Graphite moderated 252Cf source

International Nuclear Information System (INIS)

Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.

2014-08-01

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

System control for the modulated 252Cf source ''Shuffler''

International Nuclear Information System (INIS)

Stephens, M.M.

1975-06-01

The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)

Laboratory-scale shielded cell for 252Cf

International Nuclear Information System (INIS)

Anderl, R.A.; Cargo, C.H.

1979-01-01

A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms

Graphite moderated {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

2014-08-15

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated

Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

International Nuclear Information System (INIS)

Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong

2011-01-01

Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

Radiation ulcers in patients with cancer of the torgue after 252Cf therapy

International Nuclear Information System (INIS)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.

1984-01-01

Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf

Neutron shielding for a 252 Cf source

International Nuclear Information System (INIS)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente

2006-01-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources

Energy Technology Data Exchange (ETDEWEB)

Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-04-01

A new, stronger ²⁵²Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing ²⁵²Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger ²⁵²Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our ²⁵²Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.

Radionuclide 252Cf neutron source

International Nuclear Information System (INIS)

Kolevatov, Yu.I.; Trykov, L.A.

1979-01-01

Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV

Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy

Energy Technology Data Exchange (ETDEWEB)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

1984-01-01

Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.

A survey of uses and users of 252Cf

International Nuclear Information System (INIS)

Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.

1989-01-01

Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL

Neutron shielding for a {sup 252} Cf source

Energy Technology Data Exchange (ETDEWEB)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com

2006-07-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

A pneumatic transfer system for special form 252Cf

International Nuclear Information System (INIS)

Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.

1996-09-01

A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole

Shielding evaluation of a medical linear accelerator vault in preparation for installing a high-dose rate 252Cf remote after-loader

International Nuclear Information System (INIS)

Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.

2005-01-01

In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)

Californium-252 interstitial implants in carcinoma of the tongue

International Nuclear Information System (INIS)

Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.

1985-01-01

A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy

Determination of disintegration half-life of 252Cf

International Nuclear Information System (INIS)

Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen

1991-01-01

The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results

Reactor production of 252Cf and transcurium isotopes

International Nuclear Information System (INIS)

Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.

1990-01-01

Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs

Characteristics of polyethylene-moderated 252Cf neutron sources

International Nuclear Information System (INIS)

Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.

2000-01-01

Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data

RBE of Cf-252 neutrons as determined by its lethal, mutagenic, and cytogenetic effects on human cells

International Nuclear Information System (INIS)

Ban, Sadayuki

1989-01-01

To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)

Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster

International Nuclear Information System (INIS)

Seidel, A.

1977-01-01

Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment

Shielding experiments in different materials with 252Cf neutron spectra

International Nuclear Information System (INIS)

Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.

2008-01-01

Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)

Energy and angular distributions of neutrons from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.

1982-01-01

Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments

Time domain measurements for fast metal assemblies with /sup 252/Cf

Energy Technology Data Exchange (ETDEWEB)

Mihalczo, J T

1975-06-01

Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)

Implementation of 252Cf-source-driven power spectrum density measurement system

International Nuclear Information System (INIS)

Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming

2012-01-01

The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)

NAA using Cf-252 after preconcentration

International Nuclear Information System (INIS)

Panyo, O.; Moebius, S.; Keller, C.

1988-01-01

Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn

Neutron emission during acceleration of 252Cf fission fragments

International Nuclear Information System (INIS)

Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.

1991-01-01

We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

Determination of kinetics parameters using stochastic methods in a 252Cf system

International Nuclear Information System (INIS)

Difilippo, F.C.

1988-01-01

Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons

Analysis of geological material and especially ores by means of a 252Cf source

International Nuclear Information System (INIS)

Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.

1976-01-01

Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses

Exclusive radiation therapy of endometrial carcinoma using HDR Co-60 and Cf-252 sources

International Nuclear Information System (INIS)

Inciura, A.; Janulionis, E.; Atkocius, V.

2000-01-01

Although the main treatment of endometrial cancer is surgery, the gross spread of carcinoma in pelvis, elderly age of the patients and serious therapeutical diseases do not allow to operate 20% of the patients. For these patients only radical treatment decision is the combined radiation therapy. However, using various modalities of combined radiotherapy, the treatment results are not satisfying: only 52% of patients survive 5 years. There was implemented a new method of combined radiotherapy, using a three-channel applicator with two-positional locating of HDR Co-60 radioactive sources (group I). A new method of brachytherapy for endometrial carcinoma using a HDR Cf 252 sources (group II) was implemented too. For group I the medium total dose of the point A was 77.6 Gy, point I - 69.6 Gy. point 2 - 84.2 Gy, point B - 52.6 Gy, For group II the medium total dose the points A, 3 and 4 was 50 iGy. For group I 1 year overaII survival rate was 85%, 3 year - 73%. The 3 year survival rate for stage I was 79%, for stage II - 89%, for stage III - 33%. 3 year survival for highly virulent tumours - 56% and for low virulent (adenocarcinoma) - 82% was statistically different. The loss of tumour differentiation correlated with the worse prognosis: 3 year survival for G1 and G2 tumours was 92%, for G3 - 45%. Low hemoglobin level was also associated with low survival rate: 2 year survival for Hb≥120g/l was 85% and Hb<120g/l - 23%. 1 year survival rate was 87%, 3 year - 66%, 5 year - 58% for group II, treated with Cf-252. Radiation complications occurred for 13.8% of the patients for group I and 6.2% for group II. Good survival rates and a small number of complications sufficiently proofed treatment method. (author)

Neutron activation analysis detection limits using 252Cf sources

International Nuclear Information System (INIS)

DiPrete, D.P.; Sigg, R.A.

2000-01-01

The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

Evaluation of mass distribution data from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Liu Tingjin

2003-01-01

The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)

Effective source size as related to 252Cf neutron radiography

International Nuclear Information System (INIS)

Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.

1977-01-01

The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)

Production, Distribution, and Applications of Californium-252 Neutron Sources

International Nuclear Information System (INIS)

Balo, P.A.; Knauer, J.B.; Martin, R.C.

1999-01-01

The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations

Calculation of dose distribution for 252Cf fission neutron source in tissue equivalent phantoms using Monte Carlo method

International Nuclear Information System (INIS)

Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong

2001-01-01

Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf

Separation of 248Cm (III) from 252Cf (III) and its use in time resolved fluorescence spectroscopic (TRFS) studies

International Nuclear Information System (INIS)

Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.

2008-07-01

The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)

Cf-252 based neutron radiography using real-time image processing system

International Nuclear Information System (INIS)

Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka

2001-01-01

For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)

Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source

International Nuclear Information System (INIS)

Silva, Ademir X. da; Crispim, Verginia R.

2001-01-01

This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)

The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement

International Nuclear Information System (INIS)

Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan

2004-01-01

The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)

Frequency spectrum analysis of 252Cf neutron source based on LabVIEW

International Nuclear Information System (INIS)

Mi Deling; Li Pengcheng

2011-01-01

The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)

A new facility for non-destructive assay using a 252Cf source

International Nuclear Information System (INIS)

Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.

2013-01-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques

Physical and biological dosimetries of Cf-252 radiation

International Nuclear Information System (INIS)

Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo

1986-01-01

Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)

INAA using 252Cf neutron source at University of Pune

International Nuclear Information System (INIS)

Rajurkar, N.S.

2006-01-01

The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)

Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose

Energy Technology Data Exchange (ETDEWEB)

Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)

2016-11-01

{sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.

A 252Cf based nondestructive assay system for fissile material

International Nuclear Information System (INIS)

Menlove, H.O.; Crane, T.W.

1978-01-01

A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)

Prompt neutron energy spectrum for the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.

1985-06-01

The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)

Spectrum-averaged cross-section measurement of /sup 103/Rh(n,n)/sup 103m/Rh in the /sup 252/Cf fission neutron spectrum

International Nuclear Information System (INIS)

Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.

1988-01-01

Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given

Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields

Directory of Open Access Journals (Sweden)

Simakov Stanislav

2016-01-01

Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.

The fast neutron emission spectrum of 252-Cf

International Nuclear Information System (INIS)

Bensch, F.

1979-07-01

The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement

Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum

International Nuclear Information System (INIS)

Mannhart, W.

1983-01-01

After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)

Development of neutron induced prompt γ-ray spectroscopy system using 252Cf

International Nuclear Information System (INIS)

Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong

2003-01-01

For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained

Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)

International Nuclear Information System (INIS)

Budtz-Joergensen, C.; Knitter, H.H.

1986-01-01

The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)

{sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)

Energy Technology Data Exchange (ETDEWEB)

Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)

2000-04-01

The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.

Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University

International Nuclear Information System (INIS)

Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.

1988-01-01

This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)

Molecular weight determination of bisbenzyl-isoquinoline alkaloids by 252Cf-plasma desorption mass spectrometer

International Nuclear Information System (INIS)

Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao

1995-01-01

Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)

Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe

International Nuclear Information System (INIS)

Chien Chung; Jiunnhsing Chao

1991-01-01

Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements

Power spectral density measurements with 252Cf for a light water moderated research reactor

International Nuclear Information System (INIS)

King, W.T.; Mihalczo, J.T.

1979-01-01

A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented

Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)

2011-12-15

We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.

Dispersions and correlations of the distributions of products of 252Cf spontaneous fission

International Nuclear Information System (INIS)

Vidyakin, G.S.; Vyrodov, V.N.; Gurevich, I.I.; Kirillov, B.F.; Kozlov, Y.V.; Martem'yanov, V.P.; Sukhotin, S.V.; Tarasenkov, V.G.; Khakimov, S.K.

1982-01-01

We report the results of two experiments on study of the dispersions and correlations of the distributions of products of the spontaneous fission of 252 Cf. In each experiment about 10 8 fissions were recorded with simultaneous measurement of the number of neutrons produced and in one case the fragment kinetic energy and in the other case the energy of the prompt #betta# rays. The quantities obtained were the probabilities of production of a given number of neutrons per fission, the dispersions of the distributions of the number of neutrons produced and of the fragment kinetic energy, and the dependence of the average #betta#-ray energy and the average fragment kinetic energy on the number of neutrons produced. A calculation is made of the spectrum of the total energy carried away by fragments and neutrons, and its dispersion is determined. An estimate of the total energy release in the 252 Cf fission process is made

An evaluation of the spontaneous fission prompt neutron spectrum of 252Cf

International Nuclear Information System (INIS)

Bojkov, G.S.; Yurevich, V.I.

1987-01-01

An evaluation of the spontaneous fission prompt neutron spectrum of 252 Cf from 1 keV to 20 MeV is described. Variance-covariance matrices for a number of recent experimental data sets were constructed and used to evaluate the neutron spectrum following a Bayesian procedure. The evaluated spectrum is compared with various experimental and theoretical representations. (author)

Mass spectrometry with ionization induced by 252Cf fission fragments

International Nuclear Information System (INIS)

Sysoev, A.A.; Artaev, V.B.

1991-01-01

The review deals with mass-spectrometry with ionization induced by 252 Cf fission fragments. Equipment and technique of the analysis, analytic possibilities of the method are considered. The method permits to determine molecular masses of large nonvolatile biological molecules. The method is practically nondestructive, it possesses a high resolution over the depth and surface, which permits to use it for the analysis of surface of semiconductors, dielectrics, catalysts, for the study of formation kinetics of complex unstable molecules on the surface

Correlation studies of neutron multiplicities in the 252Cf spontaneous fission

International Nuclear Information System (INIS)

Alkhazov, I.D.; Dmitriev, V.D.; Kovalenko, S.S.; Kuznetsov, A.V.; Malkin, L.Z.; Petrzhak, K.A.; Petrov, B.F.; Shpakov, V.I.

1988-01-01

Correlations between the numbers of neutrons emitted by the 252 Cf spontaneous fission fragments have been studied as a function of the fragment mass and total kinetic energy. Behaviour of the neutron number dispersions and covariances was studied for the region of symmetric fission. Parameters of the complementary fragment excitation energy distribution (mean values, dispersions, covariances) were determined. Various factors describing correlations between the complementary fragment excitation energies are considered

Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements

International Nuclear Information System (INIS)

Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.

1992-01-01

The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method

Study of biological effects of varying mixtures of Cf-252 and gamma radiation on the acute radiation syndromes: Relevance to clinical radiotherapy of radioresistant cancer

International Nuclear Information System (INIS)

Maruyama, Y.; Wierzbicki, J.; Feola, J.M.

1993-01-01

Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs

Relative biological effectiveness (R.B.E.) of Cf-252 vs. acute Co-60 and low dose rate Cs-137 irradiation by spleen weight loss

International Nuclear Information System (INIS)

Maruyama, Y.; Feola, J.M.; Magura, C.; Beach, J.L.

1986-01-01

R.B.E. of Cf-252 on lymphoid tissue was assessed by radiation study of spleen weight loss following acute Co-60, and low dose rate (L.D.R.) Cs-137 and Cf-252 irradiations. Acute Co-60 and L.D.R. Cs-137 dose-response followed two component exponential curves with a 1.3-fold greater effect of L.D.R. Cs-137 vs. acute Co-60 on the first slope and 1.9-fold greater effect for the 2nd slope. L.D.R. Cf-252 response was 1.3 x greater than acute Co-60 but was 1.0 vs. L.D.R. Cs-137 for the first slope indicating a similar effect of Cf-252 mixed neutron/gamma radiation to L.D.R. gamma radiation in producing spleen shrinkage. There was no effect of different sequences and schedules of mixing acute Co-60 with Cf-252 irradiation observed by endogenous CFU-S survival. The R.B.E. of 1.0 - 1.9 indicates that lymphohemopoietic in vivo, presumably well oxygenated, does not respond acutely or as sensitively as hypoxic tumor where R.B.E. is 5 - 7. (author)

4π-spectrometer technique for measurements of secondary neutron average number in nuclear fission by 252Cf neutrons

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.

1977-01-01

A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet

In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe

International Nuclear Information System (INIS)

Chung Chien; Tseng Tzucheng

1988-01-01

A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)

Neutron dose rate for {sup 252} Cf AT source in medical applications

Energy Technology Data Exchange (ETDEWEB)

Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)

2006-07-01

The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)

Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.

1999-01-01

A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

Fresnel zone plate imaging of a 252Cf spontaneous fission source

International Nuclear Information System (INIS)

Stalker, K.T.; Hessel, K.R.

1976-11-01

The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown

Test and evaluation results of the 252Cf shuffler at the Savannah River Plant

International Nuclear Information System (INIS)

Crane, T.W.

1981-03-01

The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant

252Cf-source-driven noise analysis measurements for characterization of concrete highly enriched uranium (HEU) storage vaults

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.

1993-01-01

The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material

True ternary fission of 252Cf

International Nuclear Information System (INIS)

Vijayaraghavan, K.R.; Balasubramaniam, M.; Oertzen, W. von

2014-01-01

Splitting of heavy radioactive nucleus into three fragments is known as ternary fission. If the size of the fragments are almost equal it is referred to as true ternary fission. Recently, Yu. V. Pyatkov et al observed/reported the experimental observation of true ternary fission in 252 Cf. In this work, the possibilities of different true ternary fission modes of 252 Cf through potential energy surface (PES) calculations based on three cluster model (TCM) are discussed. In TCM a condition on the mass numbers of the fission fragments is implied as A 1 ≥ A 2 ≥ A 3 in order to avoid repetition of combinations. Due to this condition, the values of Z 3 vary from 0 to 36 and Z 2 vary from 16 to 51. Of the different pairs having similar (Z 2 , Z 3 ) with different potential energy, a pair possessing minimum potential energy is chosen. Thus identified favourable combinations are plotted. For the PES calculations the arrangement of the fragments is considered in the order of A 1 +A 2 +A 3 . i.e. the heavy and the lightest fragments are kept at the ends. It is seen that the deepest minimum in the PES occurs for Z 3 =2 labelled as (Z 2 ; 2) indicating He accompanied breakup as the most favourable one. Of which, the breakup with Z 2 around 46 to 48 is the least (shown by dashed (Z 1 = 50) and dotted (Z 1 = 52) lines indicating a constant Z 1 value). The other notable minima in the PES are labelled and they correspond to the (Z 2 , Z 3 ) pairs viz., (20, 20), (28, 20), (28, 28) and (32, 32). Of these four minima, the first three are associated with the magic numbers 20 and 28. For Z 3 =20, there are two minimums at (20,20) and (28,20) among them (28,20) is the lowest minimum through which the minimum-path passes, and it is the ternary decay observed by Yu. V. Pyatkov et al. The fourth minima is the most interesting due to the fact that it corresponds to true ternary fission mode with Z 2 =32, Z 3 =32 and Z 1 =34. The minimum potential energy path also goes through this true

Comparison Of ²⁵²Cf Time Correlated Induced Fisssion With AmLi Induced Fission On Fresh MTR Research Reactor Fuel

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jay Prakash [Los Alamos National Laboratory

2017-03-30

The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six ³He detectors as well as a shielded and collimated ion chamber. The ³He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a ²⁵²Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the ²⁵²Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The ²⁵²Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the ³He detector, which helps reduce the statistical errors in doubles when using the ²⁵²Cf interrogation source instead of

Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane

International Nuclear Information System (INIS)

Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.

1983-01-01

A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites

Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission

CERN Document Server

Greenwood, R C; Gehrke, R J; Meikrantz, D H

1981-01-01

A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s252/Cf spontaneous fission, is currently underway using the Idaho ESOL (Elemental Separation On Line) Facility. The chemistry system used for the rare-earth elemental separations consists of two high-performance chromatography columns connected in series and coupled to the /sup 252 /Cf fission source via a helium gas-jet transport arrangement. The time delay for separation and initiation of gamma -ray counting with results which have been obtained to date with this system include the identification of a number of new neutron-rich rare-earth isotopes including /sup 155/Pm (t/sub 1/2/=48+or-4 s) and /sup 163/Gd (t/sub 1 /2/=68+or-3 s), in addition to 5.51 min /sup 158/Sm which was identified in an earlier series of experiments. (11 refs).

Investigation of the far asymmetric region in 252Cf(sf)

International Nuclear Information System (INIS)

Hambsch, F.-J.; Oberstedt, S.

1997-01-01

A twin Frisch-gridded ionization chamber has been used to measure the fission fragment mass, kinetic-energy and angular correlations for 252 Cf(sf). In total 2.5 x 10 8 events were collected. The focus was in the far asymmetric mass region, where enhancements in the yield had been found earlier. It could be shown, that these findings are due to false events, coming from either close geometries not properly taking into account the angular-dependent energy loss in the sample and backing, from a too large angular cone selected in case of studies employing ionization chambers, or even from poor target qualities. (orig.)

Trajectory calculations for the ternary cold fission of 252Cf

International Nuclear Information System (INIS)

Misicu, S.

1998-01-01

We compute the final kinetic energies of the fragments emitted in the light charged particle accompanied by cold fission of 252 Cf taking into account the deformation and the finite-size effects of the fragments and integrating the equations of motion for a three-body system subjected only to Coulomb forces. The initial conditions for the trajectory calculations were derived in the framework of a deformed cluster model which includes also the effect due to the absorbative nuclear part. Although the distributions of initial kinetic energies are rather broad we show that in cold fission the initial conditions can be better determined than in the usual spontaneous fission

High energy {gamma} emission in the spontaneous fission of {sup 252}Cf; Emission {gamma} de grande energie dans la fission spontanee de {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Belier, G.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

1997-06-01

The prompt {gamma} emission in the spontaneous fission of {sup 252}Cf is characterized by an energy spectrum which extends up to 20 MeV. It was established that the spectrum presents in the neighbourhood of symmetric fission an intensity bump in the 3-8 MeV {gamma} energy interval. The origin of this phenomenon is still not well understood, so that it was found interesting to carry out new measurements. The spectrum of the {gamma} rays emitted in spontaneous fission of {sup 252}Cf has been measurement in the EUROGAM II multidetector using photovoltaic cells to detect fragments. The aim of the experiment was to investigate the {gamma} yield enhancement which appears for mass fragment ratio near 132/120. This enhancement was found to be composed of two peaks located at 4 MeV and 5.5 MeV respectively. The results obtained confirm the intensity bound in the 3-8 MeV region but this augmentation reaches the maximum when the heavy fragment is near the mass 132. Beyond mass 140 the phenomenon diminish and the {gamma} spectrum regains the behaviour expected for a statistic emission. The additional structure at 5.5 MeV does not vary with excitation energy while the excitation function of the 4 MeV structure is more structured and presents a maximum when the excitation energy is near 8 MeV. It is likely that all or part of this observed phenomenon is due to a particular excitation mode of this isotope associated for instance with a low energy dipole resonance. A theoretical study of this collective effect is under way 3 refs.

Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf

International Nuclear Information System (INIS)

Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.

1996-01-01

The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented

An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range

International Nuclear Information System (INIS)

Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.

1983-01-01

Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)

Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source

International Nuclear Information System (INIS)

Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.

1985-01-01

As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor k/sub eff/ has been satisfactorily detemined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments oriented toward particular applications including dynamic experiments and the development of theoretical methods to predict the experimental observables

A new facility for non-destructive assay using a 252Cf source.

Science.gov (United States)

Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G

2013-03-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.

A new type-B cask design for transporting 252Cf

International Nuclear Information System (INIS)

Simmons, C.M.

2000-01-01

A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask

Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.

2005-06-01

For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)

The temperature of fission fragments from spontaneous fission of 252Cf measured by time-of-flight spectrometer

International Nuclear Information System (INIS)

Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R.

1997-01-01

The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of 252 Cf. The determination of the temperature was based on the measurement of the neutron spectra

Determination of 114Pd cumulative yield and investigation of the fine-structure at light peak in mass distribution of 252Cf spontaneous fission

International Nuclear Information System (INIS)

Yu Runlan; Li Xueliang; Cui Anzhi; Guo Jingru; Yan Shuhen; Tang Peijia; Liu Daming

1991-07-01

A rapid radiochemical procedure for Pd separation was developed. It was the first time to use radiochemical techniques to determine 114 Pd cumulative yield (2.50 ± 0.14)% in 252 Cf spontaneous fission. The cumulative yields of (3.50 ± 0.13)% and (3.70 ± 0.11)% for 112 Pd and 113g Ag were also obtained. These are in agreement with Skovorodkin's results. The cumulative yields determined show that there is a fine-structure at light peak of mass number A = 113 in the mass distribution of 252 Cf spontaneous fission

Gamma-ray multiplicity measurement of the spontaneous fission decay of 252Cf in a segmented HPGe/BGO detector array

Energy Technology Data Exchange (ETDEWEB)

Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M

2008-04-23

Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.

Matrix effects correction on 252Cf shufflers by application of the alternating conditional expectation to neutron flux monitor data

International Nuclear Information System (INIS)

Pickrell, M.M.

1992-01-01

The 252 Cf shuffler assays fissile uranium and plutonium using active neutron interrogation and then counting the induced delayed neutrons. Using the shuffler, we conducted over 1700 assays of 55-gal. drums with 28 different matrices and several different fissionable materials. We measured the drums to diagnose the matrix and position effects on 252 Cf shuffler assays. The matrices incorporated metals, neutron poisons, and hydrogen in densities ranging from 0≤ pH ≤ 0.086 g/cm 3 , a range of cases more extreme than typically found in routine plant use. We used several neutron flux monitors during irradiation and kept statistics on the count rates of individual detector banks. The intent of these measurements was to gauge the effect of the matrix independently from the uranium assay

Average cross sections for the 252Cf neutron spectrum

International Nuclear Information System (INIS)

Dezso, Z.; Csikai, J.

1977-01-01

A number of average cross sections have been measured for 252 Cf neutrons in (n, γ), (n,p), (n,2n), (n,α) reactions by the activation method and for fission by fission chamber. Cross sections have been determined for 19 elements and 45 reactions. The (n,γ) cross section values lie in the interval from 0.3 to 200 mb. The data as a function of target neutron number increases up to about N=60 with minimum near to dosed shells. The values lie between 0.3 mb and 113 mb. These cross sections decrease significantly with increasing the threshold energy. The values are below 20 mb. The data do not exceed 10 mb. Average (n,p) cross sections as a function of the threshold energy and average fission cross sections as a function of Zsup(4/3)/A are shown. The results obtained are summarized in tables

Californium-252 radiotherapy sources for interstitial afterloading

International Nuclear Information System (INIS)

Permar, P.H.; Walker, V.W.

1976-01-01

Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute

Burnout and gate rupture of power MOS transistors with fission fragments of 252Cf

International Nuclear Information System (INIS)

Tang Benqi; Wang Yanping; Geng Bin; Chen Xiaohua; He Chaohui; Yang Hailiang

2000-01-01

A study to determine the single event burnout (SEB) and single event gate rupture (SEGR) sensitivities of power MOSFET devices is carried out by exposure to fission fragments from 252 Cf source. The test method, test results, a description of observed burnout current waveforms and a discussion of a possible failure mechanism are presented. The test results include the observed dependence upon applied drain or gate to source bias and effect of external capacitors and limited resistors

HeLa cell tumor response to 60Co, Cs-137, Cf-252 radiations and cisplatin chemotherapy in nude mice

International Nuclear Information System (INIS)

Maruyama, Y.; Feola, J.M.; Beach, J.L.

1984-01-01

HeLa cells were implanted into athymic nude mice from tissue culture and solid tumors established (HeLa cell tumor or HCT). Large cell numbers of 1 X 10 7 were required to obtain consistent and progressive growth, and tumor growth followed a Gompertzian mode. Irradiation studies were carried out using acute Cobalt-60 (60Co), low-dose-rate (LDR) Cs-137 and LDR Cf-252. Cf-252, a neutron-emitting radioisotope, produced an immediate tumor shrinkage and regression response after a dose of 279 cGy. Acute 60Co or LDR Cs-137 irradiation with 1000 cGy had little effect on the HCT. After a dose of 2000 cGy of 60Co radiation tumor shrinkage followed a latent period of approximately 5 days. Cisplatin had no effect on the HCT in nude mice in stationary or late exponential growth

Californium-252: a remarkable versatile radioisotope

International Nuclear Information System (INIS)

Osborne-Lee, I.W.; Alexander, C.W.

1995-01-01

A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein

Californium-252: a remarkable versatile radioisotope

Energy Technology Data Exchange (ETDEWEB)

Osborne-Lee, I.W.; Alexander, C.W.

1995-10-10

A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

Photon contributions from the 252Cf and 241Am–Be neutron sources at the PSI Calibration Laboratory

International Nuclear Information System (INIS)

Hoedlmoser, H.; Boschung, M.; Meier, K.; Stadtmann, H.; Hranitzky, C.; Figel, M.; Mayer, S.

2012-01-01

At the accredited PSI Calibration Laboratory neutron reference fields traceable to the national standards of the Physikalisch-Technische Bundesanstalt (PTB) in Germany are available for the calibration of ambient and personal dose equivalent (rate) meters and passive dosimeters. The photon contribution to the ambient dose equivalent in the neutron fields of the 252 Cf and 241 Am–Be sources was measured using various photon dose rate meters and active and passive dosimeters. Measuring photons from a neutron source usually involves considerable uncertainties due to the presence of neutron induced photons in the room, due to a non-zero neutron sensitivity of the photon detector, and last but not least due to the energy response of the photon detectors. Therefore eight independent detectors and methods were used to obtain a reliable estimate for the photon contribution of the two sources as an average of the individual methods. For the 241 Am–Be source a photon contribution of approximately 4.9% was determined and for the 252 Cf source a contribution of 3.6%.

Study the Possibility of measuring Heavy Metals Arising from Gold Mining Sample using 252Cf Neutron Source

International Nuclear Information System (INIS)

Soliman, N.F.

2012-01-01

Mining activities contribute immensely to trace element pollution .The present work studied the possibility of measuring heavy metals arising from gold mining areas Eastern Desert in Egypt using the isotopic 252 Cf neutron source. 38.5 g of the sample is irradiated in a neutron field of 252 Cf for 36.75 days and 0.3 mg of the sample is irradiated at the Pneumatic Irradiation Rabbit System (PIRS) built in the vertical thermal column of the ET-RR-2 reactor . The induced activities in the samples are measured using two high resolution f ray spectrometry systems (including two calibrated HPGe detectors). The kο standardization neutron activation analysis (kο-NAA) method was used to analyze the sample under investigation. Thermal to epithermal flux ratio fat the two irradiation positions are measured. The obtained results indicated that the values of the suspected heavy metals such as sodium, magnesium, potassium, manganese, arsenic, ruthenium and tantalum were higher than the background values, signifying accumulation of these heavy metals due to gold mining activities .The accuracy and precision of the method has been evaluated

Development of the neutron reference calibration field using a 252Cf standard source surrounded with PMMA moderators

International Nuclear Information System (INIS)

Yoshida, T.; Kanai, K.; Tsujimura, N.

2002-01-01

The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments

Feasibility of subcriticality and NDA measurements for spent fuel by frequency analysis techniques with 252Cf

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.; Mattingly, J.K.

1996-01-01

The 252 Cf-source-driven frequency analysis method can be used for measuring the subcritical neutron multiplication factor of arrays of LWR fuel and as little as a single PWR fuel assembly. These measurements can be used to verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. In addition, the data can be used to validate calculational methods for criticality safety. These measurements provide parameters that have a higher sensitivity to changes in fissile mass than neutron multiplication factor and thus serve as a better test of calculational methods. The analysis have also shown that measurement of the cross power spectral density (CPSD) between detectors on one side of a single fuel assembly and an internal or external 252 Cf source driving the fission chain multiplication process can be used for nondestructive assay of fissile mass along the length of the assembly. This CPSD is a smooth function of fissile mass and does not depend on the varying inherent source in the fuel assembly and thus is ideal for fissile mass assay

Design, Construction, and Modeling of a 252Cf Neutron Irradiator

Directory of Open Access Journals (Sweden)

Blake C. Anderson

2016-01-01

Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.

Cross-sections of 197Au(n,α)198Au and 63Cu(n,α)64Cu induced by 252Cf neutrons

International Nuclear Information System (INIS)

Mandal, Ranjita; Sengupta, D.; Roy, Malobika; Naik, Mamta; Bhoraskar, V.N.

2014-01-01

Analytical work, employing nuclear techniques, is normally carried out through (n,α) reaction because of the availability of neutrons either from reactors or laboratory sources such as Sb-Be, Am-Be, Ra-Be, Po-Be, 252 Cf, etc. The laboratory neutron sources are though portable and adaptable to a particular experimental arrangement, suffer from the disadvantage of slow neutron yield (except 252 Cf). In this set up since the neutrons available are monoenergetic, it was thought appropriate to initiate a program to measure cross-sections of a few nuclear reactions which have practical applications. Earlier studies on cross-section measurement of the reaction 197 Au(n,α) 198 Au and 63 Cu(n,α) 64 Cu has been carried out using different sources, monitors and techniques

Detection alpha particles and Cf-252 fission fragments with track solid detectors and with surface barrier detectors: efficiency determination

International Nuclear Information System (INIS)

Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.R.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.

1990-01-01

The technique of particle detection by solid track detectors, types of developing and analysis of results are presented. Efficiency measurements of alpha particle detection with Makrofol e and surface barrier detector are made. Detection of Cf-252 fission fragments is shown. (L.C.)

The legacy of Cf-252 operations at Savannah River Technology Center: Continuous releases of radioiodine to the atmosphere

International Nuclear Information System (INIS)

Kantelo, M.V.; Crandall, B.S.

1992-01-01

The iodine isotopes I-132, 1-133, I-134, and I-135, which have half-lives ranging from 53 minutes to 21 hours, are measured in the atmospheric effluent from the Savannah River Technology Center (SRTC) at the Savannah River Site (SRS) near Aiken, South Carolina. SRS is operated by Westinghouse Savannah River Company for the US Department of Energy (DOE). The isotopes' release rates range from 10 to 300 microcuries per week compared to the rate. The resulting annual dose from all iodine isotopes is minor; it comprises 0.01 percent of the total offsite dose due to atmospheric releases from SRS in 1990. Circumstantial evidence indicates the radioiodine originates from traces of unencapsulated Cf-252. The determination that spontaneous fission of Cf-252 is the source of the radioiodine has several ramifications. Radioactive fission-product isotopes of the noble gas elements krypton and xenon must also be released. Noble gases are more volatile and mobile than iodine. Also, the released iodine isotopes decay to xenon isotopes. The noble gases decay to non-gaseous elements that are transported along with radioiodine to the terrestrial environment by deposition from the SRTC plume. Only Sr-89 is believed to accumulate sufficiently in the environment to approach detectable levels. Given similar conditions in earlier years, releases of short-lived radioiodine have occurred undetected in routine monitoring since the early 1970s. Release rates 20 years ago would have been 200 times greater than current release rates. This report documents preliminary experiments conducted by SRTC and Environmental Monitoring Section (EMS) scientists. The release process and the environmental impact of fission products from Cf-252 should be thoroughly researched

Neutron-neutron angular correlations in spontaneous fission of 252Cf and 240Pu

Science.gov (United States)

Verbeke, J. M.; Nakae, L. F.; Vogt, R.

