WorldWideScience

Sample records for encoding elements promote

  1. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  2. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  3. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    International Nuclear Information System (INIS)

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori

    2005-01-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism

  4. Experimental Study of Elements Promoting Mixing in Fuel Elements

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2003-01-01

    In the present work a thermal tracing technique is used to measure the increase of the mixing between subchannels in the presence of different mixing elements.As representative elements a spacer, a spacer with mixing vanes and turbulence promoter buttons were considered.The performance of these elements was evaluated by studying the behavior of a thermal trace in each case.Also the pressure drop for each case is presented.The results present a qualitative and quantitative guide for the application of each one of these appendages in future nuclear elements

  5. Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Hammer, Karin

    1999-01-01

    Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...

  6. Molecular computational elements encode large populations of small objects

    Science.gov (United States)

    Prasanna de Silva, A.; James, Mark R.; McKinney, Bernadine O. F.; Pears, David A.; Weir, Sheenagh M.

    2006-10-01

    Since the introduction of molecular computation, experimental molecular computational elements have grown to encompass small-scale integration, arithmetic and games, among others. However, the need for a practical application has been pressing. Here we present molecular computational identification (MCID), a demonstration that molecular logic and computation can be applied to a widely relevant issue. Examples of populations that need encoding in the microscopic world are cells in diagnostics or beads in combinatorial chemistry (tags). Taking advantage of the small size (about 1nm) and large `on/off' output ratios of molecular logic gates and using the great variety of logic types, input chemical combinations, switching thresholds and even gate arrays in addition to colours, we produce unique identifiers for members of populations of small polymer beads (about 100μm) used for synthesis of combinatorial libraries. Many millions of distinguishable tags become available. This method should be extensible to far smaller objects, with the only requirement being a `wash and watch' protocol. Our focus on converting molecular science into technology concerning analog sensors, turns to digital logic devices in the present work.

  7. Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

    Science.gov (United States)

    Fléchard, Maud; Gilot, Philippe

    2014-07-01

    We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

  8. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  9. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  10. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  11. Negative affect promotes encoding of and memory for details at the expense of the gist: affect, encoding, and false memories.

    Science.gov (United States)

    Storbeck, Justin

    2013-01-01

    I investigated whether negative affective states enhance encoding of and memory for item-specific information reducing false memories. Positive, negative, and neutral moods were induced, and participants then completed a Deese-Roediger-McDermott (DRM) false-memory task. List items were presented in unique spatial locations or unique fonts to serve as measures for item-specific encoding. The negative mood conditions had more accurate memories for item-specific information, and they also had fewer false memories. The final experiment used a manipulation that drew attention to distinctive information, which aided learning for DRM words, but also promoted item-specific encoding. For the condition that promoted item-specific encoding, false memories were reduced for positive and neutral mood conditions to a rate similar to that of the negative mood condition. These experiments demonstrated that negative affective cues promote item-specific processing reducing false memories. People in positive and negative moods encode events differently creating different memories for the same event.

  12. An upstream activation element exerting differential transcriptional activation on an archaeal promoter

    DEFF Research Database (Denmark)

    Peng, Nan; Xia, Qiu; Chen, Zhengjun

    2009-01-01

    S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

  13. Attention promotes episodic encoding by stabilizing hippocampal representations

    Science.gov (United States)

    Aly, Mariam; Turk-Browne, Nicholas B.

    2016-01-01

    Attention influences what is later remembered, but little is known about how this occurs in the brain. We hypothesized that behavioral goals modulate the attentional state of the hippocampus to prioritize goal-relevant aspects of experience for encoding. Participants viewed rooms with paintings, attending to room layouts or painting styles on different trials during high-resolution functional MRI. We identified template activity patterns in each hippocampal subfield that corresponded to the attentional state induced by each task. Participants then incidentally encoded new rooms with art while attending to the layout or painting style, and memory was subsequently tested. We found that when task-relevant information was better remembered, the hippocampus was more likely to have been in the correct attentional state during encoding. This effect was specific to the hippocampus, and not found in medial temporal lobe cortex, category-selective areas of the visual system, or elsewhere in the brain. These findings provide mechanistic insight into how attention transforms percepts into memories. PMID:26755611

  14. A universal encoding scheme for MIMO transmission using a single active element for PSK modulation schemes

    DEFF Research Database (Denmark)

    Alrabadi, Osama; Papadias, C.B.; Kalis, A.

    2009-01-01

    A universal scheme for encoding multiple symbol streams using a single driven element (and consequently a single radio frequency (RF) frontend) surrounded by parasitic elements (PE) loaded with variable reactive loads, is proposed in this paper. The proposed scheme is based on creating a MIMO sys...

  15. Identification and functional analysis of a CDE/CHR element in the POLDI promoter

    Institute of Scientific and Technical Information of China (English)

    SONG NanMeng; ZHU XiaoYu; SHI Lei; AN Jing; WU YanWei; SANG JianLi

    2009-01-01

    Chinese Center for Disease Control and Prevention, Beijing 102206, China DNA polymerase delta is encoded by the POLD1 gene, the transcription of which is strictly cell cy-cle-dependent. However, the means by which POLD1 transcription is regulated by the cell cycle mechanism is currently unknown. We discovered a novel element in the POLD1 promoter known as a CDE(cell cycle-dependent element)lCHR(cell cycle gene homology region) element. A series of luci-ferase reporter constructs containing various POLD1 promoter mutations were used to investigate the role of the CDF_JCHR element in POLD1 transcription. When the CDE/CHR element was mutated, the promoter activity was up-regulated, and the cell-cycle related factors E2F1 and p21 stopped regulating the promoter. Furthermore, cell cycle-dependent changes in the promoter activity required the integra-tive CDE/CHR element. Electrophoretic mobility shift assay (EMSA) revealed the presence of at least three types of DNA/protein complexes binding to the CDE/CHR element. Our findings provide strong evidence that the CDE/CHR-like sequence is an active functional element in the POLD1 promoter, which is important for the cell cycle regulation of the POLD1 gene.

  16. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  17. SXT/R391 Integrative and Conjugative Elements (ICEs) Encode a Novel 'Trap-Door' Strategy for Mobile Element Escape.

    Science.gov (United States)

    Ryan, Michael P; Armshaw, Patricia; Pembroke, J Tony

    2016-01-01

    Integrative conjugative elements (ICEs) are a class of bacterial mobile elements that have the ability to mediate their own integration, excision, and transfer from one host genome to another by a mechanism of site-specific recombination, self-circularisation, and conjugative transfer. Members of the SXT/R391 ICE family of enterobacterial mobile genetic elements display an unusual UV-inducible sensitization function which results in stress induced killing of bacterial cells harboring the ICE. This sensitization has been shown to be associated with a stress induced overexpression of a mobile element encoded conjugative transfer gene, orf43, a traV homolog. This results in cell lysis and release of a circular form of the ICE. Induction of this novel system may allow transfer of an ICE, enhancing its survival potential under conditions not conducive to conjugative transfer.

  18. SXT/R391 ICE elements encode a novel ‘trap-door’ strategy for mobile element escape

    Directory of Open Access Journals (Sweden)

    Michael P Ryan

    2016-05-01

    Full Text Available Integrative Conjugative Elements (ICEs are a class of bacterial mobile elements that have the ability to mediate their own integration, excision and transfer from one host genome to another by a mechanism of site-specific recombination, self-circularisation and conjugative transfer. Members of the SXT/R391 ICE family of enterobacterial mobile genetic elements display an unusual UV-inducible sensitisation function which results in stress induced killing of bacterial cells harbouring the ICE. This sensitisation has been shown to be associated with a stress induced overexpression of a mobile element encoded conjugative transfer gene, orf43, a traV homolog. This results in cell lysis and release of a circular form of the ICE. Induction of this novel system may allow transfer of an ICE, enhancing its survival potential under conditions not conducive to conjugative transfer.

  19. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    Science.gov (United States)

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  20. Versatile protein recognition by the encoded display of multiple chemical elements on a constant macrocyclic scaffold

    Science.gov (United States)

    Li, Yizhou; De Luca, Roberto; Cazzamalli, Samuele; Pretto, Francesca; Bajic, Davor; Scheuermann, Jörg; Neri, Dario

    2018-03-01

    In nature, specific antibodies can be generated as a result of an adaptive selection and expansion of lymphocytes with suitable protein binding properties. We attempted to mimic antibody-antigen recognition by displaying multiple chemical diversity elements on a defined macrocyclic scaffold. Encoding of the displayed combinations was achieved using distinctive DNA tags, resulting in a library size of 35,393,112. Specific binders could be isolated against a variety of proteins, including carbonic anhydrase IX, horseradish peroxidase, tankyrase 1, human serum albumin, alpha-1 acid glycoprotein, calmodulin, prostate-specific antigen and tumour necrosis factor. Similar to antibodies, the encoded display of multiple chemical elements on a constant scaffold enabled practical applications, such as fluorescence microscopy procedures or the selective in vivo delivery of payloads to tumours. Furthermore, the versatile structure of the scaffold facilitated the generation of protein-specific chemical probes, as illustrated by photo-crosslinking.

  1. Expressions Creating Confusion among Elements of Promotion Mix: Sales Promotion

    OpenAIRE

    Kelesbayev, Dinmukhamed; Kalykulov, Kuatbek; Yertayev, Yermek; Turlybekova, Altynay; Kamalov, Akhmet

    2017-01-01

    More than twenty years on marketing, research and publications have dealt with research problems based on marketing mix and have mostly examined marketing processes. However, the types or elements of the marketing mix that are important for both the enterprises and the consumers are not analyzed too deeply, and different expressions or concepts are used in the analyzed sources. For example, when we look at the literature on marketing, which is being used as a source in our universities, the c...

  2. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  3. Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

    Energy Technology Data Exchange (ETDEWEB)

    Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka; Pigli, Ying Z.; Boyle-Vavra, Susan; Rice , Phoebe A. (UC)

    2016-08-29

    Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-family replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.

  4. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    Science.gov (United States)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  5. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  6. PROMOTION AS AN ELEMENT OF MARKETING IN SPORTING EVENT

    Directory of Open Access Journals (Sweden)

    Miodrag Koprivica

    2009-11-01

    Full Text Available The events are happening at the present time on million different tv and radio sta- tions. Every marketer should be aware of that, each and every marketer in situations like this is using different elements of marketing mix, such as: advertising, personal sales, promotional development, publicity and public relations, and of course direct marketing. Organizers of sporting events are using many different ways to bring in visitors. By using marketing mix good position and design of event is secured, and of course vi- sitors are guaranteed. Promotion is by definition one of the elements of marketing mix. This work is exploring promotion goals, rational usage of means, and usage of internet as an media in promotion of sporting event

  7. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  8. PROMOTION AS AN ELEMENT OF MARKETING IN SPORTING EVENT

    OpenAIRE

    Miodrag Koprivica; Vasilj Koprivica; Slobodan Živkucin

    2009-01-01

    The events are happening at the present time on million different tv and radio sta- tions. Every marketer should be aware of that, each and every marketer in situations like this is using different elements of marketing mix, such as: advertising, personal sales, promotional development, publicity and public relations, and of course direct marketing. Organizers of sporting events are using many different ways to bring in visitors. By using marketing mix good position and design of event is sec...

  9. Nucleases Encoded by Integraded Elements CJIE2 and CJIE4 Inhibit Natural Transformation of Campylobacter Jejuni

    NARCIS (Netherlands)

    Gaasbeek, E.J.; Wagenaar, J.A.; Guilhabert, M.R.; Putten, van J.P.; Parker, C.T.; Wal, van der F.J.

    2010-01-01

    The species Campylobacter jejuni is naturally competent for DNA uptake; nevertheless, nonnaturally transformable strains do exist. For a subset of strains we previously showed that a periplasmic DNase, encoded by dns, inhibits natural transformation in C. jejuni. In the present study, genetic

  10. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  11. The cytomegalovirus-encoded chemokine receptor US28 promotes intestinal neoplasia in transgenic mice

    NARCIS (Netherlands)

    Bongers, Gerold; Maussang, David; Muniz, Luciana R; Noriega, Vanessa M; Fraile-Ramos, Alberto; Barker, Nick; Marchesi, Federica; Thirunarayanan, Nanthakumar; Vischer, Henry F; Qin, Lihui; Mayer, Lloyd; Harpaz, Noam; Leurs, Rob; Furtado, Glaucia C; Clevers, Hans; Tortorella, Domenico; Smit, Martine J; Lira, Sergio A

    2010-01-01

    US28 is a constitutively active chemokine receptor encoded by CMV (also referred to as human herpesvirus 5), a highly prevalent human virus that infects a broad spectrum of cells, including intestinal epithelial cells (IECs). To study the role of US28 in vivo, we created transgenic mice (VS28 mice)

  12. A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

    Directory of Open Access Journals (Sweden)

    Lior Levy

    2017-10-01

    Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

  13. Motivated encoding selectively promotes memory for future inconsequential semantically-related events.

    Science.gov (United States)

    Oyarzún, Javiera P; Packard, Pau A; de Diego-Balaguer, Ruth; Fuentemilla, Lluis

    2016-09-01

    Neurobiological models of long-term memory explain how memory for inconsequential events fades, unless these happen before or after other relevant (i.e., rewarding or aversive) or novel events. Recently, it has been shown in humans that retrospective and prospective memories are selectively enhanced if semantically related events are paired with aversive stimuli. However, it remains unclear whether motivating stimuli, as opposed to aversive, have the same effect in humans. Here, participants performed a three phase incidental encoding task where one semantic category was rewarded during the second phase. A memory test 24h after, but not immediately after encoding, revealed that memory for inconsequential items was selectively enhanced only if items from the same category had been previously, but not subsequently, paired with rewards. This result suggests that prospective memory enhancement of reward-related information requires, like previously reported for aversive memories, of a period of memory consolidation. The current findings provide the first empirical evidence in humans that the effects of motivated encoding are selectively and prospectively prolonged over time. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  15. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    Science.gov (United States)

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

  16. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    Science.gov (United States)

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  17. Some efficient Lagrangian mesh finite elements encoded in ZEPHYR for two dimensional transport calculations

    International Nuclear Information System (INIS)

    Mordant, Maurice.

    1981-04-01

    To solve a multigroup stationary neutron transport equation in two-dimensional geometries (X-Y), (R-O) or (R-Z) generally on uses discrete ordinates and rectangular meshes. The way to do it is then well known, well documented and somewhat obvious. If one needs to treat awkward geometries or distorted meshes, things are not so easy and the way to do it is no longer straightforward. We have studied this problem at Limeil Nuclear Center and as an alternative to Monte Carlo methods and code we have implemented in ZEPHYR code at least two efficient finite element solutions for Lagrangian meshes involving any kind of triangles and quadrilaterals

  18. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  19. Four regulatory elements in the human c-fos promoter mediate transactivation by HTLV-1 Tax protein.

    Science.gov (United States)

    Alexandre, C; Verrier, B

    1991-04-01

    Expression of the human c-fos proto-oncogene is activated in trans by the Tax protein encoded by human T-cell leukemia virus type-1 (HTLV-1). Indeed, we show here that a HeLa clone stably transfected by Tax expresses Fos at a high level. We also show that multiple elements of the human c-fos promoter, i.e. the v-sis conditioned medium inducible element (SIE), the dyad symmetry element (DSE) necessary for growth factor induction, the octanucleotide direct repeat element (DR), and the cyclic AMP response element (CRE) centred at -60, can all mediate Tax transactivation. In the DSE, the 10bp central core that binds the serum response factor (SRF) is, by itself, sufficient to mediate Tax transactivation. Moreover, a CRE-binding protein is involved in Tax activation through the CRE-60 element. Since Fos is a transregulator of cellular genes, our results suggest that the oncoprotein plays a crucial role in T-cell transformation by HTLV-1 in conjunction with other Tax-inducible genes.

  20. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    Science.gov (United States)

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  1. Slow oscillation electrical brain stimulation during waking promotes EEG theta activity and memory encoding

    DEFF Research Database (Denmark)

    Kirov, Roumen; Weiss, Carsten; Siebner, Hartwig R

    2009-01-01

    typically occurring during this state of sleep were also enhanced. Here, we show that the same tSOS applied in the waking brain also induced an increase in endogenous EEG slow oscillations (0.4-1.2 Hz), although in a topographically restricted fashion. Applied during wakefulness tSOS, additionally, resulted......The application of transcranial slow oscillation stimulation (tSOS; 0.75 Hz) was previously shown to enhance widespread endogenous EEG slow oscillatory activity when applied during a sleep period characterized by emerging endogenous slow oscillatory activity. Processes of memory consolidation...... induced by tSOS critically depend on brain state. In response to tSOS during wakefulness the brain transposes stimulation by responding preferentially with theta oscillations and facilitated encoding....

  2. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  3. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  4. Commensal E. coli as an Important Reservoir of Resistance Encoding Genetic Elements

    Directory of Open Access Journals (Sweden)

    Azam Mahmoudi-Aznaveh

    2013-11-01

    Full Text Available Background: Diarrheagenic E. coli is the most important cause of diarrhea in children and is a public health concern in developing countries. A major public problem is acquisition and transmission of antimicrobial resistance via mobile genetic elements including plasmids, conjugative transposons, and integrons which may occur through horizontal gene transfer. Objectives: The aim of this study was to investigate the distribution of class 1 and 2 integrons among commensal and enteropathogenic E. coli isolates and assess the role of commensal E. coli population as a reservoir in the acquisition and transmission of antimicrobial resistance. Materials and Methods: Swabs were collected directly from stool samples of the children with diarrhea admitted to three hospitals in Tehran, Iran during July 2012 through October 2012. Antimicrobial susceptibility testing and PCR analysis were performed for analysis of the resistance pattern and integron content of isolates. Results: A total of 20 enteropathogenic E.coli (identified as eae+stx1-stx2- and 20 commensal E.coli were selected for analysis. The resistance pattern in commensal and pathogenic E.coli was very similar. In both groups a high rate of resistance was seen to tetracycline, streptomycin, cotrimoxazole, nalidixic acid, and minocycline. Of 20 EPEC strains, 3 strains (15 % and 1 strain (5% had positive results for int and hep genes, respectively. Among 20 commensal, 65% (13 strains and 10% (2 strains had positive results for int and hep genes, respectively. Conclusions: The higher rate of class 1 integron occurrence among commensal population proposes the commensal intestinal organisms as a potential reservoir of mobile resistance gene elements which could transfer the resistance gene cassettes to other pathogenic and/or nonpathogenic organisms in the intestinal lumen at different occasions.

  5. Modularization of genetic elements promotes synthetic metabolic engineering.

    Science.gov (United States)

    Qi, Hao; Li, Bing-Zhi; Zhang, Wen-Qian; Liu, Duo; Yuan, Ying-Jin

    2015-11-15

    In the context of emerging synthetic biology, metabolic engineering is moving to the next stage powered by new technologies. Systematical modularization of genetic elements makes it more convenient to engineer biological systems for chemical production or other desired purposes. In the past few years, progresses were made in engineering metabolic pathway using synthetic biology tools. Here, we spotlighted the topic of implementation of modularized genetic elements in metabolic engineering. First, we overviewed the principle developed for modularizing genetic elements and then discussed how the genetic modules advanced metabolic engineering studies. Next, we picked up some milestones of engineered metabolic pathway achieved in the past few years. Last, we discussed the rapid raised synthetic biology field of "building a genome" and the potential in metabolic engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. The influence of sales promotion elements on consumers (jsc „rimi lietuva“ sample)

    OpenAIRE

    Markovskaja, Ivona

    2016-01-01

    The influence of sales promotion elements on consumer is analyzed in the Bachelor‘s Thesis. The thesis examines the information published by various foreign and Lithuanian authors. The main aim of this paper is to analyze different theories of sales promotion effectiveness, sales promotion relevance and factors influencing consumer‘s behavior. This paper analyses the theoretical aspects of sales promotion. It has become more popular in the beginning of the sixth decade. The definition of conc...

  7. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  8. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  9. Synthetic scaffold coating with adeno-associated virus encoding BMP2 to promote endogenous bone repair.

    Science.gov (United States)

    Dupont, Kenneth M; Boerckel, Joel D; Stevens, Hazel Y; Diab, Tamim; Kolambkar, Yash M; Takahata, Masahiko; Schwarz, Edward M; Guldberg, Robert E

    2012-03-01

    Biomaterial scaffolds functionalized to stimulate endogenous repair mechanisms via the incorporation of osteogenic cues offer a potential alternative to bone grafting for the treatment of large bone defects. We first quantified the ability of a self-complementary adeno-associated viral vector encoding bone morphogenetic protein 2 (scAAV2.5-BMP2) to enhance human stem cell osteogenic differentiation in vitro. In two-dimensional culture, scAAV2.5-BMP2-transduced human mesenchymal stem cells (hMSCs) displayed significant increases in BMP2 production and alkaline phosphatase activity compared with controls. hMSCs and human amniotic-fluid-derived stem cells (hAFS cells) seeded on scAAV2.5-BMP2-coated three-dimensional porous polymer Poly(ε-caprolactone) (PCL) scaffolds also displayed significant increases in BMP2 production compared with controls during 12 weeks of culture, although only hMSC-seeded scaffolds displayed significantly increased mineral formation. PCL scaffolds coated with scAAV2.5-BMP2 were implanted into critically sized immunocompromised rat femoral defects, both with or without pre-seeding of hMSCs, representing ex vivo and in vivo gene therapy treatments, respectively. After 12 weeks, defects treated with acellular scAAV2.5-BMP2-coated scaffolds displayed increased bony bridging and had significantly higher bone ingrowth and mechanical properties compared with controls, whereas defects treated with scAAV2.5-BMP2 scaffolds pre-seeded with hMSCs failed to display significant differences relative to controls. When pooled, defect treatment with scAAV2.5-BMP2-coated scaffolds, both with or without inclusion of pre-seeded hMSCs, led to significant increases in defect mineral formation at all time points and increased mechanical properties compared with controls. This study thus presents a novel acellular bone-graft-free endogenous repair therapy for orthotopic tissue-engineered bone regeneration.

  10. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  11. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  12. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  13. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  14. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  15. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

    Science.gov (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1991-08-30

    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  16. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  17. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  18. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  19. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  20. The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancer-like element involved in chloroplast-dependent expression.

    Science.gov (United States)

    Vorst, O; Kock, P; Lever, A; Weterings, B; Weisbeek, P; Smeekens, S

    1993-12-01

    Plastocyanin is part of the photosynthetic electron transport chain in the chloroplast and is encoded in the nucleus. Expression of the Arabidopsis thaliana plastocyanin gene is organ specific: high mRNA levels are observed in young green parts of the plant. Furthermore, expression is dependent on the presence of light and functional chloroplasts. When grown in the presence of norflurazon under white light conditions, resulting in the photo-oxidative destruction of the chloroplast, plastocyanin mRNA levels are strongly reduced. A -1579 to -9 promoter fragment confers light-regulated and chloroplast-dependent expression to the beta-glucuronidase reporter gene in transgenic tobacco plants. This suggests that regulation takes place at the level of transcription. A plastocyanin promoter deletion series ranging from -1579 to -121 which was also tested in tobacco, revealed the presence of a strong positive regulating element (PRE) in the -1579 to -705 region. Deletion of this part of the promoter resulted in a approximately 100-fold reduction of GUS expression as measured in mature leaves. Surprisingly, this enhancer-like element was capable of stimulating transcription from a position downstream of its reporter. Moreover, it could also activate a truncated CaMV 35S promoter. Deletion of this element coincides with the loss of chloroplast-dependency of reporter gene expression, as judged by norflurazon treatment of transgenic seedlings. So, the activity of the PRE itself might depend on the presence of functional chloroplasts.

  1. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

  2. Finite Element Methods On Very Large, Dynamic Tubular Grid Encoded Implicit Surfaces

    DEFF Research Database (Denmark)

    Nemitz, Oliver; Nielsen, Michael Bang; Rumpf, Martin

    2009-01-01

    dynamic tubular grid encoding format for a narrow band. A reaction diffusion model on a fixed surface and surface evolution driven by a nonlinear geometric diffusion approach, by isotropic or truly anisotropic curvature motion, are investigated as characteristic model problems. The proposed methods...

  3. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project

    DEFF Research Database (Denmark)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya

    2007-01-01

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses...

  4. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  5. The Role of S P2, SP3 AND SP4 in The Transcriptional Regulation of The Promoter of Nuclear Encoded Mitochondrial Genes

    International Nuclear Information System (INIS)

    Zaid, A.; Salem, Gh.

    2012-01-01

    The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.

  6. Facilitation of memory encoding in primate hippocampus by a neuroprosthesis that promotes task-specific neural firing

    Science.gov (United States)

    Hampson, Robert E.; Song, Dong; Opris, Ioan; Santos, Lucas M.; Shin, Dae C.; Gerhardt, Greg A.; Marmarelis, Vasilis Z.; Berger, Theodore W.; Deadwyler, Sam A.

    2013-12-01

    Objective. Memory accuracy is a major problem in human disease and is the primary factor that defines Alzheimer’s, ageing and dementia resulting from impaired hippocampal function in the medial temporal lobe. Development of a hippocampal memory neuroprosthesis that facilitates normal memory encoding in nonhuman primates (NHPs) could provide the basis for improving memory in human disease states. Approach. NHPs trained to perform a short-term delayed match-to-sample (DMS) memory task were examined with multi-neuron recordings from synaptically connected hippocampal cell fields, CA1 and CA3. Recordings were analyzed utilizing a previously developed nonlinear multi-input multi-output (MIMO) neuroprosthetic model, capable of extracting CA3-to-CA1 spatiotemporal firing patterns during DMS performance. Main results. The MIMO model verified that specific CA3-to-CA1 firing patterns were critical for the successful encoding of sample phase information on more difficult DMS trials. This was validated by the delivery of successful MIMO-derived encoding patterns via electrical stimulation to the same CA1 recording locations during the sample phase which facilitated task performance in the subsequent, delayed match phase, on difficult trials that required more precise encoding of sample information. Significance. These findings provide the first successful application of a neuroprosthesis designed to enhance and/or repair memory encoding in primate brain.

  7. Phase reconstruction from velocity-encoded MRI measurements – A survey of sparsity-promoting variational approaches

    KAUST Repository

    Benning, Martin; Gladden, Lynn; Holland, Daniel; Schö nlieb, Carola-Bibiane; Valkonen, Tuomo

    2014-01-01

    for the reconstruction of phase-encoded magnetic resonance velocity images from sub-sampled k-space data. We are particularly interested in regularisers that correctly treat both smooth and geometric features of the image. These features are common to velocity imaging

  8. Integrator element as a promoter of active learning in engineering teaching

    Science.gov (United States)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  9. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  10. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  11. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  12. Performance of an optical encoder based on a nondiffractive beam implemented with a specific photodetection integrated circuit and a diffractive optical element.

    Science.gov (United States)

    Quintián, Fernando Perez; Calarco, Nicolás; Lutenberg, Ariel; Lipovetzky, José

    2015-09-01

    In this paper, we study the incremental signal produced by an optical encoder based on a nondiffractive beam (NDB). The NDB is generated by means of a diffractive optical element (DOE). The detection system is composed by an application specific integrated circuit (ASIC) sensor. The sensor consists of an array of eight concentric annular photodiodes, each one provided with a programmable gain amplifier. In this way, the system is able to synthesize a nonuniform detectivity. The contrast, amplitude, and harmonic content of the sinusoidal output signal are analyzed. The influence of the cross talk among the annular photodiodes is placed in evidence through the dependence of the signal contrast on the wavelength.

  13. Characterization of a Suppressive Cis-acting Element in the Epstein–Barr Virus LMP1 Promoter

    Directory of Open Access Journals (Sweden)

    Masahiro Yoshida

    2017-11-01

    Full Text Available Latent membrane protein 1 (LMP1 is a major oncogene encoded by Epstein–Barr virus (EBV and is essential for immortalization of B cells by the virus. Previous studies suggested that several transcription factors, such as PU.1, RBP-Jκ, NFκB, EBF1, AP-2 and STAT, are involved in LMP1 induction; however, the means by which the oncogene is negatively regulated remains unclear. Here, we introduced short mutations into the proximal LMP1 promoter that includes recognition sites for the E-box and Ikaros transcription factors in the context of EBV-bacterial artificial chromosome. Upon infection, the mutant exhibited increased LMP1 expression and EBV-mediated immortalization of B cells. However, single mutations of either the E-box or Ikaros sites had limited effects on LMP1 expression and transformation. Our results suggest that this region contains a suppressive cis-regulatory element, but other transcriptional repressors (apart from the E-box and Ikaros transcription factors may remain to be discovered.

  14. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  15. Effective elements of school health promotion across behavioral domains: a systematic review of reviews

    Directory of Open Access Journals (Sweden)

    Peters Louk WH

    2009-06-01

    Full Text Available Abstract Background Most school health education programs focus on a single behavioral domain. Integrative programs that address multiple behaviors may be more efficient, but only if the elements of change are similar for these behaviors. The objective of this study was to examine which effective elements of school health education are similar across three particular behavioral domains. Methods A systematic review of reviews of the effectiveness of school-based health promotion programs was conducted for the domains of substance abuse, sexual behavior, and nutrition. The literature search spanned the time period between 1995 and October 2006 and included three databases, websites of review centers and backward search. Fifty-five reviews and meta-analyses met predetermined relevance and publication criteria and were included. Data was extracted by one reviewer and checked by a second reviewer. A standardized data extraction form was used, with detailed attention to effective elements pertaining to program goals, development, content, methods, facilitator, components and intensity. Two assessors rated the quality of reviews as strong, moderate or weak. We included only strong and moderate reviews in two types of analysis: one based on interpretation of conflicting results, the other on a specific vote-counting rule. Results Thirty six reviews were rated strong, 6 moderate, and 13 weak. A multitude of effective elements was identified in the included reviews and many elements were similar for two or more domains. In both types of analysis, five elements with evidence from strong reviews were found to be similar for all three domains: use of theory; addressing social influences, especially social norms; addressing cognitive-behavioral skills; training of facilitators; and multiple components. Two additional elements had positive results in all domains with the rule-based method of analysis, but had inconclusive results in at least one domain with

  16. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    Science.gov (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  17. Interaction between the thyroid hormone receptor and co-factors on the promoter of the gene encoding phospho enol pyruvate carboxykinase

    NARCIS (Netherlands)

    Schmidt, E. D.; van Beeren, M.; Glass, C. K.; Wiersinga, W. M.; Lamers, W. H.

    1993-01-01

    Using transient transfection studies we localized a thyroid hormone-responsive element on the promoter of the rat phospho-enol pyruvate carboxykinase gene between 355 and 174 bp upstream of the transcription start site. DNAse 1 footprinting analysis within this region showed that a 28 bp fragment at

  18. Mutation of Rice BC12/GDD1, Which Encodes a Kinesin-Like Protein That Binds to a GA Biosynthesis Gene Promoter, Leads to Dwarfism with Impaired Cell Elongation[W][OA

    Science.gov (United States)

    Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang

    2011-01-01

    The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138

  19. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project.

