<10, <6, <10, and <16 keV) have been measured for four excited states above the 2.199 MeV proton threshold in {sup 20}Na. The stellar {sup 19}Ne(p,{gamma}){sup 20}Na reaction rate is calculated for temperatures between 1x10{sup 8} and 1x10{sup 9} K. When combined with a recent study of the {sup 15}O({alpha},{gamma}){sup 19}Ne reaction, a new estimate is made of the conditions required for breakout from the Hot CNO cylce to the rapid proton capture process. (orig.).
Search for narrow pp states in the reaction pi /sup -/p to p pi /sup - /pp at 16 GeV/c
Chung, S U; Bensinger, J; Button-Shafer, J; Dhar, S; Dowd, J; Etkin, A; Fernow, R; Foley, K; Goldman, J H; Kern, W; Kirk, H; Kopp, J; Kramer, M A; Lesnik, A; Lichti, R; Lindenbaum, S J; Love, W; Mallik, U; Morris, T; Morris, W; Ozaki, S; Platner, E; Protopopescu, S D; Saulys, A; Weygand, D P; Wheeler, C D; Willen, E; Winik, M
1980-01-01
This Letter carries out a sensitive ( approximately 5 events/nb) search for narrow pp states at the Brookhaven National Laboratory multiparticle spectrometer. No evidence is found for such states in the mass range 1900-2400 MeV/c/sup 2/ in the reaction pi /sup -/p to p pi /sup -/pp at 16 GeV/c. In particular, the pp states at 2020 and 2200 MeV/c/sup 2/ previously reported in a CERN Omega -spectrometer experiment are not observed. (7 refs).
A study of the Ne 2s2p{sup 5}({sup 3}P)3s and 3p correlation satellites up to 75 eV above threshold
Energy Technology Data Exchange (ETDEWEB)
Yarzhemsky, V G [RAS Kurnakov Institute of General and Inorganic Chemistry, Moscow (Russian Federation); Amusia, M Ya [Racah Institute of Physics, The Hebrew University, Jerusalem 91904 (Israel); Bolognesi, P; Avaldi, L, E-mail: lorenzo.avaldi@imip.cnr.i [CNR-Istituto di Metodologie Inorganiche e dei Plasmi, Area della Ricerca di Roma 1, CP 10, 00016 Monterotondo Scalo (Italy)
2010-09-28
The 2s2p{sup 5}({sup 3}P)3s {sup 2}P, 3p {sup 2}D and {sup 2}S satellite states of neon have been studied at several energies from 5 to 75 eV above their respective thresholds. The relative intensities of the satellite states with respect to their main lines shed light on the nature of the many-electron correlations leading to the formation of these satellites. The experimental results are compared with a calculation which makes use of a random phase approximation with exchange (RPAE) cross sections, and takes into account the shake-up and direct knock-out channels as well as their interference.
International Nuclear Information System (INIS)
Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.
1990-01-01
Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences
Solvent Extraction Separation of Phosphorus for the Measurement of {sup 32}P
Energy Technology Data Exchange (ETDEWEB)
Kang, Sang Hoon; Lee, Heung N.; Ahn, Hong Joo; Han, Sun ho; Jee, Kwang Yong [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)
2006-07-01
Phosphorus is a major element in life and plays essential roles in the human body. On the other hand, phosphorus organic compound has high toxicity, therefore, the determination of trace amount of phosphorus is important in environment studies. Development of an analytical method for the determination of low levels of phosphorus is very important as a very few analytical techniques yield reliable results for this element at trace levels. Radioactive phosphorus, {sup 32}P (T1/2 = 14.3 d, Emax 1.71 MeV) is the highest energy beta-emitting radionuclides and now generally accepted as an effective therapeutic agent for chronic leukemia and excess red blood cells. But, {sup 32}P used in diagnosis and treatment are generated radioactive waste such as pipette tips, latex gloves, angioplastic balloons, Kimwipes etc.. We'll analyze {sup 32}P in medical radioactive waste in the future. Even if {sup 32}P has low level activity and short halflife, we have to control radioactive materials in medical waste. In this work, experiment separation using solvent extraction of inactive phosphorus as preliminary experiments for the establishment of analysis. Phosphorus is extracted tri-n-octylamine (TNOA)/ xylene, which is the most suitable solvent and then is measured by UV-visable spectrophotometer.
Drozdov, V A; Fotina, O V; Giardina, G; Malaguti, F; Platonov, S Y; Tulinov, A F; Yuminov, O A
2002-01-01
The crystal blocking technique has been used to measure the induced fission lifetimes for the sup 2 sup 3 sup 2 sup , sup 2 sup 3 sup 3 Pa and sup 2 sup 3 sup 2 U nuclei produced in the sup 2 sup 3 sup 2 Th+p and sup 2 sup 3 sup 2 Th+ sup 3 He reactions at bombarding energies of protons and sup 3 He included in the 6.8-7.8 MeV and 20.8-23.4 MeV ranges, respectively. The experimental fission lifetimes observed in these reactions vary from 10 sup - sup 1 sup 6 to 10 sup - sup 1 sup 4 s, depending on the projectile energy. Experimental data have been compared with the statistical model calculations that take into account the existence of both classes of excited states of fissioning nucleus, realized in the first and second potential wells of the double-humped fission barrier. By the analysis of the measured decay times it is possible to determine the absolute values of the level density in the second well, type of shape symmetry in the second well, and also the unknown early values of the shell correction for th...
Potrzebowski, M J; Kazmierski, S
2001-01-01
In this review several applications of sup 3 sup 1 P high resolution solid state NMR spectroscopy in structural studies of bioorganic samples is recorded. The problem of pseudopolymorphism of bis[6-O,6'-O-(1,2:3,4diisopropylidene-alpha-D-galactopyranosyl) phosphothionyl] disulfide (1) and application of sup 3 sup 1 P C/MAS experiment to investigate of this phenomenon is discussed. The influence of weak C-H--S intermolecular contacts on molecular packing of 1,6-anhydro-2-O-tosyl-4-S- (5,5-dimethyl-2-thioxa-1,3,2-dioxaphosphophorinan-2-= yl)-beta-D-glucopyranose (2) and S sub P , R sub P diastereomers of deoxyxylothymidyl-3'-O-acetylthymidyl (3',5')-O-(2-cyanoethyl) phosphorothioate (3) and their implication on sup 3 sup 1 P NMR spectra is shown. The final part of review describes the recent progress in structural studies of O-phosphorylated amino acids (serine, threonine, tyrosine), relationship between molecular structure and sup 3 sup 1 P chemical shift parameters delta sub i sub i and influence of hydrogen ...
Wilson's disease: {sup 31}P and {sup 1}H MR spectroscopy and clinical correlation
Energy Technology Data Exchange (ETDEWEB)
Sinha, Sanjib; Taly, A.B.; Prashanth, L.K. [National Institute of Mental Health and Neurosciences (NIMHANS), Department of Neurology, Bangalore (India); Ravishankar, S.; Vasudev, M.K. [National Institute of Mental Health and Neurosciences (NIMHANS), Department of Neuroimaging and Interventional Radiology, Bangalore (India)
2010-11-15
Proton ({sup 1}H) magnetic resonance spectroscopy (MRS) changes are noted in Wilson's disease (WD). However, there are no studies regarding membrane phospholipid abnormality using {sup 31}P MRS in these patients. We aimed to analyze the striatal spectroscopic abnormalities using {sup 31}P and {sup 1}H MRS in WD. Forty patients of WD (treated, 29; untreated,11) and 30 controls underwent routine MR image sequences and in vivo 2-D {sup 31}P and {sup 1}H MRS of basal ganglia using an image-selected technique on a 1.5-T MRI scanner. Statistical analysis was done using Student's t test. The mean durations of illness and treatment were 6.2 {+-} 7.4 and 4.8 {+-} 5.9 years, respectively. MRI images were abnormal in all the patients. {sup 1}H MRS revealed statistically significant reduction of N-acetyl aspartate (NAA)/choline (Cho) and NAA/creatine ratios in striatum ({sup 1}H MRS) of treated patients compared to controls. The mean values of phosphomonoesters (PME) (p < 0.0001), phosphodiesters (PDE) (p < 0.0001), and total phosphorus (TPh) (p < 0.0001) were elevated in patients compared to controls. Statistically significant elevated levels of ratio of PME/PDE (p = 0.05) observed in the striatum were noted in treated patients as compared to controls in the {sup 31}P MRS study. The duration of illness correlated well with increased PME/PDE [p < 0.001], PME/TPh [p < 0.05], and PDE/TPh [p < 0.05] and decreased NAA/Cho [p < 0.05] ratios. There was correlation of MRI score and reduced NAA/Cho ratio with disease severity. The PME/PDE ratio (right) was elevated in the treated group [p < 0.001] compared to untreated group. There is reduced breakdown and/or increased synthesis of membrane phospholipids and increased neuronal damage in basal ganglia in patients with WD. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Aguilar-Benitez, M; Salicio, J
1981-07-01
An analysis of (1385) production in reactions of the type 0{sup +} 1/z 4 +{yields}>-1{sup +} 3+/2 and 0{sup -} + 1/2+{yields} 0{sup -} + 3*/2 is presented. A determination of the {sigma}(1385) production parameters Is performed and the results are compared with the predictions from several models. A transversity amplitudes reconstruction describing the processes {pi} {sup p} ->K(890) {sigma}(1385) and K{sup -}p {yields} 3{yields}{phi}(1385), {zeta}{sup -}{sigma}(1385) is obtained in a model independent way. We observe dominance of unnatural partly exchange in the production mechanisms. Exchanges of exotic quantum numbers are established by the study of {pi}p {yields} K{sup 0}+ {sigma}(1385)s and K{sup -} p{yields}>{pi}+{sigma}(1385){+-} processes. Additive quark model predictions are reasonable agreement with the experimental data. (Author)
Study of the {sup 6}Li + p → {sup 3}He + {sup 4}He reaction in inverse kinematics
Energy Technology Data Exchange (ETDEWEB)
Betsou, C.; Pakou, A.; Aslanoglou, X.; Nicolis, N.G.; Sgouros, O.; Soukeras, V. [The University of Ioannina, Department of Physics and HINP, Ioannina (Greece); Cappuzzello, F. [Laboratori Nazionali del Sud, INFN, Catania (Italy); Universita di Catania, Dipartimento di Fisica e Astronomia, Catania (Italy); Acosta, L. [Universidad Nacional Autonoma de Mexico, Instituto de Fisica, Mexico Distrito Federal (Mexico); INFN, Catania (Italy); Agodi, C.; Carbone, D.; Cavallaro, M.; Di Pietro, A.; Fernandez-Garcia, J.P.; Figuera, P.; Fisichella, M. [Laboratori Nazionali del Sud, INFN, Catania (Italy); Foti, A. [Universita di Catania, Dipartimento di Fisica e Astronomia, Catania (Italy); INFN, Catania (Italy); Keeley, N. [National Centre for Nuclear Research, Otwock (Poland); Marquinez-Duran, G.; Martel, I. [Universidad de Huelva, Departamento de Fisica Aplicada, Huelva (Spain); Mazzocco, M.; Strano, E.; Torresi, D. [Universita di Padova, Departimento di Fisica e Astronomia, Padova (Italy); INFN, Padova (Italy); Pierroutsakou, D. [INFN, Napoli (Italy); Rusek, K. [University of Warsaw, Heavy Ion Laboratory, Warsaw (Poland); Stiliaris, E. [University of Athens, Institute of Accelerating Systems and Applications and Department of Physics, Athens (Greece)
2015-07-15
Angular distribution measurements were performed for the {sup 6}Li + p → {sup 3}He + {sup 4}He reaction in inverse kinematics at incident energies of 2.7, 3.3, 4.2 and 4.8 MeV/u. The detection of both recoils ({sup 3}He and {sup 4}He) over the laboratory angle range θ{sub lab} = 16 {sup circle} to 34 {sup circle} allowed the determination of the angular distribution over a wide angular range in the center-of-mass frame (θ{sub c.m.} ∝ 40 {sup circle} to 140 {sup circle}). The results clarify inconsistencies between existing data sets and are consistent with compound nucleus model calculations. (orig.)
Labeling of human immune gamma globulin with sup(99m)Tc
International Nuclear Information System (INIS)
Wong, D.W.; Huang, J.T.
1977-01-01
Human immune serum gamma globulin and rabbit anti-Stap. aureus antibody have been successfully labeled with sup(99m)Tc at pH 7.4 with an average binding efficiency of 86 and 82%, respectively. The labeled proteins behave similarly to unlabeled gamma-globulin fraction in the normal human serum as demonstrated by protein electrophoresis. The biological half-time of sup(99m)Tc-gamma-globulin in dog has been determined to be 54 min for the fast component and 14.7 hr for a slower component. Immunological assays demonstrate no significant change in antibody activity after labeling process. (author)
Energy Technology Data Exchange (ETDEWEB)
Jokar, A., E-mail: arezajokar@gmail.com; Kakuee, O.; Lamehi-Rachti, M.
2016-09-15
Differential cross sections of proton induced gamma-ray emission from the {sup 31}P(p,pγ{sub 1}){sup 31}P (E{sub γ} = 1266 keV) nuclear reaction were measured in the proton energy range of 1886–3007 keV at the laboratory angle of 90°. For these measurements a thin Zn{sub 3}P{sub 2} target evaporated onto a self-supporting C film was used. The gamma-rays and backscattered protons were detected simultaneously. An HPGe detector placed at an angle of 90° with respect to the beam direction was employed to collect gamma-rays while an ion implanted Si detector placed at a scattering angle of 165° was used to detect backscattered protons. Simultaneous collection of gamma-rays and RBS spectra is a great advantage of this approach which makes differential cross-section measurements independent on the collected beam charge. The obtained cross-sections were compared with the previously only measured data in the literature. The validity of the measured differential cross sections was verified through a thick target benchmarking experiment. The overall systematic uncertainty of cross section values was estimated to be better than ±9%.
Standardization of {sup 32}P radioactive solution
Energy Technology Data Exchange (ETDEWEB)
Marques, Caio Pinheiros; Koskinas, Marina Fallone; Almeida, Jamille da Silveira; Yamazaki, Ione M.; Dias, Mauro da Silva, E-mail: cpmarques@usp.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2016-07-01
The standardization of {sup 32}P radioactive solution using three different methods is presented. The disintegration rate was determined by the CIEMAT/NIST and TDCR methods in liquid scintillator systems and self-absorption extrapolation method using 4π(PC)-β system. The results obtained for the activity of the {sup 32}P solution were compared and they agree within the experimental uncertainties. (author)
Breakout from the hot CNO cycle: the {sup 15}O({alpha},{gamma}) and {sup 18}Ne({alpha},p) reactions
Energy Technology Data Exchange (ETDEWEB)
Bradfield-Smith, W; Laird, A M; Davinson, T; Pietro, A di; Ostrowski, A N; Shotter, A C; Woods, P J [Dept. of Physics and Astronomy, Univ. of Edinburgh (United Kingdom); Cherubini, S; Galster, W; Graulich, J S; Leleux, P; Michel, L; Ninane, A; Vervier, J [Inst. de Physique Nucleaire, UCL, Louvain-la-Neuve (Belgium); Aliotta, M; Cali, D; Cappussello, F; Cunsolo, A; Spitaleri, C [INFN, Catania (Italy); Gorres, J; Wiescher, M [Notre Dame Univ. (United States); Rahighi, J [Van de Graaf Lab., Tehran (Iran, Islamic Republic of); Hinnefeld, J [Indiana Univ., South Bend (United States)
1998-06-01
One of the most important reactions which determines the rate of breakout from the hot CNO cycle is the {sup 15}O({alpha},{gamma}){sup 19}Ne. The reaction {sup 18}Ne({alpha},p){sup 21}Na may also provide an alternative breakout route. Experiments are being undertaken at Louvain-La-Neuve using the radioactive {sup 18}Ne beam to study these reactions by measurement of {alpha}({sup 18}Ne,p){sup 21}Na and d({sup 18}Ne,p){sup 19}Ne{sup *} {yields} {sup 15}O + {alpha} (orig.)
Comparative metagenomic analysis of plasmid encoded functions in the human gut microbiome
Directory of Open Access Journals (Sweden)
Marchesi Julian R
2010-01-01
Full Text Available Abstract Background Little is known regarding the pool of mobile genetic elements associated with the human gut microbiome. In this study we employed the culture independent TRACA system to isolate novel plasmids from the human gut microbiota, and a comparative metagenomic analysis to investigate the distribution and relative abundance of functions encoded by these plasmids in the human gut microbiome. Results Novel plasmids were acquired from the human gut microbiome, and homologous nucleotide sequences with high identity (>90% to two plasmids (pTRACA10 and pTRACA22 were identified in the multiple human gut microbiomes analysed here. However, no homologous nucleotide sequences to these plasmids were identified in the murine gut or environmental metagenomes. Functions encoded by the plasmids pTRACA10 and pTRACA22 were found to be more prevalent in the human gut microbiome when compared to microbial communities from other environments. Among the most prevalent functions identified was a putative RelBE toxin-antitoxin (TA addiction module, and subsequent analysis revealed that this was most closely related to putative TA modules from gut associated bacteria belonging to the Firmicutes. A broad phylogenetic distribution of RelE toxin genes was observed in gut associated bacterial species (Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, but no RelE homologues were identified in gut associated archaeal species. We also provide indirect evidence for the horizontal transfer of these genes between bacterial species belonging to disparate phylogenetic divisions, namely Gram negative Proteobacteria and Gram positive species from the Firmicutes division. Conclusions The application of a culture independent system to capture novel plasmids from the human gut mobile metagenome, coupled with subsequent comparative metagenomic analysis, highlighted the unexpected prevalence of plasmid encoded functions in the gut microbial ecosystem. In
Two-neutron stripping in ({sup 18}O, {sup 16}O) and (t,p) reactions
Energy Technology Data Exchange (ETDEWEB)
Cavallaro, M.; Agodi, A.; Carbone, D.; Cunsolo, A. [INFN - Laboratori Nazionali del Sud, Via S. Sofia 62, I-95125 Catania (Italy); Bondì, M.; Cappuzzello, F.; Nicolosi, D.; Tropea, S. [INFN - Laboratori Nazionali del Sud, Via S. Sofia 62, I-95125 Catania, Italy and Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia 64, I-95125 Catania (Italy); Borello-Lewin, T.; Rodrigues, M. R. D. [Instituto de Física - Universidade de São Paulo, Rua do Matão Travessa R Nr.187 CEP 05508-090 Cidade Universitária, São Paulo (Brazil); De Napoli, M. [INFN - Sezione di Catania, Via S. Sofia 64, I-95125 Catania (Italy); Garcia, V. N. [Instituto de Física, Universidade Federal Fluminense, Avenida Litoranea s/n, Gragoata, 24210-340, Niteroi, RJ (Brazil); Linares, R.; Lubian, J.; Paes, B. [Instituto de Física, Universidade Federal Fluminense, Avenida Litoranea s/n, Gragoata , 24210-340, Niteroi, RJ (Brazil); Foti, A. [Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia 64, I-95125 Catania, Italy and INFN - Sezione di Catania, Via S. Sofia 64, I-95125 Catania (Italy)
2014-11-11
The {sup 12}C({sup 18}O,{sup 16}O){sup 14}C reactions has been investigated at 84 MeV incident energy. The charged ejectiles produced in the reaction have been momentum analyzed and identified by the MAGNEX magnetic spectrometer. Q-value spectra have been extracted with an energy resolution of 160 keV (Full Width at Half Maximum) and several known bound and resonant states of {sup 14}C have been identified up to 15 MeV. In particular, excited states with dominant 2p - 4h configuration are the most populated. The absolute values of the cross sections have been extracted showing a striking similarity with those measured for the same transitions by (t,p) reactions. This indicates that the effect of the {sup 16}O core is negligible in the reaction mechanism.
Energy Technology Data Exchange (ETDEWEB)
Kokkoris, M., E-mail: kokkoris@central.ntua.g [Department of Physics, National Technical University of Athens, Zografou Campus, 157 80 Athens (Greece); Tsaris, A. [Department of Physics, National Technical University of Athens, Zografou Campus, 157 80 Athens (Greece); Misaelides, P. [Department of Chemistry, Aristotle University of Thessaloniki, GR-54124 Thessaloniki (Greece); Sokaras, D.; Lagoyannis, A.; Harissopulos, S. [Institute of Nuclear Physics, TANDEM Accelerator, N.C.S.R. ' Demokritos' , Aghia Paraskevi, 153 10 Athens (Greece); Vlastou, R.; Papadopoulos, C.T. [Department of Physics, National Technical University of Athens, Zografou Campus, 157 80 Athens (Greece)
2010-06-15
In the present work, new, differential cross-section values are presented for the {sup nat}K(p, p{sub 0}) reaction in the energy range E{sub lab} = 3000-5000 keV (with an energy step of 25 keV) and for detector angles between 140{sup o} and 170{sup o} (with an angular step of 10{sup o}). A qualitative discussion of the observed cross-section variations through the influence of strong, closely spaced resonances in the p + {sup 39}K system is also presented. Information has also been extracted concerning the {sup 39}K(p,{alpha}{sub 0}) reaction for E{sub lab} = 4000-5000 keV in the same angular range. As a result, more than {approx}500 data points will soon be available to the scientific community through IBANDL (Ion Beam Analysis Nuclear Data Library - (http://www-nds.iaea.org/ibandl/)) and could thus be incorporated in widely used IBA algorithms (e.g. SIMNRA, WINDF, etc.) for potassium depth profiling at relatively high proton beam energies.
Internal dosimetry for [4-{sup 14}C]-cholesterol in humans
Energy Technology Data Exchange (ETDEWEB)
Marcato, Larissa A.; Mesquita, Carlos H. de, E-mail: chmesqui@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Cesar, Thais B., E-mail: tcesar@fcfar.unesp.b [Universidade Estadual Paulista Julio de Mesquita Filho (FCF/UNESP), Araraquara, SP (Brazil). Fac. de Ciencias Farmaceuticas. Dept. de Alimentos e Nutricao; Vinagre, Carmen G.C. [Universidade de Sao Paulo (InCor/HCFMUSP), SP (Brazil). Hospital das Clinicas. Instituto do Coracao
2011-07-01
This study proposes a biokinetic model for use in the assessment of the internal dose received by human subjects administered orally with [4-{sup 14}C]-cholesterol. The proposed model includes three systemic pools representing the short-term (T1/2 = 1 d), intermediate-term (T1/2 = 16 d) and long-term (T1/2 = 78 d) physiological exchanges and two excretion pathways: urine and feces. This model used the ANACOMP software to estimate radiometric doses with MIRD techniques (Medical Internal Radiation Dose). To validate the model, the profile curve of excretion prediction by the model in the range of seven days was compared with those curves described in literature. No statistical difference was detected (P = 0.416). The estimated effective dose coefficient calculated for the reference man described on ICRP publication 23 was 3.39x10{sup -10} SvBq{sup -1}. The organs that received the highest equivalent dose were the lower large intestine (2.459x10{sup -9} GyBq{sup -1}), upper large intestine (9.023x10{sup -10} GyBq{sup -1}) and small intestine (3.717x10{sup -10} GyBq{sup -1}). (author)
A study of inclusive Xi /sup -/ production from K/sup -/p interactions at 42 GeV/c
Ganguli, S N; Blokzijl, R; Gavillet, P; Grossmann, P; Hemingway, R J; Kittel, E W; Kluyver, J C; Lamb, P R; Muirhead, William Hugh; Shephard, W D; Van de Walle, R T; Wells, J; Wolters, G F
1977-01-01
A study of inclusive Xi /sup -/ production from a high statistics K /sup -/p experiment at 4.2 GeV/c has been made. The total Xi /sup -/ production cross section is 157+or-8 mu b. Approximately 15% of the Xi /sup -/ arise from decay of the Xi */sup Q/(1530) resonance. The polarization of Xi /sup -/ is found to be negative and is nearly equal in value to that of the Lambda /sup 0/ from the inclusive reaction K /sup -/+p to Lambda /sup 0/+anything. An analysis of the inclusive production of Xi /sup -/ has been made in the framework of the triple- Regge formalism. (15 refs).
Energy Technology Data Exchange (ETDEWEB)
Delaunay, F
2003-10-01
The one-neutron transfer reaction d({sup 10}Be,p){sup 11}Be has been studied at 32 A.MeV at GANIL with a {sup 10}Be secondary beam. Protons were detected by the silicon strip array MUST. The ground state and excited states of {sup 11}Be at 0.32, 1.78 and 3.41 MeV were populated, demonstrating the feasibility of transfer reactions induced by radioactive beams leading to bound and unbound states. A DWBA (distorted wave born approximation) analysis indicates for the 3.41 MeV state spin and parity 3/2{sup +} or 5/2{sup +} and a spectroscopic factor of 0.18 or 0.11, respectively. A broad structure centered at 10 MeV is also observed and corresponds to transfer to the 1d sub-shells. If one assumes that only the 1d3/2 orbital contributes to this structure, the splitting of the 1d neutron states in {sup 11}Be is estimated to be 6.3 MeV. Using a 2-particle-RPA (random phase approximation) model, we have shown that neutron-neutron correlations play an important role in the inversion between the 2s1/2 and 1p1/2 neutron states in {sup 11}Be. (author)
Energy Technology Data Exchange (ETDEWEB)
Brandenburg, G W; Carnegie, R K; Cashmore, R J; Davier, M; Lasinski, T A; Leith, D W.G.S.; Mathews, J A.J.; Walden, P; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA)
1976-03-01
The differential cross sections and density matrix elements for the phi and rho/sup 0/ mesons have been measured in the reactions K/sup -/p..-->..K/sup -/K/sup +/(..lambda..,..sigma../sup 0/) and K/sup -/p..--> pi../sup -/..pi../sup +/(..lambda..,..sigma../sup 0/) at 13 GeV using a wire chamber spectrometer. The analysis shows that while the vector meson production is dominated by the natural parity exchange amplitude, some unnatural parity exchange is also required. Furthermore the phi and rho natural exchange cross sections are identical in shape and have the 2:1 relative strength expected in the quark model with K* and K** exchange degeneracy. The analysis of the clear peak-dip rho/sup 0/-..omega.. interference pattern observed in the ..pi../sup -/..pi../sup +/ data indicates that the ..omega.. production is in phase with the rho and of similar magnitude. Both the S* and f' meson are clearly observed in this experiment. The S* data are found to be consistent with S* parameters deduced from ..pi pi.. scattering analyses. The f' density matrix elements and a new limit on the f'..--> pi../sup -/..pi../sup +/ branching ratio are presented.
{sup 91}Nb(p,γ) or there and back again
Energy Technology Data Exchange (ETDEWEB)
Thomas, Benedikt; Glorius, Jan; Reich, Markus; Reifarth, Rene; Sonnabend, Kerstin [Goethe University Frankfurt a.M. (Germany); Blazhev, Andrey; Zell, Karl-Oscar [University of Cologne (Germany); Dressler, Rugard; Schumann, Dorothea [Paul-Scherrer Institute, Villigen (Switzerland); Giesen, Ulrich [Physikalisch-Technische Bundesanstalt, Braunschweig (Germany); Kritcka, Milan [Charles University, Prague (Czech Republic)
2016-07-01
The cross section of the reaction {sup 91}Nb(p,γ){sup 92}Mo is of special interest to answer questions about the production of the most abundant p nucleus {sup 92}Mo. With {sup 91}Nb being a radioactive nucleus the measurement of this reaction in standard kinematics is a big challenge. To produce a sufficient number of {sup 91}Nb isotopes an enriched {sup 92}Mo target was activated by protons at E{sub p} = 19 MeV. Afterwards the produced {sup 91}Nb isotopes are separated chemically and applied onto a tungsten backing. This leads to approximately 10{sup 16} {sup 91}Nb isotopes. The high proton current delivered by the HF-linear-accelerator FRANZ currently built at Goethe University Frankfurt, Germany, enables the execution of measurement with such limited amount of target material. The goal of our investigation is the determination of the cross section of the {sup 91}Nb(p,γ){sup 92}Mo reaction at 2 MeV proton energy and thereby in the astrophysical relevant energy region. We present the current status and the next steps towards the measurement of this cross section.
Cross-section of the reaction {sup 7}Li(p,n){sup 7}Be close to the threshold
Energy Technology Data Exchange (ETDEWEB)
Shorin, V S [Institute of Physics and Power Engineering, Obninsk (Russian Federation)
1997-06-01
The status of data on the cross-section of the reaction {sup 7}Li(p,n){sup 7}Be close to the threshold is reviewed. On the basis of recent data on the cross-section of the inverse reaction {sup 7}Be(n,p){sup 7}Li and certain theoretical models, an evaluation is performed of the total cross-section of the {sup 7}Li(p,n)-reaction in the proton energy region up to 2 MeV. (author). 16 refs, 1 fig., 1 tab.
Energy Technology Data Exchange (ETDEWEB)
Perey, F.G.; Chapman, G.T.; Kinney, W.E.; Perey, C.M.
1977-12-01
Transmission and capture data from /sup 58/Ni were analyzed up to 120 keV and are reported. High-resolution scattering measurements for Fe are discussed, and the determination of the J/sup ..pi../ value for most resonances seen in transmission data up to 400 keV is given, including an attempt at evaluation of the resonances of /sup 56/Fe on the basis of recently published data. 4 figures, 3 tables.
Energy Technology Data Exchange (ETDEWEB)
Al-Abyad, M. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany); Cyclotron Facility, Nuclear Research Center, Atomic Energy Authority, Cairo 13759 (Egypt); Spahn, I. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany); Institute of Experimental Physics, University of Debrecen, H-4010 Debrecen (Hungary); Sudar, S. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany); Institute of Experimental Physics, University of Debrecen, H-4010 Debrecen (Hungary); Morsy, M. [Cyclotron Facility, Nuclear Research Center, Atomic Energy Authority, Cairo 13759 (Egypt); Comsan, M.N.H. [Cyclotron Facility, Nuclear Research Center, Atomic Energy Authority, Cairo 13759 (Egypt); Csikai, J. [Institute of Experimental Physics, University of Debrecen, H-4010 Debrecen (Hungary); Qaim, S.M. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany)]. E-mail: s.m.qaim@fz-juelich.de; Coenen, H.H. [Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany)
2006-06-15
Nuclear data for production of the therapeutic radionuclides {sup 32}P, {sup 64}Cu, {sup 67}Cu, {sup 89}Sr, {sup 9}Y and {sup 153}Sm via (n,p) reactions on the target nuclei {sup 32}S, {sup 64}Zn, {sup 67}Zn, {sup 89}Y, {sup 9}Zr and {sup 153}Eu, respectively, are discussed. The available information on each excitation function was analysed. From the recommended data set for each reaction the average integrated cross section for a standard 14 MeV d(Be) neutron field was deduced. The spectrum-averaged cross section was also measured experimentally. A comparison of the integrated value with the integral measurement served to validate the excitation function within about 15%. A fast neutron source appears to be much more effective than a fission reactor for production of the above-mentioned radionuclides in a no-carrier-added form via the (n,p) process. In particular, the possibility of production of high specific activity {sup 153}Sm is discussed.
The Q{sup p}{sub Weak} experiment
Energy Technology Data Exchange (ETDEWEB)
Androic, D. [University of Zagreb (Croatia); Armstrong, D. S. [The College of William and Mary (United States); Asaturyan, A. [Yerevan Physics Institute (Armenia); Averett, T. [The College of William and Mary (United States); Balewski, J. [Massachusetts Institute of Technology (United States); Beaufait, J. [Thomas Jefferson National Accelerator Facility (United States); Beminiwattha, R. S. [Ohio University (United States); Benesch, J. [Thomas Jefferson National Accelerator Facility (United States); Benmokhtar, F. [Duquesne University (United States); Birchall, J. [University of Manitoba (Canada); Carlini, R. D.; Cornejo, J. C. [The College of William and Mary (United States); Covrig, S. [Thomas Jefferson National Accelerator Facility (United States); Dalton, M. M. [University of Virginia (United States); Davis, C. A. [TRIUMF (United States); Deconinck, W. [The College of William and Mary (United States); Diefenbach, J. [Hampton University (United States); Dow, K. [Massachusetts Institute of Technology (United States); Dowd, J. F. [The College of William and Mary (United States); Dunne, J. A. [Mississippi State University (United States); and others
2013-03-15
In May 2012, the Q{sup p}{sub Weak} collaboration completed a two year measurement program to determine the weak charge of the proton Q{sub W}{sup p} = ( 1 - 4sin{sup 2}{theta}{sub W}) at the Thomas Jefferson National Accelerator Facility (TJNAF). The experiment was designed to produce a 4.0 % measurement of the weak charge, via a 2.5 % measurement of the parity violating asymmetry in the number of elastically scattered 1.165 GeV electrons from protons, at forward angles. At the proposed precision, the experiment would produce a 0.3 % measurement of the weak mixing angle at a momentum transfer of Q{sup 2} = 0.026 GeV{sup 2}, making it the most precise stand alone measurement of the weak mixing angle at low momentum transfer. In combination with other parity measurements, Q{sup p}{sub Weak} will also provide a high precision determination of the weak charges of the up and down quarks. At the proposed precision, a significant deviation from the Standard Model prediction could be a signal of new physics at mass scales up to Asymptotically-Equal-To 6 TeV, whereas agreement would place new and significant constraints on possible Standard Model extensions at mass scales up to Asymptotically-Equal-To 2 TeV. This paper provides an overview of the physics and the experiment, as well as a brief look at some preliminary diagnostic and analysis data.
High-statistics study of the reaction γp → p2π{sup 0}
Energy Technology Data Exchange (ETDEWEB)
Sokhoyan, V.; Pee, H. van; Bartholomy, O.; Beck, R.; Fuchs, M.; Funke, C.; Hoffmeister, P.; Horn, I.; Junkersfeld, J.; Kalinowsky, H.; Klempt, E.; Lang, M.; Metsch, B.; Piontek, D.; Schmidt, C.; Seifen, T.; Szczepanek, T.; Thiel, A.; Thoma, U.; Wendel, C. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Gutz, E. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Universitaet Giessen, II. Physikalisches Institut, Giessen (Germany); Crede, V. [Florida State University, Department of Physics, Tallahassee (United States); Anisovich, A.V.; Bayadilov, D.; Nikonov, V.A.; Novinsky, D.; Sarantsev, A.V. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Bacelar, J.C.S.; Castelijns, R.; Loehner, H.; Messchendorp, J.G.; Shende, S. [Kernfysisch Versneller Instituut, Groningen (Netherlands); Bantes, B.; Dutz, H.; Elsner, D.; Ewald, R.; Frommberger, F.; Hillert, W.; Kammer, S.; Kleber, V.; Klein, Frank; Klein, Friedrich; Ostrick, M.; Schmieden, H.; Suele, A. [Universitaet Bonn, Physikalisches Institut, Bonn (Germany); Beloglazov, Y.A.; Gridnev, A.B.; Lopatin, I.V.; Sumachev, V.V. [Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Gregor, R.; Lugert, S.; Metag, V.; Nanova, M.; Novotny, R.; Pfeiffer, M.; Trnka, D. [Universitaet Giessen, II. Physikalisches Institut, Giessen (Germany); Jaegle, I.; Krusche, B.; Mertens, T. [Universitaet Basel, Institut fuer Physik, Basel (Switzerland); Kotulla, M. [Universitaet Giessen, II. Physikalisches Institut, Giessen (Germany); Universitaet Basel, Institut fuer Physik, Basel (Switzerland); Pant, L.; Roy, A.; Varma, R. [Universitaet Giessen, II. Physikalisches Institut, Giessen (Germany); BARC, Nucl. Phys. Div., Mumbai (India); Walther, D. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Universitaet Bonn, Physikalisches Institut, Bonn (Germany); Wilson, A. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany); Florida State University, Department of Physics, Tallahassee (United States); Collaboration: The CBELSA/TAPS Collaboration
2015-08-15
The photoproduction of 2π {sup 0} mesons off protons was studied with the Crystal Barrel/TAPS experiment at the electron accelerator ELSA in Bonn. The energy of photons produced in a radiator was tagged in the energy range from 600 MeV to 2.5 GeV. Differential and total cross sections and pπ {sup 0} π {sup 0} Dalitz plots are presented. Part of the data was taken with a diamond radiator producing linearly polarized photons, and beam asymmetries were derived. Properties of nucleon and Δ resonances contributing to the pπ {sup 0} π {sup 0} final state were determined within the Bonn-Gatchina (BnGa) partial-wave analysis. The data presented here allow us to determine branching ratios of nucleon and Δ resonances for their decays into pπ {sup 0} π {sup 0} via several intermediate states. Most prominent are decays proceeding via Δ(1232)π, N(1440)1/2{sup +} π, N(1520)3/2{sup -} π, N(1680)5/2{sup +} π, but also pf{sub 0}(500), pf{sub 0}(980), and pf{sub 2}(1270) contribute to the reaction. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Benchekroun, D
1994-05-01
The first part of this work reports on designing and testing a detector made of a gas proportional counter coupled to a CsI(TI) crystal. It is shown that a good identification of fragments of charge ranging from 3 to 20 is achieved. The energy threshold is lower than in the case of a conventional plastic - CsI(TI) phoswich detector. The second part is devoted to the study of complex fragment production in the {sup 32}S + {sup nat}Ag and {sup 32}S + {sup 58}Ni reactions using the multidetector array AMPHORA. The total multiplicity of charged particles has been used as a criterion of centrally of the collision. The evaluation of the characteristics of fragment emission has thus been studied from peripheral to central collisions. In the case of the most violet collisions the data infer that a rotating hot source has been formed (excitation energy of the order of 500 MeV). It is demonstrated that this sources de-excites through emission of a long chain of fragments and particles. The analysis of the azimuthal correlations of fragments with the evaporation code MODGAN confirmed the hypothesis of such a source. That hot source should rotate with an angular momentum up to 120 h and the emission times would be of the order of 10{sup -21} s. (author). 80 refs.
High pressure {sup 31}P NMR spectroscopy on guanine nucleotides
Energy Technology Data Exchange (ETDEWEB)
Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)
2017-01-15
The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.
Study of the reaction. gamma. p. --> delta. /sup + +/. pi. /sup -/ on polarized protons
Energy Technology Data Exchange (ETDEWEB)
Belyaev, A.; Get' man, V.; Gorbenko, V.; Gushchin, V.; Derkach, A.; Zhebrovskii, Y.; Zayats, A.; Karnaukhov, I.; Kolesnikov, L.; Lukhanin, A.; Rubashkin, A.; Sobol' , M.; Sorokin, P.; Sporov, E.; Telegin, Y.
1982-02-01
We have measured for the first time the asymmetry of the cross section for the reaction ..gamma..p..--> delta../sup + +/..pi../sup -/ on polarized protons. The measurements were made at E/sub ..gamma../ = 660 MeV in the range of pion emission angles 45--120/sup 0/ c.m.s. The experimental data obtained are compared with the theoretical predictions.
Energy Technology Data Exchange (ETDEWEB)
Schlimme, Bjoern Soeren
2012-01-15
Electromagnetic nucleon form factors are fundamental quantities which are closely related to the electromagnetic structure of the nucleon. The evolution of the electric and magnetic Sachs form factors G{sub E} and G{sub M} with Q{sup 2}, the negative square of the four momentum transfer in the electromagnetic scattering process, is directly connected with the spatial charge and current distributions in the nucleon by means of a Fourier transform. Therefore precise measurements of the form factors over a wide Q{sup 2} range are essential for a quantitative understanding of the nucleon structure. Owing to the lack of a free neutron target measurements of the neutron form factors prove to be difficult compared to the measurements on the proton. Consequently the available neutron data is less precise, and the measured Q{sup 2} range is smaller. In particular the electric neutron Sachs form factor G{sup n}{sub E} is difficult to measure; due to the vanishing net charge of the neutron, G{sup n}{sub E} is small compared to the other nucleon form factors. G{sup n}{sub E} characterizes the charge distribution of the electrically neutral neutron, hence it is very sensitive to the inner structure of the neutron. In the present work G{sup n}{sub E} was determined from beam helicity asymmetries in the quasielastic scattering process {sup 3}vector (He)(vector e,e'n)pp at a momentum transfer Q{sup 2}=1.58 (GeV/c){sup 2}. The measurement took place in Mainz at the electron accelerator facility Mainz Microtron within the A1 collaboration in the summer of 2008. Longitudinally polarized electrons with an energy of 1.508 GeV impinged on a polarized {sup 3}He gas target which served as an effective polarized neutron target. The scattered electrons were detected in coincidence with the recoil neutrons; a magnetic spectrometer was used for the electron detection, the contribution of quasielastic scattering off the protons was restricted through the detection of the neutron via a
Diffractive production of {pi}{sup -}f{sub 1} in {pi}{sup -}p interactions at COMPASS(CERN)
Energy Technology Data Exchange (ETDEWEB)
Yang, Hao
2012-11-06
Diffractive dissociation of a {pi}{sup -} beam(190 GeV/c) on a proton target was measured at the COMPASS spectrometer. During a run in 2008, a large number of events with {pi}{sup -}{pi}{sup -}{pi}{sup +}{eta} in the final state was recorded. Partial wave analyses(PWA) of these data are being performed, concentrating on the kinematic domain of momentum transfer t' from 0.1 to 1.0 GeV{sup 2}/c{sup 2}. Subject of this thesis is the diffractive production of X from {pi}{sup -}p{yields}Xp with the subsequent decays X{yields}{pi}{sup -}f{sub 1} and f{sub 1}{yields}{pi}{sup -}{pi}{sup +}{eta}. Two different decays of the {eta} were selected: {eta}{yields}{pi}{sup -}{pi}{sup +}{pi}{sup 0}({gamma}{gamma}) and {eta}{yields}{gamma}{gamma}. A kinematic fitting routine was used to improve the data selection. In order to do the PWA, a Monte Carlo(MC) simulation is needed to account for the detector acceptance. In the mass-independent PWA the angular distributions of the real events are compared with the event distributions imposed on Monte Carlo(MC) events in order to determine the production amplitudes of different assumed partial waves in mass bins of 50 MeV/c{sup 2} of the invariant mass m{sub X} of X in the range 1.3 < m{sub X} < 3.0 GeV/c{sup 2}, by means of a maximum-likelihood-fit. Then a simplified mass-dependent fit of Breit-Wigner amplitudes has been applied to the distributions of production intensities as a function of m{sub X} in order to determine the contributions of known or presumed resonances. In the {pi}{sup -}f{sub 1} channel, we focus on the S, P and D wave i.e. orbital angular momentum L=0, 1, 2 between {pi}{sup -} and f{sub 1}. Significant intensity and phase motion are observed for the following J{sup PC}M{sup {epsilon}} combinations, where J, P, C, M and {epsilon} stand for the total angular momentum, parity and charge conjugation, total spin projection and reflectivity: 1{sup -+}1{sup +} (S wave), 1{sup ++}0{sup +} (P wave), 2{sup -+}0{sup +} (D
Sensitive lifetime measurement of excited states of {sup 98}Ru via the (p,p{sup '}γ) reaction
Energy Technology Data Exchange (ETDEWEB)
Vielmetter, Vera; Hennig, Andreas; Derya, Vera; Pickstone, Simon G.; Prill, Sarah; Spieker, Mark; Zilges, Andreas [Institute for Nuclear Physics, University of Cologne (Germany); Petkov, Pavel [Institute for Nuclear Physics, University of Cologne (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria); National Institute for Physics and Nuclear Engineering, Bucharest-Magurele (Romania)
2016-07-01
The one-phonon mixed-symmetry quadrupole excitation 2{sup +}{sub ms} is a well established excitation mode in near-spherical nuclei, especially in the A ∼ 100 mass region. However, it is largely unknown how mixed-symmetry states evolve along shape-transitional paths, e.g. from spherical to deformed shapes. The chain of stable ruthenium isotopes is well suited for this study since it exhibits a smooth transition from spherical ({sup 96,98}Ru) to deformed shapes ({sup 104}Ru). To identify the 2{sup +}{sub ms} state of {sup 98}Ru on the basis of absolute M1 and E2 transition strengths, we performed a proton-scattering experiment on {sup 98}Ru using the SONIC rate at HORUS setup at the University of Cologne. Lifetimes of excited states were measured via the Doppler-shift attenuation method (DSAM), which benefits from the acquired pγ-coincidence data. First results of this experiment are presented and compared to the neighbouring nuclei {sup 96}Ru and {sup 100}Ru.
Energy Technology Data Exchange (ETDEWEB)
Mizumoto, Yoshihiko (Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology); Iwata, Shiro; Sasajima, Kazuhisa; Yoshimasu, Fumio; Yase, Yoshiro
1984-01-01
Reactor neutron activation analysis for aluminium in samples containing phosphorus and silicon was studied. The experiments were performed by using pneumatic tube of the Kyoto University Reactor (KUR). At first, the ratios of the /sup 28/Al activity produced from /sup 27/Al(n, ..gamma..) /sup 28/Al reaction by thermal neutrons to that from /sup 31/P(n, ..cap alpha..)/sup 28/Al reaction by fast neutrons, and to that from /sup 28/Si(n, p)/sup 28/Al reaction were measured by ..gamma..-ray spectrometry. With a ratio of about 5 for the thermal to fast neutron flux of KUR, the ratio of the /sup 28/Al activity from aluminium to that from phosphorus was to be 812 +- 7, and to that from silicon 282 +- 3. Secondly, the contributions of /sup 28/Al activities from phosphorus and silicon and the determination limit of aluminium were calculated for various parameters, such as fast neutron flux, thermal to fast neutron flux ratio, amounts of phosphorus and silicon, etc. Thirdly, on the basis of these results, aluminium contents in spinal cords and brains of amyotrophic lateral sclerosis, Parkinsonism-dementia complex and control cases were determined.
Energy Technology Data Exchange (ETDEWEB)
McGivern, Dustin [Univ. College London, Bloomsbury (United Kingdom)
2005-12-23
Measurements of the production cross section of W<sup>+> W<sup>-> pairs in p$\\bar{p}$ collisions at 1.96 TeV and limits on trilinear gauge boson coupling (TGC) parameters are presented. The data were recorded with the CDF experiment at Tevatron during the 2001 and 2002 data taking periods in which a total integrated luminosity of 184 pb<sup>-1sup> was collected. The data sample was filtered for events with two leptonic w boson decays where the charged leptons can be either electrons or muons. 17 events are observed against an expected background of 5.0$+2.2\\atop{-0.8}$ events. The resulting cross-section is found to be σ(p$\\bar{p}$ → W<sup>+> W<sup>->) = 14.5$+5.8\\atop{-5.1}$(stat)$+1.8\\atop{-3.0}$(syst) ± 0.9(lum) pb and agrees well with the Standard Model expectation. Limits on the TGC parameters Δκ and λ are set under both the equal coupling scheme, that assumes the W boson couples identically to the Z and γ, and the HISZ coupling scheme, that requires the couplings to respect SU(2)L x &(1)Y gauge symmetry. In both cases this is achieved by using a likelihood fit to the lepton-PT distribution of the 17 candidate events. The resulting limits are found to be: -0.4 < Δκ < +0.6(λ = 0); -0.3 < λ < +0.4 (Δκ = 0) for the EQUAL couplings and -0.7 < Δκ < +0.9 (λ = 0); -0.4 < λ < +0.4 (Δκ = 0) for the HISZ couplings.
Energy Technology Data Exchange (ETDEWEB)
McIntosh, Lawrence P., E-mail: mcintosh@chem.ubc.ca; Kang, Hyun-Seo; Okon, Mark [University of British Columbia, Department of Biochemistry (Canada); Nelson, Mary L.; Graves, Barbara J. [University of Utah, Department of Oncological Sciences, Huntsman Cancer Institute (United States); Brutscher, Bernhard [CNRS, CEA, UJF, Institut de Biologie Structurale Jean-Pierre Ebel (France)], E-mail: bernhard.brutscher@ibs.fr
2009-01-15
A simple NMR method is presented for the identification and assignment of phosphorylated serine and threonine residues in {sup 13}C- or {sup 13}C/{sup 15}N-labeled proteins. By exploiting modest ({approx}5 Hz) 2- and 3-bond {sup 13}C-{sup 31}P scalar couplings, the aliphatic {sup 1}H-{sup 13}C signals from phosphoserines and phosphothreonines can be detected selectively in a {sup 31}P spin-echo difference constant time {sup 1}H-{sup 13}C HSQC spectrum. Inclusion of the same {sup 31}P spin-echo element within the {sup 13}C frequency editing period of an intraHNCA or HN(CO)CA experiment allows identification of the amide {sup 1}H{sup N} and {sup 15}N signals of residues (i) for which {sup 13}C{sup {alpha}}(i) or {sup 13}C{sup {alpha}}(i - 1), respectively, are coupled to a phosphate. Furthermore, {sup 31}P resonance assignments can be obtained by applying selective low power cw {sup 31}P decoupling during the spin-echo period. The approach is demonstrated using a PNT domain containing fragment of the transcription factor Ets-1, phosphorylated in vitro at Thr38 and Ser41 with the MAP kinase ERK2.
The effect of weak resonances on the sup 25 Mg(p,gamma) sup 26 Al reaction rate
Energy Technology Data Exchange (ETDEWEB)
Champagne, A E [Princeton Univ., NJ (USA). Dept. of Physics; Howard, A J [Trinity Coll., Hartford, CT (USA). Dept. of Physics and Astronomy; Smith, M S; Magnus, P V; Parker, P D [Yale Univ., New Haven, CT (USA). Wright Nuclear Structure Lab.
1989-12-11
The {sup 25}Mg({sup 3}He,d){sup 26}Al reaction has been used to estimate proton spectroscopic factors for states which could be weak {sup 25}Mg+p resonances located near the proton-capture threshold. One of these states (corresponding to a resonance energy E{sub c.m.}=92.2 keV) is found to have a significant effect on the {sup 25}Mg(p,gamma){sup 26}Al reaction rate for temperatures characteristic of Wolf-Rayet stars or late-stage red giants. (orig.).
Human Transcriptome and Chromatin Modifications: An ENCODE Perspective
Directory of Open Access Journals (Sweden)
Li Shen
2013-06-01
Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.
Energy Technology Data Exchange (ETDEWEB)
Shepard, J R; Zimmerman, W R; Kraushaar, J J [Colorado Univ., Boulder (USA). Dept. of Physics and Astrophysics
1977-01-04
Strong transitions in the /sup 58/Ni(/sup 3/He,..cap alpha..)/sup 57/Ni reaction were analyzed using both the zero-range and exact finite-range DWBA. Data considered covered a range of bombarding energies from 15 to 205 MeV. The zero-range DWBA described all data well when finite-range and non-locality corrections were included in the local energy approximation. Comparison of zero-range and exact finite-range calculations showed the local energy approximation correction to be very accurate over the entire energy region. Empirically determined D/sub 0/ values showed no energy dependence. A theoretical D/sub 0/ value calculated using an ..cap alpha.. wave function which reproduced the measured ..cap alpha.. rms charge radius and the elastic electron scattering form factor agreed well the empirical values. Comparison was made between these values and D/sub 0/ values quoted previously in the literature.
Energy Technology Data Exchange (ETDEWEB)
Lahbib-Mansais, Y.; Yerle, M.; Dalens, M.; Chevalet, C.; Gellin, J. (Centre de Recherches de Toulouse (France))
1993-01-01
Two genes coding for Na[sup +],K[sup +] -ATPase [alpha] and [beta] subunits are localized on pig chromosome 4, to the q1.6[yields]q2.3 and 1.3[yields]q2.1 regions, respectively, by radioactive in situ hybridization. According to nucleotide and amino acid sequence comparisons with different human isoforms of Na[sup +] ,K[sup +]-ATPase, these pig [alpha] and [beta] ATPase genes show strong homologies with human [alpha]1 and [beta] subunit ATPase genes, respectively. These results are discussed with respect to comparative mapping data of conserved genes in mammalian species. We showed that the pig cDNA probes encoding ATPase [alpha] and, [beta] genes reveal DNA polymorphism in Meishan an Large White pigs. 35 refs., 4 figs., 2 tabs.
Energy Technology Data Exchange (ETDEWEB)
Marganiec, Justyna [ExtreMe Matter Institute EMMI, GSI Darmstadt, Darmstadt (Germany); Aumann, Thomas; Heil, Michael; Plag, Ralf; Wamers, Felix [Kernreaktionen und Nuklear Astrophysik, GSI Darmstadt, Darmstadt (Germany)
2010-07-01
For the production of proton-rich nuclei during the rp process two-proton capture plays an important role. This process can bridge long-lived waiting points which otherwise hamper the mass flow between CNO material and the FeNi mass region. One of these waiting points is {sup 15}O. The three-body radiative capture can proceed sequentially or directly from the three-body continuum. The rate of the {sup 15}O(2p,{gamma}){sup 17}Ne reaction obtained using the two-successive-proton-capture model has been discussed in J. Goerres et al. (Phys. Rev. C 51, 392, 1995). The role of continuum states ({sup 15}O+2p) for the rate calculation has been demonstrated in L.V Grigorenko, M.V. Zhukov (Phys. Rev. C 72, 015803, 2005). It has been suggested that the reaction rate can be enhanced by a few orders of magnitude by taking into account the three-body continuum. In order to verify these calculations, we have deduced the {sup 15}O(2p,{gamma}){sup 17}Ne cross section by studying the time-reversed process, the Coulomb dissociation of {sup 17}Ne, at the LAND/R{sup 3}B setup at GSI, using a {sup 17}Ne secondary beam from the fragment separator FRS.
Directory of Open Access Journals (Sweden)
Ali Mobasheri
2012-04-01
Full Text Available Membrane transport systems participate in fundamental activities such as cell cycle control, proliferation, survival, volume regulation, pH maintenance and regulation of extracellular matrix synthesis. Multiple isoforms of Na<sup>+>, K<sup>+>-ATPase are expressed in primary chondrocytes. Some of these isoforms have previously been reported to be expressed exclusively in electrically excitable cells (i.e., cardiomyocytes and neurons. Studying the distribution of Na<sup>+>, K<sup>+>-ATPase isoforms in chondrocytes makes it possible to document the diversity of isozyme pairing and to clarify issues concerning Na<sup>+>, K<sup>+>-ATPase isoform abundance and the physiological relevance of their expression. In this study, we investigated the expression of Na<sup>+>, K<sup>+>-ATPase in a human chondrocyte cell line (C-20/A4 using a combination of immunological and biochemical techniques. A panel of well-characterized antibodies revealed abundant expression of the α1, β1 and β2 isoforms. Western blot analysis of plasma membranes confirmed the above findings. Na<sup>+>, K<sup>+>-ATPase consists of multiple isozyme variants that endow chondrocytes with additional homeostatic control capabilities. In terms of Na<sup>+>, K<sup>+>-ATPase expression, the C-20/A4 cell line is phenotypically similar to primary and in situ chondrocytes. However, unlike freshly isolated chondrocytes, C-20/A4 cells are an easily accessible and convenient in vitro model for the study of Na<sup>+>, K<sup>+>-ATPase expression and regulation in chondrocytes.
Xi */sup -/(2030) production in K/sup -/p reactions at 42 GeV/c
Hemingway, R J; Bergé, J P; Díaz, J; Gay, J B; Heinen, P M; Jongejans, B; Lamb, P R; Massaro, G G G; McDowell, W L; Metzger, W J; Tiecke, H G; Timmermans, J; Trepagnier, P; Voorthuis, H
1977-01-01
Significant production of Xi */sup -/(2030) is observed in the channel K/sup -/p to ( Sigma K)/sup -/K/sup +/ from a high statistics bubble chamber exposure at 4.2 GeV/c. The mass and width are determined to be 2024+or-2 MeV and 16+or-5 MeV respectively. Apart from Sigma K, the only other channel is found to be Lambda K. (7 refs).
Energy Technology Data Exchange (ETDEWEB)
Roussel, P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1968-05-01
We describe an experimental study of ({alpha},t), ({alpha},{sup 3}He) reactions at 44 MeV using a solid-state identifier, on the target-nuclei {sup 54}Fe and {sup 58,60,62,64}Ni. A critical study of optical model and of disturbed wave analysis has been performed. We show the complementarity of different transfer-reactions, the ambiguity of spectroscopic factors, the importance of the problem of the reaction mechanism. (author) [French] On decrit une etude experimentale des reactions ({alpha},t), ({alpha},{sup 3}He) a 44 MeV utilisant un systeme identificateur de particules sur les noyaux-cibles {sup 54}Fe et {sup 58,60,62,64}Ni. Une etude critique de modele optique et d'analyse en ondes deformees (D.W.B.A.) a ete entreprise. On montre la complementarite des differentes reactions de transfert, l'ambiguite des facteurs spectroscopiques, l'importance du probleme du mecanisme. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Carraher, Jack M. [Ames Lab., Ames, IA (United States); Iowa State Univ., Ames, IA (United States); Bakac, Andreja [Ames Lab., Ames, IA (United States); Iowa State Univ., Ames, IA (United States)
2014-08-04
Laser flash photolysis of 4-benzoylpyridine N-oxide (BPyO) at 308 nm in aqueous solutions generates a triplet excited state <sup>3sup>BPyO* that absorbs strongly in the visible, λmax 490 and 380 nm. <sup>3sup>BPyO* decays with the rate law kdecay/s<sup>-1sup> = (3.3 ± 0.9) × 10<sup>4sup> + (1.5 ± 0.2) × 10<sup>9sup> [BPyO] to generate a mixture of isomeric hydroxylated benzoylpyridines, BPy(OH), in addition to small amounts of oxygen atoms, O(<sup>3sup>P). Molecular oxygen quenches <sup>3sup>BPyO*, kQ = 1.4 × 10<sup>9sup> M<sup>-1sup> s<sup>-1sup>, but the yields of O(<sup>3sup>P) increase in O2-saturated solutions to 36%. Other triplet quenchers have a similar effect, which rules out the observed <sup>3sup>BPyO* as a source of O(<sup>3sup>P). It is concluded that O(<sup>3sup>P) is produced from either <sup>1sup>BPyO* or a short-lived, unobserved, higher energy triplet generated directly from <sup>1sup>BPyO*. <sup>3sup>BPyO* is reduced by Fe<sup>2+sup> and by ABTS<sup>2-sup> to the radical anion BPyO<sup>.- sup>which exhibits a maximum at 510 nm, ε = 2200 M<sup>-1sup> cm<sup>-1sup>. The anion engages in back electron transfer with ABTS<sup>.-> with k = 1.7 × 109 M<sup>-1sup> s<sup>-1sup>. The same species can be generated by reducing ground state BPyO with <sup>.>C(CH3)2OH. The photochemistry of BPyO in acetonitrile is similar to that in aqueous solutions.