2018-04-01

Background: Angular anisotropy has been observed between prompt neutrons emitted during the fission process. Such an anisotropy arises because the emitted neutrons are boosted along the direction of the parent fragment. Purpose: To measure the neutron-neutron angular correlations from the spontaneous fission of 252Cf and 240Pu oxide samples using a liquid scintillator array capable of pulse-shape discrimination. To compare these correlations to simulations combining the Monte Carlo radiation transport code MCNPX with the fission event generator FREYA. Method: Two different analysis methods were used to study the neutron-neutron correlations with varying energy thresholds. The first is based on setting a light output threshold while the second imposes a time-of-flight cutoff. The second method has the advantage of being truly detector independent. Results: The neutron-neutron correlation modeled by FREYA depends strongly on the sharing of the excitation energy between the two fragments. The measured asymmetry enabled us to adjust the FREYA parameter x in 240Pu, which controls the energy partition between the fragments and is so far inaccessible in other measurements. The 240Pu data in this analysis was the first available to quantify the energy partition for this isotope. The agreement between data and simulation is overall very good for 252Cf(sf ) and 240Pu(sf ) . Conclusions: The asymmetry in the measured neutron-neutron angular distributions can be predicted by FREYA. The shape of the correlation function depends on how the excitation energy is partitioned between the two fission fragments. Experimental data suggest that the lighter fragment is disproportionately excited.

The temperature of fission fragments from spontaneous fission of {sup 252}Cf measured by time-of-flight spectrometer

Energy Technology Data Exchange (ETDEWEB)

Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R. [Warsaw Univ., Inst. of Experimental Physics, Nuclear Physics Div., Warsaw (Poland)

1997-12-31

The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of {sup 252}Cf. The determination of the temperature was based on the measurement of the neutron spectra. 5 refs, 2 figs.

Prompt neutron fission spectrum mean energies for the fissile nuclides and 252Cf

International Nuclear Information System (INIS)

Holden, N.E.

1985-01-01

The international standard for a neutron spectrum is that produced from the spontaneous fission of 252 Cf, while the thermal neutron induced fission neutron spectra for the four fissile nuclides, 233 U, 235 U, 239 Pu, and 241 Pu are of interest from the standpoint of nuclear reactors. The average neutron energies of these spectra are tabulated. The individual measurements are recorded with the neutron energy range measured, the method of detection as well as the average neutron energy for each author. Also tabulated are the measurements of the ratio of mean energies for pairs of fission neutron spectra. 75 refs., 9 tabs

Estimation of the LET threshold of single event upset of microelectronics in experiments with Cf-252

International Nuclear Information System (INIS)

Kuznetsov, N.V.; Nymmik, R.A.

1996-01-01

A method is proposed for analyzing single event upsets (SEU) in large scale integration circuits of random access memory (RAM) when exposed to Cf-252 fission fragments. The method makes is possible to find the RAM linear energy transfer (LET) threshold to be used for estimations of RAM SEU rates in space. The method is illustrated by analyzing experimental data for the 2 x 8 kbit CMOS/bulk RAM. (author)

Physics of the 252Cf-source-driven noise analysis measurement

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.

1997-01-01

The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement

Detection of alpha particles and Cf-252 fission fragments with solid track detectors and surface barrier detector. Efficiency calculation

International Nuclear Information System (INIS)

Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.E.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.

1990-01-01

A technique for particle detection by using track solid detector and also types of revealing and result analysis are presented concerned to Cf-252 fission fragments detection. Measurements of alpha particles detection efficiency using Makrofol E and surface barrier detector are performed. (L.C.J.A.)

Parameters for several plutonium nuclides and 252Cf of safeguards interest

International Nuclear Information System (INIS)

Zucker, M.S.; Holden, N.E.

1984-01-01

Sets of the neutron emission multiplicity distribution gleaned from the literature for plutonium nuclides and 252 Cf are considered. A methodology for rendering the different sets comparable is presented and used to convert the sets to a common basis such that the differences can be evaluated objectively and that allows realistic estimate of the uncertainties. This in turn permits development of a canonical consensus set in certain instances. Evaluated data on the average neutron multiplicity, the total half-lives, and the half-lives for spontaneous fission are also given. A careful search of the literature reveals that the data on neutron multiplicity distributions for many nuclides is surprisingly sparse, considering that almost thirty years has elapsed since the original pioneering work, which in some cases, yield the only reported value. 93 references, 26 tables

Development of the neutron reference calibration field using a {sup 252}Cf standard source surrounded with PMMA moderators

Energy Technology Data Exchange (ETDEWEB)

Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)

2002-07-01

The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.

Bias in calculated keff from subcritical measurements by the 252Cf-source-driven noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.

1995-01-01

The development of MCNP-DSP, which allows direct calculation of the measured time and frequency analysis parameters from subcritical measurements using the 252 Cf-source-driven noise analysis method, permits the validation of calculational methods for criticality safety with in-plant subcritical measurements. In addition, a method of obtaining the bias in the calculations, which is essential to the criticality safety specialist, is illustrated using the results of measurements with 17.771-cm-diam, enriched (93.15), unreflected, and unmoderated uranium metal cylinders. For these uranium metal cylinders the bias obtained using MCNP-DSP and ENDF/B-V cross-section data increased with subcriticality. For a critical experiment [height (h) = 12.629 cm], it was -0.0061 ± 0.0003. For a 10.16-cm-high cylinder (k ∼ 0.93), it was 0.0060 ± 0.0016, and for a subcritical cylinder (h = 8.13 cm, k ∼ 0.85), the bias was -0.0137 ± 0.0037, more than a factor of 2 larger in magnitude. This method allows the nuclear criticality safety specialist to establish the bias in calculational methods for criticality safety from in-plant subcritical measurements by the 252 Cf-source-driven noise analysis method

Design of a thermal neutron field by 252Cf source for measurement of 10B concentrations in the blood samples for BNCT

International Nuclear Information System (INIS)

Naito, H.; Sakurai, Y.; Maruhashi, A.

2006-01-01

10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)

Comparison of 252Cf time correlated induced fission with AmLi induced fission on fresh MTR reserach reactor fuel

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jay Prakash [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-05-01

The objectives of this project are to calibrate the Advanced Experimental Fuel Counter (AEFC), benchmark MCNP simulations using experimental results, investigate the effects of change in fuel assembly geometry, and finally to show the boost in doubles count rates with 252Cf active soruces due to the time correlated induced fission (TCIF) effect.

Evaluation of the 252Cf-source-driven neutron noise analysis method for measuring the subcriticality of LWR fuel storage casks

International Nuclear Information System (INIS)

Mihalczo, J.T.

1987-01-01

The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed

Spectroscopy of neutron-rich nuclei populated in the spontaneous fission of 252Cf and 248Cm

International Nuclear Information System (INIS)

Smith, A. G.; Simpson, G. S.; Billowes, J.; Durell, J. L.; Phillips, W. R.; Dagnall, P. J.; Freeman, S. J.; Leddy, M.; Roach, A. A.; Smith, J. F.

1999-01-01

In this paper we present research that has been carried out using the Euroball and Eurogam arrays to detect γ rays emitted from spontaneously fissioning 248 Cm and 252 Cf. The paper focuses on three sub-areas of current activity, namely, the measurement of yields of secondary fragment pairs, the measurement of state lifetimes at around spin 10, and recent measurements of g-factors of excited states in fission fragments. (c) 1999 American Institute of Physics

Sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to neutrons emitted by a 252Cf source

International Nuclear Information System (INIS)

Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.

1975-07-01

The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr

Use of californium-252 sources in Hungary for teaching and research

International Nuclear Information System (INIS)

Csikai, J.

1976-01-01

An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)

New isomeric states in 152,154,156Nd produced by spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C.; Belier, G.; Girod, M.; Meot, V.; Peru, S.; Astier, A.; Ducroux, L.; Meyer, M.; Redon, N.

1998-01-01

Isomeric states have been observed in fission-fragments produced by spontaneous fission of 252 Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between γ-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2μs have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the 152,154,156 Nd show evidence for K-isomers. (orig.)

Microarray analysis of DNA damage repair gene expression profiles in cervical cancer cells radioresistant to 252Cf neutron and X-rays

International Nuclear Information System (INIS)

Qing, Yi; Wang, Ge; Wang, Dong; Yang, Xue-Qin; Zhong, Zhao-Yang; Lei, Xin; Xie, Jia-Yin; Li, Meng-Xia; Xiang, De-Bing; Li, Zeng-Peng; Yang, Zhen-Zhou

2010-01-01

The aim of the study was to obtain stable radioresistant sub-lines from the human cervical cancer cell line HeLa by prolonged exposure to 252 Cf neutron and X-rays. Radioresistance mechanisms were investigated in the resulting cells using microarray analysis of DNA damage repair genes. HeLa cells were treated with fractionated 252 Cf neutron and X-rays, with a cumulative dose of 75 Gy each, over 8 months, yielding the sub-lines HeLaNR and HeLaXR. Radioresistant characteristics were detected by clone formation assay, ultrastructural observations, cell doubling time, cell cycle distribution, and apoptosis assay. Gene expression patterns of the radioresistant sub-lines were studied through microarray analysis and verified by Western blotting and real-time PCR. The radioresistant sub-lines HeLaNR and HeLaXR were more radioresisitant to 252 Cf neutron and X-rays than parental HeLa cells by detecting their radioresistant characteristics, respectively. Compared to HeLa cells, the expression of 24 genes was significantly altered by at least 2-fold in HeLaNR cells. Of these, 19 genes were up-regulated and 5 down-regulated. In HeLaXR cells, 41 genes were significantly altered by at least 2-fold; 38 genes were up-regulated and 3 down-regulated. Chronic exposure of cells to ionizing radiation induces adaptive responses that enhance tolerance of ionizing radiation and allow investigations of cellular radioresistance mechanisms. The insights gained into the molecular mechanisms activated by these 'radioresistance' genes will lead to new therapeutic targets for cervical cancer

Neutron beam experiments using nuclear research reactors: honoring the retirement of professor Bernard W. Wehring -II. 5. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient

Teratogenic effect of Californium-252 irradiation in rats

International Nuclear Information System (INIS)

Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro

1989-01-01

The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)

Survey of potential markets for devices using Californium-252

International Nuclear Information System (INIS)

Permar, P.H.

1975-01-01

Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US

In situ prompt gamma-ray measurement of river water salinity in northern Taiwan using HPGe-252Cf probe

International Nuclear Information System (INIS)

Jiunnhsing Chao; Chien Chung

1991-01-01

A portable HPGe- 252 Cf probe dedicated to in situ survey of river water salinity was placed on board a fishing boat to survey the Tamsui River in northern Taiwan. The variation of water salinity is surveyed by measuring the 6111 keV chlorine prompt photopeak along the river. Results indicate that the probe can be used as a salinometer for rapid, in situ measurement in polluted rivers or sea. (author)

Investigation of short-living fission products from the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Klonk, H.

1976-01-01

In this paper, a method of separating and measuring fission products of Cf-252 is presented. The measurement was achieved by means of γ-spectrometry and thus provides a quantitative analysis with a good separation of the fission products with respect to both atomic number Z and mass number A. The separation of the fission products from the fission source was achieved by means of solid traps. An automatic changing apparatus made it possible to keep irradiation and measuring times short, so even very short-lived fission products could be registered. The quantitative evaluation of primary fission products was made possible by correction according to Bateman equations. With that, the yields of single nuclides and the dispersion of charge can be determined. (orig./WL) [de

Brachytherapy

Science.gov (United States)

... the use of a type of energy, called ionizing radiation, to kill cancer cells and shrink tumors. External ... In all cases of brachytherapy, the source of radiation is encapsulated ... non-radioactive metallic capsule. This prevents the radioactive materials ...

Neutron calibration field of bare {sup 252}Cf source in Vietnam

Energy Technology Data Exchange (ETDEWEB)

Le, Ngoc Thiem; Tran, Hoai Nam; Nguyen, Khai Tuan [Institute for Nuclear Science and Technology, Hanoi (Viet Nam); Trinh, Glap Van [Institute of Research and Development, Duy Tan University, Da Nang (Viet Nam)

2017-02-15

This paper presents the establishment and characterization of a neutron calibration field using a bare {sup 252}Cf source of low neutron source strength in Vietnam. The characterization of the field in terms of neutron flux spectra and neutron ambient dose equivalent rates were performed by Monte Carlo simulations using the MCNP5 code. The anisotropy effect of the source was also investigated. The neutron ambient dose equivalent rates at three reference distances of 75, 125, and 150 cm from the source were calculated and compared with the measurements using the Aloka TPS-451C neutron survey meters. The discrepancy between the calculated and measured values is found to be about 10%. To separate the scattered and the direct components from the total neutron flux spectra, an in-house shadow cone of 10% borated polyethylene was used. The shielding efficiency of the shadow cone was estimated using the MCNP5 code. The results confirmed that the shielding efficiency of the shadow cone is acceptable.

Influence of paternal 252Cf neutron exposure on abnormal sperm, embryonal lethality, and liver tumorigenesis in the F1 offspring of mice

International Nuclear Information System (INIS)

Watanabe, Hiromitsu; Takahashi, Tadateru; Lee, Juing-Yi

1996-01-01

Experiments were conducted to determine whether neutron-induced genetic damage in parental germline cells can lead to the development of cancer in the offspring. Seven-week-old C3H male mice were irradiated with 252 Cf neutrons at a dose of 0, 50, 100, or 200 cGy. Two weeks or 3 months after irradiation, the male mice were mated with virgin 9-week-old C57BL females. Two weeks after irradiation, the irradiated male mice showed an increased incidence of sperm abnormalities, which led to embryo lethalities in a dose-dependent manner when they were mated with unirradiated female mice. Furthermore, liver tumors in male offspring of male mice in the 50 cGy group were significantly increased in 19 of 44 (43.2%) animals, in clear contrast to the unirradiated group (1 of 31; 3.2%) (P 1 generation may be caused by genetic transmission of hepatoma-associated trait (s) induced by 252 Cf neutron irradiation. (author)

Californium-252 sales and loans at Oak Ridge National Laboratory

International Nuclear Information System (INIS)

King, L.J.

1987-01-01

The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments

International Nuclear Information System (INIS)

Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.

1983-11-01

Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)

Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission

Energy Technology Data Exchange (ETDEWEB)

Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)

1998-12-01

Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}

Calculation of neutron spectra for a 252Cf transport cask using ANISN running on a PC

International Nuclear Information System (INIS)

West, L.; Akin, B.P.; Lemley, E.C.

1995-01-01

Neutron spectra have been calculated using the ANISN one-dimensional discrete ordinates code for the case of a 152 Cf source in a transport cask of a particular design. All computations were done on personal computers (PCs) (mostly 486 models) with the ANISN-ORNL (486 version) computer code. With a source of 252 Cf fission neutrons, the neutron flux spectrum in the cask cannot be characterized as open-quotes moderated.close quotes Concern about an appropriate choice for the cross-section data set has led to a comparison, for this application, of three different cross-section libraries: DABL, HILO, and BUGLE-80. Although the cross-section sets were not originally designed for PC use, the libraries have been successfully employed for PC computations. Work with yet another data library, BUGLE-93, is incomplete at this stage. From neutron flux spectra on the surface of the cask, personnel dosimetric quantities (such as dose equivalent) have been determined for the DABL, HILO, and BUGLE-80 ANISN calculations

A search for back-to-back e+e- pairs in the spontaneous-fission disintegration of 252Cf

International Nuclear Information System (INIS)

Tsunoda, T.; Nakamura, S.; Orito, S.; Minowa, M.

1995-01-01

A back-to-back electron-positron pair is searched for in spontaneous-fission disintegration of 252 Cf. The emission of such a pair, if observed, might be a manifestation of production and prompt decay of a heretofore unknown neutral particle. The emission rate of such a pair is found to be less than (2.5-5.5) . 10 -10 per fission at the 95% confidence level depending on the mass of the hypothetical particle which is between 40 and 200 MeV/c 2 . (orig.)

Application of californium-252 neutron sources for analytical chemistry

International Nuclear Information System (INIS)

Ishii, Daido

1976-01-01

The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)

The use of polyimide foils to prevent contamination from self-sputtering of {sup 252}Cf deposits in high-accuracy fission counting

Energy Technology Data Exchange (ETDEWEB)

Gilliam, David M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail: david.gilliam@nist.gov; Yue, Andrew [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Scott Dewey, M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)

2008-06-01

It is demonstrated that a thin polyimide foil can be employed to prevent contamination from the self-sputtering of a {sup 252}Cf source under vacuum, with small energy loss of the emitted fission fragments, with very small effect on the efficiency of counting the fission fragments, and with a long lifetime of the plastic foils.

Study of scission shapes in spontaneous ternary fission of 252Cf

International Nuclear Information System (INIS)

Singer, P.; Schwalm, D.; Thirolf, P.; Goennenwein, F.; Hesse, M.

1995-06-01

A new kinematic study on the ternary fission of 252 Cf has been conducted by registering prompt neutrons and fission γ rays coincidence with light charged particles (LCP) and fission fragments. The aim is to investigate changes in fragment deformation energy between the binary and ternary fission modes from measured prompt neutron angular distributions and multiplicities, and to explore the influence of light particle emission on the energy distribution, multiplicity and angular anisotropy of γ rays emitted during fragment de-excitation. The experiment was performed at the MPI Heidelberg using the Darmstadt-Heidelberg crystal ball spectrometer as γ-ray and neutron detector. Fragments were identified by a double-E measurement with an angular sensitive twin ionization chamber (IC). Light charged particles from fission were measured by ΔE-E telescopes composed of ΔE ICs and silicon PIN diodes. The telescopes enable to identify various LCPs which are emitted much more rarely than ternary α particles. The parameters of the experiment and the method of data analysis are described and first results presented. (orig.)

Importance of the elemental composition in brachytherapy with neutrons

International Nuclear Information System (INIS)

Paredes G, L.; Balcazar G, M.; Azorin N, J.; Francois L, J.L.

2004-01-01

An analysis is presented of as the small differences that exist in the elementary composition of the wicked tumors, healthy fabrics and some material substitutes of fabric employees in dosimetry, they generate variations in the value of the kerma coefficient and consequently in the absorbed dose of neutrons in the interval 11 eV to 29 MeV. These differences make that the coefficient of kerma of neutrons average for the considered wicked tumors, be between 6% and 7% smaller that the coefficient of kerma of neutrons average for soft fabric, in the interval of interest in therapy with quick neutrons. These results have a special importance during the process of planning of brachytherapy treatments with sources of 252 Cf, to optimize and to individualize the treatments to the patients. (Author)

Neutron gauging applications using a small 252Cf source

International Nuclear Information System (INIS)

Helf, S.

1975-01-01

The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)

Measurement of Neutron Energy Spectrum Emitted by Cf-252 Source Using Time-of-Flight Method

Energy Technology Data Exchange (ETDEWEB)

Lee, Cheol Ho; Son, Jaebum; Kim, Tae Hoon; Lee, Sangmin; Kim, Yong-Kyun [Hanyang University, Seoul (Korea, Republic of)

2016-10-15

The techniques proposed to detect the neutrons usually require the detection of a secondary recoiling nucleus in a scintillator (or other type of detector) to indicate the rare collision of a neutron with a nucleus. This is the same basic technique, in this case detection of a recoil proton that was used by Chadwick in the 1930 s to discover and identify the neutron and determine its mass. It is primary technique still used today for detection of fast neutron, which typically involves the use of a hydrogen based organic plastic or liquid scintillator coupled to a photo-multiplier tube. The light output from such scintillators is a function of the cross section and nuclear kinematics of the n + nucleus collision. With the exception of deuterated scintillators, the scintillator signal does not necessarily produce a distinct peak in the scintillator spectrum directly related to the incident neutron energy. Instead neutron time-of-flight (TOF) often must be utilized to determine the neutron energy, which requires generation of a prompt start signal from the nuclear source emitting the neutrons. This method takes advantage of the high number of prompt gamma rays. The Time-of-Flight method was used to measure neutron energy spectrum emitted by the Cf-252 neutron source. Plastic scintillator that has a superior discrimination ability of neutron and gamma-ray was used as a stop signal detector and liquid scintillator was used as a stat signal detector. In experiment, neutron and gamma-ray spectrum was firstly measured and discriminated using the TOF method. Secondly, neutron energy spectrum was obtained through spectrum analysis. Equation of neutron energy spectrum that was emitted by Cf-252 source using the Gaussian fitting was obtained.

Prompt neutron spectrum of the spontaneous fission of californium-252

International Nuclear Information System (INIS)

Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.

1976-01-01

The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

Charge distribution in the ternary fragmentation of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)

2017-08-15

We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)

High sensitivity isotope analysis with a 252Cf--235U fueled subcritical multiplier and low background photon detector systems

International Nuclear Information System (INIS)

Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.

1976-09-01

A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent

Project 252Cf-D2O. The multisphere system of neutron dosimetry and spectrometry (M.S.-N.D.S.). Studies of applications to health physics

International Nuclear Information System (INIS)

Zaborowski, H.L.

1976-10-01

The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr

New isomeric states in {sup 152,154,156}Nd produced by spontaneous fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C. [Commissariat l`Energie Atomique de Saclay, Gif sur Yvette (France). DSM/DAPINA/SPhN; Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires de Bordeaux-Gradignan, Domaine du Haut Vigneau, F-33175 Gradignan (France); Belier, G.; Girod, M.; Meot, V.; Peru, S. [Commissariat a l`Energie Atomique de Bruyeres-le-Chatel, DAM/SPN, BP12, F-91680 Bruyeres-le-Chatel (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Institut de Physique Nucleaire de Lyon, F-69622 Villeurbanne Cedex (France)

1998-04-01

Isomeric states have been observed in fission-fragments produced by spontaneous fission of {sup 252}Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between {gamma}-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2{mu}s have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the {sup 152,154,156}Nd show evidence for K-isomers. (orig.) With 8 figs., 27 refs.

Analysis of the boron pile measurement of the average neutron yield per fission of 252Cf: (AWBA development program)

International Nuclear Information System (INIS)

Ullo, J.J.

1977-08-01

The Harwell Boron Pile measurement of the average number of prompt neutrons emitted per fission, ν-bar/sub p/, of 252 Cf was analyzed in detail by a Monte Carlo method. From the calculated energy dependence of the neutron detection efficiency a value of ν-bar/sub p/ = 3.733 +- 0.022 was obtained. This value is 0.76 percent higher than the original reported value of 3.705 +- 0.015. Possible causes for this increase are discussed. 3 figures, 6 tables

Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation

International Nuclear Information System (INIS)

Fasso, A.; Ipe, N.E.; Reyna, A.

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation

Time-of-flight mass spectrometer with 252Cf surface ionisation coupled with high-pressure liquid chromatography for determining pharmaceutical substances in the blood

International Nuclear Information System (INIS)

Danigel, H.

1983-01-01

Cf-252 PDMS is well suited for routine applications and can be combined with HPLC. This combined analytical system can be used for measuring the concentrations of pharmaceutical substances in body fluids on the basis of an internal standard. The results (pharmacokinetics, metabolism) indicate the necessary therapeutical dose and the efficacy of the substance applied. (DG) [de

Study of ternary and quaternary spontaneous fission of 252Cf with the NESSI detector

International Nuclear Information System (INIS)

Tishchenko, V.G.; Jahnke, U.; Herbach, C.M.; Hilscher, D.

2002-11-01

Ternary and quaternary spontaneous decay of 252 Cf was studied with the NESSI detector, a combination of two 4π detectors for charged particles, neutrons and γ-rays. The applied method of particle identification by measuring the energies and relative time-of-flights of the decay products is shown to be very effective for the study of rare decay modes. The energy and angular distributions of the decay products, the associated neutron multiplicities, the total energy of the prompt γ-radiation as well as correlations between the various observables were measured for the first time in a single full-scale experiment. The characteristics of ternary fission known from previous investigations are confirmed in the frame of a methodically independent experiment. Preliminary estimates of the quaternary fission yield are presented. An attempt is made to determine the mechanism of quaternary fission. (orig.)

{sup 252}Cf spontaneous prompt fission neutron spectrum measured at 0 degree and 180 degree relative to the fragment motion

Energy Technology Data Exchange (ETDEWEB)

Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)

1994-09-01

The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.

Absolute measurement of ν/sub p/-bar for 252Cf by the large liquid scintillator tank technique

International Nuclear Information System (INIS)

Spencer, R.R.

1979-01-01

A vigorous effect to dispel the scandal of the approx. 2% dispersion in reported experimental values of 252 Cf ν-bar, the average number of neutrons emitted in spontaneous fission, has been underway over the past 5 years. The goal is to reduce the uncertainty in this fundamental parameter to the +- 0.25% level needed for reactor physics applications. Both new measurements and revaluation of older measurements are involved. At ORNL a new measurement is being carried out using the leage liquid scintillator neutron detector. Findings of the most recent experiment, incorporating improvements suggested in a preliminary study are discussed. 6 figures, 2 tables

Possibilities of activation analysis with 252Cf sources in the area of earth sciences and mining prospection

International Nuclear Information System (INIS)

Melky, Sami.

1975-01-01

The 252 Cf neutron activation experimental set-up is composed of four sources of 225μg each, symmetrically disposed with regard to the sample axis. This installation permits the irradiation of 5 to 40cm 3 of ores, so that the analysis is done on sample weighing about 100g. This method allows, not only the determination of major and minor constituents in the sample, but also the determination of some trace elements. The experimental sensitivity of some important elements are given in mining prospection and it is shown that direct gamma spectrometry after activation permits a fast and precise determination of many elements in ores [fr

Californium-252 progress, report No. 7, April 1971

Energy Technology Data Exchange (ETDEWEB)

1971-12-31

This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

SU-F-T-54: Determination of the AAPM TG-43 Brachytherapy Dosimetry Parameters for A New Titanium-Encapsulated Yb-169 Source by Monte Carlo Calculations

Energy Technology Data Exchange (ETDEWEB)

Reynoso, F [UT MD Anderson Cancer Center, Houston, TX (United States); Washington University School of Medicine, St. Louis, MO (United States); Munro, J [Source Production & Equipment Co., Inc., St. Rose, LA (United States); Cho, S [UT MD Anderson Cancer Center, Houston, TX (United States)

2016-06-15

Purpose: To determine the AAPM TG-43 brachytherapy dosimetry parameters of a new titanium-encapsulated Yb-169 source designed to maximize the dose enhancement during gold nanoparticle-aided radiation therapy (GNRT). Methods: An existing Monte Carlo (MC) model of the titanium-encapsulated Yb-169 source, which was described in the current investigators’ published MC optimization study, was modified based on the source manufacturer’s detailed specifications, resulting in an accurate model of the titanium-encapsulated Yb-169 source that was actually manufactured. MC calculations were then performed using the MCNP5 code system and the modified source model, in order to obtain a complete set of the AAPM TG-43 parameters for the new Yb-169 source. Results: The MC-calculated dose rate constant for the new titanium-encapsulated Yb-169 source was 1.05 ± 0.03 cGy per hr U, indicating about 10% decrease from the values reported for the conventional stainless steel-encapsulated Yb-169 sources. The source anisotropy and radial dose function for the new source were found similar to those reported for the conventional Yb-169 sources. Conclusion: In this study, the AAPM TG-43 brachytherapy dosimetry parameters of a new titanium-encapsulated Yb-169 source were determined by MC calculations. The current results suggested that the use of titanium, instead of stainless steel, to encapsulate the Yb-169 core would not lead to any major change in the dosimetric characteristics of the Yb-169 source, while it would allow more low energy photons being transmitted through the source filter thereby leading to an increased dose enhancement during GNRT. Supported by DOD/PCRP grant W81XWH-12-1-0198 This investigation was supported by DOD/PCRP grant W81XWH-12-1- 0198.

Health physics aspects of 252Cf

International Nuclear Information System (INIS)

Bhagwat, A.M.

1974-01-01

After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)

Characterization of neutron spectra using sources of {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderated in water; Caracterização de espectros neutrônicos com fontes de {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderados em água

Energy Technology Data Exchange (ETDEWEB)

Gonçalves, A.S.; Silva, F.S.; Patrão, K.C.S.; Fonseca, E.S. da; Pereira, W.W., E-mail: angela.souzagon@gmail.com [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Laboratório de Metrologia de Nêutrons

2017-07-01

Recent studies have demonstrated the importance of characterizing the spectrum of neutron sources for various energies in order to make the understanding of neutron interaction closer to reality they work with. This work presents the determination of neutron energy flux from the source of {sup 241}AmBe (0.6 TBq), {sup 238}PuBe (1.8 TBq) and {sup 252}Cf (120 μg) free in the air and inserted into spheres of various diameters containing distilled water. The determination of the spectrum is based on the measurement and simulation by the Monte Carlo computational method, using the sources under study, with the Bonner multisphere spectrometer containing readings with the detector without sphere and covered with polyethylene balls of diameters: 5,08 cm (2 ″), 7.62 cm (3″), 12.70 cm (5 ″), 20.32 cm (8 ″), 25.40 cm (10 ″) and 30.48 cm (12 ″). It is sought to characterize a new moderate spectrum in water using the sources of {sup 241}AmBe, {sup 238}PuBe and {sup 252}Cf that may be useful for testing, calibration and irradiation of individual and area monitors for neutrons.

Investigation of the characteristics of 252Cf-detectors

International Nuclear Information System (INIS)

Karlsson, Erik

2004-12-01

In the first chapter the characteristic behaviors of two Cf detectors have been investigated by performing pilot measurements. The detector with the stronger source gives an unstable signal with a low signal/noise ratio. Therefore this detector has not been further investigated. The ionization chamber reacts on both fission products and alpha decay. An energy experiment showed that there were large difficulties to separate those decays. A plastic scintillator, which reacts on both photons and neutrons, was used for neutron detection. Energy spectrums were performed and the result showed that it is difficult to set an energy threshold to separate the neutrons and the photons. The discrimination will rather be achieved by time of flight methods which is discussed under the second chapter in this thesis; Experimental results. An other experiment was done in order to investigate whether it is possible to detect any delayed components from the spontaneous fission of Cf. The result showed that delayed components existed. Either they are delayed neutrons from exited fission products, or it is some delay related to the charge collection in the Cf detector. Correlation measurements showed that few events are coincident. Only 50% of the signals from the plastic scintillator are correlated with the Cf source

Gamma-ray multiplicity distribution in ternary fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Jandel, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Kliman, J [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Krupa, L [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Morhac, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Hamilton, J H [Department of Physics, Vanderbilt University, Nashville, TN (United States); Kormicki, J [Department of Physics, Vanderbilt University, Nashville, TN (United States); Ramayya, A V [Department of Physics, Vanderbilt University, Nashville, TN (United States); Hwang, J K [Department of Physics, Vanderbilt University, Nashville, TN (United States); Luo, Y X [Department of Physics, Vanderbilt University, Nashville, TN (United States); Fong, D [Department of Physics, Vanderbilt University, Nashville, TN (United States); Gore, P [Department of Physics, Vanderbilt University, Nashville, TN (United States); Akopian, G M Ter; Oganessian, Yu Ts; Rodin, A M; Fomichev, A S; Popeko, G S; Daniel, A V [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna (Russian Federation); Rasmussen, J O; Macchiavelli, A O [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Stoyer, M A [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R [Instituto de Fisica, Universidade Federal do Rio de Janeiro, 21945-970 Rio de Janeiro (Brazil); Cole, J D [Idaho National Engineering and Environmental Laboratory, Idaho Falls, ID (United States)

2002-12-01

From multiparameter data obtained at Lawrence Berkeley National Laboratory, the integral characteristics of the prompt {gamma}-ray emission were extracted for tripartition of {sup 252}Cf with He, Be and C being the third light charged particle. We used multifold {gamma}-ray coincidence spectra for the determination of {gamma}-ray multiplicities assuming a Gaussian distribution for {gamma}-ray multiplicity. The multiplicity distribution characteristics, i.e. mean multiplicity and its dispersion were obtained by minimizing with respect to the calculated values of probabilities of multifold {gamma}-ray coincidences using a combinatoric method. Comparison with the known experimental data from binary fission was made. Further, we investigated dependencies of the mean {gamma}-ray multiplicity on the kinetic energy of the light charged particle. The mean {gamma}-ray multiplicity for He ternary fission is found to increase rapidly with increasing kinetic energy of He in the region less than 11 MeV and then decrease slowly with increasing kinetic energy of He. The anomalous behaviour of {gamma}-ray emission is discussed. The mean {gamma}-ray multiplicity was determined for the first time for Be and C ternary fission. For Be, the {gamma}-ray multiplicity as a function of kinetic energy was obtained as well.