    Science.gov (United States)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya; Guigó, Roderic; Gingeras, Thomas R; Margulies, Elliott H; Weng, Zhiping; Snyder, Michael; Dermitzakis, Emmanouil T; Thurman, Robert E; Kuehn, Michael S; Taylor, Christopher M; Neph, Shane; Koch, Christoph M; Asthana, Saurabh; Malhotra, Ankit; Adzhubei, Ivan; Greenbaum, Jason A; Andrews, Robert M; Flicek, Paul; Boyle, Patrick J; Cao, Hua; Carter, Nigel P; Clelland, Gayle K; Davis, Sean; Day, Nathan; Dhami, Pawandeep; Dillon, Shane C; Dorschner, Michael O; Fiegler, Heike; Giresi, Paul G; Goldy, Jeff; Hawrylycz, Michael; Haydock, Andrew; Humbert, Richard; James, Keith D; Johnson, Brett E; Johnson, Ericka M; Frum, Tristan T; Rosenzweig, Elizabeth R; Karnani, Neerja; Lee, Kirsten; Lefebvre, Gregory C; Navas, Patrick A; Neri, Fidencio; Parker, Stephen C J; Sabo, Peter J; Sandstrom, Richard; Shafer, Anthony; Vetrie, David; Weaver, Molly; Wilcox, Sarah; Yu, Man; Collins, Francis S; Dekker, Job; Lieb, Jason D; Tullius, Thomas D; Crawford, Gregory E; Sunyaev, Shamil; Noble, William S; Dunham, Ian; Denoeud, France; Reymond, Alexandre; Kapranov, Philipp; Rozowsky, Joel; Zheng, Deyou; Castelo, Robert; Frankish, Adam; Harrow, Jennifer; Ghosh, Srinka; Sandelin, Albin; Hofacker, Ivo L; Baertsch, Robert; Keefe, Damian; Dike, Sujit; Cheng, Jill; Hirsch, Heather A; Sekinger, Edward A; Lagarde, Julien; Abril, Josep F; Shahab, Atif; Flamm, Christoph; Fried, Claudia; Hackermüller, Jörg; Hertel, Jana; Lindemeyer, Manja; Missal, Kristin; Tanzer, Andrea; Washietl, Stefan; Korbel, Jan; Emanuelsson, Olof; Pedersen, Jakob S; Holroyd, Nancy; Taylor, Ruth; Swarbreck, David; Matthews, Nicholas; Dickson, Mark C; Thomas, Daryl J; Weirauch, Matthew T; Gilbert, James; Drenkow, Jorg; Bell, Ian; Zhao, XiaoDong; Srinivasan, K G; Sung, Wing-Kin; Ooi, Hong Sain; Chiu, Kuo Ping; Foissac, Sylvain; Alioto, Tyler; Brent, Michael; Pachter, Lior; Tress, Michael L; Valencia, Alfonso; Choo, Siew Woh; Choo, Chiou Yu; Ucla, Catherine; Manzano, Caroline; Wyss, Carine; Cheung, Evelyn; Clark, Taane G; Brown, James B; Ganesh, Madhavan; Patel, Sandeep; Tammana, Hari; Chrast, Jacqueline; Henrichsen, Charlotte N; Kai, Chikatoshi; Kawai, Jun; Nagalakshmi, Ugrappa; Wu, Jiaqian; Lian, Zheng; Lian, Jin; Newburger, Peter; Zhang, Xueqing; Bickel, Peter; Mattick, John S; Carninci, Piero; Hayashizaki, Yoshihide; Weissman, Sherman; Hubbard, Tim; Myers, Richard M; Rogers, Jane; Stadler, Peter F; Lowe, Todd M; Wei, Chia-Lin; Ruan, Yijun; Struhl, Kevin; Gerstein, Mark; Antonarakis, Stylianos E; Fu, Yutao; Green, Eric D; Karaöz, Ulaş; Siepel, Adam; Taylor, James; Liefer, Laura A; Wetterstrand, Kris A; Good, Peter J; Feingold, Elise A; Guyer, Mark S; Cooper, Gregory M; Asimenos, George; Dewey, Colin N; Hou, Minmei; Nikolaev, Sergey; Montoya-Burgos, Juan I; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Huang, Haiyan; Zhang, Nancy R; Holmes, Ian; Mullikin, James C; Ureta-Vidal, Abel; Paten, Benedict; Seringhaus, Michael; Church, Deanna; Rosenbloom, Kate; Kent, W James; Stone, Eric A; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross C; Haussler, David; Miller, Webb; Sidow, Arend; Trinklein, Nathan D; Zhang, Zhengdong D; Barrera, Leah; Stuart, Rhona; King, David C; Ameur, Adam; Enroth, Stefan; Bieda, Mark C; Kim, Jonghwan; Bhinge, Akshay A; Jiang, Nan; Liu, Jun; Yao, Fei; Vega, Vinsensius B; Lee, Charlie W H; Ng, Patrick; Shahab, Atif; Yang, Annie; Moqtaderi, Zarmik; Zhu, Zhou; Xu, Xiaoqin; Squazzo, Sharon; Oberley, Matthew J; Inman, David; Singer, Michael A; Richmond, Todd A; Munn, Kyle J; Rada-Iglesias, Alvaro; Wallerman, Ola; Komorowski, Jan; Fowler, Joanna C; Couttet, Phillippe; Bruce, Alexander W; Dovey, Oliver M; Ellis, Peter D; Langford, Cordelia F; Nix, David A; Euskirchen, Ghia; Hartman, Stephen; Urban, Alexander E; Kraus, Peter; Van Calcar, Sara; Heintzman, Nate; Kim, Tae Hoon; Wang, Kun; Qu, Chunxu; Hon, Gary; Luna, Rosa; Glass, Christopher K; Rosenfeld, M Geoff; Aldred, Shelley Force; Cooper, Sara J; Halees, Anason; Lin, Jane M; Shulha, Hennady P; Zhang, Xiaoling; Xu, Mousheng; Haidar, Jaafar N S; Yu, Yong; Ruan, Yijun; Iyer, Vishwanath R; Green, Roland D; Wadelius, Claes; Farnham, Peggy J; Ren, Bing; Harte, Rachel A; Hinrichs, Angie S; Trumbower, Heather; Clawson, Hiram; Hillman-Jackson, Jennifer; Zweig, Ann S; Smith, Kayla; Thakkapallayil, Archana; Barber, Galt; Kuhn, Robert M; Karolchik, Donna; Armengol, Lluis; Bird, Christine P; de Bakker, Paul I W; Kern, Andrew D; Lopez-Bigas, Nuria; Martin, Joel D; Stranger, Barbara E; Woodroffe, Abigail; Davydov, Eugene; Dimas, Antigone; Eyras, Eduardo; Hallgrímsdóttir, Ingileif B; Huppert, Julian; Zody, Michael C; Abecasis, Gonçalo R; Estivill, Xavier; Bouffard, Gerard G; Guan, Xiaobin; Hansen, Nancy F; Idol, Jacquelyn R; Maduro, Valerie V B; Maskeri, Baishali; McDowell, Jennifer C; Park, Morgan; Thomas, Pamela J; Young, Alice C; Blakesley, Robert W; Muzny, Donna M; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Jiang, Huaiyang; Weinstock, George M; Gibbs, Richard A; Graves, Tina; Fulton, Robert; Mardis, Elaine R; Wilson, Richard K; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B; Chang, Jean L; Lindblad-Toh, Kerstin; Lander, Eric S; Koriabine, Maxim; Nefedov, Mikhail; Osoegawa, Kazutoyo; Yoshinaga, Yuko; Zhu, Baoli; de Jong, Pieter J

    2007-06-14

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non-protein-coding transcripts, and those that extensively overlap one another. Second, systematic examination of transcriptional regulation has yielded new understanding about transcription start sites, including their relationship to specific regulatory sequences and features of chromatin accessibility and histone modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra-species sequence comparisons, has yielded new mechanistic and evolutionary insights concerning the functional landscape of the human genome. Together, these studies are defining a path for pursuit of a more comprehensive characterization of human genome function.

  20. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  1. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    Science.gov (United States)

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Phase reconstruction from velocity-encoded MRI measurements – A survey of sparsity-promoting variational approaches

    KAUST Repository

    Benning, Martin

    2014-01-01

    In recent years there has been significant developments in the reconstruction of magnetic resonance velocity images from sub-sampled k-space data. While showing a strong improvement in reconstruction quality compared to classical approaches, the vast number of different methods, and the challenges in setting them up, often leaves the user with the difficult task of choosing the correct approach, or more importantly, not selecting a poor approach. In this paper, we survey variational approaches for the reconstruction of phase-encoded magnetic resonance velocity images from sub-sampled k-space data. We are particularly interested in regularisers that correctly treat both smooth and geometric features of the image. These features are common to velocity imaging, where the flow field will be smooth but interfaces between the fluid and surrounding material will be sharp, but are challenging to represent sparsely. As an example we demonstrate the variational approaches on velocity imaging of water flowing through a packed bed of solid particles. We evaluate Wavelet regularisation against Total Variation and the relatively recent second order Total Generalised Variation regularisation. We combine these regularisation schemes with a contrast enhancement approach called Bregman iteration. We verify for a variety of sampling patterns that Morozov\\'s discrepancy principle provides a good criterion for stopping the iterations. Therefore, given only the noise level, we present a robust guideline for setting up a variational reconstruction scheme for MR velocity imaging. © 2013 Elsevier Inc. All rights reserved.

  3. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  4. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  5. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  6. Low message sensation health promotion videos are better remembered and activate areas of the brain associated with memory encoding.

    Directory of Open Access Journals (Sweden)

    David Seelig

    Full Text Available Greater sensory stimulation in advertising has been postulated to facilitate attention and persuasion. For this reason, video ads promoting health behaviors are often designed to be high in "message sensation value" (MSV, a standardized measure of sensory intensity of the audiovisual and content features of an ad. However, our previous functional Magnetic Resonance Imaging (fMRI study showed that low MSV ads were better remembered and produced more prefrontal and temporal and less occipital cortex activation, suggesting that high MSV may divert cognitive resources from processing ad content. The present study aimed to determine whether these findings from anti-smoking ads generalize to other public health topics, such as safe sex. Thirty-nine healthy adults viewed high- and low MSV ads promoting safer sex through condom use, during an fMRI session. Recognition memory of the ads was tested immediately and 3 weeks after the session. We found that low MSV condom ads were better remembered than the high MSV ads at both time points and replicated the fMRI patterns previously reported for the anti-smoking ads. Occipital and superior temporal activation was negatively related to the attitudes favoring condom use (see Condom Attitudes Scale, Methods and Materials section. Psychophysiological interaction (PPI analysis of the relation between occipital and fronto-temporal (middle temporal and inferior frontal gyri cortices revealed weaker negative interactions between occipital and fronto-temporal cortices during viewing of the low MSV that high MSV ads. These findings confirm that the low MSV video health messages are better remembered than the high MSV messages and that this effect generalizes across public health domains. The greater engagement of the prefrontal and fronto-temporal cortices by low MSV ads and the greater occipital activation by high MSV ads suggest that that the "attention-grabbing" high MSV format could impede the learning and

  7. Low message sensation health promotion videos are better remembered and activate areas of the brain associated with memory encoding.

    Science.gov (United States)

    Seelig, David; Wang, An-Li; Jagannathan, Kanchana; Jaganathan, Kanchana; Loughead, James W; Blady, Shira J; Childress, Anna Rose; Romer, Daniel; Langleben, Daniel D

    2014-01-01

    Greater sensory stimulation in advertising has been postulated to facilitate attention and persuasion. For this reason, video ads promoting health behaviors are often designed to be high in "message sensation value" (MSV), a standardized measure of sensory intensity of the audiovisual and content features of an ad. However, our previous functional Magnetic Resonance Imaging (fMRI) study showed that low MSV ads were better remembered and produced more prefrontal and temporal and less occipital cortex activation, suggesting that high MSV may divert cognitive resources from processing ad content. The present study aimed to determine whether these findings from anti-smoking ads generalize to other public health topics, such as safe sex. Thirty-nine healthy adults viewed high- and low MSV ads promoting safer sex through condom use, during an fMRI session. Recognition memory of the ads was tested immediately and 3 weeks after the session. We found that low MSV condom ads were better remembered than the high MSV ads at both time points and replicated the fMRI patterns previously reported for the anti-smoking ads. Occipital and superior temporal activation was negatively related to the attitudes favoring condom use (see Condom Attitudes Scale, Methods and Materials section). Psychophysiological interaction (PPI) analysis of the relation between occipital and fronto-temporal (middle temporal and inferior frontal gyri) cortices revealed weaker negative interactions between occipital and fronto-temporal cortices during viewing of the low MSV that high MSV ads. These findings confirm that the low MSV video health messages are better remembered than the high MSV messages and that this effect generalizes across public health domains. The greater engagement of the prefrontal and fronto-temporal cortices by low MSV ads and the greater occipital activation by high MSV ads suggest that that the "attention-grabbing" high MSV format could impede the learning and retention of public

  8. The SXT conjugative element and linear prophage N15 encode toxin-antitoxin-stabilizing systems homologous to the tad-ata module of the Paracoccus aminophilus plasmid pAMI2.

    Science.gov (United States)

    Dziewit, Lukasz; Jazurek, Magdalena; Drewniak, Lukasz; Baj, Jadwiga; Bartosik, Dariusz

    2007-03-01

    A group of proteic toxin-antitoxin (TA) cassettes whose representatives are widely distributed among bacterial genomes has been identified. These cassettes occur in chromosomes, plasmids, bacteriophages, and noncomposite transposons, as well as in the SXT conjugative element of Vibrio cholerae. The following four homologous loci were subjected to detailed comparative studies: (i) tad-ata from plasmid pAMI2 of Paracoccus aminophilus (the prototype of this group), (ii) gp49-gp48 from the linear bacteriophage N15 of Escherichia coli, (iii) s045-s044 from SXT, and (iv) Z3230-Z3231 from the genomic island of enterohemorrhagic Escherichia coli O157:H7 strain EDL933. Functional analysis revealed that all but one of these loci (Z3230-Z3231) are able to stabilize heterologous replicons, although the host ranges varied. The TA cassettes analyzed have the following common features: (i) the toxins are encoded by the first gene of each operon; (ii) the antitoxins contain a predicted helix-turn-helix motif of the XRE family; and (iii) the cassettes have two promoters that are different strengths, one which is located upstream of the toxin gene and one which is located upstream of the antitoxin gene. All four toxins tested are functional in E. coli; overexpression of the toxins (in the absence of antitoxin) results in a bacteriostatic effect manifested by elongation of bacterial cells and growth arrest. The toxins have various effects on cell viability, which suggests that they may recognize different intracellular targets. Preliminary data suggest that different cellular proteases are involved in degradation of antitoxins encoded by the loci analyzed.

  9. Two ABREs, two redundant root-specific and one W-box cis-acting elements are functional in the sunflower HAHB4 promoter.

    Science.gov (United States)

    Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L

    2008-10-01

    HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.

  10. FB elements can promote exon shuffling: a promoter-less white allele can be reactivated by FB mediated transposition in Drosophila melanogaster.

    Science.gov (United States)

    Moschetti, R; Marsano, R M; Barsanti, P; Caggese, C; Caizzi, R

    2004-05-01

    Foldback ( FB) elements are transposable elements found in many eukaryotic genomes; they are thought to contribute significantly to genome plasticity. In Drosophila melanogaster, FBs have been shown to be involved in the transposition of large chromosomal regions and in the genetic instability of some alleles of the white gene. In this report we show that FB mediated transposition of w(67C23), a mutation that deletes the promoter of the white gene and its first exon, containing the start codon, can restore expression of the white gene. We have characterized three independent events in which a 14-kb fragment from the w(67C23) locus was transposed into an intron region in three different genes. In each case a local promoter drives the expression of white, producing a chimeric mRNA. These findings suggest that, on an evolutionary timescale, FB elements may contribute to the creation of new genes via exon shuffling.

  11. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  12. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    International Nuclear Information System (INIS)

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-01-01

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR

  13. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  14. Promoção da saúde: elemento instituinte? Health promotion: an instituing element?

    Directory of Open Access Journals (Sweden)

    Juan Carlos Aneiros Fernandez

    2008-03-01

    Full Text Available O artigo inclui na discussão sobre os resultados da promoção da saúde um argumento de natureza epistemológica, levando em consideração o contexto contemporâneo de mudanças econômicas, políticas e culturais do qual ela é parte e expressão. Destacam-se, por um lado, as suspeitas que recaem sobre o projeto da Modernidade, sejam elas decorrentes do crescimento das incertezas ou da irrealização de promessas e, por outro lado, as tentativas de equacionamento do binômio determinação/autonomia, como questões sensíveis a uma ruptura dos modos de conhecer na contemporaneidade. Propõe-se considerar a dinâmica social e abordá-la como a união e a tensão da história feita e da história se fazendo, para melhor compreender o alcance e os resultados da promoção da saúde. A conclusão é que a promoção da saúde deve continuar buscando o desenvolvimento de ações cada vez mais efetivas, mas deve fazê-lo sem abdicar da possibilidade de manter-se próxima da energia social livre e em ebulição, que caracteriza o elemento instituinte de uma produção histórica.The article includes, in the discussion about health promotion results, an epistemological argument, considering the contemporary context of changes of which it is part and expression. The suspicion concerning the project of Modernity is emphasized, as a result of growing uncertainties or unfulfilled promises. In addition, the attempts to solve the conflict between determination and autonomy are also highlighted. Both aspects are considered as sensible questions regarding a rupture of the ways of knowing in contemporariness. The article proposes to consider social dynamics, approaching it as the union and tension of concluded history and ongoing history, so as to better understand the reach and results of health promotion. The conclusion is that health promotion must continue the search for the development of increasingly effective actions, but it must do it without

  15. Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

    Science.gov (United States)

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2012-01-01

    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

  16. Differential distribution of a SINE element in the Entamoeba histolytica and Entamoeba dispar genomes: Role of the LINE-encoded endonuclease

    Directory of Open Access Journals (Sweden)

    Gupta Abhishek K

    2011-05-01

    Full Text Available Abstract Background Entamoeba histolytica and Entamoeba dispar are closely related protistan parasites but while E. histolytica can be invasive, E. dispar is completely non pathogenic. Transposable elements constitute a significant portion of the genome in these species; there being three families of LINEs and SINEs. These elements can profoundly influence the expression of neighboring genes. Thus their genomic location can have important phenotypic consequences. A genome-wide comparison of the location of these elements in the E. histolytica and E. dispar genomes has not been carried out. It is also not known whether the retrotransposition machinery works similarly in both species. The present study was undertaken to address these issues. Results Here we extracted all genomic occurrences of full-length copies of EhSINE1 in the E. histolytica genome and matched them with the homologous regions in E. dispar, and vice versa, wherever it was possible to establish synteny. We found that only about 20% of syntenic sites were occupied by SINE1 in both species. We checked whether the different genomic location in the two species was due to differences in the activity of the LINE-encoded endonuclease which is required for nicking the target site. We found that the endonucleases of both species were essentially very similar, both in their kinetic properties and in their substrate sequence specificity. Hence the differential distribution of SINEs in these species is not likely to be influenced by the endonuclease. Further we found that the physical properties of the DNA sequences adjoining the insertion sites were similar in both species. Conclusions Our data shows that the basic retrotransposition machinery is conserved in these sibling species. SINEs may indeed have occupied all of the insertion sites in the genome of the common ancestor of E. histolytica and E. dispar but these may have been subsequently lost from some locations. Alternatively, SINE

  17. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    Science.gov (United States)

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  18. Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2014-09-01

    Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  19. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  20. ttm-1 encodes CDF transporters that excrete zinc from intestinal cells of C. elegans and act in a parallel negative feedback circuit that promotes homeostasis.

    Directory of Open Access Journals (Sweden)

    Hyun Cheol Roh

    2013-05-01

    Full Text Available Zinc is an essential metal involved in a wide range of biological processes, and aberrant zinc metabolism is implicated in human diseases. The gastrointestinal tract of animals is a critical site of zinc metabolism that is responsible for dietary zinc uptake and distribution to the body. However, the role of the gastrointestinal tract in zinc excretion remains unclear. Zinc transporters are key regulators of zinc metabolism that mediate the movement of zinc ions across membranes. Here, we identified a comprehensive list of 14 predicted Cation Diffusion Facilitator (CDF family zinc transporters in Caenorhabditis elegans and demonstrated that zinc is excreted from intestinal cells by one of these CDF proteins, TTM-1B. The ttm-1 locus encodes two transcripts, ttm-1a and ttm-1b, that use different transcription start sites. ttm-1b expression was induced by high levels of zinc specifically in intestinal cells, whereas ttm-1a was not induced by zinc. TTM-1B was localized to the apical plasma membrane of intestinal cells, and analyses of loss-of-function mutant animals indicated that TTM-1B promotes zinc excretion into the intestinal lumen. Zinc excretion mediated by TTM-1B contributes to zinc detoxification. These observations indicate that ttm-1 is a component of a negative feedback circuit, since high levels of cytoplasmic zinc increase ttm-1b transcript levels and TTM-1B protein functions to reduce the level of cytoplasmic zinc. We showed that TTM-1 isoforms function in tandem with CDF-2, which is also induced by high levels of cytoplasmic zinc and reduces cytoplasmic zinc levels by sequestering zinc in lysosome-related organelles. These findings define a parallel negative feedback circuit that promotes zinc homeostasis and advance the understanding of the physiological roles of the gastrointestinal tract in zinc metabolism in animals.

  1. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    Science.gov (United States)

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  2. Translational control and differential RNA decay are key elements regulating postsegregational expression of the killer protein encoded by the parB locus of plasmid R1

    DEFF Research Database (Denmark)

    Gerdes, K; Helin, K; Christensen, O W

    1988-01-01

    The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...

  3. Genes encoded within 8q24 on the amplicon of a large extrachromosomal element are selectively repressed during the terminal differentiation of HL-60 cells.

    Science.gov (United States)

    Hirano, Tetsuo; Ike, Fumio; Murata, Takehide; Obata, Yuichi; Utiyama, Hiroyasu; Yokoyama, Kazunari K

    2008-04-02

    Human acute myeloblastic leukemia HL-60 cells become resistant to differentiation during long-term cultivation. After 150 passages, double minute chromosomes (dmins) found in early-passaged cells are replaced by large extrachromosomal elements (LEEs). In a DNA library derived from a purified fraction of LEEs, 12.6% (23/183) of clones were assigned to 8q24 and 9.2% (17/183) were assigned to 14q11 in the human genome. Fluorescence in situ hybridization (FISH) revealed a small aberrant chromosome, which had not been found in early-passaged cells, in addition to the purified LEEs. We determined that each LEE consisted of six discontinuous segments in a region that extended for 4.4Mb over the 8q24 locus. Five genes, namely, Myc (a proto-oncogene), NSMCE2 (for a SUMO ligase), CCDC26 (for a retinoic acid-dependent modulator of myeloid differentiation), TRIB1 (for a regulator of MAPK kinase) and LOC389637 (for a protein of unknown function), were encoded by the amplicon. Breaks in the chromosomal DNA within the amplicon were found in the NSMCE2 and CCDC26 genes. The discontinuous structure of the amplicon unit of the LEEs was identical with that of dmins in HL-60 early-passaged cells. The difference between them seemed, predominantly, to be the number (10-15 copies per LEE versus 2 or 3 copies per dmin) of constituent units. Expression of the Myc, NSMCE2, CCDC26 and LOC389637 and TRIB1 genes was constitutive in all lines of HL-60 cells and that of the first four genes was repressed during the terminal differentiation of early-passaged HL-60 cells. We also detected abnormal transcripts of CCDC26. Our results suggest that these genes were selected during the development of amplicons. They might be amplified and, sometimes, truncated to contribute to the maintenance of HL-60 cells in an undifferentiated state.

  4. Solution NMR Structure of Hypothetical Protein CV_2116 Encoded by a Viral Prophage Element in Chromobacterium violaceum

    Directory of Open Access Journals (Sweden)

    Yunhuang Yang

    2012-06-01

    Full Text Available CV_2116 is a small hypothetical protein of 82 amino acids from the Gram-negative coccobacillus Chromobacterium violaceum. A PSI-BLAST search using the CV_2116 sequence as a query identified only one hit (E = 2e−07 corresponding to a hypothetical protein OR16_04617 from Cupriavidus basilensis OR16, which failed to provide insight into the function of CV_2116. The CV_2116 gene was cloned into the p15TvLic expression plasmid, transformed into E. coli, and 13C- and 15N-labeled NMR samples of CV_2116 were overexpressed in E. coli and purified for structure determination using NMR spectroscopy. The resulting high-quality solution NMR structure of CV_2116 revealed a novel α + β fold containing two anti-parallel β -sheets in the N-terminal two-thirds of the protein and one α-helix in the C-terminal third of the protein. CV_2116 does not belong to any known protein sequence family and a Dali search indicated that no similar structures exist in the protein data bank. Although no function of CV_2116 could be derived from either sequence or structural similarity searches, the neighboring genes of CV_2116 encode various proteins annotated as similar to bacteriophage tail assembly proteins. Interestingly, C. violaceum exhibits an extensive network of bacteriophage tail-like structures that likely result from lateral gene transfer by incorporation of viral DNA into its genome (prophages due to bacteriophage infection. Indeed, C. violaceum has been shown to contain four prophage elements and CV_2116 resides in the fourth of these elements. Analysis of the putative operon in which CV_2116 resides indicates that CV_2116 might be a component of the bacteriophage tail-like assembly that occurs in C. violaceum.

  5. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  6. Displacement encoder

    International Nuclear Information System (INIS)

    Hesketh, T.G.

    1983-01-01

    In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

  7. Experimental evaluation of different mixing promoter for nuclear fuel element by means of a new thermal tracing technique

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2004-01-01

    In this work a new experimental method is used to experimentally evaluate the performance of different appendages promoting the turbulent mixing between the coupled subchannels of nuclear fuel elements.The method used will be introduced in another presentation and consists in the generation and measurement of small thermal traces in the refrigerating water flow between the fuel rods.Because it is suitable for heterogeneous and compact subchannels (as Argentinean fuels) with high water flows in simple and affordable tests at atmospheric pressure, this new method is specially well suited for the design of fuel elements, while it offers advantages over other methods of mixing measurement.The experiments carried out on a small test section proved that the buttons brazed to the fuel rods (similar to the 'turbulence promoters' of the Canflex fuel) had an excellent thermohydraulic performance as compared to different mixing vane designs studied.The thermal traces method developed has shown its potential as a thermohydraulic design tool for the development of advanced nuclear fuels, that eventually incorporate mixing promoter elements. In the case of CARA, and as it includes spacer grids, it could be possible to use them to incorporate these elements without the need of brazing them to the rods (as is the case in Canflex), and therefore without penalizing its integrity [es

  8. The MTP1 promoters from Arabidopsis halleri reveal cis-regulating elements for the evolution of metal tolerance.

    Science.gov (United States)

    Fasani, Elisa; DalCorso, Giovanni; Varotto, Claudio; Li, Mingai; Visioli, Giovanna; Mattarozzi, Monica; Furini, Antonella

    2017-06-01

    In the hyperaccumulator Arabidopsis halleri, the zinc (Zn) vacuolar transporter MTP1 is a key component of hypertolerance. Because protein sequences and functions are highly conserved between A. halleri and Arabidopsis thaliana, Zn tolerance in A. halleri may reflect the constitutively higher MTP1 expression compared with A. thaliana, based on copy number expansion and different cis regulation. Three MTP1 promoters were characterized in A. halleri ecotype I16. The comparison with the A. thaliana MTP1 promoter revealed different expression profiles correlated with specific cis-acting regulatory elements. The MTP1 5' untranslated region, highly conserved among A. thaliana, Arabidopsis lyrata and A. halleri, contains a dimer of MYB-binding motifs in the A. halleri promoters absent in the A. thaliana and A. lyrata sequences. Site-directed mutagenesis of these motifs revealed their role for expression in trichomes. A. thaliana mtp1 transgenic lines expressing AtMTP1 controlled by the native A. halleri promoter were more Zn-tolerant than lines carrying mutations on MYB-binding motifs. Differences in Zn tolerance were associated with different distribution of Zn among plant organs and in trichomes. The different cis-acting elements in the MTP1 promoters of A. halleri, particularly the MYB-binding sites, are probably involved in the evolution of Zn tolerance. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  9. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  10. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  11. Analysing the interactions between renewable energy promotion and energy efficiency support schemes: The impact of different instruments and design elements

    International Nuclear Information System (INIS)

    Rio, Pablo del

    2010-01-01

    CO 2 emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the 'certificate' debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions.

  12. Analysing the interactions between renewable energy promotion and energy efficiency support schemes: The impact of different instruments and design elements

    Energy Technology Data Exchange (ETDEWEB)

    Rio, Pablo del, E-mail: pablo.delrio@cchs.csic.e [Instituto de Politicas y Bienes Publicos, Consejo Superior de Investigaciones Cientificas (CSIC), C/Albasanz 26-28, 28037 Madrid (Spain)

    2010-09-15

    CO{sub 2} emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the 'certificate' debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions.

  13. Analysing the interactions between renewable energy promotion and energy efficiency support schemes. The impact of different instruments and design elements

    Energy Technology Data Exchange (ETDEWEB)

    Del Rio, Pablo [Instituto de Politicas y Bienes Publicos, Consejo Superior de Investigaciones Cientificas (CSIC), C/Albasanz 26-28, 28037 Madrid (Spain)

    2010-09-15

    CO{sub 2} emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the certificate debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions. (author)

  14. Generic structure and promotional elements in best-selling online book blurbs: a cross-cultural study

    Directory of Open Access Journals (Sweden)

    Neslihan Önder

    2013-04-01

    Full Text Available This study investigates the generic structure and promotional elements of the online fiction blurbs accompanying the 95 best-selling books from Amazon United Kingdom and Okuoku Turkey (1999-2011, a company that sells books online that are written in Turkish or translated into Turkish, and adds to the growing number of investigations into this genre (Kathpalia, 1997; Bhatia, 2004; Cacchiani, 2007; Gea-Valor, 2007; Gesuato, 2007; Basturkmen, 2009. Based on the findings, a two-level schematic structure (moves and steps is proposed for the blurbs following Swales (1990. The findings suggest that Amazon UK book blurbs have a six-move schematic structure: complimenting the author, book description, justifying the book by establishing a niche, book promotion, author’s background and author’s website/blog being the second, fourth and fifth obligatory moves. However, Okuoku book blurbs feature a five-move schematic structure with complimenting the author, book description, involving the reader in the text, book promotion and author’s background, the second and fourth being obligatory. Analysis of promotional elements in the corpora reveals that online fiction book blurbs employ the art of advertising through the use of favorable expressions (Bhatia, 2005 and innovative uses of rhetorical strategies to persuade the reader to read the book.

  15. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  16. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  17. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  18. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus.

    Science.gov (United States)

    Smith, Emily M; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2016-01-07

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

    OpenAIRE

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-01-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  20. ONLINE SOCIAL ADVERTISING: PROMOTIONAL ELEMENTS POSTED BY TRAVEL AGENCIES FROM SUCEAVA CITY ON FACEBOOK FRIENDS’ COMMUNITY

    Directory of Open Access Journals (Sweden)

    Pavel STANCIU

    2016-08-01

    Full Text Available Like any other business in the travel and hospitality industry, it is essential for travel agencies to establish a good promotion policy, to be most noticeable among buyers of travel packages. The promotion – WOM (Word of Mouth, and especially Social Advertising via social networks offer a new perspective of economic development, based on participatory marketing policies that would break the barriers of classical marketing, perceived by tourists as unattractive and completely outdated socio-morally. The new policy promoting travel agencies must be built in cyberspace, on account of social networks, which tend to overshadow the traditional ways of tourist feedback. In this relatively new conjuncture, travel agencies in Suceava are forced to adapt, offering potential customers in the online environment, tourism products and presenting highly attractive destinations in informal circumstances, with a seemingly purely informative character. A research based on questionnaires, which benefited from dissemination on social networks, was carried out with the support of one affable group of 137 friends from Facebook community, and aimed to highlight the effectiveness of online promotion of travel agencies in Suceava and its driving force generated locally. We conclude that people from Suceava who are in the group of friends have constant activity on social networks (especially Facebook, have much knowledge about the travel agencies in Suceava that are active in the virtual environment, but are reluctant when they have the opportunity to sign in with the promotional offers of tour operators. It is therefore imperative that travel agencies in Suceava have a constant interaction with future tourists and respond as quickly as possible to the signals they receive from them, even if, at least for now, locally, there is no culture that fosters such promotion relations - offer for sale - purchase between travel agencies and potential customers, recruited on

  1. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  2. PePPER : a webserver for prediction of prokaryote promoter elements and regulons

    NARCIS (Netherlands)

    de Jong, Anne; Pietersma, Hilco; Cordes, Martijn; Kuipers, Oscar P.; Kok, Jan

    2012-01-01

    Background: Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison

  3. Analysis of AVR4 promoter by sequential response-element deletion ...

    African Journals Online (AJOL)

    An Avr4 promoter region ligated to chloramphenicol acetyltransferase plasmid vector (pBLCAT2) to produce recombinant plasmid Avr4pBLCAT2 was sequentially deleted to produce five distinct mutants: Avr4pBLCAT2907-176, Avr4pBLCAT2809-176, Avr4pBLCAT2789-176, Avr4pBLCAT2429-176 and Avr4pBLCAT2 ...

  4. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  5. Structured model Consumer-based Brand Equity based on Promotional-mix elements(Case Study: Food Active Industries of Tehran)

    OpenAIRE

    Mehran Rezvani; Siran Mehrnia

    2014-01-01

    Abstract This paper aims to examine the relationships among Promotional-mix elements and Customer-based Brand Equity. Then, a model is developed to examine the relationships Promotional-mix elements and Customer-based brand equity in Food Industries of Tehran. The sample size is 240. Data are collected by questionnaire designed. The collected data is estimated using Lizrel and SEM method. The test results show that four dimensions of brand equity (brand awareness, perceived quality, and br...