Phase shift and zeros in K/sup +/p
Energy Technology Data Exchange (ETDEWEB)
Urban, M [California Univ., Berkeley (USA). Lawrence Berkeley Lab.
1975-12-22
A specific example--K/sup +/p elastic scattering--is used to show some drawbacks of the classical phase shift analysis (PSA). The recently introduced method of zeros is used to obtain new results concerning K/sup +/p elastic and to prove that PSA are not well fit to the study of this interaction.
The Λ{sub b} → Λ (→ pπ{sup -})μ{sup +}μ{sup -} decay in the aligned two-Higgs-doublet model
Energy Technology Data Exchange (ETDEWEB)
Hu, Quan-Yi; Li, Xin-Qiang; Yang, Ya-Dong [Central China Normal University, Institute of Particle Physics and Key Laboratory of Quark and Lepton Physics (MOE), Wuhan, Hubei (China)
2017-04-15
The rare baryonic decay Λ{sub b} → Λ (→ pπ{sup -})μ{sup +}μ{sup -} provides valuable complementary information compared to the corresponding mesonic b → sμ{sup +}μ{sup -} transition. In this paper, using the latest high-precision lattice QCD calculation of the Λ{sub b} → Λ transition form factors, we study this interesting decay within the aligned two-Higgs-doublet model, paying particularly attention to the effects of the chirality-flipped operators generated by the charged scalars. In order to extract the full set of angular coefficients in this decay, we consider the following ten angular observables, which can be derived from the analysis of the subsequent parity-violating Λ → pπ{sup -} decay: the differential branching fraction dB/dq{sup 2}, the longitudinal polarization fraction F{sub L}, the lepton-, hadron- and combined lepton-hadron-side forward-backward asymmetries A{sub FB}{sup l}, A{sub FB}{sup Λ} and A{sub FB}{sup lΛ}, as well as the other five asymmetry observables Y{sub i} (i = 2, 3s, 3sc, 4s, 4sc). Detailed numerical comparisons are made between the SM and NP values for these angular observables. It is found that, under the constraints from the inclusive B → X{sub s}γ branching fraction and the latest global fit results of b → sll data, the contributions of right-handed semileptonic operators O{sup '}{sub 9,10}, besides reconciling the P{sub 5}{sup '} anomaly observed in B{sup 0} → K{sup *0}μ{sup +}μ{sup -} decay, could also enhance the values of dB/dq{sup 2} and A{sub FB}{sup l} in the bin [15,20] GeV{sup 2}, leading to results consistent with the current LHCb measurements. (orig.)
Synthesis of (/sup 3/H-Tyr/sup B26/)-human insulin by enzymic semisynthesis
Energy Technology Data Exchange (ETDEWEB)
Haensicke, A; Kaufmann, K D; Beyermann, M; Oehlke, J; Kertscher, U; Bienert, M; Niedrich, H; Mittag, E; Bespalova, Zh D; Titov, M I
1988-11-01
A procedure is described for tritium labelling of human insulin in position Tyr/sup B26/ by means of trypsin catalyzed condensation of DiBoc-DOI with (N/sup /epsilon//-Boc, /sup 3/H-Tyr/sup B26/)-IOP, subsequent deprotection and purification by HPLC. The tritium labelling of the octapeptide was accomplished by dehalotritiation of the corresponding Dit/sup B26/-octapeptide which was obtained both by iodination of N/sup /epsilon//-Boc-IOP and by total synthesis. (author). 2 figs., 1 tab., 17 refs.
Search for ({lambda}{sup 2})/p{sup 2} corrections to the QCD running coupling
Energy Technology Data Exchange (ETDEWEB)
Burgio, G.; Di Renzo, F.; Parrinello, C.; Pittori, C
1999-03-01
We investigate the occurrence of power terms ({lambda}{sup 2})/p>{sup 2} in the running QCD coupling by analysing non-perturbative measurements of {alpha}{sub s}(p) at quite low momenta obtained from the lattice three-gluon vertex. Our study provides some evidence for such a contribution. The phenomenological implications of such a presence are reviewed.
Energy Technology Data Exchange (ETDEWEB)
Krambrich, D.
2007-01-15
Since spring 2004 the Crystal Ball Detector has been used for coincidence experiments probing the structure of the nucleons with real photons at the Mainzer Microtron. A major part of the commissioning, which was the first goal of this work, was the development and implementation of a new system for the Crystal Ball electronics. Components were designed or tested and, if necessary, modified to fit the experimental needs. After the commissioning, the set-up was then used successfully in several pion and eta production experiments for more than 2500 hours of beamtime. The second focus of this dissertation is the first measurement of the beam helicity asymmetry I{sup s}un in photoproduction of two neutral pions. The understanding of the excitation spectra of the nucleon requires experiments using polarised photons and/or polarised targets. Models based on different assumptions do reproduce the quantities measured without polarisation equally well but differ in the prediction of polarisation observables. The determination of more sensitive quantities is therefore mandatory. In contrast to single meson production, an observable appears in double pion production when using circularly polarized photons incident on an unpolarized target. This observable was determined as a function of energy and angle in the reactions {gamma} p {yields} p {pi}{sup 0} {pi}{sup 0} and in {gamma} p {yields} p {pi}{sup +} {pi}{sup -}. The results differ significantly from the model predictions. (orig.)
Intermediate resonance excitation in the {gamma}p->p{pi}{sup 0}{pi}{sup 0} reaction
Energy Technology Data Exchange (ETDEWEB)
Ahrens, J. [Institut fuer Kernphysik, Universitaet Mainz, D-55099 Mainz (Germany); Altieri, S. [INFN, Sezione di Pavia, I-27100 Pavia (Italy); Dipartimento di Fisica Nucleare e Teorica, Universita di Pavia, I-27100 Pavia (Italy); Annand, J.R.M. [Department of Physics and Astronomy, University of Glasgow (United Kingdom)] (and others)
2005-09-29
The helicity dependence of the total cross section for the {gamma}->p->->p{pi}{sup 0}{pi}{sup 0} reaction has been measured for the first time at incident photon energies from 400 to 800 MeV. The measurement, performed at the tagged photon beam facility of the MAMI accelerator in Mainz, used the large acceptance detector DAPHNE and a longitudinally polarized frozen-spin target. This channel is found to be excited predominantly when the photon and proton have a parallel spin orientation, most likely due to the intermediate production of the D{sub 13}(1520) resonance. However, the contribution of the antiparallel spin configuration, arising from other reaction mechanisms, is also not negligible. This result gives important new information to resolve the existing model discrepancies in the identification of the nucleon resonances contributing to this channel.
RNAi suppressors encoded by pathogenic human viruses
de Vries, Walter; Berkhout, Ben
2008-01-01
RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Takeshi, E-mail: takeshi-takahashi@ciea.or.jp; Katano, Ikumi; Ito, Ryoji; Ito, Mamoru
2015-01-02
Highlights: • β-Lactoglobulin (BLG) specific TCR genes were introduced to human HSC by retrovirus. • Human HSC with BLG-specific TCR were transplanted into NOG-HLA-DR4 I-A{sup −/−} mice. • BLG-specific TCR induced positive selection of thymocytes. • BLG-specific TCR positive CD4{sup +} T cells mediated immune responses in humanized mice. - Abstract: The development of severe immunodeficient mouse strains containing various human genes, including cytokines or HLA, has enabled the reconstitution of functional human immune systems after transplantation of human hematopoietic stem cells (HSC). Accumulating evidence has suggested that HLA-restricted antigen-specific human T-cell responses can be generated in these humanized mice. To directly monitor immune responses of human CD4{sup +} T cells, we introduced β-lactoglobulin (BLG)-specific T cell receptor (TCR) genes derived from CD4{sup +} T-cell clones of cow-milk allergy patients into HSCs, and subsequently transplanted them into NOG-HLA-DR4 transgenic/I-Aβ deficient mice (NOG-DR4/I-A{sup o}). In the thymus, thymocytes with BLG-specific TCR preferentially differentiated into CD4{sup +}CD8{sup −} single-positive cells. Adoptive transfer of mature CD4{sup +} T cells expressing the TCR into recipient NOG-DR4/I-A{sup o} mice demonstrated that human CD4{sup +} T cells proliferated in response to antigenic stimulation and produced IFN-γ in vivo, suggesting that functional T-cell reactions (especially Th1-skewed responses) were induced in humanized mice.
A Selective Neutron Detector in the keV Region Utilizing the {sup 19}F (n, gamma) {sup 20}F Reaction
Energy Technology Data Exchange (ETDEWEB)
Konijn, J
1963-05-15
The Research Swimming-Pool Reactor R2-0 at Studsvik has been used to investigate some resonance and threshold reactions for neutron flux measurements. This reactor, equipped with MTR type fuel elements, has a maximum neutron flux of about 10{sup 12} n/cm{sup 2}/sec, giving a thermal output of 100 kW. A pneumatic rabbit was constructed to bring the samples in activation position, in which there was 15 cm H{sub 2}O and 1.2 cm Al between reactor and foil. A covering, containing 1.22 g {sup 10}B/cm{sup 2} was pushed over the cadmium-covered Al tube of the rabbit. The activation of the foil was measured with a Nal(Tl)-scintillation spectrometer. From the gamma ray spectrum, recorded on a 256 channel pulse height analyzer, the epithermal neutron flux per unit of In E interval was calculated. The activation cross section for {sup 19}F (n, {gamma}) {sup 20}F in the {sup 10}B-covering was computed to be 16 mb, and about 60 % of the induced activity is due to neutrons in the energy range of 20-70 keV. The experimental results were compared with those obtained from the more known resonance reactions {sup 63}Cu (n, {gamma}) {sup 64}Cu and {sup 27}Al (n, {gamma}) {sup 28}Al. The epithermal neutron flux experiments are in good agreement with each other. The fast neutron flux measurements were carried out with the following threshold detectors: {sup 197}Au (n, n') {sup 197m}Au, {sup 58}Ni (n, p) {sup 58}Co, {sup 27}Al (n, p) {sup 27}Mg and {sup 19}F (n, p) {sup 19}O. From these experiments the ratio of {phi}{sub epi}/{phi}{sub fiss} =0.045 {+-} 0.010 is determined at the activation position. The half-life of {sup 197}Au m was determined to 7.35 {+-} 0.25 sec.
Energy Technology Data Exchange (ETDEWEB)
Godfrey, Edmund M. [St James' Hospital, Leeds (United Kingdom); St James' Hospital, Department of Radiology, Leeds (United Kingdom); Patterson, Andrew J.; Priest, Andrew N.; Davies, Susan E.; Joubert, Ilse; Krishnan, Anant S.; Shaw, Ashley S.; Alexander, Graeme J.; Allison, Michael E.; Griffiths, William J.H.; Gimson, Alexander E.S. [Addenbrooke' s Hospital, Cambridge (United Kingdom); Griffin, Nyree [St Thomas' s Hospital, London (United Kingdom); Lomas, David J. [University of Cambridge, Department of Radiology, Cambridge (United Kingdom)
2012-12-15
Conventional imaging techniques are insensitive to liver fibrosis. This study assesses the diagnostic accuracy of MR elastography (MRE) stiffness values and the ratio of phosphomonoesters (PME)/phosphodiesters (PDE) measured using {sup 31}P spectroscopy against histological fibrosis staging. The local research ethics committee approved this prospective, blinded study. A total of 77 consecutive patients (55 male, aged 49 {+-} 11.5 years) with a clinical suspicion of liver fibrosis underwent an MR examination with a liver biopsy later the same day. Patients underwent MRE and {sup 31}P spectroscopy on a 1.5 T whole body system. The liver biopsies were staged using an Ishak score for chronic hepatitis or a modified NAS fibrosis score for fatty liver disease. MRE increased with and was positively associated with fibrosis stage (Spearman's rank = 0.622, P < 0.001). PME/PDE was not associated with fibrosis stage (Spearman's rank = -0.041, p = 0.741). Area under receiver operating curves for MRE stiffness values were high (range 0.75-0.97). The diagnostic utility of PME/PDE was no better than chance (range 0.44-0.58). MRE-estimated liver stiffness increases with fibrosis stage and is able to dichotomise fibrosis stage groupings. We did not find a relationship between {sup 31}P MR spectroscopy and fibrosis stage. circle Magnetic resonance elastography (MRE) and MR spectroscopy can both assess the liver. (orig.)
Study of Sigma /sup +or-/(1385) inclusive production in K/sup -/p interactions at 42 GeV/c
Barreiro, F; Blokzijl, R; Engelen, J J; Ganguli, S N; Gavillet, P; Hemingway, R J; Kittel, E W; Kluyver, J C; Shephard, W D; Wolters, G F
1977-01-01
Properties of Sigma /sup +or-/(1385) inclusively produced in 4.2 GeV/c K/sup -/p interactions are studied. Inclusive cross sections are presented together with differential cross sections as functions of x and p/sub t//sup 2/ for both Sigma /sup +/(1385) and Sigma /sup - /(1385). The complete density matrix for Sigma /sup +/(1385) production at small momentum transfer is studied as a function of t and of recoil mass MM/sup 2/. Substantial agreement with the predictions of the additive quark model is found. The Sigma /sup + /(1385) production in the target fragmentation region is studied in the framework of the triple-Regge model. (17 refs).
Energy Technology Data Exchange (ETDEWEB)
Marechal, F
1998-02-06
We measured for the first time the elastic and inelastic proton scattering on the {sup 40}S unstable nucleus. The experiment was performed in inverse kinematics at the NSCL AT Michigan State University with a {sup 40}S secondary beam bombarding a CH{sub 2} target at 30 MeV/A. We obtained the elastic scattering angular distribution and two points of the inelastic distribution to the first 2{sup +} excited state found to be located at 860{+-}90 KeV. With a coupled channel analysis, the {beta}{sub 2} quadrupolar deformation parameter is found to be equal to 0.35{+-}0.05. This value can be compared to 0.28{+-}0.02 obtained by coulomb excitation. A macroscopic analysis allowed us to extract the neutron and proton transition matrix element ratio M{sub n}/M{sub p} which is equal to 1.88{+-}0.38. This value, greater than N/Z, could indicate an isovector effect in the first 2{sup +} state excitation which could be due to a difference between the neutron and proton vibrations. The microscopic analysis gives the possibility to test the densities and the transition densities to the first 2{sup +} state. The calculated densities for the {sup 40}S nucleus show a neutron skin. However the microscopic analysis yields a M{sub n}/M{sub p} ratio of 1.40{+-}0.20. A similar elastic and inelastic proton scattering experiment allowed us to get a deformation parameter of 0.25{+-}0.03 for the {sup 43}Ar nucleus. To develop the study of direct reactions induced by radioactive beams at GANIL, we have developed and built, in collaboration with the CEA-Saclay and the CEA-Bruyeres, the new detector MUST.It is based on the silicon strip technology, and is dedicated to the measurement of recoiling light particles emitted in these reactions. The results obtained with a {sup 40}Ar beam at 77 Me V/A, have shown the good performances of the detector for the particle identification as well as for the resolutions, and allow us to consider now a large experimental programme concerning these direct
Energy Technology Data Exchange (ETDEWEB)
Beaumevieille, H. [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires
1964-05-01
The interpretation of the results of the reaction {sup 6}Li (p, {alpha}) in the energy range 100 keV to 3 MeV has been done with the next levels of {sup 7}Be : 3/2- (5,9 MeV), 3/2+ (6,2 MeV), 5/2- (7,18 MeV) and a level the characteristics of which may be 1/2+ or {sup 4}P (9,5 MeV). (author) [French] L'interpretation des resultats de la reaction {sup 6}Li (p, {alpha}) dans la gamme d'energie 100 keV a 3 MeV a ete faite avec les niveaux suivants du {sup 7}Be : 3/2- (5,9 MeV), 3/2 + (6,2 MeV), 5/2- (7,18 MeV) et un niveau dont les caracteristiques doivent etre 1/2+ ou {sup 4}P (9,5 MeV). (auteur)
Energy Technology Data Exchange (ETDEWEB)
Beaumevieille, H [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires
1964-05-01
The interpretation of the results of the reaction {sup 6}Li (p, {alpha}) in the energy range 100 keV to 3 MeV has been done with the next levels of {sup 7}Be : 3/2- (5,9 MeV), 3/2+ (6,2 MeV), 5/2- (7,18 MeV) and a level the characteristics of which may be 1/2+ or {sup 4}P (9,5 MeV). (author) [French] L'interpretation des resultats de la reaction {sup 6}Li (p, {alpha}) dans la gamme d'energie 100 keV a 3 MeV a ete faite avec les niveaux suivants du {sup 7}Be : 3/2- (5,9 MeV), 3/2 + (6,2 MeV), 5/2- (7,18 MeV) et un niveau dont les caracteristiques doivent etre 1/2+ ou {sup 4}P (9,5 MeV). (auteur)
Energy Technology Data Exchange (ETDEWEB)
Avakyan, R. O.; Avakyan, E. O.; Avetisyan, A. E.; Aivazyan, R. B.; Arestakesyan, G. A.; Bagdasryan, A. S.; Vartapetyan, G. A.; Garibyan, Y. A.; Eganov, V. S.; Karapetyan, A. P.; and others
1988-12-01
Measurements are reported of the energy dependence of the /ital p//sub /ital xz// and /ital P//sub /ital y// components of the polarization vector of the recoil protons in the reaction ..gamma../ital p//r arrow//ital p/..pi../sup 0/ for a ..pi../sup 0/-meson production angle theta/sup *//sub ..pi../sup 0// =80/degree/ in the c.m.s. in the ..gamma..-ray energy range /ital E//sub ..gamma../=730--1066 MeV. The experimental data are compared with the results of various phenomenological analyses.
Energy Technology Data Exchange (ETDEWEB)
Matulewicz, T; Decowski, P; Kicinska-Habior, M; Sikora, B; Toke, J
1983-01-01
The /sup 28/Si(p, ..gamma..)/sup 29/P reaction data have been analyzed in terms of a modified direct-semidirect capture model which accounts for the presence of broad shape (single-particle) resonances in the entrance channel. Values of the spectroscopic factors for the ground state and 1,65 MeV and 2,88 MeV resonances in /sup 29/P nuclei were extracted and found to be consistent with those obtained in other experiments. The modified theoretical analysis scheme was found to provide a convenient tool for analyzing the radiative capture reaction data.
Energy Technology Data Exchange (ETDEWEB)
Dickstein, Leah P.; Zoghbi, Sami S.; Fujimura, Yota; Imaizumi, Masao; Zhang, Yi; Pike, Victor W.; Innis, Robert B.; Fujita, Masahiro [National Institutes of Health, Molecular Imaging Branch, National Institute of Mental Health, Bethesda, MD (United States)
2011-02-15
Translocator protein (TSPO) is a promising biomarker for neuroinflammation. We developed two new PET ligands, {sup 18}F-PBR06 and {sup 11}C-PBR28, to image TSPOs. Although our prior studies suggest that either of the two ligands could be used to quantify TSPOs in human brain, the studies were done in different sets of subjects. In this study, we directly compared {sup 18}F-PBR06 and {sup 11}C-PBR28 in eight human subjects to determine (1) whether either ligand provides more precise measurements of TSPOs and (2) whether the higher in vitro affinity of PBR06 compared to PBR28 led to higher in vivo binding of {sup 18}F-PBR06 compared to {sup 11}C-PBR28. In vivo binding was calculated as total distribution volume (V{sub T}), using an unconstrained two-tissue compartment model. V{sub T} was corrected for plasma free fraction (f{sub P}) to measure ligand binding based on free ligand concentration in brain. Both ligands measured V{sub T} with similar precision, as evidenced by similarly good identifiability. However, V{sub T} for both radioligands increased with increasing lengths of data acquisition, consistent with the accumulation of radiometabolites in brain. Despite its higher lipophilicity and higher in vitro affinity, V{sub T}/f{sub P} of {sup 18}F-PBR06 was similar to that of {sup 11}C-PBR28. Both {sup 18}F-PBR06 and {sup 11}C-PBR28 are similar in terms of precision, sensitivity to accumulation of radiometabolites, and magnitude of in vivo binding. Thus, selection between the two radioligands will be primarily determined by the logistical impact of the different half-lives of the two radionuclides (110 vs 20 min). (orig.)
Energy Technology Data Exchange (ETDEWEB)
Arai, K.; Aoyama, S.; Suzuki, Y.; Descouvemont, P.; Baye, D. [Division of General Education, Nagaoka National College of Technology, 888 Nishikatakai, Nagaoka, Niigata, 940-8532 (Japan); Center for Academic Information Service, Niigata University, Niigata 950-2181 (Japan); Department of Physics, Niigata University, Niigata 950-2181, Japan and RIKEN Nishina Center, Wako 351-0198 (Japan); Physique Nucleaire Theorique et Physique Mathematique, C.P.229, Universite Libre de Bruxelles, B 1050 Brussels (Belgium); Physique Quantique, CP165/82, Universite Libre de Bruxelles, B-1050 Brussels (Belgium)
2012-11-12
The {sup 2}H(d,p){sup 3}H, {sup 2}H(d,n){sup 3}He, and {sup 2}H(d,{gamma}){sup 4}He reactions at low energies are studied with realistic nucleon-nucleon interactions in an ab initio approach. The obtained astrophysical S-factors are all in very good agreement with experiment. The most important channels for both transfer and radiative capture are all found to dominate thanks to the tensor force.
Test of the Zweig rule in. pi. /sup -/p interactions at 19 GeV/c
Energy Technology Data Exchange (ETDEWEB)
Woodworth, P L; Treille, D; Thompson, A S; Strub, R; Sonderegger, P; Palazzi-Cerrina, C; Mitaroff, W A; French, B R [European Organization for Nuclear Research, Geneva (Switzerland); Kumar, R [Glasgow Univ. (UK). Dept. of Natural Philosophy; Kenyon, I R [Birmingham Univ. (UK). Dept. of Physics
1976-10-25
Phi production has been observed in ..pi../sup -/p interactions at 19 GeV/c with (44+-10) events in the final state phi..pi../sup +/..pi../sup -/..pi../sup -/p and (45+-9) events in phiK/sup +/K/sup -/..pi../sup -/p. The production ratios phi..pi../sup +/..pi../sup -/..pi../sup -/p/..omega pi../sup +/..pi../sup -/..pi../sup -/p approximately 0.005 and phiK/sup +/K/sup -/..pi../sup -/p/rho/sup 0/K/sup +/K/sup -/..pi../sup -/p approximately 0.45 agree with Zweig-rule expectations.
Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W
1989-01-01
A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...
Energy Technology Data Exchange (ETDEWEB)
Honma, A.K.
1980-11-01
The results from a high-statistics study of K..pi.. elastic scattering in the reaction K/sup -/p ..-->.. K/sup -/..pi../sup +/n are presented. The data for this analysis are taken from an 11-GeV/c K/sup -/p experiment performed on the Large Aperture Solenoidal Spectrometer (LASS) facility at the Stanford Linear Accelerator Center (SLAC). By selecting the very forward produced K/sup -/..pi../sup +/ events, a sample consisting of data for the K..pi.. ..-->.. K..pi.. elastic scattering reaction was extracted. The angular distribution for this meson-meson scattering is studied by use of both a spherical harmonic moments analysis and a partial-wave analysis (PWA). The previously established leading natural spin-parity strange meson resonances (the J/sup P/ = 1/sup -/ K*(895), the 2/sup +/ K*(1430), and the 3/sup -/ K*(1780)) are observed in the results from both the moments analysis and the PWA. In addition, evidence for a new spin 4/sup -/ K* resonance with a mass of 2080 MeV and a width of about 225 MeV is presented. The results from the PWA confirm the existence of a 0/sup +/ kappa (1490) and propose the existence of a second scalar meson resonance, the 0/sup +/ kappa' (1900). Structure in the P-wave amplitude indicates resonance behavior in the mass region near 1700 MeV. In two of the four ambiguous solutions for the mass region above 1800 MeV, there is strong evidence for another P-wave resonant structure near 2100 MeV. The observed strange meson resonances are found to have a natural interpretation in terms of states predicted by the quark model. In particular, the mass splittings of the leading trajectory natural spin-parity strange meson states and the mass splittings between the spin-orbit triplet states are discussed. 59 figures, 17 tables.
Energy Technology Data Exchange (ETDEWEB)
Rynkun, P., E-mail: pavel.rynkun@gmail.com [Department of Physics and Information Technologies, Lithuanian University of Educational Science, Studentu 39, LT-08106 Vilnius (Lithuania); Jönsson, P. [Group for Materials Science and Applied Mathematics, Malmö University, 20506 Malmö (Sweden); Gaigalas, G. [Department of Physics and Information Technologies, Lithuanian University of Educational Science, Studentu 39, LT-08106 Vilnius (Lithuania); Vilnius University, Institute of Theoretical Physics and Astronomy, A. Goštauto 12, LT-01108 Vilnius (Lithuania); Froese Fischer, C. [National Institute of Standards and Technology, Gaithersburg, MD 20899-8420 (United States)
2014-03-15
Based on relativistic wavefunctions from multiconfiguration Dirac–Hartree–Fock and configuration interaction calculations, E1, M1, E2, and M2 transition rates, weighted oscillator strengths, and lifetimes are evaluated for the states of the (1s{sup 2})2s{sup 2}2p{sup 3},2s2p{sup 4}, and 2p{sup 5} configurations in all nitrogen-like ions between F III and Kr XXX. The wavefunction expansions include valence, core–valence, and core–core correlation effects through single–double multireference expansions to increasing sets of active orbitals. The computed energies agree very well with experimental values, with differences of only 300–600 cm{sup −1} for the majority of the levels and ions in the sequence. Computed transitions rates are in close agreement with available data from MCHF-BP calculations by Tachiev and Froese Fischer [G.I. Tachiev, C. Froese Fischer, A and A 385 (2002) 716].
The 1p-encoded protein stathmin and resistance of malignant gliomas to nitrosoureas.
Ngo, Teri-T B; Peng, Tien; Liang, Xing-Jie; Akeju, Oluwaseun; Pastorino, Sandra; Zhang, Wei; Kotliarov, Yuri; Zenklusen, Jean C; Fine, Howard A; Maric, Dragan; Wen, Patrick Y; De Girolami, Umberto; Black, Peter McL; Wu, Wells W; Shen, Rong-Fong; Jeffries, Neal O; Kang, Dong-Won; Park, John K
2007-04-18
Malignant gliomas are generally resistant to all conventional therapies. Notable exceptions are anaplastic oligodendrogliomas with loss of heterozygosity on chromosome 1p (1p+/-). Patients with 1p+/- anaplastic oligodendroglioma frequently respond to procarbazine, 1-(2-chloroethyl)-3-cyclohexyl-l-nitrosourea, and vincristine. Because the underlying biologic basis for this clinical finding is unclear, we evaluated differentially expressed 1p-encoded proteins in 1p+/- and 1p+/+ malignant glioma cell lines and then examined whether their expression was associated with outcome of patients with anaplastic oligodendroglioma. We used a comparative proteomic screen of A172 (1p+/-) and U251 (1p+/+) malignant glioma cell lines to identify differentially expressed 1p-encoded proteins, including stathmin, a microtubule-associated protein. 1p+/- and 1p+/+ anaplastic oligodendroglioma specimens from 24 patients were assessed for stathmin expression by immunohistochemistry. The relationship between stathmin expression and clinical outcome was assessed with Kaplan-Meier analyses. RNA inhibition and cDNA transfection experiments tested effects of stathmin under- and overexpression, respectively, on the in vitro and in vivo resistance of malignant glioma cells to treatment with nitrosourea. For in vivo resistance studies, 36 mice with intracranial and 16 mice with subcutaneous xenograft tumor implants were used (one tumor per mouse). Flow cytometry was used for cell cycle analysis. Immunoblotting was used to assess protein expression. All statistical tests were two-sided. Decreased stathmin expression in tumors was statistically significantly associated with loss of heterozygosity in 1p (Pnitrosourea-treated mice carrying xenograft tumors. Median survival of mice with stathmin+/- tumors was 95 days (95% CI = 68.7 to 121.3 days) and that of mice with stathmin+/+ tumors was 64 days (95% CI = 58.2 to 69.8 days) (difference = 31 days, 95% CI = 4.1 to 57.9 days; PNitrosoureas induced
Relative brightness of the O{sup +}({sup 2} D-{sup 2} P) doublets in low-energy aurorae
Energy Technology Data Exchange (ETDEWEB)
Whiter, D. K. [Finnish Meteorological Institute, Erik Palménin Aukio 1, FI-00560 Helsinki (Finland); Lanchester, B. S.; Gustavsson, B.; Jallo, N. I. B.; Jokiaho, O.; Dahlgren, H. [School of Physics and Astronomy, University of Southampton, SO17 1BJ (United Kingdom); Ivchenko, N., E-mail: daniel.whiter@fmi.fi [Royal Institute of Technology (KTH), Teknikringen 31, SE-100 44 Stockholm (Sweden)
2014-12-10
The ratio of the emission line doublets from O{sup +} at 732.0 nm (I {sub 732}) and 733.0 nm (I {sub 733}) has been measured in auroral conditions of low-energy electron precipitation from Svalbard (78.°20 north, 15.°83 east). Accurate determination of R = I {sub 732}/I {sub 733} provides a powerful method for separating the density of the O{sup +} {sup 2} P{sub 1} {sub /2,3} {sub /2}{sup o} levels in modeling of the emissions from the doublets. A total of 383 spectra were included from the winter of 2003-2004. The value obtained is R = I {sub 732}/I {sub 733} = 1.38 ± 0.02, which is higher than theoretical values for thermal equilibrium in fully ionized plasma, but is lower than reported measurements by other authors in similar auroral conditions. The continuity equations for the densities of the two levels are solved for different conditions, in order to estimate the possible variations of R. The results suggest that the production of ions in the two levels from O ({sup 3} P {sub 1}) and O ({sup 3} P {sub 2}) does not follow the statistical weights, unlike astrophysical calculations for plasmas in nebulae. The physics of auroral impact ionization may account for this difference, and therefore for the raised value of R. In addition, the auroral solution of the densities of the ions, and thus of the value of R, is sensitive to the temperature of the neutral atmosphere. Although the present work is a statistical study, it shows that it is necessary to determine whether there are significant variations in the ratio resulting from non-equilibrium conditions, from auroral energy deposition, large electric fields, and changes in temperature and composition.
Energy Technology Data Exchange (ETDEWEB)
Tada, Hiroshi; Morooka, Keiichi; Arimoto, Kiyoshi; Matsuo, Takiko; Takagi, Kazue; Yanagawa, Etsuko (Toho Univ., Tokyo (Japan). School of Medicine)
1992-09-01
We studied the clinical usefulness of I[sup 123]-IMP SPECT in 50 pediatric patients with CNS disorders, which were categorized into the convulsive disorder group (n=20), the cerebrovascular disorder group (n=10), the acute encephalopathy or CNS infection group (n=10), the metabolic or degenerative disorder group (n=6), the congenital abnormality group (n=2) and the migraine group (n=2). The findings obtained were compared with those of cranial CT. I[sup 123]-IMP SPECT revealed abnormal findings in 45 out of the 50 patients (90%), although cranial CT showed abnormal findings in only 24 patients (48%). This difference was statistically significant (p<0.01). In all groups except the migraine, we could find abnormal findings in more than 90% of the patients. Out of 28 patients without focal findings on the initial CT scanning. I[sup 123]-IMP SPECT showed focal abnormalities in 26 patients (93%). Moreover in many patients with focal neurological abnormalities, we found focal abnormalities of I[sup 123]-IMP SPECT related with neurological abnormalities of the patients. From these findings, we think I[sup 123]-IMP SPECT might be superior to CT scanning in examining a localized lesion. It was found that in many patients with focal abnormalities in CT scanning, I[sup 123]-IMP SPECT showed larger abnormalities in CT scanning. By using I[sup 123]-IMP SPECT we might be able to study the blood perfusional state surrounding the abnormal area shown by CT. In 3 patients with acute cerebrovascular disorders, I[sup 123]-IMP SPECT revealed abnormal findings 3 to 11 days earlier than cranial CT. I[sup 123]-IMP SPECT might be useful for early recognition of the pathological state. From these experiences, we concluded that I[sup 123]-IMP SPECT was useful for studying the pathophysiology of CNS disorders in children. (author).
/sup 15/N(p,. cap alpha. )/sup 12/C reaction with polarized protons from 0. 34 to 1. 21 MeV
Energy Technology Data Exchange (ETDEWEB)
Pepper, G H; Brown, L [Carnegie Institution of Washington, D.C. (USA). Dept. of Terrestrial Magnetism
1976-03-29
A polarized beam was used to measure angular distributions of the analyzing power of the /sup 15/N(p,..cap alpha..)/sup 12/C reaction at 0.34 MeV and at five energies from 0.92 to 1.21 MeV. The analyzing power can be fitted with associated Legendre polynomials, P/sub 1//sup 1/ and P/sub 2//sup 1/ sufficing to describe the results except near 1.2 MeV where P/sub 3//sup 1/ is also required. Polarization excitation functions were measured throughout the entire energy range at angles where the polynomials P/sub 2//sup 1/ and P/sub 3//sup 1/ are zero. A polarization contour map is given.
Factorization in the inclusive reactions pp to Lambda +X/sup ++/ and K /sup +/p to Lambda +X/sup ++/
Alpgard, K; Ciapetti, G; De Wolf, E; Frodesen, A G; Ginestet, J; Goldschmidt-Clermont, Yves; Grant, A; Grard, F; Hagman, V M; Henri, V P; Herquet, P; Hulth, P A; Jobes, M; Johnson, D; Kinson, J B; Manesse, D; Müller, F; Sekera, Z; Sené, M; Storr, K M; Svedin, U; Tuominiemi, J; Verbeure, F; Vignaud, D; Villanen, P; Watkins, D C; Yamdagni, N
1976-01-01
A test of factorization is made using data on the inclusive reactions pp to Lambda +X/sup ++/ at 19 GeV/c and K/sup +/p to Lambda +X/sup ++/ at 16 GeV/c incident momentum. In these reactions Lambda production occurs dominantly via proton fragmentation and, in addition, abc is exotic in both cases. The comparison of the structure functions on the Chew-Low plot shows that the factorization hypothesis is satisfied at the approximately 10% level when the momentum transfer from the proton to the Lambda is less than 1 (GeV/c)/sup 2/. (8 refs).
Directory of Open Access Journals (Sweden)
Jun Chen
2017-12-01
Full Text Available Cellular receptor-mediated signaling pathways play critical roles during the initial immune response to Human Cytomegalovirus (HCMV infection. However, the involvement of type-I transmembrane glycoprotein CD147/EMMPRIN (extracellular matrix metalloproteinase inducer in the antiviral response to HCMV infection is still unknown. Here, we demonstrated the specific knockdown of CD147 significantly decreased HCMV-induced activation of NF-κB and Interferon-beta (IFN-β, which contribute to the cellular antiviral responses. Next, we confirmed that HCMV-encoded miR-US25-1-5p could target the 3′ UTR (Untranslated Region of CD147 mRNA, and thus facilitate HCMV lytic propagation at a low multiplicity of infection (MOI. The expression and secretion of Cyclophilin A (sCyPA, as a ligand for CD147 and a proinflammatory cytokine, were up-regulated in response to HCMV stimuli. Finally, we confirmed that CD147 mediated HCMV-triggered antiviral signaling via the sCyPA-CD147-ERK (extracellular regulated protein kinases/NF-κB axis signaling pathway. These findings reveal an important HCMV mechanism for evading antiviral innate immunity through its encoded microRNA by targeting transmembrane glycoprotein CD147, and a potential cause of HCMV inflammatory disorders due to the secretion of proinflammatory cytokine CyPA.
Energy Technology Data Exchange (ETDEWEB)
Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))
1990-08-01
We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.
Baryon exchange in 12 GeV/c. pi. /sup -/p interactions. [Differential cross sections
Energy Technology Data Exchange (ETDEWEB)
Arenton, M W; Bacino, W J; Hauptman, J M; Rudnick, F D; Shepard, P F; Slater, W E; Stork, D H; Ticho, H K [California Univ., Los Angeles (USA)
1978-08-14
Final states produced by charged baryon exchange in ..pi../sup -/p interactions at 12 GeV/c laboratory momentum have been studied. Forward neutrons with momenta determined by a calorimeter to be greater than 8.5 +- 1.4 GeV/c triggered the SLAC 40-inch hydrogen bubble chamber which operated at a 10 Hz expansion rate. Data on the reactions ..pi../sup -/p..-->..n..pi../sup -/..pi../sup +/, ..pi../sup -/p..-->..n..pi../sup -/..pi../sup +/..pi../sup 0/, and ..pi../sup -/p..-->..n..pi../sup -/..pi../sup -/..pi../sup +/..pi../sup +/are reported. In ..pi../sup -/p..-->..n..pi../sup -/..pi../sup +/ production of rho and f mesons is observed. Differential cross sections are derived and compared with data at lower incident momentum and with theoretical models. In ..pi../sup -/p..-->..n..pi../sup -/..pi../sup +/..pi../sup 0/, ..omega.. production is observed with a differential cross section having a deep dip near u' = 0.2 (GeV/c)/sup 2/. In ..pi../sup -/p..-->..n..pi../sup -/..pi../sup -/..pi../sup +/..pi../sup +/, ..delta../sup -/, rho and f production is observed. The observed mass distributions appear to indicate the production of wide resonances decaying into rho..pi pi... Some evidence for rho-..omega.. interference is also observed.
Comparison of polarization and analysing power for the /sup 9/Be(p,n)/sup 9/B reaction
Energy Technology Data Exchange (ETDEWEB)
Byrd, R.C.; Lisowski, P.W.; Tornow, W.; Walter, R.L. (Duke Univ., Durham, NC (USA). Dept. of Physics; Triangle Universities Nuclear Lab., Durham, NC (USA))
1983-08-01
A recent Lane model of the /sup 9/Be + nucleon system raised the question of differences between the polarization P(THETA) and the analyzing power A(THETA) in (p, n) reactions between mirror nuclei. Since these two observables are identical under exact charge symmetry, observation of a difference would indicate the breaking of this symmetry, probably by the Coulomb interaction. This paper describes the techniques for measurements of P(THETA) and A(THETA) in (p, n) reactions, with an emphasis on the elimination of systematic errors and the determination of background contributions. Measurements of both observables were made for the /sup 9/Be(p, n/sub 0/)/sup 9/B reaction at several angles for energies from 3 to 10 MeV. The results are combined with previous measurements to develop data sets for a comprehensive comparison of P(THETA) and A(THETA). Previous A(THETA) values agree well with the present measurements, while most of the earlier P(THETA) data are shown to be in error. Our data show that there do exist sizeable differences between P(THETA) and A(THETA) at energies from Esub(p) = 5-7 MeV. The existence of such differences in light nuclear systems is consistent with recent shell-model calculations for the /sup 11/B(p, n/sub 0/)/sup 11/C reaction.
Experiment E89-044 on the Quasielastic <sup>3sup>He(e,e'p) Reaction at Jefferson Laboratory
Energy Technology Data Exchange (ETDEWEB)
Penel-Nottaris, Emilie [Univ. Joseph Fourier Grenoble (France)
2004-07-07
The Jefferson Lab Hall A E89-044 experiment has measured the <sup>3sup>He(e,e'p) reaction cross-sections. The extraction of the longitudinal and transverse response functions for the two-body break-up <sup>3sup>He(e,e'p)d reaction in parallel kinematics allows the study of the bound proton electromagnetic properties inside the <sup>3sup>He nucleus and the involved nuclear mechanisms beyond plane wave approximations.
pK{sup +}Λ final state: Towards the extraction of the ppK{sup −} contribution
Energy Technology Data Exchange (ETDEWEB)
Fabbietti, L., E-mail: laura.fabbietti@ph.tum.de [Excellence Cluster ‘Origin and Structure of the Universe’, 85748 Garching (Germany); Agakishiev, G. [Joint Institute of Nuclear Research, 141980 Dubna (Russian Federation); Behnke, C. [Institut für Kernphysik, Goethe-Universität, 60438 Frankfurt (Germany); Belver, D. [LabCAF, F. Física, Univ. de Santiago de Compostela, 15706 Santiago de Compostela (Spain); Belyaev, A. [Joint Institute of Nuclear Research, 141980 Dubna (Russian Federation); Berger-Chen, J.C. [Excellence Cluster ‘Origin and Structure of the Universe’, 85748 Garching (Germany); Blanco, A. [LIP-Laboratório de Instrumentação e Física Experimental de Partículas, 3004-516 Coimbra (Portugal); Blume, C. [Institut für Kernphysik, Goethe-Universität, 60438 Frankfurt (Germany); Böhmer, M. [Physik Department E12, Technische Universität München, 85748 Garching (Germany); Cabanelas, P. [LabCAF, F. Física, Univ. de Santiago de Compostela, 15706 Santiago de Compostela (Spain); Chernenko, S. [Joint Institute of Nuclear Research, 141980 Dubna (Russian Federation); Dritsa, C. [II. Physikalisches Institut, Justus Liebig Universität Giessen, 35392 Giessen (Germany); Dybczak, A. [Smoluchowski Institute of Physics, Jagiellonian University of Cracow, 30-059 Kraków (Poland); and others
2013-09-20
The reaction p(@3.5 GeV)+p→p+Λ+K{sup +} can be studied to search for the existence of kaonic bound states like ppK{sup −} leading to this final state. This effort has been motivated by the assumption that in p+p collisions the Λ(1405) resonance can act as a doorway to the formation of the kaonic bound states. The status of this analysis within the HADES Collaboration, with particular emphasis on the comparison to simulations, is shown in this work and the deviation method utilized by the DISTO Collaboration in a similar analysis is discussed. The outcome suggests the employment of a partial wave analysis do disentangle the different contributions to the measured pK{sup +}Λ final state.
Energy Technology Data Exchange (ETDEWEB)
Lee, Won Woo; Moon, D. H.; Park, S. Y.; Jin, J.; Kim, S. J.; Lee, H. [Ulsan University College of Medicine, Seoul (Korea, Republic of)
2002-07-01
We have evaluated the feasibility of human sodium iodide symporter (hNIS) as a reporter gene by {sup 99m}TcO{sub 4} scan in vivo. Recombinant adenovirus encoding hNIS (Rad-hNIS) gene was introduced to FRO cell. hNIS expression was assessed by western blot and {sup 99m}TcO{sub 4} uptake in vitro. {sup 99m}TcO{sub 4} scan were obtained in BALB/c mice 48 hrs post injection of Tris buffer, Rad-hNIS (1x10{sup 9} or 2x10{sup 8} pfu), or Rad-LacZ (1x10{sup 9} pfu) via the tail vein (n=5-7 for each group). Biodistribution study and RT-PCR were performed. A series of {sup 99m}TcO{sub 4} scans were obtained in 2 mice until 21 days post Rad-hNIS injection. FRO readily expressed hNIS protein and incorporated significantly higher level of {sup 99m}TcO{sub 4} in vitro. With {sup 99m}TcO{sub 4} scan, prominent hepatic uptake was observed only in the mice with 1x10{sup 9} pfu of Rad-hNIS. Liver/lung ratio was increased in this group from 15 (5.7{+-}2.5) till 60 min(6.7{+-}3.6) (p<0.01). Significantly increased {sup 99m}TcO{sub 4} uptake (22.7{+-}11.2 %ID/g) and hNIS mRNA expression were exclusively noticed in livers of this group. The persistent hepatic uptake was observed for up one week. NaClO{sub 4} inhibited the hepatic uptake of {sup 99m}TcO{sub 4}. hNIS holds a promising potential as an effective reporter gene for noninvasive/repeated imaging in combination with {sup 99m}TcO{sub 4}.
Armenise, N
1978-01-01
To solve the problem of separating competitive channels in a multiparticle final state the use of a parameter, called A(*), measuring the 'event transversity' has been suggested. The A parameter is found to be as powerful as prism plot analysis in separating different channels and economic with respect to the computer time. The transversity method is applied to the three-body reaction p/sup +/n to p pi /sup +/ pi /sup -/ at 9 TeV/c selected in pi /sup +/d interactions obtained in 2m-DBC exposed at CERN-PS. The main contributions in the final state are rho /sup 0/, f, g/sup 0/ (a dipion mass resonance) resonance production and neutron diffraction dissociation. (5 refs).
Energy Technology Data Exchange (ETDEWEB)
Cohen, S.
1986-05-01
The response to external electric fields of the /sup 1/P/sup 0/ resonance in the H/sup -/ photodetachment continuum below the n = 3 hydrogenic excitation threshold is investigated. Using the relativistic (..beta.. = 0.806) 650 MeV H/sup -/ beam at the Clinton P. Anderson Meson Physics Facility (LAMPF) in Los Alamos, the fourth harmonic (2.66 nm) of a Nd:YAG laser is Doppler shifted to provide a continuously tunable photon beam in the rest frame of the ions. The magnetic field from pulsed Helmholtz coils, surrounding the photon-H/sup -/ interaction point provides a Lorentz-transformed barycentric electric field. Relative total photodetachment cross sections were measured as a function of photon energy and electric field. The resulting spectra were fit to a Fano line shape. 70 refs., 28 figs., 7 tabs.
Energy Technology Data Exchange (ETDEWEB)
Antipov, Yu.M.; Artamonov, A.V.; Batarin, V.A.; Eroshin, O.V. [Inst. for High Energy Physics, Protvino (Russian Federation); Kolgamov, V.Z. [Inst. of Theoretical and Experimental Physics, Moscow (RU)] [and others
2004-09-01
A search for narrow {theta}(1540){sup +}, a candidate for pentaquark baryon with positive strangeness, has been performed in an exclusive proton-induced reaction p+C(N){yields}{theta}{sup +} anti K{sup 0}+C(N) on carbon nuclei or quasifree nucleons at E{sub beam}=70 GeV ({radical}(s)=11.5 GeV) studying nK{sup +}, pK{sub S}{sup 0} and pK{sub L}{sup 0} decay channels of {theta}(1540){sup +} in four different final states of the {theta}{sup +} anti K{sup 0} system. In order to assess the quality of the identification of the final states with neutron or K {sup 0} {sub L}, we reconstructed {lambda}(1520){yields}nK{sup 0}{sub S} and {phi}{yields}K{sup 0}{sub L}K{sup 0}{sub S} decays in the calibration reactions p+C(N){yields}{lambda}(1520)K{sup +}+C(N) and p+C(N){yields}p{phi}+C(N). We found no evidence for narrow pentaquark peak in any of the studied final states and decay channels. Assuming that the production characteristics of the {theta}{sup +} anti K{sup 0} system are not drastically different from those of the {lambda}(1520)K{sup +} and p{phi} systems, we established upper limits on the cross-section ratios {sigma}({theta}{sup +} anti K{sup 0})/{sigma}({lambda}(1520)K{sup +})< 0.02 and {sigma}({theta}{sup +} anti K{sup 0})/{sigma}(p{phi})< 0.15 at 90% CL and a preliminary upper limit for the forward hemisphere cross-section {sigma}({theta}{sup +} anti K{sup 0})< 30 nb/nucleon. (orig.)
Magnetic substate populations of product nuclei in the /sup 11/B(d,p)/sup 12/B reaction
Energy Technology Data Exchange (ETDEWEB)
Tanaka, M; Ochi, S; Minamisono, T; Mizobuchi, A; Sugimoto, K [Osaka Univ., Toyonaka (Japan). Lab. of Nuclear Studies
1976-05-31
Magnetic substate populations of product nuclei in the /sup 11/B(d,p)/sup 12/B reaction have been measured in an energy range Esub(d) = 1.3-3.0 MeV at recoil angles of thetasub(R) = 55/sup 0/, 45/sup 0/ and 27/sup 0/-37/sup 0/. A static magnetic field (3 kG) was applied normal to the reaction plane to keep the nuclear orientation. Quadrupole effects on the implanted /sup 12/B in Ta were utilized to perturb the Zeeman splitting. NMR transitions were induced, and detected by the asymmetry change in the ..beta..-decay of /sup 12/B. From this information, the magnetic substate populations were determined, for the unique assignment of which the sign of the quadrupole interaction had to be known. For this purpose, a p-..gamma.. angular correlation was measured, which determined the alignment of the first excited state of /sup 12/B. A comparison of the present result with theoretical predictions is given, together with the resultant information about j-mixings in the /sup 12/B states.
Observation of K sup + d correlations from pA collisions
Koptev, V; Nekipelov, M; Büscher, M; Hartmann, M; Hejny, V; Koch, H R; Ohm, H; Schleichert, R; Sibirtsev, A A; Sistemich, K; Ströher, H; Watzlawik, K H; Dymov, S; Lang, N; Petrus, A; Rudy, Z
2003-01-01
Results of a first experiment on (K sup + sup p) and (K sup + sup d) correlations from proton-carbon (pC) and proton-deuteron (pd) interactions at beam energies above and much below the threshold for elementary kaon production in nucleon-nucleon reactions (T sub N sub N =1580 MeV) are discussed. These data, obtained with the ANKE spectrometer at COSY-Juelich, provide first direct evidence for K sup + production via the two-step mechanism and an indication for a cluster mechanism. It is shown that both processes contribute significantly in pC collisions at 1200 MeV, while they are strongly suppressed at 2300 MeV and also in pd-interactions at 1344 MeV. It is emphasized that the underlying kinematics can be exploited to distinguish between these reaction mechanisms. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Mokhtari Oranj, Leila [Division of Advanced Nuclear Engineering, POSTECH, Pohang 37673 (Korea, Republic of); Jung, Nam-Suk; Kim, Dong-Hyun; Lee, Arim; Bae, Oryun [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of); Lee, Hee-Seock, E-mail: lee@postech.ac.kr [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of)
2016-11-01
Experimental and simulation studies on the depth profiles of production yields of {sup nat}Pb(p, xn) {sup 206,205,204,203,202,201}Bi nuclear reactions were carried out. Irradiation experiments were performed at the high-intensity proton linac facility (KOMAC) in Korea. The targets, irradiated by 100-MeV protons, were arranged in a stack consisting of natural Pb, Al, Au foils and Pb plates. The proton beam intensity was determined by activation analysis method using {sup 27}Al(p, 3p1n){sup 24}Na, {sup 197}Au(p, p1n){sup 196}Au, and {sup 197}Au(p, p3n){sup 194}Au monitor reactions and also by Gafchromic film dosimetry method. The yields of produced radio-nuclei in the {sup nat}Pb activation foils and monitor foils were measured by HPGe spectroscopy system. Monte Carlo simulations were performed by FLUKA, PHITS/DCHAIN-SP, and MCNPX/FISPACT codes and the calculated data were compared with the experimental results. A satisfactory agreement was observed between the present experimental data and the simulations.
Energy Technology Data Exchange (ETDEWEB)
Angelique, J.C.; Bizard, G.; Brou, R.; Cussol, D.; Kerambrun, A.; Patry, J.P.; Peter, J.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E. [Caen Univ., 14 (France). Lab. de Physique Corpusculaire; Popescu, R.; Buta, A. [Caen Univ., 14 (France). Lab. de Physique Corpusculaire]|[Central Inst. of Physics, Bucharest (Romania). Inst. of Physics and Nuclear Engineering; He, Z.Y. [Caen Univ., 14 (France). Lab. de Physique Corpusculaire]|[Lanzhou Univ., GS (China). Dept. of Modern Physics; Auger, G.; Peghaire, A.; Saint-Laurent, F. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France); Cabot, C. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France)]|[Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Crema, E. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France)]|[Sao Paulo Univ., SP (Brazil). Inst. de Fisica; Hagel, K.; Wada, R. [Texas A and M Univ., College Station, TX (United States). Cyclotron Inst.; Gonin, M. [Texas A and M Univ., College Station, TX (United States). Cyclotron Inst.]|[Brooklyn Coll., NY (United States). Dept. of Chemistry; Eudes, P.; Lebrun, C. [Nantes Univ., 44 (France). Lab. de Physique Nucleaire; El Masri, Y. [Universite Catholique de Louvain (UCL), Louvain-la-Neuve (Belgium); Rosato, E. [Istituto Nazionale di Fisica Nucleare, Naples (Italy)
1994-05-01
The azimuthal distributions of light particles relative to the reaction plane have been measured for several bins of experimentally estimated impact parameter in the reactions of {sup 64}Zn + {sup 58}Ni at energies between 35 and 79 MeV/u. An in-plane enhancement for mid-rapidity Z = 1, 2, 3 particles is observed at low incident energy but gradually evolves to out-of plane enhancement (squeeze-out effect) with increasing energy. This evolution depends on the impact parameter in a way similar to the flow parameter. The energies for this system at which the azimuthal distribution is uniform are lower than the corresponding balance energies. (authors). 22 refs.
A simple thick target for production of <sup>89sup>Zr using an <sup>11sup>MeV cyclotron
Energy Technology Data Exchange (ETDEWEB)
Link, Jeanne M.; Krohn, Kenneth A.; O' Hara, Matthew J.
2017-04-01
The growing interest but limited availability of <sup>89sup>Zr for PET led us to test targets for the <sup>89sup>(p,n) reaction. The goal was an easily constructed target for an 11 MeV Siements cyclotron. Yttrium foils were tested at different thicknesses, angles and currents. A 90 degree foil tolerated 41 microAmp without damage and produced ~800 MBq/hr, >20 mCi, an amount adequate for radiochemistry research and human doses in a widely available accelerator. This method should translate to higher energy cyclotrons.
Internal bremsstrahlung spectra of the allowed. beta. emitters /sup 32/P, /sup 35/S and /sup 45/Ca
Energy Technology Data Exchange (ETDEWEB)
Powar, M S; Singh, M [Punjabi Univ., Patiala (India). Dept. of Physics
1976-01-01
A study of Coulomb field effects in internal bremsstrahlung (IB) has been undertaken by measuring the IB spectra for the allowed beta emitters /sup 32/P, /sup 35/S and /sup 45/Ca in the photon energy intervals of 50 to 1600 keV, 25 to 150 keV and 30 to 240 keV respectively. The experimental results show increasing positive departures from the KUB and Coulomb-corrected theories of Lewis and Ford, and Nilsson, with decreasing beta end-point energy. In the case of /sup 35/S the experimental results are 40 % higher than the more exact theory of Struzynski and Pollock for this isotope.
Energy Technology Data Exchange (ETDEWEB)
Stirling, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1966-07-01
The {pi}{sup +} P and {pi}{sup -} P total cross sections have been measured between 500 and 1700 MeV to eliminate discrepancies in the experimental data. These new values have permitted a more precise calculation of the forward dispersion relation. These relations are well satisfied by the experimental data up to 18 GeV for charge exchange scattering. The dispersion relation for the spin-flip amplitude gives an efficient test for the phase-shift analysis solutions. (author) [French] Les sections efficaces totales {pi}{sup +} P et {pi}{sup -} P ont ete mesurees entre 500 et 1700 MeV pour eliminer les divergences qui existaient entre les resultats experimentaux anterieurs. Ces nouvelles valeurs ont permis de preciser le calcul des relations de dispersion vers l'avant. Dans le cas de la diffusion avec echange de charge ces relations sont en bon accord avec les resultats experimentaux entre 0 et 18 GeV. L'application des relations de dispersion vers l'avant a l'amplitude de spin-flip fournit une methode tres sensible pour comparer differentes series de dephasages en fonction de l'energie. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Golovkin, S.V.; Kozhevnikov, A.P.; Kubarovsky, V.P. [Institute for High Energy Physics, Protvino (Russian Federation)] [and others; SPHINX Collaboration (IHEP-ITEP)
1995-11-01
In the experiments at the SPHINX facility in 70 GeV proton beam of the IHEP accelerator the coherent diffractive production reactions on carbon nuclei p + C {yields} [{Sigma}(1385){sup 0}K{sup +}] + C and p + C {yields} [{Sigma}{sup 0}K{sup +}] + C were investigated. The evidences for new baryon states were obtained in the study of hyperon-kaon effective mass spectra in these two reactions: X(2050) with mass M = (2052 {+-} 6) MeV and width {Gamma} = (35{sup +22}{sub -35}) MeV in M[{Sigma}(1385){sup 0}K{sup +}] and X(2000) with M = 1999 {+-} 6 MeV and {Gamma} = 91 {+-} 17 MeV in M[{Sigma}{sup 0}K{sup +}]. The unusual features of these massive states (small enough decay widths, anomalously large branching ratios for decays with strange particles emission) make them very serious candidates for cryptoexotic pentaquark baryons with hidden strangeness. (orig.)
Naik, H; Iyer, R H
2003-01-01
Charge distribution studies for heavy-mass fission products were carried out in the fast-neutron-induced fission of sup 2 sup 3 sup 2 Th, sup 2 sup 3 sup 8 U, sup 2 sup 4 sup 0 Pu and sup 2 sup 4 sup 4 Cm using radiochemical and gamma-ray spectrometric techniques. The width parameter(sigma sub Z /sigma sub A), the most probable charge/mass (Z sub P /A sub P), the charge polarization (DELTA Z) and the slope of charge polarization [ delta(DELTA Z)/delta A sup '] as a function of the fragment mass (A sup ') were deduced. The average charge dispersion parameter (left angle sigma sub Z right angle) and proton odd-even effect (delta sub p) were also obtained for these fissioning systems. The left angle sigma sub Z right angle and delta sub p values in the fissioning systems sup 2 sup 4 sup 1 Pu sup * and sup 2 sup 4 sup 5 Cm sup * were determined for the first time. The delta(DELTA Z)/delta A sup ' value is also determined for the first time in the fissioning systems sup 2 sup 3 sup 9 U sup * , sup 2 sup 4 sup 1 Pu...
Kawakami, H
2003-01-01
On 100 isobars from 72 to 171 mass number, the radiation strength, dose equivalent and mean gamma-ray energy from p+ sup 2 sup 3 sup 8 U fission products at Tandem accelerator facility were estimated on the basis of data of proton induced fission mass yield by T. Tsukada. In order to control radiation, the decay curves of radiation of each mass after irradiation were estimated and illustrated. These calculation results showed 1) the peak of p+ sup 2 sup 3 sup 8 U fission products is 101 and 133 mass number. 2) gamma-ray strength of target ion source immediately after irradiation is 3.12x10 sup 1 sup 1 (Radiation/s) when it repeated 4 cycles of UC sub 2 (2.6 g/cm sup 2) target radiated by 30 MeV and 3 mu A proton for 5 days and then cooled for 2 days. It decreased to 3.85x10 sup 1 sup 0 and 6.7x10 sup 9 (Radiation/s) after one day and two weeks cooling, respectively. 3) Total dose equivalent is 3.8x10 sup 4 (mu S/h) at 1 m distance without shield. 4) There are no problems on control the following isobars, beca...