Shielding of radiation fields generated by {sup 252}Cf in a concrete maze. Part 2 -- Simulation

Energy Technology Data Exchange (ETDEWEB)

Fasso, A.; Ipe, N.E.; Reyna, A. [Stanford Univ., CA (US). Stanford Linear Accelerator Center; McCall, R.C. [McCall Associates, Woodside, CA (US)

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare {sup 252}Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation.

Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas

International Nuclear Information System (INIS)

Maruyama, J.; Beach, J.L.; Nagell, J.R. van

1984-01-01

Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de

Historical review of californium-252 discovery and development

International Nuclear Information System (INIS)

Stoddard, D.H.

1985-01-01

This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

Multielemental nondestructive neutron activation analysis of Dy, Mn, Eu, Na, Ga, W, La and Sm involving cyclic irradiations with 252Cf

International Nuclear Information System (INIS)

Narkhede, S.S.; Turel, Z.R.

1995-01-01

Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs

Determination of the average number of neutrons per fission event for californium-252

International Nuclear Information System (INIS)

Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.

1982-01-01

By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)

Structures of the neutron-rich nuclei observed in fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Ramayya, A. V.; Hamilton, J. H.; Goodin, C. J.; Brewer, N. T.; Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Luo, Y. X. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Liu, S. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and UNRIB/Oak Ridge Associated Universities, Oak Ridge, Tennessee 37831 (United States); Rasmussen, J. O.; Lee, I. Y. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Stone, N. J. [Department of Physics, Oxford University, Oxford OX1 3PU (United Kingdom); Daniel, A. V. [Flerov Laboratory of Nuclear Reactions, JINR, Dubna (Russian Federation); Zhu, S. J. [Department of Physics, Tsinghua University, Beijing 100084 (China)

2014-08-14

Analysis of high statistics triple coincidence fission γ data from {sup 252}Cf at Gammasphere including angular correlations yielded well-expanded high-spin level schemes with more complete and reliable spin/parity assignments for {sup 82}Ge, {sup 118,120,122}Cd and {sup 114,115}Rh. Both the quasi-particle/hole couplings and quasi-rotational degrees of freedom are implied to play roles in these Cd isotopes. Evidence for triaxial shapes and octupole components in the Cd isotopes is presented. These Cd isotopes may have triaxial deformations. High-spin level schemes of {sup 114,115}Rh have been established for the first time. The existence of a relatively large signature splitting and an yrare band shows typical features of a triaxially deformed nucleus. Possible excited deformed rotational bands are observed, for the first time, in {sup 82}Ge. From the multipole mixing ratio measurement, the ground state configurations of {sup 109,111}Ru, as well as excited states in {sup 103,107}Mo and {sup 111}Ru were determined.

Transport-level description of the 252Cf-source method using the Langevin technique

International Nuclear Information System (INIS)

Stolle, A.M.; Akcasu, A.Z.

1991-01-01

The fluctuations in the neutron number density and detector outputs in a nuclear reactor can be analyzed conveniently by using the Langevin equation approach. This approach can be implemented at any level of approximation to describe the time evolution of the neutron population, from the most complete transport-level description to the very basic point reactor analysis of neutron number density fluctuations. In this summary, the complete space- and velocity-dependent transport-level formulation of the Langevin equation approach is applied to the analysis of the 252 Cf-source-driven noise analysis (CSDNA) method, an experimental technique developed by J.T. Mihalczo at Oak Ridge National Laboratory, which makes use of noise analysis to determine the reactivity of subcritical media. From this analysis, a theoretical expression for the subcritical multiplication factor is obtained that can then be used to interpret the experimental data. Results at the transport level are in complete agreement with an independent derivation performed by Sutton and Doub, who used the probability density method to interpret the CSDNA experiment, but differed from other expressions that have appeared in the literature

Resistive plate chamber neutron and gamma sensitivity measurement with a {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Abbrescia, M.; Altieri, S.; Baratti, V.; Barnaba, O.; Belli, G.; Bruno, G.; Colaleo, A.; DeVecchi, C.; Guida, R. E-mail: roberto.guida@pv.infn.it; Iaselli, G.; Imbres, E.; Loddo, F.; Maggi, M.; Marangelli, B.; Musitelli, G.; Nardo, R.; Natali, S.; Nuzzo, S.; Pugliese, G.; Ranieri, A.; Ratti, S.; Riccardi, C.; Romano, F.; Torre, P.; Vicini, A.; Vitulo, P.; Volpe, F

2003-06-21

A bakelite double gap Resistive Plate Chamber (RPC), operating in avalanche mode, has been exposed to the radiation emitted from a {sup 252}Cf source to measure its neutron and gamma sensitivity. One of the two gaps underwent the traditional electrodes surface coating with linseed oil. RPC signals were triggered by fission events detected using BaF{sub 2} scintillators. A Monte Carlo code, inside the GEANT 3.21 framework with MICAP interface, has been used to identify the gamma and neutron contributions to the total number of collected RPC signals. A neutron sensitivity of (0.63{+-}0.02)x10{sup -3} (average energy 2 MeV) and a gamma sensitivity of (14.0{+-}0.5)x10{sup -3} (average energy 1.5 MeV) have been measured in double gap mode. Measurements done in single gap mode have shown that both neutron and gamma sensitivity are independent of the oiling treatment.

A search for fine structure of the time-of-flight spectrum of the fission neutrons of 252Cf

International Nuclear Information System (INIS)

Scobie, J.; Scott, R.D.; Feather, N.; Vass, D.G.

1977-01-01

A standard time-of-flight arrangement, in which start pulses were supplied by fission fragments and stop pulses by neutrons, has been employed in an attempt to check recent claims of the existence of fine structures in the time-of-flight spectrum of the fission neutrons of 252 Cf. This structure, in the form of spikes with tails towards longer times, has been attributed to the emission of neutrons of short delay (with half-lives of a few to a hundred or so nanoseconds) in the fission process. It has not been possible to find any convincing evidence for the existence of such structure. (author)

Distinct difference in relative biological effectiveness of 252Cf neutrons for the induction of mitotic crossing over and intragenic reversion of the white-ivory allele in Drosophila melanogaster

International Nuclear Information System (INIS)

Yoshikawa, Isao; Hoshi, Masaharu; Ikenaga, Mituo

1996-01-01

The relative biological effectiveness (RBE) of 252 Cf neutrons was determined for two different types of somatic mutations, i.e., loss of heterozygosity for wing-hair mutations and reversion of the mutant white-ivory eye-color, in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change in the white locus on the X-chromosome. For a quantitative comparison of RBE values for these events, we have constructed a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clones can be detected simultaneously in the same individuals. Larvae were irradiated at the age of 80±4 h post-oviposition with 252 Cf neutrons or 137 Cs γ-rays, and male adult flies were examined under the microscope for the presence of the two types of clonal mosaic spots appearing. The induction of wing-hair spots per dose unit was much greater for 252 Cf neutrons than for 137 Cs γ -rays, whereas the frequencies of eye-color reversion were similar for neutrons and γ-rays. The estimated RBE values of neutrons were 8.5 and 1.2 for the induction of mutant wing-hair spots and revertant eye-color spots, respectively. These results indicate that the RBE of neutrons is much greater for mitotic crossing over in comparison to the intragenic white-ivory reversion events. Possible causes for the difference in RBE are discussed

Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory

International Nuclear Information System (INIS)

Martin, R.C.; Laxson, R.R.; Knauer, J.B.

1996-01-01

The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests

Measurements of gamma-ray dose from a moderated 252Cf source

International Nuclear Information System (INIS)

McDonald, J.C.; Griffith, R.V.; Plato, P.; Miklos, J.

1983-06-01

The gamma-ray dose fraction from a moderated 252 Cf source was determined by using three types of dosimetry systems. Measurements were carried out in air at a distance of 35 cm from the surface of the moderating sphere (50 cm from the source which is at the center of the sphere) to the geometrical center of each detector. The moderating sphere is 0.8-mm-thick stainless steel shell filled with D 2 O and covered with 0.5 mm of cadmium. Measurements were also carried out with instruments and dosimeters positioned at the surface of a 40 cm x 40 cm x 15 cm plexiglass irradiation phantom whose front surface was also 35 cm from the surface of the moderating sphere. A-150 tissue-equivalent (TE) plastic ionization chambers and a TE proportional counter (TEPC) were used to measure tissue dose, from which the neutron dose equivalent was computed. The ratio of gamma-ray dose to the neutron dose equivalent was determined by using a relatively neutron-insensitive Geiger-Mueller (GM) counter and thermoluminescent dosimeters (TLD). In addition, the event-size spectrum measured by the TEPC was also used to compute the gamma-ray dose fraction. The average value for the ratio of gamma-ray dose to neutron dose equivalent was found to be 0.18 with an uncertainty of about +-18%

Nuclear isomerism in fission fragments produced by the spontaneous fission of {sup 252}Cf; Isomerisme nucleaire dans les fragments de fission produits dans la fission spontanee du {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C

1997-09-01

This thesis is devoted to the study of the nuclear structure of neutron-rich nuclei, via the search of isomeric nuclear states. Neutron-rich nuclei were produced in the spontaneous fission of {sup 252}Cf. The experimental study of isomeric states in these nuclei was performed with the {gamma}-array EUROGAM II, coupled to an additional and original fission fragment detector composed by photovoltaic cells, SAPhIR. The photovoltaic cells are well adapted to detect low energy heavy ions and have good energy and time resolutions to obtain a good fission fragment detection. This experiment led to the discovery of new isomeric states in {sup 135}Xe, {sup 104}Mo, {sup 146,147,148}Ce and {sup 152,154,156}Nd, with lifetimes between 60 ns and 2 {mu}s. Level schemes of these nuclei have been completed. An interpretation of the isomeric states in the nuclei {sup 154,156}Nd and {sup 156,158}Sm was performed by Hartree-Fock-Bogolyubov calculations using the DIS Gogny force with two quasi-particles excitations. The confrontation with the experimental results led to an interpretation of these isomeric states as K-isomers. (author)

Standard test method for nondestructive assay of nuclear material in scrap and waste by passive-Active neutron counting using 252Cf shuffler

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 This test method covers the nondestructive assay of scrap and waste items for U, Pu, or both, using a 252Cf shuffler. Shuffler measurements have been applied to a variety of matrix materials in containers of up to several 100 L. Corrections are made for the effects of matrix material. Applications of this test method include measurements for safeguards, accountability, TRU, and U waste segregation, disposal, and process control purposes (1, 2, 3). 1.1.1 This test method uses passive neutron coincidence counting (4) to measure the 240Pu-effective mass. It has been used to assay items with total Pu contents between 0.03 g and 1000 g. It could be used to measure other spontaneously fissioning isotopes such as Cm and Cf. It specifically describes the approach used with shift register electronics; however, it can be adapted to other electronics. 1.1.2 This test method uses neutron irradiation with a moveable Cf source and counting of the delayed neutrons from the induced fissions to measure the 235U equiva...

Analysis of existing data and specification of an experiment to determine the 252Cf half-life to the required degree of accuracy

International Nuclear Information System (INIS)

Lorenz, A.; Kharitonov, I.A.

1994-02-01

The methods used and the results obtained in measurements of the 252 Cf half-life are analyzed. In calculating the weighted mean value, additional error components as well as those given by the authors are taken into account. In order to reduce the error in the weighted mean value to less than 0.1%, the need and the requirements for an exact measurement are specified. A half-life of 2.6473±0.0028 years is recommended. (author). 16 refs, 3 tabs

Thermal neutron imaging with rare-earth-ion-doped LiCaAlF6 scintillators and a sealed 252Cf source

International Nuclear Information System (INIS)

Kawaguchi, Noriaki; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei; Fukuda, Kentaro; Suyama, Toshihisa; Watanabe, Kenichi; Yamazaki, Atsushi; Chani, Valery; Yoshikawa, Akira

2011-01-01

Thermal neutron imaging with Ce-doped LiCaAlF 6 crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF 6 scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF 6 single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm 2 was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The 252 Cf source ( 6 .

Definitive Brachytherapy for Kaposi's Sarcoma

International Nuclear Information System (INIS)

Williams, A.; Ezzell, G.; Zalupski, M.; Fontanesi, J.

1996-01-01

Purpose: To assess the efficacy and possible complications in patients diagnosed with Kaposi's sarcoma and treated with definitive brachytherapy. Methods and Materials: Between January, 1995 and December, 1995, four patients with Kaposi's sarcoma (KS) were treated with brachytherapy. Three patients, all with positive HIV status were treated using Iridium 192 (Ir-192) sources via a high-dose rate remote afterloader. One patient with endemic KS was treated using the application of catheters loaded with Californium 252. Eight sites were treated and included scalp, feet, nose, penis, hand, neck, and back. Dose rate for Ir-192 was 330cGy/fx to a total dose of 990cGy. The Californium was delivered as 100nGy/b.i.d. to a total dose of 900nGy. Follow-up as ranged from 2-6 months. Results: All four patients remain alive. Seven of eight sites have had complete clinical response and each patient has reported durable pain relief that has not subsided through last follow-up of 1/96. Two of eight sites, both treated with surface mold technique with Californium 252 developed moist desquamation. The remaining six sites did not demonstrate significant toxicity. Conclusion: Brachytherapy can offer Kaposi's sarcoma patients results that are equivalent to external beam radiation therapy, with minimal complications, a shorter treatment time and potential cost effectiveness

Californium-252 Program Equipment Evaluation

Energy Technology Data Exchange (ETDEWEB)

Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-12-01

To successfully continue the ²⁵²Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

Experimental research on specific activity of 24Na using Chinese reference man phantom irradiated by 252Cf neutrons source

International Nuclear Information System (INIS)

Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan

2011-01-01

Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)

Long-term effects of an intracavitary treatment with californium-252 on normal tissue

International Nuclear Information System (INIS)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra

Study of fission mechanism with the reactions 230Th, 231Pa, 235U, 237Np(n,f) and 252Cf(fs)

International Nuclear Information System (INIS)

Benfoughal, T.

1983-01-01

In this work, the different stages of the nuclear fission process have been investigated. The analysis of fission cross-section and fission fragment angular distribution measurements are made using the hypothesis of asymmetrically deformed states. From the correlation between fissioning nucleus excitation energy and fragment total kinetic energy measurement for several fissioning systems, it is shown that the nuclear viscosity is relatively strong during the saddle-point to scission-point transition. The study of the spontaneous fission of 252 Cf shows that the fragment mass and kinetic energy distributions are mainly determinated by the nucleon shell effects and pairing correlations [fr

252Cf-source-correlated transmission measurements for uranyl fluoride deposit in a 24-in.-OD process pipe

International Nuclear Information System (INIS)

Uckan, T.; Mihalczo, J.T.; Valentine, T.E.; Mullens, J.A.

1998-01-01

Characterization of a hydrated uranyl fluoride (UO 2 F 2 ·nH 2 O) deposit in a 17-ft-long, 24-in.-OD process pipe at the former Oak Ridge Gaseous Diffusion Plant was successfully performed by using 252 Cf-source-correlated time-of-flight (TOF) transmission measurements. These measurements of neutrons and gamma rays through the pipe from an external 2521 Cf fission source were used to measure the deposit profile and its distribution along the pipe, the hydration (or H/U), and the total uranium mass. The measurements were performed with a source in an ionization chamber on one side of the pipe and detectors on the other. Scanning the pipe vertically and horizontally produced a spatial and time-dependent radiograph of the deposit in which transmitted gamma rays and neutrons were separated in time. The cross-correlation function between the source and the detector was measured with the Nuclear Weapons Identification System. After correcting for pipe effects, the deposit thickness was determined from the transmitted neutrons and H/U from the gamma rays. Results were consistent with a later intrusive observation of the shape and the color of the deposit; i.e., the deposit was annular and was on the top of the pipe at some locations, demonstrating the usefulness of this method for deposit characterization

Design and construction of an explosive detection system by Tna methods, using 252Cf radioisotope source

International Nuclear Information System (INIS)

Tavakkoli Farsouli, A.

1999-01-01

Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given

Undergraduate experiments using the neutron radiation from californium-252

International Nuclear Information System (INIS)

Rossel, J.; Golecki, I.

1976-01-01

Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)

Automated box/drum waste assay (252Cf shuffler) through the material access and accountability boundary

International Nuclear Information System (INIS)

Horley, E.C.; Bjork, C.W.; Bourret, S.C.; Polk, P.J.; Schneider, C.J.; Studley, R.V.

1992-01-01

For the first time, a shuffler waste-assay system has been made a part of material access and accountability boundary (MAAB). A 252 Cf Pass-Thru shuffler integrated with a conveyor handling system, will process box or drum waste across the MAAB. This automated system will significantly reduce personnel operating costs because security forces will not be required at the MAAB during waste transfer. Further, the system eliminates the chance of a mix-up between measured and nonmeasured waste. This Pass-Thru shuffler is to be installed in the Westinghouse Savannah River Company 321M facility to screen waste boxes and drums for 235 U. An automated conveyor will load waste containers into the shuffler, and upon verification, will transfer the containers across the MAAB. Verification will consist of a weight measurement followed by active neutron interrogation. Containers that pass low-level waste criteria will be conveyed to an accumulator section outside the MAAB. If a container fails to meet the waste criteria, it will be rejected and sent back to the load station for manual inspection and repackaging

Importance of the elemental composition in brachytherapy with neutrons; Importancia de la composicion elemental en braquiterapia con neutrones

Energy Technology Data Exchange (ETDEWEB)

Paredes G, L.; Balcazar G, M. [ININ, A.P. 18-1027, 11801 Mexico D.F. (Mexico); Azorin N, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois L, J.L. [ICN-UNAM, 04510 Mexico D.F. (Mexico)

2004-07-01

An analysis is presented of as the small differences that exist in the elementary composition of the wicked tumors, healthy fabrics and some material substitutes of fabric employees in dosimetry, they generate variations in the value of the kerma coefficient and consequently in the absorbed dose of neutrons in the interval 11 eV to 29 MeV. These differences make that the coefficient of kerma of neutrons average for the considered wicked tumors, be between 6% and 7% smaller that the coefficient of kerma of neutrons average for soft fabric, in the interval of interest in therapy with quick neutrons. These results have a special importance during the process of planning of brachytherapy treatments with sources of {sup 252} Cf, to optimize and to individualize the treatments to the patients. (Author)

A fast neutron and dual-energy gamma-ray absorption method (NEUDEG) for investigating materials using a 252Cf source

International Nuclear Information System (INIS)

Bartle, C. Murray

2014-01-01

DEXA (dual-energy X-ray absorption) is widely used in airport scanners, industrial scanners and bone densitometers. DEXA determines the properties of materials by measuring the absorption differences of X-rays from a bremsstrahlung tube source with and without filtering. Filtering creates a beam with a higher mean energy, which causes lower material absorption. The absorption difference between measurements (those with a filter subtracted from those without a filter) is a positive number that increases with the effective atomic number of the material. In this paper, the concept of using a filter to create a dual beam and an absorption difference in materials is applied to radiation from a 252 Cf source, called NEUDEG (neutron and dual-energy gamma absorption). NEUDEG includes absorptions for fast neutrons as well as the dual photon beams and thus an incentive for developing the method is that, unlike DEXA, it is inherently sensitive to the hydrogen content of materials. In this paper, a model for the absorption difference and absorption sum in NEUDEG is presented using the combined gamma ray and fast neutron mass attenuation coefficients. Absorption differences can be either positive or negative in NEUDEG, increasing with increases in the effective atomic number and decreasing with increases in the hydrogen content. Sample sets of absorption difference curves are calculated for materials with typical gamma-ray and fast neutron mass attenuation coefficients. The model, which uses tabulated mass attenuated coefficients, agrees with experimental data for porcelain tiles and polyethylene sheets. The effects of “beam hardening” are also investigated. - Highlights: • Creation of a dual neutron/gamma beam from 252 Cf is described. • An absorption model is developed using mass attenuation coefficients. • A graphical method is used to show sample results from the model. • The model is successfully compared with experimental results. • The importance of

Monte Carlo design study of a moderated {sup 252}Cf source for in vivo neutron activation analysis of aluminium

Energy Technology Data Exchange (ETDEWEB)

Lewis, D.G.; Natto, S.S.A.; Evans, C.J. [Swansea In Vivo Analysis and Cancer Research Group, Department of Physics, University of Wales, Swansea (United Kingdom); Ryde, S.J.S. [Swansea In Vivo Analysis and Cancer Research Group, Department of Medical Physics and Clinical Engineering, Singleton Hospital, Swansea (United Kingdom)

1997-04-01

The Monte Carlo computer code MCNP has been used to design a moderated 2{sup 52}Cf neutron source for in vivo neutron activation analysis of aluminium (Al) in the bones of the hand. The clinical motivation is the need to monitor l body burden in subjects with renal dysfunction, at risk of Al toxicity. The design involves the source positioned on the central axis at one end of a cylindrical deuterium oxide moderator. The moderator is surrounded by a graphite reflector, with the hand inserted at the end of the moderator opposing the source. For a 1 mg {sup 252}Cf source, 15 cm long x 20 cm radius moderator and 20 cm thick reflector, the estimated minimum detection limit is .5 mg Al for a 20 min irradiation, with an equivalent dose of 16.5 mSv to the hand. Increasing the moderator length and/or introducing a fast neutron filter (for example silicon) further reduces interference from fast-neutron-induced reactions on phosphorus in bone, at the expense of decreased fluence of the thermal neutrons which activate Al. Increased source strengths may be necessary to compensate for this decreased thermal fluence, or allow measurements to be made within an acceptable time limit for the comfort of the patient. (author)

Induction of external abnormalities in offspring of male mice irradiated with 252Cf neutron

International Nuclear Information System (INIS)

Kurishita, Akihiro; Ono, Tetsuya; Mori, Yuriko; Okada, Shigefumi; Sawada, Syozo

1992-01-01

To assess the genetic effects of fission neutron, the induction of external malformations was studied in F 1 fetuses after F 0 male mice were irradiated. Male mice of the ICR:MCH strain were irradiated with 252 Cf neutron at doses of 0.238, 0.475, 0.95 and 1.9 Gy. They were mated with non-irradiated female mice at 71-120 days after irradiation. Pregnant females were autopsied on day 18 of gestation and their fetuses were examined for deaths and external abnormalities. No increases of pre- and post-implantation losses were noted at any dose. External abnormalities were observed at rates of 1.40% in the 0.238 Gy, 2.23% in the 0.475 Gy, 3.36% in the 0.95 and 3.26% in the 1.9 Gy groups; the rate in the control group was 1.65%. The dose-response curve was linear up to 0.95 Gy, and then flattened out; the induction rate of external abnormalities was 2.7x10 -4 /gamete/cGy based on the linear regression. These results indicated that fission neutron effectively induces external abnormalities in F 1 fetuses after spermatogonial irradiation. (author). 29 refs.; 1 fig.; 2 tabs

Measurements of the prompt neutron spectra in 233U, 235U, 239Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252Cf spontaneous fission in the energy range of 0.01-10 MeV

International Nuclear Information System (INIS)

Starostov, B.I.; Semenov, A.F.; Nefedov, V.N.

1978-01-01

The measurement results on the prompt neutron spectra in 233 U, 235 U, 239 Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252 Cf spontaneous fission in the energy range of 0.01-10 MeV are presented. The time-of-flight method was used. The exceeding of the spectra over the Maxwell distributions is observed at E 252 Cf neutron fission spectra. The spectra analysis was performed after normalization of the spectra and corresponding Maxwell distributions for one and the same area. In the range of 0.05-0.22 MeV the yield of 235 U + nsub(t) fission neutrons is approximately 8 and approximately 15 % greater than the yield of 252 Cf and 239 Pu + nsub(t) fission neutrons, respectively. In the range of 0.3-1.2 MeV the yield of 235 U + nsub(t) fission neutrons is 8 % greater than the fission neutron yield in case of 239 Pu + nsub(t) fission. The 235 U + nsub(t) and 233 U + nsub(t) fission neutron spectra do not differ from one another in the 0.05-0.6 MeV range

252Cf-source-driven neutron noise measurements of subcriticality for a slab tank containing aqueous Pu-U nitrate

International Nuclear Information System (INIS)

Mihalczo, J.T.; Blakeman, E.D.; Ragan, G.E.; Kryter, R.C.; Robinson, R.C.; Seino, H.

1987-08-01

In order to study nuclear criticality safety related to the development of fast breeder technology, 252 Cf-source-driven neutron noise analysis measurements were performed with a Pu-U nitrate solution in a slab tank of various heights and thickness varying 11.43 cm to 19.05 cm. The results and conclusions of these experiments are (1) a capability to measure the subcriticality of a multiplying system of slab geometry to a k/sub eff/ as low as 0.7 was demonstrated, (2) calculated neutron multiplication factors agreed with those from the experiments within ∼0.02, and (3) the applicability of the method for plutonium solution systems was demonstrated. This paper describes measurements in which the height of the slab was varied for a fixed thickness and the thickness varied for a fixed height, which are the first applications of this measurement method to slab geometry

Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

Energy Technology Data Exchange (ETDEWEB)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

Study of the isomer nuclei produced in the spontaneous fission of {sup 252}Cf; Etude des noyaux isomeriques produits dans la fission spontanee de {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Belier, G.; Girod, M.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, G.; Meot, V.; Peru, S. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

1997-06-01

Isomeric states have been studied in fission fragments produced by spontaneous fission of {sup 252}Cf. 34 isomeric nuclei have been identified by using coincidences between {gamma}-rays detected in EUROGAM II and fission fragments detected in photovoltaic cells. Lifetimes from 20 ns up to 2 {mu}s have been measured. Microscopic interpretation of the isomeric levels discovered has been tried by means of the Hartree-Fock-Bogolyubov procedure using Gogny force. It was found that the {sup 152,154,156}Nd nuclei have prolate deformation in their ground state; the rotational band built on this ground state is well reproduced by the calculation. For these nuclei the 2 quasi-particle excited states energies are above 1 MeV in agreement with the experiment. The computation confirms the similitude of the {sup 156}Nd and {sup 158}Sm isomeric states associated to neutron 2 quasi-particles of J{sup {pi}} K{sup {pi}} = 5{sup -} ({nu} 5/2 (642) x {nu} 5/2 (523)) while such similitude does not occur for the isotone nuclei {sup 154}Nd and {sup 156}Sm. The computation predicts a proton 2 quasi-particle excited states of J{sup {pi}} = 5{sup -}, near the isomeric level measured in {sup 156}Sm but not for that of {sup 154}Nd. Concerning the {sup 152}Nd the calculated level density is very near that of the states measured in the 1.6 to 2.3 MeV interval. However, the lack of precise information on spins and parities of the measured levels does make not possible a confrontation with the calculations. An up-graded equipment implying 32 photovoltaic cells instead of 2 cells is to be developed and installed by the EUROGAM 3 refs.

The observation of quasi-molecular ions from a tiger snake venom component (Msub(r) 13309) using 252Cf-plasma desorption mass spectrometry

International Nuclear Information System (INIS)

Kamensky, I.; Haakansson, P.; Kjellberg, J.; Sundqvist, B.; Fohlman, J.; Peterson, P.A.

1983-01-01

A method involving fast heavy-ion bombardment of a solid sample called 252 Cf-plasma desorption mass spectrometry has been used to study a non-enzymatic, non-toxic phospholipase homolog from Australian tiger snake (Notechis scutatus) venom. The protein consists of 119 amino acids in a single polypeptide chain cross-linked by 7 disulfide bridges. The isotopically averaged molecular mass as determined by protein sequence analysis is 13309 atomic mass units (amu). The mass distributions were studied by means of time-of-flight measurements. Quasi-molecular ions associated to the molecule and its dimer were observed. The mass of the quasi-molecular ion corresponding to the molecule was determined to be 13285 +- 25 amu. (Auth.)

Determination of the multiplication factor and its bias by the 252Cf-source technique: A method for code benchmarking with subcritical configurations

International Nuclear Information System (INIS)

Perez, R.B.; Valentine, T.E.; Mihalczo, J.T.; Mattingly, J.K.

1997-01-01

A brief discussion of the Cf-252 source driven method for subcritical measurements serves as an introduction to the concept and use of the spectral ratio, Γ. It has also been shown that the Monte Carlo calculation of spectral densities and effective multiplication factors have as a common denominator the transport propagator. This commonality follows from the fact that the Neumann series expansion of the propagator lends itself to the Monte Carlo method. On this basis a linear relationship between the spectral ratio and the effective multiplication factor has been shown. This relationship demonstrates the ability of subcritical measurements of the ratio of spectral densities to validate transport theory methods and cross sections

Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field

International Nuclear Information System (INIS)

Mannhart, W.

1979-01-01

The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables

Treatment of bulky stage IB and IIB cervical cancers with outpatient neutron brachytherapy, external pelvic radiation and extrafascial hysterectomy

International Nuclear Information System (INIS)

Van Nagell, J.R.; Maruyama, Y.; Yoneda, J.; Donaldson, E.S.; Hanson, M.B.; Gallion, H.H.; Powell, D.E.; Kryscio, R.J.

1986-01-01

From January, 1977, to December, 1982, twenty-nine patients with bulky (>4 cms diameter) Stage IB or IIB cervical cancer were treated at the University of Kentucky Medical Center by a combination of out-patient neutron brachytherapy (Cf-252) and external pelvic radiation followed by extrafascial hysterectomy. Residual tumor was present in the hysterectomy specimens of 25 per cent. Complications during and following radiation therapy and surgery were minimal and included vaginal stenosis, proctitis, and hemorrhagic cystitis. The mean duration of hospitalization for surgery in these patients was 6.6 days (range 5-15 days) and postoperative morbidity was low. No patient required blood transfusion. Four patients developed urinary tract infections and two had superficial wound separations. Following treatment, patients were seen at monthly intervals for one year, every three months for two years, and every six months thereafter. No patient has been lost to follow-up. Two patients (7 per cent) developed tumor recurrence and have died of disease (1 of distant metastases; 1 local). The remaining 27 patients (93 per cent) are alive and well with no evidence of disease 24-89 months (mean 48 months) after therapy. No radiogenic fistulae or bowel obstruction were observed. These preliminary results suggest that the combination of outpatient neutron brachytherapy, external pelvic radiation, and extrafascial hysterectomy for patients with Stage IB and IIB cervical cancer is well tolerated. Complications associated with this treatment regimen have been minimal, and the recurrence rate is low. The duration of intracavitary neutron brachytherapy was short, and outpatient therapy was well received by patients

Measurement of the average number of prompt neutrons emitted per fission of 235U relative to 252Cf for the energy region 500 eV to 10 MeV

International Nuclear Information System (INIS)

Gwin, R.; Spencer, R.R.; Ingle, R.W.; Todd, J.H.; Weaver, H.