  6. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  7. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    International Nuclear Information System (INIS)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-01-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants

  8. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    Science.gov (United States)

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  9. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  10. Critical Role of a Single Position in the −35 Element for Promoter Recognition by Mycobacterium tuberculosis SigE and SigH▿

    OpenAIRE

    Song, Taeksun; Song, Seung-Eun; Raman, Sahadevan; Anaya, Mauricio; Husson, Robert N.

    2008-01-01

    Mycobacterial SigE and SigH both initiate transcription from the sigB promoter, suggesting that they recognize similar sequences. Through mutational and primer extension analyses, we determined that SigE and SigH recognize nearly identical promoters, with differences at the 3′ end of the −35 element distinguishing between SigE- and SigH-dependent promoters.

  11. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  12. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  13. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

    Science.gov (United States)

    Hattori, T; Terada, T; Hamasuna, S

    1995-06-01

    Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

  14. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

    OpenAIRE

    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

    2005-01-01

    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  15. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    DEFF Research Database (Denmark)

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    -binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA....... Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1....

  16. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  17. Genes encoded within 8q24 on the amplicon of a large extrachromosomal element are selectively repressed during the terminal differentiation of HL-60 cells

    OpenAIRE

    Hirano, Tetsuo; Ike, Fumio; Murata, Takehide; Obata, Yuichi; Utiyama, Hiroyasu; Yokoyama, Kazunari K.

    2008-01-01

    Human acute myeloblastic leukemia HL-60 cells become resistant to differentiation during long­term cultivation. After 150 passages, double minute chromosomes (dmins) found in early­-passaged cells are replaced by large extrachromosomal elements (LEEs). In a DNA library derived from a purified fraction of LEEs, 12.6% (23/183) of clones were assigned to 8q24 and 9.2% (17/183) were assigned to 14q11 in the human genome. Fluorescence in situ hybridization (FISH) revealed a small aberrant chromos...

  18. Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element.

    Science.gov (United States)

    Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin

    2015-03-01

    The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

  19. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  20. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  1. Effect of the deletion of qmoABC and the promoter distal gene encoding a hypothetical protein on sulfate-reduction in Desulfovibrio vulgaris Hildenborough

    Energy Technology Data Exchange (ETDEWEB)

    Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.

    2010-03-18

    The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.

  2. Mycobacterium tuberculosis septum site determining protein, Ssd encoded by rv3660c, promotes filamentation and elicits an alternative metabolic and dormancy stress response

    Directory of Open Access Journals (Sweden)

    Crew Rebecca

    2011-04-01

    Full Text Available Abstract Background Proteins that are involved in regulation of cell division and cell cycle progression remain undefined in Mycobacterium tuberculosis. In addition, there is a growing appreciation that regulation of cell replication at the point of division is important in establishing a non-replicating persistent state. Accordingly, the objective of this study was to use a systematic approach consisting of consensus-modeling bioinformatics, ultrastructural analysis, and transcriptional mapping to identify septum regulatory proteins that participate in adaptive metabolic responses in M. tuberculosis. Results Septum site determining protein (Ssd, encoded by rv3660c was discovered to be an ortholog of septum site regulating proteins in actinobacteria by bioinformatics analysis. Increased expression of ssd in M. smegmatis and M. tuberculosis inhibited septum formation resulting in elongated cells devoid of septa. Transcriptional mapping in M. tuberculosis showed that increased ssd expression elicited a unique response including the dormancy regulon and alternative sigma factors that are thought to play a role in adaptive metabolism. Disruption of rv3660c by transposon insertion negated the unique transcriptional response and led to a reduced bacterial length. Conclusions This study establishes the first connection between a septum regulatory protein and induction of alternative metabolism consisting of alternative sigma factors and the dormancy regulon that is associated with establishing a non-replicating persistent intracellular lifestyle. The identification of a regulatory component involved in cell cycle regulation linked to the dormancy response, whether directly or indirectly, provides a foundation for additional studies and furthers our understanding of the complex mechanisms involved in establishing a non-replicating state and resumption of growth.

  3. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  4. Neither Reb1p nor poly(dA*T) elements are responsible for the highly specific chromatin organization at the ILV1 promoter

    DEFF Research Database (Denmark)

    Moreira, José Manuel Alfonso; Hörz, Wolfram; Holmberg, Steen

    2001-01-01

    Analysis of the chromatin structure at the yeast ILV1 locus revealed highly positioned nucleosomes covering the entire locus except for a hypersensitive site in the promoter region. All previously identified cis-acting elements required for GCN4-independent ILV1 basal level transcription, includi...

  5. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  6. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  7. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    Science.gov (United States)

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  9. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  10. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  11. A pilot study on genetic variation in purine-rich elements in the nephrin gene promoter in type 2 diabetic patients

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2007-01-01

    Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls

  12. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  13. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    Science.gov (United States)

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  14. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  15. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  16. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  17. Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

    OpenAIRE

    Babiss, L E; Friedman, J M; Darnell, J E

    1986-01-01

    In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

  18. The retinoid X receptor response element in the human aldehyde dehydrogenase 2 promoter is antagonized by the chicken ovalbumin upstream promoter family of orphan receptors

    NARCIS (Netherlands)

    Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D

    2000-01-01

    Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift

  19. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  20. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  1. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.

    2015-01-01

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  2. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  3. Autokinase activity of alpha-crystallin inhibits its specific interaction with the DOTIS element in the murine gamma D/E/F-crystallin promoter in vitro.

    Science.gov (United States)

    Pietrowski, D; Graw, J

    1997-10-01

    In a previous report we demonstrated the in vitro interaction of alpha-crystallin with an element downstream of the transcriptional initiation site (DOTIS) of the murine gamma E-crystallin promoter (Pietrowski et al., 1994, Gene 144, 171-178). The aim of the present study was to investigate the influence of phosphorylation on this particular interaction. We could demonstrate that the autophosphorylation of alpha-crystallin leads to a complete loss of interaction with the DOTIS element, however, PKA-dependent phosphorylation of alpha-crystallin is without effect on the interaction. It is hypothesized that the autophosphorylation of alpha-crystallin might be involved in regulatory mechanisms of the murine gamma D/E/F-crystallin gene expression.

  4. [Immunoprecipitation mapping of the TRX-associated chromosome elements in the fork head gene promoter in the Drosophila melanogaster salivary gland cells].

    Science.gov (United States)

    Riakhovskiĭ, A A; Tillib, S V

    2007-09-01

    Using the method of immunoprecipitation of the in vivo crosslinked and sheared by sonication chromatin, mapping of potential trithorax-associated regulatory elements within the extended (9 kb) promoter region of the fork head gene (fkh) in the Drosophila melanogaster salivary gland cells was performed. Relative homogeneity of the salivary gland cells, along with the parallel use of the antibodies to different domains of the same trithorax protein (TRX), and the introduction of cross-hybridization steps for additional specific enrichment of initial DNA libraries, provided improvement of the method effectiveness and identification of one major and two less expressed potential TRX-binding sites.

  5. Further promotion of the use of mosses and lichens for studies of atmospheric deposition of trace elements

    International Nuclear Information System (INIS)

    Steinnes, E.

    1999-01-01

    This paper presents a brief survey of biomonitoring work carried out in the author's laboratory during more than 20 years using nuclear and non-nuclear techniques for the determination of over 50 elements. A major part of this work concerns large-scale deposition surveys in Norway and elsewhere using the moss Hylocomium splendens. However, considerable efforts have also been spent on intercalibration of different species of mosses and lichens and transformation of concentrations in moss to absolute deposition rates. Experience from this intercalibration work as well as from the calibration of moss reference samples may be of particular importance to the present co-ordinated research project. (author)

  6. Policies and instruments for the promotion of the export sector in Japan: Key elements for the economic growth

    Directory of Open Access Journals (Sweden)

    Alberto Francisco Torres García

    2011-08-01

    Full Text Available Ravaged by war and submitted during the first years by the Supreme Commander Allied Powers, led by General McArthur of the U.S., Japan in 1950 implemented a policy of economic recovery. Over the years, this economy has been considered a peculiar case of economic growth and development. The diversification of international relations under the pillar of economic restructuring has enabled a more favorable insertion in international markets to an economy that even in a deep recession, remains high competitiveness. Thus, the promotion of Japanese exports was made possible by the combination of state intervention and private sector efficiency, which showed a great ability to tune their industrial development.

  7. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  8. Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

    Science.gov (United States)

    Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

    2013-07-22

    Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

  9. DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Thanh Theresa Dinh

    2014-07-01

    Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

  10. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  11. Landscape encodings enhance optimization.

    Directory of Open Access Journals (Sweden)

    Konstantin Klemm

    Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

  12. Landscape Encodings Enhance Optimization

    Science.gov (United States)

    Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.

    2012-01-01

    Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

  13. Encoding of coordination complexes with XML.

    Science.gov (United States)

    Vinoth, P; Sankar, P

    2017-09-01

    An in-silico system to encode structure, bonding and properties of coordination complexes is developed. The encoding is achieved through a semantic XML markup frame. Composition of the coordination complexes is captured in terms of central atom and ligands. Structural information of central atom is detailed in terms of electron status of valence electron orbitals. The ligands are encoded with specific reference to the electron environment of ligand centre atoms. Behaviour of ligands to form low or high spin complexes is accomplished by assigning a Ligand Centre Value to every ligand based on the electronic environment of ligand centre atom. Chemical ontologies are used for categorization purpose and to control different hybridization schemes. Complexes formed by the central atoms of transition metal, non-transition elements belonging to s-block, p-block and f-block are encoded with a generic encoding platform. Complexes of homoleptic, heteroleptic and bridged types are also covered by this encoding system. Utility of the encoded system to predict redox electron transfer reaction in the coordination complexes is demonstrated with a simple application. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  15. Perilipin-mediated lipid droplet formation in adipocytes promotes sterol regulatory element-binding protein-1 processing and triacylglyceride accumulation.

    Directory of Open Access Journals (Sweden)

    Yu Takahashi

    Full Text Available Sterol regulatory element-binding protein-1 (SREBP-1 has been thought to be a critical factor that assists adipogenesis. During adipogenesis SREBP-1 stimulates lipogenic gene expression, and peroxisome proliferator-activated receptor γ (PPARγ enhances perilipin (plin gene expression, resulting in generating lipid droplets (LDs to store triacylglycerol (TAG in adipocytes. Plin coats adipocyte LDs and protects them from lipolysis. Here we show in white adipose tissue (WAT of plin-/- mice that nuclear active SREBP-1 and its target gene expression, but not nuclear SREBP-2, significantly decreased on attenuated LD formation. When plin-/- mouse embryonic fibroblasts (MEFs differentiated into adipocytes, attenuated LDs were formed and nuclear SREBP-1 decreased, but enforced plin expression restored them to their original state. Since LDs are largely derived from the endoplasmic reticulum (ER, alterations in the ER cholesterol content were investigated during adipogenesis of 3T3-L1 cells. The ER cholesterol greatly reduced in differentiated adipocytes. The ER cholesterol level in plin-/- WAT was significantly higher than that of wild-type mice, suggesting that increased LD formation caused a change in ER environment along with a decrease in cholesterol. When GFP-SREBP-1 fusion proteins were exogenously expressed in 3T3-L1 cells, a mutant protein lacking the S1P cleavage site was poorly processed during adipogenesis, providing evidence of the increased canonical pathway for SREBP processing in which SREBP-1 is activated by two cleavage enzymes in the Golgi. Therefore, LD biogenesis may create the ER microenvironment favorable for SREBP-1 activation. We describe the novel interplay between LD formation and SREBP-1 activation through a positive feedback loop.

  16. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  17. Blind encoding into qudits

    International Nuclear Information System (INIS)

    Shaari, J.S.; Wahiddin, M.R.B.; Mancini, S.

    2008-01-01

    We consider the problem of encoding classical information into unknown qudit states belonging to any basis, of a maximal set of mutually unbiased bases, by one party and then decoding by another party who has perfect knowledge of the basis. Working with qudits of prime dimensions, we point out a no-go theorem that forbids 'shift' operations on arbitrary unknown states. We then provide the necessary conditions for reliable encoding/decoding

  18. An encoding device and a method of encoding

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

  19. Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

    Science.gov (United States)

    Han, Gil-Soo; Carman, George M

    2017-08-11

    The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Optical demodulation system for digitally encoded suspension array in fluoroimmunoassay

    Science.gov (United States)

    He, Qinghua; Li, Dongmei; He, Yonghong; Guan, Tian; Zhang, Yilong; Shen, Zhiyuan; Chen, Xuejing; Liu, Siyu; Lu, Bangrong; Ji, Yanhong

    2017-09-01

    A laser-induced breakdown spectroscopy and fluorescence spectroscopy-coupled optical system is reported to demodulate digitally encoded suspension array in fluoroimmunoassay. It takes advantage of the plasma emissions of assembled elemental materials to digitally decode the suspension array, providing a more stable and accurate recognition to target biomolecules. By separating the decoding procedure of suspension array and adsorption quantity calculation of biomolecules into two independent channels, the cross talk between decoding and label signals in traditional methods had been successfully avoided, which promoted the accuracy of both processes and realized more sensitive quantitative detection of target biomolecules. We carried a multiplexed detection of several types of anti-IgG to verify the quantitative analysis performance of the system. A limit of detection of 1.48×10-10 M was achieved, demonstrating the detection sensitivity of the optical demodulation system.

  1. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Science.gov (United States)

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  2. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

  3. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Science.gov (United States)

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  4. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Directory of Open Access Journals (Sweden)

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  5. Transcriptional regulation of the Bacillus subtilis menp1 promoter.

    OpenAIRE

    Qin, X; Taber, H W

    1996-01-01

    The Bacillus subtilis men genes encode biosynthetic enzymes for formation of the respiratory chain component menaquinone. The menp1 promoter previously was shown to be the primary cis element for menFD gene expression. In the present work, it was found that either supplementation with nonfermentable carbon sources or reutilization of glycolytic end products increased menp1 activity in the late postexponential phase. The effect on menp1 activity by a particular end product (such as acetoin or ...

  6. Negative regulation of P element excision by the somatic product and terminal sequences of P in drosophila melanogaster

    Science.gov (United States)

    A transient in vivo P element excision assay was used to test the regulatory properties of putative repressor-encoding plasmids in Drosophila melanogaster embryos. The somatic expression of an unmodified transposase transcription unit under the control of a heat shock gene promoter (phsn) effectivel...

  7. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Directory of Open Access Journals (Sweden)

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  8. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Directory of Open Access Journals (Sweden)

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  9. Heat shock factor 1 upregulates transcription of Epstein–Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    International Nuclear Information System (INIS)

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-01-01

    Epstein–Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the − 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  10. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng-Wei [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Wu, Xian-Rui [Department of Surgery, Sixth Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Liu, Wen-Ju; Liao, Yi-Ji [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Lin, Sheng [Laboratory of Integrated Biosciences, School of Life Science, Sun Yat-sen University, Guangzhou (China); Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Mai, Shi-Juan, E-mail: maishj@sysucc.org.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Xie, Dan, E-mail: xied@mail.sysu.edu.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China)

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  11. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  12. The Prdm13 histone methyltransferase encoding gene is a Ptf1a-Rbpj downstream target that suppresses glutamatergic and promotes GABAergic neuronal fate in the dorsal neural tube

    DEFF Research Database (Denmark)

    Hanotel, Julie; Bessodes, Nathalie; Thélie, Aurore

    2014-01-01

    The basic helix-loop-helix (bHLH) transcriptional activator Ptf1a determines inhibitory GABAergic over excitatory glutamatergic neuronal cell fate in progenitors of the vertebrate dorsal spinal cord, cerebellum and retina. In an in situ hybridization expression survey of PR domain containing genes...... encoding putative chromatin-remodeling zinc finger transcription factors in Xenopus embryos, we identified Prdm13 as a histone methyltransferase belonging to the Ptf1a synexpression group. Gain and loss of Ptf1a function analyses in both frog and mice indicates that Prdm13 is positively regulated by Ptf1a...

  13. a permutation encoding te algorithm solution of reso tation encoding

    African Journals Online (AJOL)

    eobe

    Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

  14. Parallel encoders for pixel detectors

    International Nuclear Information System (INIS)

    Nikityuk, N.M.

    1991-01-01

    A new method of fast encoding and determining the multiplicity and coordinates of fired pixels is described. A specific example construction of parallel encodes and MCC for n=49 and t=2 is given. 16 refs.; 6 figs.; 2 tabs

  15. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Science.gov (United States)

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  16. The major-effect quantitative trait locus CsARN6.1 encodes an AAA ATPase domain-containing protein that is associated with waterlogging stress tolerance by promoting adventitious root formation.

    Science.gov (United States)

    Xu, Xuewen; Ji, Jing; Xu, Qiang; Qi, Xiaohua; Weng, Yiqun; Chen, Xuehao

    2018-03-01

    In plants, the formation of hypocotyl-derived adventitious roots (ARs) is an important morphological acclimation to waterlogging stress; however, its genetic basis remains fragmentary. Here, through combined use of bulked segregant analysis-based whole-genome sequencing, SNP haplotyping and fine genetic mapping, we identified a candidate gene for a major-effect QTL, ARN6.1, that was responsible for waterlogging tolerance due to increased AR formation in the cucumber line Zaoer-N. Through multiple lines of evidence, we show that CsARN6.1 is the most possible candidate for ARN6.1 which encodes an AAA ATPase. The increased formation of ARs under waterlogging in Zaoer-N could be attributed to a non-synonymous SNP in the coiled-coil domain region of this gene. CsARN6.1 increases the number of ARs via its ATPase activity. Ectopic expression of CsARN6.1 in Arabidopsis resulted in better rooting ability and lateral root development in transgenic plants. Transgenic cucumber expressing the CsARN6.1 Asp allele from Zaoer-N exhibited a significant increase in number of ARs compared with the wild type expressing the allele from Pepino under waterlogging conditions. Taken together, these data support that the AAA ATPase gene CsARN6.1 has an important role in increasing cucumber AR formation and waterlogging tolerance. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

  17. Molecular genetics and epigenetics of CACTA elements

    KAUST Repository

    Fedoroff, Nina V.

    2013-08-21

    The CACTA transposons, so named for a highly conserved motif at element ends, comprise one of the most abundant superfamilies of Class 2 (cut-and-paste) plant transposons. CACTA transposons characteristically include subterminal sequences of several hundred nucleotides containing closely spaced direct and inverted repeats of a short, conserved sequence of 14-15 bp. The Supressor-mutator (Spm) transposon, identified and subjected to detailed genetic analysis by Barbara McClintock, remains the paradigmatic element of the CACTA family. The Spm transposon encodes two proteins required for transposition, the transposase (TnpD) and a regulatory protein (TnpA) that binds to the subterminal repeats. Spm expression is subject to both genetic and epigenetic regulation. The Spm-encoded TnpA serves as an activator of the epigenetically inactivated, methylated Spm, stimulating both transient and heritable activation of the transposon. TnpA also serves as a negative regulator of the demethylated active element promoter and is required, in addition to the TnpD, for transposition. © Springer Science+Business Media, New York 2013.

  18. Selecting Operations for Assembler Encoding

    Directory of Open Access Journals (Sweden)

    Tomasz Praczyk

    2010-04-01

    Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
    The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

  19. Association of genetic variants in the promoter region of genes encoding p22phox (CYBA and glutamate cysteine ligase catalytic subunit (GCLC and renal disease in patients with type 1 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Pavin Elizabeth J

    2011-09-01

    Full Text Available Abstract Background Oxidative stress is recognized as a major pathogenic factor of cellular damage caused by hyperglycemia. NOX/NADPH oxidases generate reactive oxygen species and NOX1, NOX2 and NOX4 isoforms are expressed in kidney and require association with subunit p22phox (encoded by the CYBA gene. Increased expression of p22phox was described in animal models of diabetic nephropathy. In the opposite direction, glutathione is one of the main endogenous antioxidants whose plasmatic concentrations were reported to be reduced in diabetes patients. The aim of the present investigation was to test whether functional single nucleotide polymorphisms (SNPs in genes involved in the generation of NADPH-dependent O2•- (-675 T → A in CYBA, unregistered and in glutathione metabolism (-129 C → T in GCLC [rs17883901] and -65 T → C in GPX3 [rs8177412] confer susceptibility to renal disease in type 1 diabetes patients. Methods 401 patients were sorted into two groups according to the presence (n = 104 or absence (n = 196 of overt diabetic nephropathy or according to glomerular filtration rate (GFR estimated by Modification of Diet in Renal Disease (MDRD equation: ≥ 60 mL (n = 265 or 2 (n = 136 and were genotyped. Results No differences were found in the frequency of genotypes between diabetic and non-diabetic subjects. The frequency of GFR CYBA genotypes T/A+A/A (18.7% than in the group carrying the T/T genotype (35.3% (P = 0.0143 and the frequency of GFR GCLC genotypes C/T+T/T (47.1% than in the group carrying the C/C genotype (31.1% (p = 0.0082. Logistic regression analysis identified the presence of at least one A allele of the CYBA SNP as an independent protection factor against decreased GFR (OR = 0.38, CI95% 0.14-0.88, p = 0.0354 and the presence of at least one T allele of the GCLC rs17883901 SNP as an independent risk factor for decreased GFR (OR = 2.40, CI95% 1.27-4.56, p = 0.0068. Conclusions The functional SNPs CYBA -675 T → A and

  20. Obligatory encoding of task-irrelevant features depletes working memory resources.

    Science.gov (United States)

    Marshall, Louise; Bays, Paul M

    2013-02-18

    Selective attention is often considered the "gateway" to visual working memory (VWM). However, the extent to which we can voluntarily control which of an object's features enter memory remains subject to debate. Recent research has converged on the concept of VWM as a limited commodity distributed between elements of a visual scene. Consequently, as memory load increases, the fidelity with which each visual feature is stored decreases. Here we used changes in recall precision to probe whether task-irrelevant features were encoded into VWM when individuals were asked to store specific feature dimensions. Recall precision for both color and orientation was significantly enhanced when task-irrelevant features were removed, but knowledge of which features would be probed provided no advantage over having to memorize both features of all items. Next, we assessed the effect an interpolated orientation-or color-matching task had on the resolution with which orientations in a memory array were stored. We found that the presence of orientation information in the second array disrupted memory of the first array. The cost to recall precision was identical whether the interfering features had to be remembered, attended to, or could be ignored. Therefore, it appears that storing, or merely attending to, one feature of an object is sufficient to promote automatic encoding of all its features, depleting VWM resources. However, the precision cost was abolished when the match task preceded the memory array. So, while encoding is automatic, maintenance is voluntary, allowing resources to be reallocated to store new visual information.

  1. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  2. Seed-specific increased expression of 2S albumin promoter of sesame qualifies it as a useful genetic tool for fatty acid metabolic engineering and related transgenic intervention in sesame and other oil seed crops.

    Science.gov (United States)

    Bhunia, Rupam Kumar; Chakraborty, Anirban; Kaur, Ranjeet; Gayatri, T; Bhattacharyya, Jagannath; Basu, Asitava; Maiti, Mrinal K; Sen, Soumitra Kumar

    2014-11-01

    The sesame 2S albumin (2Salb) promoter was evaluated for its capacity to express the reporter gusA gene encoding β-glucuronidase in transgenic tobacco seeds relative to the soybean fad3C gene promoter element. Results revealed increased expression of gusA gene in tobacco seed tissue when driven by sesame 2S albumin promoter. Prediction based deletion analysis of both the promoter elements confirmed the necessary cis-acting regulatory elements as well as the minimal promoter element for optimal expression in each case. The results also revealed that cis-regulatory elements might have been responsible for high level expression as well as spatio-temporal regulation of the sesame 2S albumin promoter. Transgenic over-expression of a fatty acid desaturase (fad3C) gene of soybean driven by 2S albumin promoter resulted in seed-specific enhanced level of α-linolenic acid in sesame. The present study, for the first time helped to identify that the sesame 2S albumin promoter is a promising endogenous genetic element in genetic engineering approaches requiring spatio-temporal regulation of gene(s) of interest in sesame and can also be useful as a heterologous genetic element in other important oil seed crop plants in general for which seed oil is the harvested product. The study also established the feasibility of fatty acid metabolic engineering strategy undertaken to improve quality of edible seed oil in sesame using the 2S albumin promoter as regulatory element.

  3. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Science.gov (United States)

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  4. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna

    2016-02-01

    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  5. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  6. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  7. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  8. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L)

    Czech Academy of Sciences Publication Activity Database

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocábek, Tomáš; Matoušek, Jaroslav

    2016-01-01

    Roč. 84, October (2016), s. 346-352 ISSN 1476-9271 R&D Projects: GA ČR GA13-03037S Institutional support: RVO:60077344 Keywords : Cis-acting elements * Gene regulation * Humulus lupulus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.331, year: 2016

  9. How can survival processing improve memory encoding?

    Science.gov (United States)

    Luo, Meng; Geng, Haiyan

    2013-11-01

    We investigated the psychological mechanism of survival processing advantage from the perspective of false memory in two experiments. Using a DRM paradigm in combination with analysis based on signal detection theory, we were able to separately examine participants' utilization of verbatim representation and gist representation. Specifically, in Experiment 1, participants rated semantically related words in a survival scenario for a survival condition but rated pleasantness of words in the same DRM lists for a non-survival control condition. The results showed that participants demonstrated more gist processing in the survival condition than in the pleasantness condition; however, the degree of item-specific processing in the two encoding conditions did not significantly differ. In Experiment 2, the control task was changed to a category rating task, in which participants were asked to make category ratings of words in the category lists. We found that the survival condition involved more item-specific processing than did the category condition, but we found no significant difference between the two encoding conditions at the level of gist processing. Overall, our study demonstrates that survival processing can simultaneously promote gist and item-specific representations. When the control tasks only promoted either item-specific representation or gist representation, memory advantages of survival processing occurred.

  10. Encoded diffractive optics for full-spectrum computational imaging

    KAUST Repository

    Heide, Felix

    2016-09-16

    Diffractive optical elements can be realized as ultra-thin plates that offer significantly reduced footprint and weight compared to refractive elements. However, such elements introduce severe chromatic aberrations and are not variable, unless used in combination with other elements in a larger, reconfigurable optical system. We introduce numerically optimized encoded phase masks in which different optical parameters such as focus or zoom can be accessed through changes in the mechanical alignment of a ultra-thin stack of two or more masks. Our encoded diffractive designs are combined with a new computational approach for self-calibrating imaging (blind deconvolution) that can restore high-quality images several orders of magnitude faster than the state of the art without pre-calibration of the optical system. This co-design of optics and computation enables tunable, full-spectrum imaging using thin diffractive optics.

  11. Encoded diffractive optics for full-spectrum computational imaging

    KAUST Repository

    Heide, Felix; Fu, Qiang; Peng, Yifan; Heidrich, Wolfgang

    2016-01-01

    Diffractive optical elements can be realized as ultra-thin plates that offer significantly reduced footprint and weight compared to refractive elements. However, such elements introduce severe chromatic aberrations and are not variable, unless used in combination with other elements in a larger, reconfigurable optical system. We introduce numerically optimized encoded phase masks in which different optical parameters such as focus or zoom can be accessed through changes in the mechanical alignment of a ultra-thin stack of two or more masks. Our encoded diffractive designs are combined with a new computational approach for self-calibrating imaging (blind deconvolution) that can restore high-quality images several orders of magnitude faster than the state of the art without pre-calibration of the optical system. This co-design of optics and computation enables tunable, full-spectrum imaging using thin diffractive optics.

  12. Learning from Number Board Games: You Learn What You Encode

    Science.gov (United States)

    Laski, Elida V.; Siegler, Robert S.

    2014-01-01

    We tested the hypothesis that encoding the numerical-spatial relations in a number board game is a key process in promoting learning from playing such games. Experiment 1 used a microgenetic design to examine the effects on learning of the type of counting procedure that children use. As predicted, having kindergartners count-on from their current…

  13. Encoding and Retrieval Interference in Sentence Comprehension: Evidence from Agreement

    Directory of Open Access Journals (Sweden)

    Sandra Villata

    2018-01-01

    Full Text Available Long-distance verb-argument dependencies generally require the integration of a fronted argument when the verb is encountered for sentence interpretation. Under a parsing model that handles long-distance dependencies through a cue-based retrieval mechanism, retrieval is hampered when retrieval cues also resonate with non-target elements (retrieval interference. However, similarity-based interference may also stem from interference arising during the encoding of elements in memory (encoding interference, an effect that is not directly accountable for by a cue-based retrieval mechanism. Although encoding and retrieval interference are clearly distinct at the theoretical level, it is difficult to disentangle the two on empirical grounds, since encoding interference may also manifest at the retrieval region. We report two self-paced reading experiments aimed at teasing apart the role of each component in gender and number subject-verb agreement in Italian and English object relative clauses. In Italian, the verb does not agree in gender with the subject, thus providing no cue for retrieval. In English, although present tense verbs agree in number with the subject, past tense verbs do not, allowing us to test the role of number as a retrieval cue within the same language. Results from both experiments converge, showing similarity-based interference at encoding, and some evidence for an effect at retrieval. After having pointed out the non-negligible role of encoding in sentence comprehension, and noting that Lewis and Vasishth’s (2005 ACT-R model of sentence processing, the most fully developed cue-based retrieval approach to sentence processing does not predict encoding effects, we propose an augmentation of this model that predicts these effects. We then also propose a self-organizing sentence processing model (SOSP, which has the advantage of accounting for retrieval and encoding interference with a single mechanism.

  14. Encoding and Retrieval Interference in Sentence Comprehension: Evidence from Agreement

    Science.gov (United States)

    Villata, Sandra; Tabor, Whitney; Franck, Julie

    2018-01-01

    Long-distance verb-argument dependencies generally require the integration of a fronted argument when the verb is encountered for sentence interpretation. Under a parsing model that handles long-distance dependencies through a cue-based retrieval mechanism, retrieval is hampered when retrieval cues also resonate with non-target elements (retrieval interference). However, similarity-based interference may also stem from interference arising during the encoding of elements in memory (encoding interference), an effect that is not directly accountable for by a cue-based retrieval mechanism. Although encoding and retrieval interference are clearly distinct at the theoretical level, it is difficult to disentangle the two on empirical grounds, since encoding interference may also manifest at the retrieval region. We report two self-paced reading experiments aimed at teasing apart the role of each component in gender and number subject-verb agreement in Italian and English object relative clauses. In Italian, the verb does not agree in gender with the subject, thus providing no cue for retrieval. In English, although present tense verbs agree in number with the subject, past tense verbs do not, allowing us to test the role of number as a retrieval cue within the same language. Results from both experiments converge, showing similarity-based interference at encoding, and some evidence for an effect at retrieval. After having pointed out the non-negligible role of encoding in sentence comprehension, and noting that Lewis and Vasishth’s (2005) ACT-R model of sentence processing, the most fully developed cue-based retrieval approach to sentence processing does not predict encoding effects, we propose an augmentation of this model that predicts these effects. We then also propose a self-organizing sentence processing model (SOSP), which has the advantage of accounting for retrieval and encoding interference with a single mechanism. PMID:29403414

  15. Analysing and Comparing Encodability Criteria

    Directory of Open Access Journals (Sweden)

    Kirstin Peters

    2015-08-01

    Full Text Available Encodings or the proof of their absence are the main way to compare process calculi. To analyse the quality of encodings and to rule out trivial or meaningless encodings, they are augmented with quality criteria. There exists a bunch of different criteria and different variants of criteria in order to reason in different settings. This leads to incomparable results. Moreover it is not always clear whether the criteria used to obtain a result in a particular setting do indeed fit to this setting. We show how to formally reason about and compare encodability criteria by mapping them on requirements on a relation between source and target terms that is induced by the encoding function. In particular we analyse the common criteria full abstraction, operational correspondence, divergence reflection, success sensitiveness, and respect of barbs; e.g. we analyse the exact nature of the simulation relation (coupled simulation versus bisimulation that is induced by different variants of operational correspondence. This way we reduce the problem of analysing or comparing encodability criteria to the better understood problem of comparing relations on processes.

  16. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Science.gov (United States)

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  17. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    OpenAIRE

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the...