Energy Technology Data Exchange (ETDEWEB)
Ryutin, R.A.; Petrov, V.A.; Sobol, A.E. [Institute for High Energy Physics, Protvino (Russian Federation)
2011-05-15
We study the possibilities to analyse the data on leading neutrons production at first LHC runs. These data could be used to extract from it {pi}{sup +}p and {pi}{sup +}{pi}{sup +} cross-sections. In this note we estimate relative contributions of {pi}, {rho} and a{sub 2} reggeons to charge exchanges and discuss related problems of measurements. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Tumino, A.; Spartà, R.; Spitaleri, C.; Pizzone, R. G.; La Cognata, M.; Rapisarda, G. G.; Romano, S.; Sergi, M. L. [Laboratori Nazionali del Sud-INFN, Catania (Italy); Mukhamedzhanov, A. M. [Cyclotron Institute Texas A and M University-College Station, Texas (United States); Typel, S. [GSI Helmholtzzentrum für Schwerionenforschung GmbH-Theorie Darmstadt (Germany); Tognelli, E.; Degl' Innocenti, S.; Prada Moroni, P. G. [Dipartimento di Fisica, Università di Pisa, and INFN-Sezione di Pisa, Pisa (Italy); Burjan, V.; Kroha, V.; Hons, Z.; Mrazek, J.; Piskor, S. [Nuclear Physics Institute of ASCR-Rez near Prague (Czech Republic); Lamia, L., E-mail: tumino@lns.infn.it [Dipartimento di Fisica e Astronomia, Università degli Studi di Catania, Catania (Italy)
2014-04-20
The cross sections of the {sup 2}H(d,p){sup 3}H and {sup 2}H(d,n){sup 3}He reactions have been measured via the Trojan Horse method applied to the quasi-free {sup 2}H({sup 3}He,p {sup 3}H){sup 1}H and {sup 2}H({sup 3}He,n {sup 3}He){sup 1}H processes at 18 MeV off the proton in {sup 3}He. For the first time, the bare nucleus S(E) factors have been determined from 1.5 MeV, across the relevant region for standard Big Bang nucleosynthesis, down to the thermal energies of deuterium burning in the pre-main-sequence (PMS) phase of stellar evolution, as well as of future fusion reactors. Both the energy dependence and the absolute value of the S(E) factors deviate by more than 15% from the available direct data and existing fitting curves, with substantial variations in the electron screening by more than 50%. As a consequence, the reaction rates for astrophysics experience relevant changes, with a maximum increase of up to 20% at the temperatures of the PMS phase. From a recent primordial abundance sensitivity study, it turns out that the {sup 2}H(d,n){sup 3}He reaction is quite influential on {sup 7}Li, and the present change in the reaction rate leads to a decrease in its abundance by up to 10%. The present reaction rates have also been included in an updated version of the FRANEC evolutionary code to analyze their influence on the central deuterium abundance in PMS stars with different masses. The largest variation of about 10%-15% pertains to young stars (≤1 Myr) with masses ≥1 M {sub ☉}.
Energy Technology Data Exchange (ETDEWEB)
Vugts, Danielle J.; Klaver, Chris; Sewing, Claudia; Poot, Alex J.; Adamzek, Kevin; Visser, Gerard W.M.; Dongen, Guus A.M.S. van [VU University Medical Center, Department of Radiology and Nuclear Medicine, Amsterdam (Netherlands); Huegli, Seraina; Mari, Cristina; Gasser, Gilles [University of Zurich, Department of Chemistry, Zurich (Switzerland); Valverde, Ibai E. [University of Basel Hospital, Division of Radiopharmaceutical Chemistry, Basel (Switzerland); Mindt, Thomas L. [Institute of Pharmaceutical Sciences, ETH Zurich, Zurich (Switzerland); General Hospital of Vienna, Ludwig Boltzmann Institute for Applied Diagnostics, Vienna (Austria)
2017-02-15
All clinical {sup 89}Zr-immuno-PET studies are currently performed with the chelator desferrioxamine (DFO). This chelator provides hexadentate coordination to zirconium, leaving two coordination sites available for coordination with, e.g., water molecules, which are relatively labile ligands. The unsaturated coordination of DFO to zirconium has been suggested to result in impaired stability of the complex in vivo and consequently in unwanted bone uptake of {sup 89}Zr. Aiming at clinical improvements, we report here on a bifunctional isothiocyanate variant of the octadentate chelator DFO* and the in vitro and in vivo comparison of its {sup 89}Zr-DFO*-mAb complex with {sup 89}Zr-DFO-mAb. The bifunctional chelator DFO*-pPhe-NCS was prepared from previously reported DFO* and p-phenylenediisothiocyanate. Subsequently, trastuzumab was conjugated with either DFO*-pPhe-NCS or commercial DFO-pPhe-NCS and radiolabeled with Zr-89 according to published procedures. In vitro stability experiments were carried out in saline, a histidine/sucrose buffer, and blood serum. The in vivo performance of the chelators was compared in N87 tumor-bearing mice by biodistribution studies and PET imaging. In 0.9 % NaCl {sup 89}Zr-DFO*-trastuzumab was more stable than {sup 89}Zr-DFO-trastuzumab; after 72 h incubation at 2-8 C 95 % and 58 % intact tracer were left, respectively, while in a histidine-sucrose buffer no difference was observed, both products were ≥ 92 % intact. In vivo uptake at 144 h post injection (p.i.) in tumors, blood, and most normal organs was similar for both conjugates, except for skin, liver, spleen, ileum, and bone. Tumor uptake was 32.59 ± 11.95 and 29.06 ± 8.66 % ID/g for {sup 89}Zr-DFO*-trastuzumab and {sup 89}Zr-DFO-trastuzumab, respectively. The bone uptake was significantly lower for {sup 89}Zr-DFO*-trastuzumab compared to {sup 89}Zr-DFO-trastuzumab. At 144 h p.i. for {sup 89}Zr-DFO*-trastuzumab and {sup 89}Zr-DFO-trastuzumab, the uptake in sternum was 0.92
Energy Technology Data Exchange (ETDEWEB)
Turlay, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1962-07-01
In the first part of this experiment, we determined the total cross section for processes yielding only neutral particles, from 300 to 1600 MeV. For this, we counted the number of incident {pi}{sup -}, as defined by a counter telescope, which interact in a liquid-hydrogen target without giving charged particles in a 4{pi} counter surrounding the target. In the second part of this experiment, we have separated the reaction {pi}{sup -} p {yields} {pi}{sup 0} n and {pi}{sup -} p {yields} {pi}{sup 0} {pi}{sup 0} n between 300 and 1100 MeV, by supposing that only these two reactions was realized by placing lead absorbers between the target and 4{pi} counter and by comparing the counting rate for neutral events with and without lead. The transmission thus measured is a function of the average number of photons produced and therefore of the ratio between the two neutral channels, {pi}{sup 0} n and {pi}{sup 0} {pi}{sup 0} n. In the last section of this work, we discuss the experimental results and compare them to those obtained by other authors in the study of photoproduction and the {pi}-nucleon interaction. (author) [French] Dans une premiere partie de cette experience, nous determinons la section efficace totale des processus ne donnant naissance qu'a des particules neutres de 300 et 1 600 MeV. Pour cela nous comptons le nombre de {pi}{sup -}, defini par un telescope incident, qui interagissent dans une cible d'hydrogene liquide sans donner de particules chargees dans un compteur 4{pi} entourant cette cible. Dans la deuxieme partie de l'experience nous avons separe les reactions {pi}{sup -} p {yields} {pi}{sup 0} n et {pi}{sup -} p {yields} {pi}{sup 0} {pi}{sup 0} n entre 300 et 1 600 MeV en supposant que seules ces deux voies soient importantes a ces energies. La separation de ces deux reactions a ete realisee en placant des ecrans de plomb entre la cible et le compteur 4 {pi}, et en comparant les traces de comptage des evenements a secondaires neutres avec et sans
Preparation and antibacterial property of silver-containing mesoporous 58S bioactive glass
Energy Technology Data Exchange (ETDEWEB)
Zhu, Hailin; Hu, Chao [Key Laboratory of Fiber Materials and Processing Technology, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Zhang, Fangfang [Zhejiang Provincial Hospital of Traditional Chinese Medicine, Hangzhou 310006 (China); Feng, Xinxing, E-mail: f0712@tom.com [The Quartermaster Research Institute of the General Logistic Department of CPLA, Beijing 100082 (China); Li, Jiuming; Liu, Tao [Key Laboratory of Fiber Materials and Processing Technology, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Chen, Jianyong, E-mail: cjy@zstu.edu.cn [Key Laboratory of Fiber Materials and Processing Technology, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Zhang, Jianchun [The Quartermaster Research Institute of the General Logistic Department of CPLA, Beijing 100082 (China)
2014-09-01
The modified mesoporous 58S bioglass (SM58S) was prepared through surface modification of the mesoporous 58S bioglass (M58S) with γ-aminopropyl triethoxysilane (KH550). The results of Fourier transform infrared spectroscopy (FTIR) and thermogravimetric analysis (TGA) showed that the amino groups were grafted to the surface of M58S after modification with KH550. The silver-containing SM58S (Ag-SM58S) and M58S (Ag-M58S) were prepared by the dipping method. The Ag{sup +} loading capacity, release rate and antibacterial properties of Ag-SM58S and Ag-M58S were investigated. It is indicated that surface modification of M58S with KH550 can improve the Ag{sup +} loading capacity. The result of antibacterial property showed that Ag-SM58S exhibited significant anti-bacterial effects against Escherichia coli and Staphylococcus aureus. The sustained release of Ag{sup +} from Ag-SM58S for 768 h ensured excellent antibacterial property of Ag-SM58S. In vitro osteoblast proliferation and differentiation tests showed that Ag-SM58S was a good matrix for the growth of osteoblasts. Consequently, the results of the study suggested that Ag-SM58S might be a promising bone repair material. - Highlights: • The amino groups are grafted to the surface of M58S after modification with KH550. • Surface modification of M58S with KH550 can improve the Ag{sup +} loading capacity. • The sustained release of Ag{sup +} from Ag-SM58S ensures good antibacterial property.
Energy Technology Data Exchange (ETDEWEB)
Abramowicz, H. [Tel Aviv Univ. (Israel). School of Physics; Max-Planck-Institute for Physics, Munich (Germany); Abt, I. [Max-Planck-Institute for Physics, Munich (Germany); Adamczyk, L. [AGH-Univ. of Science and Technology, Krakow (Poland). Faculty of Physics and Applied Computer Science; Collaboration: ZEUS Collaboration; and others
2016-06-15
A search for a narrow baryonic state in the pK{sup 0}{sub S} and anti pK{sup 0}{sub S} system has been performed in ep collisions at HERA with the ZEUS detector using an integrated luminosity of 358 pb{sup -1} taken in 2003-2007. The search was performed with deep inelastic scattering events at an ep centre-of-mass energy of 318 GeV for exchanged photon virtuality, Q{sup 2}, between 20 and 100 GeV{sup 2}. Contrary to evidence presented for such a state around 1.52 GeV in a previous ZEUS analysis using a sample of 121 pb{sup -1} taken in 1996-2000, no resonance peak was found in the p(anti p)K{sup 0}{sub S} invariant-mass distribution in the range 1.45-1.7 GeV. Upper limits on the production cross section are set.
Energy Technology Data Exchange (ETDEWEB)
Berthelot, R; Cohen, E; Cotton, H; Farraggi, T; Grjebine, A; Leveque, V; Naggiar, M; Roclawski-Conjeaud, D; Szteinsznaider, D [Commissariat a l' Energie Atomique, Saclay(France). Centre d' Etudes Nucleaires
1954-07-01
The study of angular distributions of the protons from the reaction {sup 16}O(d,p){sup 17}O{sup *} (level at 875 keV) was made, using a photographic method, at seven different deuteron energies, from 1.66 to 2.20 MeV (obtained with the Saclay electrostatic generator). The analysis of results shows that the angular distribution for forward angles is for each chosen energy in good agreement with the stripping theory (l = 0), even at the maximum of the capture resonance of the deuteron, about 2.1 MeV. Moreover, the differential cross section at 7 deg reaches a maximum for this resonance energy. (author) [French] L'etude des distributions angulaires des protons emis au cours de la reaction {sup 16}O(d,p){sup 17}O{sup *} (niveau a 875 key) a ete effectuee, par une methode photographique, pour 7 energies differentes de deuterons comprises entre 1,66 et 2,20 MeV (obtenues grace a l'accelerateur electrostatique de Saclay). L'analyse des resultats montre que la distribution angulaire vers l'avant est, pour toutes ces energies, en bon accord avec la theorie du ''stripping'' ( 1=0), meme au maximum de la resonance de capture du deuteron situee vers 2,1 MeV. De plus, la section efficace differentielle a 7 deg passe par un maximum pour cette energie de resonance. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Almeida, A.P.F.; Sousa, W.O.; Dantas, A.L.A.; Dantas, B.M., E-mail: adantas@ird.gov.br, E-mail: wander@ird.gov.br, E-mail: bmdantas@ird.gov.br [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Divisao de Dosimetria
2016-07-01
The {sup 32}P is used in the form of liquid unsealed sources in medical facilities, research and teaching, representing a risk of internal exposure in routine activities and in case of accidental incorporation. The evaluation of {sup 32}P incorporation can be accomplished through in vitro bioanalysis of urine. This paper aims to provide a methodology to analyze {sup 32}P in biological samples, applicable to internal individual monitoring using liquid scintillation technique. The minimum detectable activity of the system was determined and the sensitivity of the technique was evaluated, based on the detected minimum effective dose. (author)
Energy Technology Data Exchange (ETDEWEB)
Cornelissen, Bart [Division of Nuclear Medicine, University Health Network, Toronto, ON, Canada M5S 3E2 (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada); MRC/CRUK Gray Institute for Radiation Oncology and Biology, Oxford University, OX3 7LJ Oxford (United Kingdom)], E-mail: bart.cornelissen@rob.ox.ac.uk; Kersemans, Veerle; McLarty, Kristin [Division of Nuclear Medicine, University Health Network, Toronto, ON, M5S 3E2 (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada); Tran, Lara [Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada); Vallis, Katherine A. [MRC/CRUK Gray Institute for Radiation Oncology and Biology, Oxford University, OX3 7LJ Oxford (United Kingdom); Reilly, Raymond M. [Division of Nuclear Medicine, University Health Network, Toronto, ON, M5S 3E2 (Canada); Department of Medical Imaging, University of Toronto, Toronto, ON, M5S 3E2 (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada)
2009-10-15
Introduction: Trastuzumab, a humanized antibody directed against the Her2 receptor, induces the expression of p27{sup kip1}, an intranuclear cyclin-dependent kinase inhibitor in some breast cancer cells. The aim of this study was to develop a radioimmunoconjugate (RIC) to monitor trastuzumab-induced p27{sup kip1} protein up-regulation in vivo. Materials and Methods: Anti-p27{sup kip1} IgG was purified, and conjugated to diethylenetriaminopentaacetate, to allow radiolabeling with {sup 111}In for in vivo detection. Then tat peptide (GRKKRRQRRRPPQGYG), containing a nuclear localization sequence (underlined), was conjugated to the Fc-domain of IgG, using NaIO{sub 4} oxidation of carbohydrates and the resulting Schiff base stabilized with NaCNBH{sub 3}. The conjugate was radiolabeled with {sup 111}In, yielding [{sup 111}In]-anti-p27{sup kip1}-tat. {sup 111}In labeling efficiency, purity and p27{sup kip1} binding were measured. Trastuzumab-induced p27{sup kip1} up-regulation was assessed in a panel of breast cancer cell lines by Western blot analysis. Uptake and retention of [{sup 111}In]-anti-p27{sup kip1}-tat were measured in MDA-MB-361 and SKBr3 cells after exposure to trastuzumab. Uptake of [{sup 111}In]-anti-p27{sup kip1}-tat was determined at 72 h postintravenous injection in MDA-MB-361 xenografts in athymic mice treated with trastuzumab or saline. Results: [{sup 111}In]-anti-p27{sup kip1}-tat was synthesized to 97% purity. The RIC was able to bind to p27{sup kip1} protein and internalized in the cells and was transported to the nuclei of MDA-MB-361 cells. The level of p27{sup kip1} protein in MDA-MB-361 cells was increased after exposure to clinically relevant doses of trastuzumab for 3 days. Trastuzumab-mediated induction of p27{sup kip1} was not associated with increased cellular uptake or nuclear localization of [{sup 111}In]-anti-p27{sup kip1}-tat (6.53{+-}0.61% vs. 6.98{+-}1.36% internalized into trastuzumab-treated vs. control cells, respectively). However
Energy Technology Data Exchange (ETDEWEB)
Tárkányi, F.; Ditrói, F.; Takács, S. [Institute of Nuclear Research (ATOMKI), Debrecen (Hungary); Hermanne, A., E-mail: aherman@vub.ac.be [Cyclotron Department, Vrije Universiteit Brussel, (VUB), Brussels (Belgium)
2017-01-15
New experimental excitation functions for proton induced reactions on {sup nat}W are presented in the 32–65 MeV energy range. The cross-sections for {sup nat}W(p,xn){sup 186,184m,184g,183,} {sup 182m,182g,181}Re, {sup nat}W(p,x){sup 178}W{sup ,} {sup nat}W(p,x){sup 183,182,} {sup 180m,} {sup 177,176,175}Ta, {sup 175}Hf and {sup 177}Lu were measured via an activation method by using a stacked-foil irradiation technique and high resolution gamma-ray spectroscopy. The results were compared with predicted values obtained with the nuclear reaction code TALYS (results taken from the TENDL 2014 and TENDL 2015 on-line libraries). Production routes of the medically relevant radionuclides {sup 186}Re, the {sup 178}W → {sup 178}Ta generator and {sup 181}W are discussed.
Residual dipolar couplings in sup 3 sup 1 P MAS spectra of PPh sub 3 substituted cobalt complexes
Szalontai, G
2002-01-01
Residual dipolar couplings between sup 3 sup 1 P- sup 5 sup 9 Co spin pairs were studied in sup 3 sup 1 P MAS spectra of mono- and dinuclear cobalt-triphenylphosphine complexes. These spectra can provide important information such as the scalar coupling between the dipolar phosphorus and the quadrupolar cobalt nuclei normally not available from solution phase studies. In case of complementary (NQR or x-ray) data even the relative orientation of the interacting shielding, dipolar, scalar couplings, and electric field gradient tensors or internuclear distances can be determined. Examples are shown both for well resolved and practically unresolved cases, factors which possibly control the spectral resolution are discussed in detail. (author)
The reactions K/sup -/p to lambda pi /sup 0/, Lambda eta , Lambda eta ' at 42 GeV/c
Marzano, F; Hemingway, R J; Hoogland, W; Kluyver, J C; Loverre, P F; Maréchal, B; Massaro, G G G; Schrempp, Barbara; Tiecke, H G; Van de Walle, R T; Vergeest, J S M
1977-01-01
In a high statistics CERN 2 m bubble chamber experiment the different cross sections and polarizations of the Lambda for the reactions K/sup -/p to Lambda pi /sup 0/, Lambda eta , lambda eta ' at 4.2 GeV/c have been measured. The reaction K/sup -/p to Lambda eta exhibits a pronounced dip around -t approximately 0.5 (GeV/c)/sup 2/ and all three reactions show a significant backward peaking (-u<1.0 (GeV/c) /sup 2/). The Lambda polarization in the reaction K/sup -/p to Lambda pi /sup 0/ is measured to be significantly different from zero throughout most of the available t-range. Forward cross sections enable a determination of R/sub T/, the ratio of singlet/octet coupling eta /sub 1/KK**/ eta /sub 8/KK**. Backward cross sections are utilized to estimate the effective eta -nucleon coupling constant g /sub eta NN//sup 2/ over the -u range 0-1.5 (GeV/c)/sup 2/. (14 refs).
Energy Technology Data Exchange (ETDEWEB)
Menzel, Marie-Luise
2013-08-01
The {sup 22}Ne(p,{gamma}){sup 23}Na reaction belongs to the catalytic neon-sodium cycle and has an important role in the explosive hydrogen burning. The neon-sodium cycle takes place at temperatures of T = 0.1 - 0.5 GK and is assumed to occur in different astrophysical systems: e.g. in novae, in super novae of type Ia and during the shell-burning of red giant branch stars. The implications of {sup 22}Ne(p,{gamma}){sup 23}Na and the neon-sodium cycle in a nova scenario have been studied by using the nuclear network code libnucnet at GSI in Darmstadt. A nova is an outburst of matter in a binary system consisting of a white dwarf and a red giant star. It is therefore a representative phenomenon for explosive hydrogen burning. For the calculation of the nucleosynthesis during the nova outburst, the code libnucnet requires the initial mass composition of the novae partners, the temperature and density profiles of the nova explosion and the thermonuclear reaction rates of the participating reactions. In the following, the code determined the flow and the final atomic abundance in the neon-sodium cycle during the entire nova process. Additionally, the influence of the temperature profile of the novae outburst as well as the thermonuclear reaction rate of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction on the final atomic abundance in the outburst has been studied. A characteristic measure for the reactions in astrophysical environments is the thermonuclear reaction rate. The reaction rate of {sup 22}Ne(p,{gamma}){sup 23}Na has still strong uncertainties in the temperature range of T = 0.03 - 0.3 GK. These uncertainties are based on insufficient upper limits of the resonance strengths as well as the possible existence of tentative states that are populated in the energy range of E{sup lab}{sub p} = 30 - 300 keV. The research presented in this thesis is dedicated to the experimental study of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction for an improved determination of the
Energy Technology Data Exchange (ETDEWEB)
Titarenko, Yu. E.; Batyaev, V.F.; Pavlov, K.V.; Titarenko, A. Yu. [National Research Center Kurchatov Institute, Institute for Theoretical and Experimental Physics, Moscow 117218 (Russian Federation); Zhivun, V.M. [National Research Center Kurchatov Institute, Institute for Theoretical and Experimental Physics, Moscow 117218 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Chauzova, M.V.; Balyuk, S.A.; Bebenin, P.V. [National Research Center Kurchatov Institute, Institute for Theoretical and Experimental Physics, Moscow 117218 (Russian Federation); Ignatyuk, A.V. [National Research Center Kurchatov Institute, Institute for Theoretical and Experimental Physics, Moscow 117218 (Russian Federation); Institute of Physics and Power Engineering, Obninsk 249033 (Russian Federation); Mashnik, S.G. [Los Alamos National Laboratory (United States); Leray, S.; Boudard, A.; David, J.C.; Mancusi, D. [CEA/Saclay, Irfu/SPhN, 91191 Gif-sur-Yvette, Cedex (France); Cugnon, J. [University of Liege (Belgium); Yariv, Y. [SoreqNRC, Yavne (Israel); Nishihara, K.; Matsuda, N. [JAEA, Tokai (Japan); Kumawat, H. [BARC, Mumbai (India); Stankovskiy, A. Yu. [SCK-CEN (Belgium)
2016-06-11
The paper presents the measured cumulative yields of {sup 44}Ti for {sup nat}Cr, {sup 56}Fe, {sup nat}Ni and {sup 93}Nb samples irradiated by protons at the energy range 0.04–2.6 GeV. The obtained excitation functions are compared with calculations of the well-known codes: ISABEL, Bertini, INCL4.2+ABLA, INCL4.5+ABLA07, PHITS, CASCADE07 and CEM03.02. The predictive power of these codes regarding the studied nuclides is analyzed.
Labelling and optimization of PHOTOFRIN {sup registered} with {sup 99m}Tc
Energy Technology Data Exchange (ETDEWEB)
Fakhar-e-Alam, M. [Pakistan Institute of Engineering and Applied Sciences, Islamabad (Pakistan); Roohi, S.; Amir, N.; Zahoor, R. [Pakistan Institute of Nuclear Science and Technology, Islamabad (Pakistan). Isotope Production Div.; Atif, M.; Firdous, S. [National Institute of Laser and Optronics, Islamabad (Pakistan). Biophotonics Lab.
2010-07-01
PHOTOFRIN {sup registered} was labelled with {sup 99m}Tc using SnCl{sub 2}.2H{sub 2}O as reducing agent. Instant thin layer chromatography (ITLC-SG) in 0.05 M NaOH was used for evaluation of radiochemical purity. Labelling efficiency was dependent on various factors that include the ligand/reductant ratio, pH and time of incubation. Therefore, optimum conditions of labelling were also determined. The stability of {sup 99m}Tc-PHOTOFRIN {sup registered} in serum was checked by using fresh human serum. Tissue distribution of {sup 99m}Tc-PHOTOFRIN {sup registered} was evaluated in Sprague Dawley rats. PHOTOFRIN {sup registered} was labelled with an efficiency of > 95% under optimum conditions, which were PHOTOFRIN {sup registered}: 200 {mu}g, pH: 3-4, SnCl{sub 2}.2H{sub 2}O: 15 {mu}g and 30 min incubation at room temperature. The {sup 99m}Tc-labelled PHOTOFRIN {sup registered} remained stable in human serum for 24 h. Biodistribution study in rats revealed maximum concentration of the labelled compound in liver, lungs and spleen at 0.5 h, and significant activity was also seen in the bladder and urine, indicating the mode of urinary excretion of PHOTOFRIN {sup registered}. (orig.)
Jacholkowski, A; Bouquet, B; D'Almagne, B; De Rosny, G; Ferrer, A; Fleury, P; Lahellec, A; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Treille, D; Yoshida, H
1977-01-01
From an experiment done with the CERN Omega spectrometer, triggered by a fast forward proton device, results on the differential cross section d sigma /du for pi /sup -/p backward elastic scattering are presented. The d sigma /du distribution agrees with an Ae/sup BU/ law. The compilation of existing results shows a discrepancy between results but the (d sigma /du)/sub u=0/ data fit perfectly on s/sup 2 alpha 0-2/ dependence, as predicted by a single Delta /sub delta / Regge trajectory exchange. A search for the reaction pi /sup -/p to dp, with a fast forward deuteron, which can be produced by a double- baryon exchange mechanism, gives cross-section upper limits of approximately 1% of the backward elastic cross section. (10 refs).
Coulomb excitation of radioactive {sup 79}Pb
Energy Technology Data Exchange (ETDEWEB)
Lister, C.J.; Blumenthal, D.; Davids, C.N. [and others
1995-08-01
The technical challenges expected in experiments with radioactive beams can already be explored by using ions produced in primary reactions. In addition, the re-excitation of these ions by Coulomb excitation allows a sensitive search for collective states that are well above the yrast line. We are building an experiment to study Coulomb excitation of radioactive ions which are separated from beam particles by the Fragment Mass Analyzer. An array of gamma detectors will be mounted at the focal plane to measure the gamma radiation following re-excitation. Five Compton-suppressed Ge detectors and five planar LEPS detectors will be used. The optimum experiment of this type appears to be the study of {sup 79}Rb following the {sup 24}Mg ({sup 58}Ni,3p) reaction. We calculate that about 5 x 10{sup 5} {sup 79}Rb nuclei/second will reach the excitation foil. This rubidium isotope was selected for study as it is strongly produced and is highly deformed, so easily re-excited. The use of a {sup 58}Ni re-excitation foil offers the best yields. After re-excitation the ions will be subsequently transported into a shielded beamdump to prevent the accumulation of activity.
Isolation and identification of the human homolog of a new p53-binding protein, Mdmx
Shvarts, A.; Bazuine, M.; Dekker, P.; Ramos, Y. F.; Steegenga, W. T.; Merckx, G.; van Ham, R. C.; van der Houven van Oordt, W.; van der Eb, A. J.; Jochemsen, A. G.
1997-01-01
We recently reported the identification of a mouse cDNA encoding a new p53-associating protein that we called Mdmx because of its structural similarity to Mdm2, a well-known p53-binding protein. Here we report the isolation of a cDNA encoding the human homolog of Mdmx. The ORF of the cDNA encodes a
Energy Technology Data Exchange (ETDEWEB)
Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.
1988-01-01
Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.
Energy Technology Data Exchange (ETDEWEB)
Marcato, Larissa Andreto
2012-07-01
The main objective of this work is to provide a biokinetic model in order to estimate the radiometric dose due to intake of [4-{sup 14}C]-cholesterol. The model was validated comparing the values of fecal excretion and absorption described in literature with that predicted by the model. The proposed model achieved good concordance between the results (p = 0.416 for excretion and p = 0.423 for absorption). The coefficients of effective dose (SvBq{sup -1}), equivalent dose (SvBq{sup -1}) and absorbed dose (GyBq{sup -1}) in human organs and tissues were calculated using the MIRD methodology and the compartmental analysis software ANACOMP. The coefficients were estimated for four phantoms: adult with a body mass of 73.3 kg, 15 years old adolescent (56.9 kg), 10 years old child (33.2 kg) and five years old child (19.8 kg). The organ that received the highest absorbed dose for all phantoms was the lower large intestine (LLI). The allometry theory was used to interpolate the coefficient of absorbed dose in the lower large intestine (DLLI) for unknown body mass (m): DLLI (GyBq{sup -1})=161.26 m (kg){sup -1.025}. For the same administered activity, the effective dose coefficient (E) decreases as the body mass increases. On other words, for the same intake activity, individuals with low body mass are exposed to higher doses. The allometry theory was used to interpolate the coefficient effective dose (E) for unknown body mass (m): E(SvB{sup -1})= 171.1 m(kg){sup -1,021}. (author)
Energy Technology Data Exchange (ETDEWEB)
Shepard, J R; Anderson, R E; Kraushaar, J J; Ristinen, R A [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Comfort, J R [Pittsburgh Univ., PA (USA). Dept. of Physics; King, N S.P. [Los Alamos Scientific Lab., NM (USA); Bacher, A; Jacobs, W W [Indiana Univ., Bloomington (USA). Dept. of Physics
1979-06-11
Angular distributions have been measured for the low-lying levels of the residual nuclei for the /sup 12/C, /sup 54/Fe and /sup 208/Pb(p,t) reactions at E/sub p/ = 80 MeV. The shapes of these angular distributions are generally well reproduced by the zero-range distorted-wave Born approximation (DWBA). Enhancement factors extracted from the data show that the DWBA predicts relative strengths consistent with those observed at lower bombarding energies. However, the overall empirical DWBA normalization at E/sub p/ = 80 MeV is observed to be 1/12(1/4) of that required at 40 MeV for /sup 208/Pb(/sup 54/Fe).
Precise measurements of the thick target neutron yields of the {sup 7}Li(p,n) reaction
Energy Technology Data Exchange (ETDEWEB)
Matysiak, W., E-mail: matysiw@mcmaster.ca [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont., L8S 4K1 (Canada); Prestwich, W.V.; Byun, S.H. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont., L8S 4K1 (Canada)
2011-07-01
Thick target neutron yield of the {sup 7}Li(p,n){sup 7}Be reaction was measured in the proton energy range from 1.95 to 2.3 MeV by determining induced activity of the {sup 7}Be. A HPGe detector was used to detect the 478 keV gamma-rays emitted through {sup 7}Be decay. A series of irradiations with nominal proton energies of 1.95, 2.0, 2.1, 2.2, and 2.3 MeV were carried out. In an independent experiment, raw neutron spectra were collected by a {sup 3}He ion chamber for the same series of proton energies. From the raw neutron spectra, it was noted, that the effective proton energies were lower than the nominal by 50-58 keV. After corrections for the proton energy offsets were applied, the measured neutron yields matched the analytically calculated yields within 20%. Long term stability of neutron yield was tested at two nominal proton energies, 2.1 and 1.95 MeV over an experimental period of one year. The results show that the yield at 2.1 MeV was stable within rmse variation coefficient of 4.7% and remained consistent even when the lithium target was replaced, whereas at 1.95 MeV, the maximum fluctuations reached a factor of 10.
Energy Technology Data Exchange (ETDEWEB)
Tan, Kemin; Johnson, Parker M.; Stols, Lucy; Boubion, Bryan; Eschenfeldt, William; Babnigg, Gyorgy; Hayes, Christopher S.; Joachimiak, Andrezj; Goulding, Celia W.
2015-05-20
<p>Contact-dependent growth inhibition (CDI) is an important mechanism of intercellular competition between neighboring Gram-negative bacteria. CDI systems encode large surface-exposed CdiA effector proteins that carry a variety of C-terminal toxin domains (CdiA-CTs). All CDI<sup>+>bacteria also produce CdiI immunity proteins that specifically bind to the cognate CdiA-CT and neutralize its toxin activity to prevent auto-inhibition. Here, the X-ray crystal structure of a CdiI immunity protein from
Fast-neutron total and scattering cross sections of sup 58 Ni and nuclear models
Energy Technology Data Exchange (ETDEWEB)
Smith, A.B.; Guenther, P.T.; Whalen, J.F. (Argonne National Lab., IL (United States)); Chiba, S. (Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment)
1991-07-01
The neutron total cross sections of {sup 58}Ni were measured from {approx} 1 to > 10 MeV using white-source techniques. Differential neutron elastic-scattering cross sections were measured from {approx} 4.5 to 10 MeV at {approx} 0.5 MeV intervals with {ge} 75 differential values per distribution. Differential neutron inelastic-scattering cross sections were measured, corresponding to fourteen levels with excitations up to 4.8 MeV. The measured results, combined with relevant values available in the literature, were interpreted in terms of optical-statistical and coupled-channels model using both vibrational and rotational coupling schemes. The physical implications of the experimental results nd their interpretation are discussed in the contexts of optical-statistical, dispersive-optical, and coupled-channels models. 61 refs.
Vasilevsky, V S; Arickx, F; Broeckhove, J
2002-01-01
The reactions sup 3 H( sup 3 H, 2n) sup 4 He and sup 3 He( sup 3 He, 2p) sup 4 He are investigated within a fully microscopic cluster model featuring a three-cluster exit channel. A Hyperspherical Harmonics basis is used to describe the three-cluster continuum. The resulting astrophysical s-factor of both reactions is in good agreement with experimental data. Analysis of the low-energy scattering parameters reveals no evidence for a hidden resonance state would increase the cross-section of the reactions, and would help to resolve the solar neutrino problem.
Levels in {sup 227}Ac populated in the {sup 230}Th(p,{alpha}) reaction
Energy Technology Data Exchange (ETDEWEB)
Burke, D.G. E-mail: dgb@physics.mcmaster.ca; Garrett, P.E.; Qu, Tao
2003-09-08
The {sup 230,232}Th(p,{alpha}){sup 227,229}Ac reactions were studied using 20 MeV protons and a magnetic spectrograph to analyze the reaction products. Relative populations of levels in {sup 229}Ac correlated well with previously published (t,{alpha}) results for the same final levels, showing that the similarity of the two reactions observed empirically in the deformed rare earth region extends to actinides. The most strongly populated level in {sup 227}Ac is at 639 keV, and is assigned as the 1/2{sup +}[4 0 0] bandhead. The 435 keV level, previously adopted as the 1/2{sup +}[6 6 0] bandhead, also has a significant intensity that is attributed to {delta}N=2 mixing between these two K=1/2 proton orbitals. The {delta}N=2 matrix element estimated from these data is {approx}80 keV, similar to values observed for the same two Nilsson states as neutron orbitals in the dysprosium isotopes.
International Nuclear Information System (INIS)
Yuan Junqian; Wang Yongchang; Kong Xiangzhong; Yang Jingkang
1992-01-01
The cross sections for the 50 Ti(n, α) 47 Ca, 46 Ti(n, p) 46 Sc, 48 Ti(n, p) 48 Sc and 58 Ni(n, 2n) 57 Ni, 58 Ni(n, p) 58m+g Co reactions have been measured by using the activation method relative to the cross sections of the 27 Al(n, α) 24 Na reaction in the neutron energy range of 13.50-14.81 MeV. The neutron energies were determined by the cross section ratios of the 90 Zr(n, 2n) 89m+g Zr and 93 Nb(n, 2n) 92m Nb reactions. The results obtained are compared with the published and to be published data of several authors
Energy Technology Data Exchange (ETDEWEB)
Rautenberg, J
2004-06-01
Cross sections for charged current deep inelastic scattering have been measured in e{sup +}p collisions at a center-of-mass energy of 318 GeV. The data collected with the ZEUS detector at HERA in the running periods 1999 and 2000 correspond to an integrated luminosity of 61 pb{sup -1}. Single differential cross sections d{sigma}/dQ{sup 2}, d{sigma}/dx and d{sigma}/dy have been measured for Q{sup 2}>200 GeV{sup 2}, as well as the double differential reduced cross section d{sup 2}{sigma}/dxdQ{sup 2} in the kinematic range 280 GeV{sup 2}sup 2}<17000 GeV{sup 2} and 0.008
Energy Technology Data Exchange (ETDEWEB)
Bolton, T; Bunnell, K O; Cassell, R E; Coward, D H; Labs, J; Odian, A; Pitman, D; Schindler, R H; Toki, W [Stanford Linear Accelerator Centre, Stanford Univ., CA (United States); Brown, J S; Burnett, T H; Li, A; Mir, R; Mockett, P M; Parrish, L; Willutzki, H J [Dept. of Physics, Univ. Washington, Seattle, WA (United States); Burchell, M; Drinkard, J; Gatto, C; Heusch, C A; Lockman, W S; Sadrozinski, H F.W.; Scarlatella, M; Schalk, T L; Seiden, A; Weinstein, A J; Xu, R [Santa Cruz Inst. for Particle Physics, Univ. California, CA (United States); Coffman, D; DeJongh, F; Dubois, G P; Eigen, G; Hitlin, D G; Matthews, C G; Richman, J D; Wisniewski, W J; Zhu, Y [Dept. of Physics, California Inst. of Tech., Pasadena, CA (United States); Eisenstein, B I; Freese, T; Gladding, G; Izen, J M; Kim, P C; Stockdale, I E; Tripsas, B [Dept. of Physics, Univ. of Illinois at Urbana-Champaign, Urbana, IL (United States); Mallik, U; Wang, M Z [Dept. of; Mark III Collaboration
1992-04-02
We present an analysis of J/{psi}{yields}{gamma}f{sub 1}(1285), f{sub 1}(1285){yields}{pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}, using the Mark III detector at SPEAR, based on 5.8x10{sup 6} produced J/{psi} events. We measure B(J/{psi}{yields}{gamma}f{sub 1}(1285), f{sub 1}(1285){yields}{pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -})=(4.8{+-}1.3{+-}0.9)x10{sup -5}. We obtain a new measurement of the absolute branching ratio of J/{psi}{yields}{gamma}f{sub 1}(1285). The mixing angle of the f{sub 1}(1285) and the f{sub 1}(1420) in the 1{sup ++} nonet is determined. (orig.).
The effect of sodium bicarbonate on intracellular pH using {sup 31}P-MR spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Nakashima, Kazuya; Kashiwagi, Shiro; Ito, Haruhide [Yamaguchi Univ., Ube (Japan). School of Medicine; Yamashita, Tetsuo; Kitahara, Tetsuhiro; Nakayama, Naoto; Saito, Kennichi
1997-03-01
This report deals with the effects of sodium bicarbonate on the intracellular pH of the brain and cerebral blood flow (CBF); five normal volunteers were studied. Intracellular pH and CBF were measured by phosphorus 31 magnetic resonance spectroscopy ({sup 31}P-MRS) and stable xenon computed tomography (Xe-CT), respectively. Each individual received 7% sodium bicarbonate (3.5 ml/kg body weight), infused intravenously over a 15-min period. Intracellular pH, CBF, and physiological parameters were determined before and after the injection. Intracellular pH was significantly decreased and CBF was increased. Among the physiological parameters, the hematocrit was significantly decreased and arterial pressure of carbon dioxide (PaCO{sub 2}), increased. These results suggest that increasing CO{sub 2} contributes to the decrease in intracellular pH. In conclusion, three factors increase CBF during the administration of sodium bicarbonate to humans: arterial dilatation in response to carbon dioxide; decrease of the hematocrit, and intracellular cerebral acidosis. (author)
{sup 96}Ru(p,{gamma}){sup 97}Rh measurement at the GSI storage ring
Energy Technology Data Exchange (ETDEWEB)
Zhong, Q; Aumann, T; Boretzky, K; Bosch, F; Braeuning, H; Brandau, C; Ershova, O; Geissel, H; Heil, M; Kelic, A; Kozhuharov, C; Langer, C; Bleis, T Le; Litvinov, Y A [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt, 64291 (Germany); Bishop, S; Dillmann, I [Technische Universitaet Muenchen, 85748 Garching (Germany); Blaum, K [Max-Planck-Institut fuer Kernphysik, 69117 Heidelberg (Germany); Davinson, T [University of Edinburgh, Edinburgh (United Kingdom); Gyuerky, G [Institute of Nuclear Research of the Hungarian Academy of Sciences (Hungary); Kaeppeler, F, E-mail: r.reifarth@gsi.d [Forschungszentrum Karlsruhe, Institut fuer Kernphysik, Karlsruhe (Germany)
2010-01-01
A pioneering experiment was recently performed at the Experimental Storage Ring (ESR) at GSI. Fully stripped ions of {sup 96}Ru were injected into the storage ring and slowed down to a few MeV per nucleon. The {sup 97}Rh ions from the {sup 96}Ru(p,{gamma}) reaction at a newly developed hydrogen jet target were detected with Double Sided Silicon Strip Detectors (DSSSD) mounted inside a pocket. The experiment and the status of the analysis at a beam energy of 11 MeV per nucleon will be presented.
Energy Technology Data Exchange (ETDEWEB)
Wallace, J.P., E-mail: J.P.Wallace@sms.ed.ac.uk [University of Edinburgh, Edinburgh, EH9 3JZ (United Kingdom); Woods, P.J.; Lotay, G. [University of Edinburgh, Edinburgh, EH9 3JZ (United Kingdom); Alharbi, A.; Banu, A. [Cyclotron Institute, Texas A and M University, College Station, TX (United States); David, H.M.; Davinson, T. [University of Edinburgh, Edinburgh, EH9 3JZ (United Kingdom); McCleskey, M.; Roeder, B.T.; Simmons, E.; Spiridon, A.; Trache, L.; Tribble, R.E. [Cyclotron Institute, Texas A and M University, College Station, TX (United States)
2012-05-30
Under astrophysical conditions of high temperature and density, such as for example found in X-ray bursts, breakout can occur from the hot CNO cycles into the rapid proton capture process. A key breakout route is via the sequence {sup 15}O({alpha},{gamma}){sup 19}Ne(p,{gamma}){sup 20}Na. The {sup 19}Ne(p,{gamma}){sup 20}Na reaction rate is expected to be dominated by a single resonance at 457(3) keV. The identity of the resonance has been under discussion for a long time, with J{sup {pi}}=1{sup +} and 3{sup +} assignments suggested. In this study of the {beta}-delayed proton decay of {sup 20}Mg we report a new, significantly more stringent, upper limit on the {beta}-decay branch to this state of 0.02% with a confidence level of 90%. This makes a 1{sup +} assignment highly unlikely and favours a 3{sup +} assignment for which no branch is expected to be observed. The 3{sup +} state is predicted to have a significantly higher resonance strength, and to produce a proportionately higher {sup 19}Ne(p,{gamma}){sup 20}Na reaction rate in X-ray burst conditions.
Energy Technology Data Exchange (ETDEWEB)
Usynin, Denys [Univ. of Pennsylvania, Philadelphia, PA (United States)
2005-01-01
The authors study the yields of charged kaons, charged pions, and protons produced in association with B mesons produced in proton-antiproton collisions at center of mass energy 1960 GeV using 355 pb<sup>-1sup> of data collected with the CDF detector at the Fermilab Tevatron. This is the first reported measurements of these yields at a hadron collider. The B mesons are reconstructed using their semileptonic decays: B<sup>0sup> → ℓ<sup>+D->X, D<sup>-> → K<sup>+π-π->; B<sup>0sup> → ℓ<sup>+D*->X, D*<sup>-> → π<sup>-$\\bar{D}$>0sup>,$\\bar{D}$>0sup> → K<sup>+π->; B<sup>+> → ℓ<sup>+$\\bar{D}$>0sup>X, $\\bar{D}$<sup>0sup> → K<sup>+π->; Bs→ℓ<sup>+>D$-\\atop{s}$ X, D$-\\atop{s}$ → π<sup>->Φ,Φ → K<sup>+K->. The K, π, and p are identified using the Time of Flight detector (TOF), the CDF spectrometer, and the specific ionization (dE/dx) measured in the central drift chamber (COT). The fraction of charged kaons produced in association with $\\bar{B}$$0\\atop{s}$ mesons is found to be larger than the fraction produced in association with the $\\bar{B}$$0\\atop{s}$ and B<sup>-> mesons, as expected from naive models of heavy quark hadronization to mesons. The particle species yields are found to be in qualitative agreement with simulation of B meson production in hadron collisions from the PYTHIA Monte Carlo, although the yield of kaons around $\\bar{B}$$0\\atop{s}$ mesons is found to be larger in the simulation when compared to the data. These studies are important for understanding methods of identifying the flavor of $\\bar{B}$$0\\atop{s}$ mesons in measurement of $\\bar{B}$$0\\atop{s}$ flavor oscillations and charge conjugation-parity (CP) violation in $\\bar{B}$$0\\atop{s}$ meson decays.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Observation of CP violation in B{sup {+-}}{yields}DK{sup {+-}} decays
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Abellan Beteta, C. [Universitat de Barcelona, Barcelona (Spain); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Adrover, C. [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Affolder, A. [Oliver Lodge Laboratory, University of Liverpool, Liverpool (United Kingdom); Ajaltouni, Z. [Clermont Universite, Universite Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Albrecht, J.; Alessio, F. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Alexander, M. [School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Ali, S. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Alkhazov, G. [Petersburg Nuclear Physics Institute (PNPI), Gatchina (Russian Federation); Alvarez Cartelle, P. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Alves, A.A. [Sezione INFN di Roma La Sapienza, Roma (Italy); Amato, S. [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro (Brazil); Amhis, Y. [Ecole Polytechnique Federale de Lausanne (EPFL), Lausanne (Switzerland); Anderson, J. [Physik-Institut, Universitaet Zuerich, Zuerich (Switzerland); Appleby, R.B. [School of Physics and Astronomy, University of Manchester, Manchester (United Kingdom); Aquines Gutierrez, O. [Max-Planck-Institut fuer Kernphysik (MPIK), Heidelberg (Germany); Archilli, F. [Laboratori Nazionali dell' INFN di Frascati, Frascati (Italy); European Organization for Nuclear Research (CERN), Geneva (Switzerland); and others
2012-06-06
An analysis of B{sup {+-}}{yields}DK{sup {+-}} and B{sup {+-}}{yields}D{pi}{sup {+-}} decays is presented where the D meson is reconstructed in the two-body final states: K{sup {+-}}{pi}{sup -}Or +, K{sup +}K{sup -} and {pi}{sup +}{pi}{sup -}. Using 1.0 fb{sup -1} of {radical}(s)=7 TeV pp collisions, measurements of several observables are made including the first observation of the suppressed mode B{sup {+-}}{yields}[{pi}{sup {+-}}K{sup -} Or+]{sub D}K{sup {+-}}. CP violation in B{sup {+-}}{yields}DK{sup {+-}} decays is observed with 5.8{sigma} significance.
Corden, M J; Bellamy, E H; Corbett, I F; Dagan, S; Dowell, John D; Esterling, R J; Garvey, J; Gnat, Y; Green, M G; Harnew, N; Jobes, M; Kenyon, I R; Lipman, Norman H; Lister, J B; Lister, J R; Litchfield, P J; March, P V; Mawson, J; McMahon, T; Robertson, A W; Stacey, B J; Strong, J A; Sumorok, K; Thomas, D H
1978-01-01
Data on the reaction pi /sup -/p to pi /sup +/ pi /sup -/ pi /sup 0/n have been taken at 12 and 15 GeV/c with the CERN Omega multiparticle spectrometer. In a 3-pion partial-wave analysis strong production of A /sub 2//sup 0/ (1310) and omega * (1675) is observed. Total and differential cross sections are determined and density matrix elements presented as a function of t in the t- and s-channel frames. The energy dependence of A/sub 2//sup 0/ production is studied, and a comparison of omega (780), A/sub 2//sup 0/ (1310) and omega * (1675) production is made. (15 refs).
Geometrical aspects of reaction cross sections for {sup 3}He, {sup 4}He and {sup 12}C projectiles
Energy Technology Data Exchange (ETDEWEB)
Ingemarsson, A. [Uppsala Univ. (Sweden). Dept. of Radiation Sciences; Lantz, M. [Uppsala Univ. (Sweden). The Svedberg Laboratory
2003-04-01
A black-disc model combined with accurate matter densities has been used for an investigation of reaction cross sections for {sup 3}He, {sup 4}He and {sup 12}C projectiles. A simple relation is derived between the energy dependence of the reaction cross sections and the strength of the nucleon-nucleon interaction. A comparison is also made of the reaction cross sections for {sup 3}He and {sup 4}He for six different nuclei {sup 12}C, {sup 16}O, {sup 40}Ca, {sup 58,60}Ni and {sup 208}Pb.
The 65 keV resonance in the {sup 17}O(p,alpha){sup 14}N thermonuclear reaction
Energy Technology Data Exchange (ETDEWEB)
Sergi, M.L. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Centro Siciliano di Fisica Nucleare e Struttura della Materia, Catania (Italy); Spitaleri, C. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Coc, A. [CSNSM, UMR 8609, CNRS/IN2P3and Universite Paris Sud 11, Batiment 104, 91405 Orsay Campus (France); Mukhamedzhanov, A. [Cyclotron Institute, Texas A and M University, College Station, TX 77843 (United States); Burjan, S.V. [Nuclear Physics Institute of ASCR Rez near Prague (Czech Republic); Gulino, M. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Hammache, F. [IPN, IN2P3-CNRS et Universite de Paris-Sud 11, 91406 Orsay Cedex (France); Hons, Z. [Nuclear Physics Institute of ASCR Rez near Prague (Czech Republic); Irgaziev, B. [GIK Institute of Engineering Sciences and Technology Topi District Swabi NWFP (Pakistan); Kiss, G.G. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Kroha, V. [Nuclear Physics Institute of ASCR Rez near Prague (Czech Republic); La Cognata, M. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Centro Siciliano di Fisica Nucleare e Struttura della Materia, Catania (Italy); Lamia, L.; Pizzone, R.G. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Sereville, N. de [IPN, IN2P3-CNRS et Universite de Paris-Sud 11, 91406 Orsay Cedex (France); Somorjai, E. [ATOMKI, Debrecen (Hungary)
2010-03-01
The indirect measurement of {sup 17}O(p,alpha){sup 14}N cross section was performed by means of the Trojan Horse Method. This approach allowed to investigate the ultra-low energy range (E{sub c.m.}=0-300 keV) relevant for several astrophysics environments, where two resonant levels of {sup 18}F at E{sub c.m.}{sup R}=65 keV and E{sub c.m.}{sup R}=183 keV play a significant role in the reaction rate determination.
Energy Technology Data Exchange (ETDEWEB)
Champagne, A E; Pitt, M L
1986-09-08
The /sup 18/O(/sup 3/He,d)/sup 19/F reaction has been used to determine if a presumed sub-threshold resonance at Esub(c.m.)=-94 KeV in the /sup 18/O(p,..cap alpha..)/sup 15/N reaction exists at an astrophysically significant level. No evidence for this state was observed which implies a dimensionless reduced width thetasub(p)/sup 2/<5 . 10/sup -5/. In addition, a proton width GAMMAsub(p)=2 x 10/sup -19/ eV has been determined for a d-wave resonance located at Esub(c.m.)=20 keV. The resulting thermonuclear reaction rate is slow enough to ensure that /sup 18/O is not destroyed at red-giant temperatures.
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae Jeong [Korea Univ., Seoul (South Korea)
2007-06-01
This work presents a search for the pair production of doubly-charged Higgs bosons in the process p{bar p} → H<sup>++H--> → μ<sup>+μ+μ-μ-> using the data corresponding to an integrated luminosity of about 1.1 fb<sup>-1sup>. This is the complete dataset of RunIIa taken from April 19, 2002 to February 22, 2006 by the D0 experiment at the Fermilab Tevatron Collider. In the absence of significant excess above standard model background, 95% confidence level mass limits of M(H$±±\\atop{L}$) > 150 GeV and M(H$±±\\atop{R}$) > 126.5 GeV are set for left-handed and right-handed doubly-charged Higgs bosons respectively assuming a 100% branching ratio into muons.
Energy Technology Data Exchange (ETDEWEB)
Auce, A.; Ingemarsson, A.; Johansson, R. [and others
2005-04-01
Results of reaction cross section measurements on {sup 12}C, {sup 40}Ca, {sup 90}Zr and {sup 208}Pb at incident proton energies between 80 and 180 MeV and for {sup 58}Ni at 81 MeV are presented. The experimental procedure is described and the results are compared with earlier measurements and predictions using macroscopic and microscopic models.
Possible production of glueballs in anti p sup 4 He reactions at 0. 6 GeVc sup -1 incident momentum
Energy Technology Data Exchange (ETDEWEB)
Balestra, F.; Bossolasco, S.; Bussa, M.P.; Busso, L.; Fava, L.; Ferrero, L.; Grasso, A.; Maggiora, A.; Panzieri, D.; Piragino, G.; Piragino, R.; Tosello, F. (Ist. di Fisica Generale ' A. Avogadro' , Univ. of Turin and INFN (Italy)); Bendiscioli, G.; Filippini, V.; Rotondi, A.; Salvini, P.; Zenoni, A. (Dipt. di Fisica Nucleare e Teorica, Univ. of Pavia and INFN, Sezione di Pavia (Italy)); Batusov, Yu.; Bunyatov, S.A.; Falomkin, I.V.; Nichitiu, F.; Pontecorvo, G.B.; Rozhdestvensky, A.M.; Sapozhnikov, M.G.; Tretyak, V.I. (Joint Inst. for Nuclear Research, Dubna (USSR)); Guaraldo, C. (Lab. Nazionali di Frascati, INFN (Italy)); Lodi Rizzini, E. (Dipt. di Automazione Industriale, Univ. of Brescia and INFN, Turin (Italy)); Haatuft, A.; Halsteinslid, A.; Myklebost, K.; Olsen, J.M. (Physics Dept., Univ. of Bergen (Norway)); Breivik, F.O.; Danielsen, K.M.; Jacobsen, T.; Soerensen, S.O. (Inst. of Physics, Univ. of Oslo (Norway))
1991-05-01
A sharp peak at 1150 MeV c{sup -2} in the {pi}{sup -}{pi}{sup +}{pi}{sup -}{pi}{sup +}-system in the final state of anti p {sup 4}He-reactions at 0.6 GeV c{sup -1} incident momentum is seen. This system probably has spin-parity = 0{sup +} or 2{sup +}, which are possible spin-parity assignments of a glueball. (orig.).
Energy Technology Data Exchange (ETDEWEB)
Sergi, M. L.; La Cognata, M.; Pizzone, R. G. [INFN-Laboratori Nazionali del Sud, Catania (Italy); Spitaleri, C.; Cherubini, S.; Puglia, S. M. R.; Rapisarda, G. G.; Romano, S. [Università di Catania, Catania, Italy and INFN-Laboratori Nazionali del Sud, Catania (Italy); Burjan, S. V.; Hons, Z.; Kroha, V. [Nuclear Physics Institute of ASCR Rez near Prague (Czech Republic); Coc, A. [CSNSM, UMR 8609, CNRS/IN2P3 and Universitè Paris Sud 11, Bâtiment 104, 91405 Orsay Campus (France); Gulino, M.; Tumino, A. [Università di Catania, Catania, Italy and INFN-Laboratori Nazionali del Sud, Catania, Italy and Universitá Kore di Enna, Enna (Italy); Hammache, F. [IPN, IN2P3-CNRS et Université de Paris-Sud 91406 Orsay Cedex (France); Irgaziev, B. [GIK Institute of Engineering Sciences and Technology Topi District Swabi NWFP (Pakistan); Kiss, G. G.; Somorjai, E. [ATOMKI, Debrecen (Hungary); Lamia, L. [Università di Catania, Catania (Italy); Mukhamedzhanov, A. [Cyclotron Institute,Texas A and M University College Station (United States); and others
2015-02-24
The {sup 17}O(p,α){sup 14}N reaction is of paramount importance for the nucleosynthesis in a number of stellar sites, including red giants (RG), asymptotic giant branch (AGB) stars, massive stars and classical novae. We report on the indirect study of the {sup 17}O(p,α){sup 14}N reaction via the Trojan Horse Method by applying the approach recently developed for extracting the resonance strength of the narrow resonance at E{sub c.m.}{sup R} = 65 keV (E{sub X} =5.673 MeV). The strength of the 65 keV resonance in the {sup 17}O(p,α){sup 14}N reaction, measured by means of the THM, has been used to renormalize the corresponding resonance strength in the {sup 17}O+p radiative capture channel.
International Nuclear Information System (INIS)
Schiffer, L.M.; Braunschweiger, P.G.; Glickson, J.D.; Evanochko, W.T.; Ng, T.C.
1985-01-01
In order to translate the concepts that have been developed in animal systems to human treatment programs, there is an urgent need for noninvasive techniques to study tumor cell biology. The characteristics of the ideal technique for the noninvasive monitoring of cell proliferation are truly imposing. The method should not require repeated biopsies; it should be amenable to repeated studies at frequent intervals without patient discomfort; it should monitor the proliferative response to the treatment modality; and it should not, in itself, perturb the tumor. Ideally, one would also like to be able to evaluate normal cell proliferation as well. It appears now that a new technique, /sup 31/P nuclear magnetic resonance (/sup 31/PNMR), may fulfill these rather rigid requirements. However, many studies in animal systems are necessary before it can be applied to the study of human tumors. The theory and mechanics of /sup 31/P NMR have been well described. Recently, its use as a noninvasive technique to study in vivo metabolic processes has become important. The authors presented a series of reports on the use of /sup 31/P NMR for the evaluation of tumor metabolism in animal systems under a variety of conditions. Studies of subcutaneously transplanted mouse tumors and human xenografts detected significant changes in nucleotide triphosphate (NTP), phosphocreatine, and inorganic phosphorus (Pi) as a result of tumor growth and perturbation with chemotherapeutic drugs, radiation, and hyperthermia. Their collabortive studies were designed to evaluate the changing effects of a noncurative single dose of cyclophosphamide on the /sup 31/P NMR resonances from the RIF-1 tumor, and to compare them with the proliferative changes that occur with time after drug administration. They were carried out in the hope of finding a noninvasive correlate with tumor cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Huo, Wen-Sheng [Xinjiang University, Department of Physics, Ueruemqi (China); Chen, Guo-Ying [Xinjiang University, Department of Physics, Ueruemqi (China); Institute of Theoretical Physics, Chinese Academy of Sciences, State Key Laboratory of Theoretical Physics, Beijing (China)
2016-03-15
With a combined analysis of data on Υ(5S) → h{sub b}(1P, 2P)π{sup +}π{sup -} and Υ(5S) → B{sup (*)} anti B{sup (*)}π in an effective field theory approach, we determine resonance parameters of Z{sub b} states in two scenarios. In one scenario we assume that Z{sub b} states are pure molecular states, while in the other one we assume that Z{sub b} states contain compact components. We find that the present data favor that there should be some compact components inside Z{sub b}{sup (')} associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h{sub b}(1P, 2P)π{sup +}π{sup -} and Υ(5S) → B{sup (*)} anti B{sup *}π, we determine that the probability of finding the compact components in Z{sub b} states may be as large as about 40 %. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Fazal-e-Aleem; Saleem, M. (University of the Punjab, Lahore (Pakistan). Centre for High Energy Physics); Rafique, M. (University of the Punjab, Lahore (Pakistan). Dept. of Mathematics)
1984-10-01
A pole plus cut model has been used to fit simultaneously the data on dsigma/dt, P(t) and ..delta..sigma for the reaction ..pi../sup -/p ..-->.. ..pi../sup 0/n at high energies; the most recent measurements of polarisation are included in the fit.