1980-01-01

The average number of prompt neutrons emitted per fission ν/sub p/-bar(E), was measured for 235 U relative to ν/sub p/-bar for the spontaneous fission of 252 Cf over the neutron energy range from 500 eV to 10 MeV. The samples of 235 U and 252 Cf were contained in fission chambers located in the center of a large liquid scintillator. Fission neutrons were detected by the large liquid scintillator. The present values of ν/sub p/-bar(E) for 235 U are about 0.8% larger than those measured by Boldeman. In earlier work with the present system, it was noted that Boldeman's value of ν/sub p/-bar(E) for thermal energy neutrons was about 0.8% lower than obtained at ORELA. It is suggested that the thickness of the fission foil used in Boldeman's experiment may cause some of the discrepancy between his and the present values of ν/sub p/-bar(E). For the energy region up to 700 keV, the present values of ν/sub p/-bar(E) for 235 U agree, within the uncertainty, with those given in ENDF/B-V. Above 1 MeV the present results for ν/sub p/-bar(E) range about the ENDF/B-V values with differences up to 1.3%. 6 figures, 1 table

Experimental determination of dosimetric characterization of a newly designed encapsulated interstitial brachytherapy source of 103Pd-model Pd-1

International Nuclear Information System (INIS)

Nath, Ravinder; Yue Ning; Roa, Eduardo

2002-01-01

A newly designed encapsulated 103 Pd source has been introduced (BrachySeed trade mark sign -Pd-103, also named Model Pd-1, manufactured by DRAXIMAGE Inc. and distributed by Cytogen Corp.) for interstitial brachytherapy to provide more isotropic dose distributions. In this work, the dosimetric characteristics of the 103 Pd source were measured with micro LiF TLD chips and dosimetry parameters were characterized based upon the American Association of Physicists in Medicine (AAPM) Task Group No. 43 formalism. The dose rate constant of the sources was determined to be 0.66±0.05 cGy h-1 U-1. The radial dose function was measured and was found to be similar to that of the Theragenics Model 200 103 Pd source. The anisotropy constant for the Model Pd-1 source was determined to be 1.03

5He, 7He, and 8Li (E*=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Kopatch, Yu.N.; Mutterer, M.; Schwalm, D.; Thirolf, P.; Goennenwein, F.

2002-01-01

The neutron-unstable odd-N isotopes 5 He, 7 He, and 8 Li (in its excited state of E*=2.26 MeV) were measured to show up as short-lived (τ≅10 -21 -10 -20 s) intermediate light charged particles (LCPs) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs, and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1x10 -21 s, and 4x10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E*=2.26 MeV (lifetime: 2x10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the 'true' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α particles registered, and to 16.4(3) MeV for the true ternary α particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li* was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed

5He, 7He and 8Li (E=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Kopatch, Yu. N.; Goennenwein, F.

2002-02-01

The neutron-unstable odd-N isotopes 5 He, 7 He and 8 Li (in its excited state of E * = 2.26 MeV) were measured to show up as short-lived intermediate light-charged-particles (LCP) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1 x 10 -21 s, and 4 x 10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E * = 2.26 MeV (lifetime: 2 x 10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the ''true'' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α-particles registered, and to 16.4(3) MeV for the true ternary α-particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li * was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed. (orig.)

Ocular brachytherapy with a holmium-166 irradiator device

International Nuclear Information System (INIS)

Mourao, Arnaldo P.; Campos, Tarcisio P.R.

2009-01-01

The ocular brachytherapy is a method that allows controlling ocular tumors. However, the irradiation of the ocular area in high doses can bring damages mainly to the surrounding healthy tissue, such as lens, retina and bone tissue of the orbital area in growth phase. Brachytherapy in comparison to teletherapy allows a large reduction of the absorbed doses in the adjacent tissues avoiding deleterious effects. Various types of radionuclides can be applied to ocular brachytherapy. Those radionuclides shall be encapsulated and placed juxtaposed to the sclera, back to the tumor. Herein, a new device was developed to encapsulate the radioactive material. It can easily place back of the eyeball. A computational model of the ocular area was developed in order to simulate the spatial dose distribution promoted by the holmium-166 nuclide distributed inside the irradiator device. The simulations addressed a device placed on the surface of the sclera, rotated 90 deg taken at the normal axis forward to the lens. The simulation was carried on the code Monte Carlo MCNP5. The computational simulation generates the spatial dose distribution in the treated volume. All continuous beta and the discrete gamma and X-ray spectra emitted by the holmium-166 were incorporated on simulations. The results allow comparing the space dose distribution to other types of sources used for the same end. The sclera absorbed dose, the maximum apical tumor dose, as well as on the tumor base were investigated. Indeed, the tumor thickness defines the conditions of irradiation. The holmium-166 dose distribution provides a tool to propose a better and optimized protocol for ocular brachytherapy. (author)

Ocular brachytherapy with a holmium-166 irradiator device

Energy Technology Data Exchange (ETDEWEB)

Mourao, Arnaldo P. [Centro Federal de Educacao Tecnoloica de Minas Gerais (CEFET-MG), Belo Horizonte, MG (Brazil). Nucleo de Engenharia Hospitalar], e-mail: aprata@des.cefetmg.br; Campos, Tarcisio P.R. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Programa de Pos-graduacao em Ciencias e Tecnicas Nucleares], e-mail: campos@nuclear.ufmg.br

2009-07-01

The ocular brachytherapy is a method that allows controlling ocular tumors. However, the irradiation of the ocular area in high doses can bring damages mainly to the surrounding healthy tissue, such as lens, retina and bone tissue of the orbital area in growth phase. Brachytherapy in comparison to teletherapy allows a large reduction of the absorbed doses in the adjacent tissues avoiding deleterious effects. Various types of radionuclides can be applied to ocular brachytherapy. Those radionuclides shall be encapsulated and placed juxtaposed to the sclera, back to the tumor. Herein, a new device was developed to encapsulate the radioactive material. It can easily place back of the eyeball. A computational model of the ocular area was developed in order to simulate the spatial dose distribution promoted by the holmium-166 nuclide distributed inside the irradiator device. The simulations addressed a device placed on the surface of the sclera, rotated 90 deg taken at the normal axis forward to the lens. The simulation was carried on the code Monte Carlo MCNP5. The computational simulation generates the spatial dose distribution in the treated volume. All continuous beta and the discrete gamma and X-ray spectra emitted by the holmium-166 were incorporated on simulations. The results allow comparing the space dose distribution to other types of sources used for the same end. The sclera absorbed dose, the maximum apical tumor dose, as well as on the tumor base were investigated. Indeed, the tumor thickness defines the conditions of irradiation. The holmium-166 dose distribution provides a tool to propose a better and optimized protocol for ocular brachytherapy. (author)

The needs for brachytherapy source calibrations in the United States

International Nuclear Information System (INIS)

Coursey, B.M.; Goodman, L.J.; Hoppes, D.D.; Loevinger, R.; McLaughlin, W.L.; Soares, C.G.; Weaver, J.T.

1992-01-01

Brachytherapy sources of beta and gamma radiation ('brachy' is from the Greek, meaning 'near') have a long history of use in interstitial, intracavitary, intraluminal, and ocular radiation therapy. In the past the US national standards for these sources were often specified in activity or milligram radium equivalent. With the introduction of new radionuclide sources to replace radium, source strength calibrations are now expressed as air kerma rate at a meter. In this paper, we review the NIST standards for brachytherapy sources, list some of the common radionuclides and source encapsulations in use in the US radiology community, and describe the latest NIST work, in collaboration with several US medical institutions, on a method of two- and three-dimensional dose mapping of brachytherapy sources using radiochromic films. (orig.)

Modeling a Hypothetical 170Tm Source for Brachytherapy Applications

International Nuclear Information System (INIS)

Enger, Shirin A.; D'Amours, Michel; Beaulieu, Luc

2011-01-01

Purpose: To perform absorbed dose calculations based on Monte Carlo simulations for a hypothetical 170 Tm source and to investigate the influence of encapsulating material on the energy spectrum of the emitted electrons and photons. Methods: GEANT4 Monte Carlo code version 9.2 patch 2 was used to simulate the decay process of 170 Tm and to calculate the absorbed dose distribution using the GEANT4 Penelope physics models. A hypothetical 170 Tm source based on the Flexisource brachytherapy design with the active core set as a pure thulium cylinder (length 3.5 mm and diameter 0.6 mm) and different cylindrical source encapsulations (length 5 mm and thickness 0.125 mm) constructed of titanium, stainless-steel, gold, or platinum were simulated. The radial dose function for the line source approximation was calculated following the TG-43U1 formalism for the stainless-steel encapsulation. Results: For the titanium and stainless-steel encapsulation, 94% of the total bremsstrahlung is produced inside the core, 4.8 and 5.5% in titanium and stainless-steel capsules, respectively, and less than 1% in water. For the gold capsule, 85% is produced inside the core, 14.2% inside the gold capsule, and a negligible amount ( 170 Tm source is primarily a bremsstrahlung source, with the majority of bremsstrahlung photons being generated in the source core and experiencing little attenuation in the source encapsulation. Electrons are efficiently absorbed by the gold and platinum encapsulations. However, for the stainless-steel capsule (or other lower Z encapsulations) electrons will escape. The dose from these electrons is dominant over the photon dose in the first few millimeter but is not taken into account by current standard treatment planning systems. The total energy spectrum of photons emerging from the source depends on the encapsulation composition and results in mean photon energies well above 100 keV. This is higher than the main gamma-ray energy peak at 84 keV. Based on our

Measurement of the energy spectrum of {sup 252}Cf fission fragments using nuclear track detectors and digital image processing

Energy Technology Data Exchange (ETDEWEB)

Espinosa, G.; Golzarri, J. I. [UNAM, Instituto de Fisica, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Castano, V. M. [UNAM, Centro de Fisica Aplicada y Tecnologia Avanzada, Boulevard Juriquilla 3001, Santiago de Queretaro, 76230 Queretaro (Mexico); Gaso, I. [ININ, Carretera Mexico-Toluca s/n, Ocoyoacac 52750, Estado de Mexico (Mexico); Mena, M.; Segovia, N. [UNAM, Instituto de Geofisica, Circuito de la Investigacion Cientifica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)

2010-02-15

The energy spectrum of {sup 252}Cf fission fragments was measured using nuclear track detectors and digital image analysis system. The detection material was fused silica glass. The detectors were chemically etched in an 8% HF solution. After experimenting with various etching time, it was found that the best resolution of the track diameter distribution was obtained after 30 minutes of etching. Both Gaussian and Lorentzian curves were fit to the track diameter distribution histograms and used to determine the basic parameters of the distribution of the light (N{sub L}) and heavy (N{sub H}) formed peaks and the minimum of the central valley (N{sub V}). Advantages of the method presented here include the fully-automated analysis process, the low cost of the nuclear track detectors and the simplicity of the nuclear track method. The distribution resolution obtained by this method is comparable with the resolution obtained by electronic analysis devices. The descriptive variables calculated were very close to those obtained by other methods based on the use of semiconductor detectors. (Author)

Coulomb effects in isobaric cold fission from reactions 233U(nth,f), 235U(nth,f),239Pu(nth,f) and 252Cf(sf)

International Nuclear Information System (INIS)

Montoya, Modesto

2013-01-01

The Coulomb effect hypothesis, formerly used to interpret fluctuations in the curve of maximal total kinetic energy as a function of light fragment mass in reactions 233 U(n th ,f), 235 U(n th ,f) and 239 Pu(n th ,f), is confirmed in high kinetic energy as well as in low excitation energy windows, respectively. Data from reactions 233 U(n th ,f), 235 U(n th ,f), 239 Pu(n th ,f) and 252 Cf(sf) show that, between two isobaric fragmentations with similar Q-values, the more asymmetric charge split reaches the higher value of total kinetic energy. Moreover, in isobaric charge splits with different Q-values, similar preference for asymmetrical fragmentations is observed in low excitation energy windows. (author).

Sensitivity of the 252Cf(sf neutron observables to the FREYA input yield functions Y(A, Z, TKE

Directory of Open Access Journals (Sweden)

Randrup Jørgen

2017-01-01

Full Text Available Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A and Y (TKE|A. For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.

Sensitivity of the 252Cf(sf) neutron observables to the FREYA input yield functions Y(A, Z, TKE)

Science.gov (United States)

Randrup, Jørgen; Talou, Patrick; Vogt, Ramona

2017-09-01

Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE) used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A) and Y (TKE|A). For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.

Sensitivity studies in Monte Carlo treatment planning for neutron brachytherapy of cervical cancer : role of boron augmentation

International Nuclear Information System (INIS)

Ralston, A.; Wallace, S.A.; Allen, B.J.

1996-01-01

Cervical cancer is the most common malignancy of women in the world and in the third world often presents in an advanced state. While photo radiation therapy is an established form of treatment, neutron brachytherapy with Cf-252 has proven to give superior local control in advanced cases without serious complications. This advantage arises from the reduction in radio-resistance, ascribed to hypoxia in bulky tumours, which occurs with high LET radiation. A further improvement is being sought by dose augmentation with boron neutron capture therapy. The Los Alamos Monte Carlo Neutron Photon radiation transport code MCNP is being used to investigate the effects of fat, muscle, bone and voids in the fast and thermal dose distributions. Whereas the fast neutron dose determines normal tissue tolerance, the boron neutron capture dose rate is determined by the thermal flux distribution. The neutron spectrum is sensitive to changes in hydrogen density, as occurs with muscle, fat and bone. The implications of this sensitivity are examined to determine whether detailed individual Monte Carlo calculations are required for patient clinical treatment plans. (author)

Californium-252

International Nuclear Information System (INIS)

1975-01-01

This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)

A portable measurement system for subcriticality measurements by the CF-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Ragan, G.E.; Blakeman, E.D.

1988-01-01

A portable measurement system consisting of a personal computer used as a Fourier analyzer and three detection channels (with associated electronics that provide the signals to analog-to-digital (A/D) convertors) has been assembled to measure subcriticality by the /sup 252/Cf-source-driven neutron noise analysis method. The /sup 252/Cf-source-driven neutron noise analysis method for obtaining the subcritical neutron multiplication factor of a configuration of fissile material requires measurement of the frequency-dependent cross-power spectral density (CPSD), G/sub 23/(ω), between a pair of detectors (Nos. 2 and 3) located in or near the fissile material and CPSDs G/sub 12/(ω) and G/sub 13/(ω) between these same detectors and a source of neutrons emanating from an ionization chamber (No. 1) containing /sup 252/Cf, also positioned in or near the fissile material. The auto-power spectral density (APSD), G/sub 11/(ω), of the source is also required. A particular ratio of spectral densities, G/sub 12//sup */G/sub 13//G/sub 11/G/sub 23/ (/sup */ denotes complex conjugation), is then formed. This ratio is related to the subcritical neutron multiplication factor and is independent of detector efficiencies

Feasibility of fissile mass assay of spent nuclear fuel using 252Cf-source-driven frequency-analysis

International Nuclear Information System (INIS)

Mattingly, J.K.; Valentine, T.E.; Mihalczo, J.T.

1996-01-01

The feasibility was evaluated using MCNP-DSP, an analog Monte Carlo transport cod to simulate source-driven measurements. Models of an isolated Westinghouse 17x17 PWR fuel assembly in a 1500-ppM borated water storage pool were used. In the models, the fuel burnup profile was represented using seven axial burnup zones, each with isotopics estimated by the PDQ code. Four different fuel assemblies with average burnups from fresh to 32 GWd/MTU were modeled and analyzed. Analysis of the fuel assemblies was simulated by inducing fission in the fuel using a 252 Cf source adjacent to the assembly and correlating source fissions with the response of a bank of 3 He detectors adjacent to the assembly opposite the source. This analysis was performed at 7 different axial positions on each of the 4 assemblies, and the source-detector cross-spectrum signature was calculated for each of these 28 simulated measurements. The magnitude of the cross-spectrum signature follows a smooth upward trend with increasing fissile material ( 235 U and 239 Pu) content, and the signature is independent of the concentration of spontaneously fissioning isotopes (e.g., 244 Cm) and (α,n) sources. Furthermore, the cross-spectrum signature is highly sensitive to changes in fissile material content. This feasibility study indicated that the signature would increase ∼100% in response to an increase of only 0.1 g/cm 3 of fissile material

In Plant Measurement and Analysis of Mixtures of Uranium and Plutonium TRU-Waste Using a 252Cf Shuffler Instrument

International Nuclear Information System (INIS)

Hurd, J.R.

1998-01-01

The active-passive 252 Cf shuffler instrument, installed and certified several years ago in Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU)-waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here

Thermal neutron imaging with rare-earth-ion-doped LiCaAlF{sub 6} scintillators and a sealed {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Kawaguchi, Noriaki, E-mail: famicom@mail.tagen.tohoku.ac.jp [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fukuda, Kentaro; Suyama, Toshihisa [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Watanabe, Kenichi; Yamazaki, Atsushi [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center, Tohoku University, Sendai 980-8579 (Japan)

2011-10-01

Thermal neutron imaging with Ce-doped LiCaAlF{sub 6} crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF{sub 6} scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF{sub 6} single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm{sup 2} was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The {sup 252}Cf source (<1 MBq) was sealed with 43 mm of polyethylene for neutron thermalization. Alphabet-shaped Cd pieces with a thickness of 2 mm were used as a mask for the thermal neutrons. After corrections for the pedestals and gain of each pixel, we successfully obtained two-dimensional neutron images using Ce-doped LiCaAlF{sub 6}.

Limonene encapsulation in freeze dried gellan systems.

Science.gov (United States)

Evageliou, Vasiliki; Saliari, Dimitra

2017-05-15

The encapsulation of limonene in freeze-dried gellan systems was investigated. Surface and encapsulated limonene content was determined by measurement of the absorbance at 252nm. Gellan matrices were both gels and solutions. For a standard gellan concentration (0.5wt%) gelation was induced by potassium or calcium chloride. Furthermore, gellan solutions of varying concentrations (0.25-1wt%) were also studied. Limonene was added at two different concentrations (1 and 2mL/100g sample). Gellan gels encapsulated greater amounts of limonene than solutions. Among all gellan gels, the KCl gels had the greater encapsulated limonene content. However, when the concentration of limonene was doubled in these KCl gels, the encapsulated limonene decreased. The surface limonene content was significant, especially for gellan solutions. The experimental conditions and not the mechanical properties of the matrices were the dominant factor in the interpretation of the observed results. Copyright © 2016 Elsevier Ltd. All rights reserved.

Calibration of brachytherapy sources using ferrous sulphate-benzoic acid-xylenol orange dosimeter

International Nuclear Information System (INIS)

Madhvanath, U.; Kini, U.R.; Gupta, B.L.

1976-01-01

A solution containing 0.20 mM of ferrous ammonium sulphate, 5.0 mM benzoic acid and 0.20 mM xylenol orange in 0.05 N sulphuric acid was used for the calibration of 252 Cf, 137 Cs, 226 Ra and 60 Co needle sources. A known volume of this solution contained in a pyrex glass tube was irradiated with the source kept in a glass capillary at the centre of the solution. A few hours of irradiation were required for each needle and the absorbance of the solution was measured at 540 nm against the unirradiated solution. The accuracy of this method was found to be within a few percent and is particularly useful for 252 Cf sources as the neutron component of the source contributes significantly to the absorbance produced. (author)

Challenges using a 252Cf shuffler instrument in a plant environment to measure mixtures of uranium and plutonium transuranic waste

International Nuclear Information System (INIS)

Hurd, J.R.

1999-01-01

An active-passive 252 Cf shuffler instrument, installed and certified several years ago at Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU) waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here

Unification of a common biochemical failure definition for prostate cancer treated with brachytherapy or external beam radiotherapy with or without androgen deprivation

International Nuclear Information System (INIS)

Fitch, Dwight L.; McGrath, Samuel; Martinez, Alvaro A.; Vicini, Frank A.; Kestin, Larry L.

2006-01-01

Purpose: Minimal data are available regarding selection of an optimal biochemical failure (BF) definition for patients treated with brachytherapy, external beam radiotherapy (EBRT), and combinations of these treatments with or without androgen deprivation (AD). We retrospectively analyzed our institution's experience treating localized prostate cancer in an attempt to determine a BF definition that could be applied for these various treatment modalities. Methods and Materials: A total of 2376 patients with clinical stage T1-T3 N0 M0 prostate cancer were treated with conventional dose (median, 66.6 Gy) EBRT (n = 1201), high-dose (median, 75.6 Gy) adaptive radiation therapy (n = 465), EBRT + high-dose-rate brachytherapy boost (n 416), or brachytherapy alone (n = 294) between 1987 and 2003. A total of 496 patients (21%) received neoadjuvant AD with radiation therapy. There were 21924 posttreatment prostate-specific antigen (PSA) measurements. Multiple BF definitions were tested for their sensitivity, specificity, positive predictive value (+PV), and negative PV (-PV) in predicting subsequent clinical failure (CF) (any local failure or distant metastasis), overall survival (OS), and cause-specific survival (CSS). Median follow-up was 4.5 years. The date of BF was the date BF criteria were met (e.g., date of third rise). Results: A total of 290 patients (12%) experienced CF at a median interval of 3.6 years (range, 0.2-15.2 years). The 5- and 10-year CF rates were 12% and 26%, respectively. Three consecutive rises yielded a 46% sensitivity and 84% specificity for predicting CF. The 10-year CF for those 475 patients who experienced three rises (BF) was 37% vs. 17% for those patients who did not meet these criteria (biochemically controlled [BC]). For all patients, the following definitions were superior to three rises for predicting CF for both +PV, and -PV: n + 1 (≥1 ng/mL above nadir), n + 2, n + 3, threshold 2 (any PSA ≥2.0 ng/mL at or after nadir), threshold 3

Fabrication of californium-252 sources in the United Kingdom

International Nuclear Information System (INIS)

Ainsworth, A.; Brady, M.W.; Thornett, W.H.

1975-01-01

The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)

100 mg 251Cf activation analysis facility at the Savannah River Laboratory

International Nuclear Information System (INIS)

MacMurdo, K.W.; Bowman, W.W.

1975-01-01

The 252 Cf Activation Analysis Facility at the Savannah River Laboratory (SRL) is used routinely for multielement analyses of a wide variety of solid and liquid samples (e.g., metal alloys, fly ash and other airborne particles, rocks, and aqueous and nonaqueous solutions). An automated absolute activation analysis technique, developed to use neutron transport codes to calculate multienergy group neutron spectra and fluxes, converts counting data directly into elemental concentrations expressed in parts per million. The facility contains four sources of 252 Cf totaling slightly over 100 mg. A pneumatic ''rabbit'' system permits automatic irradiation/decay/counting regimes to be performed unattended on up to 100 samples. Detection sensitivities of less than or equal to 400 ppb natural uranium and less than or equal to 0.5 nCi/g for 239 Pu are observed. Detection limits for over 65 elements have been determined. Over 40 elements are detectable at the one part per million level or less. Overall accuracies of +- 10 percent are observed for most elements. (auth)

Analysis of linear energy transfers and quality factors of charged particles produced by spontaneous fission neutrons from 252Cf and 244Pu in the human body

International Nuclear Information System (INIS)

Endo, A.; Sato, T.

2013-01-01

Absorbed doses, linear energy transfers (LETs) and quality factors of secondary charged particles in organs and tissues, generated via the interactions of the spontaneous fission neutrons from. 252 Cf and. 244 Pu within the human body, were studied using the Particle and Heavy Ion Transport Code System (PHITS) coupled with the ICRP Reference Phantom. Both the absorbed doses and the quality factors in target organs generally decrease with increasing distance from the source organ. The analysis of LET distributions of secondary charged particles led to the identification of the relationship between LET spectra and target-source organ locations. A comparison between human body-averaged mean quality factors and fluence-averaged radiation weighting factors showed that the current numerical conventions for the radiation weighting factors of neutrons, updated in ICRP103, and the quality factors for internal exposure are valid. (authors)

Brachytherapy: The need for a national metrology lab in Spain

International Nuclear Information System (INIS)

Aviles Lucas, P.

2011-01-01

Radiotherapy, along with chemotherapy and surgery, is an essential therapeutic technique for treating malignant tumours. Part of the challenge of a suitable radiotherapy treatment lies on the optimisation of the irradiated volume, which must be adapted to the tumour volume as far as possible. Depending on position of the radiation source relative to the patient, the procedure in question could be external radiotherapy, or brachytherapy. In a brachytherapy procedure, relatively small encapsulated radioactive sources are placed close to or in the tumour volume to be treated. This therapeutic treatment has two obvious advantages; on one hand the prescribed dose can be adjusted to the tumour volume, preventing unnecessary exposure of the adjacent healthy tissues, and on the other, it decreases the treatment duration compared to a radiotherapy treatment. (Author) 19 refs.

Role of energy cost in the yield of cold ternary fission of Cf

Indian Academy of Sciences (India)

Abstract. The energy costs in the cold ternary fission of 252Cf for various light charged particle emission are calculated by including Wong's correction for Coulomb potential. Energy cost is found to be higher in cold fission than in normal fission. It is found that energy cost always increases with decrease in experimental yield ...

Development of an encapsulation method using plasma arc welding to produce iodine-125 seeds for brachytherapy

International Nuclear Information System (INIS)

Feher, Anselmo; Calvo, Wilson A.P.; Rostelato, Maria E.C.M.; Zeituni, Carlos A.; Somessari, Samir L.; Costa, Osvaldo L.; Moura, Joao A.; Moura, Eduardo S.; Souza, Carla D.; Rela, Paulo R.

2011-01-01

The prostate cancer, which is the second cause of death by cancer in men, overcome only by lung cancer is public health problem in Brazil. Brachytherapy is among the possible available treatments for prostate cancer, in which small seeds containing Iodine-125 radioisotope are implanted into the prostate gland. The seed consists of a titanium sealed capsule with 0.8 mm external diameter and 4.5 mm length, containing a central silver wire with adsorbed Iodine-125. The Plasma Arc Welding (PAW) is one of the viable techniques for sealing process. The equipment used in this technique is less costly than in other processes, such as, Laser Beam Welding (LBW). The main purpose of this work was the development of an encapsulation method using PAW. The development of this work has presented the following phases: cutting and cleaning titanium tube, determination of the welding parameters, development of a titanium tube holding device for PAW, sealed sources validation according to ISO 2919 - Sealed Radioactive Sources - General Requirements and Classification, and metallographic assays. The developed procedure to seal Iodine-125 seeds using PAW has shown high efficiency, satisfying all the established requirements of ISO 2919. The results obtained in this work will give the possibility to establish a routine production process according to the orientations presented in resolution RDC 17 - Good Manufacturing Practices to Medical Products defined by the ANVISA - National Agency of Sanitary Surveillance. (author)

Development of an encapsulation method using plasma arc welding to produce iodine-125 seeds for brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Feher, Anselmo; Calvo, Wilson A.P.; Rostelato, Maria E.C.M.; Zeituni, Carlos A.; Somessari, Samir L.; Costa, Osvaldo L.; Moura, Joao A.; Moura, Eduardo S.; Souza, Carla D.; Rela, Paulo R., E-mail: afeher@ipen.b, E-mail: wapcalvo@ipen.b, E-mail: elisaros@ipen.b, E-mail: somessar@ipen.b, E-mail: olcosta@ipen.b, E-mail: esmoura@ipen.b, E-mail: cdsouza@ipen.b, E-mail: prela@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

2011-07-01

The prostate cancer, which is the second cause of death by cancer in men, overcome only by lung cancer is public health problem in Brazil. Brachytherapy is among the possible available treatments for prostate cancer, in which small seeds containing Iodine-125 radioisotope are implanted into the prostate gland. The seed consists of a titanium sealed capsule with 0.8 mm external diameter and 4.5 mm length, containing a central silver wire with adsorbed Iodine-125. The Plasma Arc Welding (PAW) is one of the viable techniques for sealing process. The equipment used in this technique is less costly than in other processes, such as, Laser Beam Welding (LBW). The main purpose of this work was the development of an encapsulation method using PAW. The development of this work has presented the following phases: cutting and cleaning titanium tube, determination of the welding parameters, development of a titanium tube holding device for PAW, sealed sources validation according to ISO 2919 - Sealed Radioactive Sources - General Requirements and Classification, and metallographic assays. The developed procedure to seal Iodine-125 seeds using PAW has shown high efficiency, satisfying all the established requirements of ISO 2919. The results obtained in this work will give the possibility to establish a routine production process according to the orientations presented in resolution RDC 17 - Good Manufacturing Practices to Medical Products defined by the ANVISA - National Agency of Sanitary Surveillance. (author)

Discrepancies in the half-lives of 90Sr, 137Cs and 252Cf

International Nuclear Information System (INIS)

Rajput, M.U.; Mac Mahon, T.D.

1990-01-01

Recent reports have pointed out that significant discrepancies exist in published half-life data for 90 Sr, 137 Cs and 252 Cr, amongst others. These discrepancies make the estimation of evaluated half-lives for these isotopes difficult and contentious. This paper reviews the current situation, takes into account recently available data and attempts to derive recommended half-lives and associated uncertainties for the three isotopes. 37 refs, 3 tabs

Study of the 249-251Cf + 48Ca reactions: recent results and outlook

Science.gov (United States)

Voinov, A. A.; Oganessian, Yu Ts; Abdullin, F. Sh; Brewer, N. T.; Dmitriev, S. N.; Grzywacz, R. K.; Hamilton, J. H.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Rykaczewski, K. P.; Sabelnikov, A. V.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Stoyer, M. A.; Subbotin, V. G.; Sukhov, A. M.; Tsyganov, Yu S.; Utyonkov, V. K.; Vostokin, G. K.

2018-02-01

Experiment aiming at the synthesis of heavy isotopes of Z=118 (Og) using beam of 48Ca and a target of 249-251Cf was undertaken in October 2015 - April 2016 employing the Dubna Gas-Filled Recoil Separator (FLNR JINR). The target of mixed isotopes of 249-251Cf (50.7% of 249Cf, 12.9% of 250Cf, and 36.4% of 251Cf) was irradiated by 48Ca ions at two beam energies of 252 and 258 MeV with the corresponding accumulated beam doses of 1.6×1019 and 1.1×1019. A single event observed at lower beam energy was assigned to the isotope 294Og, the product of the reaction 249Cf(48Ca, 3n); its decay pattern and the observed radioactive properties of the nuclides in the decay chain reproduce in full those observed for 294Og in our earlier experiments of 2002-2005 and 2012. At higher beam energy we observed no decay chains that could be attributed to the isotopes of Og. The possibility of renewal of this experiment in the future is discussed.

In situ x-ray fluorescence and californium-252 neutron activation analysis for marine and terrestrial mineral exploration

International Nuclear Information System (INIS)

Wogman, N.A.

1976-12-01

Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables

Measurement of the fission yields of selected prompt and decay fission product gamma-rays of spontaneously fissioning 252Cf and 244Cm

International Nuclear Information System (INIS)

Reber, E.L.; Gehrke, R.J.; Aryaeinejad, R.; Hartwell, J.K.

2005-01-01

Gamma-ray spectrometry measurements have been made of the fission yields of selected γ -rays emitted by the spontaneously fissioning isotopes 252 Cf and 244 Cm. The measured γ-rays were selected based on their relative abundance in the spectrum and their freedom from interference or, in a few instances, ease of interference correction. From these data and the cumulative and independent yield data of England and Rider, those γ-rays that are primarily produced by radioactive decay, as opposed to direct yield, were converted into the decays per spontaneous fission expressed in percent and compared to cumulative yield values of England and Rider. For those γ-rays whose production is dominated by direct (independent) yield, the ratio of γ-rays per spontaneous fission is reported. The γ-ray yield can be compared to the independent yield values of England and Rider when 100% of the direct feeding passes through the γ-ray. In those cases where both cumulative and independent yields contribute to the observed γ-ray emission rate, a direct comparison is not possible but a method to quantify the contribution from each is proposed. (author)

Differential and integral comparisons of three representations of the prompt neutron spectrum for the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Madland, D.G.; LaBauve, R.J.; Nix, J.R.