  18. Data Encoding using Periodic Nano-Optical Features

    Science.gov (United States)

    Vosoogh-Grayli, Siamack

    Successful trials have been made through a designed algorithm to quantize, compress and optically encode unsigned 8 bit integer values in the form of images using Nano optical features. The periodicity of the Nano-scale features (Nano-gratings) have been designed and investigated both theoretically and experimentally to create distinct states of variation (three on states and one off state). The use of easy to manufacture and machine readable encoded data in secured authentication media has been employed previously in bar-codes for bi-state (binary) models and in color barcodes for multiple state models. This work has focused on implementing 4 states of variation for unit information through periodic Nano-optical structures that separate an incident wavelength into distinct colors (variation states) in order to create an encoding system. Compared to barcodes and magnetic stripes in secured finite length storage media the proposed system encodes and stores more data. The benefits of multiple states of variation in an encoding unit are 1) increased numerically representable range 2) increased storage density and 3) decreased number of typical set elements for any ergodic or semi-ergodic source that emits these encoding units. A thorough investigation has targeted the effects of the use of multi-varied state Nano-optical features on data storage density and consequent data transmission rates. The results show that use of Nano-optical features for encoding data yields a data storage density of circa 800 Kbits/in2 via the implementation of commercially available high resolution flatbed scanner systems for readout. Such storage density is far greater than commercial finite length secured storage media such as Barcode family with maximum practical density of 1kbits/in2 and highest density magnetic stripe cards with maximum density circa 3 Kbits/in2. The numerically representable range of the proposed encoding unit for 4 states of variation is [0 255]. The number of

  19. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  20. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  1. Multidimensionally encoded magnetic resonance imaging.

    Science.gov (United States)

    Lin, Fa-Hsuan

    2013-07-01

    Magnetic resonance imaging (MRI) typically achieves spatial encoding by measuring the projection of a q-dimensional object over q-dimensional spatial bases created by linear spatial encoding magnetic fields (SEMs). Recently, imaging strategies using nonlinear SEMs have demonstrated potential advantages for reconstructing images with higher spatiotemporal resolution and reducing peripheral nerve stimulation. In practice, nonlinear SEMs and linear SEMs can be used jointly to further improve the image reconstruction performance. Here, we propose the multidimensionally encoded (MDE) MRI to map a q-dimensional object onto a p-dimensional encoding space where p > q. MDE MRI is a theoretical framework linking imaging strategies using linear and nonlinear SEMs. Using a system of eight surface SEM coils with an eight-channel radiofrequency coil array, we demonstrate the five-dimensional MDE MRI for a two-dimensional object as a further generalization of PatLoc imaging and O-space imaging. We also present a method of optimizing spatial bases in MDE MRI. Results show that MDE MRI with a higher dimensional encoding space can reconstruct images more efficiently and with a smaller reconstruction error when the k-space sampling distribution and the number of samples are controlled. Copyright © 2012 Wiley Periodicals, Inc.

  2. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  3. Neutral details associated with emotional events are encoded: evidence from a cued recall paradigm.

    Science.gov (United States)

    Mickley Steinmetz, Katherine R; Knight, Aubrey G; Kensinger, Elizabeth A

    2016-11-01

    Enhanced emotional memory often comes at the cost of memory for surrounding background information. Narrowed-encoding theories suggest that this is due to narrowed attention for emotional information at encoding, leading to impaired encoding of background information. Recent work has suggested that an encoding-based theory may be insufficient. Here, we examined whether cued recall-instead of previously used recognition memory tasks-would reveal evidence that non-emotional information associated with emotional information was effectively encoded. Participants encoded positive, negative, or neutral objects on neutral backgrounds. At retrieval, they were given either the item or the background as a memory cue and were asked to recall the associated scene element. Counter to narrowed-encoding theories, emotional items were more likely than neutral items to trigger recall of the associated background. This finding suggests that there is a memory trace of this contextual information and that emotional cues may facilitate retrieval of this information.

  4. Method for making an improved magnetic encoding device

    Science.gov (United States)

    Fox, Richard J.

    1981-01-01

    A magnetic encoding device and method for making the same are provided for use as magnetic storage mediums in identification control applications which give output signals from a reader that are of shorter duration and substantially greater magnitude than those of the prior art. Magnetic encoding elements are produced by uniformly bending wire or strip stock of a magnetic material longitudinally about a common radius to exceed the elastic limit of the material and subsequently mounting the material so that it is restrained in an unbent position on a substrate of nonmagnetic material. The elements are spot weld attached to a substrate to form a binary coded array of elements according to a desired binary code. The coded substrate may be enclosed in a plastic laminate structure. Such devices may be used for security badges, key cards, and the like and may have many other applications.

  5. A selfish genetic element confers non-Mendelian inheritance in rice.

    Science.gov (United States)

    Yu, Xiaowen; Zhao, Zhigang; Zheng, Xiaoming; Zhou, Jiawu; Kong, Weiyi; Wang, Peiran; Bai, Wenting; Zheng, Hai; Zhang, Huan; Li, Jing; Liu, Jiafan; Wang, Qiming; Zhang, Long; Liu, Kai; Yu, Yang; Guo, Xiuping; Wang, Jiulin; Lin, Qibing; Wu, Fuqing; Ren, Yulong; Zhu, Shanshan; Zhang, Xin; Cheng, Zhijun; Lei, Cailin; Liu, Shijia; Liu, Xi; Tian, Yunlu; Jiang, Ling; Ge, Song; Wu, Chuanyin; Tao, Dayun; Wang, Haiyang; Wan, Jianmin

    2018-06-08

    Selfish genetic elements are pervasive in eukaryote genomes, but their role remains controversial. We show that qHMS7 , a major quantitative genetic locus for hybrid male sterility between wild rice ( Oryza meridionalis ) and Asian cultivated rice ( O. sativa ), contains two tightly linked genes [ Open Reading Frame 2 ( ORF2 ) and ORF3 ]. ORF2 encodes a toxic genetic element that aborts pollen in a sporophytic manner, whereas ORF3 encodes an antidote that protects pollen in a gametophytic manner. Pollens lacking ORF3 are selectively eliminated, leading to segregation distortion in the progeny. Analysis of the genetic sequence suggests that ORF3 arose first, followed by gradual functionalization of ORF2 Furthermore, this toxin-antidote system may have promoted the differentiation and/or maintained the genome stability of wild and cultivated rice. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  6. Virally encoded 7TM receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Waldhoer, M; Lüttichau, H R

    2001-01-01

    expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...

  7. Evaluating standard terminologies for encoding allergy information.

    Science.gov (United States)

    Goss, Foster R; Zhou, Li; Plasek, Joseph M; Broverman, Carol; Robinson, George; Middleton, Blackford; Rocha, Roberto A

    2013-01-01

    Allergy documentation and exchange are vital to ensuring patient safety. This study aims to analyze and compare various existing standard terminologies for representing allergy information. Five terminologies were identified, including the Systemized Nomenclature of Medical Clinical Terms (SNOMED CT), National Drug File-Reference Terminology (NDF-RT), Medication Dictionary for Regulatory Activities (MedDRA), Unique Ingredient Identifier (UNII), and RxNorm. A qualitative analysis was conducted to compare desirable characteristics of each terminology, including content coverage, concept orientation, formal definitions, multiple granularities, vocabulary structure, subset capability, and maintainability. A quantitative analysis was also performed to compare the content coverage of each terminology for (1) common food, drug, and environmental allergens and (2) descriptive concepts for common drug allergies, adverse reactions (AR), and no known allergies. Our qualitative results show that SNOMED CT fulfilled the greatest number of desirable characteristics, followed by NDF-RT, RxNorm, UNII, and MedDRA. Our quantitative results demonstrate that RxNorm had the highest concept coverage for representing drug allergens, followed by UNII, SNOMED CT, NDF-RT, and MedDRA. For food and environmental allergens, UNII demonstrated the highest concept coverage, followed by SNOMED CT. For representing descriptive allergy concepts and adverse reactions, SNOMED CT and NDF-RT showed the highest coverage. Only SNOMED CT was capable of representing unique concepts for encoding no known allergies. The proper terminology for encoding a patient's allergy is complex, as multiple elements need to be captured to form a fully structured clinical finding. Our results suggest that while gaps still exist, a combination of SNOMED CT and RxNorm can satisfy most criteria for encoding common allergies and provide sufficient content coverage.

  8. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  9. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    Science.gov (United States)

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Elemental composition of strawberry plants inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, assessed with scanning electron microscopy and energy dispersive X-ray analysis.

    Science.gov (United States)

    Guerrero-Molina, M F; Lovaisa, N C; Salazar, S M; Díaz-Ricci, J C; Pedraza, R O

    2014-07-01

    The elemental composition of strawberry plants (Fragaria ananassa cv. Macarena) inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, and non-inoculated controls, was studied using scanning electron microscopy (SEM) and energy dispersive X-ray (EDS) analysis. This allowed simultaneous semi-quantification of different elements in a small, solid sample. Plants were inoculated and grown hydroponically in 50% or 100% Hoagland solution, corresponding to limited or optimum nutrient medium, respectively. Bacteria-inoculated plants increased the growth index 45% and 80% compared to controls when grown in 100% and 50% Hoagland solution, respectively. Thus, inoculation with A. brasilense REC3 in a nutrient-limited medium had the strongest effect in terms of increasing both shoot and root biomass and growth index, as already described for Azospirillum inoculated into nutrient-poor soils. SEM-EDS spectra and maps showed the elemental composition and relative distribution of nutrients in strawberry tissues. Leaves contained C, O, N, Na, P, K, Ca and Cu, while roots also had Si and Cl. The organic fraction (C, O and N) accounted for over 96.3% of the total chemical composition; of the mineral fraction, Na had higher accumulation in both leaves and roots. Azospirillum-inoculated and control plants had similar elemental quantities; however, in bacteria-inoculated roots, P was significantly increased (34.33%), which constitutes a major benefit for plant nutrition, while Cu content decreased (35.16%). © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  11. Cyclic AMP-Responsive Element-Binding Protein (CREB is Critical in Autoimmunity by Promoting Th17 but Inhibiting Treg Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Xiaohu Wang

    2017-11-01

    Full Text Available The molecular mechanisms that govern differential T cell development into pro-inflammatory Th17 vs. regulatory T (Treg cells remain unclear. Here, we show that selective deletion of CREB in T cells or Th17 cells impaired Th17 cell differentiation in vitro and in vivo, and led to resistance to autoimmune diseases. Mechanistically, CREB, activated by CD3-PKC-ϴ signaling, plays a key role in regulating Th17 cell differentiation, at least in part through directly binding to the Il17-Il17f gene locus. Unexpectedly, although dispensable for FOXP3 expression and for the homeostasis and suppressive function of thymus-derived Treg cells, CREB negatively regulates the survival of TGF-β-induced Treg cells, and deletion of CREB resulted in increased FOXP3+ Treg cells in the intestine and protection in a colitis model. Thus, CREB is critical in autoimmune diseases by promoting Th17 cell and inhibiting de novo Treg cell generation.

  12. Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

    Directory of Open Access Journals (Sweden)

    Shuichi Shimmura

    2017-07-01

    Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

  13. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  14. Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

    Directory of Open Access Journals (Sweden)

    Li Shen

    2013-06-01

    Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

  15. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However...... and enhancers are considered a single class of functional element, with a unified architecture for transcription initiation. The context of interacting regulatory elements and the surrounding sequences determine local transcriptional output as well as the enhancer and promoter activities of individual elements....

  16. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

    Directory of Open Access Journals (Sweden)

    Christine R Langlois

    2016-11-01

    Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

  17. Encoding information into precipitation structures

    International Nuclear Information System (INIS)

    Martens, Kirsten; Bena, Ioana; Droz, Michel; Rácz, Zoltan

    2008-01-01

    Material design at submicron scales would be profoundly affected if the formation of precipitation patterns could be easily controlled. It would allow the direct building of bulk structures, in contrast to traditional techniques which consist of removing material in order to create patterns. Here, we discuss an extension of our recent proposal of using electrical currents to control precipitation bands which emerge in the wake of reaction fronts in A + + B – → C reaction–diffusion processes. Our main result, based on simulating the reaction–diffusion–precipitation equations, is that the dynamics of the charged agents can be guided by an appropriately designed time-dependent electric current so that, in addition to the control of the band spacing, the width of the precipitation bands can also be tuned. This makes straightforward the encoding of information into precipitation patterns and, as an amusing example, we demonstrate the feasibility by showing how to encode a musical rhythm

  18. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    Science.gov (United States)

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

  19. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    Science.gov (United States)

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

  20. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  1. Peafowl antipredator calls encode information about signalers.

    Science.gov (United States)

    Yorzinski, Jessica L

    2014-02-01

    Animals emit vocalizations that convey information about external events. Many of these vocalizations, including those emitted in response to predators, also encode information about the individual that produced the call. The relationship between acoustic features of antipredator calls and information relating to signalers (including sex, identity, body size, and social rank) were examined in peafowl (Pavo cristatus). The "bu-girk" antipredator calls of male and female peafowl were recorded and 20 acoustic parameters were automatically extracted from each call. Both the bu and girk elements of the antipredator call were individually distinctive and calls were classified to the correct signaler with over 90% and 70% accuracy in females and males, respectively. Females produced calls with a higher fundamental frequency (F0) than males. In both females and males, body size was negatively correlated with F0. In addition, peahen rank was related to the duration, end mean frequency, and start harmonicity of the bu element. Peafowl antipredator calls contain detailed information about the signaler and can potentially be used by receivers to respond to dangerous situations.

  2. Soybean phytase and nucleic acid encoding the same

    OpenAIRE

    1999-01-01

    Isolated soybean phytase polypeptides and isolated nucleic acids encoding soybean phytases are provided. The invention is also directed to nucleic acid expression constructs, vectors, and host cells comprising the isolated soybean phytase nucleic acids, as well as methods for producing recombinant and non-recombinant purified soybean phytase. The invention also relates to transgenic plants expressing the soybean phytase, particularly expression under seed-specific expression control elements.

  3. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  4. Transcriptional regulation of the Bacillus subtilis menp1 promoter.

    Science.gov (United States)

    Qin, X; Taber, H W

    1996-02-01

    The Bacillus subtilis men genes encode biosynthetic enzymes for formation of the respiratory chain component menaquinone. The menp1 promoter previously was shown to be the primary cis element for menFD gene expression. In the present work, it was found that either supplementation with nonfermentable carbon sources or reutilization of glycolytic end products increased menp1 activity in the late postexponential phase. The effect on menp1 activity by a particular end product (such as acetoin or acetate) was prevented by blocking the corresponding pathway for end product utilization. Alteration of a TGAAA motif within the promoter region resulted in unregulated menp1 activity throughout the culture cycle, irrespective of the carbon source added.

  5. ENCODE: A Sourcebook of Epigenomes and Chromatin Language

    Directory of Open Access Journals (Sweden)

    Maryam Yavartanoo

    2013-03-01

    Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

  6. Hall effect encoding of brushless dc motors

    Science.gov (United States)

    Berard, C. A.; Furia, T. J.; Goldberg, E. A.; Greene, R. C.

    1970-01-01

    Encoding mechanism integral to the motor and using the permanent magnets embedded in the rotor eliminates the need for external devices to encode information relating the position and velocity of the rotating member.

  7. Flipped-Adversarial AutoEncoders

    OpenAIRE

    Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

    2018-01-01

    We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

  8. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    International Nuclear Information System (INIS)

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S.

    2007-01-01

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-κB. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K

  9. Optical Finite Element Processor

    Science.gov (United States)

    Casasent, David; Taylor, Bradley K.

    1986-01-01

    A new high-accuracy optical linear algebra processor (OLAP) with many advantageous features is described. It achieves floating point accuracy, handles bipolar data by sign-magnitude representation, performs LU decomposition using only one channel, easily partitions and considers data flow. A new application (finite element (FE) structural analysis) for OLAPs is introduced and the results of a case study presented. Error sources in encoded OLAPs are addressed for the first time. Their modeling and simulation are discussed and quantitative data are presented. Dominant error sources and the effects of composite error sources are analyzed.

  10. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  11. Olfactory bulb encoding during learning under anaesthesia

    Directory of Open Access Journals (Sweden)

    Alister U Nicol

    2014-06-01

    Full Text Available Neural plasticity changes within the olfactory bulb are important for olfactory learning, although how neural encoding changes support new associations with specific odours and whether they can be investigated under anaesthesia, remain unclear. Using the social transmission of food preference olfactory learning paradigm in mice in conjunction with in vivo microdialysis sampling we have shown firstly that a learned preference for a scented food odour smelled on the breath of a demonstrator animal occurs under isofluorane anaesthesia. Furthermore, subsequent exposure to this cued odour under anaesthesia promotes the same pattern of increased release of glutamate and GABA in the olfactory bulb as previously found in conscious animals following olfactory learning, and evoked GABA release was positively correlated with the amount of scented food eaten. In a second experiment, multiarray (24 electrodes electrophysiological recordings were made from olfactory bulb mitral cells under isofluorane anaesthesia before, during and after a novel scented food odour was paired with carbon disulfide. Results showed significant increases in overall firing frequency to the cued-odour during and after learning and decreases in response to an uncued odour. Analysis of patterns of changes in individual neurons revealed that a substantial proportion (>50% of them significantly changed their response profiles during and after learning with most of those previously inhibited becoming excited. A large number of cells exhibiting no response to the odours prior to learning were either excited or inhibited afterwards. With the uncued odour many previously responsive cells became unresponsive or inhibited. Learning associated changes only occurred in the posterior part of the olfactory bulb. Thus olfactory learning under anaesthesia promotes extensive, but spatially distinct, changes in mitral cell networks to both cued and uncued odours as well as in evoked glutamate and

  12. Tagging, Encoding, and Jones Optimality

    DEFF Research Database (Denmark)

    Danvy, Olivier; Lopez, Pablo E. Martinez

    2003-01-01

    A partial evaluator is said to be Jones-optimal if the result of specializing a self-interpreter with respect to a source program is textually identical to the source program, modulo renaming. Jones optimality has already been obtained if the self-interpreter is untyped. If the selfinterpreter...... is typed, however, residual programs are cluttered with type tags. To obtain the original source program, these tags must be removed. A number of sophisticated solutions have already been proposed. We observe, however, that with a simple representation shift, ordinary partial evaluation is already Jones......-optimal, modulo an encoding. The representation shift amounts to reading the type tags as constructors for higherorder abstract syntax. We substantiate our observation by considering a typed self-interpreter whose input syntax is higher-order. Specializing this interpreter with respect to a source program yields...

  13. An Unusual Phage Repressor Encoded by Mycobacteriophage BPs.

    Directory of Open Access Journals (Sweden)

    Valerie M Villanueva

    Full Text Available Temperate bacteriophages express transcription repressors that maintain lysogeny by down-regulating lytic promoters and confer superinfection immunity. Repressor regulation is critical to the outcome of infection-lysogenic or lytic growth-as well as prophage induction into lytic replication. Mycobacteriophage BPs and its relatives use an unusual integration-dependent immunity system in which the phage attachment site (attP is located within the repressor gene (33 such that site-specific integration leads to synthesis of a prophage-encoded product (gp33103 that is 33 residues shorter at its C-terminus than the virally-encoded protein (gp33136. However, the shorter form of the repressor (gp33103 is stable and active in repression of the early lytic promoter PR, whereas the longer virally-encoded form (gp33136 is inactive due to targeted degradation via a C-terminal ssrA-like tag. We show here that both forms of the repressor bind similarly to the 33-34 intergenic regulatory region, and that BPs gp33103 is a tetramer in solution. The BPs gp33103 repressor binds to five regulatory regions spanning the BPs genome, and regulates four promoters including the early lytic promoter, PR. BPs gp33103 has a complex pattern of DNA recognition in which a full operator binding site contains two half sites separated by a variable spacer, and BPs gp33103 induces a DNA bend at the full operator site but not a half site. The operator site structure is unusual in that one half site corresponds to a 12 bp palindrome identified previously, but the other half site is a highly variable variant of the palindrome.

  14. Emotional arousal and memory after deep encoding.

    Science.gov (United States)

    Leventon, Jacqueline S; Camacho, Gabriela L; Ramos Rojas, Maria D; Ruedas, Angelica

    2018-05-22

    Emotion often enhances long-term memory. One mechanism for this enhancement is heightened arousal during encoding. However, reducing arousal, via emotion regulation (ER) instructions, has not been associated with reduced memory. In fact, the opposite pattern has been observed: stronger memory for emotional stimuli encoded with an ER instruction to reduce arousal. This pattern may be due to deeper encoding required by ER instructions. In the current research, we examine the effects of emotional arousal and deep-encoding on memory across three studies. In Study 1, adult participants completed a writing task (deep-encoding) for encoding negative, neutral, and positive picture stimuli, whereby half the emotion stimuli had the ER instruction to reduce the emotion. Memory was strong across conditions, and no memory enhancement was observed for any condition. In Study 2, adult participants completed the same writing task as Study 1, as well as a shallow-encoding task for one-third of negative, neutral, and positive trials. Memory was strongest for deep vs. shallow encoding trials, with no effects of emotion or ER instruction. In Study 3, adult participants completed a shallow-encoding task for negative, neutral, and positive stimuli, with findings indicating enhanced memory for negative emotional stimuli. Findings suggest that deep encoding must be acknowledged as a source of memory enhancement when examining manipulations of emotion-related arousal. Copyright © 2018. Published by Elsevier B.V.

  15. Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

    International Nuclear Information System (INIS)

    Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

    2004-01-01

    The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

  16. Temporal texture of associative encoding modulates recall processes.

    Science.gov (United States)

    Tibon, Roni; Levy, Daniel A

    2014-02-01

    Binding aspects of an experience that are distributed over time is an important element of episodic memory. In the current study, we examined how the temporal complexity of an experience may govern the processes required for its retrieval. We recorded event-related potentials during episodic cued recall following pair associate learning of concurrently and sequentially presented object-picture pairs. Cued recall success effects over anterior and posterior areas were apparent in several time windows. In anterior locations, these recall success effects were similar for concurrently and sequentially encoded pairs. However, in posterior sites clustered over parietal scalp the effect was larger for the retrieval of sequentially encoded pairs. We suggest that anterior aspects of the mid-latency recall success effects may reflect working-with-memory operations or direct access recall processes, while more posterior aspects reflect recollective processes which are required for retrieval of episodes of greater temporal complexity. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Biallelic Mutations in TBCD, Encoding the Tubulin Folding Cofactor D, Perturb Microtubule Dynamics and Cause Early-Onset Encephalopathy

    NARCIS (Netherlands)

    Flex, Elisabetta; Niceta, Marcello; Cecchetti, Serena; Thiffault, Isabelle; Au, Margaret G.; Capuano, Alessandro; Piermarini, Emanuela; Ivanova, Anna A.; Francis, Joshua W.; Chillemi, Giovanni; Chandramouli, Balasubramanian; Carpentieri, Giovanna; Haaxma, Charlotte A.; Ciolfi, Andrea; Pizzi, Simone; Douglas, Ganka V.; Levine, Kara; Sferra, Antonella; Dentici, Maria Lisa; Pfundt, Rolph R.; Le Pichon, Jean-Baptiste; Farrow, Emily; Baas, Frank; Piemonte, Fiorella; Dallapiccola, Bruno; Graham, John M.; Saunders, Carol J.; Bertini, Enrico; Kahn, Richard A.; Koolen, David A.; Tartaglia, Marco

    2016-01-01

    Microtubules are dynamic cytoskeletal elements coordinating and supporting a variety of neuronal processes, including cell division, migration, polarity, intracellular trafficking, and signal transduction. Mutations in genes encoding tubulins and microtubule-associated proteins are known to cause

  18. A device, a system and a method of encoding a position of an object

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a device for encoding a position of an object, comprising a first light source; a first collimating element adapted to form first collimated light from the first light source; a carrier adapted to guide light and comprising a first primary light redirecting...... structure and a second primary light redirecting structure; and a detector device for encoding the position of an object with respect to an active area of an encoding plane; wherein the first primary light redirecting structure is adapted to redirect at least a part of a first light beam through the active...

  19. NMDA receptors and memory encoding.

    Science.gov (United States)

    Morris, Richard G M

    2013-11-01

    It is humbling to think that 30 years have passed since the paper by Collingridge, Kehl and McLennan showing that one of Jeff Watkins most interesting compounds, R-2-amino-5-phosphonopentanoate (d-AP5), blocked the induction of long-term potentiation in vitro at synapses from area CA3 of the hippocampus to CA1 without apparent effect on baseline synaptic transmission (Collingridge et al., 1983). This dissociation was one of the key triggers for an explosion of interest in glutamate receptors, and much has been discovered since that collectively contributes to our contemporary understanding of glutamatergic synapses - their biophysics and subunit composition, of the agonists and antagonists acting on them, and their diverse functions in different networks of the brain and spinal cord. It can be fairly said that Collingridge et al.'s (1983) observation was the stimulus that has led, on the one hand, to structural biological work at the atomic scale describing the key features of NMDA receptors that enables their coincidence function to happen; and, on the other, to work with whole animals investigating the contributions that calcium signalling via this receptor can have on rhythmical activities controlled by spinal circuits, memory encoding in the hippocampus (the topic of this article), visual cortical plasticity, sensitization in pain, and other functions. In this article, I lay out how my then interest in long-term potentiation (LTP) as a model of memory enabled me to recognise the importance of Collingridge et al.'s discovery - and how I and my colleagues endeavoured to take things forward in the area of learning and memory. This is in some respects a personal story, and I tell it as such. The idea that NMDA receptor activation is essential for memory encoding, though not for storage, took time to develop and to be accepted. Along the way, there have been confusions, challenges, and surprises surrounding the idea that activation of NMDA receptors can

  20. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  1. Encoder designed to work in harsh environments

    Energy Technology Data Exchange (ETDEWEB)

    Toop, L.

    2007-05-15

    Dynapar has developed the Acuro AX71 absolute encoder for use on offshore or land-based oil rig operations. It provides feedback on the operation of automated systems such as draw works, racking systems, rotary tables and top drives. By ensuring that automated systems function properly, this encoder responds to a need by the oil and gas industry to keep workers safe and improve efficiency, particularly for operations in rugged situations. The encoder provides feedback from motor systems to controllers, giving information about position and speed of downhole drill bits. This newly developed encoder is better than commonly used incremental encoders which are not precise in strong electrical noise environments. Rather, the absolute encoder uses a different method of reporting to the controller. A digital signal is transmitted constantly as the device operates. It is less susceptible to noise issues. It is highly accurate, tolerant of noise and is not affected by power outages. However, the absolute encoder is generally more delicate in drilling applications with high ambient temperatures and shock levels. Dynapar addressed this issue by developing compact stainless steel housing that is useful for corrosion resistance in marine applications. The AX71 absolute encoder can withstand up to 100 G of mechanical shock and ambient temperatures of up to 60 degrees C. The encoder is ATEX certified without barriers, and offers the high resolution feedback of 4,000 counts of multiturn rotation and 16,000 counts of position. 1 fig.

  2. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo

    2012-10-01

    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  3. Transplutonium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  4. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  5. A long HBV transcript encoding pX is inefficiently exported from the nucleus

    International Nuclear Information System (INIS)

    Doitsh, Gilad; Shaul, Yosef

    2003-01-01

    The longest hepatitis B virus transcript is a 3.9-kb mRNA whose function remained unclear. In this study, we wished to identify the translation products and physiological role of this viral transcript. This transcript initiates from the X promoter region ignoring the inefficient and noncanonical viral polyadenylation signal at the first round of transcription. However, an HBV mutant with canonical polyadenylation signal continues, though with lower efficiency, to program the synthesis of this long transcript, indicating that the deviated HBV polyadenylation signal is important but not essential to enable transcription of the 3.9-kb species. The 3.9-kb RNA contains two times the X open reading frame (ORF). The X ORF at the 5'-end is positioned upstream of the CORE gene. By generating an HBV DNA mutant in which the X and Core ORFs are fused, we demonstrated the production of a 40-kDa X-Core fusion protein that must be encoded by the 3.9-kb transcript. Mutagenesis studies revealed that the production of this protein depends on the 5' X ORF ATG, suggesting that the 3.9-kb RNA is active in translation of the X ORF. Based on these features, the 3.9-kb transcript was designated lxRNA for long X RNA. Unlike other HBV transcripts, lxRNA harbors two copies of PRE, the posttranscriptional regulatory element that controls the nuclear export of HBV mRNAs. Unexpectedly, despite the presence of PRE sequences, RNA fractionation analysis revealed that lxRNA barely accumulates in the cytoplasm, suggesting that nuclear export of lxRNA is poor. Collectively, our data suggest that two distinct HBV mRNA species encode pX and that the HBV transcripts are differentially regulated at the level of nuclear export

  6. Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

    Science.gov (United States)

    Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

    1995-03-01

    A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

  7. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  8. Generation of Path-Encoded Greenberger-Horne-Zeilinger States

    Science.gov (United States)

    Bergamasco, N.; Menotti, M.; Sipe, J. E.; Liscidini, M.

    2017-11-01

    We study the generation of Greenberger-Horne-Zeilinger (GHZ) states of three path-encoded photons. Inspired by the seminal work of Bouwmeester et al. [Phys. Rev. Lett. 82, 1345 (1999), 10.1103/PhysRevLett.82.1345] on polarization-entangled GHZ states, we find a corresponding path representation for the photon states of an optical circuit, identify the elements required for the state generation, and propose a possible implementation of our strategy. Besides the practical advantage of employing an integrated system that can be fabricated with proven lithographic techniques, our example suggests that it is possible to enhance the generation efficiency by using microring resonators.

  9. The Arabic Diatessaron Project: Digitalizing, Encoding, Lemmatization

    Directory of Open Access Journals (Sweden)

    Giuliano Lancioni

    2016-04-01

    Full Text Available The Arabic Diatessaron Project (henceforth ADP is an international research project in Digital Humanities that aims to collect, digitalise and encode all known manuscripts of the Arabic Diatessaron (henceforth AD, a text that has been relatively neglected in scholarly research. ADP’s final goal is to provide a number of tools that can enable scholars to effectively query, compare and investigate all known variants of the text that will be encoded as far as possible in compliance with the Text Encoding Initiative (TEI guidelines. The paper addresses a number of issues involved in the process of digitalising manuscripts included in the two existing editions (Ciasca 1888 and Marmardji 1935, adding variants in unedited manuscripts, encoding and lemmatising the text. Issues involved in the design of the ADP include presentation of variants, choice of the standard text, applicability of TEI guidelines, automatic translation between different encodings, cross-edition concordances and principles of lemmatisation.

  10. A model for visual memory encoding.

    Directory of Open Access Journals (Sweden)

    Rodolphe Nenert

    Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

  11. A model for visual memory encoding.

    Science.gov (United States)

    Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P

    2014-01-01

    Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

  12. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  13. Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen

    DEFF Research Database (Denmark)

    Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup

    2012-01-01

    Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...

  14. Componente educativo-recreativo-asociativo en estrategias promotoras de salud bucal en preescolares Educational-recreational-associative element of promotion strategies for oral health in children of preschool education.

    Directory of Open Access Journals (Sweden)

    Carmen Julia Álvarez Montero

    2006-08-01

    Full Text Available Se analiza la integración del componente educativo-recreativo-asociativo en las estrategias mediadoras de promoción de salud bucal implementadas en el Preescolar Fuerzas Armadas de Cooperación, Maracaibo, Venezuela. El estado de salud-enfermedad bucal se determinó en una muestra de 32 niños evaluando la caries inicial y manifiesta e índices de placa y gingival. Se conocieron las concepciones de salud bucal de los padres, posteriormente se diseñaron y aplicaron actividades para lograr la resignificación de los conceptos y obtener la adopción de conductas observables en padres y niños, empleando actividades lúdicas, recursos visuales y prácticas guiadas de higiene bucal. Se concluye que el estado de salud bucal de los niños mejoró significativamente luego del aprendizaje obtenido, lo cual se relacionó directamente con las acciones mediadoras implementadas y el compromiso asumido por los padres y docentes. Se recomienda la metodología empleada para planificar nuevas experiencias de enseñanza-aprendizaje.This paper analyzed the integration of the educational-recreational-associative element into the oral health-promoting strategies implemented in the preschool education center named “Fuerzas Armadas de Cooperación”, Maracaibo, Venezuela. The condition of oral health-disease was determined in a sample of 32 children by evaluating initial and manifest caries along with plaque and gingival indexes. The oral health conceptions of the parents were learned, afterwards, some activities were designed and carried out to come to a re-definition of concepts and to achieve adoption of observable behaviours in parents and their children alike by holding games and usisng visual resources and guided practices in oral hygiene. It was concluded that the oral health condition of children improved significantly after the required learning, which directly related with the implemented actions and the commitment by parents and professors. This

  15. A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

    Science.gov (United States)

    Mikkelsen, Michael D; Thomashow, Michael F

    2009-10-01

    The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

  16. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  17. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    International Nuclear Information System (INIS)

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng

    2008-01-01

    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage

  18. ENCODE whole-genome data in the UCSC genome browser (2011 update).

    Science.gov (United States)

    Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

    2011-01-01

    The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

  19. Fuel element

    International Nuclear Information System (INIS)

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  20. Insulated transcriptional elements enable precise design of genetic circuits.