K-matrix analysis of the (IJ sup P sup C = 00 sup + sup +)-wave in the mass region below 1900 MeV
Anisovich, V V
2003-01-01
We present the results of the current analysis of the partial wave IJ sup P sup C =00 sup + sup + based on the available data for meson spectra (pi pi, K anti K, eta eta, eta eta sup ' ,pi pi pi pi). In the framework of the K-matrix approach, the analytical amplitude has been reconstructed in the mass region 280 MeV
A phenomenological {pi}{sup -}p scattering length from pionic hydrogen
Energy Technology Data Exchange (ETDEWEB)
Ericson, T.E.O.; Loiseau, B.; Wycech, S
2004-07-29
We derive a closed, model independent, expression for the electromagnetic correction factor to a phenomenological hadronic scattering length a{sup h} extracted from a hydrogenic atom. It is obtained in a non-relativistic approach and in the limit of a short ranged hadronic interaction to terms of order {alpha}{sup 2}log{alpha} using an extended charge distribution. A hadronic {pi}N scattering length a{sup h}{sub {pi}{sup -}}{sub p}=0.0870(5)m{sub {pi}}{sup -1} is deduced leading to a {pi}NN coupling constant from the GMO relation g{sub c}{sup 2}/(4{pi})=14.04(17)
Energy Technology Data Exchange (ETDEWEB)
Erhard, Martin Andreas
2010-02-26
By the high intensity of the bremsstrahlung of up to 20 MeV to 10{sup 9} MeV{sup -1}cm{sup -2}s{sup -1} in the energy range up to 20 MeV in the framework of this thesis for the first time not only the ({gamma},n), but also the ({gamma},p) reactions could be studied on {sup 92}Mo at astrophysically relevant energies.
Energy Technology Data Exchange (ETDEWEB)
Zagidullin, M V; Azyazov, V N [Samara Branch of the P.N. Lebedev Physical Institute, Russian Academy of Sciences, Samara (Russian Federation); Malyshev, M S [S.P. Korolev Samara State Aerospace University, Samara (Russian Federation)
2015-08-31
The kinetics of the processes occurring in an O{sub 2} – I{sub 2} – He – H{sub 2}O gas flow in which photodissociation of molecular iodine at a wavelength close to 500 nm and excitation of atomic iodine on the {sup 2}P{sub 1/2} – {sup 2}P{sub 3/2} transition by narrow-band radiation near 1315 nm are implemented successively has been analysed. It is shown that implementation of these processes allows one to form an oxygen – iodine medium with a high degree of dissociation of molecular iodine and a relative content of singlet oxygen O{sub 2}(a{sup 1}Δ) exceeding 10%. Having formed a supersonic gas flow with a temperature ∼100 K from this medium, one can reach a small-signal gain of about 10{sup -2} cm{sup -1} on the {sup 2}P{sub 1/2} – {sup 2}P{sub 3/2} transition in iodine atoms. The specific power per unit flow cross section in the oxygen – iodine laser with this active medium may reach ∼100 W cm{sup -2}. (active media)
Energy Technology Data Exchange (ETDEWEB)
Putzer, Daniel; Kroiss, Alexander; Waitz, Dietmar; Gabriel, Michael; Uprimny, Christian; Guggenberg, Elisabeth von; Decristoforo, Clemens; Warwitz, Boris; Virgolini, Irene Johanna [Innsbruck Medical University, Department of Nuclear Medicine, Innsbruck (Austria); Traub-Weidinger, Tatjana [Vienna Medical University, Department of Nuclear Medicine, Vienna (Austria); Widmann, Gerlig [Innsbruck Medical University, Department of Radiology, Innsbruck (Austria)
2013-03-15
-DOTA-TOC revealed more tumour sites than {sup 68}Ga-DOTA-LAN (106 vs 53). The tumour to background ratios for tumour and liver calculated from SUV{sub max} measurements were significantly higher for {sup 68}Ga-DOTA-TOC than {sup 68}Ga-DOTA-LAN (p < 0.02). {sup 68}Ga-DOTA-TOC PET imaging is an established imaging procedure for accurate staging of NET patients. {sup 68}Ga-DOTA-LAN should only be considered as a PET tracer of second choice in patients with no pathologic tracer uptake on {sup 68}Ga-DOTA-TOC PET. In these patients, {sup 68}Ga-DOTA-LAN PET can provide valuable information when evaluating PRRT as the treatment option, as a broader spectrum of human SSTR subtypes can be detected. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Birkhan, Jonny Hubertus
2016-07-01
In this thesis, proton scattering data on the nucleus {sup 48}Ca at very forward angles had been analysed. The data stem from a measurement campaign which was launched at the Research Centre of Nuclear Physics at Osaka, Japan, in the past. One of the two objectives of this analysis was to extract a value for the static electric dipole polarisability from the isovector giant dipole resonance (IVGDR). The second objective was to extract the total electromagnetic M1 strength B(M1) of the spin-flip transition which excites the prominent 1{sup +} state at an excitation energy of E{sub x}=10.22 MeV. The polarisability was calculated from the distribution of photo-absorption cross sections within an energy range from E{sub x}=11 MeV to E{sub x}=26 MeV. The photo-absorption cross sections had been deduced from the distribution of E1 cross sections by the method of virtual photons. For this purpose the experimental cross sections had been deconvoluted by a multipole deconvolution into an E1 part and a background part. Then, the best estimate of the polarisability is given by α{sub D}=(1.36±0.14) fm{sup 3}. If a E3 model was included into the multipole decomposition of the (p,p') data the result increased up to α{sub D}=(1.50±0.09) fm{sup 3}. The deviation between these two results is mainly due to the fact that the multipole decomposition is very sensitive on the background function. Assuming that the the IVGDR of the nuclei {sup 48}Ca and {sup 40}Ca have approximately the same structure, estimates for the polarisability of the nucleus {sup 48}Ca could be drawn from {sup 40}Ca(γ,abs) data. Additionally, data from a {sup 48}Ca(e,e'n) measurement were used to estimate the polarisability of the nucleus {sup 48}Ca. Its polarisability seems to fall within the range of α{sub D}=(1.50±0.09) fm{sup 3} and α{sub D}=(1.69±0.03) fm{sup 3}. Beside this, it could be shown by the {sup 40}Ca data that a significant contribution to the polarisability has to be expected
Measurement of B(B<sup>+>→ J/Ψ π<sup>+)/B(B+> → J/Ψ K<sup>+>) at the collider detector at Fermilab
Energy Technology Data Exchange (ETDEWEB)
Lee, Jaison [Sungkyunkwan Univ., Suwon (Republic of Korea)
2005-01-01
This thesis reports on a measurement of the ratio of braching frac t ions, B(B<sup>+>→ J/Ψ π<sup>+)/B(B+> → J/Ψ K<sup>+>) , where J/Ψ → μ<sup>+μ-> . The data were collected by the Collider Detector at Fermilab between February 2002 and August 2003 and corresponds to an integrated luminosity of 220 pb<sup>- 1sup> in p$\\bar{p}$ collisions at √s = l.96 TeV. We determine the ratio of branching fractions.
Energy Technology Data Exchange (ETDEWEB)
Estabrooks, P; Martin, A D [Durham Univ. (UK); Brandenburg, G W; Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Matthews, J A.J.
1976-04-05
Amplitudes for K*(890) and K*(1420) production, and their lower spin background, are determined from an analysis of the K..pi.. angular distribution observed in K/sup +/p..-->..K/sup +/..pi../sup -/..delta../sup + +/ at 13 GeV/c. The exchange mechanisms responsible for K*..delta.. production are studied, and a simple model is introduced which describes all features of the data.
Sequence of a cloned cDNA encoding human ribosomal protein S11
Energy Technology Data Exchange (ETDEWEB)
Lott, J B; Mackie, G A
1988-02-11
The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
Study of NΣ cusp in p+p → p+K{sup +}+Λ with partial wave analysis
Energy Technology Data Exchange (ETDEWEB)
Lu, S.; Muenzer, R.; Epple, E.; Fabbietti, L. [Excellenz Cluster Universe, Technische Universitaet Muenchen (Germany); Ritman, J.; Roderburg, E.; Hauenstein, F. [FZ Juelich (Germany); Collaboration: Hades and FOPI Collaboration
2016-07-01
In the last years, an analysis of exclusive reaction of p+p → p+K{sup +}+Λ has been carried out using Bonn-Gatchina Partial Wave Analysis. In a combined analysis of data from Hades, Fopi, Disto and Cosy-TOF, an energy dependent production process is determined. This analysis has shown that a sufficient description of the p+p → p+K{sup +}+Λ is quite challenging due to the presence of resonances N* and interference, which requires Partial Wave Analysis. A pronounced narrow structure is observed in its projection on the pΛ-invariant mass. This peak structure, which appears around the NΣ threshold, has a strongly asymmetric structure and is interpreted a NΣ cusp effect. In this talk, the results from a combined analysis will be shown, with a special focus on the NΣ cusp structure and a description using Flatte parametrization.
FIRST DETECTION OF [C I] {sup 3}P{sub 1}–{sup 3}P{sub 0} EMISSION FROM A PROTOPLANETARY DISK
Energy Technology Data Exchange (ETDEWEB)
Tsukagoshi, Takashi; Momose, Munetake [College of Science, Ibaraki University, Bunkyo 2-1-1, Mito 310-8512 (Japan); Saito, Masao [Nobeyama Radio Observatory, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Kitamura, Yoshimi [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, Yoshinodai 3-1-1, Sagamihara, Kanagawa 229-8510 (Japan); Shimajiri, Yoshito [Laboratoire AIM, CEA/DSM-CNRS-Université Paris, Diderot, IRFU/Service d’Astrophysique, CEA, Saclay, F-91191 Gif-sur-Yvette Cedex (France); Kawabe, Ryohei, E-mail: ttsuka@mx.ibaraki.ac.jp [National Astronomical Observatory of Japan, Osawa 2-21-1, Mitaka, Tokyo 181-8588 (Japan)
2015-03-20
We performed single point [C i] {sup 3}P{sub 1}–{sup 3}P{sub 0} and CO J = 4–3 observations toward three T Tauri stars (TTSs), DM Tau, LkCa 15, and TW Hya, using the Atacama Large Millimeter/submillimeter Array Band 8 qualification model receiver installed on the Atacama Submillimeter Telescope Experiment. Two protostars (PSs) in the Taurus L1551 region, L1551 IRS 5 and HL Tau, were also observed. We successfully detected [C i] emission from the protoplanetary disk around DM Tau as well as the protostellar targets. The spectral profile of the [C i] emission from the protoplanetary disk is marginally single-peaked, suggesting that atomic carbon (C) extends toward the outermost disk. The detected [C i] emission is optically thin and the column densities of C are estimated to be ≲10{sup 16} and ∼10{sup 17} cm{sup −2} for the TTS targets and the PSs, respectively. We found a clear difference in the total mass ratio of C to dust, M(C)/M(dust), between the TTSs and protostellar targets; the M(C)/M(dust) ratio of the TTSs is one order of magnitude smaller than that of the PSs. The decrease of the estimated M(C)/M(dust) ratios for the disk sources is consistent with a theoretical prediction that the atomic C can survive only in the near surface layer of the disk and C{sup +}/C/CO transition occurs deeper into the disk midplane.
/sup 99m/Tc labeling of antibodies to cardiac myosin Fab and to human fibrinogen
International Nuclear Information System (INIS)
Khaw, B.A.; Strauss, H.W.; Carvalho, A.; Locke, E.; Gold, H.K.; Haber, E.
1982-01-01
We have developed a method of labeling biologically active labile macromolecules, such as human fibrinogen (HF) and anticardiac-myosin Fab (AM-Fab), with /sup 99m/Tc at neutral pH. This method uses dithionite reduction of pertechnetate and subsequent labeling, to test the method with acid-labile macromolecules. Complexes of diethylene triamine pentaacetic acid with macromolecules such as human fibrinogen (D-HF) and anticardiac-myosin Fab (D-AM-Fab) were labeled and utilized in in vitro and in vivo studies. In biodistribution studies, the /sup 99m/Tc D-HF had a two-component blood clearance (half-times 1 hr and 15 hr) and was 80--88% coagulable. The /sup 99m/Tc AM-Fab retained its immunoreactivity as tested by affinity chromatography; also during in vivo localization in experimental myocardial infarction. This labeling technique provides an easy and efficient approach to the /sup 99m/Tc labeling of other biologically active and acid-labile macromolecules
K/sup -/n and K/sup -/p elastic scattering in K/sup -/d collisions from 12 to 22 GeV/c
Déclais, Y; Bricman, C; Duchon, J; Ferro-Luzzi, M; Louvel, M; Patry, J P; Perreau, J M; Séguinot, Jacques; Ypsilantis, Thomas
1977-01-01
The elastic scattering of negative K-mesons on the proton and on the neutron of the deuterium has been measured at six incident momenta equally spaced between 1.2 and 2.2 GeV/c. Differential cross sections over the almost complete angular range have been obtained for K/sup - /p and K/sup -/n. The aim of the experiment was the measurement of the pure isospin I=1 reaction K/sup -/n to K/sup -/n. The results for the reaction on proton are a by-product and provide a verification of the assumptions necessary for the analysis of the neutron reaction.
Energy Technology Data Exchange (ETDEWEB)
John, Christy S. E-mail: radcsj@gwumc.edu; Bowen, Wayne D.; Fisher, Susan J.; Lim, Benjamin B.; Geyer, Brian C.; Vilner, Bertold J.; Wahl, Richard L
1999-05-01
The goal of this study was to investigate the potential use of a radioiodinated benzamide, N-[2-(1'-piperidinyl)ethyl]-3-iodo[{sup 125}I]-4-methoxybenzamide (P[{sup 125}I]MBA), a sigma receptor binding radioligand for imaging breast cancer. The chemical and radiochemical syntheses of PIMBA are described. The pharmacological evaluation of PIMBA was carried out for sigma-1 and sigma-2 receptor sites. The in vivo pharmacokinetics of the radioiodinated benzamide were determined in rats and comparison of P[{sup 125}I]MBA with Tc-99m sestamibi were made in a rat mammary tumor model. Sigma-1 affinity (K{sub i}) for PIMBA in guinea pig brain membranes using [{sup 3}H](+)pentazocine was found to be 11.82{+-}0.68 nM, whereas sigma-2 affinity in rat liver using [{sup 3}H]DTG (1,3-o-di-tolylguanidine) was 206{+-}11 nM. Sites in guinea pig brain membranes labeled by P[{sup 125}I]MBA showed high affinity for haloperidol, (+)-pentazocine, BD1008, and PIMBA (K{sub i}=4.87{+-}1.49,8.81{+-}1.97,0.057{+-}0.005,46.9{+-}1.8 nM), respectively). Competition binding studies were carried out in human ductal breast carcinoma cells (T47D). A dose-dependent inhibition of specific binding was observed with several sigma ligands. K{sub i} values for the inhibition of P[{sup 125}I]MBA binding in T47D cells for haloperidol, N-[2-(1'-piperidinyl)]ethyl]4-iodobenzamide (IPAB), N-(N-benzylpiperidin-4-yl)-4-iodobenzamide (4-IBP), and PIMBA were found to be 1.30{+-}0.07, 13{+-}1.5, 5.19{+-}2.3, 1.06{+-}0.5 nM, respectively. The in vitro binding data in guinea pig brain membranes and breast cancer cells confirmed binding to sigma sites. The saturation binding of P[{sup 125}I]MBA in T47D cells as studied by Scatchard analysis showed saturable binding, with a K{sub d}=94{+-}7 nM and a B{sub max}=2035{+-}305 fmol/mg of proteins. Biodistribution studies in Sprague-Dawley rats showed a rapid clearance of P[{sup 125}I]MBA from the normal organs. The potential of PIMBA in imaging breast cancer was
Energy Technology Data Exchange (ETDEWEB)
Michaud, Y
1995-09-21
The aim of the study was to examine the behaviour of the proton-proton elastic scattering, for mass center energies around 10 GeV, and more especially to study the charge exchange reaction {pi}{sup -} p {yields} {pi}{sup 0} n for mass center energies between 3 and 20 GeV. A formalism based on the Glauber model has been used, and a Regge trajectory exchange term was introduced in the model in order to enable the description of the lower energy domain (inferior to 10 GeV) that is characterized by a large contribution of meson exchanges at the scattering amplitude. The Glauber model is then applied to the charge exchange reaction and the differential cross section is analyzed for a center mass energy comprised between 3 and 20 GeV, together with the polarization at 40 GeV/c. The approach is then validated through the study of the {pi}{sup -} p {yields} {eta} n reaction. The size of the kernel of proton and pion components implied in the {pi}{sup -} p {yields} {pi}{sup 0} n reaction, is also investigated. 90 refs., 48 figs., 4 tabs., 5 appends.
Energy Technology Data Exchange (ETDEWEB)
Hennig, Andreas; Derya, Vera; Pickstone, Simon G.; Spieker, Mark; Zilges, Andreas [Institute for Nuclear Physics, University of Cologne (Germany); Mineva, Milena N. [INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria); Petkov, Pavel [Institute for Nuclear Physics, University of Cologne (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria)
2015-07-01
Absolute transition matrix elements are valuable observables in nuclear-structure physics since they are directly related to the nuclear wave functions. A key ingredient to determine transition matrix elements is the measurement of lifetimes of excited states. In a recent experiment, we extracted the lifetimes of 30 excited states of the low-abundant isotope {sup 96}Ru utilizing the Doppler-shift attenuation method (DSAM) in an inelastic proton-scattering experiment and taking advantage of the proton-γ coincidence technique. In contrast to the DSAM technique following inelastic neutron scattering, which was frequently performed to extract comprehensive lifetime information in the sub-picosecond regime, the (p,p{sup '}γ) reaction requires a much less amount of target material and is thus especially suited to investigate low-abundant isotopes. In this contribution, the (p,p{sup '}γ) method for lifetime measurements is presented and the results of recent experiments on {sup 96}Ru, {sup 94}Zr, and {sup 112,114}Sn are shown.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Spectroscopy of the {sup 29}Si(p,{gamma}) reaction for E{sub p}=1.00{endash}1.75 MeV
Energy Technology Data Exchange (ETDEWEB)
Vavrina, G.A.; Bybee, C.R.; Mitchell, G.E.; Moore, E.F.; Shriner, J.D. [North Carolina State University, Raleigh, North Carolina 27695 (United States); Bilpuch, E.G.; Wallace, P.M.; Westerfeldt, C.R. [Duke University, Durham, North Carolina 27708 (United States); Shriner, J.F. , Jr. [Tennessee Technological University, Cookeville, Tennessee 38505 (United States)
1997-03-01
The {sup 29}Si(p,{gamma}) reaction has been studied in the range E{sub p}=1.00{endash}1.75 MeV. Three previously unknown states in {sup 30}P were identified, and one state previously assigned to {sup 30}P was identified as a state in {sup 14}N. Gamma-ray strengths were determined for the three new levels, and branching ratios were measured for 17 resonances. Revised J{sup {pi}};T assignments were made for nine of these states. {copyright} {ital 1997} {ital The American Physical Society}
Corden, M J; Bellamy, E H; Corbett, I F; Dagan, S; Dowell, John D; Esterling, R J; Garvey, J; Gnat, Y; Green, M G; Harnew, N; Jobes, M; Kenyon, I R; Lipman, Norman H; Lister, J B; Lister, J R; Litchfield, P J; Mawson, J; McMahon, T; Robertson, A W; Stacey, B J; Strong, J A; Sumorok, K; Thomas, D H
1978-01-01
Data on the charge-exchange reaction pi /sup -/p to ( pi /sup +/ pi /sup -/ pi /sup 0/)n have been taken at beam momenta of 12 and 15 GeV /c, using the CERN Omega Multiparticle Spectrometer. A partial-wave analysis has been made of the (3 pi )/sup 0/ system. Both natural and unnatural spin-parity production was observed. The natural parity states can be identified with established resonances. In addition a natural spin-parity enhancement is observed at a mass of about 2 GeV/c /sup 2/ with J/sup P/=4/sup +/ preferred. This effect is called the A /sub 2/*(2030). The unnatural spin-parity production found is consistent with reggeized Deck model predictions. No unambiguous A/sub 1/ or A/sub 3/ production is observed. (15 refs).
Energy Technology Data Exchange (ETDEWEB)
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-29
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of /sup 168/Er in the /sup 166/Er(t,P)/sup 168/Er reaction rather well. In particular, the excitation of I,Ksub(i)sup(..pi..) = 4,3/sub 1//sup +/; 2,2/sub 2//sup +/; 0,0/sub 3//sup +/ and 0,0/sub 4//sup +/ states is much improved over the sd-IBM appraoch.
Configuration interaction calculations of positron binding to Be({sup 3}P )
Energy Technology Data Exchange (ETDEWEB)
Bromley, M.W.J. [Department of Physics, San Diego State University, San Diego, CA 92182 (United States)]. E-mail: mbromley@physics.sdsu.edu; Mitroy, J. [Faculty of Technology, Charles Darwin University, Darwin, NT 0909 (Australia)]. E-mail: jxm107@rsphysse.anu.edu.au
2006-06-15
The configuration interaction method is applied to investigate the possibility of positron binding to the metastable beryllium (1s{sup 2}2s2p {sup 3}P ) state. The largest calculation obtained an estimated energy that was unstable by 0.00014 Hartree with respect to the Ps + Be{sup +}(2s) lowest dissociation channel. It is likely that positron binding to parent states with non-zero angular momentum is inhibited by centrifugal barriers.
Energy Technology Data Exchange (ETDEWEB)
Thevenet, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1963-06-15
We measured, with {gamma} rays counters, the total production cross section of {gamma} accompanied by charged secondaries in {pi}{sup {+-}} p interactions between 0.5 and 1.5 GeV/c. We obtained the cross section of the reaction {pi}{sup +} p {yields} {pi}{sup +} {pi}{sup 0} p, with incident {pi}{sup -} we could determined only the cross section of {pi}{sup -} p {yields} {pi}{sup 0} + (charged particles) because the lack of information on multiple production. We compared our experimental results with the predictions of simple production models. A method for calculation of high energy {gamma} rays efficiency of detectors with lead converters is given in the appendix. (author) [French] Nous avons mesure, au moyen de compteurs sensibles aux photons, la section efficace totale de production de {gamma} accompagnes de secondaires charges dans les interactions {pi}{sup {+-}} p entre 0,5 et 1,5 GeV/c. Nous avons obtenu la section efficace de la reaction {pi}{sup +} p {yields} {pi}{sup +} {pi}{sup 0} p, mais avec des {pi}{sup -} incidents nous n'avons pu determiner que la section efficace de la reaction {pi}{sup -} p {yields} {pi}{sup 0} + particules chargees, par manque d'information sur la production multiple. Nous avons compare nos resultats aux predictions des principaux modeles de production simple. En appendice, nous donnons une methode de calcul de l'efficacite de detecteurs a ecrans de plomb pour les photons de grande energie. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Zaman, Muhammad; Kim, Guinyun; Kim, Kwangsoo [Kyungpook National Univ., Daegu (Korea, Republic of). Dept. of Physics; Naik, Haladhara [Kyungpook National Univ., Daegu (Korea, Republic of). Dept. of Physics; Bhabha Atomic Research Centre, Mumbai (India). Radiochemistry Div.; Lee, Young-Ouk; Cho, Young-Sik [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of). Nuclear Data Center; Lee, Man Woo; Kang, Yeong-Rok [Dongnam Institute of Radiological and Medical Science, Busan (Korea, Republic of). Research Center
2017-10-01
The cross sections of the {sup 27}Al(n,α){sup 24}Na and {sup 27}Al(n,p){sup 27}Mg reactions with the average neutron energies of 15.2, 26.4, and 37.2 MeV were measured using the activation and off-line γ-ray spectrometric technique at the Korean Institute of Radiological and Medical Sciences (KIRAMS), Korea. Quasi-monoenergetic neutrons produced via the {sup 9}Be(p,n) reaction with the proton beam energies of 25, 35, and 45 MeV from the MC50 cyclotron of KIRAMS were used. The present measured values were compared with those from the evaluated nuclear data libraries ENDF/B-VII, TENDL-2015, TALYS 1.8, and from literature. In general, a close agreement with the literature data as well as the evaluated data was found.
Vergeest, J S M; Chaloupka, V; Engelen, J J; Gavillet, P; Gay, J B; Hemingway, R J; Jongejans, B; Kittel, E W; Losty, Michael J; Metzger, W J; Tiecke, H G; Voorthuis, H; Wolters, G F
1976-01-01
A partial wave analysis of the K/sup 0/ pi /sup +/ pi /sup -/ system produced in the charge exchange reaction K/sup -/p to (K/sup 0/ pi /sup +/ pi /sup -/)n at 4.2 GeV/c has been performed both as a function of K pi pi mass and of t'. The 1/sup +/S wave forms the largest contribution to the K pi pi system and peaks at roughly the same mass as the Q in diffractive K pi pi production. The polarization properties of the 1/sup +/S(K* pi ) and 1/sup +/S(K rho ) waves differ from those of the diffractive 1/sup +/ wave. There is some evidence for a resonance contribution to 1/sup +/S(K* pi ). The strong 2/sup +/ wave is identified with K*(1420) and the K rho /K* pi decay branching ratio determined to be 0.36+or-0.10. An enhancement with spin-parity 1 /sup -/ is observed under the K*(1420). (14 refs).
SANE's Measurement of the Proton's Virtual Photon Spin Asymmetry, A<sup>p>1, at Large Bjorken x
Energy Technology Data Exchange (ETDEWEB)
Mulholland, Jonathan [Univ. of Virginia, Charlottesville, VA (United States)
2012-05-01
The experiment SANE (Spin Asymmetries of the Nucleon Experiment) measured inclusive double polarization electron asymmetries on a proton target at the Continuous Electron Beam Accelerator Facility at the Thomas Jefferson National Laboratory in Newport News Virgina. Polarized electrons were scattered from a solid <sup>14sup>NH3 polarized target provided by the University of Virginia target group. Measurements were taken with the target polarization oriented at 80 degrees and 180 degrees relative to the beam direction, and beam energies of 4.7 and 5.9 GeV were used. Scattered electrons were detected by a multi-component novel non-magnetic detector package constructed for this experiment. Asymmetries measured at the two target orientations allow for the extraction of the virtual Compton asymmetries A1<sup>p> and A2<sup>p> as well as the spin structure functions g1<sup>p> and g2<sup>p>. This work addresses the extraction of the virtual Compton asymmetry A1<sup>p> in the deep inelastic regime. The analysis uses data in the kinematic range from Bjorken x of 0.30 to 0.55, separated into four Q<sup>2sup> bins from 1.9 to 4.7 GeV<sup>2sup>.
Energy Technology Data Exchange (ETDEWEB)
Cheng, Nai-Ming; Yen, Tzu-Chen [Chang Gung University College of Medicine, Department of Nuclear Medicine and Molecular Imaging Center, Chang Gung Memorial Hospital, Taipei (China); Chang, Joseph Tung-Chieh; Tsan, Din-Li; Lin, Chien-Yu [Chang Gung University College of Medicine, Department of Radiation Oncology, Chang Gung Memorial Hospital, Taipei (China); Huang, Chung-Guei [Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Department of Laboratory Medicine, Taipei (China); Ng, Shu-Hang [Chang Gung University College of Medicine, Department of Diagnostic Radiology, Chang Gung Memorial Hospital, Taipei (China); Wang, Hung-Ming; Hsu, Cheng-Lung [Chang Gung University College of Medicine, Division of Hematology/Oncology, Department of Internal Medicine, Chang Gung Memorial Hospital, Taipei (China); Liao, Chun-Ta [Chang Gung University College of Medicine, Department of Otolaryngology-Head and Neck Surgery, Chang Gung Memorial Hospital, Taipei (China)
2012-11-15
Human papillomavirus type 16 (HPV-16) positivity is associated with favourable survival in oropharyngeal squamous cell carcinoma (OPSCC). We report here a study of the prognostic significance of {sup 18}F-FDG PET/CT functional parameters and HPV-16 infection in OPSCC patients. We retrospectively analysed 60 patients with stage III or IV OPSCC who had had a pretherapy {sup 18}F-FDG PET/CT scan and had completed concurrent chemoradiotherapy (n = 58) or curative radiotherapy (n = 2). All patients were followed up for {>=}24 months or until death. We determined total lesion glycolysis (TLG) and the maximal standardized uptake values (SUV{sub max}) of the primary tumour and neck lymph nodes from the pretherapy {sup 18}F-FDG PET/CT scan. Optimal cut-offs of the {sup 18}F-FDG PET/CT parameters were obtained by receiver operating characteristic (ROC) curve analyses. Pretherapy tumour biopsies were studied by polymerase chain reaction to determine HPV infection status. The pretherapy tumour biopsies were positive for HPV-16 in 12 patients (20.0 %). Cox regression analyses revealed HPV-16 positivity and tumour TLG >135.3 g to be independently associated with overall survival (p = 0.027 and 0.011, respectively). However, only tumour TLG >135.3 g was independently associated with progression-free survival, disease-free survival and locoregional control (p = 0.011, 0.001 and 0.034, respectively). A scoring system was formulated to define distinct overall survival groups using tumour TLG and HPV-16 status. Patients positive for HPV-16 and with tumour TLG {<=}135.3 g experienced better survival than those with tumour TLG >135.3 g and no HPV infection (p = 0.001). Tumour TLG was an independent predictor of survival in patients with locally advanced OPSCC. A scoring system was developed and may serve as a risk stratification strategy for guiding therapy. (orig.)
[sup 205]Bi/[sup 206]Bi cyclotron production from Pb-isotopes for absorption studies in humans
Energy Technology Data Exchange (ETDEWEB)
Fischer, R.; Dresow, B.; Heinrich, H.C. (Universitaetskrankenhaus Eppendorf, Hamburg (Germany). Abt. Medizinische Biochemie); Wendel, J.; Bechtold, V. (Kernforschungszentrum Karlsruhe GmbH (Germany). Inst. fuer Kernphysik)
1993-12-01
Pb(p,xn) thick target excitation functions were measured in the energy range 10-38 MeV in order to optimize the production of isotopically pure radiobismuth from [sup nat]Pb, [sup 206]Pb, and [sup 207]Pb. Additionally, the decay of Po-isotopes from deuteron irradiation of natural bismuth ([sup 209]Bi) was exploited for radiobismuth production. [sup 205]Bi was produced from [sup 206]Pb at 20 MeV with only 2% of [sup 206]Bi at 4 weeks post irradiation. Bismuth compounds as used in the treatment of peptic ulcer were labeled with [sup 205]Bi for absorption studies in animals and subjects. (Author).
Charm production in charged current deep inelastic e{sup +}p scattering at HERA
Energy Technology Data Exchange (ETDEWEB)
Wang, M.
2006-03-15
The measurement of charm production in charged current deep inelastic positron-proton scattering is investigated with the ZEUS detector at the HERA collider. The data used has been collected from 1995 to 2000, corresponding to an integrated luminosity of 110 pb{sup -1}. Charged D{sup *} mesons decaying in the channel D{sup *+}{yields}D{sup 0}{pi}{sup +}{sub s} with D{sup 0}{yields}K{sup -}{pi}{sup +} and the charge conjugated channel are reconstructed to tag charm quarks. The visible cross section for D{sup *}, {sigma}{sup D*}{sub vis}=12.8{+-}4.0(stat){sup +4.7}{sub -1.5}(sys) pb, is measured in the kinematic range of Q{sup 2}>200 GeV{sup 2} and y<0.9, and of p{sup D{sup *}}{sub T}>1.5 GeV and vertical stroke {eta}{sup D{sup *}} vertical stroke <1.5. The upper-limit for the charm production in the same DIS kinematic range is determined to be {sigma}{sup e{sup +}}{sup p{yields}} {sup anti} {sup {nu}{sub e}}{sup cX} < 109 pb at 90% confidence level. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Hanson, A L; Kraner, H W; Shroy, R E; Jones, K W [Brookhaven National Lab., Upton, NY (USA)
1984-08-01
The fluorine contents of National Bureau of Standards (NBS) Standard Reference Materials (SRM) 91, opal glass; 120b, phosphate rock; and 2671a, freeze-dried urine; have been measured using the /sup 19/F(p,p'..gamma..)/sup 19/F reaction at a proton energy of 3.1 MeV. The results are in good agreement with the values certified by the NBS.
Energy Technology Data Exchange (ETDEWEB)
Al-Jarallah, M.I. E-mail: mibrahim@kfupm.edu.sa; Naqvi, A.A.; Abu-Jarad, F.A.; Fazal-ur-Rehman; Durrani, S.M.A.; Kidwai, S
2001-06-01
Angular distributions of a {sup 6}Li(p,{alpha}) {sup 3}He reaction were measured at six angles for 140 keV proton energy using nuclear track detectors (NTDs). The measurements were carried out over 60 deg. -160 deg. lab. angles in 20 deg. increments using a scattering chamber of 80 deg. beam line of the 350 kV accelerator. A semiconductor silicon surface barrier (SSB) detector was placed at +160 deg. and was used as a monitor. The results have shown that the CR-39 detector has excellent capabilities to distinguish 1.4-2.7 MeV {alpha}+ {sup 3}He particles from the {sup 6}Li(p,{alpha}) {sup 3}He reaction and 8-9.4 MeV {alpha}-particles from the {sup 7}Li(p,{alpha}) {sup 4}He reaction through their track diameters. However, it was not possible to distinguish between the 2.3 MeV {sup 3}He ions and the 1.7 MeV {sup 4}He ions from the {sup 6}Li(p,{alpha}) {sup 3}He reaction from their track diameter measurements, but it was possible to differentiate between the two, from the darker contrast of the {sup 3}He particles caused by its deeper tracks as compared to those of {sup 4}He.
The {sup 14}N(p, {gamma}){sup 15}O reaction studied at low and high beam energy
Energy Technology Data Exchange (ETDEWEB)
Marta, Michele
2012-07-01
The Bethe-Weizsaecker cycle consists of a set of nuclear reactions that convert hydrogen into helium and release energy in the stars. It determines the luminosity of low-metal stars at their turn-off from the main-sequence in the Hertzsprung-Russel diagram, so its rate enters the calculation of the globular clusters' age, an independent lower limit on the age of the universe. The cycle contributes less than 1% to our Sun's luminosity, but it produces neutrinos that can in principle be measured on Earth in underground experiments and bring direct information of the physical conditions in the solar core, provided that the nuclear reaction rate is known with sufficient precision. The {sup 14}N(p,{gamma}){sup 15}O reaction is the slowest reaction of the Bethe-Weizsaecker cycle and establishes its rate. Its cross section is the sum of the contributions by capture to different excited levels and to the ground state in {sup 15}O. Recent experiments studied the region of the resonance at E{sub p} = 278 keV. Only one modern data set from an experiment performed in 1987 is available for the high-energy domain. Both energy ranges are needed to constrain the fit of the excitation function in the R-matrix framework and to obtain a reliable extrapolated S-factor at the very low astrophysical energies. The present research work studied the {sup 14}N(p,{gamma}){sup 15}O reaction in the LUNA (Laboratory for Underground Nuclear Astrophysics) underground facility at three proton energies 0.36, 0.38, 0.40MeV, and in Dresden in the energy range E{sub p} = 0.6 - 2MeV. In both cases, an intense proton beam was sent on solid titanium nitride sputtered targets, and the prompt photons emitted from the reaction were detected with germanium detectors. At LUNA, a composite germanium detector was used. This enabled a measurement with dramatically reduced summing corrections with respect to previous studies. The cross sections for capture to the ground state and to the excited states
Energy Technology Data Exchange (ETDEWEB)
Longequeue, N [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires
1965-05-01
The reactions {sup 16}O(d,{alpha}{sub 0}), (d,p{sub 0}), (d,p{sub 1}) and {sup 11}B(d,{alpha}{sub 0}), (d,{alpha}{sub 2}), (d,p{sub 0}) have been studied from 200 keV to 1 MeV. The interpretation of (d,{alpha}) reactions by the compound nucleus theory has shown the presence of {sup 18}F levels (7,94 MeV, 1+; 8,09 MeV, 1+ ) and of {sup 13}C level (19 MeV, 3/2{+-} or 5/2-). The interpretation of {sup 16}O(d,p{sub 1}) and {sup 11}B(d,p{sub 0}) reactions at energies lower than 400 keV has been given by a theory of Coulomb stripping. (author) [French] L'etude experimentale des reactions {sup 16}O(d,{alpha}{sub 0}); (d,p{sub 0}), (d,p{sub 1}) et {sup 11}B(d,{alpha}{sub 0}), (d,{alpha}{sub 2}), (d,p{sub 0}) a ete faite de 200 keV a 1 Mev. L'interpretation des reactions (d,a) par la theorie du noyau compose a permis la mise en evidence de niveaux du {sup 18}F (7,94 MeV, 1+; 8,09MeV, 1+ ) et du {sup 13}C(19 MeV, 3/2{+-} ou 5/2-). L'interpretation des reactions {sup 16}O(d,p{sub 1}) et {sup 11}B(d,p{sub 0}), a basse energie (< 400 keV), par une theorie de stripping de Coulomb, a ete donnee.
Theory of the (n,p) reaction on /sup 90/Zr
International Nuclear Information System (INIS)
Yabe, M.
1987-01-01
A theoretical study of the /sup 90/Zr(n,p) reaction is performed at an incident energy of 200 MeV. The forward angle /sup 90/Zr(n,p)= spectra are calculated within a microscopic model using random phase approximation transition densities for the description of the nuclear excited states. The calculated spectra are compared to those published previously by Klein, Love, and Auerbach
Energy Technology Data Exchange (ETDEWEB)
Hoeche, M.R.; Berrettini, W.H. (Clinical Neurogenetics Branch, Bethesda, MD (USA)); Regan, J.W. (Duke Univ. Medical Center, Durham, NC (USA))
1989-12-11
A 1.5 kb Eco RI cDNA fragment representing the human alpha2-C4 adrenergic receptor (AR) gene encoding the putative alpha2B-AR, containing approximately 1270 bp of the coding and 240 bp of the 3{prime}flanking region, inserted into pSP65, was used as a probe (p ADRA2RL2). This clone was obtained by screening a human kidney lambda GT10 cDNA library with the 0.95 kb Pst I restriction fragment derived from the coding block of the gene for the human platelet alpha2-AR. Hybridization of human genomic DNA digested with Bsu 36 I identifies a two allele polymorphism with bands at 12 kb and 5.8 kb. 20 unrelated North American caucasian subjects were evaluated with frequencies of: A allele, 0.45; B allele, 0.55, heterozygosity (obs), 0.5. This alpha2-AR gene has been mapped in a separation effort in 59 CEPH reference pedigrees to the tip of the short arm of chromosome 4 just proximal to GB (4p 16.3) reported to be linked to the Huntingston's disease gene. Codominant inheritance was observed in seven families with two and three generations, respectively. The number of meioses scored was 95.
Energy Technology Data Exchange (ETDEWEB)
Lazar, K. [Inst. of Isotopes, Budapest, P.O.B. 77, H-1525 (Hungary)]. e-mail : lazar@iki.kfki.hu; Megyeri, J.; Mathe, Z. [Mecsekerc Co., Esztergar L. 19, Pec s, H-7633 (Hungary)
2007-06-15
Diffusion rates of TcO{sub 4}{sup -} and H{sup 14}CO{sub 3}{sup -} anions are compared in break-through experiments performed on bore core samples with different mineral compositions. Measurements were carried out using synthetic ground water of different pH (8 and 12). Significant increase of the apparent diffusivities was observed in samples containing smectite constituent for both anions in experiments performed at pH = 8. Rock capacity factors were also different in dependence of the composition in experiments with H{sup 14}CO{sub 3}{sup -} at pH = 8. The presence of smectite is assumed to result in formation of microcracks, providing additional free volume for diffusion. In the diffusion of H{sup 14}CO{sub 3}{sup -} the isotope exchange between the carbonate forms, CO{sub 3}{sup 2-} solution . CO{sub 3}{sup 2-} rock, plays probably also a role in the migration process.
Developing a hippocampal neural prosthetic to facilitate human memory encoding and recall
Hampson, Robert E.; Song, Dong; Robinson, Brian S.; Fetterhoff, Dustin; Dakos, Alexander S.; Roeder, Brent M.; She, Xiwei; Wicks, Robert T.; Witcher, Mark R.; Couture, Daniel E.; Laxton, Adrian W.; Munger-Clary, Heidi; Popli, Gautam; Sollman, Myriam J.; Whitlow, Christopher T.; Marmarelis, Vasilis Z.; Berger, Theodore W.; Deadwyler, Sam A.
2018-06-01
Objective. We demonstrate here the first successful implementation in humans of a proof-of-concept system for restoring and improving memory function via facilitation of memory encoding using the patient’s own hippocampal spatiotemporal neural codes for memory. Memory in humans is subject to disruption by drugs, disease and brain injury, yet previous attempts to restore or rescue memory function in humans typically involved only nonspecific, modulation of brain areas and neural systems related to memory retrieval. Approach. We have constructed a model of processes by which the hippocampus encodes memory items via spatiotemporal firing of neural ensembles that underlie the successful encoding of short-term memory. A nonlinear multi-input, multi-output (MIMO) model of hippocampal CA3 and CA1 neural firing is computed that predicts activation patterns of CA1 neurons during the encoding (sample) phase of a delayed match-to-sample (DMS) human short-term memory task. Main results. MIMO model-derived electrical stimulation delivered to the same CA1 locations during the sample phase of DMS trials facilitated short-term/working memory by 37% during the task. Longer term memory retention was also tested in the same human subjects with a delayed recognition (DR) task that utilized images from the DMS task, along with images that were not from the task. Across the subjects, the stimulated trials exhibited significant improvement (35%) in both short-term and long-term retention of visual information. Significance. These results demonstrate the facilitation of memory encoding which is an important feature for the construction of an implantable neural prosthetic to improve human memory.
Energy Technology Data Exchange (ETDEWEB)
Straniero, O.; Cristallo, S. [INAF-Osservatorio Astronomico di Collurania, Teramo (Italy); Imbriani, G.; DiLeva, A.; Limata, B. [INFN Sezione di Napoli, Napoli (Italy); Strieder, F. [Institut fuer Experimentalphysik, Ruhr-Universitaet Bochum, Bochum (Germany); Bemmerer, D. [Helmholtz-Zentrum Dresden-Rossendorf, Bautzner Landstr. 400 (Germany); Broggini, C.; Caciolli, A. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Padova, via Marzolo 8, I-35131 Padova (Italy); Corvisiero, P.; Costantini, H.; Lemut, A. [Universita di Genova and INFN Sezione di Genova, Genova (Italy); Formicola, A.; Gustavino, C.; Junker, M. [INFN, Laboratori Nazionali del Gran Sasso (LNGS), Assergi (AQ) (Italy); Elekes, Z.; Fueloep, Zs.; Gyuerky, Gy. [Institute of Nuclear Research (ATOMKI), Debrecen (Hungary); Gervino, G. [Dipartimento di Fisica Universita di Torino and INFN Sezione di Torino, Torino (Italy); Guglielmetti, A., E-mail: straniero@oa-teramo.inaf.it [Universita degli Studi di Milano and INFN, Sezione di Milano (Italy); and others
2013-02-15
Proton captures on Mg isotopes play an important role in the Mg-Al cycle active in stellar H-burning regions. In particular, low-energy nuclear resonances in the {sup 25}Mg(p, {gamma}){sup 26}Al reaction affect the production of radioactive {sup 26}Al{sup gs} as well as the resulting Mg/Al abundance ratio. Reliable estimations of these quantities require precise measurements of the strengths of low-energy resonances. Based on a new experimental study performed at the Laboratory for Underground Nuclear Astrophysics, we provide revised rates of the {sup 25}Mg(p, {gamma}){sup 26}Al{sup gs} and the {sup 25}Mg(p, {gamma}){sup 26}Al {sup m} reactions with corresponding uncertainties. In the temperature range 50-150 MK, the new recommended rate of {sup 26}Al {sup m} production is up to five times higher than previously assumed. In addition, at T = 100 MK, the revised total reaction rate is a factor of two higher. Note that this is the range of temperature at which the Mg-Al cycle operates in a H-burning zone. The effects of this revision are discussed. Due to the significantly larger {sup 25}Mg(p, {gamma}){sup 26}Al {sup m} rate, the estimated production of {sup 26}Al{sup gs} in H-burning regions is less efficient than previously obtained. As a result, the new rates should imply a smaller contribution from Wolf-Rayet stars to the galactic {sup 26}Al budget. Similarly, we show that the asymptotic giant branch (AGB) extra-mixing scenario does not appear able to explain the most extreme values of {sup 26}Al/{sup 27}Al, i.e., >10{sup -2}, found in some O-rich presolar grains. Finally, the substantial increase of the total reaction rate makes the hypothesis of self-pollution by massive AGBs a more robust explanation for the Mg-Al anticorrelation observed in globular-cluster stars.
Search for a pentaquark decaying to pK>0sup>S in γN
Energy Technology Data Exchange (ETDEWEB)
Link, J. M.; Yager, P. M.; Anjos, J. C.; Bediaga, I.; Castromonte, C.; Machado, A. A.; Magnin, J.; Massafferri, A.; de Miranda, J. M.; Pepe, I. M.; Polycarpo, E.; dos Reis, A. C.; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sánchez-Hernández, A.; Uribe, C.; Vázquez, F.; Agostino, L.; Cinquini, L.; Cumalat, J. P.; Frisullo, V.; O' Reilly, B.; Segoni, I.; Stenson, K.; Butler, J. N.; Cheung, H. W. K.; Chiodini, G.; Gaines, I.; Garbincius, P. H.; Garren, L. A.; Gottschalk, E.; Kasper, P. H.; Kreymer, A. E.; Kutschke, R.; Wang, M.; Benussi, L.; Bertani, M.; Bianco, S.; Fabbri, F. L.; Pacetti, S.; Zallo, A.; Reyes, M.; Cawlfield, C.; Kim, D. Y.; Rahimi, A.; Wiss, J.; Gardner, R.; Kryemadhi, A.; Chung, Y. S.; Kang, J. S.; Ko, B. R.; Kwak, J. W.; Lee, K. B.; Cho, K.; Park, H.; Alimonti, G.; Barberis, S.; Boschini, M.; Cerutti, A.; D' Angelo, P.; DiCorato, M.; Dini, P.; Edera, L.; Erba, S.; Inzani, P.; Leveraro, F.; Malvezzi, S.; Menasce, D.; Mezzadri, M.; Moroni, L.; Pedrini, D.; Pontoglio, C.; Prelz, F.; Rovere, M.; Sala, S.; Davenport, T. F.; Arena, V.; Boca, G.; Bonomi, G.; Gianini, G.; Liguori, G.; Lopes Pegna, D.; Merlo, M. M.; Pantea, D.; Ratti, S. P.; Riccardi, C.; Vitulo, P.; Göbel, C.; Olatora, J.; Hernandez, H.; Lopez, A. M.; Mendez, H.; Paris, A.; Quinones, J.; Ramirez, J. E.; Zhang, Y.; Wilson, J. R.; Handler, T.; Mitchell, R.; Engh, D.; Givens, K. M.; Hosack, M.; Johns, W. E.; Luiggi, E.; Nehring, M.; Sheldon, P. D.; Vaandering, E. W.; Webster, M.; Sheaff, M.
2006-08-01
We present a search for a pentaquark decaying strongly to pK>0sup>S in γN collisions at a center-of-mass energy up to 25 GeV/c<sup>2sup>. Finding no evidence for such a state in the mass range of 1470 MeV/c<sup>2sup> to 2200 MeV/c<sup>2sup>, we set limits on the yield and on the cross section times branching ratio relative to Σ<sup>*> (1385)<sup>±> and K<sup>*> (892) <sup>+>.
Ghosh, Reetuparna; Badwar, Sylvia; Lawriniang, Bioletty; Jyrwa, Betylda; Naik, Haldhara; Naik, Yeshwant; Suryanarayana, Saraswatula Venkata; Ganesan, Srinivasan
2017-08-01
The 58Fe (p , n)58Co reaction cross-section within Giant Dipole Resonance (GDR) region i.e. from 3.38 to 19.63 MeV was measured by stacked-foil activation and off-line γ-ray spectrometric technique using the BARC-TIFR Pelletron facility at Mumbai. The present data were compared with the existing literature data and found to be in good agreement. The 58Fe (p , n)58Co reaction cross-section as a function of proton energy was also theoretically calculated by using the computer code TALYS-1.8 and found to be in good agreement, which shows the validity of the TALYS-1.8 program.
Energy Technology Data Exchange (ETDEWEB)
Blank, B.; Czajkowski, S.; Davi, F.; Del Moral, R.; Fleury, A.; Marchand, C.; Pravikoff, M.S. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Dufour, J.P. [URA 451, Gradignan (France); Benlliure, J.; Boue, F.; Collatz, R.; Heinz, A.; Hellstroem, M.; Hu, Z.; Roeckl, E.; Shibata, M.; Suemmerer, K. [Gesellschaft fuer Schwerionenforschung mbH, Darmstadt (Germany); Janas, Z.; Karny, M.; Pfuetzner, M. [Institute of Experimental Physics, University of Warsaw, PL-00 681 Warszawa (Poland); Lewitowicz, M. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France)
1997-06-01
The two-proton radioactivity from the ground states was predicted by V.I. Goldanskii; it can take place either by {sup 2}He emission or by the simultaneous emission of two spatially non-correlated protons. For the nuclei liable to this type of radioactivity the single proton emission is energetically forbidden. The two-proton decay was observed for {sup 6}Be{sup 2} and {sup 12}O{sup 3} but the Q-value of the reaction is high above the Coulomb barrier and as such does not permit a decay process of a sufficient long lifetime. Theoretical calculations by B.A. Brawn predict {sup 39}Ti, {sup 45}Fe and {sup 48}Ni as the best candidates with the 2p emission lifetime within 1{mu}s to 150 ms. Only {sup 39}Ti decay has been observed so far. As candidate for 2p radioactivity nuclei we studied {sup 38}Ti, {sup 42}Cr, {sup 45}Fe and {sup 48`49}Ni. A primary beam of {sup 58}Ni at 600 MeV/nucleon from the SIS synchrotron at GSI was used to produce proton-rich isotopes in the titanium-to-nickel region by projectile fragmentation on a beryllium target. The fragment were separated by the projectile-fragment separator FRS and unambiguously identified by means of its standard detection set-up using a ToF-{Delta}E-B{rho} analysis. We report here the first observation of the T{sub Z} = - 7/2 nuclei {sup 45}Fe and {sup 49}Ni, the most proton-rich nuclei ever synthesized with an excess and seven protons. In addition, the new isotope {sup 42}Cr (T{sub Z} -3) was also identified. These isotopes are, according to commonly used mass predictions, all unbound with respect to two-proton emission from their ground states. However, we did not observe any count corresponding to {sup 38}Ti (T{sub Z} -3) although we expected about 5 counts in a setting optimized for this isotope 6 refs.
International Nuclear Information System (INIS)
Chi, Yayun; Hong, Yi; Zong, Hongliang; Wang, Yanlin; Zou, Weiying; Yang, Junwu; Kong, Xiangfei; Yun, Xiaojing; Gu, Jianxin
2009-01-01
Vitamin D receptor (VDR) is a member of the nuclear receptor superfamily and regulates transcription of target genes. In this study, we identified CDK11 p58 as a novel protein involved in the regulation of VDR. CDK11 p58 , a member of the large family of p34cdc2-related kinases, is associated with cell cycle progression, tumorigenesis, and apoptotic signaling. Our study demonstrated that CDK11 p58 interacted with VDR and repressed VDR-dependent transcriptional activation. Furthermore, overexpression of CDK11 p58 decreased the stability of VDR through promoting its ubiquitin-proteasome-mediated degradation. Taken together, these results suggest that CDK11 p58 is involved in the negative regulation of VDR.
Energy Technology Data Exchange (ETDEWEB)
Schiavilla, R.
1991-12-31
The cross sections of the radiative {sup 3}He(n,{gamma}){sup 4}He and weak {sup 3}He(p,e{sup +}{nu}{sub e}){sup 4}He capture reactions at thermal neutron and keV proton energies have been calculated with the Variational Monte Carlo method. The ground state and low-energy continuum wave functions have been determined variationally from a realistic Hamiltonian, and include both nucleon and {Delta}-isobar degrees of freedom. The electroweak transition operator contains one- and two-body components in the N + {Delta} Hilbert space.
Energy Technology Data Exchange (ETDEWEB)
Schiavilla, R.
1991-01-01
The cross sections of the radiative {sup 3}He(n,{gamma}){sup 4}He and weak {sup 3}He(p,e{sup +}{nu}{sub e}){sup 4}He capture reactions at thermal neutron and keV proton energies have been calculated with the Variational Monte Carlo method. The ground state and low-energy continuum wave functions have been determined variationally from a realistic Hamiltonian, and include both nucleon and {Delta}-isobar degrees of freedom. The electroweak transition operator contains one- and two-body components in the N + {Delta} Hilbert space.
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Energy Technology Data Exchange (ETDEWEB)
Ikegami, H.; Yamazaki, T.; Morinobu, S.; Katayama, I.; Fujiwara, M. [Osaka Univ., Suita (Japan). Research Center for Nuclear Physics; Ikegami, Hidetsugu; Muraoka, Mitsuo [eds.; Osaka Univ., Suita (Japan). Research Center for Nuclear Physics
1980-01-01
Proton inelastic scattering experiment on Pb-208 was carried out by using 65 MeV protons from a 230 cm AVF cyclotron, to study the 1/sup +/ states in Pb-208. The momentum of outgoing protons was analyzed by the magnetic spectrograph RAIDEN. The 7.06 MeV state was very weakly excited. In order to identify 1/sup +/ states from the angular distributions of the inelastic scattering, the proton spectra scattered from the well known 1/sup +/ state in Pb-206 were measured. because of masking by a strong neighbouring peak, the differential cross section of the 1/sup +/ state was measured only at two points. The comparison between the experiment and distorted wave calculation for the 1/sup +/ state (1.703 MeV) in Pb-206 was made, and the results implied that the 1/sup +/ states in Pb-208 would also be weakly excited even if these states are good particle-hole states, Next, Bi-209 (d, He-3) reaction experiment was performed. The comparison between the preliminary results and the calculated results based on the shell model is shown in a figure. The overall agreement between the experimental and theoretical results seems to be good. However, the existence of the 1/sup +/ state has not been confirmed, and will be confirmed in the next step to be done.
Energy Technology Data Exchange (ETDEWEB)
Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)
2013-01-01
In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of
The continuing saga of the /sup 1/P/sub 1/ (q-barq) mesonic states
International Nuclear Information System (INIS)
Dalitz, R.H.; Tuan, S.F.
1986-01-01
The mesonic states predicted by the quark model to have the structure (q-barq) do not allow all combinations possible for the quantum numbers (JPC). The happy situation for the /sup 3/P/sub J/ states does not hold for the /sup 1/P/sub 1/ state. The experimenter is therefore faced by a double difficulty, the difficulty of forming the /sup 1/P/sub 1/ through the channels available to him and the difficulty of detecting the /sup 1/P/sub 1/ state when it is formed. The difficulty about the detection and study of /sup 1/P/sub 1/ states is not intrinsic but circumstantial. It is not intrinsic because the B-meson is readily produced and studied, the same being true for Q/sub B/, although this has been a more confused situation because of the mixing between the Q/sub A/ and Q/sub B/ states. Porter has devoted considerable attention to the search for the /sup 1/P/sub 1/ (c-barc) state and the authors outline that discussion in this paper. They also describe the formation of the state Psi' (3685), since this has a large cross section in e/sup +/e/sup -/ annihilation, and to look for the /sup 1/P/sub 1/ state as a product among its decay modes
Radiative capture reaction {sup 7}Be(p,{gamma}){sup 8}B in the continuum shell model
Energy Technology Data Exchange (ETDEWEB)
Bennaceur, K; Ploszajczak, M [Grand Accelerateur National d` Ions Lourds (GANIL), Caen (France); Nowacki, F [Grand Accelerateur National d` Ions Lourds (GANIL), Caen (France); [Lab. de Physique Theorique Strasbourg, Strasbourg (France); Okolowicz, J [Grand Accelerateur National d` Ions Lourds (GANIL), Caen (France); [Inst. of Nuclear Physics, Krakow (Poland)
1998-06-01
We present here the first application of realistic shell model (SM) including coupling between many-particle (quasi-)bound states and the continuum of one-particle scattering states to the calculation of the total capture cross section and the astrophysical factor in the reaction {sup 7}Be(p,{gamma}){sup 8}B. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Pichat, L; Carbonnier, P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1959-07-01
Description of the synthesis of the amino acids given in the title, labelled with {sup 14}C in the beta position. Benzoic, fluorobenzoic and thenoic acids carboxyl {sup 14}C prepared from {sup 14}CO{sub 2} from converted respectively to benzyl chloride, p-fluorobenzyl chloride and 2-chloromethyl thiophene, which were condensed in dimethyl-formamide solution with sodium ethyl acetamido malonate. After hydrobromic hydrolysis the desired products were obtained with respective overall yields of 64, 49 and 57 per cent. (author) [French] Description de la synthese des acides amines du titre, marques au {sup 14}C en position beta. Les acides benzoique, fluorobenzoique, thenoique carboxyl {sup 19}C prepares a partir de {sup 14}CO{sub 2} ont ete transformes respectivement en chlorure de benzyle, chlorure de p-fluorobenzyle, chloromethyl-2 thiophene lesquels ont ete condenses dans le dimethyl-formamide sur l'acetamidomalonate d'ethyle sode. Apres hydrolyse bromhydrique, on a obtenu les produits cherches avec les rendements globaux respectifs de 64, 39 et 57 pour cent. (auteur)
A Search for Higher Twist Effects in the Neutron Spin Structure Function g<sup>n>2(x,Q<sup>2sup>)
Energy Technology Data Exchange (ETDEWEB)
Kramer, Kevin [College of William and Mary, Williamsburg, VA (United States)
2003-08-01
Jefferson Lab experiment E97-103 measured the spin structure function g<sup>n>2(x,Q<sup>2sup>) from a Q<sup>2sup> of 0.58 to 1.36 with a nearly constant x of 0.2. Combining this data with a fit to the world g<sup>n>1 data, the size of higher twist contributions to the spin structure functions can be extracted using the Wandzura-Wilczek relation. These higher twist contributions result from quark-gluon correlations and are expected to be larger as Q<sup>2sup> decreases. This experiment was performed in Hall A with a longitudinally polarized electron beam and a high density polarized <sup>3sup>He target. The physics motivation and an overview of the experiment will be presented.