1984-01-01

Because of their importance as neutron standards, we present comparisons of measured and calculated prompt fission neutron spectra N(E) and average prompt neutron multiplicities anti nu/sub p/ for the spontaneous fission of 252 Cf. In particular, we test three representations of N(E) against recent experimental measurements of the differential spectrum and threshold integral cross sections. These representations are the Maxwellian spectrum, the NBS spectrum, and the Los Alamos spectrum of Madland and Nix. For the Maxwellian spectrum, we obtain the value of the Maxwellian temperature T/sub M/ by a least-squares adjustment to the experimental differential spectrum of Poenitz and Tamura. For the Los Alamos spectrum, a similar least-squares adjustment determines the nuclear level-density parameter a, which is the single unknown parameter that appears. The NBS spectrum has been previously constructed by adjustments to eight differential spectra measured during the period 1965 to 1974. Among these three representations, we find that the Los Alamos spectrum best reproduces both the differential and integral measurements, assuming ENDF/B-V cross sections in the calculation of the latter. Although the NBS spectrum reproduces the integral measurements fairly well, it fails to satisfactorily reproduce the new differential measurement, and the Maxwellian spectrum fails to satisfactorily reproduce the integral measurements. Additionally, we calculate a value of anti nu/sub p/ from the Los Alamos theory that is within approximately 1% of experiment. 25 references

Evaluation of resins for use in brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Carvalho, Luiz Claudio F.M. Garcia; Ferraz, Wilmar Barbosa; Chrcanovic, Bruno Ramos; Santos, Ana Maria M., E-mail: ferrazw@cdtn.b, E-mail: amms@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

2011-07-01

Brachytherapy is an advanced cancer treatment where radioactive seeds or sources are placed near or directly into the tumor thus reducing the radiation exposure in the surrounding healthy tissues. Prostate cancer can be treated with interstitial brachytherapy in initial stage of the disease in which tiny radioactive seeds with cylindrical geometry are used. Several kinds of seeds have been developed in order to obtain a better dose distribution around them and with a lower cost manufacturing. These seeds consist of an encapsulation, a radionuclide carrier, and X-ray marker. Among the materials that have potential for innovation in the construction of seeds, biocompatible resins appear as an important option. In this paper, we present some characterization results with Fourier transform infrared spectroscopic (FTIR) and ultraviolet-visible spectroscopy (UV-vis) performed on two types of resins in which curing temperatures for each one were varied as also the results of coatings with these resins under titanium substrates. Interactions of these resins in contact with the simulated body fluid were evaluated by atomic force microscopy, scanning electron microscopy, and energy dispersive X-ray spectroscopy. (author)

Fabrication of intense neutron sources for medical applications

International Nuclear Information System (INIS)

Boulogne, A.R.; Walker, V.W.

1975-01-01

Simulated sources containing 252 Cf equivalents of 0.1 to 1.0 milligrams were prepared. Samarium was used as the simulant in a modified chemical plating technique similar to that used to prepare palladium-californium oxide cermet for industrial applications. The length of the platinum-10 percent iridium doubly encapsulated source with its protective sheath is 0.545 in. (14.1 mm). Outside dia of the source, including its sheath, is 0.109 in. (2.8 mm). Existing ''Brachytrons'' can accommodate this source form. This capsule system will withstand internal gas pressures from helium due to alpha decay and fission gases from a 1 mg 252 Cf source after ten years if the source is subjected to a maximum temperature of 800 0 C, the theoretical temperature of an accidental fire. Under these conditions the safety factor is 3. The capsule system is being tested with tracer amounts of 252 Cf to ensure that it will withstand adverse service conditions as well as tests specified for Special Form Materials. (auth)

A portable measurement system for subcriticality measurements by the Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Ragan, G.E.; Blakeman, E.D.

1987-01-01

A portable measurement system consisting of a personal computer used as a Fourier analyzer and three detection channels (with associated electronics that provide the signals to analog-to-digital (A/D) convertors) has been assembled to measure subcriticality by the 252 Cf-source-driven neutron noise analysis method. 8 refs

Preliminary MCNP-POLIMI Simulations for the Evaluation of the ''Floor Effect'' Comparison of APSTNG and Cf Sources

CERN Document Server

Pozzi, S A

2002-01-01

The present simulations performed with the Monte Carlo code MCNP-POLIMI [1] have the scope of evaluating the associated-particle sealed tube neutron generator (APSTNG) for use as an interrogation source in the source-driven noise analysis method for the assay of nuclear materials. In the Nuclear Materials Identification System (NMIS) developed at the Oak Ridge National Laboratory, the time dependent cross-correlation of the timed neutron source and detector responses is one of the signatures acquired. Previous studies and measurements have demonstrated the sensitivity of this and other related signatures to fissile mass [2-3]. In a recent report [4], we outlined the advantages of the APSTNG interrogation source for use with NMIS when compared with the Cf-252 source. In particular, we showed that when the distance between the source and the sample and the sample and the detectors is large, the APSTNG source outperforms the Cf-252 in sensitivity to fissile mass. This is the case when performing measurements of ...

1987 Neutron and gamma personnel dosimeter intercomparison study using a D2O-moderated 252Cf source

International Nuclear Information System (INIS)

Swaja, R.E.; West, L.E.; Sims, C.S.; Welty, T.J.

1989-05-01

The thirteenth Personnel Dosimetry Intercomparison Study (i.e., PDIS 13) was conducted during April 1987 as a joint effort by Oak Ridge National Laboratory's (ORNL) Dosimetry Applications Research Group and the Southwest Radiation Calibration Center at the University of Arkansas. A total of 48 organizations (34 from the US and 14 from abroad) participated in PDIS 13. Participants submitted a total of 1,113 neutron and gamma dosimeters for this mixed field study. The dosimeters were transferred by mail and were handled by experimental personnel at ORNL and the University of Arkansas. The type of neutron dosimeter and the percentage of participants submitting that type are as follows: TLD-albedo (49%), direct interaction TLD (31%), CR-39 (17%), film (3%). The type of gamma dosimeter and the percentage of participants submitting that type are as follows: Li 2 B 4 O 7 , alone or in combination with CaSO 4 , (69%), 7 LiF (28%), natural LiF (3%). Radiation exposures in PDIS 13 were limited to 0.5 and 1.5 mSv from 252 Cf moderated by 15-cm of D 2 O. Traditional exposures using the Health Physics Research Reactor (HPRR) were not possible due to the fact that all reactors at ORNL, including the HPRR, were shutdown by order of the Department of Energy at the time the intercomparison was performed. Planned exposures using a 238 PuBe source were negated by a faulty timing mechanism. Based on accuracy and precision, direct interaction TLD dosimeters exhibited the best performance in PDIS 13 neutron measurements. They were followed, in order of best performance, by CR-39, TLD albedo, and film. The Li 2 B 4 O 7 type TLD dosimeters exhibited the best performance in PDIS 13 gamma measurements. They were followed by natural LiF, 7 LiF, and film. 12 refs., 1 fig., 5 tabs

Dosimetric study of a new polymer encapsulated palladium-103 seed

International Nuclear Information System (INIS)

Bernard, S; Vynckier, S

2005-01-01

The use of low-energy photon emitters for brachytherapy applications, as in the treatment of prostate or ocular tumours, has increased significantly over the last few years. Several new seed models utilizing 103 Pd and 125 I have recently been introduced. Following the TG43U1 recommendations of the AAPM (American Association of Physicists in Medicine) (Rivard et al 2004 Med. Phys. 31 633), dose distributions around these low-energy photon emitters are characterized by the dose rate constant, the radial dose function and the anisotropy function in water. These functions and constants can be measured for each new seed in a solid phantom (i.e. solid water such as WT1) using high spatial resolution detectors such as very small thermoluminescent detectors. These experimental results in solid water must then be converted into liquid water by using Monte Carlo simulations. This paper presents the dosimetric parameters of a new palladium seed, OptiSeed TM (produced by International Brachytherapy (IBt), Seneffe, Belgium), made with a biocompatible polymeric shell and with a design that differs from the hollow titanium encapsulated seed, InterSource 103 , produced by the same company. A polymer encapsulation was chosen by the company IBt in order to reduce the quantity of radioactive material needed for a given dose rate, and to improve the symmetry of the radiation field around the seed. The necessary experimental data were obtained by measurements with LiF thermoluminescent dosimeters (1 mm 3 ) in a solid water phantom (WT1) and then converted to values in liquid water using Monte Carlo calculations (MCNP-4C). Comparison of the results with a previous study by Reniers et al (2002 Appl. Radiat. Isot. 57 805) shows very good agreement for the dose rate constant and for the radial dose function. In addition, the results also indicate an improvement in isotropy compared to a conventional titanium encapsulated seed. The relative dose (anisotropy value relative to 90 deg.) from

Inverse gamma ray dose rate effect in californium-252 RBE experiment with human T-1 cells irradiated in vitro

International Nuclear Information System (INIS)

Todd, P.; Feola, J.M.

1986-01-01

Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)

Development of an automation system for Iodine-125 brachytherapy seed encapsulated by Nd:YAG laser welding

International Nuclear Information System (INIS)

Somessari, S.L.; Feher, A.; Sprenger, F.E.; Rostelato, M.E.C.M.; Costa, F.E. da; Calvo, W.A.P.

2011-01-01

The aim of this work is to develop an automation system for iodine-125 radioactive seed production by Nd:YAG laser welding, which has been used successfully in low dose rate (LDR) brachytherapy treatment. This small seed consists of a welded titanium capsule, with 0.8 mm in diameter and 4.5 mm in length, containing iodine-125 adsorbed onto a silver rod. The iodine-125 seeds are implanted into the human prostate to irradiate the tumor for cancer treatment. Nowadays, the Radiation Technology Center, at Institute for Nuclear and Energy Research, Sao Paulo, Brazil (IPEN-CNEN/SP) imports and distributes 36,000 iodine-125 seeds per year, for the clinics and hospitals in the country. However, the Brazilian market potential is now over 8,000 iodine-125 seeds per month. The local production of these iodine-125 radioactive sources became a priority for the Institute, in order to reduce the price and the problems of prostate cancer management. It will permit to spread their use to a larger number of patients in Brazil. On the other hand, the industrial automation plays an important role for iodine-125 seeds in order to increase the productivity, with high quality and assurance, avoiding human factors, implementing and operating with good manufacturing practices (GMP). The technology consists of appliance electronic and electro-mechanical parts and components to control machines and processes. The automation system technology for iodine-125 seed production developed in this work was mainly assembled employing a programmable logic controller (PLC), a stepper motor, an Nd:YAG laser welding machine and a supervisory. The statistical repeatability of correctly encapsulated sealed sources with this automation system is greater than 95%. (authors)

The need for international standardization in clinical beta dosimetry for brachytherapy

International Nuclear Information System (INIS)

Quast, U.; Boehm, J.; Kaulich, T.W.

2002-01-01

Beta radiation has found increasing interest in radiotherapy. Besides the curative treatment of small and medium-sized intraocular tumors by means of ophthalmic beta radiation plaques, intravascular brachytherapy has proven to successfully overcome the severe problem of restenosis after interventional treatment of arterial stenosis in coronaries and peripheral vessels in many clinical trials with a large number of patients. Prior to initiating procedures applying beta radiation in radiotherapy, however, there is a common need to specify methods for the determination and specification of the absorbed dose to water or tissue and their spatial distributions. The IAEA-TECDOC-1274 Calibration of photon and beta ray sources used in brachytherapy (2002) is a help for photon brachytherapy calibration. But, for beta seed and line sources, IAEA recommends well type ionization chambers as working standards which are far from measuring absorbed dose to water of the radiation clinically used. Although the application of such working standards seems to be more precise, large errors can occur when the medical physicist has to convert the calibration data to absorbed dose to water of the beta radiation emitted. The user must believe that the source is equally activated and that the manufacturer did not change the design and construction of the source encapsulation. With the DGMP Report 16 (2001) Guidelines for medical physical aspects of intravascular brachytherapy a very detailed code of practice is given, especially for the calibration and clinical dosimetry of intravascular beta radiation sources. As there is a global need for standardization in clinical dosimetry for intravascular brachytherapy utilizing beta radiation, the DIN-NAR, the German committee on standardization in radiology, task group dosimetry, has initiated an international adhoc working group for a new ISO work item proposal on the standardization of procedures in clinical dosimetry to guarantee reliable

Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

Energy Technology Data Exchange (ETDEWEB)

Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2014-04-24

This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

American brachytherapy society (ABS) consensus guidelines for brachytherapy of esophageal cancer

International Nuclear Information System (INIS)

Gaspar, Laurie E.; Nag, Subir; Herskovic, Arnold; Mantravadi, Rao; Speiser, Burton

1997-01-01

Introduction: There is wide variation in the indications, treatment regimens, and dosimetry for brachytherapy in the treatment of cancer of the esophagus. No guidelines for optimal therapy currently exist. Methods and Materials: Utilizing published reports and clinical experience, representatives of the Clinical Research Committee of the American Brachytherapy Society (ABS) formulated guidelines for brachytherapy in esophageal cancer. Results: Recommendations were made for brachytherapy in the definitive and palliative treatment of esophageal cancer. (A) Definitive treatment: Good candidates for brachytherapy include patients with unifocal thoracic adeno- or squamous cancers ≤ 10 cm in length, with no evidence of intra-abdominal or metastatic disease. Contraindications include tracheal or bronchial involvement, cervical esophagus location, or stenosis that cannot be bypassed. The esophageal brachytherapy applicator should have an external diameter of 6-10 mm. If 5FU-based chemotherapy and 45-50-Gy external beam are used, recommended brachytherapy is either: (i) HDR 10 Gy in two weekly fractions of 5 Gy each; or (ii) LDR 20 Gy in a single course at 0.4-1 Gy/hr. All doses are specified 1 cm from the midsource or middwell position. Brachytherapy should follow external beam radiation therapy and should not be given concurrently with chemotherapy. (B) Palliative treatment: Patients with adeno- or squamous cancers of the thoracic esophagus with distant metastases or unresectable local disease progression/recurrence after definitive radiation treatment should be considered for brachytherapy with palliative intent. After limited dose (30 Gy) EBRT, the recommended brachytherapy is either: (i) HDR 10-14 Gy in one or two fractions; or (ii) LDR 20-25 Gy in a single course at 0.4-1 Gy/hr. The need for external beam radiation in newly diagnosed patients with a life expectancy of less than 3 months is controversial. In these cases, HDR of 15-20 Gy in two to four fractions or

American brachytherapy society (ABS) guidelines for brachytherapy of esophageal cancer

International Nuclear Information System (INIS)

Nag, Subir; Gaspar, Laurie; Herskovic, Arnold; Mantravadi, Prasad; Speiser, Burton

1996-01-01

Introduction: There is wide variation in the indications, techniques, treatment regimens and dosimetry being used to treat cancer of the esophagus and no guidelines exist for optimal therapy. Methods: The Clinical Research Committee of the ABS met to formulate consensus guidelines for brachytherapy in esophageal cancer. Results: Good candidates for brachytherapy include patients with unifocal disease, with thoracic tumor 10 cm primary regional lymph adenopathy or tumor located in the gastro-esophageal junction or cervical esophagus. Contraindications include tracheo-esophageal fistula or stenosis that cannot be by-passed. The esophageal or nasogastric tube inserted should have a diameter of 6-10 mm whenever possible. If 5FU-based chemotherapy and 50 Gy external beam (EBRT) are used, it is suggested that the low dose rate brachytherapy (LDR) dose be 20 Gy at 0.4-1 Gy/hr, prescribed at 1 cm from the source. If high dose rate (HDR) is used, the dose recommended is 10 Gy in 2 weekly fractions of 5 Gy each, given after EBRT. Chemotherapy is not usually given concurrently with brachytherapy, and when it is, the brachytherapy dose is reduced. The length of esophagus treated by brachytherapy includes the post-EBRT involved area and a 1-2 cm margin proximally and distally. Supportive care, given during EBRT includes an antifungal agent (e.g., diflucan) and carafate. Gradual dilatation of the esophagus is required post-treatment for esophageal strictures. Conclusion: Guidelines were developed for brachytherapy in esophageal cancer. As more clinical data becomes available, these guidelines will be updated by the ABS

Use of polyethylene pellets in the design and construction of a storage safe, a transport vessel and a portable shield for californium-252

International Nuclear Information System (INIS)

Sharma, S.

1986-01-01

A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields

The American Brachytherapy Society recommendations for low-dose-rate brachytherapy for carcinoma of the cervix

International Nuclear Information System (INIS)

Nag, Subir; Chao, Clifford; Erickson, Beth; Fowler, Jeffery; Gupta, Nilendu; Martinez, Alvaro; Thomadsen, Bruce

2002-01-01

Purpose: This report presents guidelines for using low-dose-rate (LDR) brachytherapy in the management of patients with cervical cancer. Methods: Members of the American Brachytherapy Society (ABS) with expertise in LDR brachytherapy for cervical cancer performed a literature review, supplemented by their clinical experience, to formulate guidelines for LDR brachytherapy of cervical cancer. Results: The ABS strongly recommends that radiation treatment for cervical carcinoma (with or without chemotherapy) should include brachytherapy as a component. Precise applicator placement is essential for improved local control and reduced morbidity. The outcome of brachytherapy depends, in part, on the skill of the brachytherapist. Doses given by external beam radiotherapy and brachytherapy depend upon the initial volume of disease, the ability to displace the bladder and rectum, the degree of tumor regression during pelvic irradiation, and institutional practice. The ABS recognizes that intracavitary brachytherapy is the standard technique for brachytherapy for cervical carcinoma. Interstitial brachytherapy should be considered for patients with disease that cannot be optimally encompassed by intracavitary brachytherapy. The ABS recommends completion of treatment within 8 weeks, when possible. Prolonging total treatment duration can adversely affect local control and survival. Recommendations are made for definitive and postoperative therapy after hysterectomy. Although recognizing that many efficacious LDR dose schedules exist, the ABS presents suggested dose and fractionation schemes for combining external beam radiotherapy with LDR brachytherapy for each stage of disease. The dose prescription point (point A) is defined for intracavitary insertions. Dose rates of 0.50 to 0.65 Gy/h are suggested for intracavitary brachytherapy. Dose rates of 0.50 to 0.70 Gy/h to the periphery of the implant are suggested for interstitial implant. Use of differential source activity or

Micelle-encapsulated fullerenes in aqueous electrolytes

Energy Technology Data Exchange (ETDEWEB)

Ala-Kleme, T., E-mail: timo.ala-kleme@utu.fi [Department of Chemistry, University of Turku, 20014 Turku (Finland); Maeki, A.; Maeki, R.; Kopperoinen, A.; Heikkinen, M.; Haapakka, K. [Department of Chemistry, University of Turku, 20014 Turku (Finland)

2013-03-15

Different micellar particles Mi(M{sup +}) (Mi=Triton X-100, Triton N-101 R, Triton CF-10, Brij-35, M{sup +}=Na{sup +}, K{sup +}, Cs{sup +}) have been prepared in different aqueous H{sub 3}BO{sub 3}/MOH background electrolytes. It has been observed that these particles can be used to disperse the highly hydrophobic spherical [60]fullerene (1) and ellipsoidal [70]fullerene (2). This dispersion is realised as either micelle-encapsulated monomers Mi(M{sup +})1{sub m} and Mi(M{sup +})2{sub m} or water-soluble micelle-bound aggregates Mi(M{sup +})1{sub agg} and Mi(M{sup +})2{sub agg}, where especially the hydration degree and polyoxyethylene (POE) thickness of the micellar particle seems to play a role of vital importance. Further, the encapsulation microenvironment of 1{sub m} was found to depend strongly on the selected monovalent electrolyte cation, i.e., the encapsulated 1{sub m} is accommodated in the more hydrophobic microenvironment the higher the cationic solvation number is. - Highlights: Black-Right-Pointing-Pointer Different micellar particles is used to disperse [60]fullerene and [70]fullerene. Black-Right-Pointing-Pointer Fullerene monomers or aggregates are dispersed encaging or bounding by micelles. Black-Right-Pointing-Pointer Effective facts are hydration degree and polyoxyethylene thickness of micelle.

New fit of thermal neutron constants (TNC for 233,235U, 239,241Pu and 252Cf(sf: Microscopic vs. maxwellian data

Directory of Open Access Journals (Sweden)

Pronyaev Vladimir G.

2017-01-01

Full Text Available An IAEA project to update the Neutron Standards is near completion. Traditionally, the Thermal Neutron Constants (TNC evaluated data by Axton for thermal-neutron scattering, capture and fission on four fissile nuclei and the total nu-bar of 252Cf(sf are used as input in the combined least-square fit with neutron cross section standards. The evaluation by Axton (1986 was based on a least-square fit of both thermal-spectrum averaged cross sections (Maxwellian data and microscopic cross sections at 2200 m/s. There is a second Axton evaluation based exclusively on measured microscopic cross sections at 2200 m/s (excluding Maxwellian data. Both evaluations disagree within quoted uncertainties for fission and capture cross sections and total multiplicities of uranium isotopes. There are two factors, which may lead to such difference: Westcott g-factors with estimated 0.2% uncertainties used in the Axton's fit, and deviation of the thermal spectra from Maxwellian shape. To exclude or mitigate the impact of these factors, a new combined GMA fit of standards was undertaken with Axton's TNC evaluation based on 2200 m/s data used as a prior. New microscopic data at the thermal point, available since 1986, were added to the combined fit. Additionally, an independent evaluation of TNC was undertaken using CONRAD code. Both GMA and CONRAD results are consistent within quoted uncertainties. New evaluation shows a small increase of fission and capture thermal cross sections, and a corresponding decrease in evaluated thermal nubar for uranium isotopes and 239Pu.

Prostate cancer brachytherapy

International Nuclear Information System (INIS)

Abreu, Carlos Eduardo Vita; Silva, Joao L. F.; Srougi, Miguel; Nesrallah, Adriano

1999-01-01

The transperineal brachytherapy with 125 I/Pd 103 seed implantation guided by transurethral ultrasound must be presented as therapeutical option of low urinary morbidity in patients with localized prostate cancer. The combined clinical staging - including Gleason and initial PSA - must be encouraged, for definition of a group of low risk and indication of exclusive brachytherapy. Random prospective studies are necessary in order to define the best role of brachytherapy, surgery and external beam radiation therapy

Factors affecting radiation injury after interstitial brachytherapy for brain tumors

International Nuclear Information System (INIS)

Leibel, S.A.; Gutin, P.H.; Davis, R.L.

1991-01-01

The effects of brachytherapy on normal brain tissue are not easily delineated in the clinical setting because of the presence of concurrent radiation-induced changes in the coexistent brain tumor. Sequential morphologic studies performed after the implantation of radioactive sources into the brains of experimental animals have provided a better understanding of the character and magnitude of the structural changes produced by interstitial irradiation on normal brain tissue. Furthermore, the clinical experience accumulated thus far provides not only relevant information, but also some guidelines for future treatment policies. In this paper, the authors summarize the experimental findings and review the pathologic and clinical features of brain injury caused by interstitial brachytherapy. A number of studies in the older literature examined the effects of radioisotopes such as radium-226 (38--43), radon-22 (44--46), gold-198 (29,47--50), tantalum-182 (29,51,52) yttrium-9- (50,53,54), and cobalt-60 (29,50,55). This review is restricted to low- and high-activity encapsulated iodine-125 ( 125 I) and iridium-192 ( 192 Ir), the isotopes that are most commonly used in current clinical practice

48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...

[An improved method of preparing protein and peptide probes in mass spectrometry with ionization of division fragments by californium-252 (TOF-PDMS)].

Science.gov (United States)

Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A

1996-08-01

The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.

Atmospheric Chemistry of (CF3)2CF-C≡N

DEFF Research Database (Denmark)

Andersen, Mads Peter Sulbæk; Kyte, Mildrid; Thirstrup Andersen, Simone

2017-01-01

FTIR/smog chamber experiments and ab initio quantum calculations were performed to investigate the atmospheric chemistry of (CF3)2CFCN, a proposed replacement compound for the industrially important sulfur hexafluoride, SF6. The present study determined k(Cl + (CF3)2CFCN) = (2.33 ± 0.87) × 10–17, k......(OH + (CF3)2CFCN) = (1.45 ± 0.25) × 10–15, and k(O3 + (CF3)2CFCN) ≤ 6 × 10–24 cm3 molecule–1 s–1, respectively, in 700 Torr of N2 or air diluent at 296 ± 2 K. The main atmospheric sink for (CF3)2CFCN was determined to be reaction with OH radicals. Quantum chemistry calculations, supported by experimental...

Intravascular brachytherapy for peripheral vascular disease

Directory of Open Access Journals (Sweden)

Hagen, Anja

2008-09-01

Full Text Available Scientific background: Percutaneous transluminal angioplasties (PTA through balloon dilatation with or without stenting, i.e. vessel expansion through balloons with or without of implantation of small tubes, called stents, are used in the treatment of peripheral artery occlusive disease (PAOD. The intravascular vessel irradiation, called intravascular brachytherapy, promises a reduction in the rate of repeated stenosis (rate of restenosis after PTA. Research questions: The evaluation addresses questions on medical efficacy, cost-effectiveness as well as ethic, social and legal implications in the use of brachytherapy in PAOD patients. Methods: A systematic literature search was conducted in August 2007 in the most important medical electronic databases for publications beginning from 2002. The medical evaluation included randomized controlled trials (RCT. The information synthesis was performed using meta-analysis. Health economic modeling was performed with clinical assumptions derived from the meta-analysis and economical assumptions derived from the German Diagnosis Related Groups (G-DRG-2007. Results: Medical evaluation: Twelve publications about seven RCT on brachytherapy vs. no brachytherapy were included in the medical evaluation. Two RCT showed a significant reduction in the rate of restenosis at six and/or twelve months for brachytherapy vs. no brachytherapy after successful balloon dilatation, the relative risk in the meta-analysis was 0.62 (95% CI: 0.46 to 0.84. At five years, time to recurrence of restenosis was significantly delayed after brachytherapy. One RCT showed a significant reduction in the rate of restenosis at six months for brachytherapy vs. no brachytherapy after PTA with optional stenting, the relative risk in the meta-analysis was 0.76 (95% CI: 0.61 to 0.95. One RCT observed a significantly higher rate of late thrombotic occlusions after brachytherapy in the subgroup of stented patients. A single RCT for brachytherapy

The development of a human eye model for ophthalmic iodine-125 brachytherapy dosimetry

International Nuclear Information System (INIS)

Mourao, A.P.; Campos, T.P.R.

2008-01-01

Full text: Radiotherapy is used to treat malign tumors. Radiotherapy is an alternative to enucleation in ocular tumors. However, the irradiation of ocular region can bring damages due high doses, mainly in the crystalline lens and in the bone tissue in growth phase. Brachytherapy instead of teletherapy looks for reducing doses in the crystalline lens and the adjacent tissues of the ocular globe (orbital region), minimizing side effects. Herein, some encapsulated radioisotopes in radioactive seeds applied to the ocular brachytherapy are available. Thus, a three-dimensional computational voxel model of the ocular region with its heterogeneous tissues, globe and adjacent tissues is developed. This computational model is used to simulate orbital irradiation with radioactive seeds positioned on the sclera surface through the MCNP5 code. The computational simulation allows evaluating how doses are spatially distributed in the orbital volume in treatments with the radioactive seeds of iodine-125. Therefore, the results allow comparing the spatial doses distribution obtained through the MCNP5 simulation for those two distinct types of radioactive seeds. Bench markets from literature validates the proposed simulations. (author)

Image Guided Cervical Brachytherapy: 2014 Survey of the American Brachytherapy Society

Energy Technology Data Exchange (ETDEWEB)

Grover, Surbhi, E-mail: Surbhi.grover@uphs.upenn.edu [Department of Radiation Oncology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Harkenrider, Matthew M. [Department of Radiation Oncology, Stritch School of Medicine, Loyola University Chicago, Chicago, Illinois (United States); Cho, Linda P. [Department of Radiation Oncology, Brigham & Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Erickson, Beth [Department Radiation Oncology, Froedtert Hospital and Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Small, Christina [Department of Public Health Sciences, Stritch School of Medicine, Loyola University Chicago, Chicago, Illinois (United States); Small, William [Department of Radiation Oncology, Stritch School of Medicine, Loyola University Chicago, Chicago, Illinois (United States); Viswanathan, Akila N. [Department of Radiation Oncology, Brigham & Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States)

2016-03-01

Purpose: To provide an update of the 2007 American brachytherapy survey on image-based brachytherapy, which showed that in the setting of treatment planning for gynecologic brachytherapy, although computed tomography (CT) was often used for treatment planning, most brachytherapists used point A for dose specification. Methods and Materials: A 45-question electronic survey on cervical cancer brachytherapy practice patterns was sent to all American Brachytherapy Society members and additional radiation oncologists and physicists based in the United States between January and September 2014. Responses from the 2007 survey and the present survey were compared using the χ{sup 2} test. Results: There were 370 respondents. Of those, only respondents, not in training, who treat more than 1 cervical cancer patient per year and practice in the United States, were included in the analysis (219). For dose specification to the target (cervix and tumor), 95% always use CT, and 34% always use MRI. However, 46% use point A only for dose specification to the target. There was a lot of variation in parameters used for dose evaluation of target volume and normal tissues. Compared with the 2007 survey, use of MRI has increased from 2% to 34% (P<.0001) for dose specification to the target. Use of volume-based dose delineation to the target has increased from 14% to 52% (P<.0001). Conclusion: Although use of image-based brachytherapy has increased in the United States since the 2007 survey, there is room for further growth, particularly with the use of MRI. This increase may be in part due to educational initiatives. However, there is still significant heterogeneity in brachytherapy practice in the United States, and future efforts should be geared toward standardizing treatment.

Advancements in brachytherapy

DEFF Research Database (Denmark)

Tanderup, Kari; Ménard, Cynthia; Polgar, Csaba

2017-01-01

Brachytherapy is a radiotherapy modality associated with a highly focal dose distribution. Brachytherapy treats the cancer tissue from the inside, and the radiation does not travel through healthy tissue to reach the target as with external beam radiotherapy techniques. The nature of brachytherap...

Inverse planning and class solutions for brachytherapy treatment planning

International Nuclear Information System (INIS)

Trnkova, P.

2010-01-01

Brachytherapy or interventional radiooncology is a method of radiation therapy. It is a method, where a small encapsulated radioactive source is placed near to / in the tumour and therefore delivers high doses directly to the target volume. Organs at risk (OARs) are spared due to the inverse square dose fall-off. In the past years there was a slight stagnation in the development of techniques for brachytherapy treatment. While external beam radiotherapy became more and more sophisticated, in brachytherapy traditional methods have been still used. Recently, 3D imaging was considered also as the modality for brachytherapy and more precise brachytherapy could expand. Nowadays, an image guided brachytherapy is state-of-art in many centres. Integration of imaging methods lead to the dose distribution individually tailored for each patient. Treatment plan optimization is mostly performed manually as an adaptation of a standard loading pattern. Recently, inverse planning approaches have been introduced into brachytherapy. The aim of this doctoral thesis was to analyze inverse planning and to develop concepts how to integrate inverse planning into cervical cancer brachytherapy. First part of the thesis analyzes the Hybrid Inverse treatment Planning and Optimization (HIPO) algorithm and proposes a workflow how to safely work with this algorithm. The problem of inverse planning generally is that only the dose and volume parameters are taken into account and spatial dose distribution is neglected. This fact can lead to unwanted high dose regions in a normal tissue. A unique implementation of HIPO into the treatment planning system using additional features enabled to create treatment plans similar to the plans resulting from manual optimization and to shape the high dose regions inside the CTV. In the second part the HIPO algorithm is compared to the Inverse Planning Simulated Annealing (IPSA) algorithm. IPSA is implemented into the commercial treatment planning system. It

In-water calibration of PDR 192Ir brachytherapy sources with an NE2571 ionization chamber

International Nuclear Information System (INIS)

Reynaert, N.; Verhaegen, F.; Thierens, H.