    Science.gov (United States)

    Zong, Yeqing; Zhang, Haoqian M; Lyu, Cheng; Ji, Xiangyu; Hou, Junran; Guo, Xian; Ouyang, Qi; Lou, Chunbo

    2017-07-03

    Rational engineering of biological systems is often complicated by the complex but unwanted interactions between cellular components at multiple levels. Here we address this issue at the level of prokaryotic transcription by insulating minimal promoters and operators to prevent their interaction and enable the biophysical modeling of synthetic transcription without free parameters. This approach allows genetic circuit design with extraordinary precision and diversity, and consequently simplifies the design-build-test-learn cycle of circuit engineering to a mix-and-match workflow. As a demonstration, combinatorial promoters encoding NOT-gate functions were designed from scratch with mean errors of 96% using our insulated transcription elements. Furthermore, four-node transcriptional networks with incoherent feed-forward loops that execute stripe-forming functions were obtained without any trial-and-error work. This insulation-based engineering strategy improves the resolution of genetic circuit technology and provides a simple approach for designing genetic circuits for systems and synthetic biology.Unwanted interactions between cellular components can complicate rational engineering of biological systems. Here the authors design insulated minimal promoters and operators that enable biophysical modeling of bacterial transcription without free parameters for precise circuit design.

  1. Encoding entanglement-assisted quantum stabilizer codes

    International Nuclear Information System (INIS)

    Wang Yun-Jiang; Bai Bao-Ming; Li Zhuo; Xiao He-Ling; Peng Jin-Ye

    2012-01-01

    We address the problem of encoding entanglement-assisted (EA) quantum error-correcting codes (QECCs) and of the corresponding complexity. We present an iterative algorithm from which a quantum circuit composed of CNOT, H, and S gates can be derived directly with complexity O(n 2 ) to encode the qubits being sent. Moreover, we derive the number of each gate consumed in our algorithm according to which we can design EA QECCs with low encoding complexity. Another advantage brought by our algorithm is the easiness and efficiency of programming on classical computers. (general)

  2. Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements.

    Science.gov (United States)

    Hayes, James E; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J

    2015-01-01

    Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin's lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well.

  3. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak......-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show...... four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate...

  4. A novel attack method about double-random-phase-encoding-based image hiding method

    Science.gov (United States)

    Xu, Hongsheng; Xiao, Zhijun; Zhu, Xianchen

    2018-03-01

    By using optical image processing techniques, a novel text encryption and hiding method applied by double-random phase-encoding technique is proposed in the paper. The first step is that the secret message is transformed into a 2-dimension array. The higher bits of the elements in the array are used to fill with the bit stream of the secret text, while the lower bits are stored specific values. Then, the transformed array is encoded by double random phase encoding technique. Last, the encoded array is embedded on a public host image to obtain the image embedded with hidden text. The performance of the proposed technique is tested via analytical modeling and test data stream. Experimental results show that the secret text can be recovered either accurately or almost accurately, while maintaining the quality of the host image embedded with hidden data by properly selecting the method of transforming the secret text into an array and the superimposition coefficient.

  5. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  6. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  7. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  8. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  9. Encoding information using laguerre gaussian modes

    CSIR Research Space (South Africa)

    Trichili, A

    2015-08-01

    Full Text Available The authors experimentally demonstrate an information encoding protocol using the two degrees of freedom of Laguerre Gaussian modes having different radial and azimuthal components. A novel method, based on digital holography, for information...

  10. Molecular mechanisms for protein-encoded inheritance

    Science.gov (United States)

    Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

    2013-01-01

    Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598

  11. Quantum Logical Operations on Encoded Qubits

    International Nuclear Information System (INIS)

    Zurek, W.H.; Laflamme, R.

    1996-01-01

    We show how to carry out quantum logical operations (controlled-not and Toffoli gates) on encoded qubits for several encodings which protect against various 1-bit errors. This improves the reliability of these operations by allowing one to correct for 1-bit errors which either preexisted or occurred in the course of operation. The logical operations we consider allow one to carry out the vast majority of the steps in the quantum factoring algorithm. copyright 1996 The American Physical Society

  12. Using XML to encode TMA DES metadata

    Directory of Open Access Journals (Sweden)

    Oliver Lyttleton

    2011-01-01

    Full Text Available Background: The Tissue Microarray Data Exchange Specification (TMA DES is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

  13. Using XML to encode TMA DES metadata.

    Science.gov (United States)

    Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

    2011-01-01

    The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs.

  14. Using XML to encode TMA DES metadata

    Science.gov (United States)

    Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

    2011-01-01

    Background: The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs. PMID:21969921

  15. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  16. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  17. Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

  18. Semantic Congruence Accelerates the Onset of the Neural Signals of Successful Memory Encoding.

    Science.gov (United States)

    Packard, Pau A; Rodríguez-Fornells, Antoni; Bunzeck, Nico; Nicolás, Berta; de Diego-Balaguer, Ruth; Fuentemilla, Lluís

    2017-01-11

    As the stream of experience unfolds, our memory system rapidly transforms current inputs into long-lasting meaningful memories. A putative neural mechanism that strongly influences how input elements are transformed into meaningful memory codes relies on the ability to integrate them with existing structures of knowledge or schemas. However, it is not yet clear whether schema-related integration neural mechanisms occur during online encoding. In the current investigation, we examined the encoding-dependent nature of this phenomenon in humans. We showed that actively integrating words with congruent semantic information provided by a category cue enhances memory for words and increases false recall. The memory effect of such active integration with congruent information was robust, even with an interference task occurring right after each encoding word list. In addition, via electroencephalography, we show in 2 separate studies that the onset of the neural signals of successful encoding appeared early (∼400 ms) during the encoding of congruent words. That the neural signals of successful encoding of congruent and incongruent information followed similarly ∼200 ms later suggests that this earlier neural response contributed to memory formation. We propose that the encoding of events that are congruent with readily available contextual semantics can trigger an accelerated onset of the neural mechanisms, supporting the integration of semantic information with the event input. This faster onset would result in a long-lasting and meaningful memory trace for the event but, at the same time, make it difficult to distinguish it from plausible but never encoded events (i.e., related false memories). Conceptual or schema congruence has a strong influence on long-term memory. However, the question of whether schema-related integration neural mechanisms occur during online encoding has yet to be clarified. We investigated the neural mechanisms reflecting how the active

  19. Fuel element

    International Nuclear Information System (INIS)

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  20. Transactinide elements

    International Nuclear Information System (INIS)

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)

  1. FoxO3A promotes metabolic adaptation to hypoxia by antagonizing Myc function

    DEFF Research Database (Denmark)

    Jensen, Kim Steen; Binderup, Tina; Jensen, Klaus Thorleif

    2011-01-01

    Exposure of metazoan organisms to hypoxia engages a metabolic switch orchestrated by the hypoxia-inducible factor 1 (HIF-1). HIF-1 mediates induction of glycolysis and active repression of mitochondrial respiration that reduces oxygen consumption and inhibits the production of potentially harmful...... tumour tissue in vivo and that FoxO3A short-hairpin RNA (shRNA)-expressing xenograft tumours are decreased in size and metabolically changed. Our findings define a novel mechanism by which FoxO3A promotes metabolic adaptation and stress resistance in hypoxia....... reactive oxygen species (ROS). Here, we show that FoxO3A is activated in hypoxia downstream of HIF-1 and mediates the hypoxic repression of a set of nuclear-encoded mitochondrial genes. FoxO3A is required for hypoxic suppression of mitochondrial mass, oxygen consumption, and ROS production and promotes...... cell survival in hypoxia. FoxO3A is recruited to the promoters of nuclear-encoded mitochondrial genes where it directly antagonizes c-Myc function via a mechanism that does not require binding to the consensus FoxO recognition element. Furthermore, we show that FoxO3A is activated in human hypoxic...

  2. ERP Correlates of Encoding Success and Encoding Selectivity in Attention Switching

    Science.gov (United States)

    Yeung, Nick

    2016-01-01

    Long-term memory encoding depends critically on effective processing of incoming information. The degree to which participants engage in effective encoding can be indexed in electroencephalographic (EEG) data by studying event-related potential (ERP) subsequent memory effects. The current study investigated ERP correlates of memory success operationalised with two different measures—memory selectivity and global memory—to assess whether previously observed ERP subsequent memory effects reflect focused encoding of task-relevant information (memory selectivity), general encoding success (global memory), or both. Building on previous work, the present study combined an attention switching paradigm—in which participants were presented with compound object-word stimuli and switched between attending to the object or the word across trials—with a later recognition memory test for those stimuli, while recording their EEG. Our results provided clear evidence that subsequent memory effects resulted from selective attentional focusing and effective top-down control (memory selectivity) in contrast to more general encoding success effects (global memory). Further analyses addressed the question of whether successful encoding depended on similar control mechanisms to those involved in attention switching. Interestingly, differences in the ERP correlates of attention switching and successful encoding, particularly during the poststimulus period, indicated that variability in encoding success occurred independently of prestimulus demands for top-down cognitive control. These results suggest that while effects of selective attention and selective encoding co-occur behaviourally their ERP correlates are at least partly dissociable. PMID:27907075

  3. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  4. Multichannel compressive sensing MRI using noiselet encoding.

    Directory of Open Access Journals (Sweden)

    Kamlesh Pawar

    Full Text Available The incoherence between measurement and sparsifying transform matrices and the restricted isometry property (RIP of measurement matrix are two of the key factors in determining the performance of compressive sensing (CS. In CS-MRI, the randomly under-sampled Fourier matrix is used as the measurement matrix and the wavelet transform is usually used as sparsifying transform matrix. However, the incoherence between the randomly under-sampled Fourier matrix and the wavelet matrix is not optimal, which can deteriorate the performance of CS-MRI. Using the mathematical result that noiselets are maximally incoherent with wavelets, this paper introduces the noiselet unitary bases as the measurement matrix to improve the incoherence and RIP in CS-MRI. Based on an empirical RIP analysis that compares the multichannel noiselet and multichannel Fourier measurement matrices in CS-MRI, we propose a multichannel compressive sensing (MCS framework to take the advantage of multichannel data acquisition used in MRI scanners. Simulations are presented in the MCS framework to compare the performance of noiselet encoding reconstructions and Fourier encoding reconstructions at different acceleration factors. The comparisons indicate that multichannel noiselet measurement matrix has better RIP than that of its Fourier counterpart, and that noiselet encoded MCS-MRI outperforms Fourier encoded MCS-MRI in preserving image resolution and can achieve higher acceleration factors. To demonstrate the feasibility of the proposed noiselet encoding scheme, a pulse sequences with tailored spatially selective RF excitation pulses was designed and implemented on a 3T scanner to acquire the data in the noiselet domain from a phantom and a human brain. The results indicate that noislet encoding preserves image resolution better than Fouirer encoding.

  5. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  6. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  7. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  8. Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

    Science.gov (United States)

    Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

    2000-06-01

    The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

  9. New elements

    International Nuclear Information System (INIS)

    Flerov, G.

    1976-01-01

    The history is briefly described of the investigation of superheavy elements at the Joint Institute for Nuclear Research at Dubna. The significance of the investigation is assessed from the point of view of the nuclear structure study and major problems encountered in experimental efforts are indicated. Current experimental methods aiming at the discovery or the production of superheavy nuclei with Z approximately 114 are listed. (I.W.)

  10. Improved magnetic encoding device and method for making the same. [Patent application

    Science.gov (United States)

    Fox, R.J.

    A magnetic encoding device and method for making the same are provided for use as magnetic storage media in identification control applications that give output signals from a reader that are of shorter duration and substantially greater magnitude than those of the prior art. Magnetic encoding elements are produced by uniformly bending wire or strip stock of a magnetic material longitudinally about a common radius to exceed the elastic limit of the material and subsequently mounting the material so that it is restrained in an unbent position on a substrate of nonmagnetic material. The elements are spot weld attached to a substrate to form a binary coded array of elements according to a desired binary code. The coded substrate may be enclosed in a plastic laminate structure. Such devices may be used for security badges, key cards, and the like and may have many other applications. 7 figures.

  11. Noise level and MPEG-2 encoder statistics

    Science.gov (United States)

    Lee, Jungwoo

    1997-01-01

    Most software in the movie and broadcasting industries are still in analog film or tape format, which typically contains random noise that originated from film, CCD camera, and tape recording. The performance of the MPEG-2 encoder may be significantly degraded by the noise. It is also affected by the scene type that includes spatial and temporal activity. The statistical property of noise originating from camera and tape player is analyzed and the models for the two types of noise are developed. The relationship between the noise, the scene type, and encoder statistics of a number of MPEG-2 parameters such as motion vector magnitude, prediction error, and quant scale are discussed. This analysis is intended to be a tool for designing robust MPEG encoding algorithms such as preprocessing and rate control.

  12. Indirect Encoding in Neuroevolutionary Ship Handling

    Directory of Open Access Journals (Sweden)

    Miroslaw Lacki

    2018-03-01

    Full Text Available In this paper the author compares the efficiency of two encoding schemes for artificial intelligence methods used in the neuroevolutionary ship maneuvering system. This may be also be seen as the ship handling system that simulates a learning process of a group of artificial helmsmen - autonomous control units, created with an artificial neural network. The helmsman observes input signals derived form an enfironment and calculates the values of required parameters of the vessel maneuvering in confined waters. In neuroevolution such units are treated as individuals in population of artificial neural networks, which through environmental sensing and evolutionary algorithms learn to perform given task efficiently. The main task of this project is to evolve a population of helmsmen with indirect encoding and compare results of simulation with direct encoding method.

  13. An Information Theoretic Characterisation of Auditory Encoding

    Science.gov (United States)

    Overath, Tobias; Cusack, Rhodri; Kumar, Sukhbinder; von Kriegstein, Katharina; Warren, Jason D; Grube, Manon; Carlyon, Robert P; Griffiths, Timothy D

    2007-01-01

    The entropy metric derived from information theory provides a means to quantify the amount of information transmitted in acoustic streams like speech or music. By systematically varying the entropy of pitch sequences, we sought brain areas where neural activity and energetic demands increase as a function of entropy. Such a relationship is predicted to occur in an efficient encoding mechanism that uses less computational resource when less information is present in the signal: we specifically tested the hypothesis that such a relationship is present in the planum temporale (PT). In two convergent functional MRI studies, we demonstrated this relationship in PT for encoding, while furthermore showing that a distributed fronto-parietal network for retrieval of acoustic information is independent of entropy. The results establish PT as an efficient neural engine that demands less computational resource to encode redundant signals than those with high information content. PMID:17958472

  14. Regulation of the cd38 promoter in human airway smooth muscle cells by TNF-α and dexamethasone

    Directory of Open Access Journals (Sweden)

    Walseth Timothy F

    2008-03-01

    Full Text Available Abstract Background CD38 is expressed in human airway smooth muscle (HASM cells, regulates intracellular calcium, and its expression is augmented by tumor necrosis factor alpha (TNF-α. CD38 has a role in airway hyperresponsiveness, a hallmark of asthma, since deficient mice develop attenuated airway hyperresponsiveness compared to wild-type mice following intranasal challenges with cytokines such as IL-13 and TNF-α. Regulation of CD38 expression in HASM cells involves the transcription factor NF-κB, and glucocorticoids inhibit this expression through NF-κB-dependent and -independent mechanisms. In this study, we determined whether the transcriptional regulation of CD38 expression in HASM cells involves response elements within the promoter region of this gene. Methods We cloned a putative 3 kb promoter fragment of the human cd38 gene into pGL3 basic vector in front of a luciferase reporter gene. Sequence analysis of the putative cd38 promoter region revealed one NF-κB and several AP-1 and glucocorticoid response element (GRE motifs. HASM cells were transfected with the 3 kb promoter, a 1.8 kb truncated promoter that lacks the NF-κB and some of the AP-1 sites, or the promoter with mutations of the NF-κB and/or AP-1 sites. Using the electrophoretic mobility shift assays, we determined the binding of nuclear proteins to oligonucleotides encoding the putative cd38 NF-κB, AP-1, and GRE sites, and the specificity of this binding was confirmed by gel supershift analysis with appropriate antibodies. Results TNF-α induced a two-fold activation of the 3 kb promoter following its transfection into HASM cells. In cells transfected with the 1.8 kb promoter or promoter constructs lacking NF-κB and/or AP-1 sites or in the presence of dexamethasone, there was no induction in the presence of TNF-α. The binding of nuclear proteins to oligonucleotides encoding the putative cd38 NF-κB site and some of the six AP-1 sites was increased by TNF-α, and to

  15. Incremental phonological encoding during unscripted sentence production

    Directory of Open Access Journals (Sweden)

    Florian T Jaeger

    2012-11-01

    Full Text Available We investigate phonological encoding during unscripted sentence production, focusing on the effect of phonological overlap on phonological encoding. Previous work on this question has almost exclusively employed isolated word production or highly scripted multiword production. These studies have led to conflicting results: some studies found that phonological overlap between two words facilitates phonological encoding, while others found inhibitory effects. One worry with many of these paradigms is that they involve processes that are not typical to everyday language use, which calls into question to what extent their findings speak to the architectures and mechanisms underlying language production. We present a paradigm to investigate the consequences of phonological overlap between words in a sentence while leaving speakers much of the lexical and structural choices typical in everyday language use. Adult native speakers of English described events in short video clips. We annotated the presence of disfluencies and the speech rate at various points throughout the sentence, as well as the constituent order. We find that phonological overlap has an inhibitory effect on phonological encoding. Specifically, if adjacent content words share their phonological onset (e.g., hand the hammer, they are preceded by production difficulty, as reflected in fluency and speech rate. We also find that this production difficulty affects speakers’ constituent order preferences during grammatical encoding. We discuss our results and previous works to isolate the properties of other paradigms that resulted in facilitatory or inhibitory results. The data from our paradigm also speak to questions about the scope of phonological planning in unscripted speech and as to whether phonological and grammatical encoding interact.

  16. Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation.

    Science.gov (United States)

    Qin, Yu-Xiang; Qin, Fangyuan

    2016-02-01

    Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Positive- and negative-acting regulatory elements contribute to the tissue-specific expression of INNER NO OUTER, a YABBY-type transcription factor gene in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Simon Marissa K

    2012-11-01

    Full Text Available Abstract Background The INNER NO OUTER (INO gene, which encodes a YABBY-type transcription factor, specifies and promotes the growth of the outer integument of the ovule in Arabidopsis. INO expression is limited to the abaxial cell layer of the developing outer integument of the ovule and is regulated by multiple regions of the INO promoter, including POS9, a positive element that when present in quadruplicate can produce low-level expression in the normal INO pattern. Results Significant redundancy in activity between different regions of the INO promoter is demonstrated. For specific regulatory elements, multimerization or the addition of the cauliflower mosaic virus 35S general enhancer was able to activate expression of reporter gene constructs that were otherwise incapable of expression on their own. A new promoter element, POS6, is defined and is shown to include sufficient positive regulatory information to reproduce the endogenous pattern of expression in ovules, but other promoter regions are necessary to fully suppress expression outside of ovules. The full-length INO promoter, but not any of the INO promoter deletions tested, is able to act as an enhancer-blocking insulator to prevent the ectopic activation of expression by the 35S enhancer. Sequence conservation between the promoter regions of Arabidopsis thaliana, Brassica oleracea and Brassica rapa aligns closely with the functional definition of the POS6 and POS9 regions, and with a defined INO minimal promoter. The B. oleracea INO promoter is sufficient to promote a similar pattern and level of reporter gene expression in Arabidopsis to that observed for the Arabidopsis promoter. Conclusions At least two independent regions of the INO promoter contain sufficient regulatory information to direct the specific pattern but not the level of INO gene expression. These regulatory regions act in a partially redundant manner to promote the expression in a specific pattern in the ovule and

  18. Optical encoder based on a nondiffractive beam

    International Nuclear Information System (INIS)

    Lutenberg, Ariel; Perez-Quintian, Fernando; Rebollo, Maria A.

    2008-01-01

    Optical encoders are used in industrial and laboratory motion equipment to measure rotations and linear displacements. We introduce a design of an optical encoder based on a nondiffractive beam. We expect that the invariant profile and radial symmetry of the nondiffractive beam provide the design with remarkable tolerance to mechanical perturbations. We experimentally demonstrate that the proposed design generates a suitable output sinusoidal signal with low harmonic distortion. Moreover, we present a numerical model of the system based on the angular spectrum approximation whose predictions are in excellent agreement with the experimental results

  19. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

    Science.gov (United States)

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

    2000-10-01

    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  20. QualityML: a dictionary for quality metadata encoding

    Science.gov (United States)

    Ninyerola, Miquel; Sevillano, Eva; Serral, Ivette; Pons, Xavier; Zabala, Alaitz; Bastin, Lucy; Masó, Joan

    2014-05-01

    The scenario of rapidly growing geodata catalogues requires tools focused on facilitate users the choice of products. Having quality fields populated in metadata allow the users to rank and then select the best fit-for-purpose products. In this direction, we have developed the QualityML (http://qualityml.geoviqua.org), a dictionary that contains hierarchically structured concepts to precisely define and relate quality levels: from quality classes to quality measurements. Generically, a quality element is the path that goes from the higher level (quality class) to the lowest levels (statistics or quality metrics). This path is used to encode quality of datasets in the corresponding metadata schemas. The benefits of having encoded quality, in the case of data producers, are related with improvements in their product discovery and better transmission of their characteristics. In the case of data users, particularly decision-makers, they would find quality and uncertainty measures to take the best decisions as well as perform dataset intercomparison. Also it allows other components (such as visualization, discovery, or comparison tools) to be quality-aware and interoperable. On one hand, the QualityML is a profile of the ISO geospatial metadata standards providing a set of rules for precisely documenting quality indicator parameters that is structured in 6 levels. On the other hand, QualityML includes semantics and vocabularies for the quality concepts. Whenever possible, if uses statistic expressions from the UncertML dictionary (http://www.uncertml.org) encoding. However it also extends UncertML to provide list of alternative metrics that are commonly used to quantify quality. A specific example, based on a temperature dataset, is shown below. The annual mean temperature map has been validated with independent in-situ measurements to obtain a global error of 0.5 ° C. Level 0: Quality class (e.g., Thematic accuracy) Level 1: Quality indicator (e.g., Quantitative

  1. On the Immortality of Television Sets: ?Function? in the Human Genome According to the Evolution-Free Gospel of ENCODE

    OpenAIRE

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selec...

  2. Developing a promotional strategy: important questions for social marketing.

    Science.gov (United States)

    Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L

    2007-10-01

    Health practitioners often use the terms marketing and promotion interchangeably. Yet, promotion is just one element of an overall marketing strategy. To realize the greatest impact there must be a combination of all the marketing components, including product, price, place, and promotion. The purpose of this article is to clarify the role of promotion and describe key elements of developing a promotional strategy within the broader context of a social marketing initiative.

  3. The Compass-like locus, exclusive to the Ambulacrarians, encodes a chromatin insulator binding protein in the sea urchin embryo.

    Directory of Open Access Journals (Sweden)

    Vincenzo Cavalieri

    Full Text Available Chromatin insulators are eukaryotic genome elements that upon binding of specific proteins display barrier and/or enhancer-blocking activity. Although several insulators have been described throughout various metazoans, much less is known about proteins that mediate their functions. This article deals with the identification and functional characterization in Paracentrotus lividus of COMPASS-like (CMPl, a novel echinoderm insulator binding protein. Phylogenetic analysis shows that the CMPl factor, encoded by the alternative spliced Cmp/Cmpl transcript, is the founder of a novel ambulacrarian-specific family of Homeodomain proteins containing the Compass domain. Specific association of CMPl with the boxB cis-element of the sns5 chromatin insulator is demonstrated by using a yeast one-hybrid system, and further corroborated by ChIP-qPCR and trans-activation assays in developing sea urchin embryos. The sns5 insulator lies within the early histone gene cluster, basically between the H2A enhancer and H1 promoter. To assess the functional role of CMPl within this locus, we challenged the activity of CMPl by two distinct experimental strategies. First we expressed in the developing embryo a chimeric protein, containing the DNA-binding domain of CMPl, which efficiently compete with the endogenous CMPl for the binding to the boxB sequence. Second, to titrate the embryonic CMPl protein, we microinjected an affinity-purified CMPl antibody. In both the experimental assays we congruently observed the loss of the enhancer-blocking function of sns5, as indicated by the specific increase of the H1 expression level. Furthermore, microinjection of the CMPl antiserum in combination with a synthetic mRNA encoding a forced repressor of the H2A enhancer-bound MBF1 factor restores the normal H1 mRNA abundance. Altogether, these results strongly support the conclusion that the recruitment of CMPl on sns5 is required for buffering the H1 promoter from the H2A enhancer

  4. Hiding a Covert Digital Image by Assembling the RSA Encryption Method and the Binary Encoding Method

    OpenAIRE

    Kuang Tsan Lin; Sheng Lih Yeh

    2014-01-01

    The Rivest-Shamir-Adleman (RSA) encryption method and the binary encoding method are assembled to form a hybrid hiding method to hide a covert digital image into a dot-matrix holographic image. First, the RSA encryption method is used to transform the covert image to form a RSA encryption data string. Then, all the elements of the RSA encryption data string are transferred into binary data. Finally, the binary data are encoded into the dot-matrix holographic image. The pixels of the dot-matri...

  5. Synthesis and nanoscale thermal encoding of phase-change nanowires

    International Nuclear Information System (INIS)

    Sun Xuhui; Yu Bin; Meyyappan, M.

    2007-01-01

    Low-dimensional phase-change nanostructures provide a valuable research platform for understanding the phase-transition behavior and thermal properties at nanoscale and their potential in achieving superdense data storage. Ge 2 Sb 2 Te 5 nanowires have been grown using a vapor-liquid-solid technique and shown to exhibit distinctive properties that may overcome the present data storage scaling barrier. Local heating of an individual nanowire with a focused electron beam was used to shape a nano-bar-code on a Ge 2 Sb 2 Te 5 nanowire. The data encoding on Ge 2 Sb 2 Te 5 nanowire may promote novel device concepts to implement ultrahigh density, low energy, high speed data storage using phase-change nanomaterials with diverse thermal-programing strategies

  6. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  7. Bacteriophages encode factors required for protection in a symbiotic mutualism.

    Science.gov (United States)

    Oliver, Kerry M; Degnan, Patrick H; Hunter, Martha S; Moran, Nancy A

    2009-08-21

    Bacteriophages are known to carry key virulence factors for pathogenic bacteria, but their roles in symbiotic bacteria are less well understood. The heritable symbiont Hamiltonella defensa protects the aphid Acyrthosiphon pisum from attack by the parasitoid Aphidius ervi by killing developing wasp larvae. In a controlled genetic background, we show that a toxin-encoding bacteriophage is required to produce the protective phenotype. Phage loss occurs repeatedly in laboratory-held H. defensa-infected aphid clonal lines, resulting in increased susceptibility to parasitism in each instance. Our results show that these mobile genetic elements can endow a bacterial symbiont with benefits that extend to the animal host. Thus, phages vector ecologically important traits, such as defense against parasitoids, within and among symbiont and animal host lineages.

  8. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  9. Visual Memory : The Price of Encoding Details

    NARCIS (Netherlands)

    Nieuwenstein, Mark; Kromm, Maria

    2017-01-01

    Studies on visual long-term memory have shown that we have a tremendous capacity for remembering pictures of objects, even at a highly detailed level. What remains unclear, however, is whether encoding objects at such a detailed level comes at any cost. In the current study, we examined how the

  10. Encoders for block-circulant LDPC codes

    Science.gov (United States)

    Divsalar, Dariush (Inventor); Abbasfar, Aliazam (Inventor); Jones, Christopher R. (Inventor); Dolinar, Samuel J. (Inventor); Thorpe, Jeremy C. (Inventor); Andrews, Kenneth S. (Inventor); Yao, Kung (Inventor)

    2009-01-01

    Methods and apparatus to encode message input symbols in accordance with an accumulate-repeat-accumulate code with repetition three or four are disclosed. Block circulant matrices are used. A first method and apparatus make use of the block-circulant structure of the parity check matrix. A second method and apparatus use block-circulant generator matrices.

  11. 47 CFR 11.32 - EAS Encoder.

    Science.gov (United States)

    2010-10-01

    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL EMERGENCY ALERT SYSTEM (EAS) Equipment Requirements § 11... operation. (vi) Indicator Display. The encoder shall be provided with a visual and/or aural indicator which... to +50 degrees C and a range of relative humidity of up to 95%. (c) Primary Supply Voltage Variation...

  12. Toward Chemical Implementation of Encoded Combinatorial Libraries

    DEFF Research Database (Denmark)

    Nielsen, John; Janda, Kim D.

    1994-01-01

    The recent application of "combinatorial libraries" to supplement existing drug screening processes might simplify and accelerate the search for new lead compounds or drugs. Recently, a scheme for encoded combinatorial chemistry was put forward to surmount a number of the limitations possessed...

  13. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  14. Bubble masks for time-encoded imaging of fast neutrons.

    Energy Technology Data Exchange (ETDEWEB)

    Brubaker, Erik; Brennan, James S.; Marleau, Peter; Nowack, Aaron B.; Steele, John T.; Sweany, Melinda; Throckmorton, Daniel J.

    2013-09-01

    Time-encoded imaging is an approach to directional radiation detection that is being developed at SNL with a focus on fast neutron directional detection. In this technique, a time modulation of a detected neutron signal is inducedtypically, a moving mask that attenuates neutrons with a time structure that depends on the source position. An important challenge in time-encoded imaging is to develop high-resolution two-dimensional imaging capabilities; building a mechanically moving high-resolution mask presents challenges both theoretical and technical. We have investigated an alternative to mechanical masks that replaces the solid mask with a liquid such as mineral oil. Instead of fixed blocks of solid material that move in pre-defined patterns, the oil is contained in tubing structures, and carefully introduced air gapsbubblespropagate through the tubing, generating moving patterns of oil mask elements and air apertures. Compared to current moving-mask techniques, the bubble mask is simple, since mechanical motion is replaced by gravity-driven bubble propagation; it is flexible, since arbitrary bubble patterns can be generated by a software-controlled valve actuator; and it is potentially high performance, since the tubing and bubble size can be tuned for high-resolution imaging requirements. We have built and tested various single-tube mask elements, and will present results on bubble introduction and propagation as a function of tubing size and cross-sectional shape; real-time bubble position tracking; neutron source imaging tests; and reconstruction techniques demonstrated on simple test data as well as a simulated full detector system.

  15. Nonlinear inversion of potential-field data using a hybrid-encoding genetic algorithm

    Science.gov (United States)

    Chen, C.; Xia, J.; Liu, J.; Feng, G.

    2006-01-01

    Using a genetic algorithm to solve an inverse problem of complex nonlinear geophysical equations is advantageous because it does not require computer gradients of models or "good" initial models. The multi-point search of a genetic algorithm makes it easier to find the globally optimal solution while avoiding falling into a local extremum. As is the case in other optimization approaches, the search efficiency for a genetic algorithm is vital in finding desired solutions successfully in a multi-dimensional model space. A binary-encoding genetic algorithm is hardly ever used to resolve an optimization problem such as a simple geophysical inversion with only three unknowns. The encoding mechanism, genetic operators, and population size of the genetic algorithm greatly affect search processes in the evolution. It is clear that improved operators and proper population size promote the convergence. Nevertheless, not all genetic operations perform perfectly while searching under either a uniform binary or a decimal encoding system. With the binary encoding mechanism, the crossover scheme may produce more new individuals than with the decimal encoding. On the other hand, the mutation scheme in a decimal encoding system will create new genes larger in scope than those in the binary encoding. This paper discusses approaches of exploiting the search potential of genetic operations in the two encoding systems and presents an approach with a hybrid-encoding mechanism, multi-point crossover, and dynamic population size for geophysical inversion. We present a method that is based on the routine in which the mutation operation is conducted in the decimal code and multi-point crossover operation in the binary code. The mix-encoding algorithm is called the hybrid-encoding genetic algorithm (HEGA). HEGA provides better genes with a higher probability by a mutation operator and improves genetic algorithms in resolving complicated geophysical inverse problems. Another significant

  16. Genetic and phylogenetic characterization of the type II cyclobutane pyrimidine dimer photolyases encoded by Leporipoxviruses

    International Nuclear Information System (INIS)

    Bennett, C. James; Webb, Melissa; Willer, David O.; Evans, David H.