E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China.
Directory of Open Access Journals (Sweden)
Zuyi Chen
Full Text Available Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV. The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216 and HPV-58 (E6, E7: n = 405 E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0. The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8 software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N were observed in both HPV-33 and HPV-58 E6.
Energy Technology Data Exchange (ETDEWEB)
Zdrazil, Marian [Stony Brook Univ., NY (United States)
2004-08-01
This work presents a search for the pair production of doubly-charged Higgs Bosons in the process p$\\bar{p}$ → H<sup>++H--> → μ<sup>+μ+μ-μ-> using inclusive dimuon events. These data correspond to an integrated luminosity of about 113 pb 1 and were recorded by the D0 experiment between August 2002 and June 2003. In the absence of a signal, 95% confidence level mass limits of M(H$±±\\atop{L}$) > 118.6 GeV/c<sup>2sup> and M(HR<sup>±±>) > 98.1 GeV/c<sup>2sup> are set for left-handed and right-handed doubly-charged Higgs boson, assuming 100% branching into muons and hypercharge |Y| = 2 and Yukawa coupling h μμ > 10<sup>-7sup>. This is the first search for doubly-charged Higgs bosons at hadron colliders. It significantly extends the previous mass limit of 100.5 GeV/c<sup>2sup> for a left-handed doubly-charged Higgs boson measured in the muon final states by the OPAL collaboration.
Energy Technology Data Exchange (ETDEWEB)
Mahon, Jose Roberto Pinheiro
1993-12-31
We have measured the branching ratio of the radiative decay of the hyperon {Sigma}{sup -}. This experiment (E761) was performed with a 375 GeV/c charged hyperon beam in the Proton Center at Fermi National Accelerator Laboratory in Batavia, Illinois. We found a value for the branching ratio BR({Sigma}{sup -} -> p{gamma}) = (1,079 {+-} 0,230) x 10{sup -3} where the first error is statistical and the second is systematic. This result is based on a sample of 213 {+-} 19 events. We have also measured the {delta} parameter for a test of CP violation in hyperon decays. This result is consistent with CP invariance. (author) 79 refs., 42 figs., 13 tabs.
Energy Technology Data Exchange (ETDEWEB)
D’Argent, P. [Physikalisches Institut, Ruprecht-Karls-Universität Heidelberg,Heidelberg (Germany); Skidmore, N.; Benton, J.; Dalseno, J. [H.H. Wills Physics Laboratory, University of Bristol,Bristol (United Kingdom); Gersabeck, E. [Physikalisches Institut, Ruprecht-Karls-Universität Heidelberg,Heidelberg (Germany); Harnew, S.T.; Naik, P.; Prouve, C.; Rademacker, J. [H.H. Wills Physics Laboratory, University of Bristol,Bristol (United Kingdom)
2017-05-29
The resonant substructure of D{sup 0}→π{sup +}π{sup −}π{sup +}π{sup −} decays is studied using data collected by the CLEO-c detector. An amplitude analysis is performed in order to disentangle the various intermediate state contributions. To limit the model complexity a data driven regularization procedure is applied. The prominent contributions are the decay modes D{sup 0}→a{sub 1}(1260){sup +} π{sup −}, D{sup 0}→σ f{sub 0}(1370) and D{sup 0}→ρ(770){sup 0} ρ(770){sup 0}. The broad resonances a{sub 1}(1260){sup +}, π(1300){sup +} and a{sub 1}(1640){sup +} are studied in detail, including quasi-model-independent parametrizations of their lineshapes. The mass and width of the a{sub 1}(1260){sup +} meson are determined to be m{sub a{sub 1(1260){sup +}}}=[1225±9 (stat)±17 (syst)±10 (model)] MeV/c{sup 2} and Γ{sub a{sub 1(1260){sup +}}}=[430±24 (stat)±25 (syst)±18 (model)] MeV. The amplitude model of D{sup 0}→K{sup +}K{sup −}π{sup +}π{sup −} decays obtained from CLEO II.V, CLEO III, and CLEO-c data is revisited with improved lineshape parametrizations. The largest components are the decay modes D{sup 0}→ϕ(1020)ρ(770){sup 0}, D{sup 0}→K{sub 1}(1270){sup +}K{sup −} and D{sup 0}→K(1400){sup +}K{sup −}. The fractional C P-even content of the decay D{sup 0}→π{sup +}π{sup −}π{sup +}π{sup −} is calculated from the amplitude model to be F{sub +}{sup 4π}=[72.9±0.9 (stat)±1.5 (syst)±1.0 (model)] %, consistent with that obtained from a previous model-independent measurement. For D{sup 0}→K{sup +}K{sup −}π{sup +}π{sup −} decays, the C P-even fraction is measured for the first time and found to be F{sub +}{sup KKππ}=[75.3±1.8 (stat)±3.3 (syst)±3.5 (model)] %. The global decay rate asymmetries between D{sup 0} and D̄{sup 0} decays are measured to be A{sub CP}{sup 4π}=[+0.54±1.04 (stat)±0.51 (syst)]% and A{sub CP}{sup KKππ}=[+1.84±1.74 (stat)±0.30 (syst)]%. A search for C P asymmetries
Cerrada, M; Chaloupka, V; Foster, B; Heinen, P M; Hemingway, R J; Holmgren, S O; Kittel, E W; Losty, Michael J; Massaro, G G G; Metzger, W J; Vergeest, J S M; Wagner, F; Wells, J; Wolters, G F
1977-01-01
A partial-wave analysis of the (3 pi )/sup 0/ system produced peripherally in the reaction K/sup -/p to pi /sup +/ pi /sup -/ pi /sup 0/ Lambda at 4.2 GeV/c is presented. The observation of the weak Lambda decay allows a determination of all the transverse production amplitudes except for two phases. The production of known resonances having decay modes other than 3 pi is used to test the isobar model ansatz. Significant omega (783), phi (1020) and A/sub 2/(1310) production is observed. The spin parity of the omega *(1675) is established as 3/sup -/. No evidence for production of other resonances, such as axial vector-mesons, is found. (23 refs).
Energy Technology Data Exchange (ETDEWEB)
Owrangi, Amir M., E-mail: aowrangi@robats.ca [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, London, Canada N6A 5K8 (Canada); Graduate Program in Biomedical Engineering, The University of Western Ontario, London (Canada); Wang, Jian X., E-mail: jxwang@robats.ca [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, London, Canada N6A 5K8 (Canada); Applied Science Laboratories, General Electric Healthcare (Canada); Wheatley, Andrew, E-mail: awheat@imaging.robarts.ca [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, London, Canada N6A 5K8 (Canada); McCormack, David G., E-mail: David.Mccormack@lhsc.on.ca [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, London, Canada N6A 5K8 (Canada); Division of Respirology, Department of Medicine, The University of Western Ontario, London (Canada); Parraga, Grace, E-mail: gparraga@robats.ca [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, London, Canada N6A 5K8 (Canada); Graduate Program in Biomedical Engineering, The University of Western Ontario, London (Canada); Department of Medical Imaging, The University of Western Ontario, London (Canada); Department of Medical Biophysics, The University of Western Ontario, London (Canada)
2014-01-15
Objective: The aim of this study was to quantitatively evaluate the relationship between short echo time pulmonary {sup 1}H magnetic resonance imaging (MRI) signal intensity (SI) and {sup 3}He MRI apparent diffusion coefficients (ADC), high-resolution computed tomography (CT) measurements of emphysema, and pulmonary function measurements. Materials and methods: Nine healthy never-smokers and 11 COPD subjects underwent same-day plethysmography, spirometry, short echo time ((TE) = 1.2 ms) {sup 1}H and diffusion-weighted hyperpolarized {sup 3}He MRI (b = 1.6 s/cm{sup 2}) at 3.0 T. In addition, for COPD subjects only, CT densitometry was also performed. Results: Mean {sup 1}H SI was significantly greater for never-smokers (12.1 ± 1.1 arbitrary units (AU)) compared to COPD subjects (10.9 ± 1.3 AU, p = 0.04). The {sup 1}H SI AP-gradient was also significantly greater for never-smokers (0.40 AU/cm, R{sup 2} = 0.94) compared to COPD subjects (0.29 AU/cm, R{sup 2} = 0.968, p = 0.05). There was a significant correlation between {sup 1}H SI and {sup 3}He ADC (r = −0.58, p = 0.008) and significant correlations between {sup 1}H MR SI and CT measurements of emphysema (RA{sub 950}, r = −0.69, p = 0.02 and HU{sub 15}, r = 0.66, p = 0.03). Conclusions: The significant and moderately strong relationship between {sup 1}H SI and {sup 3}He ADC, as well as between {sup 1}H SI and CT measurements of emphysema suggests that these imaging methods and measurements may be quantifying similar tissue changes in COPD and that pulmonary {sup 1}H SI may be used to monitor emphysema as a complement to CT and noble gas MRI.
Energy Technology Data Exchange (ETDEWEB)
Nakagawara, Jyoji; Fukuoka, Seiji; Takahashi, Shuhei; Takahashi, Masaaki; Satoh, Katsuyasu; Suematsu, Katsumi; Nakamura, Jun-ichi (Nakamura Memorial Hospital, Sapporo (Japan))
1994-02-01
Single photon emission computed tomography (SPECT) using technetium-99m-DTPA-human serum albumin ([sup 99m]Tc-HSA-D) and thallium-201 chloride ([sup 201]Tl) was simultaneously performed on 25 patients with brain tumors; 10 with brain metastasis, 8 with astrocytoma (Gr. 3) and 7 with meningioma. The early image was obtained 10 minutes after [sup 99m]Tc-HSA-D (740 MBq) injection, and the delayed image was taken 5 hours after the injection. HSA-D index, based on the ratio of [sup 99m]Tc-HSA-D uptake in the tumor versus the cortical area, was calculated on each image, and compared with Tl index (tumor/contralateral cerebrum ratio). HSA-D delayed index was significantly greater than HSA-D early index in all tumor types (p<0.05 by the Wilcoxon ranked sign test). Linear correlation between HSA-D early index and HSA-D delayed index was significant in astrocytoma (GR. 3) (p<0.01) and meningioma (p<0.001), and a linear correlation between HSA-D delayed index and Tl index was significant in astrocytoma (Gr. 3) (p<0.05). It is concluded that HSA-D early index and delayed index could reflect tumor vascularity and permeability, respectively, and provide supplementary information for Tl index. (author).
The reaction {sup 48}Ca+{sup 238}U {yields}{sup 286}112{sup *} studied at the GSI-SHIP
Energy Technology Data Exchange (ETDEWEB)
Hofmann, S. [Gesellschaft fuer Schwerionenforschung (GSI), D-64291 Darmstadt (Germany); Institut fuer Kernphysik, Johann Wolfgang Goethe-Universitaet, Frankfurt (Germany); Ackermann, D.; Burkhard, H.G.; Heinz, S.; Hessberger, F.P.; Khuyagbaatar, J.; Kindler, B.; Kojouharov, I.; Lommel, B.; Mann, R.; Muenzenberg, G.; Schoett, H.J.; Sulignano, B. [Gesellschaft fuer Schwerionenforschung (GSI), Darmstadt (Germany); Antalic, S.; Saro, S.; Streicher, B.; Venhart, M. [Comenius University, Department of Nuclear Physics and Biophysics, Bratislava (Slovakia); Comas, V.F.; Heredia, J.A. [InSTEC, Habana (Cuba); Dressler, R. [Paul Scherrer Institute, Villigen (Switzerland); Gan, Z. [Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); Kuusiniemi, P. [University of Oulu, CUPP (Finland); Leino, M.; Uusitalo, J. [University of Jyvaeskylae, Department of Physics, Jyvaeskylae (Finland); Nishio, K. [Japan Atomic Energy Agency, Tokai, Ibaraki (Japan); Popeko, A.G.; Yeremin, A.V. [JINR, Flerov Laboratory of Nuclear Reactions, Dubna (Russian Federation)
2007-06-15
The fusion reaction of {sup 48}Ca projectiles with {sup 238}U target nuclei was studied at the velocity filter SHIP of GSI in Darmstadt. Two decay chains were measured, which fully confirm data that were previously assigned to the isotope {sup 283}112 in experiments at the Flerov Laboratory in Dubna. Two other events are consistent with a 50% spontaneous-fission (SF) branch of this isotope. The mean value obtained for the half-life of {sup 283}112 is (6.9{sup +6.9}{sub -2.3}) s, the {alpha} energy is (9.520{+-}0.015) MeV, and the total kinetic energy (TKE) of SF is (238{+-}14) MeV. The half-life of the {alpha} decay daughter nucleus {sup 279}Ds is (0.18{sup +0.32}{sub -0.07}) s, and the TKE of SF is (210 {sup +32}{sub -11}) MeV. The cross-section deduced from all four events is (0.72{sup +0.58}{sub -0.35}) pb, measured at an excitation energy of 34.6MeV of the compound nucleus {sup 286}112. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Petersen, D. F. [Los Alamos Scientific Laboratory, University of California, Los Alamos, NM (United States)
1965-06-15
Unique chemical composition, fixed anatomical location, and ready availability combine to make human hair a useful material for rapid estimation of fast neutron doses sustained by personnel involved in accidental nuclear critical excursions. The sulphur content of human hair is remarkably constant regardless of sex, colour, or distribution; values of 0.048 {+-}0.005 g sulphur per gram of hair indicate that 5% can be used as a standard figure for the abundance of sulphur in preliminary dose estimates without resorting to individual sulphur analyses. In the absence of easily removable external contamination, hair contains less than 0.025% phosphorus; since the activation cross-sections of phosphorus and sulphur are similar, the virtual absence of phosphorus permits the use of hair as a biological sulphur threshold detector for measuring the flux of neutrons with energies in excess of 2.5 MeV by the S{sup 32}(n, p)P{sup 32} reaction. Techniques for rapid isolation of radiochemically pure P{sup 32} have been developed with a view toward providing clinically useful estimates of the fast neutron exposure of criticality accident victims. In the absence of gross fission product contamination, preliminary estimates can be made within two hours; the more extensive procedure for eliminating fission products requires approximately six hours for a preliminary estimate. Experiments employing the well-defined fission spectrum of an unshielded critical assembly have consistently provided estimates of neutron dose within {+-}10% of referee dosimetry. Moreover, the fixed anatomical location of hair samples makes it possible to deduce orientation and asymmetry of exposure from a comparison of the relative specific activities of samples from different regioris of the body. Experience with three nuclear critical excursions resulting in fatalities has demonstrated that in each case exposures were markedly asymmetrical. Thus, P{sup 32} measurements on hair provide valuable complementary
Theoretical study for ICRF sustained LHD type p-{sup 11}B reactor
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Tsuguhiro (ed.)
2003-04-01
This is a summary of the workshop on 'Theoretical Study for ICRF Sustained LHD Type p-{sup 11}B Reactor' held in National Institute for Fusion Science (NIFS) on July 25, 2002. In the workshop, study of LHD type D-{sup 3}He reactor is also reported. A review concerning the advanced nuclear fusion fuels is also attached. This review was reported at the workshop of last year. The development of the p-{sup 11}B reactor research which uses the LHD magnetic field configuration has been briefly summarized in section 1. In section 2, an integrated report on advanced nuclear fusion fuels is given. Ignition conditions in a D-{sup 3}He helical reactor are summarized in section 3. 0-dimensional particle and power balance equations are solved numerically assuming the ISS95 confinement law including a confinement factor ({gamma}{sub HH}). It is shown that high average beta plasma confinement, a large confinement factor ({gamma}{sub HH} > 3) and the hot ion mode (T{sub i}/T{sub e} > 1.4) are necessary to achieve the ignition of the D-{sup 3}He helical reactor. Characteristics of ICRF sustained p-{sup 11}B reactor are analyzed in section 4. The nuclear fusion reaction rate < {sigma}{upsilon} > is derived assuming a quasilinear plateau distribution function (QPDF) for protons, and an ignition condition of p-{sup 11}B reactor is shown to be possible. The 3 of the presented papers are indexed individually. (J.P.N.)
Reaction /sup 56/Fe (. gamma. ,. cap alpha. /sub 0/) and /sup 56/Fe (. gamma. , p/sub 0/)
Energy Technology Data Exchange (ETDEWEB)
Tamae, T; Sugawara, M [Tohoku Univ., Sendai (Japan). Lab. of Nuclear Science; Tsubota, H
1975-06-01
Precise analysis was made on the cross section of the /sup 56/Fe (..gamma.., ..cap alpha../sub 0/) reaction and the angular distribution at Esub(e) = 17 MeV, including the systematic error. The (..gamma.., ..cap alpha../sub 0/) reaction cross section was compared with a calculation using the compound nucleus model, utilizing the photon absorption cross section derived from the experimental values of /sup 56/Fe (..gamma.., n) and /sup 56/Fe (..gamma.., p) cross sections. From the (..gamma.., ..cap alpha../sub 0/) reaction cross section data of various nuclei, an empirical formula was obtained for determining the position of a peak in the (..gamma.., ..cap alpha../sub 0/) reaction cross section. The /sup 56/Fe (..gamma.., p/sub 0/) reaction cross section measured at an excitation energy in the range of 14.6--25.0 MeV was compared with the calculated one with the compound nucleus model, but the form and size differ totally.
Total (p,n), (p,γ), (p,p'γ) and differential (p,p) cross-sections measurements for /sup 61,64/Ni
International Nuclear Information System (INIS)
Hershberger, R.L.; Gabbard, F.; Laird, C.E.
1985-01-01
Absolute total (p,n) and differential elastic (p,p) cross sections have been measured for /sup 61,64/Ni in the energy range of E/sub p/ = 2 to 7 MeV. The (p,γ) and (p,p'γ) cross sections were measured from as low an energy as feasible to approximately one MeV above the (p,n) threshold. Standard optical potentials have been used with a Hauser-Feshbach model to analyze the data. The adopted model values are used to deduce a total proton strength function which displays features of the 3s single particle resonance
Natural levels of {sup 210}Po in human urine
Energy Technology Data Exchange (ETDEWEB)
Diaz-Frances, I.; Manjon, G.; Mantero, J.; Diaz, J. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); Garcia-Tenorio, R. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); National Accelerator Centre, P.O. Box 41092 Seville (Spain)
2014-07-01
Since the secret agent Alexander Litvinenko was murdered in 2006 by a {sup 210}Po lethal dose, presumably ingested, there is renovated interest on the toxicity of this radionuclide in humans. {sup 210}Po is a radioactive isotope naturally found in nature, mainly incorporated by humans via food and water ingestion, as well as inhaled through its progenitor, the {sup 222}Rn. The total amount of natural {sup 210}Po in the human body can vary from person to person depending on their lifestyle: dietary habits, drinking water source, place of residence (associated with exposure to {sup 222}Rn), etc- and therefore in the concentrations of this element to be found in urine. To analyze the influence of dietary habits on the amount of {sup 210}Po excreted in urine, two volunteers in Seville had a well-defined and time-varying diet for a month, following a daily collection of their urine and determination of the concentrations therein of this radionuclide. The results obtained and the conclusions derived from them form the core of this communication. {sup 210}Po determinations were performed daily in 200 ml aliquots of urine using the technique of high resolution alpha spectrometry. This has involved the application of a single radiochemical method for the concentration and isolation {sup 210}Po, followed by its auto-deposition on copper planchets for proper measure. Daily {sup 210}Po activity concentrations in voluntary urine analyzed during the month of study show high variability with a difference of up to an order of magnitude between maximum and minimum values obtained, and a clear dependence on the diet type followed in the various stages of the experiment. The lowest concentrations obtained are associated with a diet rich in carbohydrates and proteins 'terrestrial' (pork, beef,...), while the highest concentrations were obtained in the final phase of the experiment when the diet was enriched with presence of marine products in fair correspondence with the
Nuclear reactions with <sup>11sup>C and <sup>14sup>O radioactive ion beams
Energy Technology Data Exchange (ETDEWEB)
Guo, Fanqing [Univ. of California, Berkeley, CA (United States)
2004-01-01
Radioactive ion beams (RIBs) have been shown to be a useful tool for studying proton-rich nuclides near and beyond the proton dripline and for evaluating nuclear models. To take full advantage of RIBs, Elastic Resonance Scattering in Inverse Kinematics with Thick Targets (ERSIKTT), has proven to be a reliable experimental tool for investigations of proton unbound nuclei. Following several years of effort, Berkeley Experiments with Accelerated Radioactive Species (BEARS), a RIBs capability, has been developed at the Lawrence Berkeley National Laboratory's 88-Inch Cyclotron. The current BEARS provides two RIBs: a <sup>11sup>C beam of up to 2x10<sup>8sup> pps intensity on target and an <sup>14sup>O beam of up to 3x10<sup>4sup> pps intensity. While the development of the <sup>11sup>C beam has been relatively easy, a number of challenges had to be overcome to obtain the <sup>14sup>O beam. The excellent <sup>11sup>C beam has been used to investigate several reactions. The first was the <sup>197sup>Au(>11sup>C,xn)>208-xnsup>At reaction, which was used to measure excitation functions for the 4n to 8n exit channels. The measured cross sections were generally predicted quite well using the fusion-evaporation code HIVAP. Possible errors in the branching ratios of ?? decays from At isotopes as well as the presence of incomplete fusion reactions probably contribute to specific overpredictions. <sup>15sup>F has been investigated by the p(>14sup>O,p)14O reaction with the ERSIKTT technology. Several <sup>14sup>O+p runs have been performed. Excellent energy calibration was obtained using resonances from the p(>14sup>N,p)>14sup>N reaction in inverse kinematics, and comparing the results to those obtained earlier with normal kinematics. The differences between <sup>14sup>N+p and <sup>14sup>O+p in the stopping power function have been evaluated for better energy calibration. After careful calibration, the energy levels of 15F
Energy Technology Data Exchange (ETDEWEB)
Schulday, I.
2004-10-01
The reaction {gamma}p{yields}K{sup +}{sigma}{sup -}{pi}{sup +} was measured in the photon energy range from threshold up to 2.65 GeV. The cross section is dominated by the production of the resonances {sigma}(1385), {lambda}(1405) and {lambda}(1520) which decay into {sigma}{sup -}{pi}{sup +}. Cross sections were obtained as a function of the photon energy and the K{sup +} production angle for the reaction and the resonance production. The cross section for {lambda}(1520) rises up to (0.230{+-}0.029) {mu}b in the photon energy range 1.80
Technical advances in neutron polarimetry and studies of the (p,n) reaction in /sup 13/C
Energy Technology Data Exchange (ETDEWEB)
Videla, N G
1985-01-01
The asymmetry in the /sup 4/He(p,n vector)/sup 4/He reaction has been measured at three different incident neutron energies: 19.40; 22.85 and 27.31 MeV, and 120/sup 0/ from forward direction. Values of the asymmetry have been used to calculate the polarization of fast neutrons produced in the /sup 13/C(p,n vector)/sup 13/N. The /sup 13/C(p,n vector)/sup 13/N reaction was studied as part of a program being undertaken at the University of Manitoba Cyclotron Laboratory to study (p,n) reactions linking isobaric analog states of mirror nuclei in the energy range of 22 to 50 MeV. The study involves a comparison of the proton analyzing power A(theta), in the reaction /sup 13/C(vector p,n)/sup 13/N to the neutron polarization in the inverse reaction /sup 13/C(p,n vector)/sup 13/N. The importance of the comparison between these two observables is based in Conzett's theorem for time reversed reactions, the theorem states that the proton analyzing power in the reaction /sup 13/C(vector p,n)/sup 13/N is equal to the neutron polarization in the reaction /sup 13/C(p,n vector)/sup 13/N provided the reaction proceeds between members of an isospin doublet and when charge symmetry and time reversal invariance hold exactly. However, isospin symmetry is broken by the Coulomb interaction. So comparison of these two observables should yield information of the breaking of isospin by the Coulomb force.
In vivo sodium ({sup 23}Na) imaging of the human kidneys at 7 T: Preliminary results
Energy Technology Data Exchange (ETDEWEB)
Haneder, Stefan [University Medical Center Mannheim, Heidelberg University, Institute of Clinical Radiology and Nuclear Medicine, Mannheim (Germany); Medical University of Vienna/Vienna General Hospital, Department of Biomedical Imaging and Image-guided Therapy, Department of Radiology, Vienna (Austria); Juras, Vladimir; Trattnig, Siegfried; Zbyn, Stefan [Medical University of Vienna/Vienna General Hospital, Department of Biomedical Imaging and Image-guided Therapy, Department of Radiology, Vienna (Austria); Michaely, Henrik J.; Schoenberg, Stefan O. [University Medical Center Mannheim, Heidelberg University, Institute of Clinical Radiology and Nuclear Medicine, Mannheim (Germany); Deligianni, Xeni; Bieri, Oliver [University of Basel Hospital, Department of Radiology, Division of Radiological Physics, Basel (Switzerland)
2014-02-15
To evaluate the feasibility of in vivo {sup 23}Na imaging of the corticomedullary {sup 23}Na gradient and to measure {sup 23}Na transverse relaxation times (T2*) in human kidneys. In this prospective, IRB-approved study, eight healthy volunteers (4 female, 4 male; mean age 29.4 ± 3.6 years) were examined on a 7-T whole-body MR system using a {sup 23}Na-only spine-array coil. For morphological {sup 23}Na-MRI, a 3D gradient echo (GRE) sequence with a variable echo time scheme (vTE) was used. T2* times were calculated using a multiecho 3D vTE-GRE approach. {sup 23}Na signal-to-noise ratios (SNR) were given on a pixel-by-pixel basis for a 20-mm section from the cortex in the direction of the medulla. T2* maps were calculated by fitting the {sup 23}Na signal decay monoexponentially on a pixel-by-pixel basis, using least squares fit. Mean corticomedullary {sup 23}Na-SNR increased from the cortex (32.2 ± 5.6) towards the medulla (85.7 ± 16.0). The SNR increase ranged interindividually from 57.2 % to 66.3 %. Mean {sup 23}Na-T2* relaxation times differed statistically significantly (P < 0.001) between the cortex (17.9 ± 0.8 ms) and medulla (20.6 ± 1.0 ms). The aim of this study was to evaluate the feasibility of in vivo {sup 23}Na MRI of the corticomedullary {sup 23}Na gradient and to measure the {sup 23}Na T2* relaxation times of human kidneys at 7 T. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Lamia, L.; Puglia, S.M.R.; Spitaleri, C.; Romano, S. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Del Santo, M. Gimenez; Carlin, N.; Munhoz, M. Gameiro [Departamento de Fisica Nuclear, Universitade de Sao Paulo, Sao Paulo (Brazil); Cherubini, S. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Kiss, G.G. [Laboratori Nazionali del Sud, Catania (Italy); Atomki, Debrecen (Hungary); Kroha, V. [Institute for Nuclear Physics, Prague (Czech Republic); Kubono, S. [CNS, University of Tokyo, Tokyo (Japan); La Cognata, M. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Centro Siciliano di Fisica Nucleare e Struttura della Materia, Catania (Italy); Li Chengbo [China Institute of Atomic Energy, Department of Physics, Beijing (China); Pizzone, R.G. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Wen Qungang [China Institute of Atomic Energy, Department of Physics, Beijing (China); Sergi, M.L. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Centro Siciliano di Fisica Nucleare e Struttura della Materia, Catania (Italy); Szanto de Toledo, A. [Departamento de Fisica Nuclear, Universitade de Sao Paulo, Sao Paulo (Brazil); Wakabayashi, Y. [CNS, University of Tokyo, Tokyo (Japan); Advanced Science Research Center - JAEA - Ibaraki (Japan); Yamaguchi, H. [CNS, University of Tokyo, Tokyo (Japan); Zhou Shuhua [China Institute of Atomic Energy, Department of Physics, Beijing (China)
2010-03-01
Nuclear (p,alpha) reactions destroying the so-called 'light-elements' lithium, beryllium and boron have been largely studied in the past mainly because their role in understanding some astrophysical phenomena, i.e. mixing-phenomena occurring in young F-G stars [A.M. Boesgaard et al., Astr. Phys. J, 991, 2005, 621]. Such mechanisms transport the surface material down to the region close to the nuclear destruction zone, where typical temperatures of the order of approx10{sup 6} K are reached. The corresponding Gamow energy E{sub 0}=1.22(Z{sub x}{sup 2}Z{sub X}{sup 2}T{sub 6}{sup 2}){sup 1/3} keV [C. Rolfs and W. Rodney, 'Cauldrons in the Cosmos', The Univ. of Chicago press, 1988] is about approx10 keV if one considers the 'boron-case' and replaces in the previous formula Z{sub x}=1, Z{sub X}=5 and T{sub 6}=5. Direct measurements of the two {sup 11}B(p,alpha{sub 0}){sup 8}Be and {sup 10}B(p,alpha){sup 7}Be reactions in correspondence of this energy region are difficult to perform mainly because the combined effects of Coulomb barrier penetrability and electron screening [H.J. Assenbaum, K. Langanke and C. Rolfs, Z. Phys., 327, 1987, 461]. The indirect method of the Trojan Horse (THM) [G. Baur et al., Phys. Lett. B, 178, 1986, 135; G. Calvi et al., Nucl. Phys. A, 621, 1997, 139; C. Spitaleri et al., Phys. Rev. C, 493, 1999, 206] allows one to extract the two-body reaction cross section of interest for astrophysics without the extrapolation-procedures. Due to the THM formalism, the extracted indirect data have to be normalized to the available direct ones at higher energies thus implying that the method is a complementary tool in solving some still open questions for both nuclear and astrophysical issues [S. Cherubini et al., Astr. Phys. J, 457, 1996, 855; C. Spitaleri et al., Phys. Rev. C, 63, 2001, 005801; C. Spitaleri et al., Phys. Rev. C, 63, 2004, 055806; A. Tumino et al., Phys. Rev. Lett., 98, 2007, 252502; M. La Cognata et al., Phys
The K/sup -/p charge exchange and elastic scattering reactions at 42 GeV/c
Marzano, F; Gavillet, P; Gay, J B; Grossmann, P; Heinen, P M; Hemingway, R J; Jongejans, B; Kluyver, J C; Maréchal, B; Schotanus, D J; Toet, D Z; Wells, J; Wolters, G F
1977-01-01
Results are presented on the reactions K/sup -/p to K/sup 0/n and K /sup -/p to K/sup -/p from a high statistics CERN 2-metre hydrogen bubble chamber exposure at 4.15 GeV/c. The behaviour of the differential cross section as a function of four-momentum transfer shows remarkable similarities between the two reactions studied. From a comparison of their data with K/sup +/p elastic scattering at 4.27 GeV/c the authors draw some conclusions concerning the magnitude of the contributing amplitudes. (10 refs).
Magnetic moments of J{sup P} = (3)/(2){sup +} decuplet baryons using the statistical model
Energy Technology Data Exchange (ETDEWEB)
Kaur, Amanpreet; Upadhyay, Alka [Thapar University, School of Physics and Materials Science, Patiala (India)
2016-04-15
A suitable wave function for the baryon decuplet is framed with the inclusion of the sea containing quark-gluon Fock states. Relevant operator formalism is applied to calculate the magnetic moments of J{sup P} = (3)/(2){sup +} baryon decuplet. The statistical model assumes the decomposition of the baryonic state in various quark-gluon Fock states and is used in combination with the detailed balance principle to find the relative probabilities of these Fock states in flavor, spin and color space. The upper limit to the gluon is restricted to three with the possibility of emission of quark-antiquark pairs. We study the importance of strangeness in the sea (scalar, vector and tensor) and its contribution to the magnetic moments. Our approach has confirmed the scalar-tensor sea dominancy over the vector sea. Various modifications in the model are used to check the validity of the statistical approach. The results are matched with the available theoretical data. A good consistency with the experimental data has been achieved for Δ{sup ++}, Δ{sup +} and Ω{sup -}. (orig.)
International Nuclear Information System (INIS)
Li Zejuan; Wang Hanzhou; Zong Hongliang; Sun Qing; Kong Xiangfei; Jiang Jianhai; Gu Jianxin
2005-01-01
Cyclin-dependent kinase 11 (CDK11; also named PITSLRE) is part of the large family of p34 cdc2 -related kinases whose functions appear to be linked with cell cycle progression, tumorigenesis, and apoptotic signaling. The mechanism that CDK11 p58 induces apoptosis is not clear. Some evidences suggested β1,4-galactosyltransferase 1 (β1,4-GT 1) might participate in apoptosis induced by CDK11 p58 . In this study, we demonstrated that ectopically expressed β1,4-GT 1 increased CDK11 p58 -mediated apoptosis induced by cycloheximide (CHX). In contrast, RNAi-mediated knockdown of β1,4-GT 1 effectively inhibited apoptosis induced by CHX in CDK11 p58 -overexpressing cells. For example, the cell morphological and nuclear changes were reduced; the loss of cell viability was prevented and the number of cells in sub-G1 phase was decreased. Knock down of β1,4-GT 1 also inhibited the release of cytochrome c from mitochondria and caspase-3 processing. Therefore, the cleavage of CDK11 p58 by caspase-3 was reduced. We proposed that β1,4-GT 1 might contribute to the pro-apoptotic effect of CDK11 p58 . This may represent a new mechanism of β1,4-GT 1 in CHX-induced apoptosis of CDK11 p58 -overexpressing cells
Energy Technology Data Exchange (ETDEWEB)
Uddin, Md. Shuza [Atomic Energy Research Establishment, Dhaka (Bangladesh). Tandem Accelerator Facilities; Forschungszentrum Juelich GmbH (Germany). Inst. fuer Neurowissenschaften und Medizin, INM-5: Nuklearchemie; Chakraborty, Animesh Kumer [Atomic Energy Research Establishment, Dhaka (Bangladesh). Tandem Accelerator Facilities; Chittagong University of Engineering and Technology (Bangladesh). Dept. of Physics; Spellerberg, Stefan; Spahn, Ingo; Qaim, Syed M. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Neurowissenschaften und Medizin, INM-5: Nuklearchemie; Shariff, Md. Asad; Das, Sopan [Atomic Energy Research Establishment, Dhaka (Bangladesh). Tandem Accelerator Facilities; Rashid, Md. Abdur [Chittagong University of Engineering and Technology (Bangladesh). Dept. of Physics
2016-08-01
A newly developed facility at the 3 MV Tandem Accelerator at Dhaka for measurement of proton induced reaction cross sections in the energy region below 5 MeV is outlined and tests for the beam characterization are described. The results were validated by comparison with the well-known excitation function of the {sup 64}Ni(p, n){sup 64}Cu reaction. Excitation functions of the reactions {sup nat}Ni(p, x){sup 60,61}Cu, {sup nat}Ni(p, x){sup 55,57,58m+g}Co and {sup nat}Ni(p, x){sup 57}Ni were also measured from threshold to 16 MeV using the stacked-foil technique, whereby irradiations were performed with 5 MeV protons available at the Tandem Accelerator and 16.7 MeV protons at the BC 1710 cyclotron at Juelich, Germany. The radioactivity was measured using HPGe γ-ray detectors. A few results are new, the others strengthen the database. In particular, the results of the reaction {sup nat}Ni(p, x){sup 61}Cu below 3 MeV could serve as beam monitor.
Energy Technology Data Exchange (ETDEWEB)
Kiener, J. E-mail: kiener@csnsm.in2p3.fr; Gros, M.; Tatischeff, V.; Attie, D.; Bailly, I.; Bauchet, A.; Chapuis, C.; Cordier, B.; Deloncle, I.; Porquet, M.G.; Schanne, S.; Sereville, N. de; Tauzin, G
2004-03-01
Gamma-ray angular distributions for the resonances at E{sub p}=550 and 1747 keV of the radiative capture reaction {sup 13}C(p,{gamma}){sup 14}N have been measured, using intense proton beams on isotopically pure {sup 13}C targets. Experimental gamma-ray spectra were obtained with three HP-Germanium detectors at four angles for E{sub p}=550 keV and six angles for E{sub p}=1747 keV in the range of 0-90 deg. with respect to the proton beam. From the data, relative intensities for the strongest transitions were extracted with an accuracy of typically 5%, making these resonances new useful gamma-ray standards for efficiency calibration in the energy range from E{sub {gamma}}=1.6-9 MeV. Gamma-ray branching ratios were obtained for several levels of {sup 14}N and are compared with literature values.
On the hidden charm pentaquarks in Λ{sub b} → J/ψK{sup -} p decay
Energy Technology Data Exchange (ETDEWEB)
Roca, L. [Universidad de Murcia, Departamento de Fisica, Murcia (Spain); Oset, E. [Centro Mixto Universidad de Valencia-CSIC Institutos de Investigacion de Paterna, Departamento de Fisica Teorica y IFIC, Valencia (Spain)
2016-11-15
In a previous work we presented a theoretical analysis of the Λ{sub b} → J/ψK{sup -} p reaction based on which a recent experiment by the LHCb collaboration at CERN claimed the existence of two hidden charm pentaquarks, P{sub c}(4380){sup +} and P{sub c}(4450){sup +}. In that work we focused only on the Λ(1405) and P{sub c}(4450){sup +} signals and discussed the possible explanation of this pentaquark state within the picture of a dynamical meson-baryon molecule made up mostly from anti D*Σ{sub c} and anti D*Σ{sup *}{sub c} components. In the present work we improve upon the previous one by considering the total K{sup -} p and J/ψp data including all the relevant resonances contributing to the spectra, and discuss the possible nature of both P{sub c}(4380){sup +} and P{sub c}(4450){sup +}. We also discuss several important topics, like the effect of the contact term in the reaction, the viability of reproducing the data without the P{sub c}(4380){sup +} and the possible quantum number assignment to these pentaquarks. (orig.)
Measurement of the branching fractions of {Lambda}{sub c}{sup +}{r_arrow}p{bar K}n({pi})
Energy Technology Data Exchange (ETDEWEB)
Alam, M.S.; Athar, S.B.; Ling, Z.; Mahmood, A.H.; Severini, H.; Timm, S.; Wappler, F. [State University of New York at Albany, Albany, New York12222 (United States); Anastassov, A.; Duboscq, J.E.; Fujino, D.; Gan, K.K.; Hart, T.; Honscheid, K.; Kagan, H.; Kass, R.; Lee, J.; Spencer, M.B.; Sung, M.; Undrus, A.; Wanke, R.; Wolf, A.; Zoeller, M.M. [Ohio State University, Columbus, Ohio43210 (United States); Nemati, B.; Richichi, S.J.; Ross, W.R.; Skubic, P. [University of Oklahoma, Norman, Oklahoma73019 (United States); Bishai, M.; Fast, J.; Hinson, J.W.; Menon, N.; Miller, D.H.; Shibata, E.I.; Shipsey, I.P.; Yurko, M. [Purdue University, West Lafayette, Indiana47907 (United States); Gibbons, L.; Glenn, S.; Johnson, S.D.; Kwon, Y.; Roberts, S.; Thorndike, E.H. [University of Rochester, Rochester, New York14627 (United States); Jessop, C.P.; Lingel, K.; Marsiske, H.; Perl, M.L.; Ugolini, D.; Wang, R.; Zhou, X. [Stanford Linear Accelerator Center, Stanford University, Stanford, California94309 (United States); Coan, T.E.; Fadeyev, V.; Korolkov, I.; Maravin, Y.; Narsky, I.; Shelkov, V.; Staeck, J.; Stroynowski, R.; Volobouev, I.; Ye, J. [Southern Methodist University, Dallas, Texas75275 (United States); Artuso, M.; Efimov, A.; Goldberg, M.; He, D.; Kopp, S.; Moneti, G.C.; Mountain, R.; Schuh, S.; Skwarnicki, T.; Stone, S.; Viehhauser, G.; Xing, X. [Syracuse University, Syracuse, New York13244 (United States); Bartelt, J.; Csorna, S.E.; Jain, V.; McLean, K.W.; Marka, S. [Vanderbilt University, Nashville, Tennessee37235 (United States); Godang, R.; Kinoshita, K.; Lai, I.C.; Pomianowski, P.; Schrenk, S. [Virginia Polytechnic Institute and State University, Blacksburg, Virginia24061 (United States); Bonvicini, G.; Cinabro, D.; Greene, R.; Perera, L.P.; Zhou, G.J. [Wayne State University, Detroit, Michigan48202 (United States); Barish, B.; Chadha, M.; Chan, S.; Eigen, G.; Miller, J.S.; OGrady, C.; Schmidtler, M.; Urheim, J.; Weinstein, A.J.; and others
1998-04-01
Using data recorded by the CLEO-II detector at CESR, we report new measurements of the branching fractions for the decays of the charmed baryon {Lambda}{sub c}{sup +} into pK{sup {minus}}{pi}{sup +}{pi}{sup 0}, p{bar K}{sup 0}, p{bar K}{sup 0}{pi}{sup +}{pi}{sup {minus}}, and p{bar K}{sup 0}{pi}{sup 0}, all measured relative to pK{sup {minus}}{pi}{sup +}. The relative branching fractions are 0.67{plus_minus}0.04{plus_minus}0.11,0.46{plus_minus}0.02{plus_minus}0.04,0.52 {plus_minus}0.04{plus_minus}0.05, and 0.66{plus_minus}0.05{plus_minus}0.07, respectively. {copyright} {ital 1998} {ital The American Physical Society}
Integral measurement of the {sup 12}C(n, p){sup 12}B reaction up to 10 GeV
Energy Technology Data Exchange (ETDEWEB)
Zugec, P.; Bosnar, D. [University of Zagreb, Department of Physics, Faculty of Science, Zagreb (Croatia); Colonna, N.; Barbagallo, M.; Mastromarco, M.; Tagliente, G.; Variale, V. [Istituto Nazionale di Fisica Nucleare, Bari (Italy); Ventura, A. [Istituto Nazionale di Fisica Nucleare, Bologna (Italy); Mengoni, A. [ENEA, Bologna (Italy); Altstadt, S.; Langer, C.; Lederer, C.; Reifarth, R.; Schmidt, S.; Weigand, M. [Johann-Wolfgang-Goethe Universitaet, Frankfurt (Germany); Andrzejewski, J.; Marganiec, J.; Perkowski, J. [Uniwersytet Lodzki, Lodz (Poland); Audouin, L.; Leong, L.S.; Tassan-Got, L. [Centre National de la Recherche Scientifique/IN2P3 - IPN, Orsay (France); Becares, V.; Cano-Ott, D.; Garcia, A.R.; Gonzalez-Romero, E.; Martinez, T.; Mendoza, E. [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas (CIEMAT), Madrid (Spain); Becvar, F.; Krticka, M.; Kroll, J.; Valenta, S. [Charles University, Prague (Czech Republic); Belloni, F.; Mondalaers, W.; Plompen, A.; Schillebeeckx, P. [European Commission JRC, Institute for Reference Materials and Measurements, Geel (Belgium); Berthoumieux, E.; Fraval, K.; Gunsing, F. [CEA/Saclay - IRFU, Gif-sur-Yvette (France); Billowes, J.; Ware, T.; Wright, T. [University of Manchester, Manchester (United Kingdom); Boccone, V.; Brugger, M.; Calviani, M.; Cerutti, F.; Chiaveri, E.; Chin, M.; Ferrari, A.; Guerrero, C.; Losito, R.; Roman, F.; Rubbia, C.; Tsinganis, A.; Versaci, R.; Vlachoudis, V.; Weiss, C. [CERN, Geneva (Switzerland); Calvino, F.; Cortes, G.; Gomez-Hornillos, M.B.; Riego, A. [Universitat Politecnica de Catalunya, Barcelona (Spain); Carrapico, C.; Goncalves, I.F.; Sarmento, R.; Vaz, P. [Universidade de Lisboa, C2TN-Instituto Superior Tecnico, Lisboa (Portugal); Cortes-Giraldo, M.A.; Praena, J.; Quesada, J. [Universidad de Sevilla, Sevilla (Spain); Cosentino, L.; Finocchiaro, P. [INFN - Laboratori Nazionali del Sud, Catania (Italy); Diakaki, M.; Karadimos, D.; Kokkoris, M.; Vlastou, R. [National Technical University of Athens (NTUA), Athens (Greece); Domingo-Pardo, C.; Giubrone, G.; Tain, J.L. [CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular, Valencia (Spain); Dressler, R.; Heinitz, S.; Kivel, N.; Schumann, D. [Paul Scherrer Institut, Villigen (Switzerland); Duran, I.; Tarrio, D. [Universidade de Santiago de Compostela, Santiago de Compostela (Spain); Eleftheriadis, C.; Manousos, A. [Aristotle University of Thessaloniki, Thessaloniki (Greece); Ganesan, S.; Gurusamy, P.; Saxena, A. [Bhabha Atomic Research Centre (BARC), Mumbai (India); Griesmayer, E.; Jericha, E.; Leeb, H. [Atominstitut der Oesterreichischen Universitaeten, Technische Universitaet Wien, Wien (Austria); Jenkins, D.G.; Vermeulen, M.J. [University of York, York, Heslington (United Kingdom); Kaeppeler, F. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik, Karlsruhe (Germany); Lo Meo, S. [Istituto Nazionale di Fisica Nucleare, Bologna (Italy); ENEA, Bologna (Italy); Massimi, C.; Mingrone, F.; Vannini, G. [Dipartimento di Fisica, Universita di Bologna (IT); INFN, Bologna (IT); Mastinu, P. [Laboratori Nazionali di Legnaro, Istituto Nazionale di Fisica Nucleare, Legnaro (IT); Milazzo, P.M. [Istituto Nazionale di Fisica Nucleare, Trieste (IT); Mirea, M. [Horia Hulubei National Institute of Physics and Nuclear Engineering - IFIN HH, Magurele (RO); Musumarra, A. [Universita di Catania, Dipartimento di Fisica e Astronomia DFA, Catania (IT); INFN-Laboratori Nazionali del Sud, Catania (IT); Paradela, C. [European Commission JRC, Institute for Reference Materials and Measurements, Geel (BE); Universidade de Santiago de Compostela, Santiago de Compostela (ES); Pavlik, A. [Faculty of Physics, University of Vienna, Wien (AT); Rauscher, T. [University of Hertfordshire, Centre for Astrophysics Research, School of Physics, Astronomy and Mathematics, Hatfield (GB); University of Basel, Department of Physics, Basel (CH); Wallner, A. [Faculty of Physics, University of Vienna, Wien (AT); Australian National University, Research School of Physics and Engineering, Canberra (AU)
2016-04-15
The integral measurement of the {sup 12}C(n, p){sup 12}B reaction was performed at the neutron time-of-flight facility nTOF at CERN. The total number of {sup 12}B nuclei produced per neutron pulse of the nTOF beam was determined using the activation technique in combination with a time-of-flight technique. The cross section is integrated over the nTOF neutron energy spectrum from reaction threshold at 13.6 MeV to 10 GeV. Having been measured up to 1GeV on basis of the {sup 235}U(n, f) reaction, the neutron energy spectrum above 200 MeV has been re-evaluated due to the recent extension of the cross section reference for this particular reaction, which is otherwise considered a standard up to 200 MeV. The results from the dedicated GEANT4 simulations have been used to evaluate the neutron flux from 1 GeV up to 10 GeV. The experimental results related to the {sup 12}C(n, p){sup 12}B reaction are compared with the evaluated cross sections from major libraries and with the predictions of different GEANT4 models, which mostly underestimate the {sup 12}B production. On the contrary, a good reproduction of the integral cross section derived from measurements is obtained with TALYS-1.6 calculations, with optimized parameters. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Zhang, Hanwen; Huang, Ruimin; Pillarsetty, NagaVaraKishore; Thorek, Daniel L.J. [Memorial Sloan-Kettering Cancer Center (MSKCC), Department of Radiology, New York, NY (United States); Vaidyanathan, Ganesan [Duke University School of Medicine, Department of Radiology, Durham, NC (United States); Serganova, Inna [Memorial Sloan-Kettering Cancer Center (MSKCC), Department of Neurology, New York, NY (United States); Blasberg, Ronald G. [Memorial Sloan-Kettering Cancer Center (MSKCC), Department of Radiology, New York, NY (United States); Memorial Sloan-Kettering Cancer Center (MSKCC), Department of Neurology, New York, NY (United States); Memorial Sloan-Kettering Cancer Center (MSKCC), Molecular Pharmacology and Chemistry Program, New York, NY (United States); Lewis, Jason S. [Memorial Sloan-Kettering Cancer Center (MSKCC), Department of Radiology, New York, NY (United States); Memorial Sloan-Kettering Cancer Center (MSKCC), Molecular Pharmacology and Chemistry Program, New York, NY (United States); Molecular Pharmacology and Chemistry Program, SKI, Memorial Sloan-Kettering Cancer Center, Radiochemistry and Imaging Sciences Service, Department of Radiology, New York, NY (United States)
2014-02-15
Both {sup 131}I- and {sup 123}I-labeled meta-iodobenzylguanidine (MIBG) have been widely used in the clinic for targeted imaging of the norepinephrine transporter (NET). The human NET (hNET) gene has been imaged successfully with {sup 124}I-MIBG positron emission tomography (PET) at time points of >24 h post-injection (p.i.). {sup 18}F-labeled MIBG analogs may be ideal to image hNET expression at time points of <8 h p.i. We developed improved methods for the synthesis of known MIBG analogs, [{sup 18}F]MFBG and [{sup 18}F]PFBG and evaluated them in hNET reporter gene-transduced C6 rat glioma cells and xenografts. [{sup 18}F]MFBG and [{sup 18}F]PFBG were synthesized manually using a three-step synthetic scheme. Wild-type and hNET reporter gene-transduced C6 rat glioma cells and xenografts were used to comparatively evaluate the {sup 18}F-labeled analogs with [{sup 123}I]/[{sup 124}I]MIBG. The fluorination efficacy on benzonitrile was predominantly determined by the position of the trimethylammonium group. The para-isomer afforded higher yields (75 ± 7 %) than meta-isomer (21 ± 5 %). The reaction of [{sup 18}F]fluorobenzylamine with 1H-pyrazole-1-carboximidamide was more efficient than with 2-methyl-2-thiopseudourea. The overall radiochemical yields (decay-corrected) were 11 ± 2 % (n = 12) for [{sup 18}F]MFBG and 41 ± 12 % (n = 5) for [{sup 18}F]PFBG, respectively. The specific uptakes of [{sup 18}F]MFBG and [{sup 18}F]PFBG were similar in C6-hNET cells, but 4-fold less than that of [{sup 123}I]/[{sup 124}I]MIBG. However, in vivo [{sup 18}F]MFBG accumulation in C6-hNET tumors was 1.6-fold higher than that of [{sup 18}F]PFBG at 1 h p.i., whereas their uptakes were similar at 4 h. Despite [{sup 18}F]MFBG having a 2.8-fold lower affinity to hNET and approximately 4-fold lower cell uptake in vitro compared to [{sup 123}I]/[{sup 124}I]MIBG, PET imaging demonstrated that [{sup 18}F]MFBG was able to visualize C6-hNET xenografts better than [{sup 124}I
Energy Technology Data Exchange (ETDEWEB)
Ohtsubo, T., E-mail: tohtsubo@np.gs.niigata-u.ac.jp; Hirano, H.; Takahashi, S. [Niigata Univ. (Japan); Matsuta, K.; Mihara, M.; Fukuda, M. [Osaka Univ. (Japan); Nagatomo, T. [RIKEN (Japan); Izumikawa, T. [Niigata Univ., RI Center (Japan); Momota, S. [Kochi Univ. of Tech. (Japan); Nishimura, D.; Komurasaki, J.; Ishikawa, D. [Osaka Univ. (Japan); Zhou, D. M.; Zheng, Y. N.; Zhu, S. Y. [China Institute of Atomic Energy (China); Kitagawa, A.; Kanazawa, M.; Torikoshi, M.; Sato, S. [Inage-ku, NIRS (Japan); Minamisono, T. [Fukui Univ. of Tech. (Japan)
2007-11-15
We measured the polarization of the {beta}-emitting {sup 23}Ne (I{sup {pi}} 5/2{sup +}, T{sub 1/2} = 37.24 s) and {sup 25}Al(I{sup {pi}} = 5/2{sup +}, T{sub 1/2} = 7.18 s) produced through the one nucleon pickup reactions and {sup 24m}Al(I{sup {pi}} = 1{sup +}, T{sub 1/2} 131 ms, E{sub ex} = 426 keV) and {sup 28}P(I{sup {pi}} = 3{sup +}, T{sub 1/2} = 270 ms) produced through charge-exchange reactions in the intermediate energy heavy ion collisions. We compared them with those from the projectile fragmentation process. The larger polarization seems to persistently be positive throughout the momentum distribution, and sharper momentum distributions suggest that nuclear friction mechanism is responsible for the polarization phenomena.
Automorphism group of nonabelian groups of order p{sup 3}
Energy Technology Data Exchange (ETDEWEB)
Sarmin, Nor Haniza [Department of Mathematical Sciences, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Johor Bahru (Malaysia); Barakat, Yasamin [Department of Mathematical Sciences, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Johor Bahru, Malaysia and Islamic Azad University-Ahvaz Branch, Ahvaz (Iran, Islamic Republic of)
2014-06-19
Let G be a nonabelian group of order p{sup 3}, where p is a prime number. Then G is a two generated group that its commutator, centre and Frattini subgroup coincide and are of order p. Hence, the quotient group of G over its centre and also Frattini quotient group of G, both are of order p{sup 2}. However, the first mentioned quotient is isomorphic to the inner group of G, which is a normal subgroup of automorphism group of G. Whereas, Frattini quotient group of G is an abelian elementary group that can be considered as a vector space of dimension two over Z{sub p}, the field of integers modulo p. In this paper, we consider to apply these properties of G to characterize the automorphism group of G.
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Study of the /sup 12/N 2. 43 MeV level. [Differential cross sections; 44 MeV /sup 3/He; 52 MeV p
Energy Technology Data Exchange (ETDEWEB)
Cecil, F E; Shepard, J R; Sercely, R R; Peterson, R J [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; King, N S.P. [California Univ., Davis (USA). Crocker Nuclear Lab.
1976-10-11
The differential cross sections have been measured for the reactions /sup 12/C(/sup 3/He, /sup 3/He')/sup 12/C(17.77 MeV 0/sup +/ T = 1) and /sup 12/C(/sup 3/He, t)/sup 12/N(2.43 MeV) at Esub(/sup 3/He) = 44 MeV. The similar shapes of the angular distributions and the relative magnitudes of the cross sections suggest that the /sup 12/N 2.43 MeV level is the 0/sup +/ T = 1 analog to the /sup 12/C 17.77 MeV level. The reaction /sup 14/N(p, t)/sup 12/N(2.43 MeV) at Esub(p) = 52 MeV is also studied. The strength with which this level is excited in this reaction is consistent with reasonable two-step calculations assuming the 2.43 MeV level to have Jsup(..pi..) = 0/sup +/.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Energy Technology Data Exchange (ETDEWEB)
Sokhoyan, Vahe
2012-07-27
The spectrum and the properties of baryon resonances can be studied using photons with energies appropriate to excite baryonic states. Double meson photoproduction allows access to cascading resonance decays via other excited states. Also, at higher energies the importance of the double meson photoproduction increases due to higher cross-sections in comparison to single meson photoproduction. To study baryon resonances, the measurement of polarization observables as well as the measurement of differential cross-sections plays a very important role. In this work the three-body polarization observables I{sup s}, I{sup c} and the respective twobody asymmetry {Sigma} were measured for the reaction {gamma}p {yields} p{pi}{sup 0}{pi}{sup 0} in an incoming photon energy range of E{sub {gamma}} = 970 - 1650 MeV. The data were acquired with the CBELSA/TAPS experiment located at the ELSA accelerator in Bonn, using a linearly polarized photon beam impinging on a liquid hydrogen target. The observables I{sup s} and I{sup c} which occur in two-meson final states are measured for the first time in the reaction {gamma}p {yields} p{pi}{sup 0}{pi}{sup 0}. The corresponding two-body asymmetry {Sigma} is measured in an extended energy range in comparison to already existing data. A comparison with theoretical models shows that the polarization observables provide valuable input to study resonance contributions and their decay modes. The D{sub 33}(1700) {yields} {Delta}{pi} decay is studied based on the comparison of the Bonn-Gatchina Partial Wave Analysis (PWA) predictions with the data. Furthermore, a comparison of the data with the Bonn-Gatchina PWA and the Fix isobar model predictions allows to distinguish between these two models. Additionally, band-like structures and peaks are observed in the mass ranges of {Delta}(1232), D{sub 13}(1520), F{sub 15}(1680), f{sub 0}(980) and f{sub 2}(1270) in the according Dalitz plots and invariant mass distributions. The contributions of these
{sup 131}I-CRTX internal dosimetry: animal model and human extrapolation
Energy Technology Data Exchange (ETDEWEB)
Andrade, Henrique Martins de; Ferreira, Andrea Vidal; Soares, Marcella Araugio; Silveira, Marina Bicalho; Santos, Raquel Gouvea dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: hma@cdtn.br
2009-07-01
Snake venoms molecules have been shown to play a role not only in the survival and proliferation of tumor cells but also in the processes of tumor cell adhesion, migration and angiogenesis. {sup 125}I-Crtx, a radiolabeled version of a peptide derived from Crotalus durissus terrificus snake venom, specifically binds to tumor and triggers apoptotic signalling. At the present work, {sup 125}I-Crtx biokinetic data (evaluated in mice bearing Erlich tumor) were treated by MIRD formalism to perform Internal Dosimetry studies. Doses in several organs of mice were determinate, as well as in implanted tumor, for {sup 131}I-Crtx. Doses results obtained for animal model were extrapolated to humans assuming a similar concentration ratio among various tissues between mouse and human. In the extrapolation, it was used human organ masses from Cristy/Eckerman phantom. Both penetrating and non-penetrating radiation from {sup 131}I in the tissue were considered in dose calculations. (author)
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Adrover, C. [CPPM, Aix-Marseille Université, CNRS/IN2P3, Marseille (France); Affolder, A. [Oliver Lodge Laboratory, University of Liverpool, Liverpool (United Kingdom); Ajaltouni, Z. [Clermont Université, Université Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Albrecht, J. [Fakultät Physik, Technische Universität Dortmund, Dortmund (Germany); Alessio, F. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Alexander, M. [School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Ali, S. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Alkhazov, G. [Petersburg Nuclear Physics Institute (PNPI), Gatchina (Russian Federation); Alvarez Cartelle, P. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Alves, A.A. [Sezione INFN di Roma La Sapienza, Roma (Italy); European Organization for Nuclear Research (CERN), Geneva (Switzerland); Amato, S. [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro (Brazil); Amerio, S. [Sezione INFN di Padova, Padova (Italy); Amhis, Y. [LAL, Université Paris-Sud, CNRS/IN2P3, Orsay (France); Anderlini, L. [Sezione INFN di Firenze, Firenze (Italy); Anderson, J. [Physik-Institut, Universität Zürich, Zürich (Switzerland); Andreassen, R. [University of Cincinnati, Cincinnati, OH (United States); Andrews, J.E. [University of Maryland, College Park, MD (United States); and others
2013-11-04
An analysis of B{sup +}→K{sub S}{sup 0}π{sup +} and B{sup +}→K{sub S}{sup 0}K{sup +} decays is performed with the LHCb experiment. The pp collision data used correspond to integrated luminosities of 1 fb{sup −1} and 2 fb{sup −1} collected at centre-of-mass energies of √(s)=7 TeV and √(s)=8 TeV, respectively. The ratio of branching fractions and the direct CP asymmetries are measured to be B(B{sup +}→K{sub S}{sup 0}K{sup +})/B(B{sup +}→K{sub S}{sup 0}π{sup +})=0.064±0.009 (stat.)±0.004 (syst.), A{sup CP}(B{sup +}→K{sub S}{sup 0}π{sup +})=−0.022±0.025 (stat.)±0.010 (syst.) and A{sup CP}(B{sup +}→K{sub S}{sup 0}K{sup +})=−0.21±0.14 (stat.)±0.01 (syst.). The data sample taken at √(s)=7 TeV is used to search for B{sub c}{sup +}→K{sub S}{sup 0}K{sup +} decays and results in the upper limit (f{sub c}⋅B(B{sub c}{sup +}→K{sub S}{sup 0}K{sup +}))/(f{sub u}⋅B(B{sup +}→K{sub S}{sup 0}π{sup +}))<5.8×10{sup −2} at 90% confidence level, where f{sub c} and f{sub u} denote the hadronisation fractions of a b{sup ¯} quark into a B{sub c}{sup +} or a B{sup +} meson, respectively.