1998-01-01

An ionometric calibration procedure for 192 Ir PDR brachytherapy sources in terms of dose rate to water is presented. The calibration of the source is performed directly in a water phantom at short distances (1.0, 2.5 and 5.0 cm) using an NE2571 Farmer type ion chamber. To convert the measured air-kerma rate in water to dose rate to water a conversion factor (CF) was calculated by adapting the medium-energy x-ray dosimetry protocol for a point source geometry (diverging beam). The obtained CF was verified using two different methods. Firstly, the CF was calculated by Monte Carlo simulations, where the source-ionization chamber geometry was modelled accurately. In a second method, a combination of Monte Carlo simulations and measurements of the air-kerma rate in water (at 1.0, 2.5 and 5.0 cm distance) and in air (1 m distance) was used to determine the CF. The obtained CFs were also compared with conversion factors calculated with the adapted dosimetry protocol for high-energy photons introduced by Toelli. All calculations were done for a Gammamed PDR 192 Ir source-NE2571 chamber geometry. The conversion factors obtained with the four different methods agree to within 1% at the three distances of interest. We obtained the following values (medium-energy x-ray protocol): CF(1 cm) = 1.458; CF(2.5 cm) = 1.162; CF(5.0 cm) = 1.112 (1σ=0.7% for the three distances of interest). The obtained results were checked with TLD measurements. The values of the specific dose rate constant and the radial dose function calculated in this work are in accordance with the literature data. (author)

Brachytherapy of endometrial cancers

International Nuclear Information System (INIS)

Peiffert, D.; Hoffstetter, S.; Charra-Brunaud, C.

2003-01-01

Endometrial adenocarcinomas rank third as tumoral sites en France. The tumors are confined to the uterus in 80% of the cases. Brachytherapy has a large place in the therapeutic strategy. The gold standard treatment remains extra-fascial hysterectomy with bilateral annexiectomy and bilateral internal iliac lymph node dissection. However, after surgery alone, the rate of locoregional relapses reaches 4-20%, which is reduced to 0-5% after postoperative brachytherapy of the vaginal cuff. This postoperative brachytherapy is delivered as outpatients treatment, by 3 or 4 fractions, at high dose rate. The utero-vaginal preoperative brachytherapy remains well adapted to the tumors which involve the uterine cervix. Patients presenting a localized tumor but not operable for general reasons (< 10%) can be treated with success by exclusive irradiation, which associates a pelvic irradiation followed by an utero-vaginal brachytherapy. A high local control of about 80-90% is obtained, a little lower than surgery, with a higher risk of late complications. Last but not least, local relapses in the vaginal cuff, or in the perimeatic area, can be treated by interstitial salvage brachytherapy, associated if possible with external beam irradiation. The local control is reached in half of the patients, but metastatic dissemination is frequent. We conclude that brachytherapy has a major role in the treatment of endometrial adenocarcinomas, in combination with surgery, or with external beam irradiation for not operable patients or in case of local relapses. It should use new technologies now available including computerized after-loaders and 3D dose calculation. (authors)

Brachytherapy: The need for a national metrology lab in Spain; Branquiterapia: la necesidad de un laboratorio nacional de metrologia en Espana

Energy Technology Data Exchange (ETDEWEB)

Aviles Lucas, P.

2011-07-01

Radiotherapy, along with chemotherapy and surgery, is an essential therapeutic technique for treating malignant tumours. Part of the challenge of a suitable radiotherapy treatment lies on the optimisation of the irradiated volume, which must be adapted to the tumour volume as far as possible. Depending on position of the radiation source relative to the patient, the procedure in question could be external radiotherapy, or brachytherapy. In a brachytherapy procedure, relatively small encapsulated radioactive sources are placed close to or in the tumour volume to be treated. This therapeutic treatment has two obvious advantages; on one hand the prescribed dose can be adjusted to the tumour volume, preventing unnecessary exposure of the adjacent healthy tissues, and on the other, it decreases the treatment duration compared to a radiotherapy treatment. (Author) 19 refs.

Brachytherapy in childhood rhabdomyosarcoma treatment

International Nuclear Information System (INIS)

Novaes, Paulo Eduardo Ribeiro dos Santos

1995-01-01

A retrospective study of 21 children with rhabdomyosarcoma treated by brachytherapy to the primary site of the tumor at the Radiotherapy Department of the A.C.Camargo Hospital between january/1980 to june/1993 was undertaken. The main objectives were to comprove the utility of brachytherapy in childhood rhabdomyosarcoma, to evaluate the local control and survival, in association with chemotherapy, to analyze the late effects of the treatment and to determinate the preferential technique to each clinical situation. All patients received brachytherapy to the tumor site. The radioactive isotopes employed were Gold 198 , Cesium 137 and Iridium 192 . The brachytherapy techniques depended on the tumor site, period of treatment, availability of the radioactive material and stage of the disease. Patients treated exclusively by brachytherapy received 40 Gy to 60 Gy. When brachytherapy was associated with external radiotherapy the dose ranged from 20 Gy to 40 Gy. Local control was achieved in 18 of 20 patients (90%). The global survival and local control survival rates were 61.9% (13/21 patients) and 72,2% (13/18 patients) respectively. (author)

A retrospective study of external beam radiation, neutron brachytherapy, and concurrent chemotherapy for patients with localized advanced carcinoma of the esophagus

International Nuclear Information System (INIS)

Ma, Kai; Wang, Qifeng; Li, Tao; Liu, Huiming; Liu, Bo; Jia, Xitang; Li, Shufeng; Lang, Junyuan; Zhang, Mingzhi

2014-01-01

The aim of this study was to retrospectively observe and analyze the long-term treatment outcomes of a total of 140 esophageal cancer patients who were treated with californium-252 ( 252 Cf) neutron brachytherapy (NBT) in combination with external beam radiotherapy (EBRT) and concurrent chemotherapy (CCT). From January 2002 to November 2012, 140 patients with esophageal cancer underwent NBT in combination with EBRT and CCT. The distribution of the patient numbers over the various cancer stages of IIA, IIB, and III were 43, 7, and 90, respectively. The total radiation dose to the reference point via NBT was 8–25 Gy-eq in two to five fractions with one fraction per week. The total dose via EBRT was 50–60 Gy, which was delivered over a period of five to six weeks with normal fractionation. Fifty-four and 86 patients received tegafur suppositories (TS) and continuous infusion of fluorouracil (5-Fu) with cisplatin (CDDP), respectively. The median follow-up time was 42 months. The minimum follow-up was three months, and the maximum was 106 months. The overall median survival including death from all causes was 29.5 months. The five-year overall survival rate (OS) and local control (LC) were 33.4% and 55.9%, respectively. The chemotherapy regimen was a factor that was significantly associated with OS (p = 0.025) according to univariate analysis. The five-year OSs were 27.4% and 44.3% for the PF and TS chemotherapy regimens, respectively. Regarding acute toxicity, no incidences of fistula or massive bleeding were observed during this treatment period. The incidence of severe, late complications was related to the PF chemotherapy regimen (p = 0.080). The clinical data indicated that NBT in combination with EBRT and CRT produced favorable local control and long-term survival rates for patients with esophageal cancer and that the side effects were tolerable. A reasonable CRT regimen can decrease the rate of severe, late complications

Use of neutron activation and X-ray fluorescence with radioactive sources (Cf-252 and Am-241) for the instrumental qualiquantitative simultaneous analysis of some elements in samples of mineral supplement for animals

International Nuclear Information System (INIS)

Simabuco, S.M.

1984-01-01

To study the possibility of using two non-destructive (neutron activation and X-ray fluorescence) analyses in simultaneous quali-quantitative evaluations of some elements in mineral supplement for animals, a Cf-252 neutron source (11.3 mCi; 21.1 μgrams) and a Am-241 low energy gamma-ray emitter source (59.5 KeV; 100 mCi) were employed. For these sources, shieldings and sample irradiation systems were built. For the neutron activation analysis a reservoir of 72 cm height and 43 cm diameter was filled with paraffine, and the samples and neutron sources were put inside this reservoir using polypropilene and nylon tubes. To detect the gamma-rays emitted by the radioisotopes a well-type solid NaI(Tl) crystal scintillator (3x3') was used, coupled to a multi-channel analyser. For the X-ray fluorescence analysis a lead cylinder of 9.75 cm height and 5.6 cm diameter (with 0.7 cm thickness) was made and internally lined with a 0.36 mm copper and 0.1 mm aluminium foil. (Author) [pt

Guidelines for the calibration of low energy photon sources at beta-ray brachytherapy sources

International Nuclear Information System (INIS)

2000-01-01

With the development of improved methods of implanting brachytherapy sources in a precise manner for treating prostate cancer and other disease processes, there has been a tremendous growth in the use of low energy photon sources, such as 125 I and 103 Pd brachytherapy seeds. Low energy photon sources have the advantage of easier shielding and also lowering the dose to normal tissue. However, the dose distributions around these sources are affected by the details in construction of the source and its encapsulation more than other sources used for brachytherapy treatments, such as 192 Ir. With increasing number of new low energy photon sources on the market, care should be taken with regard to its traceability to primary standards. It cannot be assumed that a calibration factor for an ionization chamber that is valid for one type of low energy photon source, automatically is valid for another source even if both would use the same isotope. Moreover, the method used to calculate the dose must also take into account the structure of the source and the encapsulation. The dose calculation algorithm that is valid for one type of low energy source may not be valid for another source even if in both cases the same radionuclide is used. Simple ''point source'' approximations, i.e. where the source is modeled as a point, should be avoided, as such methods do not account for any details in the source construction. In this document, the dose calculation formalism adopted for low energy photon sources is that recommended by the American Association of Physicists in Medicine (AAPM) as outlined by Task Group-43 (TG-43). This method accounts for the source and capsule geometry. The AAPM recommends brachytherapy photon sources to be specified in terms of 'Air Kerma Strength' that is also used in the formalism mentioned above. On the other hand, the International Commission on Radiation Units and Measurements (ICRU) recommends that the specification be done in terms of Reference Air

Atmospheric chemistry of HFE-7000 (CF(3)CF (2)CF (2)OCH (3)) and 2,2,3,3,4,4,4-heptafluoro-1-butanol (CF (3)CF (2)CF (2)CH (2)OH): kinetic rate coefficients and temperature dependence of reactions with chlorine atoms.

Science.gov (United States)

Díaz-de-Mera, Yolanda; Aranda, Alfonso; Bravo, Iván; Rodríguez, Diana; Rodríguez, Ana; Moreno, Elena

2008-10-01

The adverse environmental impacts of chlorinated hydrocarbons on the Earth's ozone layer have focused attention on the effort to replace these compounds by nonchlorinated substitutes with environmental acceptability. Hydrofluoroethers (HFEs) and fluorinated alcohols are currently being introduced in many applications for this purpose. Nevertheless, the presence of a great number of C-F bonds drives to atmospheric long-lived compounds with infrared absorption features. Thus, it is necessary to improve our knowledge about lifetimes and global warming potentials (GWP) for these compounds in order to get a complete evaluation of their environmental impact. Tropospheric degradation is expected to be initiated mainly by OH reactions in the gas phase. Nevertheless, Cl atoms reaction may also be important since rate constants are generally larger than those of OH. In the present work, we report the results obtained in the study of the reactions of Cl radicals with HFE-7000 (CF(3)CF(2)CF(2)OCH(3)) (1) and its isomer CF(3)CF(2)CF(2)CH(2)OH (2). Kinetic rate coefficients with Cl atoms have been measured using the discharge flow tube-mass spectrometric technique at 1 Torr of total pressure. The reactions of these chlorofluorocarbons (CFCs) substitutes have been studied under pseudo-first-order kinetic conditions in excess of the fluorinated compounds over Cl atoms. The temperature ranges were 266-333 and 298-353 K for reactions of HFE-7000 and CF(3)CF(2)CF(2)CH(2)OH, respectively. The measured room temperature rate constants were k(Cl+CF(3)CF(2)CF(2)OCH(3)) = (1.24 +/- 0.28) x 10(-13) cm(3) molecule(-1) s(-1)and k(Cl+CF(3)CF(2)CF(2)CH(2)OH) = (8.35 +/- 1.63) x 10(-13) cm(3) molecule(-1) s(-1) (errors are 2sigma + 10% to cover systematic errors). The Arrhenius expression for reaction 1 was k (1)(266-333 K) = (6.1 +/- 3.8) x 10(-13)exp[-(445 +/- 186)/T] cm(3) molecule(-1) s(-1) and k (2)(298-353 K) = (1.9 +/- 0.7) x 10(-12)exp[-(244 +/- 125)/T] cm(3) molecule(-1) s(-1) (errors

Two-quasineutron states in 98248Cf and 98250Cf and the neutron-neutron residual interactions

International Nuclear Information System (INIS)

Katori, K.; Ahmad, I.; Friedman, A. M.

2008-01-01

Two-quasineutron states in 248 Cf and 250 Cf were investigated by single-neutron transfer reactions, 249 Cf(d,t) 248 Cf and 249 Cf(d,p) 250 Cf. The majority of levels observed were assigned to 12 bands in 248 Cf and six bands in 250 Cf, constructed from the single-particle states in neighboring Cf nuclei. The effective two-body interactions between two odd neutrons coupled outside a deformed core were deduced from the differences in the energies of the bandheads formed by the parallel and antiparallel coupling of the intrinsic spins of the two single-particle states

Treatment of intractable cancer by radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Abe, M [Kyoto Univ. (Japan). Faculty of Medicine

1981-07-01

Intraoperative irradiation, thermotherapy, hypoxic cell sensitizer, and neutron brachytherapy were used for locally advanced cancer and value and limitations of these therapies were discussed. Intraoperative irradiation was mainly used for cancers of the gastro-intestinal tract. In stage I gastric cancers, no difference in the five-year survival rates was found between the groups with and without intraoperative irradiation. In gastric cancers of stage II or more, intraoperative irradiation had a favourable effect. Thermotherapy was applied to superficial radio-resistant cancer by the use of a thermal system of microwave- and radio-frequency heating. This treatment induced disappearance of approximately 50% of tumor. For the treatment with hypoxic cell sensitizer, studies of phase I and II with Misonidazole were conducted; from these results, the protocol was made for phase III study of esophagus cancer, lung cancer, head and neck cancer, uterus cancer, and brain cancer. Brachytherapy using /sup 252/Cf was also developed for locally advanced cancer.

Atmospheric chemistry of (CF3)2CHOCH3, (CF3)2CHOCHO, and CF3C(O)OCH3

DEFF Research Database (Denmark)

Østerstrøm, Freja From; Wallington, Timothy J.; Andersen, Mads Peter Sulbæk

2015-01-01

Smog chambers with in situ FTIR detection were used to measure rate coefficients in 700 Torr of air and 296 ± 2 K of: k(Cl+(CF3)2CHOCH3) = (5.41 ± 1.63) × 10(-12), k(Cl+(CF3)2CHOCHO) = (9.44 ± 1.81) × 10(-15), k(Cl+CF3C(O)OCH3) = (6.28 ± 0.98) × 10(-14), k(OH+(CF3)2CHOCH3) = (1.86 ± 0.41) × 10(-1...

Interstitial prostate brachytherapy. LDR-PDR-HDR

International Nuclear Information System (INIS)

Kovacs, Gyoergy; Hoskin, Peter

2013-01-01

The first comprehensive overview of interstitial brachytherapy for the management of local or locally advanced prostate cancer. Written by an interdisciplinary team who have been responsible for the successful GEC-ESTRO/EAU Teaching Course. Discusses in detail patient selection, the results of different methods, the role of imaging, and medical physics issues. Prostate brachytherapy has been the subject of heated debate among surgeons and the proponents of the various brachytherapy methods. This very first interdisciplinary book on the subject provides a comprehensive overview of innovations in low dose rate (LDR), high dose rate (HDR), and pulsed dose rate (PDR) interstitial brachytherapy for the management of local or locally advanced prostate cancer. In addition to detailed chapters on patient selection and the use of imaging in diagnostics, treatment guidance, and implantation control, background chapters are included on related medical physics issues such as treatment planning and quality assurance. The results obtained with the different treatment options and the difficult task of salvage treatment are fully discussed. All chapters have been written by internationally recognized experts in their fields who for more than a decade have formed the teaching staff responsible for the successful GEC-ESTRO/EAU Prostate Brachytherapy Teaching Course. This book will be invaluable in informing residents and others of the scientific background and potential of modern prostate brachytherapy. It will also prove a useful source of up-to-date information for those who specialize in prostate brachytherapy or intend to start an interstitial brachytherapy service.

WE-A-17A-02: BEST IN PHYSICS (THERAPY) - Development of a Calorimeter for the Measurement of the Power Emitted From LDR Brachytherapy Sources

Energy Technology Data Exchange (ETDEWEB)

Malin, M; Palmer, B; DeWerd, L [University of WI-Madison, Madison, WI (United States)

2014-06-15

Purpose: Model-based dose calculation algorithms for brachytherapy sources are designed to compute dose per particle or dose per unit energy leaving the encapsulation of a brachytherapy source. As such, the power leaving the encapsulation of a source, called emitted power (EP), would be a natural source strength metric for these new algorithms. However, no instrument is currently capable of an absolute measurement of EP. A calorimeter operating with a liquid helium thermal sink was designed and constructed to measure the EP of low-dose rate (LDR) I-125 and Pd-103 brachytherapy sources. Methods: Calorimeter design was optimized through thermal and Monte Carlo (MC) modeling. Thermal modeling showed that specific thermal conditions would be necessary for accurate calorimeter measurements. These conditions were experimentally verified. The EP of two LDR I-125 source models was measured. An air-kermastrength (AKS)-to-EP conversion coefficient was determined through MC simulations and applied to well-type ionization chamber measurements of AKS to enable comparison with EP measurements. Results: MCdetermined EP per unit AKS conversion coefficients were source model dependent and are on the order of 0.1 μW/U. The signal-to-noise ratio was a function of source strength, and was 294 for a 0.5 μW source. Measurements were repeatable to within 3.6% for a 0.5 μW source. Initial EP measurements were made with two I-125 source models, a 5.7 U Oncura 6711 and a 2.9 U Best Medical 2301. Model 2301 results agreed with the MC-converted AKS value to within the measurement uncertainty of 4.3% at k=1. The Model 6711 results were systematically high and are under investigation. Conclusion: A calorimeter was designed to provide an absolute measurement of the EP for LDR brachytherapy sources and preliminary EP measurements have been made. This new calorimeter design shows promise of providing a more fundamentally useful source strength standard.

A comparison of complications between ultrasound-guided prostate brachytherapy and open prostate brachytherapy

International Nuclear Information System (INIS)

Benoit, Ronald M.; Naslund, Michael J.; Cohen, Jeffrey K.

2000-01-01

Purpose: Prostate brachytherapy has reemerged during the 1990s as a treatment for clinically localized prostate cancer. The renewed popularity of prostate brachytherapy is largely due to the use of transrectal ultrasound of the prostate, which allows for more accurate isotope placement within the prostate when compared to the open approach. The present study investigates whether this improved cancer control is at the expense of increased morbidity by comparing the morbidity after transrectal ultrasound-guided prostate brachytherapy to the morbidity after prostate brachytherapy performed via an open approach. Methods and Materials: All men in the Medicare population who underwent prostate brachytherapy in the year 1991 were identified. These men were further stratified into those men who underwent prostate brachytherapy via an open approach and the men who underwent prostate brachytherapy with ultrasound guidance. All subsequent inpatient, outpatient, and physician (Part B) Medicare claims for these men from the years 1991-1993 were then analyzed to determine outcomes. Results: In the year 1991, 2124 men in the Medicare population underwent prostate brachytherapy. An open approach was used in 715 men (33.7%), and ultrasound guidance was used in 1409 men (66.3%). Mean age for both cohorts was 73.7 years with a range of 50.7-92.8 years for the ultrasound group and 60.6-92.1 years for the open group. A surgical procedure for the relief of bladder outlet obstruction was performed in 122 men (8.6%) in the ultrasound group and in 54 men (7.6%) in the open group. An artificial urinary sphincter was placed in 2 men (0.14%) in the ultrasound group and in 2 men (0.28%) in the open group. A penile prosthesis was implanted in 10 men (0.71%) in the ultrasound group and in 4 men (0.56%) in the open group. A diagnosis code for urinary incontinence was carried by 95 men (6.7%) in the ultrasound group and by 45 men (6.3%) in the open group. A diagnosis code for erectile dysfunction

High dose rate brachytherapy for oral cancer.

Science.gov (United States)

Yamazaki, Hideya; Yoshida, Ken; Yoshioka, Yasuo; Shimizutani, Kimishige; Furukawa, Souhei; Koizumi, Masahiko; Ogawa, Kazuhiko

2013-01-01

Brachytherapy results in better dose distribution compared with other treatments because of steep dose reduction in the surrounding normal tissues. Excellent local control rates and acceptable side effects have been demonstrated with brachytherapy as a sole treatment modality, a postoperative method, and a method of reirradiation. Low-dose-rate (LDR) brachytherapy has been employed worldwide for its superior outcome. With the advent of technology, high-dose-rate (HDR) brachytherapy has enabled health care providers to avoid radiation exposure. This therapy has been used for treating many types of cancer such as gynecological cancer, breast cancer, and prostate cancer. However, LDR and pulsed-dose-rate interstitial brachytherapies have been mainstays for head and neck cancer. HDR brachytherapy has not become widely used in the radiotherapy community for treating head and neck cancer because of lack of experience and biological concerns. On the other hand, because HDR brachytherapy is less time-consuming, treatment can occasionally be administered on an outpatient basis. For the convenience and safety of patients and medical staff, HDR brachytherapy should be explored. To enhance the role of this therapy in treatment of head and neck lesions, we have reviewed its outcomes with oral cancer, including Phase I/II to Phase III studies, evaluating this technique in terms of safety and efficacy. In particular, our studies have shown that superficial tumors can be treated using a non-invasive mold technique on an outpatient basis without adverse reactions. The next generation of image-guided brachytherapy using HDR has been discussed. In conclusion, although concrete evidence is yet to be produced with a sophisticated study in a reproducible manner, HDR brachytherapy remains an important option for treatment of oral cancer.

High dose rate brachytherapy for oral cancer

International Nuclear Information System (INIS)

Yamazaki, Hideya; Yoshida, Ken; Yoshioka, Yasuo; Shimizutani, Kimishige; Koizumi, Masahiko; Ogawa, Kazuhiko; Furukawa, Souhei

2013-01-01

Brachytherapy results in better dose distribution compared with other treatments because of steep dose reduction in the surrounding normal tissues. Excellent local control rates and acceptable side effects have been demonstrated with brachytherapy as a sole treatment modality, a postoperative method, and a method of reirradiation. Low-dose-rate (LDR) brachytherapy has been employed worldwide for its superior outcome. With the advent of technology, high-dose-rate (HDR) brachytherapy has enabled health care providers to avoid radiation exposure. This therapy has been used for treating many types of cancer such as gynecological cancer, breast cancer, and prostate cancer. However, LDR and pulsed-dose-rate interstitial brachytherapies have been mainstays for head and neck cancer. HDR brachytherapy has not become widely used in the radiotherapy community for treating head and neck cancer because of lack of experience and biological concerns. On the other hand, because HDR brachytherapy is less time-consuming, treatment can occasionally be administered on an outpatient basis. For the convenience and safety of patients and medical staff, HDR brachytherapy should be explored. To enhance the role of this therapy in treatment of head and neck lesions, we have reviewed its outcomes with oral cancer, including Phase I/II to Phase III studies, evaluating this technique in terms of safety and efficacy. In particular, our studies have shown that superficial tumors can be treated using a non-invasive mold technique on an outpatient basis without adverse reactions. The next generation of image-guided brachytherapy using HDR has been discussed. In conclusion, although concrete evidence is yet to be produced with a sophisticated study in a reproducible manner, HDR brachytherapy remains an important option for treatment of oral cancer. (author)

Dicty_cDB: SLH252 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC

15 CFR 25.2 - Definitions.

Science.gov (United States)

2010-01-01

... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...

10 CFR 35.406 - Brachytherapy sources accountability.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Brachytherapy sources accountability. 35.406 Section 35....406 Brachytherapy sources accountability. (a) A licensee shall maintain accountability at all times... area. (c) A licensee shall maintain a record of the brachytherapy source accountability in accordance...

Establishment of Ge-doped optical fibres as thermoluminescence dosimeters for brachytherapy

International Nuclear Information System (INIS)

Issa, Fatma; Abdul Rahman, A.T.; Hugtenburg, Richard P.; Bradley, David A.; Nisbet, Andrew

2012-01-01

This study aims to establish the sensitive, ∼120 μm high spatial resolution, high dynamic range Ge-doped optical fibres as thermoluminescence (TL) dosimeters for brachytherapy dose distribution. This requires investigation to accommodate sensitivity of detection, both for the possibility of short range dose deposition from beta components as well as gamma/x-mediated dose. In-air measurements are made at distances close to radionuclide sources, evaluating the fall off in dose along the transverse axis of 133 Ba and 60 Co radioactive sources, at distances from 2 mm up to 20 mm from their midpoints. Measurements have been compared with Monte Carlo code DOSRZnrc simulations for photon-mediated dose only, agreement being obtained to within 3% and 1% for the 133 Ba and 60 Co sources, respectively. As such, in both cases it is determined that as intended, beta dose has been filtered out by source encapsulation. - Highlights: ► We seek to establish Ge-doped optical fibres as TLDs for brachytherapy. ► Dose was evaluated along the central axis of 133 Ba and 60 Co, at 2 mm–20 mm. ► We verify values using DOSRZnrc Monte Carlo code simulations. ► Good agreement is between dose measurements and calculation to within 3% and 1%. ► Methodology is to be used in obtaining doses around 125 I and 192 Ir sources.

Investigation of the Effects of Tissue Inhomogeneities on the Dosimetric Parameters of a Cs-137 Brachytherapy Source using the MCNP4C Code

Directory of Open Access Journals (Sweden)

Mehdi Zehtabian

2010-09-01

Full Text Available Introduction: Brachytherapy is the use of small encapsulated radioactive sources in close vicinity of tumors. Various methods are used to obtain the dose distribution around brachytherapy sources. TG-43 is a dosimetry protocol proposed by the AAPM for determining dose distributions around brachytherapy sources. The goal of this study is to update this protocol for presence of bone and air inhomogenities.  Material and Methods: To update the dose rate constant parameter of the TG-43 formalism, the MCNP4C simulations were performed in phantoms composed of water-bone and water-air combinations. The values of dose at different distances from the source in both homogeneous and inhomogeneous phantoms were estimated in spherical tally cells of 0.5 mm radius using the F6 tally. Results: The percentages of dose reductions in presence of air and bone inhomogenities for the Cs-137 source were found to be 4% and 10%, respectively. Therefore, the updated dose rate constant (Λ will also decrease by the same percentages.   Discussion and Conclusion: It can be easily concluded that such dose variations are more noticeable when using lower energy sources such as Pd-103 or I-125.

Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF

Energy Technology Data Exchange (ETDEWEB)

Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-12-06

CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.

CF and School

Science.gov (United States)

... Accommodations for College Scholarships and Financial Aid 10 Things I Wish I Knew Before Coming to College CF and College: The Secret to Getting it All Done View All Managing My CF in College Resources ...

Biomedical neutron research at the Californium User Facility for neutron science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1997-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

Overview of brachytherapy resources in Europe: A survey of patterns of care study for brachytherapy in Europe

International Nuclear Information System (INIS)

Guedea, Ferran; Ellison, Tracey; Venselaar, Jack; Borras, Josep Maria; Hoskin, Peter; Poetter, Richard; Heeren, Germaine; Nisin, Roselinne; Francois, Guy; Mazeron, Jean Jacques; Limbergen, Erik Van; Ventura, Montserrat; Taillet, Michel; Cottier, Brian

2007-01-01

Background and purpose: The Patterns of Care for Brachytherapy in Europe (PCBE) study is aimed at establishing a detailed information system on brachytherapy throughout Europe. Materials and methods: The questionnaire was web-based and the analysis used data from each radiotherapy department with brachytherapy. There were three groups: Group I with 19 countries (15 initial European Community (EC) countries plus Iceland, Monaco, Norway and Switzerland -EC+4-), Group II with 10 countries (New European Community countries -NEC-) and Group III with 14 countries (Other European Countries -OEC-). Results: In the European area there are 36 of 43 countries (85%) which achieved data collection from at least 50% of centres, and were included in the analysis. The tumour site that had the largest number of treated patients was gynaecological tumours. Several variations have been found in the mean number of patients treated per consultant radiation oncologist and physicist; and in the proportion of brachytherapy patients with gynaecology, prostate and breast tumours, by country and by European area. The provided data showed that the average number of brachytherapy patients per centre increased by 10% between 1997 and 2002. Conclusions: A European wide evaluation of brachytherapy practice using a web-based questionnaire is feasible and that there is considerable variation in both patterns of practice and available resources

Development of brachytherapy medium doserate

International Nuclear Information System (INIS)

Atang Susila; Ari Satmoko; Ahmad Rifai; Kristiyanti

2010-01-01

Brachytherapy has proven to be an effective treatment for different types of cancers and it become a common treatment modality in most radiotherapy clinics. PRPN has had experience in development of Low Dose Rate Brachytherapy for cervix cancer treatment. However the treatment process using LDR device needs 5 hours in time that the patient feel uncomfort. Therefore PRPN develops Medium Dose Rate Brachytherapy with radiation activity not more than 5 Currie. The project is divided into two stages. Purchasing of TPS software and TDS design are held in 2010, and the construction will be in 2011. (author)

3-D conformal HDR brachytherapy as monotherapy for localized prostate cancer. A pilot study

International Nuclear Information System (INIS)

Martin, T.; Baltas, D.; Kurek, R.; Roeddiger, S.; Kontova, M.; Anagnostopoulos, G.; Skazikis, G.; Zamboglou, N.; Dannenberg, T.; Buhleier, T.; Tunn, U.

2004-01-01

Purpose: pilot study to evaluate feasibility, acute toxicity and conformal quality of three-dimensional (3-D) conformal high-dose-rate (HDR) brachytherapy as monotherapy for localized prostate cancer using intraoperative real-time planning. Patients and methods: between 05/2002 and 05/2003, 52 patients with prostate cancer, prostate-specific antigen (PSA) ≤ 10 ng/ml, Gleason score ≤ 7 and clinical stage ≤ T2a were treated. Median PSA was 6.4 ng/ml and median Gleason score 5. 24/52 patients had stage T1c and 28/52 stage T2a. For transrectal ultrasound-(TRUS-)guided transperineal implantation of flexible plastic needles into the prostate, the real-time HDR planning system SWIFT trademark was used. After implantation, CT-based 3-D postplanning was performed. All patients received one implant for four fractions of HDR brachytherapy in 48 h using a reference dose (D ref ) of 9.5 Gy to a total dose of 38.0 Gy. Dose-volume histograms (DVHs) were analyzed to evaluate the conformal quality of each implant using D 90 , D 10 urethra, and D 10 rectum. Acute toxicity was evaluated using the CTC (common toxicity criteria) scales. Results: median D 90 was 106% of D ref (range: 93-115%), median D 10 urethra 159% of D ref (range: 127-192%), and median D 10 rectum 55% of D ref (range: 35-68%). Median follow-up is currently 8 months. In 2/52 patients acute grade 3 genitourinary toxicity was observed. No gastrointestinal toxicity > grade 1 occurred. Conclusion: 3-D conformal HDR brachytherapy as monotherapy using intraoperative real-time planning is a feasible and highly conformal treatment for localized prostate cancer associated with minimal acute toxicity. Longer follow-up is needed to evaluate late toxicity and biochemical control. (orig.)

Erectile function after prostate brachytherapy

International Nuclear Information System (INIS)

Merrick, Gregory S.; Butler, Wayne M.; Wallner, Kent E.; Galbreath, Robert W.; Anderson, Richard L.; Kurko, Brian S.; Lief, Jonathan H.; Allen, Zachariah A.