    2003-01-01

    Shope fibroma virus and myxoma virus encode proteins predicted to be Type II photolyases. These are enzymes that catalyze light-dependent repair of cyclobutane pyrimidine dimers (CPDs). When the Shope fibroma virus S127L gene was expressed in an Escherichia coli strain lacking functional CPD repair pathways, the expressed gene protected the bacteria from 70-75% of the ultraviolet (UV) light-induced cytotoxic DNA damage. This proportion suggests that Leporipoxvirus photolyases can only repair CPDs, which typically comprise ∼70% of the damage caused by short wavelength UV light. To test whether these enzymes can protect virus genomes from UV, we exposed virus suspensions to UV-C light followed by graded exposure to filtered visible light. Viruses encoding a deletion of the putative photolyase gene were unable to photoreactivate UV damage while this treatment again eliminated 70-90% of the lethal photoproducts in wild-type viruses. Western blotting detected photolyase protein in extracts prepared from purified virions and it can be deduced that the poxvirion interior must be fluid enough to permit diffusion of this ∼50-kDa DNA-binding protein to the sites where it catalyzes photoreactivation. Photolyase promoters are difficult to categorize using bioinformatics methods, as they do not obviously resemble any of the known poxvirus promoter motifs. By fusing the SFV promoter to DNA encoding a luciferase open reading frame, the photolyase promoter was found to exhibit very weak late promoter activity. These data show that the genomes of Leporipoxviruses, similar to that of fowlpox virus, encode catalytically active photolyases. Phylogenetic studies also confirmed the monophyletic origin of poxviruses and suggest an ancient origin for these genes and perhaps poxviruses

  17. Deep--deeper--deepest? Encoding strategies and the recognition of human faces.

    Science.gov (United States)

    Sporer, S L

    1991-03-01

    Various encoding strategies that supposedly promote deeper processing of human faces (e.g., character judgments) have led to better recognition than more shallow processing tasks (judging the width of the nose). However, does deeper processing actually lead to an improvement in recognition, or, conversely, does shallow processing lead to a deterioration in performance when compared with naturally employed encoding strategies? Three experiments systematically compared a total of 8 different encoding strategies manipulating depth of processing, amount of elaboration, and self-generation of judgmental categories. All strategies that required a scanning of the whole face were basically equivalent but no better than natural strategy controls. The consistently worst groups were the ones that rated faces along preselected physical dimensions. This can be explained by subjects' lesser task involvement as revealed by manipulation checks.

  18. Spatially Compact Neural Clusters in the Dorsal Striatum Encode Locomotion Relevant Information.

    Science.gov (United States)

    Barbera, Giovanni; Liang, Bo; Zhang, Lifeng; Gerfen, Charles R; Culurciello, Eugenio; Chen, Rong; Li, Yun; Lin, Da-Ting

    2016-10-05

    An influential striatal model postulates that neural activities in the striatal direct and indirect pathways promote and inhibit movement, respectively. Normal behavior requires coordinated activity in the direct pathway to facilitate intended locomotion and indirect pathway to inhibit unwanted locomotion. In this striatal model, neuronal population activity is assumed to encode locomotion relevant information. Here, we propose a novel encoding mechanism for the dorsal striatum. We identified spatially compact neural clusters in both the direct and indirect pathways. Detailed characterization revealed similar cluster organization between the direct and indirect pathways, and cluster activities from both pathways were correlated with mouse locomotion velocities. Using machine-learning algorithms, cluster activities could be used to decode locomotion relevant behavioral states and locomotion velocity. We propose that neural clusters in the dorsal striatum encode locomotion relevant information and that coordinated activities of direct and indirect pathway neural clusters are required for normal striatal controlled behavior. VIDEO ABSTRACT. Published by Elsevier Inc.

  19. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  20. Fuel element

    International Nuclear Information System (INIS)

    Hirose, Yasuo.

    1982-01-01

    Purpose: To increase the plenum space in a fuel element used for a liquid metal cooled reactor. Constitution: A fuel pellet is secured at one end with an end plug and at the other with a coil spring in a tubular container. A mechanism for fixing the coil spring composed of a tubular unit is mounted by friction with the inner surface of the tubular container. Accordingly, the recoiling force of the coil spring can be retained by fixing mechanism with a small volume, and since a large amount of plenum space can be obtained, the internal pressure rise in the cladding tube can be suppressed even if large quantities of fission products are discharged. (Kamimura, M.)

  1. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    Science.gov (United States)

    2009-01-01

    Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

  2. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    Directory of Open Access Journals (Sweden)

    Lindberg Pia

    2009-03-01

    Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.

  3. Inverse correlation between promoter strength and excision activity in class 1 integrons.

    Directory of Open Access Journals (Sweden)

    Thomas Jové

    2010-01-01

    Full Text Available Class 1 integrons are widespread genetic elements that allow bacteria to capture and express gene cassettes that are usually promoterless. These integrons play a major role in the dissemination of antibiotic resistance among Gram-negative bacteria. They typically consist of a gene (intI encoding an integrase (that catalyzes the gene cassette movement by site-specific recombination, a recombination site (attI1, and a promoter (Pc responsible for the expression of inserted gene cassettes. The Pc promoter can occasionally be combined with a second promoter designated P2, and several Pc variants with different strengths have been described, although their relative distribution is not known. The Pc promoter in class 1 integrons is located within the intI1 coding sequence. The Pc polymorphism affects the amino acid sequence of IntI1 and the effect of this feature on the integrase recombination activity has not previously been investigated. We therefore conducted an extensive in silico study of class 1 integron sequences in order to assess the distribution of Pc variants. We also measured these promoters' strength by means of transcriptional reporter gene fusion experiments and estimated the excision and integration activities of the different IntI1 variants. We found that there are currently 13 Pc variants, leading to 10 IntI1 variants, that have a highly uneven distribution. There are five main Pc-P2 combinations, corresponding to five promoter strengths, and three main integrases displaying similar integration activity but very different excision efficiency. Promoter strength correlates with integrase excision activity: the weaker the promoter, the stronger the integrase. The tight relationship between the aptitude of class 1 integrons to recombine cassettes and express gene cassettes may be a key to understanding the short-term evolution of integrons. Dissemination of integron-driven drug resistance is therefore more complex than previously thought.

  4. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  5. Age-related influences of prior sleep on brain activation during verbal encoding

    Directory of Open Access Journals (Sweden)

    Michelle B Jonelis

    2012-04-01

    Full Text Available Disrupted sleep is more common in older adults (OA than younger adults (YA, often co-morbid with other conditions. How these sleep disturbances affect cognitive performance is an area of active study. We examined whether brain activation during verbal encoding correlates with sleep quantity and quality the night before testing in a group of healthy OA and YA. Twenty-seven OA (ages 59-82 and twenty-seven YA (ages 19-36 underwent one night of standard polysomnography. Twelve hours post-awakening, subjects performed a verbal encoding task while undergoing functional MRI. Analyses examined the group (OA vs. YA by prior sleep quantity (Total Sleep Time (TST or quality (Sleep Efficiency (SE interaction on cerebral activation, controlling for performance. Longer TST promoted higher levels of activation in the bilateral anterior parahippocampi in OA and lower activation levels in the left anterior parahippocampus in YA. Greater SE promoted higher activation levels in the left posterior parahippocampus and right inferior frontal gyrus in YA, but not in OA. The roles of these brain regions in verbal encoding suggest, in OA, longer sleep duration may facilitate functional compensation during cognitive challenges. By contrast, in YA, shorter sleep duration may necessitate functional compensation to maintain cognitive performance, similar to what is seen following acute sleep deprivation. Additionally, in YA, better sleep quality may improve semantic retrieval processes, thereby aiding encoding.

  6. An Event Related Potentials Study of Semantic Coherence Effect during Episodic Encoding in Schizophrenia Patients

    Directory of Open Access Journals (Sweden)

    Lâle Battal Merlet

    2018-01-01

    Full Text Available The objective of this electrophysiological study was to investigate the processing of semantic coherence during encoding in relation to episodic memory processes promoted at test, in schizophrenia patients, by using the N400 paradigm. Eighteen schizophrenia patients and 15 healthy participants undertook a recognition memory task. The stimuli consisted of pairs of words either semantically related or unrelated to a given category name (context. During encoding, both groups exhibited an N400 external semantic coherence effect. Healthy controls also showed an N400 internal semantic coherence effect, but this effect was not present in patients. At test, related stimuli were accompanied by an FN400 old/new effect in both groups and by a parietal old/new effect in the control group alone. In the patient group, external semantic coherence effect was associated with FN400, while, in the control group, it was correlated to the parietal old/new effect. Our results indicate that schizophrenia patients can process the contextual information at encoding to enhance familiarity process for related stimuli at test. Therefore, cognitive rehabilitation therapies targeting the implementation of semantic encoding strategies can mobilize familiarity which in turn can overcome the recollection deficit, promoting successful episodic memory performance in schizophrenia patients.

  7. An Intensional Concurrent Faithful Encoding of Turing Machines

    Directory of Open Access Journals (Sweden)

    Thomas Given-Wilson

    2014-10-01

    Full Text Available The benchmark for computation is typically given as Turing computability; the ability for a computation to be performed by a Turing Machine. Many languages exploit (indirect encodings of Turing Machines to demonstrate their ability to support arbitrary computation. However, these encodings are usually by simulating the entire Turing Machine within the language, or by encoding a language that does an encoding or simulation itself. This second category is typical for process calculi that show an encoding of lambda-calculus (often with restrictions that in turn simulates a Turing Machine. Such approaches lead to indirect encodings of Turing Machines that are complex, unclear, and only weakly equivalent after computation. This paper presents an approach to encoding Turing Machines into intensional process calculi that is faithful, reduction preserving, and structurally equivalent. The encoding is demonstrated in a simple asymmetric concurrent pattern calculus before generalised to simplify infinite terms, and to show encodings into Concurrent Pattern Calculus and Psi Calculi.

  8. Temporal information encoding in dynamic memristive devices

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Wen; Chen, Lin; Du, Chao; Lu, Wei D., E-mail: wluee@eecs.umich.edu [Department of Electrical Engineering and Computer Science, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2015-11-09

    We show temporal and frequency information can be effectively encoded in memristive devices with inherent short-term dynamics. Ag/Ag{sub 2}S/Pd based memristive devices with low programming voltage (∼100 mV) were fabricated and tested. At weak programming conditions, the devices exhibit inherent decay due to spontaneous diffusion of the Ag atoms. When the devices were subjected to pulse train inputs emulating different spiking patterns, the switching probability distribution function diverges from the standard Poisson distribution and evolves according to the input pattern. The experimentally observed switching probability distributions and the associated cumulative probability functions can be well-explained using a model accounting for the short-term decay effects. Such devices offer an intriguing opportunity to directly encode neural signals for neural information storage and analysis.

  9. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  11. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  12. Nucleic acid compositions and the encoding proteins

    Science.gov (United States)

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  13. Asymmetric synthesis using chiral-encoded metal

    Science.gov (United States)

    Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander

    2016-08-01

    The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity.

  14. Effects of emotion and reward motivation on neural correlates of episodic memory encoding: a PET study.

    Science.gov (United States)

    Shigemune, Yayoi; Abe, Nobuhito; Suzuki, Maki; Ueno, Aya; Mori, Etsuro; Tashiro, Manabu; Itoh, Masatoshi; Fujii, Toshikatsu

    2010-05-01

    It is known that emotion and reward motivation promote long-term memory formation. It remains unclear, however, how and where emotion and reward are integrated during episodic memory encoding. In the present study, subjects were engaged in intentional encoding of photographs under four different conditions that were made by combining two factors (emotional valence, negative or neutral; and monetary reward value, high or low for subsequent successful recognition) during H2 15O positron emission tomography (PET) scanning. As for recognition performance, we found significant main effects of emotional valence (negative>neutral) and reward value (high value>low value), without an interaction between the two factors. Imaging data showed that the left amygdala was activated during the encoding conditions of negative pictures relative to neutral pictures, and the left orbitofrontal cortex was activated during the encoding conditions of high reward pictures relative to low reward pictures. In addition, conjunction analysis of these two main effects detected right hippocampal activation. Although we could not find correlations between recognition performance and activity of these three regions, we speculate that the right hippocampus may integrate the effects of emotion (processed in the amygdala) and monetary reward (processed in the orbitofrontal cortex) on episodic memory encoding. 2010 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  15. Optimal Achievable Encoding for Brain Machine Interface

    Science.gov (United States)

    2017-12-22

    dictionary-based encoding approach to translate a visual image into sequential patterns of electrical stimulation in real time , in a manner that...including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and...networks, and by applying linear decoding to complete recorded populations of retinal ganglion cells for the first time . Third, we developed a greedy

  16. Encoded libraries of chemically modified peptides.

    Science.gov (United States)

    Heinis, Christian; Winter, Greg

    2015-06-01

    The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.

  17. Encoding and decoding messages with chaotic lasers

    International Nuclear Information System (INIS)

    Alsing, P.M.; Gavrielides, A.; Kovanis, V.; Roy, R.; Thornburg, K.S. Jr.

    1997-01-01

    We investigate the structure of the strange attractor of a chaotic loss-modulated solid-state laser utilizing return maps based on a combination of intensity maxima and interspike intervals, as opposed to those utilizing Poincare sections defined by the intensity maxima of the laser (I=0,Ie<0) alone. We find both experimentally and numerically that a simple, intrinsic relationship exists between an intensity maximum and the pair of preceding and succeeding interspike intervals. In addition, we numerically investigate encoding messages on the output of a chaotic transmitter laser and its subsequent decoding by a similar receiver laser. By exploiting the relationship between the intensity maxima and the interspike intervals, we demonstrate that the method utilized to encode the message is vital to the system close-quote s ability to hide the signal from unwanted deciphering. In this work alternative methods are studied in order to encode messages by modulating the magnitude of pumping of the transmitter laser and also by driving its loss modulation with more than one frequency. copyright 1997 The American Physical Society

  18. Definition of an ISO 19115 metadata profile for SeaDataNet II Cruise Summary Reports and its XML encoding

    Science.gov (United States)

    Boldrini, Enrico; Schaap, Dick M. A.; Nativi, Stefano

    2013-04-01

    SeaDataNet implements a distributed pan-European infrastructure for Ocean and Marine Data Management whose nodes are maintained by 40 national oceanographic and marine data centers from 35 countries riparian to all European seas. A unique portal makes possible distributed discovery, visualization and access of the available sea data across all the member nodes. Geographic metadata play an important role in such an infrastructure, enabling an efficient documentation and discovery of the resources of interest. In particular: - Common Data Index (CDI) metadata describe the sea datasets, including identification information (e.g. product title, interested area), evaluation information (e.g. data resolution, constraints) and distribution information (e.g. download endpoint, download protocol); - Cruise Summary Reports (CSR) metadata describe cruises and field experiments at sea, including identification information (e.g. cruise title, name of the ship), acquisition information (e.g. utilized instruments, number of samples taken) In the context of the second phase of SeaDataNet (SeaDataNet 2 EU FP7 project, grant agreement 283607, started on October 1st, 2011 for a duration of 4 years) a major target is the setting, adoption and promotion of common international standards, to the benefit of outreach and interoperability with the international initiatives and communities (e.g. OGC, INSPIRE, GEOSS, …). A standardization effort conducted by CNR with the support of MARIS, IFREMER, STFC, BODC and ENEA has led to the creation of a ISO 19115 metadata profile of CDI and its XML encoding based on ISO 19139. The CDI profile is now in its stable version and it's being implemented and adopted by the SeaDataNet community tools and software. The effort has then continued to produce an ISO based metadata model and its XML encoding also for CSR. The metadata elements included in the CSR profile belong to different models: - ISO 19115: E.g. cruise identification information, including

  19. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    Science.gov (United States)

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  1. Implementation of trinary logic in a polarization encoded optical shadow-casting scheme.

    Science.gov (United States)

    Rizvi, R A; Zaheer, K; Zubairy, M S

    1991-03-10

    The design of various multioutput trinary combinational logic units by a polarization encoded optical shadow-casting (POSC) technique is presented. The POSC modified algorithm is employed to design and implement these logic elements in a trinary number system with separate and simultaneous generation of outputs. A detailed solution of the POSC logic equations for a fixed source plane and a fixed decoding mask is given to obtain input pixel coding for a trinary half-adder, full adder, and subtractor.

  2. Standard generalized markup language: A guide for transmitting encoded bibliographic records

    International Nuclear Information System (INIS)

    1994-09-01

    This document provides the guidance necessary to transmit to DOE's Office of Scientific and Technical Information (OSTI) an encoded bibliographic record that conforms to International Standard ISO 8879, Information Processing -- Text and office systems -- Standard Generalized Markup Language (SGML). Included in this document are element and attribute tag definitions, sample bibliographic records, the bibliographic document type definition, and instructions on how to transmit a bibliographic record electronically to OSTI

  3. Standard generalized markup language: A guide for transmitting encoded bibliographic records

    Energy Technology Data Exchange (ETDEWEB)

    1994-09-01

    This document provides the guidance necessary to transmit to DOE`s Office of Scientific and Technical Information (OSTI) an encoded bibliographic record that conforms to International Standard ISO 8879, Information Processing -- Text and office systems -- Standard Generalized Markup Language (SGML). Included in this document are element and attribute tag definitions, sample bibliographic records, the bibliographic document type definition, and instructions on how to transmit a bibliographic record electronically to OSTI.

  4. The synergistic transactivation of the hepatitis B viral (HBV) pregenomic promoter by the E6 protein of human papillomavirus type 16 (HPV-16 E6) with HBV X protein was mediated through the AP1 site of E element in the enhancer I (EnI) in human liver cell.

    Science.gov (United States)

    Lee, D H; Choi, B H; Rho, H M

    1999-11-01

    Infection by HBV of a cell already infected with other viral species or vice versa has been suggested as being involved in hepatocellular carcinoma. Using the CAT assay method, we investigated the interactive roles of HBx and potentially oncogenic and transactivating viral early proteins such as Ad5 E1A, HPV-16 E6, and SV40 T ag. In the presence of HBx, only HPV-16 E6 showed significant synergistic transactivation of EnI. We further investigated the function of the HPV-16 E6 using deletion, heterologous promoter, and mutation analyses on the EnI promoter. The results showed that the synergistic effect was mediated through the AP1 site of the E element in EnI by the direct activation of AP1 and support the idea that the infection by HBV of the cell with other viral species such as HPV-16 could increase the transcription activity of the HBV and other oncogenes containing an AP1 site in the promoter. Copyright 1999 Academic Press.

  5. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  6. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  7. Properties of virion transactivator proteins encoded by primate cytomegaloviruses

    Directory of Open Access Journals (Sweden)

    Barry Peter A

    2009-05-01

    Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All

  8. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  9. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  10. Dual beam encoded extended fractional Fourier transform security ...

    Indian Academy of Sciences (India)

    This paper describes a simple method for making dual beam encoded extended fractional Fourier transform (EFRT) security holograms. The hologram possesses different stages of encoding so that security features are concealed and remain invisible to the counterfeiter. These concealed and encoded anticounterfeit ...

  11. Optimal higher-order encoder time-stamping

    NARCIS (Netherlands)

    Merry, R.J.E.; Molengraft, van de M.J.G.; Steinbuch, M.

    2013-01-01

    Optical incremental encoders are used to measure the position of motion control systems. The accuracy of the position measurement is determined and bounded by the number of slits on the encoder. The position measurement is affected by quantization errors and encoder imperfections. In this paper, an

  12. Encoding of electrophysiology and other signals in MR images

    DEFF Research Database (Denmark)

    Hanson, Lars G; Lund, Torben E; Hanson, Christian G

    2007-01-01

    to the "magstripe" technique used for encoding of soundtracks in motion pictures, the electrical signals are in this way encoded as artifacts appearing in the MR images or spectra outside the region of interest. The encoded signals are subsequently reconstructed from the signal recorded by the scanner. RESULTS...

  13. Hippocampal Contribution to Context Encoding across Development Is Disrupted following Early-Life Adversity.

    Science.gov (United States)

    Lambert, Hilary K; Sheridan, Margaret A; Sambrook, Kelly A; Rosen, Maya L; Askren, Mary K; McLaughlin, Katie A

    2017-02-15

    Context can drastically influence responses to environmental stimuli. For example, a gunshot should provoke a different response at a public park than a shooting range. Little is known about how contextual processing and neural correlates change across human development or about individual differences related to early environmental experiences. Children ( N = 60; 8-19 years, 24 exposed to interpersonal violence) completed a context encoding task during fMRI scanning using a delayed match-to-sample design with neutral, happy, and angry facial cues embedded in realistic background scenes. Outside the scanner, participants completed a memory test for context-face pairings. Context memory and neural correlates of context encoding did not vary with age. Larger hippocampal volume was associated with better context memory. Posterior hippocampus was recruited during context encoding, and greater activation in this region predicted better memory for contexts paired with angry faces. Children exposed to violence had poor memory of contexts paired with angry faces, reduced hippocampal volume, and atypical neural recruitment on encoding trials with angry faces, including reduced hippocampal activation and greater functional connectivity between hippocampus and ventrolateral prefrontal cortex (vlPFC). Greater hippocampus-vlPFC connectivity was associated with worse memory for contexts paired with angry faces. Posterior hippocampus appears to support context encoding, a process that does not exhibit age-related variation from middle childhood to late adolescence. Exposure to dangerous environments in childhood is associated with poor context encoding in the presence of threat, likely due to greater vlPFC-dependent attentional narrowing on threat cues at the expense of hippocampus-dependent processing of the broader context. SIGNIFICANCE STATEMENT The ability to use context to guide reactions to environmental stimuli promotes flexible behavior. Remarkably little research has

  14. Similar activation of signal transduction pathways by the herpesvirus-encoded chemokine receptors US28 and ORF74

    DEFF Research Database (Denmark)

    McLean, Katherine A; Holst, Peter J; Martini, Lene

    2004-01-01

    The virally encoded chemokine receptors US28 from human cytomegalovirus and ORF74 from human herpesvirus 8 are both constitutively active. We show that both receptors constitutively activate the transcription factors nuclear factor of activated T cells (NFAT) and cAMP response element binding...

  15. A gain-field encoding of limb position and velocity in the internal model of arm dynamics.

    Directory of Open Access Journals (Sweden)

    Eun Jung Hwang

    2003-11-01

    Full Text Available Adaptability of reaching movements depends on a computation in the brain that transforms sensory cues, such as those that indicate the position and velocity of the arm, into motor commands. Theoretical consideration shows that the encoding properties of neural elements implementing this transformation dictate how errors should generalize from one limb position and velocity to another. To estimate how sensory cues are encoded by these neural elements, we designed experiments that quantified spatial generalization in environments where forces depended on both position and velocity of the limb. The patterns of error generalization suggest that the neural elements that compute the transformation encode limb position and velocity in intrinsic coordinates via a gain-field; i.e., the elements have directionally dependent tuning that is modulated monotonically with limb position. The gain-field encoding makes the counterintuitive prediction of hypergeneralization: there should be growing extrapolation beyond the trained workspace. Furthermore, nonmonotonic force patterns should be more difficult to learn than monotonic ones. We confirmed these predictions experimentally.

  16. Genome-wide identification and characterization of stress-associated protein (SAP gene family encoding A20/AN1 zinc-finger proteins in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Zhou Yong

    2018-01-01

    Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.

  17. Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence.

    Directory of Open Access Journals (Sweden)

    Chikara Kaito

    Full Text Available The F region downstream of the mecI gene in the SCCmec element in hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA contains two bidirectionally overlapping open reading frames (ORFs, the fudoh ORF and the psm-mec ORF. The psm-mec ORF encodes a cytolysin, phenol-soluble modulin (PSM-mec. Transformation of the F region into the Newman strain, which is a methicillin-sensitive S. aureus (MSSA strain, or into the MW2 (USA400 and FRP3757 (USA300 strains, which are community-acquired MRSA (CA-MRSA strains that lack the F region, attenuated their virulence in a mouse systemic infection model. Introducing the F region to these strains suppressed colony-spreading activity and PSMα production, and promoted biofilm formation. By producing mutations into the psm-mec ORF, we revealed that (i both the transcription and translation products of the psm-mec ORF suppressed colony-spreading activity and promoted biofilm formation; and (ii the transcription product of the psm-mec ORF, but not its translation product, decreased PSMα production. These findings suggest that both the psm-mec transcript, acting as a regulatory RNA, and the PSM-mec protein encoded by the gene on the mobile genetic element SCCmec regulate the virulence of Staphylococcus aureus.

  18. V123 Beam Synchronous Encoder Module

    International Nuclear Information System (INIS)

    Kerner, T.; Conkling, C. R.; Oerter, B.

    1999-01-01

    The V123 Synchronous Encoder Module transmits events to distributed trigger modules and embedded decoders around the RHIC rings where they are used to provide beam instrumentation triggers [1,2,3]. The RHIC beam synchronous event link hardware is mainly comprised of three VMEbus board designs, the central input modules (V201), and encoder modules (V123), and the distributed trigger modules (V124). Two beam synchronous links, one for each ring, are distributed via fiberoptic and fanned out via twisted wire pair cables. The V123 synchronizes with the RF system clock derived from the beam bucket frequency and a revolution fiducial pulse. The RF system clock is used to create the beam synchronous event link carrier and events are synchronized with the rotation fiducial. A low jitter RF clock is later recovered from this carrier by phase lock loops in the trigger modules. Prioritized hardware and software triggers fill up to 15 beam event code transmission slots per revolution while tracking the ramping RF acceleration frequency and storage frequency. The revolution fiducial event is always the first event transmitted which is used to synchronize the firing of the abort kicker and to locate the first bucket for decoders distributed about the ring

  19. Place field assembly distribution encodes preferred locations.

    Directory of Open Access Journals (Sweden)

    Omar Mamad

    2017-09-01

    Full Text Available The hippocampus is the main locus of episodic memory formation and the neurons there encode the spatial map of the environment. Hippocampal place cells represent location, but their role in the learning of preferential location remains unclear. The hippocampus may encode locations independently from the stimuli and events that are associated with these locations. We have discovered a unique population code for the experience-dependent value of the context. The degree of reward-driven navigation preference highly correlates with the spatial distribution of the place fields recorded in the CA1 region of the hippocampus. We show place field clustering towards rewarded locations. Optogenetic manipulation of the ventral tegmental area demonstrates that the experience-dependent place field assembly distribution is directed by tegmental dopaminergic activity. The ability of the place cells to remap parallels the acquisition of reward context. Our findings present key evidence that the hippocampal neurons are not merely mapping the static environment but also store the concurrent context reward value, enabling episodic memory for past experience to support future adaptive behavior.

  20. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  1. Negative base encoding in optical linear algebra processors

    Science.gov (United States)

    Perlee, C.; Casasent, D.

    1986-01-01

    In the digital multiplication by analog convolution algorithm, the bits of two encoded numbers are convolved to form the product of the two numbers in mixed binary representation; this output can be easily converted to binary. Attention is presently given to negative base encoding, treating base -2 initially, and then showing that the negative base system can be readily extended to any radix. In general, negative base encoding in optical linear algebra processors represents a more efficient technique than either sign magnitude or 2's complement encoding, when the additions of digitally encoded products are performed in parallel.

  2. On-line Vibration Diagnostics of the Optical Elements at BL-28 of the Photon Factory

    International Nuclear Information System (INIS)

    Maruyama, T.; Kashiwagi, T.; Kikuchi, T.; Toyoshima, A.; Kubota, M.; Ono, K.

    2007-01-01

    We have analyzed the data of encoders attached to optical elements and developed an on-line vibration diagnostics system of the monochromator. After eliminating the vibration source we have been able to improve the performance of the monochromator

  3. Genome-Wide Analyses of the NAC Transcription Factor Gene Family in Pepper (Capsicum annuum L.: Chromosome Location, Phylogeny, Structure, Expression Patterns, Cis-Elements in the Promoter, and Interaction Network

    Directory of Open Access Journals (Sweden)

    Weiping Diao

    2018-03-01

    Full Text Available The NAM, ATAF1/2, and CUC2 (NAC transcription factors form a large plant-specific gene family, which is involved in the regulation of tissue development in response to biotic and abiotic stress. To date, there have been no comprehensive studies investigating chromosomal location, gene structure, gene phylogeny, conserved motifs, or gene expression of NAC in pepper (Capsicum annuum L.. The recent release of the complete genome sequence of pepper allowed us to perform a genome-wide investigation of Capsicum annuum L. NAC (CaNAC proteins. In the present study, a comprehensive analysis of the CaNAC gene family in pepper was performed, and a total of 104 CaNAC genes were identified. Genome mapping analysis revealed that CaNAC genes were enriched on four chromosomes (chromosomes 1, 2, 3, and 6. In addition, phylogenetic analysis of the NAC domains from pepper, potato, Arabidopsis, and rice showed that CaNAC genes could be clustered into three groups (I, II, and III. Group III, which contained 24 CaNAC genes, was exclusive to the Solanaceae plant family. Gene structure and protein motif analyses showed that these genes were relatively conserved within each subgroup. The number of introns in CaNAC genes varied from 0 to 8, with 83 (78.9% of CaNAC genes containing two or less introns. Promoter analysis confirmed that CaNAC genes are involved in pepper growth, development, and biotic or abiotic stress responses. Further, the expression of 22 selected CaNAC genes in response to seven different biotic and abiotic stresses [salt, heat shock, drought, Phytophthora capsici, abscisic acid, salicylic acid (SA, and methyl jasmonate (MeJA] was evaluated by quantitative RT-PCR to determine their stress-related expression patterns. Several putative stress-responsive CaNAC genes, including CaNAC72 and CaNAC27, which are orthologs of the known stress-responsive Arabidopsis gene ANAC055 and potato gene StNAC30, respectively, were highly regulated by treatment with

  4. Targeted Memory Reactivation during Sleep Adaptively Promotes the Strengthening or Weakening of Overlapping Memories.

    Science.gov (United States)

    Oyarzún, Javiera P; Morís, Joaquín; Luque, David; de Diego-Balaguer, Ruth; Fuentemilla, Lluís

    2017-08-09

    System memory consolidation is conceptualized as an active process whereby newly encoded memory representations are strengthened through selective memory reactivation during sleep. However, our learning experience is highly overlapping in content (i.e., shares common elements), and memories of these events are organized in an intricate network of overlapping associated events. It remains to be explored whether and how selective memory reactivation during sleep has an impact on these overlapping memories acquired during awake time. Here, we test in a group of adult women and men the prediction that selective memory reactivation during sleep entails the reactivation of associated events and that this may lead the brain to adaptively regulate whether these associated memories are strengthened or pruned from memory networks on the basis of their relative associative strength with the shared element. Our findings demonstrate the existence of efficient regulatory neural mechanisms governing how complex memory networks are shaped during sleep as a function of their associative memory strength. SIGNIFICANCE STATEMENT Numerous studies have demonstrated that system memory consolidation is an active, selective, and sleep-dependent process in which only subsets of new memories become stabilized through their reactivation. However, the learning experience is highly overlapping in content and thus events are encoded in an intricate network of related memories. It remains to be explored whether and how memory reactivation has an impact on overlapping memories acquired during awake time. Here, we show that sleep memory reactivation promotes strengthening and weakening of overlapping memories based on their associative memory strength. These results suggest the existence of an efficient regulatory neural mechanism that avoids the formation of cluttered memory representation of multiple events and promotes stabilization of complex memory networks. Copyright © 2017 the authors 0270-6474/17/377748-11$15.00/0.

  5. Encoding circuit for transform coding of a picture signal and decoding circuit for encoding said signal

    NARCIS (Netherlands)

    1991-01-01

    Encoding circuit for transforming a picture signal into blocks of, for example, 8*8 coefficients, in which each block of coefficients is read motion-adaptively. In the case of motion within a sub-picture, the block of coefficients is read in such an order that the obtained series of coefficients

  6. Video encoder/decoder for encoding/decoding motion compensated images

    NARCIS (Netherlands)

    1996-01-01

    Video encoder and decoder, provided with a motion compensator for motion-compensated video coding or decoding in which a picture is coded or decoded in blocks in alternately horizontal and vertical steps. The motion compensator is provided with addressing means (160) and controlled multiplexers

  7. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  8. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  9. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem

    Czech Academy of Sciences Publication Activity Database

    Ernst, A.; Jekat, S. B.; Zielonka, S.; Mueller, B.; Neumann, U.; Ruping, B.; Twyman, R. M.; Krzyžánek, Vladislav; Pruefer, D.; Noll, G. A.

    2012-01-01

    Roč. 109, č. 28 (2012), E1980-E1989 ISSN 0027-8424 Institutional support: RVO:68081731 Keywords : photoassimilate transport * wound response * exudation * phloem protein 1 Subject RIV: CE - Biochemistry Impact factor: 9.737, year: 2012

  10. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

    2003-01-01

    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  11. Brain Circuits Encoding Reward from Pain Relief.