Omelaenko, A S
2002-01-01
The reliability of the phenomenological estimates for the DELTA sup + (1232) mass is questioned coming from the of pi sup + and pi sup 0 mesons photoproduction data off proton target till the end of 2001. The origin of an old discrepancy for the DELTA sup + (1232) mass presented in tables of the Particle Data Group is discussed.
Exploring the island of inversion with the d({sup 30}Mg,p){sup 31}Mg reaction
Energy Technology Data Exchange (ETDEWEB)
Bildstein, Vinzenz
2010-12-07
In this thesis the results of a d({sup 30}Mg,p){sup 31}Mg experiment at REX-ISOLDE are presented. {sup 31}Mg is located directly on the border of the so-called ''Island of Inversion'', a region of the nuclear chart around {sup 32}Mg where deformed intruder states of the fp shell form the ground states of the nuclei instead of the normal spherical states of the sd shell. A recent experiment has shown the ground state of {sup 31}Mg to be a 1/2{sup +} state and indicates more than 90% intruder configuration. The question whether the low-lying excited states of {sup 31}Mg are deformed intruder states as well or rather spherical states from the sd shell, indicating shape coexistence, is still open. The d({sup 30}Mg,p) {sup 31}Mg reaction is thus a good tool to gain more insight into the nature of the Island of Inversion. In the framework of this thesis the angular distribution of protons was measured for the second excited state at 221 keV in coincidence with de-excitation {gamma}-rays. The angular distribution was compared to DWBA calculations for different transferred orbital momenta, identifying the state for the first time as an l=1 state. The experiment was performed with the new charged particle detector setup T-REX. The setup is optimized for transfer reactions with radioactive beams in inverse kinematics. T-REX was developed, built, installed, and used for this first one neutron transfer experiment in the context of this thesis. The T-REX setup consists of {delta}E-E{sub Rest} telescopes made out of position sensitive silicon detectors that cover almost 4{pi} of the solid angle and can be combined with the MINIBALL {gamma}-ray detector array. It has a large solid angle for the detection and identification of the light recoils from transfer reactions. T-REX allows in combination with the MINIBALL Germanium detector array the tagging of the excited states by their characteristic {gamma}-rays. The combination of T-REX and MINIBALL achieves an
Analysis of D{sup 0} and D{sup *+}-meson production in pp and p-Pb collisions with ALICE at the LHC
Energy Technology Data Exchange (ETDEWEB)
Wilkinson, Jeremy John
2016-07-28
This thesis presents measurements of D-meson production in the central barrel of the ALICE detector in pp and p-Pb collisions. The reconstruction of D{sup 0} mesons in the hadronic channel D{sup 0}→K{sup -}π{sup +} was studied in pp collisions at √(s)=7 TeV using a Bayesian particle identification (PID) method, in order to test the validity of this new approach. Comparisons were made between these results and those obtained with established PID methods. Consistency was found between the different approaches, as well as an increase of the signal-to-background ratio and a similar or greater statistical significance for most of the implementations of the Bayesian approach. Further measurements of D{sup *+}→D{sup 0}π{sup +} were made as a function of charged-particle multiplicity in p-Pb collisions at √(s{sub NN})=5.02 TeV. The aim was to test the role of multi-parton interactions (MPI) and possible collective phenomena in small systems at LHC energies. The results for D{sup *+} mesons were consistent with the other D-meson species studied by ALICE (D{sup 0} and D{sup +}). The measurements against mid-rapidity multiplicity showed consistency with previous results from pp collisions; however, a slower increase of the relative D-meson yield was found as a function of multiplicity at large rapidity for p-Pb collisions than pp collisions. The results for both multiplicity estimators were reproduced by phenomenological models, both with and without viscous hydrodynamics.
Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas
1997-01-01
The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306
Energy Technology Data Exchange (ETDEWEB)
Reza Abdi, Mohammad [Department of Physics, University of Isfahan, Isfahan 81747-73441 (Iran, Islamic Republic of)], E-mail: r.abdi@phys.ui.ac.ir; Kamali, Mehdi [Central Laboratory, University of Isfahan, Isfahan 81747-73441 (Iran, Islamic Republic of); Vaezifar, Sedigheh [Department of Chemistry, University of Isfahan, Isfahan 81747-73441 (Iran, Islamic Republic of)
2008-04-15
A reconnaissance study has been made of the distribution of {sup 238}U, {sup 232}Th, {sup 40}K and {sup 137}Cs and geochemical features in soils and sediments samples at various locations in the northwestern coast of Persian Gulf. Activity concentration levels due to radionuclides were measured in 30 soil and sediment samples collected from this region. From the measured spectra, activity concentrations were determined for {sup 40}K (range from 146 to 500 Bq kg{sup -1}), {sup 137}Cs (from 5 to 20 Bq kg{sup -1}), {sup 238}U (from 21 to 65 Bq kg{sup -1}) and {sup 232}Th (from 15 to 45 Bq kg{sup -1}) with lowest limit detection (LLD) of 68, 3.2, 4.3 and 4.3 Bq kg{sup -1}, respectively. The dose rate from ambient air at the soil ranges was between 19 and 58 nGy h{sup -1} with an average of 37.41 {+-} 9.66 nGy h{sup -1}.
180Ta/sup g,m/ production cross sections form the 180Hf(p,n) reaction
International Nuclear Information System (INIS)
Norman, E.B.; Renner, T.R.; Grant, P.J.
1981-01-01
Cross sections have been determined for the production of the J/sup π/ = 1 + 180 Ta/sup g/ and the J/sup π/= 9 - 180 Ta/sup m/ from the 180 Hf(p,n) reaction. The 180 Ta/sup g/ cross sections were determined from measurements of γ-rays emitted following the electron-capture and β-decay of this 8.1-hour state. Total 180 Ta production cross sections were determined from measurements of the thick-target (p,n) yield. 180 Ta/sup m/ cross sections were calculated by subtracting the 180 Ta/sup g/ cross sections from the total (p,n) cross sections. These measurements are compared with the results of a statistical-model evaporation calculation
Energy Technology Data Exchange (ETDEWEB)
Fowler, J.S.; Volkow, N.D.; Wang, G.J. [Brookhaven National Laboratory, Upton, NY (United States)] [and others
1995-05-01
Post-mortem reports that human brain monoamine oxidase B (MAO B) increases in normal aging and neurodegenerative disorders due to the proliferation of MAO B-rich glial cells suggest that PET measures of MAO B may track gliosis. We have recently shown that the MAO B tracer [{sup 11}C]L-deprenyl has limited sensitivity in regions of high MAO B due to its rapid rate of trapping. This limits its utility for measuring MAO B in brain regions where MAO B is higher and/or where blood flow is low. We have recently demonstrated that [{sup 11}C]L-deprenyl-D2 has improved sensitivity in regions of high MAO B due to the deuterium isotope effect which reduces the rate of trapping. We report studies [{sup 11}C]L-deprenyl-D2 in normal human brain in 16 healthy men and women (age range 23-73) to assess tracer sensitivity, regional distribution, and reproducibility. Graphical analysis for irreversible systems was used to calculate Ki (influx constant) as an index of MAO B concentration in different brain regions. The uptake of carbon-11 in different brain regions was rapid, peaking at 5 minutes and plateauing from 30-60 minutes after an initial clearance. MAO B was highest in subcortical regions: thalamus{ge}basal ganglia>cingulate gyrus>frontal cortex=occipital cortex=cerebellum in agreement with post-mortem measurements. Ki values were highly correlated within an individual. Repeated measures at 1-4 week intervals were highly correlated (r=0.9; p=0.0001). In women (n=8: age range 23-73), Ki increased with increasing age for 8 brain regions (p < 0.04). Though men (N=8; age range 34-70) showed no correlation with age, a larger sample size is needed to adequately assess trends. In summary, the use of [{sup 11}C]L-deprenyl-D2 improves the measurement of MAO B in the human brain permitting its investigation as a positive tracer for glial cell proliferation in neurodegenerative disorders.
Dipole pomeron and. pi. /sup -/p elastic scattering at high energies
Energy Technology Data Exchange (ETDEWEB)
Fazal-E-Aleem (Panjab Univ., Lahore (Pakistan). Physics Dept.)
1982-10-16
The differential cross-sections for high-energy ..pi../sup -/p elastic scattering showing structure near -t=4 (GeV/c)/sup 2/ for psub(L)=50 and 200 GeV/c together with total cross-sections for 50<=psub(L)<=370 GeV/c, and with -t extending up to 11 (GeV/c)/sup 2/ have been fitted by using a dipole pomeron model.
Energy Technology Data Exchange (ETDEWEB)
Derrien, H.; Leal, L.C.; Guber, K.H.; Wiarda, D.; Arbanas, G. [Oak Ridge National Laboratory, Oak Ridge, TN (United States)
2009-07-01
The previous {sup 58}Ni and {sup 60}Ni set of resonance parameters (Endf/B7.O, Jeff-3, etc.) was based on the SAMMY analysis of Oak Ridge National Laboratory neutron transmission, scattering cross section and capture cross section measurements by C.M. Perey et al. The present results were obtained by adding to the SAMMY experimental database the capture cross sections measured recently at the Oak Ridge Linear Electron Accelerator by Guber et al. and the Geel Electron Linear Accelerator and very high-resolution neutron transmission measurements performed by Brusegan et al. A complete resonance parameter covariance matrix (RPCM) was obtained from the SAMMY analysis of the experimental database. The data sets were made consistent, when needed, by adjusting the neutron energy scales, the normalization coefficients, and the background corrections. The RPCM allows the calculation of the cross section uncertainties due mainly to statistical errors in the experimental data. The systematic uncertainties of the experimental data, estimated from the preliminary analyses of the experimental database, were taken into account in the cross section covariance matrix (CSCM) for total, scattering, and capture cross sections. The diagonal elements of the CSCM were obtained by quadratic combination of the different components of the uncertainties. Because of a lack of experimental information, the energy correlations were not obtained, and a value of 0.5 was arbitrarily taken for all the CSCM nondiagonal elements. The average capture cross-sections are significantly smaller than those calculated form Endf/B7.0
Zelenskaya, N S; Lebedev, V M; Orlova, N V; Spasskij, A V
2001-01-01
The results of measurements of double differential cross sections of the sup 9 Be(d, p gamma) sup 1 sup 0 Be reaction at E sub d = 15.3 MeV in the forward hemisphere proton ejection angles are presented. The modelless restoration of all even spin-tensor components of the density matrix of the 2 sup + (3.37 MeV) state of residual nucleus is reduced. The angular dependences of magnetic substate population and moment orientation tensor components for this state are also obtained. The experimental results are compared with calculations incorporating the neutron stripping mechanism by coupled-channel method. A large sensitivity of the calculated correlation characteristics to wave functions of nuclei participating in reaction, especially for nucleus sup 1 sup 0 Be is pointed out. It is demonstrated that taking the multistep processes into account is important for the investigated reaction
Energy Technology Data Exchange (ETDEWEB)
Deler, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1968-06-01
Results on {pi}{sup +}p scattering at 810 and 1300 MeV incoming kinetic energy are presented. In the three-body final states ({pi}{sup +}p {yields} {pi}{sup +}{pi}{sup 0}p or {pi}{sup +}{pi}{sup +}n) the N{sup *}{sub 33} production is strongly dominant. At 1300 MeV one also observes the {rho}, N{sup *}{sub 1/2} {sub 3/2} and N{sup *}{sub 1/2} {sub 5/2} productions. The difficulty in correctly separating these channels demands trying a more general analysis, taking simultaneously into account several processes (N{sup *}{pi}, {rho}N,...). A generalized isobaric model is discussed. Assuming the interaction of particles by pairs, we can carry out a partial wave analysis of the three body final state reactions. The expansion of the differential cross section in spherical harmonics for data between 600 and 1460 MeV (compilation of data from different laboratories) leads to a simple discussion of the angular effects for different parts of the Dalitz plot. A partial wave analysis has been made below 1 GeV. The reaction p {pi}{sup +}{pi}{sup 0} is correctly explained by considering only the N{sup *}{sub 33} production. The different partial waves are in agreement with the elastic phase shift analysis, except for the wave SD1 (corresponding to the elastic wave S31) which is found to be small. Therefore, the S31 resonance appears weakly coupled to the N{sup *}{sub 33}-{pi} channel. (author) [French] Les resultats de la mesure de la diffusion {pi}{sup +}p pour des energies cinetiques du {pi} incident egales a 810 MeV et 1300 MeV sont presentes. Dans les reactions a trois corps, {pi}{sup +}p {yields} {pi}{sup +}{pi}{sup 0}p ou {pi}{sup +}{pi}{sup +}n, la production de l'isobare 3/2 3/2 est fortement dominante. A 1300 MeV, on observe egalement la production du {rho} et des isobares 1/2 3/2 et 1/2 5/2. L'impossibilite de separer correctement ces differentes productions demande de chercher a effectuer l'analyse des donnees sous une forme plus generale permettant de tenir compte
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Oxygen determination in materials by {sup 18}O(p,αγ){sup 15}N nuclear reaction
Energy Technology Data Exchange (ETDEWEB)
Kumar, Sanjiv, E-mail: sanjucccm@rediffmail.com [National Centre for Compositional Characterization of Materials, BARC, ECIL Post, Hyderabad 500062 (India); Sunitha, Y.; Reddy, G.L.N.; Sukumar, A.A.; Ramana, J.V.; Sarkar, A. [National Centre for Compositional Characterization of Materials, BARC, ECIL Post, Hyderabad 500062 (India); Verma, Rakesh [Analytical Chemistry Division, BARC, Mumbai 400085 (India)
2016-07-01
The paper presents a proton induced γ-ray emission method based on {sup 18}O(p,αγ){sup 15}N nuclear reaction to determine bulk oxygen in materials. The determination involves the measurement of 5.27 MeV γ-rays emitted following the de-excitation of {sup 15}N nuclei. A description of the energetics of the reaction is given to provide an insight into the origin of 5.27 MeV γ-rays. In addition, thick target γ-ray yields and the limits of detection are measured to ascertain the analytical potential of the reaction. The thick-target γ-ray yields are measured with a high purity germanium detector and a bismuth germanate detector at 0° as well as 90° angles in 3.0–4.2 MeV proton energy region. The best limit of detection of about 1.3 at.% is achieved at 4.2 MeV proton energy for measurements at 0° as well 90° angles with the bismuth germanate detector while the uncertainty in quantitative analysis is <8%. The reaction has a probing depth of several tens of microns. Interferences can arise from fluorine due to the occurrence of {sup 19}F(p,αγ){sup 16}O reaction that emits 6–7 MeV γ-rays. The analytical potential of the methodology is demonstrated by determining oxygen in several oxide as well as non-oxide materials.
Measurement of CP Violation in B<sup>0sup>d Mixing Using B<sup>0sup>d → D<sup>*-μ+>(νμ)X Decays
Energy Technology Data Exchange (ETDEWEB)
Ross, Anthony [Lancaster Univ. (United Kingdom)
2012-09-10
This thesis describes the measurement of the time-integrated semileptonic charge asymmetry in B<sup>0sup>d mixing, a<sup>d> sl, using the decay chain of B<sup>0sup>d ! D<sup>*-μ+>(νμ), D<sup>*-> ! D<sup>0sup>π->, D<sup>0sup> ! K<sup>+π->. Decay candidates are reconstructed from 10.4 fb<sup>-1sup> of data recorded by the DØ detector at Fermilab’s Tevatron p$\\bar{p}$ collder during the 2002- 2011 ‘RunII’ data taking period. Yields are extracted using a 2 minimising simultaneous binned fit where 490k D candidates are reconstructed. The measurements presented in this thesis was made possible due to sophisticated online and offline reconstruction software, precise tracking systems, and the first-order background asymmetry negating magnet polarity reversal of the DØ detector.
Backward omega /sup 0/ and eta /sup 0/ production in pi p interactions at 9 and 12 GeV/c
Benkheiri, P; D'Almagne, B; De Rosny, G; Eisenstein, B I; Ferrer, A; Fleury, P; Grossetête, B; Jacholkowski, A; Nguyen, H; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Treille, D; Volte, A; Yiou, T P; Yoshida, H
1979-01-01
The backward production of omega /sup 0/ mesons in the u-channel I/sub u/=/sup 1///sub 2/ exchange reaction pi /sup -/p to N/sup 0/ (1680) omega /sup 0/ has been studied at 9 GeV/c and 12 GeV/c incident momenta. The data comes from an experiment performed at the CERN Omega Spectrometer using a fast proton trigger device. The backward production of the eta /sup 0/ meson has also been observed and the coupling constant ratio g/sub eta NN//g/sub pi NN/ has been estimated. (21 refs).
Energy Technology Data Exchange (ETDEWEB)
Bergmann, Florian Sebastian
2017-07-21
The reaction p+d→{sup 3}He+η was measured with theWASA-at-COSY experimental setup during two beam times in 2008 and 2009. Most of the data were recorded at an excess energy of Q=59.8 MeV, while data were collected at Q=48.8 MeV during one day of the 2009 beam time. In the first part of this thesis the production reaction p+d→{sup 3}He+η was investigated utilizing a part of the data collected in 2009 at Q=59.8 MeV and the full data measured at Q=48.8 MeV. The data were used to determine the differential cross sections for 23 angular bins in the range from cos θ{sup CMS}{sub η}=-0.92 to cos θ{sup CMS}{sub η}=0.92. The resulting distributions can be described by polynomial distributions of third order. Furthermore, the total cross section ratio of (σ{sub η}(48.8 MeV))/(σ{sub η}(59.8 MeV))=0.77±0.06 was extracted. This result indicates a distinct and unexpected fluctuation of the total cross section between Q=20 MeV and Q=60 MeV, which might indicate a possible variation of the production mechanism in this energy range. Due to these results a new beam time was conducted withWASAat- COSY in 2014 covering the excess energy range from 13.6 MeV to 80.9 MeV. The second part of the thesis was based on both the 2008 and the 2009 data set with the goal to search for the decay η→π{sup 0}+e{sup +}+e{sup -} in regards to a C parity violating process. It was possible to extract an improved upper limit for the branching ratio of the decay η→π{sup 0}+γ{sup *}→π{sup 0}+e{sup +}+e{sup -} of 7.52 x 10{sup -6} (CL=90%) and for the branching ratio of the decay η→π{sup 0}+e{sup +}+e{sup -} according to three-particle phase space of 9.49 x 10{sup -6}(CL=90%).
Energy Technology Data Exchange (ETDEWEB)
Chekanov, S.; Derrick, M.; Magill, S. [Argonne National Lab., Argonne, IL (US)] (and others)
2008-12-15
Measurements of the neutral current cross sections for deep inelastic scattering in e{sup -}p collisions at HERA with a longitudinally polarised electron beam are presented. The single-differential cross-sections d{sigma}/dQ{sup 2}, d{sigma}/dx and d{sigma}/dy and the double-differential cross sections in Q{sup 2} and x are measured in the kinematic region y < 0.9 and Q{sup 2} > 185GeV{sup 2} for both positively and negatively polarised electron beams and for each polarisation state separately. The measurements are based on an integrated luminosity of 169.9 pb{sup -1} taken with the ZEUS detector in 2005 and 2006 at a centre-of-mass energy of 318GeV. The structure functions xF{sub 3} and xF{sub 3}{sup {gamma}}{sup Z} are determined by combining the e{sup -}p results presented in this paper with previously measured e{sup +}p neutral current data. The asymmetry parameter A{sup -} is used to demonstrate the parity violating effects of electroweak interactions at large spacelike photon virtuality. The measurements agree well with the predictions of the Standard Model. (orig.)
In vitro expansion of Lin{sup +} and Lin{sup −} mononuclear cells from human peripheral blood
Energy Technology Data Exchange (ETDEWEB)
Norhaiza, H. Siti; Zarina, Z. A. Intan; Hisham, Z. A. Shahrul [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Selangor (Malaysia); Rohaya, M. A. W. [Department of Orthodontics, Faculty of Dentistry, Universiti Kebangsaan Malaysia, 50300, Kuala Lumpur (Malaysia)
2013-11-27
Haematopoietic stem cells (HSCs) are used in the therapy of blood disorders due to the ability of these cells to reconstitute haematopoietic lineage cells when transplanted into myeloablative recipients. However, substantial number of cells is required in order for the reconstitution to take place. Since HSCs present in low frequency, larger number of donor is required to accommodate the demand of transplantable HSCs. Therefore, in vitro expansion of HSCs will have profound impact on clinical purposes. The aim of this study was to expand lineage negative (Lin{sup −}) stem cells from human peripheral blood. Total peripheral blood mononuclear cells (PBMNCs) were fractionated from human blood by density gradient centrifugation. Subsequently, PBMNCs were subjected to magnetic assisted cell sorter (MACS) which depletes lineage positive (Lin{sup +}) mononuclear cells expressing lineage positive markers such as CD2, CD3, CD11b, CD14, CD15, CD16, CD19, CD56, CD123, and CD235a to obtained Lin{sup −} cell population. The ability of Lin{sup +} and Lin{sup −} to survive in vitro was explored by culturing both cell populations in complete medium consisting of Alpha-Minimal Essential Medium (AMEM) +10% (v/v) Newborn Calf Serum (NBCS)+ 2% (v/v) pen/strep. In another experiment, Lin{sup +} and Lin{sup −} were cultured with complete medium supplemented with 10ng/mL of the following growth factors: stem cell factor (SCF), interleukin (IL)-3, granulocyte-macrophage colony stimulating factor (GM-CSF), 2IU/mL of Erythropoietin (Epo) and 20ng/mL of IL-6. Three samples were monitored in static culture for 22 days. The expansion potential was assessed by the number of total viable cells, counted by trypan blue exclusion assay. It was found that Lin{sup +} mononuclear cells were not able to survive either in normal proliferation medium or proliferation medium supplemented with cytokines. Similarly, Lin{sup −} stem cells were not able to survive in proliferation medium however
Energy Technology Data Exchange (ETDEWEB)
Alef, Stefan [Physikalisches Institut, Universitaet Bonn (Germany); Collaboration: BGO-OD-Collaboration
2016-07-01
The BGO-OD experiment at the ELSA facility in Bonn is built to investigate nucleon excitations via meson photoproduction. One research objective is associated strangeness production, which includes the reaction channel γp → K{sup 0}Σ{sup +}. Results of the analysis for the neutral decay channel K{sup 0}Σ{sup +} → π{sup 0}π{sup 0}π{sup 0}p will be presented. Due to the small production cross section and branching ratio kinematic fitting is used to discriminate the reaction against background.
Uptake and distribution of /sup 32/P in the budded and self-rooted grape varieties
Energy Technology Data Exchange (ETDEWEB)
Srinivasan, C; Chelam, G V; Shanmugam, A [Tamil Nadu Agricultural Univ., Coimbatore (India)
1974-06-01
In the self-rooted and budded varieties of grape (Vitis vinifera L.), the total P and /sup 32/P contents were high in 'Anabee-Shahi', but low in in 'Muscat'. The growing shoots contained more P than old stems and roots in all the varieties. In the budded plants, 'Kali Sahebi' scion budded on 'Anab-e-Shani showed the maximum /sup 32/P and total P in the shoots, but 'Muscat' scion budded on 'Anab-e-Shahi' accumulated more P in the roots and very low /sup 32/P in the growing shoots. Auto-radiographs of shoots also showed that 'Kali Sahebi' budded on 'Anab-e-Shani' rootstock accumulated more /sup 32/P in the shoots.
Study of the p+{sup 12}C reaction at energies up to 30 MeV
Energy Technology Data Exchange (ETDEWEB)
Harada, Masahide; Yamamoto, A.; Yoshioka, S. [Kyushu Univ., Fukuoka (Japan)] [and others
1998-03-01
Double differential cross sections of charged-particles emitted in the p+{sup 12}C reaction were measured in the energy region from 14 to 26 MeV. The observed continuous components of emitted protons and {alpha}-particles were analyzed by assuming sequential decay of intermediate reaction products and/or simultaneous breakup process. It was found that the three body simultaneous decay, p+{alpha}+{sup 8}Be, and the sequential decay via p+{sup 12}C{sup *}{sub 3-} and {alpha}+{sup 9}B{sub g.s.} are most important in the proton-induced breakup of {sup 12}C for energies up to 30 MeV. (author)
The human genome project and novel aspects of cytochrome P450 research
International Nuclear Information System (INIS)
Ingelman-Sundberg, Magnus
2005-01-01
Currently, 57 active cytochrome P450 (CYP) genes and 58 pseudogenes are known to be present in the human genome. Among the genes discovered by initiatives in the human genome project are CYP2R1, CYP2W1, CYP2S1, CYP2U1 and CYP3A43, the latter apparently encoding a pseudoenzyme. The function, polymorphism and regulation of these genes are still to be discovered to a great extent. The polymorphism of drug metabolizing CYPs is extensive and influences the outcome of drug therapy causing lack of response or adverse drug reactions. The basis for the differences in the global distribution of the polymorphic variants is inactivating gene mutations and subsequent genetic drift. However, polymorphic alleles carrying multiple active gene copies also exist and are suggested in case of CYP2D6 to be caused by positive selection due to development of alkaloid resistance in North East Africa about 10,000-5000 BC. The knowledge about the CYP genes and their polymorphisms is of fundamental importance for effective drug therapy and for drug development as well as for understanding metabolic activation of carcinogens and other xenobiotics. Here, a short review of the current knowledge is given
Energy Technology Data Exchange (ETDEWEB)
Huang, Wen-Sheng [PET Center, Tri-Service General Hospital, Department of Nuclear Medicine, Neihu, Taipei (China); Changhua Christian Hospital, Department of Nuclear Medicine, Changhua (China); Huang, San-Yuan; Ho, Pei-Shen; Yeh, Chin-Bin [Tri-Service General Hospital, Department of Psychiatry, Taipei (China); Ma, Kuo-Hsing [National Defense Medical Center, Department of Biology and Anatomy, Taipei (China); Huang, Ya-Yao; Shiue, Chyng-Yann [PET Center, Tri-Service General Hospital, Department of Nuclear Medicine, Neihu, Taipei (China); PET Center, National Taiwan University Hospital, Department of Nuclear Medicine, Taipei (China); Liu, Ren-Syuan [Taipei Veterans General Hospital, Department of Nuclear Medicine, Taipei (China); Cheng, Cheng-Yi [PET Center, Tri-Service General Hospital, Department of Nuclear Medicine, Neihu, Taipei (China)
2013-01-15
The aim of this study was to assess the feasibility of using 4-[{sup 18}F]-ADAM as a brain SERT imaging agent in humans. Enrolled in the study were 19 healthy Taiwanese subjects (11 men, 8 women; age 33 {+-} 9 years). The PET data were semiquantitatively analyzed and expressed as specific uptake ratios (SUR) and distribution volume ratios (DVR) using the software package PMOD. The SUR and DVR of 4-[{sup 18}F]-ADAM in the raphe nucleus (RN), midbrain (MB), thalamus (TH), striatum (STR) and prefrontal cortex (PFC) were determined using the cerebellum (CB) as the reference region. 4-[{sup 18}F]-ADAM bound to known SERT-rich regions in human brain. The order of the regional brain uptake was MB (RN) > TH > STR > PFC > CB. The DVR (n = 4, t* = 60 min) in the RN, TH, STR and PFC were 3.00 {+-} 0.50, 2.25 {+-} 0.45, 2.05 {+-} 0.31 and 1.40 {+-} 0.13, respectively. The optimal time for imaging brain SERT with 4-[{sup 18}F]-ADAM was 120-140 min after injection. At the optimal imaging time, the SURs (n = 15) in the MB, TH, STR, and PFC were 2.25 {+-} 0.20, 2.28 {+-} 0.20, 2.12 {+-} 0.18 and 1.47 {+-} 0.14, respectively. There were no significant differences in SERT availability between men and women (p < 0.05). The results of this study showed that 4-[{sup 18}F]-ADAM was safe for human studies and its distribution in human brain appeared to correlate well with the known distribution of SERT in the human brain. In addition, it had high specific binding and a reasonable optimal time for imaging brain SERT in humans. Thus, 4-[{sup 18}F]-ADAM may be feasible for assessing the status of brain SERT in humans. (orig.)
K*(892)<sup>0sup>Λ and K<sup>+Σ*>(1385)<sup>-> Photoproduction on the Deuteron
Energy Technology Data Exchange (ETDEWEB)
Mattione, Paul [Rice Univ., Houston, TX (United States)
2011-05-01
the γn→ K<sup>+Σ*>(1385)<sup>-> reaction are limited to forward angles, where t-channel K<sup>+> and K^<sup>*+> exchanges are predicted to dominate. These cross sections are compared against theoretical models to study the channel interactions that give rise to their distributions. These reactions also have the same final state particles (K<sup>+π-pπ->), so studies of their potential interference were performed as well. A measurement of the γn→ pπ-> cross section was also performed, and the agreement with published results within the uncertainties validated the integrity of the data and procedures used in this analysis.
Possible Deformed States in {sup 115}In and {sup 117}ln
Energy Technology Data Exchange (ETDEWEB)
Baecklin, A; Fogelberg, B [Inst. of Physics, Univ. of Uppsala (Sweden); Swedish Research Councils' Laboratory, Studsvik, Nykoeping (Sweden); Malmskog, S G [AB Atomenergi, Nykoeping (Sweden)
1967-01-15
Levels and transitions in {sup 115}In and {sup 117}In have been studied from the beta decay of 2.3-day {sup 115g}Cd and 2.5-h {sup 117g}Cd. Using a Ge(Li) detector and a double focussing beta spectrometer energies, intensities, conversion coefficients and multipolarities were obtained for the following transitions (energies in keV and multipolarities are given): {sup 115}In: 35.63 (97.0 % M1 + 3.0 % E2), 231.47 (E1), 260.80 (M1), 267, 336. 23 (M4 + < 5 % E5), 492. 4 (96 % El +4 % M2), 527.70 (E1). {sup 117}In: 71.0, 89.80 (E2 + < 20 % M1), 273.32 (M1, E2), 315.27 (M4 + < 7 % E2), 344.29 (E1), 434.12 (E1). Using the delayed coincidence technique, half lives were measured for 2 levels in {sup 115}In and for 3 levels in {sup 117}In. Energies, spins, parities and half lives are given for the following levels: In: 597.03, 3/2{sup -}; 828.39, 3/2{sup +}, 5.4 ns; 863.95, l/2{sup +} or 3/2{sup +}, 1.1 ns. {sup 117}In: 588.59, 3/2{sup -}; 0.20 ns; 659.56, 3/2{sup +}, 58.7 ns; 749.37, 1/2{sup +} or 3/2{sup +}, 4.3 ns. Reduced transition probabilities are given for several transitions in both nuclei. The E2 transition rates between the two excited positive parity states in both nuclei were found to be about 100 s. p. u. indicating a possible deformation of these states. The energy spacing and transition rates between these states can be well accounted for within the Nilsson model assuming the states to form a K = 1/2{sup +} rotational band. A deformation {delta} of about 0.20 is obtained for both nuclei.
Energy Technology Data Exchange (ETDEWEB)
Antolkovic, B; Holmqvist, B; Wiedling, T
1964-10-15
The angular distributions of neutrons from the reaction {sup 9}Be (p, n) {sup 9}B have been studied at the proton energies 2.300, 2.335, 2.389, and 2.560 MeV. Time-of-flight techniques have been used. The angular distribution measurements show remarkable differences compared to earlier published results using long-counters as detectors. The new results are ascribed to the different experimental methods. By using time-of-flight techniques it has been possible to eliminate disturbing influences from neutrons obtained from the {sup 9}Be (p,p'n) {sup 8}Be reaction which has a lower reaction threshold than the {sup 9}Be (p, n) {sup 9}B reaction as well as other Be-p-reactions emitting neutrons. The experimental distribution at 2.30 MeV has been compared with the simplified theories for direct interaction processes developed by Satchler and Rodberg. It is shown that Rodberg's proposal of using optical model wave functions describes the experiment better than Satchler's original theory. However, a good fitting leads to a nuclear radius as well as an optical potential which is appreciably smaller than ordinarily obtained in scattering experiments.
Takács, S; Tarkanyi, F; Hermanne, A; Sonck, M
2003-01-01
The use of the sup 9 sup 9 Mo -> sup 9 sup 9 sup m Tc generator in nuclear medicine is well established world wide. The production of the sup 9 sup 9 Mo (T sub 1 sub / sub 2 = 66 h) parent as a fission product of sup 2 sup 3 sup 5 U is largely based on the use of reactor technology. From the early 1990's accelerator based production methods to provide either direct produced sup 9 sup 9 sup m Tc or the parent sup 9 sup 9 Mo, were studied and suggested as potential alternatives to the reactor based production of sup 9 sup 9 Mo. A possible pathway for the charged particle production of sup 9 sup 9 sup m Tc and sup 9 sup 9 Mo is irradiation of molybdenum metal with protons via the reaction sup 1 sup 0 sup 0 Mo(p,2n) sup 9 sup 9 sup m Tc and sup 1 sup 0 sup 0 Mo(p,pn) sup 9 sup 9 Mo, respectively. The earlier published excitation functions show large differences in their maximum that result in large differences in the calculated yields. Study the excitation function for these proton-induced reactions was decided. ...
Energy Technology Data Exchange (ETDEWEB)
Choi, Jae Yeon [Department of Nuclear Medicine, Institute of Radiation Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Department of Radiation Applied Life Sciences, Seoul National University College of Medicine, Seoul (Korea, Republic of); Jeong, Jae Min, E-mail: jmjng@snu.ac.k [Department of Nuclear Medicine, Institute of Radiation Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Department of Radiation Applied Life Sciences, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yoo, Byong Chul [Research Institute, National Cancer Center, Goyang, Gyeonggi (Korea, Republic of); Kim, Kyunggon; Kim, Youngsoo [Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yang, Bo Yeun; Lee, Yun-Sang; Lee, Dong Soo [Department of Nuclear Medicine, Institute of Radiation Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Department of Radiation Applied Life Sciences, Seoul National University College of Medicine, Seoul (Korea, Republic of); Chung, June-Key [Department of Nuclear Medicine, Institute of Radiation Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Department of Radiation Applied Life Sciences, Seoul National University College of Medicine, Seoul (Korea, Republic of); Lee, Myung Chul [Department of Nuclear Medicine, Institute of Radiation Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of)
2011-04-15
Introduction: Although many sentinel lymph node (SLN) imaging agents labeled with {sup 99m}Tc have been developed, no positron-emitting agent has been specifically designed for SLN imaging. Furthermore, the development of the beta probe and the requirement for better image resolution have increased the need for a positron-emitting SLN imaging agent. Here, we describe the development of a novel positron-emitting SLN imaging agent labeled with {sup 68}Ga. Methods: A mannosylated human serum albumin (MSA) was synthesized by conjugating {alpha}-D-mannopyranosylphenyl isothiocyanate to human serum albumin in sodium carbonate buffer (pH 9.5), and then 2-(p-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid was conjugated to synthesize NOTA-MSA. Numbers of mannose and NOTA units conjugated in NOTA-MSA were determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. NOTA-MSA was labeled with {sup 68}Ga at room temperature. The stability of {sup 68}Ga-NOTA-MSA was checked in labeling medium at room temperature and in human serum at 37{sup o}C. Biodistribution in normal ICR mice was investigated after tail vein injection, and micro-positron emission tomography (PET) images were obtained after injecting {sup 68}Ga-NOTA-MSA into a tail vein or a footpad. Results: The numbers of conjugated {alpha}-D-mannopyranosylphenyl isothiocyanate and 2-(p-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid units in NOTA-MSA were 10.6 and 6.6, respectively. The labeling efficiency of {sup 68}Ga-NOTA-MSA was greater than 99% at room temperature, and its stability was greater than 99% at 4 h. Biodistribution and micro-PET studies of {sup 68}Ga-NOTA-MSA showed high liver and spleen uptakes after intravenous injection. {sup 68}Ga-NOTA-MSA injected into a footpad rapidly migrated to the lymph node. Conclusions: {sup 68}Ga-NOTA-MSA was successfully developed as a novel SLN imaging agent for PET. NOTA-MSA is easily labeled at high
Yu, Z
2003-01-01
The present preliminary measurements of branching fractions and CP-violating charge asymmetries in B-meson decays to rho pi. The data sample comprises 89 million UPSILON(4S) -> B(bar B) decays collected with the BABAR detector at the PEP-II asymmetric-energy B Factor at SLAC. They find the charge-averaged branching fractions BETA(B sup + -> rho sup +pi sup 0) = (11.0 +- 1.9(stat.) +- 1.9(syst.)) x 10 sup - sup 6 and BETA(B sup + -> rho sup 0 pi sup +) = (9.3 +- 1.0(stat.) +- 0.8(syst.)) x 10 sup - sup 6; they set a 90% confidence-level upper limit of BETA(B sup 0 -> rho sup 0 pi sup 0) < 2.5 x 10 sup - sup 6. They measure the CP-violating charge asymmetries A sub C sub P suprho sup + suppi sup 0 = 0.23 +- 0.16(stat.) +- 0.06(syst.) and A sub C sub P suprho sup 0 suppi sup + = -0.17 +- 0.11(stat.) +- 0.02(syst.).
The decay of Λ{sub b} → p K{sup -} in QCD factorization approach
Energy Technology Data Exchange (ETDEWEB)
Zhu, Jie; Wei, Zheng-Tao [Nankai University, School of Physics, Tianjin (China); Ke, Hong-Wei [Tianjin University, School of Science, Tianjin (China)
2016-05-15
With only the tree-level operator, the decay of Λ{sub b} → p K{sup -} is predicted to be one order smaller than the experimental data. The QCD penguin effects should be taken into account. In this paper, we explore the one-loop QCD corrections to the decay of Λ{sub b} → p K{sup -} within the framework of QCD factorization approach. For the baryon system, the diquark approximation is adopted. The transition hadronic matrix elements between Λ{sub b} and p are calculated in the light-front quark model. The branching ratio of Λ{sub b} → p K{sup -} is predicted to be about 4.85 x 10{sup -6}, which is consistent with experimental data (4.9 ± 0.9) x 10{sup -6}. The CP violation is about 5 % in theory. (orig.)
International Nuclear Information System (INIS)
Schmidt, Karyn; Wolfe, Devin M.; Stiller, Barbara; Pearce, David A.
2009-01-01
The Saccharomyces cerevisiae gene YPK9 encodes a putative integral membrane protein which is 58% similar and 38% identical in amino acid sequence to the human lysosomal P 5B ATPase ATP13A2. Mutations in ATP13A2 have been found in patients with Kufor-Rakeb syndrome, a form of juvenile Parkinsonism. We report that Ypk9p localizes to the yeast vacuole and that deletion of YPK9 confers sensitivity for growth for cadmium, manganese, nickel or selenium. These results suggest that Ypk9p may play a role in sequestration of divalent heavy metal ions. Further studies on the function of Ypk9p/ATP13A2 may help to define the molecular basis of Kufor-Rakeb syndrome and provide a potential link to environmental factors such as heavy metals contributing to some forms of Parkinsonism.
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Adrover, C. [CPPM, Aix-Marseille Université, CNRS/IN2P3, Marseille (France); Affolder, A. [Oliver Lodge Laboratory, University of Liverpool, Liverpool (United Kingdom); Ajaltouni, Z. [Clermont Université, Université Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Albrecht, J. [Fakultät Physik, Technische Universit ät Dortmund, Dortmund (Germany); Alessio, F. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Alexander, M. [School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Ali, S. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Alkhazov, G. [Petersburg Nuclear Physics Institute (PNPI), Gatchina (Russian Federation); Alvarez Cartelle, P. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Alves, A.A. [Sezione INFN di Roma La Sapienza, Roma (Italy); European Organization for Nuclear Research (CERN), Geneva (Switzerland); Amato, S. [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro (Brazil); Amerio, S. [Sezione INFN di Padova, Padova (Italy); Amhis, Y. [LAL, Université Paris-Sud, CNRS/IN2P3, Orsay (France); Anderlini, L. [Sezione INFN di Firenze, Firenze (Italy); Anderson, J. [Physik-Institut, Universität Zürich, Zürich (Switzerland); Andreassen, R. [University of Cincinnati, Cincinnati, OH (United States); Andrews, J.E. [University of Maryland, College Park, MD (United States); and others
2013-11-04
A search for CP violation in the phase-space structures of D{sup 0} and D{sup ¯0} decays to the final states K{sup −}K{sup +}π{sup −}π{sup +} and π{sup −}π{sup +}π{sup +}π{sup −} is presented. The search is carried out with a data set corresponding to an integrated luminosity of 1.0 fb{sup −1} collected in 2011 by the LHCb experiment in pp collisions at a centre-of-mass energy of 7 TeV. For the K{sup −}K{sup +}π{sup −}π{sup +} final state, the four-body phase space is divided into 32 bins, each bin with approximately 1800 decays. The p-value under the hypothesis of no CP violation is 9.1%, and in no bin is a CP asymmetry greater than 6.5% observed. The phase space of the π{sup −}π{sup +}π{sup +}π{sup −} final state is partitioned into 128 bins, each bin with approximately 2500 decays. The p-value under the hypothesis of no CP violation is 41%, and in no bin is a CP asymmetry greater than 5.5% observed. All results are consistent with the hypothesis of no CP violation at the current sensitivity.
Particle-γ coincidence spectroscopy of the N = 90 nucleus {sup 154}Gd by (p, tγ)
Energy Technology Data Exchange (ETDEWEB)
Allmond, J.M. [Oak Ridge National Laboratory, Physics Division, Oak Ridge, TN (United States); University of Richmond, Department of Physics, Richmond, VA (United States); Beausang, C.W.; Ross, T.J.; Brooks, W.; Darakchieva, B.K. [University of Richmond, Department of Physics, Richmond, VA (United States); Humby, P. [University of Richmond, Department of Physics, Richmond, VA (United States); University of Surrey, Department of Physics, Guildford, Surrey (United Kingdom); Basunia, M.S.; Fallon, P.; Jeppesen, H.B.; McMahan, M.A.; Phair, L.; Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bernstein, L.A. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Bleuel, D.L.; Burke, J.T.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Brown, N. [Georgia Institute of Technology, School of Physics, Atlanta, GA (United States); Dudziak, K.R.; LeBlanc, J.D.; Meyer, D.A. [Rhodes College, Department of Physics, Memphis, TN (United States); Evans, K.E. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Lesher, S.R. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of Wisconsin-La Crosse, Department of Physics, La Crosse, WI (United States); Stroberg, S.R. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); TRIUMF, Vancouver, British Columbia (Canada); Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, CA (United States); iThemba LABS, Department of Nuclear Physics, P.O. Box 722, Somerset West (South Africa)
2017-03-15
A segmented Si-telescope and HPGe array, STARS-LIBERACE, was used to study the {sup 156}Gd(p, tγ){sup 154}Gd direct reaction by particle-γ coincidence spectroscopy. New cross sections with a 25MeV proton beam are reported and compared to previous (p, t) and (t, p) studies. Furthermore, additional evidence for coexisting K{sup π} = 0{sub 1}{sup +}, 2{sub 1}{sup +} and 0{sub 2}{sup +}, 2{sub 2}{sup +} configurations at N = 90 is presented. Direct and indirect population patterns of the low-lying states are also explored. Review of the new and existing evidence favors an interpretation based on a configuration-dependent pairing interaction. The weakening of monopole pairing strength and an increase in quadrupole pairing strength could bring 2p-2h 0{sup +} states below 2Δ. This may account for a large number of the low-lying 0{sup +} states observed in two-nucleon transfer reactions. A hypothesis for the origin of the 0{sub 2}{sup +} and 0{sub 3}{sup +} states is provided. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Abramowicz, H. [Tel Aviv Univ. (Israel). School of Physics; Max Planck Institute for Physics, Munich (Germany); Abt, I. [Max Planck Institute for Physics, Munich (Germany); Adamczyk, L. [AGH-Univ. of Science and Technology, Krakow (Poland). Faculty of Physics and Applied Computer Science] [and others; Collaboration: ZEUS Collaboration
2012-08-15
Measurements of neutral current cross sections for deep inelastic scattering in e{sup +}p collisions at HERA with a longitudinally polarised positron beam are presented. The single-differential cross-sections d{sigma}/dQ{sup 2}, d{sigma}/dx and d{sigma}/dy and the reduced cross-section {sigma} were measured in the kinematic region Q{sup 2}>185 GeV{sup 2} and y<0.9, where Q{sup 2} is the four-momentum transfer squared, x the Bjorken scaling variable, and y the inelasticity of the interaction. The measurements were performed separately for positively and negatively polarised positron beams. The measurements are based on an integrated luminosity of 135.5 pb{sup -1} collected with the ZEUS detector in 2006 and 2007 at a centre-of-mass energy of 318 GeV. The structure functions F{sub 3} and F{sup {gamma}Z}{sub 3} were determined by combining the e{sup +}p results presented in this paper with previously published e{sup -}p neutral current results. The asymmetry parameter A{sup +} is used to demonstrate the parity violation predicted in electroweak interactions. The measurements are well described by the predictions of the Standard Model.
Energy Technology Data Exchange (ETDEWEB)
Shepard, J R; Rost, E; Smith, G R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.
1979-12-01
Previous unsuccessful analyses of /sup 4/He(p,d)/sup 3/He at intermediate energies have employed densities based directly on the measured e/sup -/ + /sup 4/He elastic scattering. When the effects of pion exchange currents are removed, the resulting DWBA analysis is in qualitative agreement with the experimental data.
The {sup 7}Li(d, p){sup 8}Li reaction in inverse kinematics at 5.44 MeV/u
Energy Technology Data Exchange (ETDEWEB)
Pakou, A.; Aslanoglou, X.; Sgouros, O.; Soukeras, V. [The University of Ioannina, Department of Physics and HINP, Ioannina (Greece); Keeley, N. [National Centre for Nuclear Research, Otwock (Poland); Cappuzzello, F. [INFN Laboratori Nazionali del Sud, Catania (Italy); Universita di Catania, Dipartimento di Fisica e Astronomia, Catania (Italy); Acosta, L. [Universidad Nacional Autonoma de Mexico, Instituto de Fisica, Mexico City (Mexico); INFN Sezione di Catania, Catania (Italy); Agodi, C.; Calabrese, S.; Carbone, D.; Cavallaro, M. [INFN Laboratori Nazionali del Sud, Catania (Italy); Foti, A. [Universita di Catania, Dipartimento di Fisica e Astronomia, Catania (Italy); INFN Sezione di Catania, Catania (Italy); Marquinez-Duran, G.; Martel, I. [Universidad de Huelva, Departamento de Ciencias Integradas, Facultad de Ciencias Experimentales, Campus de El Carmen, Huelva (Spain); Mazzocco, M.; Strano, E. [Universita di Padova, Dipartimento di Fisica e Astronomia, Padova (Italy); INFN Sezione di Padova, Padova (Italy); Parascandolo, C.; Pierroutsakou, D. [INFN Sezione di Napoli, Napoli (Italy); Rusek, K. [University of Warsaw, Heavy Ion Laboratory, Warsaw (Poland); Zagatto, V.A.B. [Instituto de Fisica da Universidade Federal Fluminense, Niteroi, RJ (Brazil)
2017-08-15
New data are presented for the {sup 7}Li(d, p){sup 8}Li stripping reaction which, together with previously reported elastic scattering data taken in the same experiment, provide a coherent set. These data, plus existing measurements of the elastic scattering and stripping at 6 MeV/u were analysed within the same coupled reaction channels scheme. Good descriptions of the stripping data to the 0.0 MeV 2{sup +} and 0.98 MeV 1{sup +} states of {sup 8}Li were obtained using a set of left angle {sup 8}Li vertical stroke {sup 7}Li + n right angle overlaps taken from the literature, provided that the elastic scattering was also well described. Multi-step reaction paths made significant contributions to the description of the larger angle data. The asymptotic normalisation coefficients are compared with previous determinations. (orig.)
Trojan Horse Method and RIBs: The {sup 18}F(p,{alpha}){sup 15}O reaction at astrophysical energies
Energy Technology Data Exchange (ETDEWEB)
Cherubini, S.; Gulino, M.; Rapisarda, G. G.; Spitaleri, C.; La Cognata, M.; Lamia, L.; Kubono, S.; Yamaguchi, H.; Hayakawa, S.; Wakabayashi, Y.; Iwasa, N.; Kato, S.; Komatsubara, H.; Teranishi, T.; Coc, A.; De Sereville, N.; Hammache, F. [Dipartimento di Fisica ed Astronomia, Universita di Catania and INFN-LNS, Catania (Italy); INFN-LNS, Catania (Italy) and UniKORE, Enna (Italy)
2012-11-12
The abundance of {sup 18}F in Nova explosions is an important issue for the understanding of this astrophysical phenomenon. For this reason it is necessary to study the nuclear reactions that produce or destroy this isotope in novae. Among these latter processes, the {sup 18}F(p,{alpha}){sup 15}O is one of the main {sup 18}F destruction channels. We report here on the preliminary results of the first experiment that applies the Trojan Horse Method to a Radioactive Ion Beam induced reaction. The experiment was performed using the CRIB apparatus of the Center for Nuclear Study of The Tokyo University.
Petrov, V A
2001-01-01
The behaviour of the proton structure function F sub 2 sup p (x, Q sup 2) in the region of small x is described in the framework of the generalized off-shell extention of the Regge-eikonal approach which automatically takes into account off-shell unitarity. A good quality is achieved of description of the experimental data for x < 10 sup - sup 2 and it is argued that the data on F sub 2 sup p (x, Q sup 2) measured at HERA can be fairly well described with classical universal Regge trajectories. No extra, hard trajectories of high intercept are needed for that. The x, Q sup 2 slopes and the effective intercept are discussed as functions of x and Q sup 2
Energy Technology Data Exchange (ETDEWEB)
Sadeghi, Mahdi [Agricultural, Medical and Industrial Research School, Nuclear Science and Technology Research Institute, P.O. Box 31485/498, Karaj (Iran, Islamic Republic of)], E-mail: msadeghi@nrcam.org; Karimi, Elham; Sardari, Darush [Faculty of Engineering, Research and Science Campus, Islamic Azad University, Tehran (Iran, Islamic Republic of)
2009-09-15
In radiation treatments of some types of brain tumors, such as craniopharyngiomas, selection of an appropriate radionuclide is critical. The aim of this work was to calculate distributions of dose rates from {sup 32}P and {sup 186}Re in radiocolloids injected into craniopharyngioma cysts. The calculations were performed with the MCNP4C radiation transport code. Analytical calculations based on the Loevinger formula were also performed for {sup 32}P with the MATLAB software. The results of the two techniques for identical models were compared. The effects of the cyst wall type and of the density of the cyst inner fluid were investigated. The {sup 32}P activities required for providing 200, 250, and 300 Gy to cysts of different sizes were calculated.
Energy Technology Data Exchange (ETDEWEB)
Akimoto, Tetsuo; Seong, Jinsil; Hunter, Nancy R; Buchmiller, Lara; Mason, Kathy; Milas, Luka
1999-05-01
Purpose: The study investigated whether basal, constitutive levels of p21{sup WAF1/CIP1} protein in murine carcinomas are related to in vivo tumor radioresponse. The study is based on recent observations demonstrating that in vitro cancer cell lines are resistant to cytotoxic drugs when they express high basal levels of p21{sup WAF1/CIP1} protein, and that the loss of the p21 gene in the HCT116 human colorectal cancer cell line results in increased radioresponse of xenografts derived from that cell line. Methods and Materials: Protein levels of p21{sup WAF1/CIP1}, p53, bax, and bcl-2 were determined in 8 carcinomas (3 mammary carcinomas designated MCa-4, MCa-29, and MCa-35, 2 squamous cell carcinomas designated SCC-IV and SCC-VII, ovarian adenocarcinoma OCa-I, hepatocarcinoma HCa-I, and adenosquamous carcinoma ACa-SG) syngeneic to C3Hf/Kam mice using Western blot analysis. The tumors, growing in the right hind legs of mice, were 8 mm in diameter at the time of analysis. These tumors greatly differ in their radioresponse, assessed by TCD50 assay, and in their susceptibility to radiation-induced apoptosis. Results: Protein levels of these oncogenes varied among tumors, with p21{sup WAF1/CIP1} showing the greatest variation: its mean densitometric value ranged from 1 to 19. Bcl-2 levels also showed broad variation in densitometric values, from 1 to 10. In comparison, bax and p53 (7 of 8 tumors contained wild-type p53) varied much less among different tumor types; their variation was within a 5-fold range, and the level of p53 was similar in 6 of 8 tumors. Tumor radioresponse correlated significantly (R = 0.77, p = 0.02) only with the magnitude of p21{sup WAF1/CIP1}expression: tumors with high levels of p21{sup WAF1/CIP1}were less radiocurable than those with lower levels. Tumor radiocurability showed a significant positive correlation (p = 0.02) with the extent of radiation-induced apoptosis, indicating that tumors that responded to radiation with higher percentages
Evidence for leading mesons in anti p sup 4 He reactions at 0. 6 GeV c sup -1 incident momentum
Energy Technology Data Exchange (ETDEWEB)
Balestra, F.; Bossolasco, S.; Bussa, M.P.; Busso, L.; Fava, L.; Ferrero, L.; Grasso, A.; Maggiora, A.; Panzieri, D.; Piragino, G.; Piragino, R.; Tosello, F. (Ist. di Fisica Generale ' A. Avogadro' , Univ. of Turin (Italy) INFN, Sezione di Torino (Italy)); Bendiscioli, G.; Filippini, V.; Rotondi, A.; Salvini, P.; Venaglioni, A.; Zenoni, A. (Dipt. di Fisica Nucleare e Teoria, Univ. of Pavia (Italy) INFN, Sezione di Pavia (Italy)); Batusov, Yu.; Bunyatov, S.A.; Falomkin, I.V.; Nichitiu, F.; Pontecorvo, G.B.; Rozhdestvensky, A.M.; Sapozhnikov, M.G.; Tretyak, V.I. (Joint Inst. of Nuclear Research, Dubna (USSR)); Guaraldo, C. (Lab. Nazionali di Frascati dell' INFN (Italy)); Lodi Rizzini, E. (Dipt. di Automazione Industriale, Univ. of Brescia (Italy) INFN, Sezione di Pavia (Italy)); Haatuft, A.; Halsteinslid, A.; Myklebost, K.; Olsen, J.M. (Physics Dept., Univ. of Bergen (Norway)); Breivik, F.O.; Danielsen, K.M.; Jacobsen, T.; Soerensen, S.O. (Inst. of Physics, Univ. of Oslo (Norway))
1991-01-01
Leading mesons are seen in anti p {sup 4}He {yields} neutral strange particles at 0.6 GeV c{sup -1} incident momentum. These results differ somewhat from our previous results from anti p Ne-reactions. The concept of an ''effective target'' is useless. (orig.).
Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes
International Nuclear Information System (INIS)
Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.
1988-01-01
The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients
Intonational speech prosody encoding in the human auditory cortex.