2005-01-01

Purpose: To evaluate erectile function after permanent prostate brachytherapy using a validated patient-administered questionnaire and to determine the effect of multiple clinical, treatment, and dosimetric parameters on penile erectile function. Methods and materials: A total of 226 patients with preimplant erectile function determined by the International Index of Erectile Function (IIEF) questionnaire underwent permanent prostate brachytherapy in two prospective randomized trials between February 2001 and January 2003 for clinical Stage T1c-T2c (2002 American Joint Committee on Cancer) prostate cancer. Of the 226 patients, 132 were potent before treatment and, of those, 128 (97%) completed and returned the IIEF questionnaire after brachytherapy. The median follow-up was 29.1 months. Potency was defined as an IIEF score of ≥13. The clinical, treatment, and dosimetric parameters evaluated included patient age; preimplant IIEF score; clinical T stage; pretreatment prostate-specific antigen level; Gleason score; elapsed time after implantation; preimplant nocturnal erections; body mass index; presence of hypertension or diabetes mellitus; tobacco consumption; the volume of the prostate gland receiving 100%, 150%, and 200% of the prescribed dose (V 100/150/200 ); the dose delivered to 90% of the prostate gland (D 90 ); androgen deprivation therapy; supplemental external beam radiotherapy (EBRT); isotope; prostate volume; planning volume; and radiation dose to the proximal penis. Results: The 3-year actuarial rate of potency preservation was 50.5%. For patients who maintained adequate posttreatment erectile function, the preimplant IIEF score was 29, and in patients with brachytherapy-related ED, the preimplant IIEF score was 25. The median time to the onset of ED was 5.4 months. After brachytherapy, the median IIEF score was 20 in potent patients and 3 in impotent patients. On univariate analysis, the preimplant IIEF score, patient age, presence of nocturnal

Photoionisation study of Xe.CF{sub 4} and Kr.CF{sub 4} van-der-Waals molecules

Energy Technology Data Exchange (ETDEWEB)

Alekseev, V. A., E-mail: alekseev@va3474.spb.edu; Kevorkyants, R. [St. Petersburg State University, 7/9 Universitetskaya Nab., St. Petersburg 199034 (Russian Federation); Garcia, G. A.; Nahon, L. [Synchrotron Soleil, Orme des Merisiers, St. Aubin BP 48, 91192 Gif sur Yvette Cedex (France)

2016-05-14

We report on photoionization studies of Xe.CF{sub 4} and Kr.CF{sub 4} van-der-Waals complexes produced in a supersonic expansion and detected using synchrotron radiation and photoelectron-photoion coincidence techniques. The ionization potential of CF{sub 4} is larger than those of the Xe and Kr atoms and the ground state of the Rg.CF{sub 4}{sup +} ion correlates with Rg{sup +} ({sup 2}P{sub 3/2}) + CF{sub 4}. The onset of the Rg.CF{sub 4}{sup +} signals was found to be only ∼0.2 eV below the Rg ionization potential. In agreement with experiment, complementary ab initio calculations show that vertical transitions originating from the potential minimum of the ground state of Rg.CF{sub 4} terminate at a part of the potential energy surfaces of Rg.CF{sub 4}{sup +}, which are approximately 0.05 eV below the Rg{sup +} ({sup 2}P{sub 3/2}) + CF{sub 4} dissociation limit. In contrast to the neutral complexes, which are most stable in the face geometry, for the Rg.CF{sub 4}{sup +} ions, the calculations show that the minimum of the potential energy surface is in the vertex geometry. Experiments which have been performed only with Xe.CF{sub 4} revealed no Xe.CF{sub 4}{sup +} signal above the first ionization threshold of Xe, suggesting that the Rg.CF{sub 4}{sup +} ions are not stable above the first dissociation limit.

Improving the safety of a body composition analyser based on the PGNAA method

Energy Technology Data Exchange (ETDEWEB)

Miri-Hakimabad, Hashem; Izadi-Najafabadi, Reza; Vejdani-Noghreiyan, Alireza; Panjeh, Hamed [FUM Radiation Detection And Measurement Laboratory, Ferdowsi University of Mashhad (Iran, Islamic Republic of)

2007-12-15

The {sup 252}Cf radioisotope and {sup 241}Am-Be are intense neutron emitters that are readily encapsulated in compact, portable and sealed sources. Some features such as high flux of neutron emission and reliable neutron spectrum of these sources make them suitable for the prompt gamma neutron activation analysis (PGNAA) method. The PGNAA method can be used in medicine for neutron radiography and body chemical composition analysis. {sup 252}Cf and {sup 241}Am-Be sources generate not only neutrons but also are intense gamma emitters. Furthermore, the sample in medical treatments is a human body, so it may be exposed to the bombardments of these gamma-rays. Moreover, accumulations of these high-rate gamma-rays in the detector volume cause simultaneous pulses that can be piled up and distort the spectra in the region of interest (ROI). In order to remove these disadvantages in a practical way without being concerned about losing the thermal neutron flux, a gamma-ray filter made of Pb must be employed. The paper suggests a relatively safe body chemical composition analyser (BCCA) machine that uses a spherical Pb shield, enclosing the neutron source. Gamma-ray shielding effects and the optimum radius of the spherical Pb shield have been investigated, using the MCNP-4C code, and compared with the unfiltered case, the bare source. Finally, experimental results demonstrate that an optimised gamma-ray shield for the neutron source in a BCCA can reduce effectively the risk of exposure to the {sup 252}Cf and {sup 241}Am-Be sources.

Study of Different Tissue Density Effects on the Dose Distribution of a 103Pd Brachytherapy Source Model MED3633

Directory of Open Access Journals (Sweden)

Ali Asghar Mowlavi

2010-09-01

Full Text Available Introduction: Clinical application of encapsulated radioactive brachytherapy sources has a major role in cancer treatment. In the present research, the effects of different tissue densities on the dose distribution of a 103Pd brachytherapy source in a spherical phantom of 50 cm radius have been studied. Material and Methods: As is well known, absorbed dose in tissue depends to its density, but this difference is not clear in measurements. Therefore, we applied the MCNP code to evaluate the effect of density on the dose distribution. 103Pd brachytherapy sources are used to treat prostate, breast and other cancers. Results: Absorbed dose has been calculated and presented around a source placed in the center of the phantom for different tissue densities. Also, we derived anisotropy and radial dose functions and compared our Monte Carlo results with experimental results of Rivard and Li et al. for F(1, θ and g(r in 1.040 g/cm3 tissue. Conclusion: The results of this study show that relative dose variations around the source center are very considerable at different densities, because of the presence of a photoabsorber (Au-Cu alloy in the source core. Dose variation exceeds 80% at the point (Z = 2.4 mm, Y = 0 mm. Computed values of anisotropy and radial dose functions are in good agreement with the experimental results of Rivard and Li et al.

7 CFR 3565.252 - Housing types.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...

Biomedical neutron research at the Californium User Facility for Neutron Science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1998-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)

Comprehensive brachytherapy physical and clinical aspects

CERN Document Server

Baltas, Dimos; Meigooni, Ali S; Hoskin, Peter J

2013-01-01

Modern brachytherapy is one of the most important oncological treatment modalities requiring an integrated approach that utilizes new technologies, advanced clinical imaging facilities, and a thorough understanding of the radiobiological effects on different tissues, the principles of physics, dosimetry techniques and protocols, and clinical expertise. A complete overview of the field, Comprehensive Brachytherapy: Physical and Clinical Aspects is a landmark publication, presenting a detailed account of the underlying physics, design, and implementation of the techniques, along with practical guidance for practitioners. Bridging the gap between research and application, this single source brings together the technological basis, radiation dosimetry, quality assurance, and fundamentals of brachytherapy. In addition, it presents discussion of the most recent clinical practice in brachytherapy including prostate, gynecology, breast, and other clinical treatment sites. Along with exploring new clinical protocols, ...

14 CFR 252.9 - Ventilation systems.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...

The american brachytherapy society recommendations for permanent prostate brachytherapy postimplant dosimetric analysis

International Nuclear Information System (INIS)

Nag, Subir; Bice, William; Wyngaert, Keith de; Prestidge, Bradley; Stock, Richard; Yu Yan

2000-01-01

Purpose: The purpose of this report is to establish guidelines for postimplant dosimetric analysis of permanent prostate brachytherapy. Methods: Members of the American Brachytherapy Society (ABS) with expertise in prostate dosimetry evaluation performed a literature review and supplemented with their clinical experience formulated guidelines for performing and analyzing postimplant dosimetry of permanent prostate brachytherapy. Results: The ABS recommends that postimplant dosimetry should be performed on all patients undergoing permanent prostate brachytherapy for optimal patient care. At present, computed tomography (CT)-based dosimetry is recommended, based on availability cost and the ability to image the prostate as well as the seeds. Additional plane radiographs should be obtained to verify the seed count. Until the ideal postoperative interval for CT scanning has been determined, each center should perform dosimetric evaluation of prostate implants at a consistent postoperative interval. This interval should be reported. Isodose displays should be obtained at 50%, 80%, 90%, 100%, 150%, and 200% of the prescription dose and displayed on multiple cross-sectional images of the prostate. A dose-volume histogram (DVH) of the prostate should be performed and the D 90 (dose to 90% of the prostate gland) reported by all centers. Additionally, the D 80, D 100, the fractional V 80, V 90, V 100, V 150, and V 200, (i.e., the percentage of prostate volume receiving 80%, 90%, 100%, 150%, and 200% of the prescribed dose, respectively), the rectal, and urethral doses should be reported and ultimately correlated with clinical outcome in the research environment. On-line real-time dosimetry, the effects of dose heterogeneity, and the effects of tissue heterogeneity need further investigation. Conclusion: It is essential that postimplant dosimetry should be performed on all patients undergoing permanent prostate brachytherapy. Guidelines were established for the performance

[Brachytherapy of brainstem tumors].

Science.gov (United States)

Julow, Jenö; Viola, Arpád; Major, Tibor; Valálik, István; Sági, Sarolta; Mangel, László; Kovács, Rita Beáta; Repa, Imre; Bajzik, Gábor; Németh, György

2004-01-20

The optimal therapy of brain stem tumours of different histopathology determines the expected length of survival. Authors report 125Iodine interstitial irradiation of brain stem tumours with stereotactic brachytherapy. Two patients having brain stem tumours were suffering from glioma or from metastases of a carcinoma. In Case 1 the tumour volume was 1.98 cm3 at the time of planning interstitial irradiation. The control MRI examination performed at 42 months post-op showed a postirradiation cyst size of 5.73 cm3 indicating 65.5% shrinkage. In Case 2 the shrinkage was more apparent as the tumour volume measured on the control MRI at 8 months post-op was only 0.16 cm3 indicating 97.4% shrinkage of the 6.05 cm3 target volume at the time of brachytherapy with the metastasis practically disappearing. Quick access to histopathological results of the stereotactic intraoperative biopsy made it possible to carry out the 125Iodine stereotactic brachytherapy immediately after the biopsy, resulting in less inconvenience for patients of a second possible intervention. The control MRI scans show significant shrinkage of tumours in both patients. The procedure can be performed as a biopsy. The CT and image fusion guided 125Iodine stereotactic brachytherapy can be well planned dosimetrically and is surgically precise.

Atmospheric chemistry of cyc-CF2CF2CF2CH=CH-: Kinetics, products, and mechanism of gas-phase reaction with OH radicals, and atmospheric implications

Science.gov (United States)

Guo, Qin; Zhang, Ni; Uchimaru, Tadafumi; Chen, Liang; Quan, Hengdao; Mizukado, Junji

2018-04-01

The rate constants for the gas-phase reactions of cyc-CF2CF2CF2CH=CH- with OH radicals were determined by a relative rate method between 253 and 328 K. The rate constant k1 at 298 K was measured to be (1.08 ± 0.04) × 10-13 cm3 molecule-1 s-1, and the Arrhenius expression was k1 = (3.72 ± 0.14) × 10-13 exp [(-370 ± 12)/T]. The atmospheric lifetime of cyc-CF2CF2CF2CH=CH- was calculated to be 107 d. The products and mechanism for the reaction of cyc-CF2CF2CF2CH=CH- with OH radicals were also investigated. CO, CO2, and COF2 were identified as the main carbon-containing products following the OH-initiated reaction. Moreover, the radiative efficiency (RE) was determined to be 0.143 W m-2 ppb-1, and the global warming potentials (GWPs) for 20, 100, and 500 yr were 54, 15, and 4, respectively. The photochemical ozone creation potential of the title compound was estimated to be 1.3.

Establishment of Ge-doped optical fibres as thermoluminescence dosimeters for brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Issa, Fatma, E-mail: f.issa@surrey.ac.uk [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Department of Radiotherapy, Tripoli Medical Centre (TMC), Tripoli (Libya); Abdul Rahman, A.T. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); School of Physics and Material Studies, Faculty of Applied Sciences, Universiti Teknologi MARA Malaysia, Campus of Negeri Sembilan, 72000 Kuala Pilah (Malaysia); Hugtenburg, Richard P. [Department of Medical Physics and Clinical Engineering, Abertawe Bro Morgannwg UHB and School of Medicine, Swansea University, Swansea, SA2 8PP (United Kingdom); Bradley, David A. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Department of Radiological Sciences, King Saud University, P.O. Box 10219, Riyadh 11432 (Saudi Arabia); Nisbet, Andrew [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Department of Medical Physics, Royal Surrey County Hospital NHS Foundation Trust, Guildford, GU2 7XX (United Kingdom)

2012-07-15

This study aims to establish the sensitive, {approx}120 {mu}m high spatial resolution, high dynamic range Ge-doped optical fibres as thermoluminescence (TL) dosimeters for brachytherapy dose distribution. This requires investigation to accommodate sensitivity of detection, both for the possibility of short range dose deposition from beta components as well as gamma/x-mediated dose. In-air measurements are made at distances close to radionuclide sources, evaluating the fall off in dose along the transverse axis of {sup 133}Ba and {sup 60}Co radioactive sources, at distances from 2 mm up to 20 mm from their midpoints. Measurements have been compared with Monte Carlo code DOSRZnrc simulations for photon-mediated dose only, agreement being obtained to within 3% and 1% for the {sup 133}Ba and {sup 60}Co sources, respectively. As such, in both cases it is determined that as intended, beta dose has been filtered out by source encapsulation. - Highlights: Black-Right-Pointing-Pointer We seek to establish Ge-doped optical fibres as TLDs for brachytherapy. Black-Right-Pointing-Pointer Dose was evaluated along the central axis of {sup 133}Ba and {sup 60}Co, at 2 mm-20 mm. Black-Right-Pointing-Pointer We verify values using DOSRZnrc Monte Carlo code simulations. Black-Right-Pointing-Pointer Good agreement is between dose measurements and calculation to within 3% and 1%. Black-Right-Pointing-Pointer Methodology is to be used in obtaining doses around {sup 125}I and {sup 192}Ir sources.

Reactivation of the chloroplast CF1-ATPase beta subunit by trace amounts of the CF1 alpha subunit suggests a chaperonin-like activity for CF1 alpha.

Science.gov (United States)

Avni, A; Avital, S; Gromet-Elhanan, Z

1991-04-25

Incubation of tobacco and lettuce thylakoids with 2 M LiCl in the presence of MgATP removes the beta subunit from their CF1-ATPase (CF1 beta) together with varying amounts of the CF1 alpha subunit (CF1 alpha). These 2 M LiCl extracts, as with the one obtained from spinach thylakoids (Avital, S., and Gromet-Elhanan, Z. (1991) J. Biol. Chem. 266, 7067-7072), could form active hybrid ATPases when reconstituted into inactive beta-less Rhodospirillum rubrum chromatophores. Pure CF1 beta fractions that have been isolated from these extracts could not form such active hybrids by themselves, but could do so when supplemented with trace amounts (less than 5%) of CF1 alpha. A mitochondrial F1-ATPase alpha subunit was recently reported to be a heat-shock protein, having two amino acid sequences that show a highly conserved identity with sequences found in molecular chaperones (Luis, A. M., Alconada, A., and Cuezva, J. M. (1990) J. Biol. Chem. 265, 7713-7716). These sequences are also conserved in CF1 alpha isolated from various plants, but not in F1 beta subunits. The above described reactivation of CF1 beta by trace amounts of CF1 alpha could thus be due to a chaperonin-like function of CF1 alpha, which involves the correct, active folding of isolated pure CF1 beta.

Enhancement of discharge performance of Li/CF x cell by thermal treatment of CF x cathode material

Science.gov (United States)

Zhang, Sheng S.; Foster, Donald; Read, Jeffrey

In this work we demonstrate that the thermal treatment of CF x cathode material just below the decomposition temperature can enhance discharge performance of Li/CF x cells. The performance enhancement becomes more effective when heating a mixture of CF x and citric acid (CA) since CA serves as an extra carbon source. Discharge experiments show that the thermal treatment not only reduces initial voltage delay, but also raises discharge voltage. Whereas the measurement of powder impedance indicates the thermal treatment does not increase electronic conductivity of CF x material. Based on these facts, we propose that the thermal treatment results in a limited decomposition of CF x, which yields a subfluorinated carbon (CF x- δ), instead of a highly conductive carbon. In the case of CF x/AC mixture, the AC provides extra carbon that reacts with F 2 and fluorocarbon radicals generated by the thermal decomposition of CF x to form subfluorinated carbon. The process of thermal treatment is studied by thermogravimetric analysis and X-ray diffraction, and the effect of treatment conditions such as heating temperature, heating time and CF x/CA ratio on the discharge performance of CF x cathode is discussed. As an example, a Li/CF x cell using CF x treated with CA at 500 °C under nitrogen for 2 h achieved theretical specific capacity when being discharged at C/5. Impedance analysis indicates that the enhanced performance is attributed to a significant reduction in the cell reaction resistance.

Radioactive sources in brachytherapy:

OpenAIRE

Burger, Janez

2003-01-01

Background. In modern brachytherapy, a greast step forward was made in the 1960s in France with the introduction of new radioactive isotopes and new techniques. These innovations spread rapidly across Europe, though no single dosimetry standard had been set by then. In the new millennium, the advances in brachytherapy are further stimulated by the introduction of 3-D imaging techniques and the latest after loading irradiation equipment that use point sources. The international organiyation IC...

About brachytherapy for the handling of cancer

International Nuclear Information System (INIS)

Campos, Tarcisio P.R.; Silva, Nilton O.; Damaso, Renato S.; Costa, Helder R.; Borges, Paulo H.R.; Mendes, Bruno M.

2000-01-01

The technique of brachytherapy is argued in this article. The 'hardware' and 'necessary software' for the handling are summarily presented. Being the macro-dosimetry an important stage in the radiation therapy procedure, a simplified method of doses evaluation in conventional brachytherapy is presented. In an illustrative form, isodoses of a three-dimensional distribution of linear sources are drawn on a digitalized X-ray picture, exemplifying the handling of breast brachytherapy by sources of iridium

Kinetics and mechanisms of reactions of CF, CHF, and CF2 radicals

International Nuclear Information System (INIS)

Hsu, D.S.Y.; Umstead, M.E.; Lin, M.C.

1978-01-01

This chapter reviews briefly methods for the production of CF, CHF and CF 2 , and inmore detail, the reactions of these interesting and important radicals. Although a considerable, but not extensive, amount of work has been done on the reactions of CF 2 , little of the chemistry of CF and CHF is known. This chapter also includes the preliminary results of some experiments carried out in this Laboratory on the dynamics of some of the reactions involving these radicals. These results were largely arrived at through investigations of the degree of vibrational excitation of the HF and CO reaction products, determined by HF and CO laser emission and CO laser resonance absorption measurements. The coverage of this review is restricted to the gas phase chemistry of these radicals, and does not include their addition reactions to olefins

Calculation of neutron and gamma-ray energy spectra in liquid air and liquid nitrogen due to 14-MeV neutron and californium-252 sources

International Nuclear Information System (INIS)

Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.

1978-01-01

Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data

Patterns of care for brachytherapy in Europe. Results in Spain.

Science.gov (United States)

López Torrecilla, J; Guedea, F; Heeren, G; Nissin, R; Ellison, T; Cottier, B

2006-05-01

In 2003 ESTRO began a project whose primary objective, was to make a map in the European area of infrastructures in technology and personnel for brachytherapy. A survey and a web site were elaborated. The survey was sent to the 76 Spanish Radiation Oncology departments in May 2003. By the end of 2003, 66 (86.8%) services had responded, 40 (71.4%) of which had brachytherapy. The services with brachytherapy treated 73.5% of the total patients, an average of 1,199 patients. The mean number of patients treated with brachytherapy by department was 135.5 and the number of applications was 265 annually. The average number of specialists was 7, 4 of them trained in brachytherapy. The average weekly work load of the radiation oncologists, physicists, and technicians was 22.6 h, 13.8 h and 21.0 h, respectively. The mean time dedicated to each patient by radiation oncologists, physicists and technicians was 9.2 h; 6.19 h; 7.2 h, respectively. The total number of afterloaders was 43 (22 HDR, 18 LDR, 3 PDR). The tumours most frequently treated with brachytherapy were gynaecological (56.24%), breast (14.2%) and prostate (11.7%). High dose rate was used in 47.46% of the patients and low dose rate in 47.24%. Between 1997 and 2002 there was an increase of 50.53% in patients treated with brachytherapy. The survey shows the brachytherapy resources and activity in Spain up to 2003. Increased use of brachytherapy in prostate tumours, prevalence of gynaecology brachytherapy and similar number of treatments with HDR and LDR are demonstrated in the Patterns of Care of Brachytherapy in Europe (PCBE) study in Spain.

The American brachytherapy society survey of brachytherapy practice for carcinoma of the cervix in the United States.

Science.gov (United States)

Nag, S; Orton, C; Young, D; Erickson, B

1999-04-01

The purpose of this study was to survey the brachytherapy practice for cervical cancer in the United States. The Clinical Research Committee of the American Brachytherapy Society (ABS) performed a retrospective survey of individual physicians of the ABS and American Society of Therapeutic Radiologists and Oncologists regarding the details of the brachytherapy techniques they personally used in the treatment of cervical cancer patients for the year 1995. The replies (some of which may have been an estimate only) were tabulated. The scope of this survey did not allow us to verify the data by chart audits. A total of about 3500 questionnaires were mailed out; 521 responses were received. Of these responders, 206 (40%) did not perform any brachytherapy for carcinoma of the cervix in 1995. Of the other 315 responders reporting a total of 4892 patients treated in 1995, 88% used low dose rate (LDR) while 24% used high dose rate (HDR). There was a wide variation in the doses used. For LDR treatments, the median total external beam radiation therapy (EBRT) dose was 45 and 50 Gy and the LDR dose was 42 and 45 Gy for early and advanced cancers, respectively. For HDR treatments, the median EBRT dose was 48 and 50 Gy and the median HDR dose was 29 and 30 Gy for early and advanced cancers, respectively. The median dose per fraction was 6 Gy for a median of five fractions. Interstitial brachytherapy was used as a component of the treatment in 6% of the patients by 21% of responders. Very few responders treated with pulsed or medium dose rates. This retrospective survey showed the current brachytherapy practice pattern in the treatment of cervical cancer in the United States and can serve as a basis for future prospective national brachytherapy data registry. There was wide variation in the practice pattern, emphasizing the urgent need for consensus on these issues. Copyright 1999 Academic Press.

Accelerated partial breast irradiation utilizing balloon brachytherapy techniques

International Nuclear Information System (INIS)

Strauss, Jonathan B.; Dickler, Adam

2009-01-01

To overcome the barriers to BCT, methods of PBI in the setting of breast conservation have been explored. The method of PBI with the longest published follow-up is multi-catheter interstitial brachytherapy. Balloon-based brachytherapy with the MammoSite brachytherapy applicator was designed to simplify the brachytherapy procedure for PBI, enhance the reproducibility of the dosimetry, and improve patient comfort. The rates of local recurrence following PBI with the MammoSite applicator have been low, but there are few published reports and follow-up has been relatively short. The cosmetic outcomes and toxicity of MammoSite PBI are comparable to those seen after multicatheter-based PBI. Additional methods of balloon brachytherapy, including Xoft and SenoRx Contura have been developed. Finally, long-term follow-up after PBI is important for the welfare of individual patients and in order to establish the efficacy, late toxicity and cosmetic outcomes of this technique.

46 CFR 252.13 - Contract.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...

10 CFR 35.2406 - Records of brachytherapy source accountability.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Records of brachytherapy source accountability. 35.2406... Records of brachytherapy source accountability. (a) A licensee shall maintain a record of brachytherapy source accountability required by § 35.406 for 3 years. (b) For temporary implants, the record must...

7 CFR 252.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...

Neutron source for a reactor

International Nuclear Information System (INIS)

Kobayashi, Hiromasa.

1975-01-01

Object: To easily increase a start-up power of a reactor without irradiation in other reactors. Structure: A neutron source comprises Cf 252 , a natural antimony rod, a layer of beryllium, and a vessel of neutron source. On upper and lower portion of Cf 252 are arranged natural antimony rods, which are surrounded by the Be layer, the entirety being charged into the vessel. The Cf 252 may emit neutron, has a half life more than a period of operating cycle of the reactor and is less deteriorated even irradiated by radioactive rays while being left within the reactor. The natural antimony rod is radioactivated by neutron from Cf 252 and neutron as reactor power increases to emit γ rays. The Be absorbs γ rays to emit the neutron. The antimony rod is irradiated within the reactor. Further, since the Cf 252 is small in neutron absorption cross section, it is hard to be deteriorated even while being inserted within the reactor. (Kamimura, M.)

MO-B-BRC-01: Introduction [Brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Prisciandaro, J. [University of Michigan (United States)

2016-06-15

Brachytherapy has proven to be an effective treatment option for prostate cancer. Initially, prostate brachytherapy was delivered through permanently implanted low dose rate (LDR) radioactive sources; however, high dose rate (HDR) temporary brachytherapy for prostate cancer is gaining popularity. Needle insertion during prostate brachytherapy is most commonly performed under ultrasound (U/S) guidance; however, treatment planning may be performed utilizing several imaging modalities either in an intra- or post-operative setting. During intra-operative prostate HDR, the needles are imaged during implantation, and planning may be performed in real time. At present, the most common imaging modality utilized for intra-operative prostate HDR is U/S. Alternatively, in the post-operative setting, following needle implantation, patients may be simulated with computed tomography (CT) or magnetic resonance imaging (MRI). Each imaging modality and workflow provides its share of benefits and limitations. Prostate HDR has been adopted in a number of cancer centers across the nation. In this educational session, we will explore the role of U/S, CT, and MRI in HDR prostate brachytherapy. Example workflows and operational details will be shared, and we will discuss how to establish a prostate HDR program in a clinical setting. Learning Objectives: Review prostate HDR techniques based on the imaging modality Discuss the challenges and pitfalls introduced by the three imagebased options for prostate HDR brachytherapy Review the QA process and learn about the development of clinical workflows for these imaging options at different institutions.

Prostate brachytherapy - discharge

Science.gov (United States)

Implant therapy - prostate cancer - discharge; Radioactive seed placement - discharge ... You had a procedure called brachytherapy to treat prostate cancer. Your treatment lasted 30 minutes or more, ...

Monte Carlo simulations and radiation dosimetry measurements of 142Pr capillary tube-based radioactive implant (CTRI). A new structure for brachytherapy sources

International Nuclear Information System (INIS)

Bakht, M.K.; Haddadi, A.; Sadeghi, M.; Ahmadi, S.J.; Sadjadi, S.S.; Tenreiro, C.

2013-01-01

Previously, a promising β - -emitting praseodymium-142 glass seed was proposed for brachytherapy of prostate cancer. In accordance with the previous study, a 142 Pr capillary tube-based radioactive implant (CTRI) was suggested as a source with a new structure to enhance application of β - -emitting radioisotopes such as 142 Pr in brachytherapy. Praseodymium oxide powder was encapsulated in a glass capillary tube. Then, a thin and flexible fluorinated ethylene propylene Teflon layer sealed the capillary tube. The source was activated in the Tehran Research Reactor by the 141 Pr(n, γ) 142 Pr reaction. Measurements of the dosimetric parameters were performed using GafChromic radiochromic film. In addition, the dose rate distribution of 142 Pr CTRI was calculated by modeling 142 Pr source in a water phantom using Monte Carlo N-Particle Transport (MCNP5) Code. The active source was unreactive and did not leak in water. In comparison with the earlier proposed 142 Pr seed, the suggested source showed similar desirable dosimetric characteristics. Moreover, the 142 Pr CTRI production procedure may be technically and economically more feasible. The mass of praseodymium in CTRI structure could be greater than that of the 142 Pr glass seed; therefore, the required irradiation time and the neutron flux could be reduced. A 142 Pr CTRI was proposed for brachytherapy of prostate cancer. The dosimetric calculations by the experimental measurements and Monte Carlo simulation were performed to fulfill the requirements according to the American Association of Physicists in Medicine recommendations before the clinical use of new brachytherapy sources. The characteristics of the suggested source were compared with those of the previously proposed 142 Pr glass seed. (author)

Resolving the brachytherapy challenges with government funded hospital.

Science.gov (United States)

Nikam, D S; Jagtap, A S; Vinothraj, R

2016-01-01

The objective of this study is to rationalize the feasibility and cost-effectiveness of high dose rate (HDR) cobalt 60 (Co-60) source versus 192-Iridium (192-Ir) source brachytherapy in government funded hospitals and treatment interruption gap because of exchange of sources. A retrospective study of gynecological cancer patients, treated by radiotherapy with curative intent between April 2005 and September 2012 was conducted. We analyzed the total number of patients treated for external beam radiotherapy (EBRT) and brachytherapy (Intracavitary brachytherapy or cylindrical vaginal source). The dates for 192-Ir sources installation and the last date and first date of brachytherapy procedure before and after source installation respectively were also analyzed and calculated the gap in days for brachytherapy interruptions. The study was analyzed the records of 2005 to September 2012 year where eight 192-Ir sources were installed. The mean gap between treatment interruptions was 123.12 days (range 1-647 days). The Institutional incidence of gynecological cancer where radiotherapy was treatment modality (except ovary) is 34.9 percent. Around 52.25 percent of patients who received EBRT at this institute were referred to outside hospital for brachytherapy because of unavailability of Iridium source. The cost for 5 year duration for single cobalt source is approximately 20-22 lakhs while for 15 Iridium sources is approximately 52-53 lakhs. The combined HDR Co-60 brachytherapy and EBRT provide a useful modality in the treatment of gynecological cancer where radiotherapy is indicated, the treatment interruption because of source exchange is longer and can be minimized by using cobalt source as it is cost-effective and has 5 year working life. Thus, Co-60 source for brachytherapy is a feasible option for government funded hospitals in developing countries.

Guidelines for comprehensive quality assurance in brachytherapy

International Nuclear Information System (INIS)

Goldson, A.L.; Nibhanupudy, J.R.