    Science.gov (United States)

    Navratilova, Edita; Atcherley, Christopher W; Porreca, Frank

    2015-11-01

    Relief from pain in humans is rewarding and pleasurable. Primary rewards, or reward-predictive cues, are encoded in brain reward/motivational circuits. While considerable advances have been made in our understanding of reward circuits underlying positive reinforcement, less is known about the circuits underlying the hedonic and reinforcing actions of pain relief. We review findings from electrophysiological, neuroimaging, and behavioral studies supporting the concept that the rewarding effect of pain relief requires opioid signaling in the anterior cingulate cortex (ACC), activation of midbrain dopamine neurons, and the release of dopamine in the nucleus accumbens (NAc). Understanding of circuits that govern the reward of pain relief may allow the discovery of more effective and satisfying therapies for patients with acute or chronic pain.

  12. Premotor and Motor Cortices Encode Reward.

    Directory of Open Access Journals (Sweden)

    Pavan Ramkumar

    Full Text Available Rewards associated with actions are critical for motivation and learning about the consequences of one's actions on the world. The motor cortices are involved in planning and executing movements, but it is unclear whether they encode reward over and above limb kinematics and dynamics. Here, we report a categorical reward signal in dorsal premotor (PMd and primary motor (M1 neurons that corresponds to an increase in firing rates when a trial was not rewarded regardless of whether or not a reward was expected. We show that this signal is unrelated to error magnitude, reward prediction error, or other task confounds such as reward consumption, return reach plan, or kinematic differences across rewarded and unrewarded trials. The availability of reward information in motor cortex is crucial for theories of reward-based learning and motivational influences on actions.

  13. Radiofrequency encoded angular-resolved light scattering

    DEFF Research Database (Denmark)

    Buckley, Brandon W.; Akbari, Najva; Diebold, Eric D.

    2015-01-01

    The sensitive, specific, and label-free classification of microscopic cells and organisms is one of the outstanding problems in biology. Today, instruments such as the flow cytometer use a combination of light scatter measurements at two distinct angles to infer the size and internal complexity...... of cells at rates of more than 10,000 per second. However, by examining the entire angular light scattering spectrum it is possible to classify cells with higher resolution and specificity. Current approaches to performing these angular spectrum measurements all have significant throughput limitations...... Encoded Angular-resolved Light Scattering (REALS), this technique multiplexes angular light scattering in the radiofrequency domain, such that a single photodetector captures the entire scattering spectrum from a particle over approximately 100 discrete incident angles on a single shot basis. As a proof...

  14. Endogenous opioids encode relative taste preference.

    Science.gov (United States)

    Taha, Sharif A; Norsted, Ebba; Lee, Lillian S; Lang, Penelope D; Lee, Brian S; Woolley, Joshua D; Fields, Howard L

    2006-08-01

    Endogenous opioid signaling contributes to the neural control of food intake. Opioid signaling is thought to regulate palatability, the reward value of a food item as determined by orosensory cues such as taste and texture. The reward value of a food reflects not only these sensory properties but also the relative value of competing food choices. In the present experiment, we used a consummatory contrast paradigm to manipulate the relative value of a sucrose solution for two groups of rats. Systemic injection of the nonspecific opioid antagonist naltrexone suppressed sucrose intake; for both groups, however, this suppression was selective, occurring only for the relatively more valuable sucrose solution. Our results indicate that endogenous opioid signaling contributes to the encoding of relative reward value.

  15. Measurement strategy for spatially encoded photonic qubits

    International Nuclear Information System (INIS)

    Solis-Prosser, M. A.; Neves, L.

    2010-01-01

    We propose a measurement strategy which can, probabilistically, reproduce the statistics of any observable for spatially encoded photonic qubits. It comprises the implementation of a two-outcome positive operator-valued measure followed by a detection in a fixed transverse position, making the displacement of the detection system unnecessary, unlike previous methods. This strategy generalizes a scheme recently demonstrated by one of us and co-workers, restricted to measurement of observables with equatorial eigenvectors only. The method presented here can be implemented with the current technology of programmable multipixel liquid-crystal displays. In addition, it can be straightforwardly extended to high-dimensional qudits and may be a valuable tool in optical implementations of quantum information protocols with spatial qubits and qudits.

  16. Efficient Text Encryption and Hiding with Double-Random Phase-Encoding

    Directory of Open Access Journals (Sweden)

    Mohammad S. Alam

    2012-10-01

    Full Text Available In this paper, a double-random phase-encoding technique-based text encryption and hiding method is proposed. First, the secret text is transformed into a 2-dimensional array and the higher bits of the elements in the transformed array are used to store the bit stream of the secret text, while the lower bits are filled with specific values. Then, the transformed array is encoded with double-random phase-encoding technique. Finally, the encoded array is superimposed on an expanded host image to obtain the image embedded with hidden data. The performance of the proposed technique, including the hiding capacity, the recovery accuracy of the secret text, and the quality of the image embedded with hidden data, is tested via analytical modeling and test data stream. Experimental results show that the secret text can be recovered either accurately or almost accurately, while maintaining the quality of the host image embedded with hidden data by properly selecting the method of transforming the secret text into an array and the superimposition coefficient. By using optical information processing techniques, the proposed method has been found to significantly improve the security of text information transmission, while ensuring hiding capacity at a prescribed level.

  17. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  18. MPEG-1 low-cost encoder solution

    Science.gov (United States)

    Grueger, Klaus; Schirrmeister, Frank; Filor, Lutz; von Reventlow, Christian; Schneider, Ulrich; Mueller, Gerriet; Sefzik, Nicolai; Fiedrich, Sven

    1995-02-01

    A solution for real-time compression of digital YCRCB video data to an MPEG-1 video data stream has been developed. As an additional option, motion JPEG and video telephone streams (H.261) can be generated. For MPEG-1, up to two bidirectional predicted images are supported. The required computational power for motion estimation and DCT/IDCT, memory size and memory bandwidth have been the main challenges. The design uses fast-page-mode memory accesses and requires only one single 80 ns EDO-DRAM with 256 X 16 organization for video encoding. This can be achieved only by using adequate access and coding strategies. The architecture consists of an input processing and filter unit, a memory interface, a motion estimation unit, a motion compensation unit, a DCT unit, a quantization control, a VLC unit and a bus interface. For using the available memory bandwidth by the processing tasks, a fixed schedule for memory accesses has been applied, that can be interrupted for asynchronous events. The motion estimation unit implements a highly sophisticated hierarchical search strategy based on block matching. The DCT unit uses a separated fast-DCT flowgraph realized by a switchable hardware unit for both DCT and IDCT operation. By appropriate multiplexing, only one multiplier is required for: DCT, quantization, inverse quantization, and IDCT. The VLC unit generates the video-stream up to the video sequence layer and is directly coupled with an intelligent bus-interface. Thus, the assembly of video, audio and system data can easily be performed by the host computer. Having a relatively low complexity and only small requirements for DRAM circuits, the developed solution can be applied to low-cost encoding products for consumer electronics.

  19. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  20. Comparative analysis of regulatory elements in different germin-like ...

    African Journals Online (AJOL)

    It was observed that these promoters have important regulatory elements, which are involved in various important functions. These elements have been compared on the basis of location, copy number, and distributed on positive and negative strands. It was also observed that some of these elements are common and ...

  1. Modular verification of chemical reaction network encodings via serializability analysis

    Science.gov (United States)

    Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

    2015-01-01

    Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

  2. Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

    Science.gov (United States)

    Salton, S R; Fischberg, D J; Dong, K W

    1991-05-01

    Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

  3. 3D Multisource Full‐Waveform Inversion using Dynamic Random Phase Encoding

    KAUST Repository

    Boonyasiriwat, Chaiwoot

    2010-10-17

    We have developed a multisource full‐waveform inversion algorithm using a dynamic phase encoding strategy with dual‐randomization—both the position and polarity of simultaneous sources are randomized and changed every iteration. The dynamic dual‐randomization is used to promote the destructive interference of crosstalk noise resulting from blending a large number of common shot gathers into a supergather. We compare our multisource algorithm with various algorithms in a numerical experiment using the 3D SEG/EAGE overthrust model and show that our algorithm provides a higher‐quality velocity tomogram than the other methods that use only monorandomization. This suggests that increasing the degree of randomness in phase encoding should improve the quality of the inversion result.

  4. TRYPTOPHAN PROMOTES CHARITABLE DONATING

    Directory of Open Access Journals (Sweden)

    Laura eSteenbergen

    2014-12-01

    Full Text Available The link between serotonin (5-HT and one of the most important elements of prosocial behavior, charity, has remained largely uninvestigated. In the present study, we tested whether charitable donating can be promoted by administering the food supplement L-Tryptophan (TRP, the biochemical precursor of 5-HT. Participants were compared with respect to the amount of money they donated when given the opportunity to make a charitable donation. As expected, compared to a neutral placebo, TRP appears to increase the participants’ willingness to donate money to a charity. This result supports the idea that the food we eat may act as a cognitive enhancer modulating the way we think and perceive the world and others.

  5. Analysis of the pelE promoter in Erwinia chrysanthemi EC16.

    Science.gov (United States)

    Gold, S; Nishio, S; Tsuyumu, S; Keen, N T

    1992-01-01

    The pelE gene of Erwinia chrysanthemi strain EC16 encodes an extracellular pectate lyase protein that is important in virulence on plants. Control of pelE expression is complex, because the gene is regulated by catabolite repression, substrate induction, and growth-phase inhibition. A Tn7-lux reporter gene system was employed to define DNA sequences comprising the pelE promoter. When EC16 cells were grown on medium containing sodium polypectate, pelE transcriptional start sites were observed only at 95 and 96 bases upstream of the translational start site. However, DNA sequences required for pelE expression were also shown by deletion analysis to reside between 196 and 215 base pairs upstream of the translational start site. In addition to these upstream elements, two putative operator sequences that interact with negative regulatory factors occurred downstream of the transcriptional start. Finally, deletion of three bases from a putative catabolite gene activator protein binding site in the pelE promoter eliminated activity. The data demonstrate that the pelE promoter is complex and suggest that it interacts with several regulatory proteins.

  6. [Health promotion in primary care: study based on the Paulo Freire method].

    Science.gov (United States)

    Heidemann, Ivonete Teresinha Schülter Buss; Wosny, Antonio de Miranda; Boehs, Astrid Eggert

    2014-08-01

    The scope of this study is to analyze the implementation of health promotion actions in the working process of the Family Health Teams of a city in the state of Santa Catarina. It involves research adopting a qualitative approach linked to the methodological benchmark of Paulo Freire, consisting of three dialectic moments: thematic investigation; encoding and decoding; critical revelation. Fifteen Culture Circles were conducted, covering five district health units, with the participation of 70 professionals. Each meeting was scheduled to last two hours with an average attendance of thirteen participants of the Family Health teams. The research revealed that there are limitations to the implementation of health promotion as a key element of participatory action together with the community. It also highlighted the importance of interdisciplinarity and intersectorality between workers and the city, state and federal manager. The commitment to the principles of the Unified Health System (SUS) and health promotion also presents itself as a challenge to improve the quality of life of the population.

  7. Estradiol represses Insulin-like 3 expression and promoter activity in MA-10 Leydig cells

    International Nuclear Information System (INIS)

    Lague, Eric; Tremblay, Jacques J.

    2009-01-01

    There are increasing evidence in the literature reporting the detrimental effects of endocrine disruptors on the development and function of the male reproductive system. One example is cryptorchidism, or undescended testis, caused by exposure to excessive estrogens. Estrogens, acting through the estrogen receptor α (ERα), have been shown to repress expression of the gene encoding insulin-like 3 (INSL3), a small peptide produced by testicular Leydig cells that is essential for normal testis descent. The molecular mechanism of estrogen/ER action on Insl3 expression, however, remains poorly understood. Here we report estradiol (E 2 ) represses Insl3 mRNA levels in MA-10 cells, a Leydig cell line model. We also found that E 2 represses the activity of the human and mouse Insl3 promoter in these cells. The E 2 -responsive region of the human INSL3 promoter was located to the proximal INSL3 promoter. This region does not contain a consensus estrogen response element indicating an indirect mechanism of action. In agreement with this, we found that E 2 -responsiveness was lost when two previously characterized binding sites for the nuclear receptors NUR77 and SF1 were mutated. Finally we show that the E 2 repressive effect could be overcome by cotreatment with testosterone, a positive regulator of Insl3 transcription. Collectively our data provide important new insights into the molecular mechanism of estrogen action in Insl3 transcription in Leydig cells

  8. Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

    Science.gov (United States)

    Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

    2012-09-01

    It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method.

  9. Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

    International Nuclear Information System (INIS)

    Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

    2012-01-01

    It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method. (paper)

  10. Ontological Encoding of GeoSciML and INSPIRE geological standard vocabularies and schemas: application to geological mapping

    Science.gov (United States)

    Lombardo, Vincenzo; Piana, Fabrizio; Mimmo, Dario; Fubelli, Giandomenico; Giardino, Marco

    2016-04-01

    Encoding of geologic knowledge in formal languages is an ambitious task, aiming at the interoperability and organic representation of geological data, and semantic characterization of geologic maps. Initiatives such as GeoScience Markup Language (last version is GeoSciML 4, 2015[1]) and INSPIRE "Data Specification on Geology" (an operative simplification of GeoSciML, last version is 3.0 rc3, 2013[2]), as well as the recent terminological shepherding of the Geoscience Terminology Working Group (GTWG[3]) have been promoting information exchange of the geologic knowledge. There have also been limited attempts to encode the knowledge in a machine-readable format, especially in the lithology domain (see e.g. the CGI_Lithology ontology[4]), but a comprehensive ontological model that connect the several knowledge sources is still lacking. This presentation concerns the "OntoGeonous" initiative, which aims at encoding the geologic knowledge, as expressed through the standard vocabularies, schemas and data models mentioned above, through a number of interlinked computational ontologies, based on the languages of the Semantic Web and the paradigm of Linked Open Data. The initiative proceeds in parallel with a concrete case study, concerning the setting up of a synthetic digital geological map of the Piemonte region (NW Italy), named "GEOPiemonteMap" (developed by the CNR Institute of Geosciences and Earth Resources, CNR IGG, Torino), where the description and classification of GeologicUnits has been supported by the modeling and implementation of the ontologies. We have devised a tripartite ontological model called OntoGeonous that consists of: 1) an ontology of the geologic features (in particular, GeologicUnit, GeomorphologicFeature, and GeologicStructure[5], modeled from the definitions and UML schemata of CGI vocabularies[6], GeoScienceML and INSPIRE, and aligned with the Planetary realm of NASA SWEET ontology[7]), 2) an ontology of the Earth materials (as defined by the

  11. Combining Fourier phase encoding and broadband inversion toward J-edited spectra

    Science.gov (United States)

    Lin, Yulan; Guan, Quanshuai; Su, Jianwei; Chen, Zhong

    2018-06-01

    Nuclear magnetic resonance (NMR) spectra are often utilized for gathering accurate information relevant to molecular structures and composition assignments. In this study, we develop a homonuclear encoding approach based on imparting a discrete phase modulation of the targeted cross peaks, and combine it with a pure shift experiments (PSYCHE) based J-modulated scheme, providing simple 2D J-edited spectra for accurate measurement of scalar coupling networks. Chemical shifts and J coupling constants of protons coupled to the specific protons are demonstrated along the F2 and F1 dimensions, respectively. Polychromatic pulses by Fourier phase encoding were performed to simultaneously detect several coupling networks. Proton-proton scalar couplings are chosen by a polychromatic pulse and a PSYCHE element. Axis peaks and unwanted couplings are complete eradicated by incorporating a selective COSY block as a preparation period. The theoretical principles and the signal processing procedure are laid out, and experimental observations are rationalized on the basis of theoretical analyses.

  12. Hiding a Covert Digital Image by Assembling the RSA Encryption Method and the Binary Encoding Method

    Directory of Open Access Journals (Sweden)

    Kuang Tsan Lin

    2014-01-01

    Full Text Available The Rivest-Shamir-Adleman (RSA encryption method and the binary encoding method are assembled to form a hybrid hiding method to hide a covert digital image into a dot-matrix holographic image. First, the RSA encryption method is used to transform the covert image to form a RSA encryption data string. Then, all the elements of the RSA encryption data string are transferred into binary data. Finally, the binary data are encoded into the dot-matrix holographic image. The pixels of the dot-matrix holographic image contain seven groups of codes used for reconstructing the covert image. The seven groups of codes are identification codes, covert-image dimension codes, covert-image graylevel codes, pre-RSA bit number codes, RSA key codes, post-RSA bit number codes, and information codes. The reconstructed covert image derived from the dot-matrix holographic image and the original covert image are exactly the same.

  13. General-purpose stepping motor-encoder positioning subsystem with standard asynchronous serial-line interface

    International Nuclear Information System (INIS)

    Stubblefield, F.W.; Alberi, J.L.

    1982-01-01

    A general-purpose mechanical positioning subsystem for open-loop control of experiment devices which have their positions established and read out by stepping motor-encoder combinations has been developed. The subsystem is to be used mainly for experiments to be conducted at the National Synchrotron Light Source at Brookhaven National Laboratory. The subsystem unit has been designed to be compatible with a wide variety of stepping motor and encoder types. The unit may be operated by any device capable of driving a standard RS-232-C asynchronous serial communication line. An informal survey has shown that several experiments at the Light Source will use one particular type of computer, operating system, and programming language. Accordingly, a library of subroutines compatible with this combination of computer system elements has been written to facilitate driving the positioning subsystem unit

  14. System biology and the project Encode

    Directory of Open Access Journals (Sweden)

    M. Yu. Obolenskaya

    2014-08-01

    Full Text Available The goal of this review is to give an incipient knowledge on the background of system biology, the premises to its assignment as a new branch of biology, its principles, methodology and its great achievements in identification of functional elements of human genome and regulation of their concordant­ and differential activity. The short characteristics of functional elements including the protein-coding sequences and those coding noncoding RNAs, the DNAse 1 hypersensitivity sites and methylated CpG islets, modified histones and specific 3D structure of chromatin, are represented. The topology of transcription factors network with its main motifs, hierar­chy, combination and association of transcription factors and their allelic specificity are highlighted­.

  15. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    International Nuclear Information System (INIS)

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh; Khalili, Kamel; Safak, Mahmut

    2006-01-01

    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  16. Source-constrained retrieval influences the encoding of new information.

    Science.gov (United States)

    Danckert, Stacey L; MacLeod, Colin M; Fernandes, Myra A

    2011-11-01

    Jacoby, Shimizu, Daniels, and Rhodes (Psychonomic Bulletin & Review, 12, 852-857, 2005) showed that new words presented as foils among a list of old words that had been deeply encoded were themselves subsequently better recognized than new words presented as foils among a list of old words that had been shallowly encoded. In Experiment 1, by substituting a deep-versus-shallow imagery manipulation for the levels-of-processing manipulation, we demonstrated that the effect is robust and that it generalizes, also occurring with a different type of encoding. In Experiment 2, we provided more direct evidence for context-related encoding during tests of deeply encoded words, showing enhanced priming for foils presented among deeply encoded targets when participants made the same deep-encoding judgments on those items as had been made on the targets during study. In Experiment 3, we established that the findings from Experiment 2 are restricted to this specific deep judgment task and are not a general consequence of these foils being associated with deeply encoded items. These findings provide support for the source-constrained retrieval hypothesis of Jacoby, Shimizu, Daniels, and Rhodes: New information can be influenced by how surrounding items are encoded and retrieved, as long as the surrounding items recruit a coherent mode of processing.

  17. Exploring the influence of encoding format on subsequent memory.

    Science.gov (United States)

    Turney, Indira C; Dennis, Nancy A; Maillet, David; Rajah, M Natasha

    2017-05-01

    Distinctive encoding is greatly influenced by gist-based processes and has been shown to suffer when highly similar items are presented in close succession. Thus, elucidating the mechanisms underlying how presentation format affects gist processing is essential in determining the factors that influence these encoding processes. The current study utilised multivariate partial least squares (PLS) analysis to identify encoding networks directly associated with retrieval performance in a blocked and intermixed presentation condition. Subsequent memory analysis for successfully encoded items indicated no significant differences between reaction time and retrieval performance and presentation format. Despite no significant behavioural differences, behaviour PLS revealed differences in brain-behaviour correlations and mean condition activity in brain regions associated with gist-based vs. distinctive encoding. Specifically, the intermixed format encouraged more distinctive encoding, showing increased activation of regions associated with strategy use and visual processing (e.g., frontal and visual cortices, respectively). Alternatively, the blocked format exhibited increased gist-based processes, accompanied by increased activity in the right inferior frontal gyrus. Together, results suggest that the sequence that information is presented during encoding affects the degree to which distinctive encoding is engaged. These findings extend our understanding of the Fuzzy Trace Theory and the role of presentation format on encoding processes.

  18. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  19. Human cytomegalovirus-encoded miR-US4-1 promotes cell ...

    Indian Academy of Sciences (India)

    2016-04-05

    Apr 5, 2016 ... 3′) for hcmv-miR-US4-1 was designed according to the. miRNA sequence (5′- ... the hcmv-miR-US4-1 hybrid primer and polyA tails were. 184. Yaozhong ... eight hours later, luciferase activities were measured us- ing Dual ..... resolution profiling and analysis of viral and host small RNAs during human ...

  20. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  1. Noticing relevant problem features: activating prior knowledge affects problem solving by guiding encoding

    Science.gov (United States)

    Crooks, Noelle M.; Alibali, Martha W.

    2013-01-01

    This study investigated whether activating elements of prior knowledge can influence how problem solvers encode and solve simple mathematical equivalence problems (e.g., 3 + 4 + 5 = 3 + __). Past work has shown that such problems are difficult for elementary school students (McNeil and Alibali, 2000). One possible reason is that children's experiences in math classes may encourage them to think about equations in ways that are ultimately detrimental. Specifically, children learn a set of patterns that are potentially problematic (McNeil and Alibali, 2005a): the perceptual pattern that all equations follow an “operations = answer” format, the conceptual pattern that the equal sign means “calculate the total”, and the procedural pattern that the correct way to solve an equation is to perform all of the given operations on all of the given numbers. Upon viewing an equivalence problem, knowledge of these patterns may be reactivated, leading to incorrect problem solving. We hypothesized that these patterns may negatively affect problem solving by influencing what people encode about a problem. To test this hypothesis in children would require strengthening their misconceptions, and this could be detrimental to their mathematical development. Therefore, we tested this hypothesis in undergraduate participants. Participants completed either control tasks or tasks that activated their knowledge of the three patterns, and were then asked to reconstruct and solve a set of equivalence problems. Participants in the knowledge activation condition encoded the problems less well than control participants. They also made more errors in solving the problems, and their errors resembled the errors children make when solving equivalence problems. Moreover, encoding performance mediated the effect of knowledge activation on equivalence problem solving. Thus, one way in which experience may affect equivalence problem solving is by influencing what students encode about the

  2. Temporal encoding in a nervous system.

    Directory of Open Access Journals (Sweden)

    Zane N Aldworth

    2011-05-01

    Full Text Available We examined the extent to which temporal encoding may be implemented by single neurons in the cercal sensory system of the house cricket Acheta domesticus. We found that these neurons exhibit a greater-than-expected coding capacity, due in part to an increased precision in brief patterns of action potentials. We developed linear and non-linear models for decoding the activity of these neurons. We found that the stimuli associated with short-interval patterns of spikes (ISIs of 8 ms or less could be predicted better by second-order models as compared to linear models. Finally, we characterized the difference between these linear and second-order models in a low-dimensional subspace, and showed that modification of the linear models along only a few dimensions improved their predictive power to parity with the second order models. Together these results show that single neurons are capable of using temporal patterns of spikes as fundamental symbols in their neural code, and that they communicate specific stimulus distributions to subsequent neural structures.

  3. Chaotic digital communication by encoding initial conditions.

    Science.gov (United States)

    Xiaofeng, Gong; Xingang, Wang; Meng, Zhan; Lai, C H

    2004-06-01

    We investigate the possibility to improve the noise performance of a chaotic digital communication scheme by utilizing further dynamical information. We show that by encoding the initial information of the chaotic carrier according to the transmitting bits, extra redundance can be introduced into the segments of chaotic signals corresponding to the consecutive bits. Such redundant information can be exploited effectively at the receiver end to improve the noise performance of the system. Compared to other methods (e.g., differential chaos shift keying), straightforward application of the proposed modulation/demodulation scheme already provides significant performance gain in the low signal-to-noise ratio (SNR) region. Furthermore, maximum likelihood precleaning procedure based on the Viterbi algorithm can be applied before the demodulation step to overcome the performance degradation in the high SNR region. The study indicates that it is possible to improve the noise performance of the chaotic digital communication scheme if further dynamics information is added to the system. (c) 2004 American Institute of Physics

  4. Dynamical encoding of looming, receding, and focussing

    Science.gov (United States)

    Longtin, Andre; Clarke, Stephen Elisha; Maler, Leonard; CenterNeural Dynamics Collaboration

    This talk will discuss a non-conventional neural coding task that may apply more broadly to many senses in higher vertebrates. We ask whether and how a non-visual sensory system can focus on an object. We present recent experimental and modeling work that shows how the early sensory circuitry of electric sense can perform such neuronal focusing that is manifested behaviorally. This sense is the main one used by weakly electric fish to navigate, locate prey and communicate in the murky waters of their natural habitat. We show that there is a distance at which the Fisher information of a neuron's response to a looming and receding object is maximized, and that this distance corresponds to a behaviorally relevant one chosen by these animals. Strikingly, this maximum occurs at a bifurcation between tonic firing and bursting. We further discuss how the invariance of this distance to signal attributes can arise, a process that first involves power-law spike frequency adaptation. The talk will also highlight the importance of expanding the classic dual neural encoding of contrast using ON and OFF cells in the context of looming and receding stimuli. The authors acknowledge support from CIHR and NSERC.

  5. CIITA promoter I CARD-deficient mice express functional MHC class II genes in myeloid and lymphoid compartments.

    Science.gov (United States)

    Zinzow-Kramer, W M; Long, A B; Youngblood, B A; Rosenthal, K M; Butler, R; Mohammed, A-U-R; Skountzou, I; Ahmed, R; Evavold, B D; Boss, J M

    2012-06-01

    Three distinct promoters control the master regulator of major histocompatibility complex (MHC) class II expression, class II transactivator (CIITA), in a cell type-specific manner. Promoter I (pI) CIITA, expressed primarily by dendritic cells (DCs) and macrophages, expresses a unique isoform that contains a caspase-recruitment domain (CARD). The activity and function of this isoform are not understood, but are believed to enhance the function of CIITA in antigen-presenting cells. To determine whether isoform I of CIITA has specific functions, CIITA mutant mice were created in which isoform I was replaced with isoform III sequences. Mice in which pI and the CARD-encoding exon were deleted were also created. No defect in the formation of CD4 T cells, the ability to respond to a model antigen or bacterial or viral challenge was observed in mice lacking CIITA isoform I. Although CIITA and MHC-II expression was decreased in splenic DCs, pI knockout animals expressed CIITA from downstream promoters, suggesting that control of pI activity is mediated by unknown distal elements that could act at pIII, the B-cell promoter. Thus, no critical function is linked to the CARD domain of CIITA isoform I with respect to basic immune system development, function and challenge.

  6. Beyond initial encoding: Measures of the post-encoding status of memory traces predict long-term recall in infancy

    OpenAIRE

    Pathman, Thanujeni; Bauer, Patricia J.

    2012-01-01

    The first years of life are witness to rapid changes in long-term recall ability. In the present research, we contributed to explanation of the changes by testing the absolute and relative contributions to long-term recall of encoding and post-encoding processes. Using elicited imitation, we sampled the status of 16-, 20-, and 24-month-old infants’ memory representations at various time points after experience of events. In Experiment 1, infants were tested immediately, 1 week after encoding,...

  7. Stress as a mnemonic filter: Interactions between medial temporal lobe encoding processes and post-encoding stress.

    Science.gov (United States)

    Ritchey, Maureen; McCullough, Andrew M; Ranganath, Charan; Yonelinas, Andrew P

    2017-01-01

    Acute stress has been shown to modulate memory for recently learned information, an effect attributed to the influence of stress hormones on medial temporal lobe (MTL) consolidation processes. However, little is known about which memories will be affected when stress follows encoding. One possibility is that stress interacts with encoding processes to selectively protect memories that had elicited responses in the hippocampus and amygdala, two MTL structures important for memory formation. There is limited evidence for interactions between encoding processes and consolidation effects in humans, but recent studies of consolidation in rodents have emphasized the importance of encoding "tags" for determining the impact of consolidation manipulations on memory. Here, we used functional magnetic resonance imaging in humans to test the hypothesis that the effects of post-encoding stress depend on MTL processes observed during encoding. We found that changes in stress hormone levels were associated with an increase in the contingency of memory outcomes on hippocampal and amygdala encoding responses. That is, for participants showing high cortisol reactivity, memories became more dependent on MTL activity observed during encoding, thereby shifting the distribution of recollected events toward those that had elicited relatively high activation. Surprisingly, this effect was generally larger for neutral, compared to emotionally negative, memories. The results suggest that stress does not uniformly enhance memory, but instead selectively preserves memories tagged during encoding, effectively acting as mnemonic filter. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Chemistry of the elements

    International Nuclear Information System (INIS)

    Greenwood, N.N.; Earnshaw, A.

    1984-01-01

    This textbook presents an account of the chemistry of the elements for both undergraduate and postgraduate students. It covers not only the 'inorganic' chemistry of the elements, but also analytical, theoretical, industrial, organometallic;, bio-inorganic and other areas of chemistry which apply. The following elements of special nuclear interest are included: Rb, Cs, Fr, Sr, Ba, Ra, Po, At, Rn, Sc, Y, Zr, Hf, V, Nb, Ta, Mo, Tc, Ru, the Lanthanide Elements, the Actinide Elements. (U.K.)

  9. Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

    Science.gov (United States)

    Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

    2002-03-13

    Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

  10. INDUSTRIAL DESIGN ELEMENTS IN MARKETING

    Directory of Open Access Journals (Sweden)

    TOCARIU Liliana

    2015-06-01

    Full Text Available Industrial design represents an important 20th century phenomenon, which contributed to the spectacular development of human society. There are a lot of domains in which the insertion of the industrial design methods and theories is extremely necessary, becoming common practice. Marketing uses industrial design elements in order to draw up advertisements for products, to develop logos or packaging with all its attached factors, to organise promotional sales with the view of penetrating a certain market or of appealing to a large number of consumers.

  11. Encoding and Decoding Models in Cognitive Electrophysiology

    Directory of Open Access Journals (Sweden)

    Christopher R. Holdgraf

    2017-09-01

    Full Text Available Cognitive neuroscience has seen rapid growth in the size and complexity of data recorded from the human brain as well as in the computational tools available to analyze this data. This data explosion has resulted in an increased use of multivariate, model-based methods for asking neuroscience questions, allowing scientists to investigate multiple hypotheses with a single dataset, to use complex, time-varying stimuli, and to study the human brain under more naturalistic conditions. These tools come in the form of “Encoding” models, in which stimulus features are used to model brain activity, and “Decoding” models, in which neural features are used to generated a stimulus output. Here we review the current state of encoding and decoding models in cognitive electrophysiology and provide a practical guide toward conducting experiments and analyses in this emerging field. Our examples focus on using linear models in the study of human language and audition. We show how to calculate auditory receptive fields from natural sounds as well as how to decode neural recordings to predict speech. The paper aims to be a useful tutorial to these approaches, and a practical introduction to using machine learning and applied statistics to build models of neural activity. The data analytic approaches we discuss may also be applied to other sensory modalities, motor systems, and cognitive systems, and we cover some examples in these areas. In addition, a collection of Jupyter notebooks is publicly available as a complement to the material covered in this paper, providing code examples and tutorials for predictive modeling in python. The aim is to provide a practical understanding of predictive modeling of human brain data and to propose best-practices in conducting these analyses.

  12. Stereoscopic radiographic images with gamma source encoding

    International Nuclear Information System (INIS)

    Strocovsky, S.G.; Otero, D

    2012-01-01

    Conventional radiography with X-ray tube has several drawbacks, as the compromise between the size of the focal spot and the fluence. The finite dimensions of the focal spot impose a limit to the spatial resolution. Gamma radiography uses gamma-ray sources which surpass in size, portability and simplicity to X-ray tubes. However, its low intrinsic fluence forces to use extended sources that also degrade the spatial resolution. In this work, we show the principles of a new radiographic technique that overcomes the limitations associated with the finite dimensions of X-ray sources, and that offers additional benefits to conventional techniques. The new technique called coding source imaging (CSI), is based on the use of extended sources, edge-encoding of radiation and differential detection. The mathematical principles and the method of images reconstruction with the new proposed technique are explained in the present work. Analytical calculations were made to determine the maximum spatial resolution and the variables on which it depends. The CSI technique was tested by means of Monte Carlo simulations with sets of spherical objects. We show that CSI has stereoscopic capabilities and it can resolve objects smaller than the source size. The CSI decoding algorithm reconstructs simultaneously four different projections from the same object, while conventional radiography produces only one projection per acquisition. Projections are located in separate image fields on the detector plane. Our results show it is possible to apply an extremely simple radiographic technique with extended sources, and get 3D information of the attenuation coefficient distribution for simple geometry objects in a single acquisition. The results are promising enough to evaluate the possibility of future research with more complex objects typical of medical diagnostic radiography and industrial gamma radiography (author)

  13. Using Publicity As an Element of the Promotion Mix.

    Science.gov (United States)

    Henderson, Roy D.