Tang, C; Hamilton, L S; Chang, E F
2017-08-25
Speakers of all human languages regularly use intonational pitch to convey linguistic meaning, such as to emphasize a particular word. Listeners extract pitch movements from speech and evaluate the shape of intonation contours independent of each speaker's pitch range. We used high-density electrocorticography to record neural population activity directly from the brain surface while participants listened to sentences that varied in intonational pitch contour, phonetic content, and speaker. Cortical activity at single electrodes over the human superior temporal gyrus selectively represented intonation contours. These electrodes were intermixed with, yet functionally distinct from, sites that encoded different information about phonetic features or speaker identity. Furthermore, the representation of intonation contours directly reflected the encoding of speaker-normalized relative pitch but not absolute pitch. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Energy Technology Data Exchange (ETDEWEB)
Egorova, Bayirta V. [Lomonosov Moscow State Univ., Moscow (Russian Federation). Chemistry Dept.; Oshchepkov, Maxim S.; Fedorova, Olga A. [Mendeleev University of Chemistry and Technology of Russia, Moscow (Russian Federation); Russian Academy of Sciences, Moscow (Russian Federation). A.N. Nesmeyanov Institute of Organoelement Compounds; Fedorov, Yury V. [Lomonosov Moscow State Univ., Moscow (Russian Federation). Chemistry Dept.; Russian Academy of Sciences, Moscow (Russian Federation). A.N. Nesmeyanov Institute of Organoelement Compounds; Budylin, Gleb S.; Shirshin, Evgeny A. [Lomonosov Moscow State Univ., Moscow (Russian Federation). Dept. of Physics; Kalmykov, Stepan N. [Lomonosov Moscow State Univ., Moscow (Russian Federation). Chemistry Dept.; National Research Center ' Kurchatov Institute' , Moscow (Russian Federation)
2016-11-01
Polyaminopolycarboxylates are attractive ligands for binding cationic radionuclides for synthesis of radiopharmaceuticals with target delivery to tumor cells. Nowadays beta emitting Y-90 and Lu-177 are used as therapeutic agents, while Ac-225 and Bi-213 are considered as perspective for alpha therapy. In the present study new data on complexation of Y{sup 3+}, Lu{sup 3+}, Ac{sup 3+} and Bi{sup 3+} with 2,2'-(15-formyl-2,3,5,6,8,9,11,12-octahydrobenzo [b][1,4,10,7,13]trioxadiazacyclopentadecine-4,10- diyl)diacetic acid are presented. For ligand and complexes characterization potentiometric titration, solvent extraction, chromatography and solubility techniques were applied. The highest values of stability constants within the range of log K = 5.8 - 7.5 were found for Ac{sup 3+} and REE. Fast complex formation is established which is beneficial for practical applications in radiopharmaceutical synthesis.
Venkova, T; Bauchet, A; Deloncle, I; Astier, A; Buforn, N; Meyer, M; Prevost, A; Redon, N; Stezowski, O; Lalkovski, S; Donadille, L; Dorvaux, O; Gall, B J P; Schulz, N; Lucas, R; Minkova, A
2002-01-01
The sup 1 sup 0 sup 9 sup , sup 1 sup 1 sup 1 sup , sup 1 sup 1 sup 3 Rh nuclei have been produced as fission fragments in the fusion reaction sup 1 sup 8 O + sup 2 sup 0 sup 8 Pb at 85 MeV. Their level schemes have been built from gamma-rays detected using the Euroball IV array. High-spin states of the neutron-rich sup 1 sup 1 sup 1 sup , sup 1 sup 1 sup 3 Rh nuclei have been identified for the first time. Several rotational bands with the odd proton occupying the pi g sub 9 sub / sub 2 , pi p sub 1 sub / sub 2 and pi(g sub 7 sub / sub 2 /d sub 5 sub / sub 2) sub-shells have been observed. A band of low-energy transitions has been identified at excitation energy around 2 MeV in sup 1 sup 0 sup 9 sup , sup 1 sup 1 sup 1 Rh, which can be interpreted in terms of three-quasiparticle excitation, pi g sub 9 sub / sub 2 nu h sub 1 sub 1 sub / sub 2 nu g sub 7 sub / sub 2 /d sub 5 sub / sub 2. In addition another structure built on states located at low excitation energy (608 keV in sup 1 sup 1 sup 1 Rh, 570 keV in ...
Energy Technology Data Exchange (ETDEWEB)
Kaminski, R.; Lesniak, L.; Rybicki, K. [Institute of Nuclear Physics, Cracow (Poland)
1996-06-01
A new analysis of S-wave production amplitudes for the reaction {pi}{sup -}p{yields}{pi}{sup +}{pi}{sup -}n on a transversely polarized target is performed. It is based on the results obtained by CERN-Cracow-Munich collaboration in the {pi}{pi} energy range from 600 MeV to 1600 MeV at 17.2 GeV/c {pi}{sup -} momentum. Energy-independent separation of the S-wave pseudoscalar amplitude ({pi} exchange) from the pseudovector amplitude (a{sub 1} exchange) is carried out using assumptions much weaker than those in all previous analyses. We show that, especially around 1000 MeV and around 1500 MeV, the a{sub 1} exchange amplitude cannot be neglected. The scalar-isoscalar {pi}{pi} phase shift are calculated using fairly weak assumptions. Our results are consistent both with the so called ``up`` and the well-known ``down`` solution, provided we choose those in which the S-wave phases increase slower with the effective {pi}{pi} mass than the P-wave phases. Above 1420 MeV both sets of phase shifts increase with energy faster than in the experiment on an unpolarized target. This fact can be related to the presence of scalar resonance f{sub o}(1500). (author). 41 refs, 9 figs, 1 tab.
2D {sup 31}P solid state NMR spectroscopy, electronic structure and thermochemistry of PbP{sub 7}
Energy Technology Data Exchange (ETDEWEB)
Benndorf, Christopher [Institut für Anorganische und Analytische Chemie, Universität Münster, Corrensstraße 30, 48149 Münster (Germany); Institut für Physikalische Chemie, Universität Münster, Corrensstraße 30, 48149 Münster (Germany); Hohmann, Andrea; Schmidt, Peer [Brandenburgische Technische Universität Cottbus-Senftenberg, Fakultät für Naturwissenschaften, Postfach 101548, 01958 Senftenberg (Germany); Eckert, Hellmut, E-mail: eckerth@uni-muenster.de [Institut für Physikalische Chemie, Universität Münster, Corrensstraße 30, 48149 Münster (Germany); Instituto de Física de Sao Carlos, Universidade de Sao Paulo, CEP 369, Sao Carlos, SP 13560-590 (Brazil); Johrendt, Dirk [Department Chemie, Ludwig-Maximilians-Universität München, Butenandtstraße 5-13, D-81377 München (Germany); and others
2016-03-15
Phase pure polycrystalline PbP{sub 7} was prepared from the elements via a lead flux. Crystalline pieces with edge-lengths up to 1 mm were obtained. The assignment of the previously published {sup 31}P solid state NMR spectrum to the seven distinct crystallographic sites was accomplished by radio-frequency driven dipolar recoupling (RFDR) experiments. As commonly found in other solid polyphosphides there is no obvious correlation between the {sup 31}P chemical shift and structural parameters. PbP{sub 7} decomposes incongruently under release of phosphorus forming liquid lead as remainder. The thermal decomposition starts at T>550 K with a vapor pressure almost similar to that of red phosphorus. Electronic structure calculations reveal PbP{sub 7} as a semiconductor according to the Zintl description and clearly shows the stereo-active Pb-6s{sup 2} lone pairs in the electron localization function ELF. - Graphical abstract: Coordination of the lead atoms in PbP{sub 7}.
Neutron cross section covariances in the resonance region: 52Cr, 56Fe, 58Ni
Energy Technology Data Exchange (ETDEWEB)
Oblozinsky, P.; Cho, Y.-S.; Mattoon, C.M.; Mughabghab, S.F.
2010-08-03
We evaluated covariances for neutron capture and elastic scattering cross sections on major structural materials, {sup 52}Cr, {sup 56}Fe and {sup 58}Ni, in the resonance region which extends beyond 800 keV for each of them. Use was made of the recently developed covariance formalism based on kernel approximation along with data in the Atlas of Neutron Resonances. The data of most interest for AFCI applications, elastic scattering cross section uncertainties at energies above about few hundred keV, are on the level of about 12% for {sup 52}Cr, 7-8% for {sup 56}Fe and 5-6% for {sup 58}Ni.
Energy Technology Data Exchange (ETDEWEB)
Skopenko, V V; Savost' yanova, A F; Trachevskij, V V; Gorbalyuk, A D; Sukhan, T A [Kievskij Gosudarstvennyj Univ., Kiev (Ukrainian SSR)
1991-01-01
By the methods of conductometry, IR, electron and {sup 1}H, {sup 13}C, {sup 31}P NMR spectroscopy nonaqueous solutions of the compounds (La(S{sub 2}CNEt{sub 2})Hmpa{sub 5})(BPh{sub 4}){sub 2}, Hmpa=OP(NMe{sub 2}){sub 3}; (Ln(S{sub 2}CNEt{sub 2}){sub 2}Hmpa{sub 3})BPh{sub 4}, Ln=Y, La-Lu; (Ln(S{sub 2}CNEt{sub 2}){sub 3}Hmpa{sub 2}), Ln=La-Gd, have been investigated. It is ascertained that bis-dithiocarbamate compounds are dissolved in all the studied solvents with preservation of composition and structure of lanthanide (3) inner coordination sphere. Tris-dithiocarbamates in nonaqueous solutions are subjected to reactions of ligand redistribution according to schemes depending on the solvent nature. In the process of dissolving of lanthanum monodithiocarbamate bond isomerization of dithiocarbamate groups occurs, which is pronounced in splitting of {sup 1}H and {sup 13}C NMR signals.
Directory of Open Access Journals (Sweden)
Kevin Lai
Full Text Available Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal or concreteness (abstract vs. concrete of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.
Lai, Kevin; She, Hsiao-Ching; Chen, Sheng-Chang; Chou, Wen-Chi; Huang, Li-Yu; Jung, Tzyy-Ping; Gramann, Klaus
2012-01-01
Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal) or concreteness (abstract vs. concrete) of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC) during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.
Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein
Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.
1993-01-01
A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these
Unpolarized neutral current e{sup {+-}}p cross section measurements at the H1 experiment, HERA
Energy Technology Data Exchange (ETDEWEB)
Habib, Shiraz Z.
2009-11-15
Measurements of the unpolarized inclusive neutral current reduced cross section in e{sup {+-}}p scattering at a center of mass energy {radical}(s) {approx_equal} 319 GeV are presented. The data was collected by the H1 detector during the HERA II running phase, after the 2000 luminosity upgrade, and corresponds to an integrated luminosity of 145 pb{sup -1} and 167 pb{sup -1} for the e{sup -}p and e{sup +}p periods respectively. The cross section measurements were made for the negative four-momentum transfer squared range 65{<=} Q{sup 2}{<=}30000 GeV{sup 2} and Bjorken-x range 0.00085{<=}x{<=}0.65. Dedicated measurements at inelasticity y=0.75 and Q{sup 2}{<=}800 GeV{sup 2} are also made. The details of the analysis are presented here. The cross section measurements presented here are found to agree with previously published data as well as predictions determined from various NLO QCD fits. Scaling violation of the F{sub 2} structure function as well differences between the e{sup -} and e{sup +} cross sections at high Q{sup 2} due to the xF{sub 3} structure function have been observed. The cross sections in the range Q{sup 2}{<=}800 GeV{sup 2} at inelasticity y=0.75 suggest non-zero values of the longitudinal structure function F{sub L}. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Nordberg, A; Winblad, B
1986-12-03
Nicotinic cholinergic receptors were measured in human frontal cortex using (/sup 3/H)nicotine and (/sup 3/H)acetylcholine (in the presence of atropine) as receptor ligands. A parallel marked reduction in number of (/sup 3/H)nicotine (52%, P<0.01) and (/sup 3/H)acetylcholine (-55%, P<0.05) binding was found in the frontal cortex of Alzheimer brains (AD/SDAT) when compared to age-matched control brains. As a comparison the number of muscarinic receptors was quantified using (/sup 3/H)quinuclidinyl benzilate and found to be significantly increased (+23%, P<0.01) in AD/SDAT compared to controls. 26 refs.
Energy Technology Data Exchange (ETDEWEB)
Szelecsenyi, Ferenc; Kovacs, Zoltan [Hungarian Academy of Sciences, Debrecen (Hungary). Cyclotron Application Dept.; Nagatsu, Kotaro; Zhang, Ming-Rong; Suzuki, Kazutosi [National Institute of Radiological Sciences, Chiba (Japan). Molecular Imaging Center
2014-09-01
The potential for production of the medically relevant {sup 64}Cu has been investigated by proton irradiation of highly enriched {sup 67}Zn targets. The excitation function of the {sup 67}Zn(p,α){sup 64}Cu a nuclear reaction was measured by the stacked-foil technique up to 30 MeV. The prediction of the TALYS code was also compared to the measured cross section results. Based on the improved database of the {sup 67}Zn(p,α){sup 64}Cu reaction, thick target yield as a function of energy was also deduced. Production possibility of {sup 64}Cu is discussed in detail, employing different energy proton beams and with regards to the {sup 61}Cu and {sup 67}Cu contamination levels as a function of the target enrichment level. By using 1 μA beam intensity, 6.3505 h irradiation time and enriched {sup 67}Zn target ({sup 64}Zn ≤ 0.5%, {sup 66}Zn ≤ 9%, {sup 67}Zn ≥ 80%, {sup 68}Zn ≤ 10% and {sup 70}Zn ≤ 0.5%), the expected EOB (End Of bombardment) yields are 43.66, 88.80 and 156.14MBq/μA at 12, 15 and 18 MeV proton energies, respectively. Application time-frames were also deduced where the total radio-copper contamination level remains below 1%. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Turaihi, K.; Khokher, M.A.; Barradas, M.A.; Mikhailidis, D.P.; Dandona, P. (Royal Free Hospital and School of Medicine, London (England))
1989-08-01
Although active transport of potassium into human platelets has been demonstrated previously, there is hitherto no evidence that human platelets have an ouabain-inhibitable Na-K ATPase in their membrane. The present study demonstrates active rubidium (used as an index of potassium influx), {sup 86}Rb(K), influx into platelets, inhibitable by ouabain, and also demonstrates the presence of specific ({sup 3}H)ouabain binding by the human platelet. This {sup 86}Rb(K) influx was stimulated by adrenaline, isoprenaline, and salbutamol, but noradrenaline caused a mild inhibition. Active {sup 86}Rb(K) influx by platelets was inhibited markedly by timolol, mildly by atenolol, but not by phentolamine. Therefore, active {sup 86}Rb(K) influx in human platelets is enhanced by stimulation of beta adrenoceptors of the beta 2 subtype. The platelet may therefore replace the leukocyte in future studies of Na-K ATPase activity. This would be a considerable advantage in view of the ease and rapidity of preparation of platelets.
Energy Technology Data Exchange (ETDEWEB)
Härkönen, J., E-mail: jaakko.harkonen@helsinki.fi [Helsinki Institute of Physics (Finland); Tuovinen, E. [Helsinki Institute of Physics (Finland); VTT Technical Research Centre of Finland, Microsystems and Nanoelectronics (Finland); Luukka, P.; Gädda, A.; Mäenpää, T.; Tuominen, E.; Arsenovich, T. [Helsinki Institute of Physics (Finland); Junkes, A. [Institute for Experimental Physics, University of Hamburg (Germany); Wu, X. [VTT Technical Research Centre of Finland, Microsystems and Nanoelectronics (Finland); Picosun Oy, Tietotie 3, FI-02150 Espoo Finland (Finland); Li, Z. [School of Materials Science and Engineering, Xiangtan University, Xiangtan, Hunan 411105 (China)
2016-08-21
Detectors manufactured on p-type silicon material are known to have significant advantages in very harsh radiation environment over n-type detectors, traditionally used in High Energy Physics experiments for particle tracking. In p-type (n{sup +} segmentation on p substrate) position-sensitive strip detectors, however, the fixed oxide charge in the silicon dioxide is positive and, thus, causes electron accumulation at the Si/SiO{sub 2} interface. As a result, unless appropriate interstrip isolation is applied, the n-type strips are short-circuited. Widely adopted methods to terminate surface electron accumulation are segmented p-stop or p-spray field implantations. A different approach to overcome the near-surface electron accumulation at the interface of silicon dioxide and p-type silicon is to deposit a thin film field insulator with negative oxide charge. We have processed silicon strip detectors on p-type Magnetic Czochralski silicon (MCz-Si) substrates with aluminum oxide (Al{sub 2}O{sub 3}) thin film insulator, grown with Atomic Layer Deposition (ALD) method. The electrical characterization by current–voltage and capacitance−voltage measurement shows reliable performance of the aluminum oxide. The final proof of concept was obtained at the test beam with 200 GeV/c muons. For the non-irradiated detector the charge collection efficiency (CCE) was nearly 100% with a signal-to-noise ratio (S/N) of about 40, whereas for the 2×10{sup 15} n{sub eq}/cm{sup 2} proton irradiated detector the CCE was 35%, when the sensor was biased at 500 V. These results are comparable with the results from p-type detectors with the p-spray and p-stop interstrip isolation techniques. In addition, interestingly, when the aluminum oxide was irradiated with Co-60 gamma-rays, an accumulation of negative fixed oxide charge in the oxide was observed.
Energy Technology Data Exchange (ETDEWEB)
Watkinson, J.C.; Allen, S.; Lazarus, C.R.; Sinclair, J.; Blake, G.M.; Clarke, S.E.M. (Guy' s Hospital, London (UK))
1990-05-01
Technetium-99m ({sup 99}Tc{sup m})(V) dimercaptosuccinic acid (DMSA) is a new tumour imaging agent which has been used to evaluate squamous carcinoma (SCC) of the head and neck. This study evaluated the pharmacokinetics and biodistribution of {sup 99}Tc{sup m}(V)DMSA in patients with SCC and calculated the bone mass of a New Zealand White (NZW) rabbit. This data was then used to calculate the effective dose equivalent in man. A total of 16 patients were studied (5 with no tumour, 11 with tumour). {sup 99}Tc{sup m}(V)DMSA had a fast bi-exponential blood clearance in patients with no tumour (30 and 401 min) and patients with tumour (30 and 387 min) with no significant difference (p > 0.05) between the two groups. {sup 99}Tc{sup m}(V)DMSA had a fast cumulative urine excretion with mean half-times in non-tumour and tumour patients of 183 min and 244 min respectively. There was no significant difference (p > 0.05) between these two latter groups. The effective dose equivalent of {sup 99}Tc{sup m}(V)DMSA in man is 5.1 {mu}Sv/MBq. (author).
Energy Technology Data Exchange (ETDEWEB)
Efimov, G V; Ivanov, M A; Nogovitsyn, E A [Joint Inst. for Nuclear Research, Dubna (USSR)
1981-07-01
P..--> gamma gamma.. (P=..pi../sup 0/, eta, eta'), eta..--> pi../sup +/..pi../sup -/..gamma.., eta..--> pi../sup 0/..gamma gamma.., eta/sup 1/..-->..V..gamma.. (V=rho/sup 0/, ..omega..), p..--> gamma..l/sup +/l/sup -/ (p=..pi../sup 0/, eta, eta') radiation decays are studied for testing the applicability of the non-local quark model for description of the experimental data. The Feynman diagrams of these decays are presented, values of the widths of the Veta..--> gamma gamma.., eta..--> pi../sup +/..pi../sup -/..gamma.., eta..--> pi../sup 0/..gamma gamma.., eta'..--> gamma gamma.., eta'..-->..rho/sup 0/..gamma.., eta'..--> omega gamma.. decays are calculated and given in the form of a table. Calculations are carried out for two values of the eta eta'-crossing angle: THETA=-11 deg and -18 deg. Values of invariant amplitudes of these decays are determined for ..pi../sup 0/..--> gamma..e/sup +/e/sup -/, eta..--> gamma mu../sup +/..mu../sup -/, eta'..--> gamma mu../sup +/..mu../sup -/ decays at THETA=-11 deg and -18 deg. The best agreement with the experimental data is noted to take place at THETA=-11 deg, the determined width of the eta..--> pi../sup 0/..gamma gamma.. decays is underestimated as compared with the experimental one.
Energy Technology Data Exchange (ETDEWEB)
Akber, S.F. (Texas Medical School, Houston, TX (United States). Dept. of Radiology)
1991-12-01
The uptake and binding mechanism of biogenic amines in the lungs has been studied extensively with no conclusive results. The competition between N-isopropyl-{sup 123}I-p-iodo amphetamines ({sup 123}I-IMP) and propranolol and {sup 123}I-IMP and ketamine, in the lungs suggest that the pK{sub a} value of the biogenic amines has a significant role to play in the mechanism of uptake and retention of biogenic amines in the lungs. (orig.).
New high spin states and band termination in {sup 83}Y and {sup 84}Zr
Energy Technology Data Exchange (ETDEWEB)
Johnson, T.D.; Aprahamian, A. [University of Notre Dame, Notre Dame, Indiana 46556 (United States); Lister, C.J.; Blumenthal, D.J.; Crowell, B. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Chowdhury, P. [University of Massachusetts, Lowell, Massachusetts 01854 (United States); Fallon, P.; Machiavelli, A.O. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)
1997-03-01
The gamma decay of high spin yrast states in {sup 83}Y up to I{sup {pi}}=59/2{sup +} and 53/2{sup {minus}} have been observed using the reaction {sup 58}Ni({sup 29}Si,3p) at 110 MeV and the Gammasphere Early Implementation Array. The level scheme has been substantially extended due to the observations of several new transitions in all of the bands. A sequence of transitions feeding into the positive parity yrast band above I{sup {pi}}=47/2{sup +} seems to be consistent with a noncollective oblate structure expected at these high spins. A similar cascade is found in the data for {sup 84}Zr. A new forking of the favored negative parity band is found which may be due to neutron alignment polarizing the core to a different shape. This suggests that the {open_quotes}isomeric{close_quote}{close_quote} band in {sup 83}Y, for which one more connecting transition was found, is of a similar nature to other high-K bands found in this region. Lifetime measurements in the unfavored negative parity band are consistent with cranking calculations which predict a nearly oblate shape with a deformation parameter {beta}{sub 2}{approx}0.2. A qualitative analysis of line shapes at very high spins suggests the persistence of collectivity in the yrast sequence to the highest excitations seen. {copyright} {ital 1997} {ital The American Physical Society}
Energy Technology Data Exchange (ETDEWEB)
Diaz A, L V
2003-07-01
The {sup 99m}Tc are the radionuclide more used in the nuclear medicine, it is used for diagnostic and therapy, and he is commonly takes place by means of a generator {sup 99} Mo-{sup 99m}Tc, using molybdenum ({sup 99}Mo) product of the fission of the uranium, adsorbed over alumina. This generator imposes the use of high activities you specify of {sup 99} Mo, as well as of complex processes of separation of the one {sup 99} Mo, generating important quantities of radioactive waste of medium activity. As well as, the production of these generators, demands the use of reactors of great capacity that Mexico not it possesses, in such a way that, presently work is carried out a generator of {sup 99} Mo- {sup 99m} Tc, in the one which {sup 99} Mo taken place by the reaction {sup 98} Mo(n, {gamma}) {sup 99} Mo that it was part from a gel to base is used of molybdate and zirconium. It was found, therefore, to produce a generator {sup 99} Mo- {sup 99m}Tc with the help of gels of zirconium and molybdates with the same characteristics of quality and purity that those obtained by the one traditional generator and that it can be carried out under the conditions technical-economics prevailing in Mexico. Specifically, this work has been focused to the study of the effect caused by the variation of the one p H in the solutions of ZrOCl{sub 2} * 8H{sub 2}O (zirconil) and of molybdates, of the relationships molars zirconium : molybdenum (Zr:Mo), as well as the effect of the concentration variation, time of preparation and consequently p H of the ZrOCl{sub 2} * 8H{sub 2}O in the synthesis of the gel zirconium - {sup 99} molybdenum, on the efficiency of the generator and the quantity of {sup 99} Mo presents in the {sup 99m} Tc taken place by this means. The gel used for the production of {sup 99m}Tc will possess a discharge efficiency of recovery of {sup 99m}Tc and a contained first floor of pollutants, in particular smaller to 0.015% of {sup 99} Mo, main source of impurity radionuclide
Energy Technology Data Exchange (ETDEWEB)
Belyaev, A.A.; Get' man, V.A.; Gorbenko, V.G.; Gushchin, V.A.; Derkach, A.Y.; Zhebrovskii, Y.V.; Karnaukhov, I.M.; Kolesnikov, L.Y.; Lukhanin, A.A.; Rubashkin, A.L.; Sorokin, P.V.; Sporov, E.A.; Telegin, Y.N.
1982-03-01
We report an experimental study of the ..sigma.., T, and P parameters of the cross section for the reaction ..gamma..p..-->..p..pi../sup 0/ for photon energies 300, 320, 350, 380, 400, 420 MeV in the range of pion emission angles 60--135/sup 0/ c.m.s. The technique of a double polarization experiment with use of linearly polarized photons and a polarized proton target is described. The experimental results are compared with the predictions of theoretical analyses.
Structure and chromosomal localization of the human lymphotoxin gene
International Nuclear Information System (INIS)
Nedwin, G.E.; Jarrett-Nedwin, J.; Smith, D.H.; Naylor, S.L.; Sakaguchi, A.Y.; Goeddel, D.V.; Gray, P.W.
1987-01-01
The authors have isolated, sequenced, and determined the chromosomal localization of the gene encoding human lymphotoxin (LT). The single copy gene was isolated from a human genomic library using a /sup 32/P-labeled 116 bp synthetic DNA fragment whose sequence was based on the NH/sub 2/-terminal amino acid sequence of LT. The gene spans 3 kb of DNA and is interrupted by three intervening sequences. The LT gene is located on human chromosome 6, as determined by Southern blot analysis of human-murine hybrid DNA. Putative transcriptional control regions and areas of homology with the promoters of interferon and other genes are identified
Energy Technology Data Exchange (ETDEWEB)
Dolle, F.; Thominiaux, C.; Hinnen, F.; Demphel, S.; Le helleix, S.; Chauveau, F.; Boutin, H.; Herard, A.S.; Hantraye, P.; Tavitian, B. [Service Hospitalier Frederic Joliot, I2BM/DSV, 91 - Orsay (France); Kassiou, M.; James, M.; Creelman, A.; Fulton, R. [Sydney Univ., Brain and Mind Research Institute, NSW (Australia); Kassiou, M. [Sydney Univ., Discipline of Medical Radiations, Sciences and School of Chemistry, NSW (Australia); Katsifis, A.; Greguric, I.; Mattner, F.; Loch, C. [Radiopharmaceuticals Research Institute, ANSTO, NSW (Australia); Selleri, S. [Degli Studi di Firenze Univ., Dipt. di Scienze Farmaceutiche (Italy)
2008-02-15
{sup 11}C P.K.11195 is not only the oldest, but also the most widely used PET radiotracer for in vivo imaging of the peripheral benzodiazepine receptors (P.B.R. or translocator protein (18 kDa, T.S.P.O.). With the aim of developing a new PET imaging probe for the in vivo study of the P.B.R., two pyrazol [1,5-a]pyrimidineacetamides (D.P.A.-713 and D.P.A.-715) and one imidazol[1,2-a]pyridine-acetamide (C.L.I.N.M.E.) were radiolabelled with the positron emitters carbon{sup 11} (half life: 20.38 min) [1-5]. Briefly, C.L.I.N.M.E. (2-[6-chloro-2(4-iodophenyl)-imidazol[1,2-a]pyridin-3-yl] -N-ethyl-N-methyl-acetamide) was labelled at its methyl-acetamide moity chain from the corresponding nor-analogue using[{sup 11}C]methyl iodide (in D.M.S.O./D.M.F (100/200 {mu}L) containing powdered K.O.H. (3-5 mg) at 110 degrees C for 3 min. D.P.A.-713 (N,N-diethyl-2-[2-(4-methoxy-phenyl)-5,7-dimethyl-pyrazolo[1,5-a]pyrimidin -3-yl]acetamide) and D.P.A.-715 (N,N-diethyl-2-[2-(4-methoxy-phenyl)-5,7-bis-tri-fluoro-methyl-pyrazolo [1,5-a]pyrimidin-3-yl]acetamide) were labelled at their aromatic methoxy groups from the corresponding nor-derivatives using [{sup 11}C]methyl triflate (in acetone (300{mu}L) containing aq. 3 M NaOH (4{mu}L) at 110 degrees C for 1 min). All radioligands were purified using semi preparative Zorbax reverse phase H.P.L.C., were adequately formulated for in vivo injection within 30 min and were found to be > 95% chemically and radiochemically pure. (N.C.)
{sup 131}I-SPGP internal dosimetry: animal model and human extrapolation
Energy Technology Data Exchange (ETDEWEB)
Andrade, Henrique Martins de; Ferreira, Andrea Vidal; Soprani, Juliana; Santos, Raquel Gouvea dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: hma@cdtn.br; Figueiredo, Suely Gomes de [Universidade Federal do Espirito Santo, (UFES), Vitoria, ES (Brazil). Dept. de Ciencias Fisiologicas. Lab. de Quimica de Proteinas
2009-07-01
Scorpaena plumieri is commonly called moreia-ati or manganga and is the most venomous and one of the most abundant fish species of the Brazilian coast. Soprani 2006, demonstrated that SPGP - an isolated protein from S. plumieri fish- possess high antitumoral activity against malignant tumours and can be a source of template molecules for the development (design) of antitumoral drugs. In the present work, Soprani's {sup 125}ISPGP biokinetic data were treated by MIRD formalism to perform Internal Dosimetry studies. Absorbed doses due to the {sup 131}I-SPGP uptake were determinate in several organs of mice, as well as in the implanted tumor. Doses obtained for animal model were extrapolated to humans assuming a similar ratio for various mouse and human tissues. For the extrapolation, it was used human organ masses from Cristy/Eckerman phantom. Both penetrating and non-penetrating radiation from {sup 131}I were considered. (author)
Time reversal violation in the nuclear interaction and p(pol)-/sup 3/He scattering
Energy Technology Data Exchange (ETDEWEB)
Simonius, M [Eidgenoessische Technische Hochschule, Zurich (Switzerland). Lab. fuer Kernphysik; Wyler, D [Carnegie-Mellon Univ., Pittsburgh, Pa. (USA). Dept. of Physics
1977-08-08
Using T-violating boson-exchange interactions T-violating effects in low energy p-/sup 3/He scattering are calculated. The results are below 10/sup -3/ even for full strong (not millistrong) T-violation in the nucleon-nucleon system. It is argued, that the smallness of the effects is not a particularity of the p-/sup 3/He system but a general property of low energy processes.
MC148 encoded by human molluscum contagiosum poxvirus is an antagonist for human but not murine CCR8
DEFF Research Database (Denmark)
Lüttichau, H R; Gerstoft, J; Schwartz, T W
2001-01-01
The viral CC chemokines MC148, encoded by the poxvirus molluscum contagiosum, and viral macrophage inflammatory protein (vMIP)-I and vMIP-II, encoded by human herpesvirus 8, were probed on the murine CC receptor (CCR) 8 in parallel with human CCR8. In calcium mobilization assays, vMIP-I acted...... as a high-affinity agonist, whereas vMIP-II acted as a low-affinity antagonist on the murine CCR8 as well as the human CCR8. MC148 was found to bind and block responses through the human CCR8 with high affinity, but surprisingly MC148 was unable to bind and block responses through the murine CCR8. Because...
Spectroscopic Investigation of p-Shell Lambda Hypernuclei by the (e,e'K<sup>+>) Reaction
Energy Technology Data Exchange (ETDEWEB)
Chen, Chunhua [Hampton Univ., Hampton, VA (United States)
2014-08-01
Hypernuclear spectroscopy is a powerful tool to investigate Lambda-N interaction. Compared with other Lambda hypernuclei productions, electroproduction via the (e,e'K+) reaction has the advantage of exciting states deeply inside of the hypernucleus and achieving sub-MeV energy resolution. The E05-115 experiment, which was successfully performed in 2009, is the third generation hypernuclear experiment in JLab Hall C. A new splitter magnet and electron spectrometer were installed, and beam energy of 2.344 GeV was selected in this experiment. These new features gave better field uniformity, optics quality and made the tilt method more effective in improving yield-to-background ratio. The magnetic optics of the spectrometers were carefully studied with GEANT simulation, and corrections were applied to compensate for the fringe field cross talk between the compact spectrometer magnets. The non-linear least chi-squared method was used to further calibrate the spectrometer with the events from Lambda, Sigma0 and B12Lambda and uniform magnetic optics as well as precise kinematics were achieved. Several p-shell Lambda hypernuclear spectra, including B<sup>12sup>Λ, Be<sup>10sup>Λ, He<sup>7sup>Λ, were obtained with high energy resolution and good accuracy. For B<sup>12sup>Λ, eight peaks were recognized with the resolution of ~540keV (FWHM), and the ground state binding energy was obtained as 11.529 ± 0.012(stat.) ± 0.110(syst.) MeV. Be<sup>10sup>Λ, twelve peaks were recognized with the resolution of ~520keV (FWHM), and the binding energy of the ground state was determined as 8.710 ± 0.059(stat.) ± 0.114(syst.) MeV. For He<sup>7sup>Λ, three peaks were recognized with the resolution of ~730keV, and the ground state binding energy was obtained as 5.510 ± 0.050(stat.) ± 0.120(syst.) MeV. Compared with the published data of B<sup>12sup>Λ from the JLab Hall A experiment
Prevalence of Human Papillomavirus Type 58 in Women With or ...
African Journals Online (AJOL)
lesions.[7,8] Among these, at least 15 are considered high‑risk. HPV (HR‑HPV) and are strongly associated with progression. Prevalence of Human Papillomavirus Type 58 in Women With or Without Cervical Lesions in. Northeast Brazil. Fernandes JV, Carvalho MGF1, de Fernandes TAAM2, Araújo JMG, Azevedo PRM3,.
Energy Technology Data Exchange (ETDEWEB)
Langle, S.; Roger, G.; Lagnel-de Bruin, B.; Hinnen, F.; Bottlaender, M.; Dolle, F. [Service Hospitalier Frederic Joliot 91 - Orsay (France); Fulton, R.; Henderson, D. [RPAH, NSW (Australia); Kassiou, M. [Sydney Univ., NSW (Australia)
2008-02-15
Nicotinic acetylcholine receptors (n.A.Ch.R.) are crucial to many brain physiological functions and they are involved in a wide range of diseases of the brain making them attractive targets for tomographic imaging. Of particular interest, (((R)-2- [6-chloro-5-((E)-2-pyridin-4-yl-vinyl)-pyridin-3-yloxy]-1- methyl-ethyl)-methyl-amine) (p-P.V.P.-M.E.M.A.) displayed an affinity of Ki 0.077 nM for n.A.Ch.R. when using [{sup 3}H]cytisine and whole rat brain membrane [1]. p-P.V.P.-M.E.M.A. and its corresponding nor-methyl derivative where obtained using a multistep synthesis. [{sup 11}C]p-P.V.P.-M.E.M.A. prepared from the nor-methyl derivative as precursor and labeled with carbon-(T1/2 = 20.4 min) using [{sup 11}C]CH{sub 3}I. The reaction was conducted in D.M.F. using tetra-butyl ammonium hydroxide (T.B.A.H.) as base and allowed to react at room temperature for 2 min, followed by heating at 80 degrees C for 5 min. The reaction mixture was diluted with 0.5 m L of a solution of 0.1 M NH{sub 4}Ac (pH 10):A.C.N. (70:30; v:v) and injected onto a HPLC X Terra R.P. C-18 (7.8 x 300 mm, 10 mm) semi preparative reversed-phase column. Using a mobile phase of 0.1 M NH{sub 4}Ac (pH 10):A.C.N. (70:30; v:v) and a flow rate of 6.0 m L/min, the retention time (t.R.) of [{sup 11}C]p-P.V.P.-M.E.M.A. was 8.6 min. [{sup 11}C]p-P.V.P.-M.E.M.A. was isolated in a 1.5% (n = 4) non decay corrected radiochemical yield based on starting [{sup 11}C]CH{sub 3}I in an average synthesis time of 33.6 min (including H.P.L.C. purification and formulation). In the final product solution, radiochemical and chemical purity was greater than 99% with a specific activity of 86.4 GBq/mmol (2334 mCi/mmol). (authors)
Characterization of p75{sup +} ectomesenchymal stem cells from rat embryonic facial process tissue
Energy Technology Data Exchange (ETDEWEB)
Wen, Xiujie; Liu, Luchuan; Deng, Manjing; Zhang, Li; Liu, Rui; Xing, Yongjun; Zhou, Xia [Department of Stomatology, Daping Hospital and Research Institute of Surgery, Third Military Medical University, Chongqing 400042 (China); Nie, Xin, E-mail: dr.xinnie@gmail.com [Department of Stomatology, Daping Hospital and Research Institute of Surgery, Third Military Medical University, Chongqing 400042 (China)
2012-10-12
Highlights: Black-Right-Pointing-Pointer Ectomesenchymal stem cells (EMSCs) were found to migrate to rat facial processes at E11.5. Black-Right-Pointing-Pointer We successfully sorted p75NTR positive EMSCs (p75{sup +} EMSCs). Black-Right-Pointing-Pointer p75{sup +} EMSCs up to nine passages showed relative stable proliferative activity. Black-Right-Pointing-Pointer We examined the in vitro multilineage potential of p75{sup +} EMSCs. Black-Right-Pointing-Pointer p75{sup +}EMSCs provide an in vitro model for tooth morphogenesis. -- Abstract: Several populations of stem cells, including those from the dental pulp and periodontal ligament, have been isolated from different parts of the tooth and periodontium. The characteristics of such stem cells have been reported as well. However, as a common progenitor of these cells, ectomesenchymal stem cells (EMSCs), derived from the cranial neural crest have yet to be fully characterized. The aim of this study was to better understand the characteristics of EMSCs isolated from rat embryonic facial processes. Immunohistochemical staining showed that EMSCs had migrated to rat facial processes at E11.5, while the absence of epithelial invagination or tooth-like epithelium suggested that any epithelial-mesenchymal interactions were limited at this stage. The p75 neurotrophin receptor (p75NTR), a typical neural crest marker, was used to select p75NTR-positive EMSCs (p75{sup +} EMSCs), which were found to show a homogeneous fibroblast-like morphology and little change in the growth curve, proliferation capacity, and cell phenotype during cell passage. They also displayed the capacity to differentiate into diverse cell types under chemically defined conditions in vitro. p75{sup +} EMSCs proved to be homogeneous, stable in vitro and potentially capable of multiple lineages, suggesting their potential for application in dental or orofacial tissue engineering.
3' end labelling of RNA with /sup 32/P suitable for rapid gel sequencing
Energy Technology Data Exchange (ETDEWEB)
Winter, G; Brownlee, G G [Medical Research Council, Cambridge (UK)
1978-09-01
A new general method of labelling the 2', 3'-diol end of RNA with /sup 32/P has been devised suitable for gel sequencing. Poly(A) polymerase (E.coli) is incubated with the RNA and limiting amounts of ..cap alpha..-/sup 32/P-ATP. The mono-addition product is then cleaved with periodate and ..beta..-eliminated with aniline, leaving the RNA terminally labelled with 3'/sup 32/P-phosphate. When applied to a model compound, tRNAsup(Phe) from E. coli, over 28 residues could be read from the 3' end.
Energy Technology Data Exchange (ETDEWEB)
Sereville, N. de
2003-12-15
The gamma emission from novae at/or below 511 keV is due to the annihilation of the positrons produced in the beta + decay of F{sup 18}. The interpretation of this emission through observations made by the Integral satellite for instance, requires a good knowledge of F{sup 18} nucleosynthesis. The reaction rate of the F{sup 18}(p,{alpha})O{sup 15} is the least known because of 2 resonances corresponding to the levels 6.419 and 6.449 MeV of Ne{sup 19} whose proton widths are completely unknown. We have determined these proton widths via the study of one-nucleon transfer reaction D(F{sup 18},p{alpha})N{sup 15} populating equivalent levels in F{sup 19}. We have used a 14 MeV F{sup 18} radioactive beam on a CD{sub 2} target for inverse kinematics studies and the multi-track silicon detector LEDA. A DWBA (Distorted Wave Bound Approximation) has enabled us to determine the proton width of both resonances and has showed that they have an impact in the calculation of the reaction rate. A thorough study of the remaining uncertainties of the reaction rate has been undertaken, particularly for those concerning interferences between these resonances and a higher resonance of Ne{sup 19}. The reaction rate that we have obtained is very similar to the previous rate used but now it rests on a more solid basis.
N-isopropyl-p-iodoamphetamine receptors in normal and cancerous tissue of the human lung
Energy Technology Data Exchange (ETDEWEB)
Tanaka, Eiko; Mishima, Michiaki; Kawakami, Kenzo; Sakai, Naoki; Sugiura, Naoharu; Kuno, Kenshi [Kyoto Univ. (Japan). Dept. of Clinical Physiology; Taniguchi, Takashi [Kyoto Pharmaceutical Univ. (Japan). Dept. of Neurobiology
1993-04-01
N-Isopropyl-p-iodoamphetamine (IMP) receptors in normal human lung tissue were characterized using a radioligand binding assay with iodine-125 IMP as the ligand. Saturation binding studies revealed the presence of two binding sites with dissociation constant (K[sub d]) values of 53[+-]2 and 4687[+-]124 nM and maximum binding capacity (Bmax) values of 7[+-]1 and 133[+-]27 pmol/mg protein (n=5) respectively. The IC[sub 50] values of various amines were as follows: IMP, 9x10[sup -5] M; propranolol, 5x10[sup -4] M; haloperidol, 6x10[sup -4] M; ketamine, 9x10[sup -3] M; dopamine, 1x10[sup -2] M. The IMP receptors of cancerous tissue obtained from human lung also had two binding sites with K[sub d] values of 54[+-]2 and 5277[+-]652 nM and Bmax values of 7[+-]1 and 103[+-]21 pmol/mg protein (n=3) respectively. There was no significant difference in binding parameters between normal and cancerous lung tissue. These results demonstrate the existence of IMP receptors and suggest that cancer does not affect the nature of IMP receptors in human lung tissue. (orig.).
K/sup -/p interactions at 11 GeV/c: new results on strange meson systems
Energy Technology Data Exchange (ETDEWEB)
Ratcliff, B.N.
1980-06-01
The status of our programmatic study of states containing a strange quark is briefly reviewed. An 11 GeV/c K/sup -/p experiment run on the LASS spectrometer at SLAC is discussed and preliminary results presented for several inelastic channels based on approximately one half of the available data sample. In addition, new results utilizing the full statistics of the experiment are presented for the elastic K/sup -/..pi../sup +/ channel from the K/sup -/..pi../sup +/n final state. The well established leading K*(890), K*(1435), and K*(1780) resonances are observed, and clear evidence is presented for a new J/sup p/ = 4/sup +/ resonance at approx. 2070 MeV. Preliminary results from an energy independent partial wave analysis of these data are presented which display unambiguous evidence for resonant structure in the non-leading 0/sup +/ and 1/sup -/ waves.
Analyzing power measurements for the /sup 13/C(p vector,d)/sup 12/C reaction at 200 and 400 MeV
Energy Technology Data Exchange (ETDEWEB)
Liljestrand, R P; Cameron, J M; Hutcheon, D A; MacDonald, R; McDonald, W J; Miller, C A; Olsen, W C [Alberta Univ., Edmonton (Canada); Kraushaar, J J; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Rogers, J G [British Columbia Univ., Vancouver (Canada). TRIUMF Facility
1981-02-26
Cross sections and analyzing powers for the /sup 13/C(p vector,d) reaction have been measured at 200 and 400 MeV to the O/sup +/, ground state and 2/sup +/, 4.44 MeV state of /sup 12/C. While the cross sections are rather structureless, DWBA calculations in exact finite range account well for both the magnitude and shape of the angular distributions. On the other hand, the measured analyzing powers are in serious disagreement with the DWBA calculations.
Multi-jet cross sections in charged current e{sup {+-}}p scattering at HERA
Energy Technology Data Exchange (ETDEWEB)
Chekanov, S.; Derrick, M.; Magill, S. [Argonne National Laboratory, Argonne, IL (US)] (and others)
2008-02-15
Jet cross sections were measured in charged current deep inelastic e{sup {+-}}p scattering at high boson virtualities Q{sup 2} with the ZEUS detector at HERA II using an integrated luminosity of 0.36 fb{sup -1}. Differential cross sections are presented for inclusive-jet production as functions of Q{sup 2}, Bjorken x and the jet transverse energy and pseudorapidity. The dijet invariant mass cross section is also presented. Observation of three- and four-jet events in charged-current e{sup {+-}}p processes is reported for the first time. The predictions of next-to-leading-order (NLO) QCD calculations are compared to the measurements. The measured inclusive-jet cross sections are well described in shape and normalization by the NLO predictions. The data have the potential to constrain the u and d valence quark distributions in the proton if included as input to global fits. (orig.)
Study of the {sup 10}B(p,α){sup 7}Be reaction through the indirect Trojan Horse method
Energy Technology Data Exchange (ETDEWEB)
Puglia, S. M. R., E-mail: puglia@lns.infn.it [INFN Laboratori Nazionali del Sud and CSFNM-Centrosiciliano Fisica Nucleare e Struttura della Materia,Catania (Italy); Spitaleri, C.; Lamia, L.; Romano, S.; La Cognata, M.; Pizzone, R. G.; Rapisarda, G. G.; Sergi, M. L. [INFN Laboratori Nazionali del Sud and DMFCI- Università di Catania, Catania (Italy); Burjan, V.; Kroha, V.; Hons, Z.; Mrazek, J. [Institute for Nuclear Physics, Prague-Rez (Czech Republic); Carlin, N.; Del Santo, M. G.; Munhoz, M. G.; Souza, F.; Szanto de Toledo, A. [Universidade de São Paulo - DFN, São Paulo (Brazil); Chengbo, L.; Qungang, W.; Shu-Hua, Z. [China Institute of Atomic Energy, Beijing (China); and others
2015-02-24
Boron abundances in stellar atmospheres, as well as berillium and lithium ones, can give useful hints for non-standard transport processes discrimination in stars. They can also be relevant for understanding several astrophysical processes (e.g. primordial nucleosynthesis and spallation reactions in ISM). A comprehensive study of Li Be B abundances can therefore confirm or not the presence of non-standard mixing processes in stellar envelopes. For this reason nuclear processes producing or depleting boron isotope abundance need to be studied at astrophysical energies. The {sup 10}B(p,α){sup 7}Be reaction has been studied by means of the Trojan Horse Method. The Trojan Horse Method was thus applied to the {sup 10}B(d,α{sup 7}Be)n reaction, studied at 24 MeV. The obtained results will be discussed.
Energy Technology Data Exchange (ETDEWEB)
Reitz, Bjoern-Eric [Physikalisches Institut Bonn (Germany); Collaboration: BGO-OD-Collaboration
2016-07-01
The BGO-OD experiment at the ELSA facility in Bonn is built to investigate nucleon excitations via meson photoproduction. A program of measurements of reactions of associated strangeness in the final state has begun, one of which is γp → K{sup 0}Σ{sup +}. One research objective is associated production of strange particles. An interesting reaction channel is γp → K{sup 0}Σ{sup +}. This talk shows the preliminary results of the analysis for the charged decay channel K{sup 0}Σ{sup +} → π{sup -}π{sup +}π{sup 0}p. Due to the small production cross section kinematic fitting has been used to discriminate the wanted channel against background.
/sup 51/Cr-bleomycin, a new oncophilic radiopharmaceutical. Pt. 1
Energy Technology Data Exchange (ETDEWEB)
Rembelska, M J; Liniecki, J
1982-04-01
A method was developed for labelling bleomycin with /sup 51/Cr. The complex was administered to mice (Swiss and C57-B1/6) bearing 5 transplantable tumours: Ehrlich ascites tumour, NK/Ly lymphoma, Lewis lung carcinoma, melanoma B-16, and Sarcoma 180. Activity concentration in neoplasms, blood and numerous organs was determined 12, 24 and 48 hrs after injection. An identical procedure was applied using /sup 58/Co-bleomycin as a reference oncophilic substance. Tumour/non-tumor ratios exceeding substantially unity were found for blood, muscle and bone indicating preferential accumulation of both /sup 58/Co and /sup 51/Cr in all the neoplasms tested. The ratios were lower (by a factor 2-3) for /sup 51/Cr than for /sup 58/Co; however, it is postulated that the gamma-quantum energy of /sup 51/Cr which is higher than that of the commonly used /sup 57/Co, should offset to some degree this difference when scintigraphic tumour detection in a patient is to be attempted. In conclusion, clinical trials with /sup 51/Cr-bleomycin, which is cheaper than its /sup 57/Co-counterpart, appear warranted.
Energy Technology Data Exchange (ETDEWEB)
Li, Juan.
1991-10-01
The purpose of this work is to characterize the vanadium-phosphorous oxide (V-P-O) catalysts for the selective oxidation of n-butane and 1-butene to maleic anhydride. The utility of solid state nuclear magnetic resonance as an analytical tool in this investigation lies in its sensitivity to the electronic environment surrounding the phosphorous and vanadium nuclei, and proximity of paramagnetic species. Spin-echo mapping NMR of {sup 31}p and {sup 51}v and volume magnetic susceptibility measurements were used as local microscopic probes of the presence of V{sup 5+}, V{sup 4+}, V{sup 3+} species in the model compounds: {beta}-VOPO{sub 4}, {beta}-VOPO{sub 4} treated with n-butane/1-butene, (VO){sub 2}P{sub 2}O{sub 7} treated with n-butane/1-butene; and industrial catalysts with P/V (phosphorus to vanadium) ratio of 0.9, 1.0 and 1.1, before and after treatment with n-butane and 1-butene. The NMR spectra provide a picture of how the oxidation states of vanadium are distributed in these catalysts. 73 refs., 32 figs., 8 tabs.
Basu, J; Williams, B C; Li, Z; Williams, E V; Goldberg, M L
1998-01-01
In the course of a genetic screen for male-sterile mutations in Drosophila affecting chromosome segregation during the meiotic divisions in spermatocytes, we identified the mutation dsup35(63D). Examination of mutant testes showed that chromosome misbehavior was a consequence of major disruptions in meiotic spindle assembly. These perturbations included problems in aster formation, separation, and migration around the nuclear envelope; aberrations in spindle organization and integrity; and disappearance of the ana/telophase central spindle, which in turn disrupts cytokinesis. The dsup35(63D) mutation is caused by a P element insertion that affects, specifically in the testis, the expression of a gene (dsup35) encoding the Drosophila homolog of the yeast Sup35p and Xenopus eRF3 proteins. These proteins are involved in the termination of polypeptide synthesis on ribosomes, but previous studies have suggested that Sup35p and closely related proteins of the same family also interact directly with microtubules. An affinity-purified antibody directed against the product of the dsup35 gene was prepared; interestingly, this antibody specifically labels primary spermatocytes in one or two discrete foci of unknown structure within the nucleoplasm. We discuss how depletion of the dsup35 gene product in spermatocytes might lead to the global disruptions in meiotic spindle assembly seen in mutant spermatocytes.
{sup 11}B-NMR spectroscopic study on the interaction of epinephrine and p-BPA
Energy Technology Data Exchange (ETDEWEB)
Ichihara, K.; Yoshino, K. [Shinshu Univ., Department of Chemistry, Matsumoto, Nagano (Japan)
2000-10-01
It is studied that p-BPA (p-bronophenylalanine) which formed complex with catechol functional group has interaction with epinephrine by {sup 11}B-NMR. Two {sup 11}B-NMR resonance signals were observed at pH 7.0. The signal at 29.6 ppm is assigned to p-BPA and at 10.8 ppm is assigned to that of complex. We can determine complex formation constants (logK') in various pH. (author)
Energy Technology Data Exchange (ETDEWEB)
Zhao, Qing; Li, Chuanyong; Li, Shu Jie, E-mail: shujieli@nankai.edu.cn
2015-01-02
Highlights: • The α-helical content of the C-terminus is decreased with a pH increase. • The thermostability of the C-terminus is decreased with a pH increase. • Zn{sup 2+} binds to His{sup 244} and His{sup 266} residues within the C-terminal domain. • The binding of Zn{sup 2+} to His{sup 244} residue is an endothermic heat reaction. • The binding of Zn{sup 2+} to His{sup 266} residue is an exothermic heat reaction. - Abstract: The voltage-gated proton channel Hv1 is strongly sensitive to Zn{sup 2+}. The H{sup +} conduction is decreased at a high concentration of Zn{sup 2+} and Hv1 channel closing is slowed by the internal application of Zn{sup 2+}. Although the recent studies demonstrated that Zn{sup 2+} interacts with the intracellular C-terminal domain, the binding sites and details of the interaction remain unknown. Here, we studied the pH-dependent structural stability of the intracellular C-terminal domain of human Hv1 and showed that Zn{sup 2+} binds to His{sup 244} and His{sup 266} residues. The thermodynamics signature of Zn{sup 2+} binding to the two sites was investigated by isothermal titration calorimetry. The binding of Zn{sup 2+} to His{sup 244} (mutant H266A) and His{sup 266} (mutant H244A) were an endothermic heat reaction and an exothermic heat reaction, respectively.
Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library
DEFF Research Database (Denmark)
Petersen, L. K.; Blakskjær, P.; Chaikuad, A.
2016-01-01
A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...
pHlash: a new genetically encoded and ratiometric luminescence sensor of intracellular pH.
Zhang, Yunfei; Xie, Qiguang; Robertson, J Brian; Johnson, Carl Hirschie
2012-01-01
We report the development of a genetically encodable and ratiometic pH probe named "pHlash" that utilizes Bioluminescence Resonance Energy Transfer (BRET) rather than fluorescence excitation. The pHlash sensor-composed of a donor luciferase that is genetically fused to a Venus fluorophore-exhibits pH dependence of its spectral emission in vitro. When expressed in either yeast or mammalian cells, pHlash reports basal pH and cytosolic acidification in vivo. Its spectral ratio response is H(+) specific; neither Ca(++), Mg(++), Na(+), nor K(+) changes the spectral form of its luminescence emission. Moreover, it can be used to image pH in single cells. This is the first BRET-based sensor of H(+) ions, and it should allow the approximation of pH in cytosolic and organellar compartments in applications where current pH probes are inadequate.
pHlash: a new genetically encoded and ratiometric luminescence sensor of intracellular pH.
Directory of Open Access Journals (Sweden)
Yunfei Zhang
Full Text Available We report the development of a genetically encodable and ratiometic pH probe named "pHlash" that utilizes Bioluminescence Resonance Energy Transfer (BRET rather than fluorescence excitation. The pHlash sensor-composed of a donor luciferase that is genetically fused to a Venus fluorophore-exhibits pH dependence of its spectral emission in vitro. When expressed in either yeast or mammalian cells, pHlash reports basal pH and cytosolic acidification in vivo. Its spectral ratio response is H(+ specific; neither Ca(++, Mg(++, Na(+, nor K(+ changes the spectral form of its luminescence emission. Moreover, it can be used to image pH in single cells. This is the first BRET-based sensor of H(+ ions, and it should allow the approximation of pH in cytosolic and organellar compartments in applications where current pH probes are inadequate.
Energy Technology Data Exchange (ETDEWEB)
Imamura, Yasuhiro, E-mail: yimamura@po.mdu.ac.jp [Department of Pharmacology, Matsumoto Dental University, Shiojiri, Nagano 399-0781 (Japan); Wang, Pao-Li [Department of Bacteriology, Osaka Dental University, Hirakata, Osaka 573-1121 (Japan); Masuno, Kazuya [Department of Dental Education Innovation, Osaka Dental University, Hirakata, Osaka 573-1121 (Japan); Sogawa, Norio [Department of Pharmacology, Matsumoto Dental University, Shiojiri, Nagano 399-0781 (Japan)
2016-02-05
Histatins are salivary proteins with antimicrobial activities. We previously reported that histatin 3 binds to heat shock cognate protein 70 (HSC70), which is constitutively expressed, and induces DNA synthesis stimulation and promotes human gingival fibroblast (HGF) survival. However, the underlying mechanisms of histatin 3 remain largely unknown. Here, we found that the KRHH sequence of histatin 3 at the amino acid positions 5–8 was essential for enhancing p27{sup Kip1} (a cyclin-dependent kinase inhibitor) binding to HSC70 that occurred in a dose-dependent manner; histatin 3 enhanced the binding between p27{sup Kip1} and HSC70 during the G{sub 1}/S transition of HGFs as opposed to histatin 3-M(5–8) (substitution of KRHH for EEDD in histatin 3). Histatin 3, but not histatin 3-M(5–8), stimulated DNA synthesis and promoted HGF survival. Histatin 3 dose-dependently enhanced both p27{sup Kip1} and HSC70 ubiquitination, whereas histatin 3-M(5–8) did not. These findings provide further evidence that histatin 3 may be involved in the regulation of cell proliferation, particularly during G{sub 1}/S transition, via the ubiquitin–proteasome system of p27{sup Kip1} and HSC70. - Highlights: • KRHH amino acid sequence was required in histatin 3 to bind HSC70. • Histatin 3 enhanced HSC70 binding to p27{sup Kip1} during the G{sub 1}/S transition in HGFs. • KRHH sequence stimulated DNA synthesis and promoted cell survival. • Histatin 3 dose-dependently enhanced both p27{sup Kip1} and HSC70 ubiquitination. • Histatin 3 stimulates cell proliferation via the ubiquitin–proteasome system.
Platelet binding and biodistribution of [{sup 99m}Tc]rBitistatin in animal species and humans
Energy Technology Data Exchange (ETDEWEB)
Knight, Linda C. [Department of Radiology, Temple University School of Medicine, Philadelphia, PA 19140 (United States)], E-mail: lknight@temple.edu; Romano, Jan E. [Department of Radiology, Temple University School of Medicine, Philadelphia, PA 19140 (United States); Bright, Lewis T.; Agelan, Alexis [University Laboratory Animal Resources, Temple University School of Medicine, Philadelphia, PA 19140 (United States); Kantor, Steven; Maurer, Alan H. [Department of Radiology, Temple University School of Medicine, Philadelphia, PA 19140 (United States)
2007-10-15
Introduction: {sup 99m}Tc recombinant bitistatin (rBitistatin) is a radioligand for {alpha}{sub IIb}{beta}{sub 3} (glycoproteins IIb/IIIa) receptor on platelets and is being developed as a diagnostic radiopharmaceutical for in vivo imaging of acute thrombi and emboli. Prior to the first administration of [{sup 99m}Tc]rBitistatin to human subjects, its biodistribution and effects on platelets were evaluated in animals. This paper reports findings in animal studies in comparison with initial findings in normal human subjects. Methods: [{sup 99m}Tc]rBitistatin was administered to mice, guinea pigs and dogs to assess time-dependent organ distribution, urinary excretion and blood disappearance rates. Blood samples were analyzed to determine radioligand binding to circulating platelets and the extent of plasma protein binding. The effect of [{sup 99m}Tc]rBitistatin on circulating platelet count was determined. These factors were also determined in normal human subjects who received [{sup 99m}Tc]rBitistatin as part of a Phase I clinical trial. Results: The main organs that accumulated [{sup 99m}Tc]rBitistatin were kidneys, liver and spleen in all animal species and humans. The main organs seen on human images were the kidneys and spleen. Liver uptake was fainter, and soft-tissue background was low. [{sup 99m}Tc]rBitistatin bound to circulating platelets in blood, with a higher percentage of binding to platelets in guinea pigs and dogs compared to that in humans. Plasma protein binding was low and of little consequence in view of platelet binding. The main route of excretion was through the urine. [{sup 99m}Tc]rBitistatin did not affect platelet counts in humans or dogs. Conclusions: [{sup 99m}Tc]rBitistatin, when administered at low doses for imaging, has no adverse effects on platelets and has the qualitative biodistribution predicted by animal studies. [{sup 99m}Tc]rBitistatin was found to bind to circulating platelets in humans, suggesting that it will be able to bind
Energy Technology Data Exchange (ETDEWEB)
Mori, Kentaro; Nakajima, Keiji; Maeda, Minoru [Juntendo Univ., Shizuoka (Japan). Izunagaoka Hospital
1993-12-01
The effect of the loss of radioactivity from the human brain on the measurement of regional cerebral blood flow (rCBF) using N-isopropyl-p-[{sup 123}I]iodoamphetamine (IMP) was evaluated by measuring rCBF in 10 normal male volunteers from 0.5 to 30 minutes after intravenous administration. rCBF was calculated by the operational equation, which assumes no product loss. Brain tissue and arterial blood concentration data were plotted according to a multiple-time/graphic evaluation technique. Data were fitted to the kinetic three-compartment model to estimate four kinetic rate constants to evaluate activity loss from the brain. These studies showed that loss of activity from the brain is negligible during the first 5 minutes, but after 7.5 minutes the loss becomes significantly higher with time. The present study corroborates the necessity for using single photon emission computed tomographic images measured within 5 minutes of IMP injection to quantify rCBF. (author).
Evaluation of efficiency of P sources for rice using /sup 32/P as tracer
Energy Technology Data Exchange (ETDEWEB)
Sadanandan, A K [Central Plantation Crops Research Inst., Spice Farm, Peruvanuamuzhi, Kerala (India); Mohanty, S K; Patnaik, S; Dash, R N [Central Rice Research Inst., Cuttack (India); Mistry, K B
1981-10-01
/sup 32/P tracer studies were conducted in micro-plot and pot experiments to evaluate the efficiency of ammonium nitrate phosphates containing 30, 50 and 70% of the P in the water-soluble form and tri- and tetra-ammonium polyphosphates, in comparison with water-soluble phosphate for rice grown on a light-textured acid alluvials oil. Ammonium nitrate phosphate containing 50% of the P in the water-soluble form was as efficient as water-soluble phosphates on this soil in respect of dry-matter production, P uptake and utilization of applied P.
Energy Technology Data Exchange (ETDEWEB)
Aleksandrov, S; Lazarov, J [Akademiya na Selskostopanskite Nauki, Sofia-Kostinbrod (Bulgaria). Inst. po Zhivotnovydstvo
1977-01-01
Trials were conducted with 56-day-old broiler chickens. The effect was followed up of insulin and alloxan as well as of L-thyroxine and 6-methylthiouracil on /sup 32/P incorporation in phospholipids of the duodenal mucosa. A segment of the duodenum was isolated and Na/sub 2/H/sup 32/PO/sub 4/ was introduced therein. The lipids were extracted from duodenal mucosa and the individual phospholipids were separated by means of thin layer chromatography on sillica gel-G. Radioactivity was determined of individual phospholipid fractions. Blood glucose level was studied in insulin and alloxan-treated chickens. The inference was drawn that insulin significantly enhances /sup 32/P incorporation in the phospholipids in broiler chicken duodenal mucosa. The drop in blood glucose in insulin-treated chickens is inversely proportional to /sup 32/ P inclusion in individual phospholipids of duodenal mucosa. L-thyroxine exerts positive effect in chickens concerning /sup 32/P incorporation in lecithin and lysolecithin, this effect being negative with respect to sphingomyelin, cephalin and cardiolipin. Thyroid gland inhibition by 6-methylthiouracil induces negligible decline in /sup 32/P inclusion.
Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)
2012-02-03
Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Energy Technology Data Exchange (ETDEWEB)
Assmann, Walter [Ludwig-Maximilians-Univ., Muenchen (Germany). Fakultaet fuer Physik; Becker, Ricarda; Otto, Henrike [Klinikum der Universitaet Muenchen, Campus Grosshadern (Germany). Laser-Forschungslabor] [and others
2013-03-01
For LDR-brachytherapy, a limited number of implant geometries and materials are available. To avoid wound healing related hyper-proliferation (stenosis, keloids) a novel radioactive foil system was developed based on beta emitting {sup 32}P, which can be easily integrated in existing implants such as urethral catheters or bile duct stents. As substrate material for these foils PEEK (polyetherethercetone) was chosen because of its radiation hardness during neutron activation of {sup 32}P. The activity was determined by liquid scintillation counting and gamma spectroscopy, dose distributions were measured with scintillation detectors and radiochromic films. The correlation between activity and dose was checked by Monte-Carlo-simulations (Geant4). Prototypes of the {sup 32}P-implants have shown in wash-out tests the required tightness for sealed radioactive sources. In animal tests on urethra and bile duct, the uncomplicated and save application of {sup 32}P-foils mounted on standard implants has been demonstrated, which is almost unchanged due to the simple radiation protection with plexiglass. This concept of radioactive implants with integrated {sup 32}P-foils could extend essentially the application possibilities of LDR-brachytherapy. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Orphanidis, P. S.; Soultanopoulos, C. D.; Karandeinos, M. G. [Laboratoire Biologique, Institut Phytopathologique Benaki, Athens (Greece)
1963-09-15
The lack of numerical data on the movement of the olive fly led to a preliminary trial with adults reared in cages and labelled before release with a sugar solution containing {mu}c P32/cm{sup 3}. Subsequent measurements showed dispersion of the labelled adults up to a distance of 2 km from the point of release during a calm sunny period in winter. (author) [French] Le manque de donnees numeriques sur la dispersion de la mouche de l'olive a amene a faire un essai preliminaire avec 2500 adultes eleves dans des cages et marques, avant leur lacher, au moyen d'une solution sucree contenant 20 {mu}c de {sup 32}P par centimetre cube Les mesures ulterieures ont montre une dispersion des adultes marques jusqu'a une distance de 2 km du point de lacher pendant les jours ensoleilles d'hiver, dits alcyoniens. (author) [Spanish] La falta de datos numericos sobre la dispersion de la mosca del olivo ha inducido a efectuar un estudio preliminar con 2 500 adultos criados en cajas y marcados antes de susuelta con una solucion azucarada que contenia 20 {mu}c de {sup 32}P/cm{sup 3}. Las mediciones han puesto de manifiesto una dispersion de los adultos marcados hasta una distancia de dos kilometros del punto en que fueron soltados durante loe dias soleados de invierno llamados alcioneos. (author) [Russian] Otsutst'ie kolichestvennykh dannykh otnositel'no rasseyaniya olivkovykh mukh obuslovilo provedenie predvaritel'nogo opyta s 2500 vzroslymi osobyami, vyrashchennymi v yashchikakh i pomechennymi pered vypuskom s pomoshch'yu sladkogo rastvora, soderzhashchego 20 {mu}c na 1 cm{sup 3} P{sup 32}. Otnositel'nye izmereniya pokazali udalenie mechenykh vzroslykh osobej do 2 km ot mesta vypuska v period solnechnykh zimnikh dnej, nazyvaemykh alkionidnymi. (author)
Sensitized fluorescence in thallium induced in collisions with Hg(6/sup 3/P/sub 1/) atoms
Energy Technology Data Exchange (ETDEWEB)
Wade, M K; Czajkowski, M; Krause, L [Windsor Univ., Ontario (Canada). Dept. of Physics
1978-07-01
The transfer of excitation from excited mercury atoms to ground-state thallium atoms was investigated using techniques of sensitized fluorescence. A Hg-Tl vapor mixture contained in a quartz cell was irradiated with Hg 2537 A resonance radiation which caused the mercury atoms to become excited to the 6/sup 3/P/sub 1/ state. Subsequent collisions between the Hg(6/sup 3/P/sub 1/) and Tl(6/sup 2/Psub(1/2)) atoms resulted in the population of the 8/sup 2/Ssub(1/2), 6/sup 2/D, and 7/sup 2/Ssub(1/2) thallium states, whose decay gave rise to sensitized fluorescence of wavelengths 3231, 3520, 3776, and 5352 A. Intensity measurements on the sensitized fluorescence and on the Hg 2537 A resonance fluorescence, observed at right angles to the direction of excitation, yielded cross sections of 3.0, 0.3, and 0.05 A/sup 2/ for collisional excitation transfer from Hg(6/sup 3/P/sub 1/) to the 8/sup 2/Ssub(1/2), 6/sup 2/D, and 7/sup 2/Ssub(1/2) states in thallium, respectively. The results are fully consistent with previously determined cross sections for excitation transfer in other binary metallic vapor systems.
Energy Technology Data Exchange (ETDEWEB)
Chao, A C.L.
1973-01-01
A double Regge Pole Exchange Model is used to analyze Quasi-Three-Body final states selected from a 7 GeV/c - /sup -/p experiment. Three sets of data are analyzed namely: I ..pi../sup -/p ..-->.. p..pi../sup +/..pi../sup -/..pi../sup -/; II ..pi../sup -/p ..-->.. p..pi../sup +/..pi../sup -/..pi../sup -/..pi../sup 0/; III ..pi../sup -/p ..-->.. ..pi../sup +/..pi../sup +/..pi../sup -/..pi../sup -/n. The final states, selected from data sets I, II and III are (rho/sup 0/..pi../sup -/p, f/sup 0/..pi../sup -/p, ..pi../sup -/..pi../sup -/..delta../sup + +/), (rho/sup 0/..pi../sup -/..delta../sup +/, rho/sup -/..pi..-..delta../sup + +/, ..omega pi../sup -/p) and (rho/sup 0/..pi../sup -/..delta../sup +/), respectively. It is found that these channels after appropriate kinematic cuts can be well described by exchanging two Regge Trajectories. Predictions for the absolute cross-sections were also obtained by taking limits of one particle exchange and a diffraction scattering approximation. (auth)
{sup 18F} FDG Uptake of Human Testis on PET/CT: Correlation with Age, Sex Hormones, and Vasectomy
Energy Technology Data Exchange (ETDEWEB)
Moon, Seung Hwan; Eo, Jae Sun; Lee, Jong Jin; Chung, June Key; Lee, Dong Soo; Lee, Myung Chul [Seoul National Univ. Hospital, Seoul (Korea, Republic of)
2011-12-15
The purpose of this study was to evaluate glucose metabolism of normal human testis on {sup 18F} FDG PET/CT and to assess possible correlation among age, the serum levels of sex hormones, and vasectomy. {sup 18F} FDG PET/CT was performed in 66 normal healthy men (50.8{+-}13.6 years, range 22-81), and mean standard uptake values (SUV) of {sup 18F} FDG in testis and adductor muscle were measured. Testis muscle SUV ratios (T/M ratios) were calculated. Serum levels of total testosterone, free testosterone, estradiol, and of sex hormone binding globulin (SHBG) were measured. We searched for correlations between T/M ratios and age and the serum concentrations of sex hormones. {sup 18F} FDG PET/CT was also performed in 32 vasectomized men (55.7{+-}7.8 years, range 38-71) and 52 nonvasectomized men (55.4{+-}11.6 years, range 37-72). Mean SUVs of testis and adductor muscle were measured, and T/M ratios were calculated. A significant age related decline was found in T/M ratio (r=-0.509, p<0.0001). Serum levels of total testosterone and free testosterone were also found to be positively correlated with T/M ratio (r=-0.427, p=0.0003; r=0.435, p=0.0003, respectively). The mean SUV and T/M ratio of vasectomized men were significantly lower than those of nonvasectomized men (p<0.0378 and p=0.0001, respectively). Glucose metabolism in the testis in an adult population was found to be correlated with age, serum sex hormone level, and vasectomy history. These results indicate that testicular {sup 18F} FDG uptake may have attributed to testicular function and testicular histology. Our findings may have important implications for the interpretation of testicular {sup 18F} FDG uptake in the normal adult population.
Genetically encoded proton sensors reveal activity-dependent pH changes in neurons
Directory of Open Access Journals (Sweden)
Joseph Valentino Raimondo
2012-05-01
Full Text Available The regulation of hydrogen ion concentration (pH is fundamental to cell viability, metabolism and enzymatic function. Within the nervous system, the control of pH is also involved in diverse and dynamic processes including development, synaptic transmission and the control of network excitability. As pH affects neuronal activity, and can also itself be altered by neuronal activity, the existence of tools to accurately measure hydrogen ion fluctuations is important for understanding the role pH plays under physiological and pathological conditions. Outside of their use as a marker of synaptic release, genetically encoded pH sensors have not been utilised to study hydrogen ion fluxes associated with network activity. By combining whole-cell patch clamp with simultaneous two-photon or confocal imaging, we quantified the amplitude and time course of neuronal, intracellular, acidic transients evoked by epileptiform activity in two separate in vitro models of temporal lobe epilepsy. In doing so, we demonstrate the suitability of three genetically encoded pH sensors: deGFP4, E2GFP and Cl-sensor for investigating activity-dependent pH changes at the level of single neurons.
Genetically encoded proton sensors reveal activity-dependent pH changes in neurons.
Raimondo, Joseph V; Irkle, Agnese; Wefelmeyer, Winnie; Newey, Sarah E; Akerman, Colin J
2012-01-01
The regulation of hydrogen ion concentration (pH) is fundamental to cell viability, metabolism, and enzymatic function. Within the nervous system, the control of pH is also involved in diverse and dynamic processes including development, synaptic transmission, and the control of network excitability. As pH affects neuronal activity, and can also itself be altered by neuronal activity, the existence of tools to accurately measure hydrogen ion fluctuations is important for understanding the role pH plays under physiological and pathological conditions. Outside of their use as a marker of synaptic release, genetically encoded pH sensors have not been utilized to study hydrogen ion fluxes associated with network activity. By combining whole-cell patch clamp with simultaneous two-photon or confocal imaging, we quantified the amplitude and time course of neuronal, intracellular, acidic transients evoked by epileptiform activity in two separate in vitro models of temporal lobe epilepsy. In doing so, we demonstrate the suitability of three genetically encoded pH sensors: deGFP4, E(2)GFP, and Cl-sensor for investigating activity-dependent pH changes at the level of single neurons.
Measurement of neutral current e{sup {+-}}p cross sections at high Bjorken x with the ZEUS detector
Energy Technology Data Exchange (ETDEWEB)
Abramowicz, H. [Tel Aviv Univ. (Israel). School of Physics; Max-Planck-Institute for Physics, Munich (Germany); Abt, I. [Max-Planck-Institute for Physics, Munich (Germany); Adamczyk, L. [AGH-Univ. of Science and Technology, Krakow (Poland). Faculty of Physics and Applied Computer Science; Collaboration: ZEUS Collaboration; and others
2013-12-15
The neutral current e{sup {+-}}p cross section has been measured up to values of Bjorken x{approx_equal}1 with the ZEUS detector at HERA using an integrated luminosity of 187 pb{sup -1} of e{sup -}p and 142 pb{sup -1} of e{sup +}p collisions at {radical}(s)=318 GeV. Differential cross sections in x and Q{sup 2}, the exchanged boson virtuality, are presented for Q{sup 2}{>=}725 GeV{sup 2}. An improved reconstruction method and greatly increased amount of data allows a finer binning in the high-x region of the neutral current cross section and leads to a measurement with much improved precision compared to a similar earlier analysis. The measurements are compared to Standard Model expectations based on a variety of recent parton distribution functions.
Conneely, M J
2002-01-01
We report and tabulate the energies, classifications, effective quantum numbers, and configuration mixings of the triply excited sup 2 sup , sup 4 S sup e sup , sup o , sup 2 sup , sup 4 P sup e sup , sup o , sup 2 sup , sup 4 D sup e sup , sup o , and sup 2 sup , sup 4 F sup e sup , sup o states of 3-electron systems from Z=3 to 6, namely, Li, Be sup + , B sup 2 sup + , and C sup 3 sup +. For all cases considered, no electron is in the 1s state. Our results are based on calculations using the truncated diagonalization method (TDM) with hydrogenic basis functions. Where available, we compare our results with other calculations and with experiments.
High-resolution imaging of brain 5-HT{sub 1B} receptors in the rhesus monkey using [{sup 11}C]P943
Energy Technology Data Exchange (ETDEWEB)
Nabulsi, Nabeel; Huang Yiyun; Weinzimmer, David; Ropchan, Jim; Frost, James J. [Yale PET Center, Department of Diagnostic Radiology and Psychiatry, Yale University School of Medicine, P.O. Box 208048, New Haven, CT 06520-8048 (United States); McCarthy, Timothy [Pfizer Global R and D, Groton, CT 06340 (United States); Carson, Richard E.; Ding Yushin [Yale PET Center, Department of Diagnostic Radiology and Psychiatry, Yale University School of Medicine, P.O. Box 208048, New Haven, CT 06520-8048 (United States)
2010-02-15
The serotonin 5-HT{sub 1B} receptors regulate the release of serotonin and are involved in various disease states, including depression and schizophrenia. The goal of the study was to evaluate a high affinity and high selectivity antagonist, [{sup 11}C]P943, as a positron emission tomography (PET) tracer for imaging the 5-HT{sub 1B} receptor. [{sup 11}C]P943 was synthesized via N-methylation of the precursor with [{sup 11}C]methyl iodide or [{sup 11}C]methyl triflate using automated modules. The average radiochemical yield was approx. 10% with radiochemical purity of >99% and specific activity of 8.8{+-}3.6 mCi/nmol at the end-of-synthesis (n=37). PET imaging was performed in non-human primates with a high-resolution research tomograph scanner with a bolus/infusion paradigm. Binding potential (BP{sub ND}) was calculated using the equilibrium ratios of regions to cerebellum. The tracer uptake was highest in the globus pallidus and occipital cortex, moderate in basal ganglia and thalamus, and lowest in the cerebellum, which is consistent with the known brain distribution of 5-HT{sub 1B} receptors. Infusion of tracer at different specific activities (by adding various amount of unlabeled P943) reduced BP{sub ND} values in a dose-dependent manner, demonstrating the saturability of the tracer binding. Blocking studies with GR127935 (2 mg/kg iv), a selective 5-HT{sub 1B}/5-HT{sub 1D} antagonist, resulted in reduction of BP{sub ND} values by 42-95% across regions; for an example, in occipital region from 0.71 to 0.03, indicating a complete blockade. These results demonstrate the saturability and specificity of [{sup 11}C]P943 for 5-HT{sub 1B} receptors, suggesting its suitability as a PET radiotracer for in vivo evaluations of the 5-HT{sub 1B} receptor system in humans.
Energy Technology Data Exchange (ETDEWEB)
Brent, T.P.; Remack, J.S. (St. Jude Children' s Research Hospital, Memphis, TN (USA))
1988-07-25
Repair of chloroethylnitrosourea (CENU)-induced precursors of DNA interstrand cross-links by O{sup 6}-alkylguanine-DNA alkyltransferase (GAT or GATase) appears to be a factor in tumor resistance to therapy with this class of antineoplastic drugs. Since human GAT is highly specific for O{sup 6}-guanine, yet the probably cross-link structure is N{prime}-Guanine N{sup 3}cytosine ethane, rearrangement of the initial O{sup 6}-guanine adduct via O{sup 6},N{sup 1}ethanoguanine has been proposed. The authors suggested that GAT reaction with this intermediate would produce DNA covalently linked to protein through an ethane link from N{sup 1}-guanine to the alkylacceptor site on GAT. In preliminary studies they demonstrated a covalent complex between GAT and carmustine (BCNU)-treated DNA by a precipitation assay method. They have now developed a method for isolating the reaction product of BCNU-treated synthetic 14-mer ({sup 32}P)-labeled oligodeoxynucleotide and GAT using polyacrylamide gel electrophoresis. This approach can be used to characterize the adducts induced by CENUs that lead to complex formation with GAT.
Energy Technology Data Exchange (ETDEWEB)
Sato, Kazuma; Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp
2014-08-17
Highlights: • Low-lying three potential energy surfaces for the HNS/HSN system are developed. • Quantum scattering calculations are performed for S + NH and N + SH reactions. • NS production mechanisms from S + NH and N + SH reactions are discussed. - Abstract: The lowest three adiabatic potential energy surfaces (1{sup 1}A′, 1{sup 1}A″ and 1{sup 3}A″) of the HNS molecular system have been developed using ab initio MRCI + Q-level electronic structure calculations with a complete-basis-set approach in order to understand the NS production mechanisms from the S({sup 3}P) + NH(X{sup 3}Σ) → NS(X{sup 2}Π) + H({sup 2}S) and N({sup 4}S) + SH(X{sup 2}Π) → NS(X{sup 2}Π) + H({sup 2}S) reactions. The results of time-independent quantum reactive scattering calculations show that the reactions proceed with the contribution of both direct and HNS/HSN complex-forming mechanisms on all the three potential energy surfaces. It is found that the reaction dynamics is not entirely statistical and cannot be described with a simple capture theory despite that the reactions are barrierless with large exoergicity.
Energy Technology Data Exchange (ETDEWEB)
Hillmer, Ansel T.; Li, Songye; Zheng, Ming-Qiang; Lin, Shu-fei; Nabulsi, Nabeel; Holden, Daniel; Pracitto, Richard; Labaree, David; Ropchan, Jim; Esterlis, Irina; Cosgrove, Kelly P.; Carson, Richard E.; Huang, Yiyun [Yale University, PET Center, New Haven, CT (United States); Scheunemann, Matthias; Teodoro, Rodrigo; Deuther-Conrad, Winnie; Brust, Peter [Helmholtz-Zentrum Dresden-Rossendorf, Institute of Radiopharmaceutical Cancer Research, Leipzig (Germany)
2017-06-15
The α{sub 7} nicotinic acetylcholine receptor (nAChR) is implicated in many neuropsychiatric disorders, making it an important target for positron emission tomography (PET) imaging. The first aim of this work was to compare two α{sub 7} nAChRs PET radioligands, [{sup 18}F]ASEM 3-(1,4-diazabicyclo[3.2.2]nonan-4-yl)-6-([{sup 18}F]fluorodibenzo[b,d]thiophene 5,5-dioxide) and [{sup 18}F]DBT-10 7-(1,4-diazabicyclo[3.2.2]nonan-4-yl)-2-([{sup 18}F]fluorodibenzo[b,d]thiophene 5,5-dioxide), in nonhuman primates. The second aim was to assess further the quantification and test-retest variability of [{sup 18}F]ASEM in humans. PET scans with high specific activity [{sup 18}F]ASEM or [{sup 18}F]DBT-10 were acquired in three rhesus monkeys (one male, two female), and the kinetic properties of these radiotracers were compared. Additional [{sup 18}F]ASEM PET scans with blocking doses of nicotine, varenicline, and cold ASEM were acquired separately in two animals. Next, six human subjects (five male, one female) were imaged with [{sup 18}F]ASEM PET for 180 min, and arterial sampling was used to measure the parent input function. Different modeling approaches were compared to identify the optimal analysis method and scan duration for quantification of [{sup 18}F]ASEM distribution volume (V{sub T}). In addition, retest scans were acquired in four subjects (three male, one female), and the test-retest variability of V{sub T} was assessed. In the rhesus monkey brain [{sup 18}F]ASEM and [{sup 18}F]DBT-10 exhibited highly similar kinetic profiles. Dose-dependent blockade of [{sup 18}F]ASEM binding was observed, while administration of either nicotine or varenicline did not change [{sup 18}F]ASEM V{sub T}. [{sup 18}F]ASEM was selected for further validation because it has been used in humans. Accurate quantification of [{sup 18}F]ASEM V{sub T} in humans was achieved using multilinear analysis with at least 90 min of data acquisition, resulting in V{sub T} values ranging from 19.6 ± 2
Energy Technology Data Exchange (ETDEWEB)
Avakyan, R.O.; Avetisyan, A.; Bagdasaryan, A.S.; Vartapetyan, G.A.; Danagulyan, S.S.; Eganov, V.S.; Karapetyan, A.P.; Kosakov, I.K.; Marukyan, G.O.; Matevosyan, M.
1983-11-01
The energy dependence of the asymmetry in the cross section for the ..gamma..p..-->..p..pi../sup 0/ reaction induced by a polarized photon beam is measured in the energy region 0.75--1.3 GeV at the neutral-pion emission angle theta(0 = 70/sup 0/ in the c.m. system. The experimental data are compared with various theoretical predictions. A prediction based on the use of fixed-t dispersion relations is in satisfactory agreement with the experimental results.
Measurement of the B<sup>±>c Meson Lifetime Using B<sup>±>c→ J/Ψ + l<sup>±> + X Decays
Energy Technology Data Exchange (ETDEWEB)
Hartz, Mark Patrick [Univ. of Pittsburgh, PA (United States)
2008-01-01
This thesis describes a measurement of the average proper decay time of the B<sup>±>c mesons, the ground state of bottom and charm quark bound states. The lifetime measurement is carried out in the decay modes B<sup>±>c → J/Ψ + e<sup>±> + X and B<sup>±>c → J/Ψ + μ<sup>±> + X, where the J/Ψ decays as J/Ψ {yields} μ<sup>+μ-> and the X are unmeasured particles such as ve or vμ. The data are collect by the CDF II detector which measures the properties of particles created in √s = 1.96 TeV p$\\bar{p}$ collisions delivered by the Fermilab Tevatron. This measurement uses ~ 1 fb<sup>-1sup> of integrated luminosity. The measured average proper decay time of B<sup>±>c mesons, τ = 0.475-0.049<sup>+0.053sup>(stat.) ± 0.018(syst.) ps, is competitive with the most precise measurements in the world and confirms previous measurements and theoretical predictions.
Energy Technology Data Exchange (ETDEWEB)
Ngaotepprutaram, Thitirat [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Kaplan, Barbara L.F. [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Neuroscience Program, Michigan State University (United States); Kaminski, Norbert E., E-mail: kamins11@msu.edu [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States)
2013-11-15
We have previously reported that Δ{sup 9}-tetrahydrocannabinol (Δ{sup 9}-THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4{sup +} T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ{sup 9}-THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ{sup 9}-THC attenuated CD40L expression in human CD4{sup +} T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ{sup 9}-THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ{sup 9}-THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ{sup 9}-THC suppresses human T cell function. - Highlights: • Δ{sup 9}-THC attenuated CD40L expression in activated human CD4+ T cells. • Δ{sup 9}-THC suppressed DNA-binding activity of NFAT and NFκB. • Δ{sup 9}-THC impaired elevation of intracellular Ca2+. • Δ{sup 9}-THC did not affect phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β.
Energy Technology Data Exchange (ETDEWEB)
Thomas, P; Campos, J
1979-07-01
A system for sampling and averaging repetitive signals in the order of nanoseconds is discussed. The system uses as storage memory a multichannel analyzer operating in multi scaling mode. This instrument is employed for the measurement of atomic level lifetimes using a dye laser to excite the atoms and is applied to the study of lifetimes of the 3{sup 2}P1/2 and 3{sup 2}P3/2 states of sodium. (Author) 32 refs.
Energy Technology Data Exchange (ETDEWEB)
Duarte A, C
2003-07-01
The {sup 32} P are a pure emitting radioisotope of maximum energy of 1.71 MeV with half life of 14.28 days that he has applications in the industry, in agriculture, in medicine, in biology and in ecology (6,11,12,13,17,21,22,23,24,25,26,27,28,29,30,31,32 33).The {sup 32} P can be used in the industry like radiotracer in the investigation of some operations and processes and as element of measurement of some industrial meters. In agriculture is used as radiotracer (29) in the investigation of diverse biological processes that have to do with the production of diverse nutritious products. In medicine has uses but very therapeutic mainly in the treatment of some become cancerous (28, 31, 25, 27) in the diagnosis of blood disorders (24) and like part of materials of production of aortic prosthesis (6). The {sup 32} P are also used in the molecular investigation in biology and in genetics (33), and in studies of ecosystems (32) and of DNA (22). One can obtain the {sup 32} P by means of diverse nuclear reactions depending on the material used as matter it prevails, since it doesn't exist in the nature. But anyone in the ways of obtaining it it should imply a process of radiochemical separation that involves so many steps like they are required, depending on the material used as matter prevails, of the purity with which he wants himself to obtain and of the resources that it has available. The objective of this work was design, to build and to prove a prototype to obtain the {sup 32} P to leave of the irradiation of S {alpha} with fast neutrons at experimental level, which implies also to design a process that contemplates diverse stages and procedures for each one of them. The process was outlined in five stages: matter purification prevails, preparation of irradiation capsules, irradiation of irradiation capsules, transport and opening capsules of irradiation and radiochemical separation. In the last stage it was where uses the prototype of radiochemical separation
Energy Technology Data Exchange (ETDEWEB)
Courtillot, I
2003-11-01
This thesis reports the first results towards the realization of an optical clock using trapped strontium atoms. This set up would combine advantages of the different approaches commonly used to develop an atomic frequency standard. The first part describes the cold atoms source which is implemented. A magneto-optical trap operating on the {sup 1}S{sub 0}-{sup 1}P{sub 1} transition at 461 nm is loaded from an atomic beam decelerated by a Zeeman slower. The 461 nm laser is obtained by sum-frequency mixing in a potassium titanyl phosphate (KTP) crystal. The second part is devoted to the different stages developed to achieve the direct excitation of the {sup 1}S{sub 0}-{sup 3}P{sub 0} clock transition in {sup 87}Sr. This line has a theoretical natural width of 10{sup -3} Hz. Before this detection, we obtained an estimate of the resonance frequency by measuring absolute frequencies of several allowed optical transitions. (author)
Energy Technology Data Exchange (ETDEWEB)
Alexander, J.P.; Bebek, C.; Berger, B.E.; Berkelman, K.; Bloom, K.; Browder, T.E.; Cassel, D.G.; Cho, H.A.; Coffman, D.M.; Crowcroft, D.S.; Dickson, M.; Drell, P.S.; Dumas, D.J.; Ehrlich, R.; Elia, R.; Gaidarev, P.; Garcia-Sciveres, M.; Gittelman, B.; Gray, S.W.; Hartill, D.L.; Heltsley, B.K.; Henderson, S.; Jones, C.D.; Jones, S.L.; Kandaswamy, J.; Katayama, N.; Kim, P.C.; Kreinick, D.L.; Lee, T.; Liu, Y.; Ludwig, G.S.; Masui, J.; Mevissen, J.; Mistry, N.B.; Ng, C.R.; Nordberg, E.; Patterson, J.R.; Peterson, D.; Riley, D.; Soffer, A.; Avery, P.; Freyberger, A.; Lingel, K.; Prescott, C.; Rodriguez, J.; Yang, S.; Yelton, J.; Brandenburg, G.; Cinabro, D.; Liu, T.; Saulnier, M.; Wilson, R.; Yamamoto, H.; Bergfeld, T.; Eisenstein, B.I.; Ernst, J.; Gladding, G.E.; Gollin, G.D.; Palmer, M.; Selen, M.; Thaler, J.J.; Edwards, K.W.; McLean, K.W.; Ogg, M.; Bellerive, A.; Britton, D.I.; Hyatt, E.R.; Janicek, R.; MacFarlane, D.B.; Patel, P.M.; Spaan, B.; Sadoff, A.J.; Ammar, R.; Baringer, P.; Bean, A.; Besson, D.; Coppage, D.; Copty, N.; Davis, R.; Hancock, N.; Kotov, S.; Kravchenko, I.; Kwak, N.; Kubota, Y.; Lattery, M.; Momayezi, M.; Nelson, J.K.; Patton, S.; Poling, R.; Savinov, V.; Schrenk, S.; Wang, R.; Alam, M.S.; Kim, I.J.; Ling, Z.; Mahmood, A.H.; ONeill, J.J.; Severini, H.; Sun, C.R.; Wappler, F.; Crawford, G.; Fulton, R.; Fujino, D.; Gan, K.K.; Honscheid, K.; Kagan, H.; Kass, R.; Lee, J.; Sung, M.; White, C.; Wolf, A.; Zoeller, M.M.; Fu, X.; Nemati, B.; Ross, W.R.; Skubic, P.; Wood, M.; Bishai, M.; Fast, J.; Gerndt, E.; Hinson, J.W.; Miao, T.; Miller, D.H.; Modesitt, M.; Shibata, E.I.; Shipsey, I.P.; Wang, P.N.; Gibbons, L.; Johnson, S.D.; Kwon, Y.; Roberts, S.; Thorndike, E.H.; Coan, T.E.; Dominick, J.; Fadeyev, V.; Korolkov, I.; Lambrecht, M.; Sanghera, S.; Shelkov, V.; Skwarnicki, T.; Stroynowski, R.; Volobouev, I.; Wei, G.; Artuso, M.; Gao, M.; Goldberg, M.; He, D.; Horwitz, N.; Kopp, S.; Moneti, G.C.; Mountain, R.; Muheim, F.; Mukhin, Y.; Playfer, S.
1996-02-01
We report the observation of the Cabibbo-suppressed decays {Lambda}{sub {ital c}}{sup +}{r_arrow}{ital pK{sup {minus}}K{sup +}} and {Lambda}{sub {ital c}}{sup +}{r_arrow}{ital p}{phi} using data collected with the CLEO II detector at CESR. The latter mode, observed for the first time with significant statistics, is of interest as a test of color suppression in charm decays. We have determined the branching ratios for these modes relative to {Lambda}{sub {ital c}}{sup +}{r_arrow}{ital pK{sup {minus}}}{pi}{sup +} and compared our results with theory. {copyright} {ital 1996 The American Physical Society.}
Energy Technology Data Exchange (ETDEWEB)
Berg, Cornelis A T van den [Department of Radiotherapy, University Medical Center Utrecht, PO Box 85500, HP Q.00.118 3508 GA Utrecht (Netherlands); Bartels, Lambertus W [Department of Radiology, University Medical Center Utrecht, PO Box 85500, 3508 GA Utrecht (Netherlands); Bergen, Bob van den [Department of Radiotherapy, University Medical Center Utrecht, PO Box 85500, HP Q.00.118 3508 GA Utrecht (Netherlands); Kroeze, Hugo [Department of Radiotherapy, University Medical Center Utrecht, PO Box 85500, HP Q.00.118 3508 GA Utrecht (Netherlands); Leeuw, Astrid A C de [Department of Radiotherapy, University Medical Center Utrecht, PO Box 85500, HP Q.00.118 3508 GA Utrecht (Netherlands); Kamer, Jeroen B van de [Department of Radiotherapy, Amsterdam Medical Center, Amsterdam, PO Box 22660, 1100 DD Amsterdam (Netherlands); Lagendijk, Jan J W [Department of Radiotherapy, University Medical Center Utrecht, PO Box 85500, HP Q.00.118 3508 GA Utrecht (Netherlands)
2006-10-07
In this study, MR B{sup +}{sub 1} imaging is employed to experimentally verify the validity of FDTD simulations of electromagnetic field patterns in human anatomies. Measurements and FDTD simulations of the B{sup +}{sub 1} field induced by a 3 T MR body coil in a human corpse were performed. It was found that MR B{sup +}{sub 1} imaging is a sensitive method to measure the radiofrequency (RF) magnetic field inside a human anatomy with a precision of approximately 3.5%. A good correlation was found between the B{sup +}{sub 1} measurements and FDTD simulations. The measured B{sup +}{sub 1} pattern for a human pelvis consisted of a global, diagonal modulation pattern plus local B{sup +}{sub 1} heterogeneties. It is believed that these local B{sup +}{sub 1} field variations are the result of peaks in the induced electric currents, which could not be resolved by the FDTD simulations on a 5 mm{sup 3} simulation grid. The findings from this study demonstrate that B{sup +}{sub 1} imaging is a valuable experimental technique to gain more knowledge about the dielectric interaction of RF fields with the human anatomy.
Energy Technology Data Exchange (ETDEWEB)
Nikiforov, A.
2007-01-18
This thesis presents inclusive e{sup {+-}}p single and double differential cross sections for neutral current deep inelastic scattering measured as functions of the four-momentum transfer squared Q{sup 2} and the Bjorken variable x in interactions of longitudinally polarised leptons with unpolarised protons using the H1 detector at HERA II. An overview of the phenomenology of deep inelastic scattering is given and the experimental apparatus as well as the measurement and analysis procedures are described. The analysis is based on e{sup +}p data taken in 2003-04 and e{sup -}p data taken in 2005 at a centre-of-mass energy of {radical}(s)=318 GeV, with integrated luminosities of 47.6 pb{sup -1} and 98.4 pb{sup -1} for the e{sup +}p and e{sup -}p samples, respectively. The cross sections are measured in the range of 200sup 2}<20 000 GeV{sup 2} and 0.0032
Energy Technology Data Exchange (ETDEWEB)
Maciel Neto, A; Salcedo, I H [Pernambuco Univ., Recife, PE (Brazil). Dept. de Energia Nuclear
1991-01-01
The availability of P fixed in oxi-hydroxides of Fe and of Al for the microbial biomass of a P-deficient soil, was determined following addition of C sources. These oxides were impregnated in a support matrix of filter paper strips and then equilibrated with a P solution (1.5 * 1- sup(-5) M) containing sup(32)P. The strips where then incubated with soil without (control) or with additions of glicose+N (70 hs) or celulose+N (3 weeks), and the CO sub(2) evolved measured. After the incubation, the strips with Fe and Al incubated with soil+glicose had 0.004 and 0.008 {mu}moles cm sup(-2) of P less than the controls, respectively. Biomass activity dessorbed 100 to 200 more P than an exchange resin. The Fe strips incubated with soil+celulose dessorbed 0.002 {mu}moles cm sup(-2) more P than the control, while the Al ones did not differ from the control. In this last case, only about 50% of the cellulose had been decomposed, compared to approximately 85% of the cellulose in contact with the Fe strips. (author).
Energy Technology Data Exchange (ETDEWEB)
Burba, P; Lieser, K H [Technische Hochschule Darmstadt (F.R. Germany). Fachbereich Anorganische Chemie und Kernchemie
1976-07-01
The use of a cellulose compound containing salicylic acid as functional group (capacity 0.6 mequ./g) for different problems is described. The seperations Fe/sup 3 +//Cu/sup 2 +/ and Cu/sup 2 +//Ni/sup 2 +/ in aqueous solutions are achieved smoothly at pH 2 and 2.5 resp. In organic solvents (pyridine) copper ions are separated from copper complexes as shown by the examples Cu/sup 2 +//(Cu(mnt)/sub 2/)/sup 2 -/ (mnt = maleonitril-1,2-dithiolate) and Cu/sup 2 +//dibenzo(b.i.)(5.9.14.18)tetraazacyclotetradecene-copper (Cu(chel)). The complex (Cu(mnt)/sub 2/)/sup 2 -/ can be labelled with Cu-64 on a separation column, whereas (Cu-(chel)) is substition inert.
Search for fractionally charged particles in e/sup +/e/sup -/ annihilations
Energy Technology Data Exchange (ETDEWEB)
Huth, J.E.
1984-09-01
We have searched for the production of free Q = +-1/3e, Q = +-2/3e and Q = +-4/3e particles produced in e/sup +/e/sup -/ collisions at a center-of-mass energy of 29 GeV in 77 pb/sup -1/ of data collected by the time projection chamber at PEP. No evidence has been found for the production of these particles. Upper limits are established on the inclusive cross section for the production of Q = +-1/3e, Q = +-2/3e, and Q = +-4/3e particles in the mass range 1.0 to 13 GeV/c/sup 2/, improving upon previously established limits. 58 references.
omega production in the reaction pi /sup -/p to pi /sup +/ pi /sup 0/n at 8 and 12 GeV/c
Dowell, John D; Jobes, M; Kenyon, I R; Mawson, J; McMahon, T
1975-01-01
The reaction pi /sup -/p to omega n has been studied at 8 and 12 GeV/c incident momenta with the CERN Omega spectrometer using a neutron time of flight trigger. The differential cross sections and the omega decay density matrix elements are presented as functions of the momentum transfer squared (-t) in the range 0.02 to 0.80 GeV/sup 2/. The data are used to evaluate the intercept and slope of both the natural and unnatural parity exchange trajectories. Regge exchange amplitude factorisation tests involving the reaction pi N to omega N are investigated.
Energy Technology Data Exchange (ETDEWEB)
Alanis M, J. [ININ, Departamento de Materiales Radiactivos, 52045 Ocoyoacac, Estado de Mexico (Mexico)
2003-12-15
In the National Institute of Nuclear Research (ININ) it was designed, built and proved a prototype to obtain {sup 32}P in form of H{sub 3} {sup 32}PO{sub 4}, starting from irradiated S{alpha}. The beginning of the prototype it is based on a distillation system in dry of the S{alpha} in nitrogen atmosphere, and in the formation of the ion {sup 32}PO{sub 4}{sup 3-} in acid solution. Due to the handling of radioactive material during the process, the prototype is inside a hot cell and it has a cylindrical oven that opens up lengthwise to the half, with controller of temperature and with a system of empty air for to transport reagents and products. The air-vacuum system is provided of filters and traps. The tests showed a recovery from 14 to 15% of the activity obtained during the irradiation. (Author)
Energy Technology Data Exchange (ETDEWEB)
Wang, Wei; Dong, Yuan; D' Costa, Vijay Richard; Yeo, Yee-Chia, E-mail: yeo@ieee.org [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 117576 (Singapore); Vajandar, Saumitra; Lim, Sin Leng; Osipowicz, Thomas; Tok, Eng Soon [Department of Physics and Yale-NUS College, National University of Singapore, Singapore 117551 (Singapore)
2016-04-21
The in-situ Ga doping technique was used to form heavily p-type doped germanium-tin (Ge{sub 1−x}Sn{sub x}) layers by molecular beam epitaxy, avoiding issues such as Sn precipitation and surface segregation at high annealing temperatures that are associated with the alternative implant and anneal approach. In this way, an electrically active Ga concentration of up to ∼3.2 × 10{sup 20 }cm{sup −3} can be realized for Ge{sub 1−x}Sn{sub x}. The impacts of varying the Ga concentration on the crystalline quality and the mobility of p-type Ge{sub 1−x}Sn{sub x} were investigated. High crystalline quality Ge{sub 0.915}Sn{sub 0.085} can be realized with an active Ga concentration of up to ∼1.2 × 10{sup 20 }cm{sup −3}. More than 98% of the Sn atoms are located on substitutional lattice sites, although the substitutionality of Sn in p-type Ge{sub 1−x}Sn{sub x} decreases with an increasing Ga concentration. When the Ga concentration introduced is higher than 3.2 × 10{sup 20 }cm{sup −3}, excess Ga atoms cannot be substitutionally incorporated, and segregation of Ga and Sn towards the surface during growth is observed. The in-situ Ga-doped Ge{sub 0.915}Sn{sub 0.085} epitaxy was integrated in a Ge{sub 0.915}Sn{sub 0.085}-on-Si p-i-n (PIN) photodiode fabrication process, and well-behaved Ge{sub 0.915}Sn{sub 0.085}/Si PIN junction characteristics were obtained. A large forward-bias current to reverse bias current ratio of 6 × 10{sup 4} and a low reverse current (dark current) of 0.24 μA were achieved at V{sub bias} = −1 V.
Radiative proton capture to the first excited state of sup 29 P nucleus at subbarrier energies
Energy Technology Data Exchange (ETDEWEB)
Matulewicz, T; Dabrowska, M; Decowski, P; Kicinska-Habior, M; Sikora, B [Warsaw Univ. (Poland). Inst. Fizyki Doswiadczalnej; Toke, J [Rochester Univ., NY (USA). Nuclear Structure Research Lab.; Somorjai, E [Magyar Tudomanyos Akademia, Debrecen (Hungary). Atommag Kutato Intezete
1985-08-01
Differential cross sections at 0 deg and 90 deg measured for {sup 28}Si(p,{gamma}{sub 1}){sup 29}P reaction at proton energy range 2.3-2.9 MeV have been analyzed in terms of the direct-semidirect capture model extended by the effective potential approach. Spectroscopic factor of the first excited states of {sup 29}P nucleus was found to be 0.10+-0.05. 9 refs., 1 fig. (author).
Energy Technology Data Exchange (ETDEWEB)
Mazej, Zoran; Goreshnik, Evgeny [Jozef Stefan Institute, Ljubljana (Slovenia). Dept. of Inorganic Chemistry and Technology
2017-07-01
The [Ag(H{sub 2}O){sub 2}]SbF{sub 6}, is triclinic, P anti 1 (No. 2), with a=6.6419(3) Aa, b=7.6327(3) Aa, c=11.1338(3) Aa, α=95.492(3) , β=96.994(3) , γ=113.535(4) , V=507.13(4) Aa{sup 3} at 150 K, and Z=3. There are two crystallographically non-equivalent Ag{sup +} cations. The Ag1 is coordinated by two water molecules with Ag-OH{sub 2} distances equal to 2.271(2) Aa forming in that way a discrete linear [Ag(H{sub 2}O){sub 2}]{sup +} cation. Additionaly, it forms two short Ag..F contacts (2.630(2) Aa), resulting in AgO{sub 2}F{sub 2} plaquette, and four long ones (2 x 3.001(2) Aa and 2 x 3.095(2) Aa) with fluorine atoms located below and above the AgO{sub 2}F{sub 2} plaquette. The H{sub 2}O molecules bridge Ag2 atoms into {-[Ag(μ-OH_2)_2]-}{sub n} infinite chains, with Ag-O distances of 2.367(2)-2.466(2) Aa. The [Pd(H{sub 2}O){sub 4}](SbF{sub 6}){sub 2}.4H{sub 2}O is monoclinic, P2{sub 1}/a (No.14), with a=8.172(2) Aa, b=13.202(3) Aa, c=8.188(3) Aa, β=115.10(1) , V=799.9(4) Aa{sup 3} at 200 K, and Z=2. Its crystal structure can be described as an alternation of layers of [Pd(H{sub 2}O){sub 4}]{sup 2+} cations (interconnected by H{sub 2}O molecules) and [SbF{sub 6}]{sup -} anions. It represents the first example where [Pd(H{sub 2}O){sub 4}]{sup 2+} has been structurally determined in the solid state. Four oxygen atoms provided by H{sub 2}O molecules are in almost ideal square-planar arrangement with Pd-O bond lengths 2 x 2.004(5) Aa and 2 x 2.022(6) Aa. The [Cd(H{sub 2}O){sub 6}](SbF{sub 6}){sub 2}, is orthorhombic, Pnnm (No.58), with a=5.5331(2) Aa, b=14.5206(4) Aa, c=8.9051(3) Aa, V=715.47(4) Aa{sup 3} at 200 K, and Z=2. It consists of [Cd(H{sub 2}O){sub 6}]{sup 2+} cations and [SbF{sub 6}]{sup -} anions.
cis-4-[{sup 18}F]-Fluoro-L-proline fails to detect peripheral tumors in humans
Energy Technology Data Exchange (ETDEWEB)
Stoffels, Gabriele; Pauleit, Dirk [Institute of Neuroscience and Biophysics-Medicine, Research Centre Juelich, D-52425 Juelich, FRG (Germany); Haas, Rainer; Kobbe, Guido [Department of Oncology, Hematology, and Clinical Immunology, Heinrich-Heine-University Duesseldorf, FRG (Germany); Salber, Dagmar [C. and O. Vogt Institute of Brain Research, Heinrich-Heine-University Duesseldorf, FRG (Germany); Hamacher, Kurt; Coenen, Heinz H. [Institute of Neuroscience and Biophysics - Nuclear Chemistry, Research Centre Juelich, Juelich, FRG (Germany); Langen, Karl-Josef [Institute of Neuroscience and Biophysics-Medicine, Research Centre Juelich, D-52425 Juelich, FRG (Germany)], E-mail: k.j.langen@fz-juelich.de
2008-11-15
System A amino acid transport is increased in transformed and malignant cells. The amino acid 4-cis[{sup 18}F]fluoro-L-proline (cis-[{sup 18}F]FPro) has been shown to be a substrate of the System A amino acid carrier. In this pilot study, we investigated the diagnostic potential of cis-[{sup 18}F]FPro in patients with various tumors in comparison with [{sup 18}F]fluorodeoxyglucose-positron emission tomography (FDG-PET). Methods: Eight patients (seven females, one male, age range 43-77 years) with large primary, recurrent or metastatic tumors of different histologies were included in this study. One patient had a recurrent non-Hodgkin lymphoma; two patients, metastatic colon or rectal cancer; one, a metastatic endometrial cancer; one, a multiple myeloma; one, an Ewing sarcoma; one, a metastatic breast cancer and one, a gastrointestinal stromal tumor. PET scans of the trunk were acquired at 1 h after intravenous injection of 400 MBq cis-[{sup 18}F]FPro and compared to PET scans with [{sup 18}F]FDG. Results: None of the tumors or metastatic lesions in this series of patients demonstrated relevant uptake of cis-[{sup 18}F]FPro. In contrast, all tumors with exception of the multiple myeloma showed an intensive uptake of [{sup 18}F]FDG. The mean standardized uptake value of cis-[{sup 18}F]FPro in the tumor or metastases was significantly lower than that of [{sup 18}F]FDG uptake (1.7{+-}0.6 vs. 5.7{+-}3.0; n=8; P<.01). Conclusion: Although other System A-specific tracers have shown relevant tumor uptake, cis-[{sup 18}F]FPro fails to detect most types of human tumors. Based on these results, we cannot recommend a further evaluation of this tracer as a tumor-seeking agent.
Energy Technology Data Exchange (ETDEWEB)
Trzeciak, J; Felus, E; Nolewajka, E; Szaflarski, J; Dudziak, Z [Slaska Akademia Medyczna, Katowice (Poland)
1976-01-01
/sup 32/P-cyclophosphamide was found to combine with ..gamma..-globulin fractions of immune sera. Immune sera incubated with /sup 32/P-cyclophosphamide retained ability to react specifically with homologou antigen in vitro in the system: MN antigens of human erythrocytes + rabbit anti-MN antibody, and probably reacted selectively with target antigens in vivo in the system: antigens of guinea pig kidney tissue + rabbit antibodies against these antigens. Hemagglutination, passive hemagglutination and precipitation in agar gel tests were used in the experiments. Ability to combine of the immune antibody + /sup 32/P-cyclophosphamide complex with homologous antigens was evaluated by measurements of radioactivity of studied materials (erythrocyte agglutinates and organ homogenates). The results indicate feasibility of using immune antibodies as carriers of cytostatic agents.
Dynamic encoding of speech sequence probability in human temporal cortex.
Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F
2015-05-06
Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.
Inner ionization in A sup I sup I B sup V sup I
Komashchenko, A V; Kolezhuk, K V; Sheremetova, G I; Fursenko, V D; Bobrenko, Y N
2002-01-01
The dependences of the sensitivity of the p-Cu sub 1 sub . sub 8 S/n-A sup I sup I B sup V sup I -type surface-barrier heterostructures on the energy of exciting photons or accelerated monoenergetic electron beams are investigated. A technique for determination of the mean internal ionization energy epsilon in direct-gap A sup I sup I B sup V sup I compounds is suggested and epsilon values are found experimentally. It is shown that the relationship between epsilon and the semiconductor energy gap E sub g is given by the following expression epsilon 2.5E sub g
Search for narrow baryons in pi /sup -/p elastic scattering at large angles
Baillon, Paul; Benayoun, M; Chauveau, J; Chew, D; Ferro-Luzzi, M; Kahane, J; Lellouch, D; Leruste, P; Liaud, P; Moreau, F; Perreau, J M; Séguinot, Jacques; Sené, R; Tocqueville, J; Urban, M
1980-01-01
Hoping to find resonant structures in the momentum dependence of pi /sup -/p elastic scattering the authors have measured the differential cross section for this reaction at c.m. angles near 90 degrees . An intense pion beam ( approximately=10/sup 7/ pi /s) has been used, together with a high incident momentum resolution (dP/P approximately =2*10/sup -4/), to scan the region of laboratory momenta from 5.75 to 13.02 GeV/c (c.m. energy from 3.42 to 5.03 GeV). The sensitivity attained by the experiment is such that signals would have been seen corresponding to the formation of non-strange baryon resonances having width larger than approximately=0.1 MeV and elasticity larger than a few per cent. Within these limits no resonances were sighted. (4 refs) .
Deep--deeper--deepest? Encoding strategies and the recognition of human faces.
Sporer, S L
1991-03-01
Various encoding strategies that supposedly promote deeper processing of human faces (e.g., character judgments) have led to better recognition than more shallow processing tasks (judging the width of the nose). However, does deeper processing actually lead to an improvement in recognition, or, conversely, does shallow processing lead to a deterioration in performance when compared with naturally employed encoding strategies? Three experiments systematically compared a total of 8 different encoding strategies manipulating depth of processing, amount of elaboration, and self-generation of judgmental categories. All strategies that required a scanning of the whole face were basically equivalent but no better than natural strategy controls. The consistently worst groups were the ones that rated faces along preselected physical dimensions. This can be explained by subjects' lesser task involvement as revealed by manipulation checks.
Energy Technology Data Exchange (ETDEWEB)
Chutjian, A [Jet Propulsion Lab., Pasadena, Calif. (USA)
1976-07-11
Experimental normalized absolute differential cross sections (DCS) for the excitation 1/sup 1/S ..-->.. 3/sup 1/P in helium are reported at incident electron energies of 80 and 100 eV, and at scattering angles between 7/sup 0/ and 135/sup 0/. The measurements are combined with results of recent electron-photon coincidence studies, and absolute DCS for the excitation of the magnetic sublevels 3/sup 1/P/sub 0/ and 3/sup 1/Psub(+-1) are obtained. These experimental sublevel cross sections, and their sum, are compared with results of recent calculations in the multichannel eikonal and distorted-wave polarized-orbital theories.
Energy Technology Data Exchange (ETDEWEB)
Ulbricht, J; Arnold, W; Berg, H; Huttel, E; Krause, H H; Clausnitzer, G [Giessen Univ. (Germany, F.R.). Abt. Grossgeraete (Angewandte Kernphysik)
1977-09-05
The polarized proton capture in /sup 7/Li was used to study the reaction mechanism and to obtain spectroscopic information on the /sup 8/Be nucleus. Gamma-ray angular distributions of the analyzing power were measured as a function of proton energy from Esub(p) = 380-960 keV with three Ge(Li) detectors simultaneously. The excitation functions of the cross section and the analyzing power are strongly energy dependent. The data were analyzed unambiguously and represented by three R-matrix elements, two M1 and one E1. The energy dependence of the two M1 matrix elements agrees with the well-known two 1/sup +/ resonances at Esub(x) = 17.642 and 18.157 MeV. The energy dependence of the E1 matrix element shows a smooth background presumably caused by a direct-capture mechanism, and furthermore, a resonant contribution, which is a significant suggestion of a new 1/sup -/ state in the /sup 8/Be system at Esub(x) = 17.70 MeV with a width of GAMMAsub(p) = 180 keV.
Energy Technology Data Exchange (ETDEWEB)
Prior, John O.; Allenbach, Gilles; Bischof Delaloye, Angelika [Centre Hospitalier Universitaire Vaudois and University of Lausanne, Nuclear Medicine Department, Lausanne (Switzerland); Valenta, Ines; Burger, Cyrill [Cardiac Imaging, Department of Radiology, Zurich (Switzerland); Kosinski, Marek [Centre Hospitalier Universitaire Vaudois and University of Lausanne, Nuclear Medicine Department, Lausanne (Switzerland); Centre Hospitalier Universitaire Vaudois and University of Lausanne, University Institute for Radiation Physics, Lausanne (Switzerland); Verdun, Francis R. [Centre Hospitalier Universitaire Vaudois and University of Lausanne, University Institute for Radiation Physics, Lausanne (Switzerland); Kaufmann, Philipp A. [Cardiac Imaging, Department of Radiology, Zurich (Switzerland); University of Zurich, Zurich Centre for Integrative Human Physiology (ZIHP), Zurich (Switzerland)
2012-06-15
Quantification of myocardial blood flow (MBF) with generator-produced {sup 82}Rb is an attractive alternative for centres without an on-site cyclotron. Our aim was to validate {sup 82}Rb-measured MBF in relation to that measured using {sup 15}O-water, as a tracer 100% of which can be extracted from the circulation even at high flow rates, in healthy control subject and patients with mild coronary artery disease (CAD). MBF was measured at rest and during adenosine-induced hyperaemia with {sup 82}Rb and {sup 15}O-water PET in 33 participants (22 control subjects, aged 30 {+-} 13 years; 11 CAD patients without transmural infarction, aged 60 {+-} 13 years). A one-tissue compartment {sup 82}Rb model with ventricular spillover correction was used. The {sup 82}Rb flow-dependent extraction rate was derived from {sup 15}O-water measurements in a subset of 11 control subjects. Myocardial flow reserve (MFR) was defined as the hyperaemic/rest MBF. Pearson's correlation r, Bland-Altman 95% limits of agreement (LoA), and Lin's concordance correlation {rho} {sub c} (measuring both precision and accuracy) were used. Over the entire MBF range (0.66-4.7 ml/min/g), concordance was excellent for MBF (r = 0.90, [{sup 82}Rb-{sup 15}O-water] mean difference {+-} SD = 0.04 {+-} 0.66 ml/min/g, LoA = -1.26 to 1.33 ml/min/g, {rho} {sub c} = 0.88) and MFR (range 1.79-5.81, r = 0.83, mean difference = 0.14 {+-} 0.58, LoA = -0.99 to 1.28, {rho} {sub c} = 0.82). Hyperaemic MBF was reduced in CAD patients compared with the subset of 11 control subjects (2.53 {+-} 0.74 vs. 3.62 {+-} 0.68 ml/min/g, p = 0.002, for {sup 15}O-water; 2.53 {+-} 1.01 vs. 3.82 {+-} 1.21 ml/min/g, p = 0.013, for {sup 82}Rb) and this was paralleled by a lower MFR (2.65 {+-} 0.62 vs. 3.79 {+-} 0.98, p = 0.004, for {sup 15}O-water; 2.85 {+-} 0.91 vs. 3.88 {+-} 0.91, p = 0.012, for {sup 82}Rb). Myocardial perfusion was homogeneous in 1,114 of 1,122 segments (99.3%) and there were no differences in MBF among the