    The report describes procedures for teaching and administering a one-week course in publicity in a Principals of Marketing course at the University of Wisconsin-Stout. Emphasis is on helping college students develop communication skills. A major objective is to help students be aware of the public's general lack of understanding of the free…

  14. The role of depth of encoding in attentional capture

    NARCIS (Netherlands)

    Sasin, Edyta; Nieuwenstein, Mark; Johnson, Addie

    2015-01-01

    The aim of the current study was to examine whether depth of encoding influences attentional capture by recently attended objects. In Experiment 1, participants first had to judge whether a word referred to a living or a nonliving thing (deep encoding condition) or whether the word was written in

  15. Encoding Effects on First-Graders' Use of Manipulatives

    Science.gov (United States)

    Osana, Helena P.; Przednowek, Katarzyna; Cooperman, Allyson; Adrien, Emmanuelle

    2018-01-01

    The effects of prior encodings of manipulatives (red and blue plastic chips) on children's ability to use them as representations of quantity were tested. First graders (N = 73) were assigned to four conditions in which the encoding of plastic chips was experimentally manipulated. All children then participated in an addition activity that relied…

  16. The Contribution of Encoding and Retrieval Processes to Proactive Interference

    Science.gov (United States)

    Kliegl, Oliver; Pastötter, Bernhard; Bäuml, Karl-Heinz T.

    2015-01-01

    Proactive interference (PI) refers to the finding that memory for recently studied (target) material can be impaired by the prior study of other (nontarget) material. Previous accounts of PI differed in whether they attributed PI to impaired retrieval or impaired encoding. Here, we suggest an integrated encoding-retrieval account, which assigns a…

  17. Evaluation of color encodings for high dynamic range pixels

    Science.gov (United States)

    Boitard, Ronan; Mantiuk, Rafal K.; Pouli, Tania

    2015-03-01

    Traditional Low Dynamic Range (LDR) color spaces encode a small fraction of the visible color gamut, which does not encompass the range of colors produced on upcoming High Dynamic Range (HDR) displays. Future imaging systems will require encoding much wider color gamut and luminance range. Such wide color gamut can be represented using floating point HDR pixel values but those are inefficient to encode. They also lack perceptual uniformity of the luminance and color distribution, which is provided (in approximation) by most LDR color spaces. Therefore, there is a need to devise an efficient, perceptually uniform and integer valued representation for high dynamic range pixel values. In this paper we evaluate several methods for encoding colour HDR pixel values, in particular for use in image and video compression. Unlike other studies we test both luminance and color difference encoding in a rigorous 4AFC threshold experiments to determine the minimum bit-depth required. Results show that the Perceptual Quantizer (PQ) encoding provides the best perceptual uniformity in the considered luminance range, however the gain in bit-depth is rather modest. More significant difference can be observed between color difference encoding schemes, from which YDuDv encoding seems to be the most efficient.

  18. Interaction Between Encoding and Retrieval Operations in Cued Recall

    Science.gov (United States)

    Fisher, Ronald P.; Craik, Fergus I. M.

    1977-01-01

    Three experiments are described in which the qualitative nature of memorial processing was manipulated at both input (encoding) and output (retrieval). As in earlier research, it was found that retention levels were highest when the same type of information was used as a retrieval cue. Concludes that the notions of encoding specificity and depth…

  19. On The Designed And Constructed Feedback Shift-Register Encoder

    African Journals Online (AJOL)

    An encoder capable of cyclical shifting of data, and which can therefore be used for Bose-Chaudhuri and Hocquenghem (BCH) coding, has been designed and constructed using discrete components. It comprises basically four bistable multivibrators and an exclusive-OR device. On completion, the encoder performed ...

  20. Distinctiveness of Encoding and Memory for Learning Tasks.

    Science.gov (United States)

    Glover, John A.; And Others

    1982-01-01

    A distinctiveness of encoding hypothesis, as applied to the facilitative effects that higher order objectives have on readers' prose recall, was evaluated in three experiments. Results suggest that distinctiveness of encoding may offer a theoretical basis for the effects of adjunct aids as well as a guide to their construction. (Author/GK)

  1. Decoding and Encoding Facial Expressions in Preschool-Age Children.

    Science.gov (United States)

    Zuckerman, Miron; Przewuzman, Sylvia J.

    1979-01-01

    Preschool-age children drew, decoded, and encoded facial expressions depicting five different emotions. Accuracy of drawing, decoding and encoding each of the five emotions was consistent across the three tasks; decoding ability was correlated with drawing ability among female subjects, but neither of these abilities was correlated with encoding…

  2. On The Designed And Constructed Feedback Shift-Register Encoder

    African Journals Online (AJOL)

    Information transmission in noisy channels can be achieved with vanishingly small probability of error by proper coding of the information as long as the encoding rate is less than the channel capacity. An encoder capable of cyclical shifting of data, and which can therefore be used for Bose-Chaudhuri and Hocquenghem ...

  3. Structured RNAs in the ENCODE selected regions of the human genome

    DEFF Research Database (Denmark)

    Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O

    2007-01-01

    Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...

  4. A SSVEP Stimuli Encoding Method Using Trinary Frequency-Shift Keying Encoded SSVEP (TFSK-SSVEP

    Directory of Open Access Journals (Sweden)

    Xing Zhao

    2017-06-01

    Full Text Available SSVEP is a kind of BCI technology with advantage of high information transfer rate. However, due to its nature, frequencies could be used as stimuli are scarce. To solve such problem, a stimuli encoding method which encodes SSVEP signal using Frequency Shift–Keying (FSK method is developed. In this method, each stimulus is controlled by a FSK signal which contains three different frequencies that represent “Bit 0,” “Bit 1” and “Bit 2” respectively. Different to common BFSK in digital communication, “Bit 0” and “Bit 1” composited the unique identifier of stimuli in binary bit stream form, while “Bit 2” indicates the ending of a stimuli encoding. EEG signal is acquired on channel Oz, O1, O2, Pz, P3, and P4, using ADS1299 at the sample rate of 250 SPS. Before original EEG signal is quadrature demodulated, it is detrended and then band-pass filtered using FFT-based FIR filtering to remove interference. Valid peak of the processed signal is acquired by calculating its derivative and converted into bit stream using window method. Theoretically, this coding method could implement at least 2n−1 (n is the length of bit command stimulus while keeping the ITR the same. This method is suitable to implement stimuli on a monitor and where the frequency and phase could be used to code stimuli is limited as well as implementing portable BCI devices which is not capable of performing complex calculations.

  5. Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene.

    Science.gov (United States)

    Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad

    2008-10-01

    The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.

  6. Grammatical constraints on phonological encoding in speech production.

    Science.gov (United States)

    Heller, Jordana R; Goldrick, Matthew

    2014-12-01

    To better understand the influence of grammatical encoding on the retrieval and encoding of phonological word-form information during speech production, we examine how grammatical class constraints influence the activation of phonological neighbors (words phonologically related to the target--e.g., MOON, TWO for target TUNE). Specifically, we compare how neighbors that share a target's grammatical category (here, nouns) influence its planning and retrieval, assessed by picture naming latencies, and phonetic encoding, assessed by word productions in picture names, when grammatical constraints are strong (in sentence contexts) versus weak (bare naming). Within-category (noun) neighbors influenced planning time and phonetic encoding more strongly in sentence contexts. This suggests that grammatical encoding constrains phonological processing; the influence of phonological neighbors is grammatically dependent. Moreover, effects on planning times could not fully account for phonetic effects, suggesting that phonological interaction affects articulation after speech onset. These results support production theories integrating grammatical, phonological, and phonetic processes.

  7. Convolutional over Recurrent Encoder for Neural Machine Translation

    Directory of Open Access Journals (Sweden)

    Dakwale Praveen

    2017-06-01

    Full Text Available Neural machine translation is a recently proposed approach which has shown competitive results to traditional MT approaches. Standard neural MT is an end-to-end neural network where the source sentence is encoded by a recurrent neural network (RNN called encoder and the target words are predicted using another RNN known as decoder. Recently, various models have been proposed which replace the RNN encoder with a convolutional neural network (CNN. In this paper, we propose to augment the standard RNN encoder in NMT with additional convolutional layers in order to capture wider context in the encoder output. Experiments on English to German translation demonstrate that our approach can achieve significant improvements over a standard RNN-based baseline.

  8. Improved entropy encoding for high efficient video coding standard

    Directory of Open Access Journals (Sweden)

    B.S. Sunil Kumar

    2018-03-01

    Full Text Available The High Efficiency Video Coding (HEVC has better coding efficiency, but the encoding performance has to be improved to meet the growing multimedia applications. This paper improves the standard entropy encoding by introducing the optimized weighing parameters, so that higher rate of compression can be accomplished over the standard entropy encoding. The optimization is performed using the recently introduced firefly algorithm. The experimentation is carried out using eight benchmark video sequences and the PSNR for varying rate of data transmission is investigated. Comparative analysis based on the performance statistics is made with the standard entropy encoding. From the obtained results, it is clear that the originality of the decoded video sequence is preserved far better than the proposed method, though the compression rate is increased. Keywords: Entropy, Encoding, HEVC, PSNR, Compression

  9. Review of Random Phase Encoding in Volume Holographic Storage

    Directory of Open Access Journals (Sweden)

    Wei-Chia Su

    2012-09-01

    Full Text Available Random phase encoding is a unique technique for volume hologram which can be applied to various applications such as holographic multiplexing storage, image encryption, and optical sensing. In this review article, we first review and discuss diffraction selectivity of random phase encoding in volume holograms, which is the most important parameter related to multiplexing capacity of volume holographic storage. We then review an image encryption system based on random phase encoding. The alignment of phase key for decryption of the encoded image stored in holographic memory is analyzed and discussed. In the latter part of the review, an all-optical sensing system implemented by random phase encoding and holographic interconnection is presented.

  10. Characterisation of the Mucor circinelloides regulated promoter gpd1P

    DEFF Research Database (Denmark)

    Larsen, G.G.; Appel, K.F.; Wolff, A.M.

    2004-01-01

    The promoter of the Mucor circinelloides gpd1 gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd1P) was recently cloned and used for the production of recombinant proteins, such as the Aspergillus niger glucose oxidase 1 (GOX). This represents the first example of the application...

  11. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    Inci eAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  12. Beyond Initial Encoding: Measures of the Post-Encoding Status of Memory Traces Predict Long-Term Recall during Infancy

    Science.gov (United States)

    Pathman, Thanujeni; Bauer, Patricia J.

    2013-01-01

    The first years of life are witness to rapid changes in long-term recall ability. In the current research we contributed to an explanation of the changes by testing the absolute and relative contributions to long-term recall of encoding and post-encoding processes. Using elicited imitation, we sampled the status of 16-, 20-, and 24-month-old…

  13. Composing a Tumor Specific Bacterial Promoter.

    Directory of Open Access Journals (Sweden)

    Igor V Deyneko

    Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

  14. Can natural selection encode Bayesian priors?

    Science.gov (United States)

    Ramírez, Juan Camilo; Marshall, James A R

    2017-08-07

    The evolutionary success of many organisms depends on their ability to make decisions based on estimates of the state of their environment (e.g., predation risk) from uncertain information. These decision problems have optimal solutions and individuals in nature are expected to evolve the behavioural mechanisms to make decisions as if using the optimal solutions. Bayesian inference is the optimal method to produce estimates from uncertain data, thus natural selection is expected to favour individuals with the behavioural mechanisms to make decisions as if they were computing Bayesian estimates in typically-experienced environments, although this does not necessarily imply that favoured decision-makers do perform Bayesian computations exactly. Each individual should evolve to behave as if updating a prior estimate of the unknown environment variable to a posterior estimate as it collects evidence. The prior estimate represents the decision-maker's default belief regarding the environment variable, i.e., the individual's default 'worldview' of the environment. This default belief has been hypothesised to be shaped by natural selection and represent the environment experienced by the individual's ancestors. We present an evolutionary model to explore how accurately Bayesian prior estimates can be encoded genetically and shaped by natural selection when decision-makers learn from uncertain information. The model simulates the evolution of a population of individuals that are required to estimate the probability of an event. Every individual has a prior estimate of this probability and collects noisy cues from the environment in order to update its prior belief to a Bayesian posterior estimate with the evidence gained. The prior is inherited and passed on to offspring. Fitness increases with the accuracy of the posterior estimates produced. Simulations show that prior estimates become accurate over evolutionary time. In addition to these 'Bayesian' individuals, we also

  15. The spectro-contextual encoding and retrieval theory of episodic memory.

    Science.gov (United States)

    Watrous, Andrew J; Ekstrom, Arne D

    2014-01-01

    The spectral fingerprint hypothesis, which posits that different frequencies of oscillations underlie different cognitive operations, provides one account for how interactions between brain regions support perceptual and attentive processes (Siegel etal., 2012). Here, we explore and extend this idea to the domain of human episodic memory encoding and retrieval. Incorporating findings from the synaptic to cognitive levels of organization, we argue that spectrally precise cross-frequency coupling and phase-synchronization promote the formation of hippocampal-neocortical cell assemblies that form the basis for episodic memory. We suggest that both cell assembly firing patterns as well as the global pattern of brain oscillatory activity within hippocampal-neocortical networks represents the contents of a particular memory. Drawing upon the ideas of context reinstatement and multiple trace theory, we argue that memory retrieval is driven by internal and/or external factors which recreate these frequency-specific oscillatory patterns which occur during episodic encoding. These ideas are synthesized into a novel model of episodic memory (the spectro-contextual encoding and retrieval theory, or "SCERT") that provides several testable predictions for future research.

  16. Evaluation of Results from Sales Promotion Activities

    Directory of Open Access Journals (Sweden)

    Olimpia Ban

    2007-02-01

    Full Text Available An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  17. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  18. CHARACTERISTIC OF THE COMPLEX MARKETING COMMUNICATIONS ELEMENTS

    Directory of Open Access Journals (Sweden)

    Natalia Kovalenko

    2017-07-01

    Full Text Available Purpose: The purpose and objectives of the article are detailed characterization of marketing communication’s elements and characteristics of synthetic and communications. Methods: The stages of the campaign and main advantages and disadvantages of advertising have been disclosed and analyzed in the article. The marketing communication and some elements of marketing communications, the issues of formation and development of the theory of marketing communications have been studied. Results: This article describes the elements of marketing communications factors and basic tools of marketing communications: advertising, personal selling, complex sales promotion, publicity and public relation, direct marketing. Discussion: Companies must also transmit information to customers and carefully carry out selection of such information. For this order is a complex system of marketing communications. Often marketing communications identified with the products promotion which leads to a false understanding of the nature and, consequently, to the irrational use potential of marketing communications in market activity.

  19. High-Efficient Parallel CAVLC Encoders on Heterogeneous Multicore Architectures

    Directory of Open Access Journals (Sweden)

    H. Y. Su

    2012-04-01

    Full Text Available This article presents two high-efficient parallel realizations of the context-based adaptive variable length coding (CAVLC based on heterogeneous multicore processors. By optimizing the architecture of the CAVLC encoder, three kinds of dependences are eliminated or weaken, including the context-based data dependence, the memory accessing dependence and the control dependence. The CAVLC pipeline is divided into three stages: two scans, coding, and lag packing, and be implemented on two typical heterogeneous multicore architectures. One is a block-based SIMD parallel CAVLC encoder on multicore stream processor STORM. The other is a component-oriented SIMT parallel encoder on massively parallel architecture GPU. Both of them exploited rich data-level parallelism. Experiments results show that compared with the CPU version, more than 70 times of speedup can be obtained for STORM and over 50 times for GPU. The implementation of encoder on STORM can make a real-time processing for 1080p @30fps and GPU-based version can satisfy the requirements for 720p real-time encoding. The throughput of the presented CAVLC encoders is more than 10 times higher than that of published software encoders on DSP and multicore platforms.

  20. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

  1. Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

    International Nuclear Information System (INIS)

    Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti; Prasad, Tulika; Mukhopadhyay, Gauranga; Hoefer, Milan; Morschhaeuser, Joachim; Prasad, Rajendra

    2005-01-01

    Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild type CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance

  2. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  3. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  4. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  5. Thought probes during prospective memory encoding: Evidence for perfunctory processes

    Science.gov (United States)

    McDaniel, Mark A.; Dasse, Michelle N.; Lee, Ji hae; Kurinec, Courtney A.; Tami, Claudina; Krueger, Madison L.

    2018-01-01

    For nearly 50 years, psychologists have studied prospective memory, or the ability to execute delayed intentions. Yet, there remains a gap in understanding as to whether initial encoding of the intention must be elaborative and strategic, or whether some components of successful encoding can occur in a perfunctory, transient manner. In eight studies (N = 680), we instructed participants to remember to press the Q key if they saw words representing fruits (cue) during an ongoing lexical decision task. They then typed what they were thinking and responded whether they encoded fruits as a general category, as specific exemplars, or hardly thought about it at all. Consistent with the perfunctory view, participants often reported mind wandering (42.9%) and hardly thinking about the prospective memory task (22.5%). Even though participants were given a general category cue, many participants generated specific category exemplars (34.5%). Bayesian analyses of encoding durations indicated that specific exemplars came to mind in a perfunctory manner rather than via strategic, elaborative mechanisms. Few participants correctly guessed the research hypotheses and changing from fruit category cues to initial-letter cues eliminated reports of specific exemplar generation, thereby arguing against demand characteristics in the thought probe procedure. In a final experiment, encoding duration was unrelated to prospective memory performance; however, specific-exemplar encoders outperformed general-category encoders with no ongoing task monitoring costs. Our findings reveal substantial variability in intention encoding, and demonstrate that some components of prospective memory encoding can be done “in passing.” PMID:29874277

  6. Basic Finite Element Method

    International Nuclear Information System (INIS)

    Lee, Byeong Hae

    1992-02-01

    This book gives descriptions of basic finite element method, which includes basic finite element method and data, black box, writing of data, definition of VECTOR, definition of matrix, matrix and multiplication of matrix, addition of matrix, and unit matrix, conception of hardness matrix like spring power and displacement, governed equation of an elastic body, finite element method, Fortran method and programming such as composition of computer, order of programming and data card and Fortran card, finite element program and application of nonelastic problem.

  7. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  8. Latency Performance of Encoding with Random Linear Network Coding

    DEFF Research Database (Denmark)

    Nielsen, Lars; Hansen, René Rydhof; Lucani Rötter, Daniel Enrique

    2018-01-01

    the encoding process can be parallelized based on system requirements to reduce data access time within the system. Using a counting argument, we focus on predicting the effect of changes of generation (number of original packets) and symbol size (number of bytes per data packet) configurations on the encoding...... latency on full vector and on-the-fly algorithms. We show that the encoding latency doubles when either the generation size or the symbol size double and confirm this via extensive simulations. Although we show that the theoretical speed gain of on-the-fly over full vector is two, our measurements show...

  9. Wavelength-encoded OCDMA system using opto-VLSI processors.

    Science.gov (United States)

    Aljada, Muhsen; Alameh, Kamal

    2007-07-01

    We propose and experimentally demonstrate a 2.5 Gbits/sper user wavelength-encoded optical code-division multiple-access encoder-decoder structure based on opto-VLSI processing. Each encoder and decoder is constructed using a single 1D opto-very-large-scale-integrated (VLSI) processor in conjunction with a fiber Bragg grating (FBG) array of different Bragg wavelengths. The FBG array spectrally and temporally slices the broadband input pulse into several components and the opto-VLSI processor generates codewords using digital phase holograms. System performance is measured in terms of the autocorrelation and cross-correlation functions as well as the eye diagram.

  10. Wavelength-encoded OCDMA system using opto-VLSI processors

    Science.gov (United States)

    Aljada, Muhsen; Alameh, Kamal

    2007-07-01

    We propose and experimentally demonstrate a 2.5 Gbits/sper user wavelength-encoded optical code-division multiple-access encoder-decoder structure based on opto-VLSI processing. Each encoder and decoder is constructed using a single 1D opto-very-large-scale-integrated (VLSI) processor in conjunction with a fiber Bragg grating (FBG) array of different Bragg wavelengths. The FBG array spectrally and temporally slices the broadband input pulse into several components and the opto-VLSI processor generates codewords using digital phase holograms. System performance is measured in terms of the autocorrelation and cross-correlation functions as well as the eye diagram.

  11. Persistent schema-dependent hippocampal-neocortical connectivity during memory encoding and postencoding rest in humans.

    Science.gov (United States)

    van Kesteren, Marlieke T R; Fernández, Guillén; Norris, David G; Hermans, Erno J

    2010-04-20

    The hippocampus is thought to promote gradual incorporation of novel information into long-term memory by binding, reactivating, and strengthening distributed cortical-cortical connections. Recent studies implicate a key role in this process for hippocampally driven crosstalk with the (ventro)medial prefrontal cortex (vmPFC), which is proposed to become a central node in such representational networks over time. The existence of a relevant prior associative network, or schema, may moreover facilitate this process. Thus, hippocampal-vmPFC crosstalk may support integration of new memories, particularly in the absence of a relevant prior schema. To address this issue, we used functional magnetic resonance imaging (fMRI) and prior schema manipulation to track hippocampal-vmPFC connectivity during encoding and postencoding rest. We manipulated prior schema knowledge by exposing 30 participants to the first part of a movie that was temporally scrambled for 15 participants. The next day, participants underwent fMRI while encoding the movie's final 15 min in original order and, subsequently, while resting. Schema knowledge and item recognition performance show that prior schema was successfully and selectively manipulated. Intersubject synchronization (ISS) and interregional partial correlation analyses furthermore show that stronger prior schema was associated with more vmPFC ISS and less hippocampal-vmPFC interregional connectivity during encoding. Notably, this connectivity pattern persisted during postencoding rest. These findings suggest that additional crosstalk between hippocampus and vmPFC is required to compensate for difficulty integrating novel information during encoding and provide tentative support for the notion that functionally relevant hippocampal-neocortical crosstalk persists during off-line periods after learning.

  12. Datacube Interoperability, Encoding Independence, and Analytics

    Science.gov (United States)

    Baumann, Peter; Hirschorn, Eric; Maso, Joan

    2017-04-01

    representations. Further, CIS 1.1 offers a unified model for any kind of regular and irregular grids, also allowing sensor models as per SensorML. Encodings include ASCII formats like GML, JSON, RDF as well as binary formats like GeoTIFF, NetCDF, JPEG2000, and GRIB2; further, a container concept allows mixed representations within one coverage file utilizing zip or other convenient package formats. Through the tight integration with the Sensor Web Enablement (SWE), a lossless "transport" from sensor into coverage world is ensured. The corresponding service model of WCS supports datacube operations ranging from simple data extraction to complex ad-hoc analytics with WPCS. Notably, W3C is working has set out on a coverage model as well; it has been designed relatively independently from the abovementioned standards, but there is informal agreement to link it into the CIS universe (which allows for different, yet interchangeable representations). Particularly interesting in the W3C proposal is the detailed semantic modeling of metadata; as CIS 1.1 supports RDF, a tight coupling seems feasible.

  13. Radiolabelled cellular blood elements

    International Nuclear Information System (INIS)

    Sinzinger, H.

    1990-01-01

    This book reports on radiolabelled cellular blood elements, covering new advances made during the past several years, in particular the use of Tc-99 as a tracer for blood elements. Coverage extends to several radiolabelled monoclonal antibodies that are specific for blood components and may label blood elements in vivo

  14. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  15. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  16. Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

    Science.gov (United States)

    Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

    1995-01-01

    The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

  17. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  18. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  19. Generalized finite elements

    International Nuclear Information System (INIS)

    Wachspress, E.

    2009-01-01

    Triangles and rectangles are the ubiquitous elements in finite element studies. Only these elements admit polynomial basis functions. Rational functions provide a basis for elements having any number of straight and curved sides. Numerical complexities initially associated with rational bases precluded extensive use. Recent analysis has reduced these difficulties and programs have been written to illustrate effectiveness. Although incorporation in major finite element software requires considerable effort, there are advantages in some applications which warrant implementation. An outline of the basic theory and of recent innovations is presented here. (authors)

  20. What Is a Promotion?

    Science.gov (United States)

    Pergamit, Michael R.; Veum, Jonathan R.

    1999-01-01

    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  1. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  2. Emotion experienced during encoding enhances odor retrieval cue effectiveness.

    Science.gov (United States)

    Herz, R S

    1997-01-01

    Emotional potentiation may be a key variable in the formation of odor-associated memory. Two experiments were conducted in which a distinctive ambient odor was present or absent during encoding and retrieval sessions and subjects were in an anxious or neutral mood during encoding. Subjects' mood at retrieval was not manipulated. The laboratory mood induction used in Experiment 1 suggested that anxiety might increase the effectiveness of an odor retrieval cue. This trend was confirmed in Experiment 2 by capturing a naturally stressful situation. Subjects who had an ambient odor cue available and were in a preexam state during encoding recalled more words than subjects in any other group. These data are evidence that heightened emotion experienced during encoding with an ambient odor can enhance the effectiveness of an odor as a cue to memory.

  3. Color Image Authentication and Recovery via Adaptive Encoding

    Directory of Open Access Journals (Sweden)

    Chun-Hung Chen

    2014-01-01

    Full Text Available We describe an authentication and recovery scheme for color image protection based on adaptive encoding. The image blocks are categorized based on their contents and different encoding schemes are applied according to their types. Such adaptive encoding results in better image quality and more robust image authentication. The approximations of the luminance and chromatic channels are carefully calculated, and for the purpose of reducing the data size, differential coding is used to encode the channels with variable size according to the characteristic of the block. The recovery data which represents the approximation and the detail of the image is embedded for data protection. The necessary data is well protected by using error correcting coding and duplication. The experimental results demonstrate that our technique is able to identify and localize image tampering, while preserving high quality for both watermarked and recovered images.

  4. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  5. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  6. What is a "good" encoding of guarded choice?

    DEFF Research Database (Denmark)

    Nestmann, Uwe

    2000-01-01

    into the latter that preserves divergence-freedom and symmetries. This paper argues that there are nevertheless "good" encodings between these calculi. In detail, we present a series of encodings for languages with (1) input-guarded choice, (2) both input and output-guarded choice, and (3) mixed-guarded choice......, and investigate them with respect to compositionality and divergence-freedom. The first and second encoding satisfy all of the above criteria, but various "good" candidates for the third encoding-inspired by an existing distributed implementation-invalidate one or the other criterion, While essentially confirming...... Palamidessi's result, our study suggests that the combination of strong compositionality and divergence-freedom is too strong for more practical purposes. (C) 2000 Academic Press....

  7. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  8. Noise and neuronal populations conspire to encode simple waveforms reliably

    Science.gov (United States)

    Parnas, B. R.

    1996-01-01

    Sensory systems rely on populations of neurons to encode information transduced at the periphery into meaningful patterns of neuronal population activity. This transduction occurs in the presence of intrinsic neuronal noise. This is fortunate. The presence of noise allows more reliable encoding of the temporal structure present in the stimulus than would be possible in a noise-free environment. Simulations with a parallel model of signal processing at the auditory periphery have been used to explore the effects of noise and a neuronal population on the encoding of signal information. The results show that, for a given set of neuronal modeling parameters and stimulus amplitude, there is an optimal amount of noise for stimulus encoding with maximum fidelity.

  9. Universal Quantum Computing with Arbitrary Continuous-Variable Encoding.

    Science.gov (United States)

    Lau, Hoi-Kwan; Plenio, Martin B

    2016-09-02

    Implementing a qubit quantum computer in continuous-variable systems conventionally requires the engineering of specific interactions according to the encoding basis states. In this work, we present a unified formalism to conduct universal quantum computation with a fixed set of operations but arbitrary encoding. By storing a qubit in the parity of two or four qumodes, all computing processes can be implemented by basis state preparations, continuous-variable exponential-swap operations, and swap tests. Our formalism inherits the advantages that the quantum information is decoupled from collective noise, and logical qubits with different encodings can be brought to interact without decoding. We also propose a possible implementation of the required operations by using interactions that are available in a variety of continuous-variable systems. Our work separates the "hardware" problem of engineering quantum-computing-universal interactions, from the "software" problem of designing encodings for specific purposes. The development of quantum computer architecture could hence be simplified.

  10. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  11. Polypeptides having catalase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan

    2017-05-02

    Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  13. Multiple-stage pure phase encoding with biometric information

    Science.gov (United States)

    Chen, Wen

    2018-01-01

    In recent years, many optical systems have been developed for securing information, and optical encryption/encoding has attracted more and more attention due to the marked advantages, such as parallel processing and multiple-dimensional characteristics. In this paper, an optical security method is presented based on pure phase encoding with biometric information. Biometric information (such as fingerprint) is employed as security keys rather than plaintext used in conventional optical security systems, and multiple-stage phase-encoding-based optical systems are designed for generating several phase-only masks with biometric information. Subsequently, the extracted phase-only masks are further used in an optical setup for encoding an input image (i.e., plaintext). Numerical simulations are conducted to illustrate the validity, and the results demonstrate that high flexibility and high security can be achieved.

  14. Polypeptides having xylanase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2018-02-06

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Elements beyond uranium

    International Nuclear Information System (INIS)

    Seaborg, G.T.; Loveland, W.D.

    1990-01-01

    This book is the 12th volume in a series on transuranium elements. Varied techniques for production of these elements, the methods used in the identification, and the exquisitely refined microchemical techniques required to deal wth samples sometimes involving only a few atoms are described in detail. The chapter on synthesis of the new elements is liberally laced with reminiscences of the proud progenitors as well as the criteria for the discovery of a new chemical element. The authors lament that the superheavy elements (elements in the region of atomic number 114) still elude detection even though their creation should be possible, and some, at least, should survive long enough to be detected. One chapter in the book is devoted to practical applictions of uranium, and the transuranic elements

  16. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  17. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  18. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  19. Fast Coding Unit Encoding Mechanism for Low Complexity Video Coding

    OpenAIRE

    Gao, Yuan; Liu, Pengyu; Wu, Yueying; Jia, Kebin; Gao, Guandong

    2016-01-01

    In high efficiency video coding (HEVC), coding tree contributes to excellent compression performance. However, coding tree brings extremely high computational complexity. Innovative works for improving coding tree to further reduce encoding time are stated in this paper. A novel low complexity coding tree mechanism is proposed for HEVC fast coding unit (CU) encoding. Firstly, this paper makes an in-depth study of the relationship among CU distribution, quantization parameter (QP) and content ...

  20. Security enhanced BioEncoding for protecting iris codes

    Science.gov (United States)

    Ouda, Osama; Tsumura, Norimichi; Nakaguchi, Toshiya

    2011-06-01

    Improving the security of biometric template protection techniques is a key prerequisite for the widespread deployment of biometric technologies. BioEncoding is a recently proposed template protection scheme, based on the concept of cancelable biometrics, for protecting biometric templates represented as binary strings such as iris codes. The main advantage of BioEncoding over other template protection schemes is that it does not require user-specific keys and/or tokens during verification. Besides, it satisfies all the requirements of the cancelable biometrics construct without deteriorating the matching accuracy. However, although it has been shown that BioEncoding is secure enough against simple brute-force search attacks, the security of BioEncoded templates against more smart attacks, such as record multiplicity attacks, has not been sufficiently investigated. In this paper, a rigorous security analysis of BioEncoding is presented. Firstly, resistance of BioEncoded templates against brute-force attacks is revisited thoroughly. Secondly, we show that although the cancelable transformation employed in BioEncoding might be non-invertible for a single protected template, the original iris code could be inverted by correlating several templates used in different applications but created from the same iris. Accordingly, we propose an important modification to the BioEncoding transformation process in order to hinder attackers from exploiting this type of attacks. The effectiveness of adopting the suggested modification is validated and its impact on the matching accuracy is investigated empirically using CASIA-IrisV3-Interval dataset. Experimental results confirm the efficacy of the proposed approach and show that it preserves the matching accuracy of the unprotected iris recognition system.