1984-01-01

Brachytherapy treatment techniques can provide significant improvement in local control and overall survival, but only when quality assurance can be guaranteed. To establish brachytherapy quality assurance, basic requirements for three predetermined subdivisions of clinical institutions will be forwarded. These are: (1) centers having minimum requirements to provide brachytherapy, (2) intermediate centers such as regional or community hospitals, and (3) optimal centers such as university hospital and cancer centers. This presentation will highlight personnel needs, equipment requirements, academic activities, clinical experience with these systems and proposed quality assurance guidelines

Caudal epidural anesthesia during intracavitary brachytherapy for cervical cancer

International Nuclear Information System (INIS)

Isoyama-Shirakawa, Yuko; Abe, Madoka; Nakamura, Katsumasa

2015-01-01

It has been suggested that pain control during intracavitary brachytherapy for cervical cancer is insufficient in most hospitals in Japan. Our hospital began using caudal epidural anesthesia during high-dose-rate (HDR) intracavitary brachytherapy in 2011. The purpose of the present study was to retrospectively investigate the effects of caudal epidural anesthesia during HDR intracavitary brachytherapy for cervical cancer patients. Caudal epidural anesthesia for 34 cervical cancer patients was performed during HDR intracavitary brachytherapy between October 2011 and August 2013. We used the patients' self-reported Numeric Rating Scale (NRS) score at the first session of HDR intracavitary brachytherapy as a subjective evaluation of pain. We compared NRS scores of the patients with anesthesia with those of 30 patients who underwent HDR intracavitary brachytherapy without sacral epidural anesthesia at our hospital between May 2010 and August 2011. Caudal epidural anesthesia succeeded in 33 patients (97%), and the NRS score was recorded in 30 patients. The mean NRS score of the anesthesia group was 5.17 ± 2.97, significantly lower than that of the control group's 6.80 ± 2.59 (P = 0.035). The caudal epidural block resulted in no side-effects. Caudal epidural anesthesia is an effective and safe anesthesia option during HDR intracavitary brachytherapy for cervical cancer. (author)

Brachytherapy for cervix cancer: low-dose rate or high-dose rate brachytherapy – a meta-analysis of clinical trials

Directory of Open Access Journals (Sweden)

Stefano Eduardo J

2009-04-01

Full Text Available Abstract Background The literature supporting high-dose rate brachytherapy (HDR in the treatment of cervical carcinoma derives primarily from retrospective series. However, controversy still persists regarding the efficacy and safety of HDR brachytherapy compared to low-dose rate (LDR brachytherapy, in particular, due to inadequate tumor coverage for stage III patients. Whether LDR or HDR brachytherapy produces better results for these patients in terms of survival rate, local control rate and the treatment complications remain controversial. Methods A meta-analysis of RCT was performed comparing LDR to HDR brachytherapy for cervix cancer treated for radiotherapy alone. The MEDLINE, EMBASE, CANCERLIT and Cochrane Library databases, as well as abstracts published in the annual proceedings were systematically searched. We assessed methodological quality for each outcome by grading the quality of evidence using the Grading of Recommendations Assessment, Development and Evaluation (GRADE methodology. We used "recommend" for strong recommendations, and "suggest" for weak recommendations. Results Pooled results from five randomized trials (2,065 patients of HDR brachytherapy in cervix cancer showed no significant increase of mortality (p = 0.52, local recurrence (p = 0.68, or late complications (rectal; p = 0.7, bladder; p = 0.95 or small intestine; p = 0.06 rates as compared to LDR brachytherapy. In the subgroup analysis no difference was observed for overall mortality and local recurrence in patients with clinical stages I, II and III. The quality of evidence was low for mortality and local recurrence in patients with clinical stage I, and moderate for other clinical stages. Conclusion Our meta-analysis shows that there are no differences between HDR and LDR for overall survival, local recurrence and late complications for clinical stages I, II and III. By means of the GRADE system, we recommend the use of HDR for all clinical stages of cervix

Brachytherapy for cervix cancer: low-dose rate or high-dose rate brachytherapy – a meta-analysis of clinical trials

Science.gov (United States)

Viani, Gustavo A; Manta, Gustavo B; Stefano, Eduardo J; de Fendi, Ligia I

2009-01-01

Background The literature supporting high-dose rate brachytherapy (HDR) in the treatment of cervical carcinoma derives primarily from retrospective series. However, controversy still persists regarding the efficacy and safety of HDR brachytherapy compared to low-dose rate (LDR) brachytherapy, in particular, due to inadequate tumor coverage for stage III patients. Whether LDR or HDR brachytherapy produces better results for these patients in terms of survival rate, local control rate and the treatment complications remain controversial. Methods A meta-analysis of RCT was performed comparing LDR to HDR brachytherapy for cervix cancer treated for radiotherapy alone. The MEDLINE, EMBASE, CANCERLIT and Cochrane Library databases, as well as abstracts published in the annual proceedings were systematically searched. We assessed methodological quality for each outcome by grading the quality of evidence using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) methodology. We used "recommend" for strong recommendations, and "suggest" for weak recommendations. Results Pooled results from five randomized trials (2,065 patients) of HDR brachytherapy in cervix cancer showed no significant increase of mortality (p = 0.52), local recurrence (p = 0.68), or late complications (rectal; p = 0.7, bladder; p = 0.95 or small intestine; p = 0.06) rates as compared to LDR brachytherapy. In the subgroup analysis no difference was observed for overall mortality and local recurrence in patients with clinical stages I, II and III. The quality of evidence was low for mortality and local recurrence in patients with clinical stage I, and moderate for other clinical stages. Conclusion Our meta-analysis shows that there are no differences between HDR and LDR for overall survival, local recurrence and late complications for clinical stages I, II and III. By means of the GRADE system, we recommend the use of HDR for all clinical stages of cervix cancer. PMID:19344527

Current status of brachytherapy in Korea: a national survey of radiation oncologists.

Science.gov (United States)

Kim, Haeyoung; Kim, Joo Young; Kim, Juree; Park, Won; Kim, Young Seok; Kim, Hak Jae; Kim, Yong Bae

2016-07-01

The aim of the present study was to acquire information on brachytherapy resources in Korea through a national survey of radiation oncologists. Between October 2014 and January 2015, a questionnaire on the current status of brachytherapy was distributed to all 86 radiation oncology departments in Korea. The questionnaire was divided into sections querying general information on human resources, brachytherapy equipment, and suggestions for future directions of brachytherapy policy in Korea. The response rate of the survey was 88.3%. The average number of radiation oncologists per center was 2.3. At the time of survey, 28 centers (36.8%) provided brachytherapy to patients. Among the 28 brachytherapy centers, 15 (53.5%) were located in in the capital Seoul and its surrounding metropolitan areas. All brachytherapy centers had a high-dose rate system using (192)Ir (26 centers) or (60)Co (two centers). Among the 26 centers using (192)Ir sources, 11 treated fewer than 40 patients per year. In the two centers using (60)Co sources, the number of patients per year was 16 and 120, respectively. The most frequently cited difficulties in performing brachytherapy were cost related. A total of 21 centers had a plan to sustain the current brachytherapy system, and four centers noted plans to upgrade their brachytherapy system. Two centers stated that they were considering discontinuation of brachytherapy due to cost burdens of radioisotope source replacement. The present study illustrated the current status of brachytherapy in Korea. Financial difficulties were the major barriers to the practice of brachytherapy.

High versus low-dose rate brachytherapy for cervical cancer.

Science.gov (United States)

Patankar, Sonali S; Tergas, Ana I; Deutsch, Israel; Burke, William M; Hou, June Y; Ananth, Cande V; Huang, Yongmei; Neugut, Alfred I; Hershman, Dawn L; Wright, Jason D

2015-03-01

Brachytherapy plays an important role in the treatment of cervical cancer. While small trials have shown comparable survival outcomes between high (HDR) and low-dose rate (LDR) brachytherapy, little data is available in the US. We examined the utilization of HDR brachytherapy and analyzed the impact of type of brachytherapy on survival for cervical cancer. Women with stages IB2-IVA cervical cancer treated with primary (external beam and brachytherapy) radiotherapy between 2003-2011 and recorded in the National Cancer Database (NCDB) were analyzed. Generalized linear mixed models and Cox proportional hazards regression were used to examine predictors of HDR brachytherapy use and the association between HDR use and survival. A total of 10,564 women including 2681 (25.4%) who received LDR and 7883 (74.6%) that received HDR were identified. Use of HDR increased from 50.2% in 2003 to 83.9% in 2011 (Puse of HDR. While patients in the Northeast were more likely to receive HDR therapy, there were no other clinical or socioeconomic characteristics associated with receipt of HDR. In a multivariable Cox model, survival was similar between the HDR and LDR groups (HR=0.93; 95% CI 0.83-1.03). Similar findings were noted in analyses stratified by stage and histology. Kaplan-Meier analyses demonstrated no difference in survival based on type of brachytherapy for stage IIB (P=0.68), IIIB (P=0.17), or IVA (P=0.16) tumors. The use of HDR therapy has increased rapidly. Overall survival is similar for LDR and HDR brachytherapy. Copyright © 2015 Elsevier Inc. All rights reserved.

American Brachytherapy Society recommendations for reporting morbidity after prostate brachytherapy

International Nuclear Information System (INIS)

Nag, Subir; Ellis, Rodney J.; Merrick, Gregory S.; Bahnson, Robert; Wallner, Kent; Stock, Richard

2002-01-01

Purpose: To standardize the reporting of brachytherapy-related prostate morbidity to guide ongoing clinical practice and future investigations. Methods: Members of the American Brachytherapy Society (ABS) with expertise in prostate brachytherapy performed a literature review and, guided by their clinical experience, formulated specific recommendations for reporting on morbidity related to prostate brachytherapy. Results: The ABS recommends using validated, patient-administered health-related quality-of-life instruments for the determination of baseline and follow-up data regarding bowel, urinary, and sexual function. Both actuarial and crude incidences should be reported, along with the temporal resolution of specific complications, and correlated with the doses to the normal tissues. The International Prostate Symptom Score is recommended to assess urinary morbidity, and any dysuria, gross hematuria, urinary retention, incontinence, or medication use should be quantified. Likewise, the ''Sexual Health Inventory for Men,'' which includes the specific erectile questions of the International Index of Erectile Function, is the preferred instrument for reporting sexual function, and the loss of sexual desire, incidence of hematospermia, painful orgasm (orgasmalgia), altered orgasm intensity, decreased ejaculatory volume, use of erectile aids, and use of hormones for androgen deprivation should be quantified. The ABS recommends adoption of the Radiation Therapy Oncology Group/European Organization for Research and Treatment of Cancer acute and late radiation morbidity scoring scheme for reporting rectal morbidity and noting the incidence of rectal steroid, laser, or antidiarrheal use. Conclusion: It is important to focus on health-related quality-of-life issues in the treatment of prostate cancer, because the control rates are very similar between appropriate treatment modalities. The ABS recommends using the International Prostate Symptom Score, International Index of

Sexual function after permanent prostate brachytherapy

International Nuclear Information System (INIS)

Galbreath, R.W.; Merrick, G.S.; Butler, W.M.; Stipetich, R.L.; Abel, L.J.; Lief, J.H.

2001-01-01

Purpose: To determine the incidence of potency preservation following permanent prostate brachytherapy and to evaluate the effect of multiple clinical and treatment parameters on penile erectile function. Materials and Methods: 425 patients underwent permanent prostate brachytherapy from April 1995 to October 1999. 209 patients who were potent prior to brachytherapy and currently not receiving hormonal manipulation were mailed an International Index of Erectile Function (IIEF) questionnaire with a pre-addressed stamped envelope. 180 patients completed and returned the questionnaire. Median patient follow-up was 39 months (range 18-74 months). Pre-implant erectile function was assigned using a three-tiered scoring system (2 = erections always or nearly always sufficient for vaginal penetration; 1 = erections sufficient for vaginal penetration but considered suboptimal; 0 = the inability to obtain erections and/or erections inadequate for vaginal penetration). Post-implant potency was defined as an IIEF score >11. Clinical parameters evaluated for sexual function included patient age, clinical T stage, elapsed time since implantation, hypertension, diabetes mellitus, and tobacco consumption. Evaluated treatment parameters included the utilization of neoadjuvant hormonal manipulation and the choice of isotope. The efficacy of sildenafil citrate in brachytherapy induced erectile dysfunction (ED) was also evaluated. Results: A pre-treatment erectile function score of 2 and 1 were assigned to 126 and 54 patients respectively. With 6 year follow up, 39% of patients maintained potency following prostate brachytherapy with a plateau on the curve. Post-implant preservation of potency (IIEF>11) correlated with pre-implant erectile function (50% versus 14% for pre-implant scores of 2 and 1 respectively, p≤0.0001), patient age (56%, 38%, and 23% for patients <60 years of age, 60-69 years of age, and ≥70 years of age respectively, p=0.012) and a history of diabetes mellitus

High dose rate brachytherapy for superficial cancer of the esophagus

International Nuclear Information System (INIS)

Maingon, Philippe; D'Hombres, Anne; Truc, Gilles; Barillot, Isabelle; Michiels, Christophe; Bedenne, Laurent; Horiot, Jean Claude

2000-01-01

Purpose: We analyzed our experience with external radiotherapy, combined modality treatment, or HDR brachytherapy alone to limited esophageal cancers. Methods and Materials: From 1991 to 1996, 25 patients with limited superficial esophagus carcinomas were treated by high dose rate brachytherapy. The mean age was 63 years (43-86 years). Five patients showed superficial local recurrence after external radiotherapy. Eleven patients without invasion of the basal membrane were staged as Tis. Fourteen patients with tumors involving the submucosa without spreading to the muscle were staged as T1. Treatment consisted of HDR brachytherapy alone in 13 patients, external radiotherapy and brachytherapy in 8 cases, and concomitant chemo- and radiotherapy in 4 cases. External beam radiation was administered to a total dose of 50 Gy using 2 Gy daily fractions in 5 weeks. In cases of HDR brachytherapy alone (13 patients), 6 applications were performed once a week. Results: The mean follow-up is 31 months (range 24-96 months). Twelve patients received 2 applications and 13 patients received 6 applications. Twelve patients experienced a failure (48%), 11/12 located in the esophagus, all of them in the treated volume. One patient presented an isolated distant metastasis. In the patients treated for superficial recurrence, 4/5 were locally controlled (80%) by brachytherapy alone. After brachytherapy alone, 8/13 patients were controlled (61%). The mean disease-free survival is 14 months (1-36 months). Overall survival is 76% at 1 year, 37% at 2 years, and 14% at 3 years. Overall survival for Tis patients is 24% vs. 20% for T1 (p 0.83). Overall survival for patients treated by HDR brachytherapy alone is 43%. One patient presented with a fistula with local failure after external radiotherapy and brachytherapy. Four stenosis were registered, two were diagnosed on barium swallowing without symptoms, and two required dilatations. Conclusion: High dose rate brachytherapy permits the treating

Long duration mild temperature hyperthermia and brachytherapy.

Science.gov (United States)

Armour, E P; Raaphorst, G P

2004-03-01

Combining long duration mild temperature hyperthermia (LDMH) and low dose-rate (LDR) brachytherapy to enhance therapeutic killing of cancer cells was proposed many years ago. The cellular and tumour research that supports this hypothesis is presented in this review. Research describing LDMH interaction with pulsed brachytherapy and high dose-rate brachytherapy using clinically relevant parameters are compared with LDMH/LDR brachytherapy. The mechanism by which LDMH sensitizes LDR has been established as the inhibition of sublethal damage repair. The molecular mechanisms have been shown to involve DNA repair enzymes, but the exact nature of these processes is still under investigation. The relative differences between LDMH interactions with human and rodent cells are presented to help in the understanding of possible roles of LDMH in clinical application. The role of LDMH in modifying tumour blood flow and its possible role in LDR sensitization of tumours is also presented. The positive aspects of LDMH-brachytherapy for clinical application are sixfold; (1) the thermal goals (temperature, time and volume) are achievable with currently available technology, (2) the hyperthermia by itself has no detectable toxic effects, (3) thermotolerance appears to play a minor if any role in radiation sensitization, (4) TER of around 2 can be expected, (5) hypoxic fraction may be decreased due to blood flow modification and (6) simultaneous chemotherapy may also be sensitized. Combined LDMH and brachytherapy is a cancer therapy that has established biological rationale and sufficient technical and clinical advancements to be appropriately applied. This modality is ripe for clinical testing.

Brachytherapy in the treatment of cervical cancer: a review

Directory of Open Access Journals (Sweden)

Banerjee R

2014-05-01

Full Text Available Robyn Banerjee,1 Mitchell Kamrava21Department of Radiation Oncology, Tom Baker Cancer Centre, Calgary, Alberta, Canada; 2Department of Radiation Oncology, University of California Los Angeles, Los Angeles, CA, USAAbstract: Dramatic advances have been made in brachytherapy for cervical cancer. Radiation treatment planning has evolved from two-dimensional to three-dimensional, incorporating magnetic resonance imaging and/or computed tomography into the treatment paradigm. This allows for better delineation and coverage of the tumor, as well as improved avoidance of surrounding organs. Consequently, advanced brachytherapy can achieve very high rates of local control with a reduction in morbidity, compared with historic approaches. This review provides an overview of state-of-the-art gynecologic brachytherapy, with a focus on recent advances and their implications for women with cervical cancer.Keywords: cervical cancer, brachytherapy, image-guided brachytherapy

Radiation Exposure Reduction to Brachytherapy Staff By Using Remote Afterloading

International Nuclear Information System (INIS)

Attalla, E.M.

2005-01-01

The radiation exposures to the personnel staff from patients with brachytherapy implants in a brachytherapy service were reviewed. Exposures to the brachytherapy personnel, as determined by Thermoluminescence Dosimeter (TLD) monitors, indicates a four-fold reduction in exposures after the implantation of the use of remote afterloading devices. Quarterly TLD monitor data for seven quarters prior to the use of remote afterloading devices demonstrate an average projected annual dose equivalent to the brachytherapy staff of 2543 Μ Sv. After the implantation of the remote afterloading devices, the quarterly TLD monitor data indicate an average dose equivalent per person of 153 Μ Sv. This is 76% reduction in exposure to brachytherapy personnel with the use of these devices

CF3CH(ONO)CF3: Synthesis, IR spectrum, and use as OH radical source for kinetic and mechanistic studies

DEFF Research Database (Denmark)

Andersen, Mads Peter Sulbæk; Hurley, MD; Ball, JC

2003-01-01

The synthesis, IR spectrum, and first-principles characterization of CF3CH(ONO)CF3 as well as its use as an OH radical source in kinetic and mechanistic studies are reported. CF3CH(ONO)CF3 exists in two conformers corresponding to rotation about the RCO-NO bond. The more prevalent trans conformer......C(O)CF3 and, by implication, OH radicals in 100% yield. CF3CH(ONO)CF3 photolysis is a convenient source of OH radicals in the studies of the yields of CO, CO2, HCHO, and HC(O)OH products which can be difficult to measure using more conventional OH radical sources (e.g., CH3ONO photolysis). CF3CH...

Calculation of integrated biological response in brachytherapy

International Nuclear Information System (INIS)

Dale, Roger G.; Coles, Ian P.; Deehan, Charles; O'Donoghue, Joseph A.

1997-01-01

Purpose: To present analytical methods for calculating or estimating the integrated biological response in brachytherapy applications, and which allow for the presence of dose gradients. Methods and Materials: The approach uses linear-quadratic (LQ) formulations to identify an equivalent biologically effective dose (BED eq ) which, if applied to a specified tissue volume, would produce the same biological effect as that achieved by a given brachytherapy application. For simple geometrical cases, BED multiplying factors have been derived which allow the equivalent BED for tumors to be estimated from a single BED value calculated at a dose reference point. For more complex brachytherapy applications a voxel-by-voxel determination of the equivalent BED will be more accurate. Equations are derived which when incorporated into brachytherapy software would facilitate such a process. Results: At both high and low dose rates, the BEDs calculated at the dose reference point are shown to be lower than the true values by an amount which depends primarily on the magnitude of the prescribed dose; the BED multiplying factors are higher for smaller prescribed doses. The multiplying factors are less dependent on the assumed radiobiological parameters. In most clinical applications involving multiple sources, particularly those in multiplanar arrays, the multiplying factors are likely to be smaller than those derived here for single sources. The overall suggestion is that the radiobiological consequences of dose gradients in well-designed brachytherapy treatments, although important, may be less significant than is sometimes supposed. The modeling exercise also demonstrates that the integrated biological effect associated with fractionated high-dose-rate (FHDR) brachytherapy will usually be different from that for an 'equivalent' continuous low-dose-rate (CLDR) regime. For practical FHDR regimes involving relatively small numbers of fractions, the integrated biological effect to

Behavior of platelets stained by 5,6-CF-encapsulated PEGylated liposomes after laser irradiation of vessel wall: an in-vivo model for studying site-selective delivery of diagnostic or therapeutic agents

Science.gov (United States)

Mordon, Serge R.; Begu, Sylvie; Buys, Bruno; Tourne-Peteilh, Corine; Devoisselle, Jean-Marie

2001-05-01

Vascular endothelium serves as an extensive interface between circulating blood and various tissues and organs of the body. As such, it offers an accessible target for blood-borne pharmacological and genetic manipulations that can mediate both local and systemic effects. Thus, targeting of liposomes to activated vascular endothelial cells may provide a strategy for site-selective delivery in the vascular system with broad therapeutic applicability. This study aimed to evaluate an intravital fluorescence imaging technique to visualize in-situ and in real-time the activation of platelets after staining by 5,6-CF- encapsulated PEGylated liposomes injected intravenously. The study was performed on skin by using a dorsal skin-fold chamber implanted in golden hamsters using intravital microscopy. The skin micro circulation was observed with an intravital microscope (using x25 and x40 magnification) fitted with a Xenon light source and an epi-fluorescence assembly. An ultra-high sensitivity video-camera mounted on the microscope projected the image onto a monitor, and the images were recorded for play-back analysis with a digital video cassette recorder. An inflammatory response was induced by an Argon laser emitting at 514.5nm. The 80micrometers laser beam was focused on a vessel and its position was controlled with the microscope imaging system, it was possible to see individual platelets flowing in blood vessels. As liposomes were labeled with a fluorescent probe which was hydrophilic (located in the aqueous phase), the fluorescence of platelets was due only to the uptake of liposomes. After laser irradiation, platelets activation at sites of vascular injury was obtained. Tethering, translocation of some platelets inside the irradiated zone were clearly seen. At last, detachment and extravasation of platelets were observed. A perivascular fluorescence confirmed that platelets migrated across the basal lamina into the dermal connective tissue. In conclusion, staining of

48 CFR 252.231-7000 - Supplemental cost principles.

Science.gov (United States)

2010-10-01

... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...

Evolution of brachytherapy for prostate carcinoma

International Nuclear Information System (INIS)

Qin Lan

2005-01-01

Brachytherapy is one of the most main management to prostate carcinoma. This method has been rapidly accepted in clinical application since it is a convenient, little-traumatic, and outpatient therapy. With the development of techniques of production of radio-seeds, imaging modality and three-dimensional radiotherapy plan system, brachytherapy has been made a virtually progress in improving curative-effect and reducing damage to surrounding normal tissue. (authors)

Proficiency-based cervical cancer brachytherapy training.

Science.gov (United States)

Zhao, Sherry; Francis, Louise; Todor, Dorin; Fields, Emma C

2018-04-25

Although brachytherapy increases the local control rate for cervical cancer, there has been a progressive decline in its use. Furthermore, the training among residency programs for gynecologic brachytherapy varies considerably, with some residents receiving little to no training. This trend is especially concerning given the association between poor applicator placement and decline in local control. Considering the success of proficiency-based training in other procedural specialties, we developed and implemented a proficiency-based cervical brachytherapy training curriculum for our residents. Each resident placed tandem and ovoid applicators with attending guidance and again alone 2 weeks later using a pelvic model that was modified to allow for cervical brachytherapy. Plain films were taken of the pelvic model, and applicator placement quality was evaluated. Other evaluated metrics included retention of key procedural details, the time taken for each procedure and presession and postsession surveys to assess confidence. During the initial session, residents on average met 4.5 of 5 placement criteria, which improved to 5 the second session. On average, residents were able to remember 7.6 of the 8 key procedural steps. Execution time decreased by an average of 10.5%. Resident confidence with the procedure improved dramatically, from 2.6 to 4.6 of 5. Residents who had previously never performed a tandem and ovoid procedure showed greater improvements in these criteria than those who had. All residents strongly agreed that the training was helpful and wanted to participate again the following year. Residents participating in this simulation training had measurable improvements in the time to perform the procedure, applicator placement quality, and confidence. This curriculum is easy to implement and is of great value for training residents, and would be particularly beneficial in programs with low volume of cervical brachytherapy cases. Simulation programs could

Computed tomography in brachytherapy

International Nuclear Information System (INIS)

Mansfield, C.M.; Lee, K.R.; Dwyer, S.; Zellmer, D.; Cook, P.

1983-01-01

CT scanning adds to the ability to evaluate brachytherapy techniques. It provides an additional method in the assessment of patients who are candidates for or who are being treated by brachytherapy. The CT scan can give information regarding the position of the sources and their relation to the tumor and normal structures with greater ease than do orthogonal views. This makes it possible to accurately calculate areas of high or low dose. Potential areas of overdose can be recognized, thereby decreasing the chances of postbrachytherapy complications. CT scanning can be used at various levels of complexity in dosimetry evaluation. Adequate brachytherapy dosimetry information is obtainable from CT slices through one or more levels of the implanted volume. In some instances it is possible to obtain additional information by reconstructing the scans in other planes, e.g., coronal or sagittal. Three-dimensional viewing of the implant is desirable, but it should be pointed out that this approach is time-consuming and beyond the capabilities of most institutions at present. It will be necessary to continue work on three-dimensional treatment planning to make it readily available

Brachytherapy in the treatment of head and neck cancer

International Nuclear Information System (INIS)

Yoo, Seong Yul

1999-01-01

Brachytherapy has been proved to be an effective method for the purpose of increasing radiation dose to the tumor and reducing the dose to the surrounding normal tissue. In head and neck cancer, the rationale of brachytherapy is as follows; Firstly, early small lesion is radiocurative and the major cause of failure is local recurrence. Secondly, it can diminish evidently the dose to the normal tissue especially masseteric muscle and salivary gland. Thirdly, the anatomy of head and neck is suitable to various technique of brachytherapy. On background of accumulated experience of LDR iridium brachytherapy of head and neck cancer for the last 15 years, the author reviewed the history of radioisotope therapy, the characteristics of radionuclides, and some important things in the method, clinical technique and treatment planning. The author analyzed the clinical result of 185 cases of head and neck cancer treated in the Korea Cancer Center Hospital. Finally the future prospect of brachytherapy of head and neck cancer is discussed

WE-F-BRD-01: HDR Brachytherapy II: Integrating Imaging with HDR

International Nuclear Information System (INIS)

Craciunescu, O; Todor, D; Leeuw, A de

2014-01-01

In recent years, with the advent of high/pulsed dose rate afterloading technology, advanced treatment planning systems, CT/MRI compatible applicators, and advanced imaging platforms, image-guided adaptive brachytherapy treatments (IGABT) have started to play an ever increasing role in modern radiation therapy. The most accurate way to approach IGABT treatment is to provide the infrastructure that combines in a single setting an appropriate imaging device, a treatment planning system, and a treatment unit. The Brachytherapy Suite is not a new concept, yet the modern suites are incorporating state-of-the-art imaging (MRI, CBCT equipped simulators, CT, and /or US) that require correct integration with each other and with the treatment planning and delivery systems. Arguably, an MRI-equipped Brachytherapy Suite is the ideal setup for real-time adaptive brachytherapy treatments. The main impediment to MRI-IGABT adoption is access to MRI scanners. Very few radiation oncology departments currently house MRI scanners, and even fewer in a dedicated Brachytherapy Suite. CBCT equipped simulators are increasingly offered by manufacturers as part of a Brachytherapy Suite installation. If optimized, images acquired can be used for treatment planning, or can be registered with other imaging modalities. This infrastructure is relevant for all forms of brachytherapy, especially those utilizing multi-fractionated courses of treatment such as prostate and cervix. Moreover, for prostate brachytherapy, US imaging systems can be part of the suite to allow for real-time HDR/LDR treatments. Learning Objectives: Understand the adaptive workflow of MR-based IGBT for cervical cancer. Familiarize with commissioning aspects of a CBCT equipped simulator with emphasis on brachytherapy applications Learn about the current status and future developments in US-based prostate brachytherapy

WE-F-BRD-01: HDR Brachytherapy II: Integrating Imaging with HDR

Energy Technology Data Exchange (ETDEWEB)

Craciunescu, O [Duke University Medical Center, Durham, NC (United States); Todor, D [Virginia Commonwealth University, Richmond, VA (United States); Leeuw, A de

2014-06-15

In recent years, with the advent of high/pulsed dose rate afterloading technology, advanced treatment planning systems, CT/MRI compatible applicators, and advanced imaging platforms, image-guided adaptive brachytherapy treatments (IGABT) have started to play an ever increasing role in modern radiation therapy. The most accurate way to approach IGABT treatment is to provide the infrastructure that combines in a single setting an appropriate imaging device, a treatment planning system, and a treatment unit. The Brachytherapy Suite is not a new concept, yet the modern suites are incorporating state-of-the-art imaging (MRI, CBCT equipped simulators, CT, and /or US) that require correct integration with each other and with the treatment planning and delivery systems. Arguably, an MRI-equipped Brachytherapy Suite is the ideal setup for real-time adaptive brachytherapy treatments. The main impediment to MRI-IGABT adoption is access to MRI scanners. Very few radiation oncology departments currently house MRI scanners, and even fewer in a dedicated Brachytherapy Suite. CBCT equipped simulators are increasingly offered by manufacturers as part of a Brachytherapy Suite installation. If optimized, images acquired can be used for treatment planning, or can be registered with other imaging modalities. This infrastructure is relevant for all forms of brachytherapy, especially those utilizing multi-fractionated courses of treatment such as prostate and cervix. Moreover, for prostate brachytherapy, US imaging systems can be part of the suite to allow for real-time HDR/LDR treatments. Learning Objectives: Understand the adaptive workflow of MR-based IGBT for cervical cancer. Familiarize with commissioning aspects of a CBCT equipped simulator with emphasis on brachytherapy applications Learn about the current status and future developments in US-based prostate brachytherapy.

Encapsulation layer design and scalability in encapsulated vertical 3D RRAM

International Nuclear Information System (INIS)

Yu, Muxi; Fang, Yichen; Wang, Zongwei; Chen, Gong; Pan, Yue; Yang, Xue; Yin, Minghui; Yang, Yuchao; Li, Ming; Cai, Yimao; Huang, Ru

2016-01-01

Here we propose a novel encapsulated vertical 3D RRAM structure with each resistive switching cell encapsulated by dielectric layers, contributing to both the reliability improvement of individual cells and thermal disturbance reduction of adjacent cells due to the effective suppression of unwanted oxygen vacancy diffusion. In contrast to the traditional vertical 3D RRAM, encapsulated bar-electrodes are adopted in the proposed structure substituting the previous plane-electrodes, thus encapsulated resistive switching cells can be naturally formed by simply oxidizing the tip of the metal bar-electrodes. In this work, TaO x -based 3D RRAM devices with SiO 2 and Si 3 N 4 as encapsulation layers are demonstrated, both showing significant advantages over traditional unencapsulated vertical 3D RRAM. Furthermore, it was found thermal conductivity and oxygen blocking ability are two key parameters of the encapsulation layer design influencing the scalability of vertical 3D RRAM. Experimental and simulation data show that oxygen blocking ability is more critical for encapsulation layers in the relatively large scale, while thermal conductivity becomes dominant as the stacking layers scale to the sub-10 nm regime. Finally, based on the notable impacts of the encapsulation layer on 3D RRAM scaling, an encapsulation material with both excellent oxygen blocking ability and high thermal conductivity such as AlN is suggested to be highly desirable to maximize the advantages of the proposed encapsulated structure. The findings in this work could pave the way for reliable ultrahigh-density storage applications in the big data era. (paper)

Methods for prostate stabilization during transperineal LDR brachytherapy.

Science.gov (United States)

Podder, Tarun; Sherman, Jason; Rubens, Deborah; Messing, Edward; Strang, John; Ng, Wan-Sing; Yu, Yan

2008-03-21

In traditional prostate brachytherapy procedures for a low-dose-rate (LDR) radiation seed implant, stabilizing needles are first inserted to provide some rigidity and support to the prostate. Ideally this will provide better seed placement and an overall improved treatment. However, there is much speculation regarding the effectiveness of using regular brachytherapy needles as stabilizers. In this study, we explored the efficacy of two types of needle geometries (regular brachytherapy needle and hooked needle) and several clinically feasible configurations of the stabilization needles. To understand and assess the prostate movement during seed implantation, we collected in vivo data from patients during actual brachytherapy procedures. In vitro experimentation with tissue-equivalent phantoms allowed us to further understand the mechanics behind prostate stabilization. We observed superior stabilization with the hooked needles compared to the regular brachytherapy needles (more than 40% in bilateral parallel needle configuration). Prostate movement was also reduced significantly when regular brachytherapy needles were in an angulated configuration as compared to the parallel configuration (more than 60%). When the hooked needles were angulated for stabilization, further reduction in prostate displacement was observed. In general, for convenience of dosimetric planning and to avoid needle collision, all needles are desired to be in a parallel configuration. In this configuration, hooked needles provide improved stabilization of the prostate. On the other hand, both regular and hooked needles appear to be equally effective in reducing prostate movement when they are in angulated configurations, which will be useful in seed implantation using a robotic system. We have developed nonlinear spring-damper model for the prostate movement which can be used for adapting dosimetric planning during brachytherapy as well as for developing more realistic haptic devices and

Methods for prostate stabilization during transperineal LDR brachytherapy

International Nuclear Information System (INIS)

Podder, Tarun; Yu Yan; Sherman, Jason; Rubens, Deborah; Strang, John; Messing, Edward; Ng, Wan-Sing

2008-01-01

In traditional prostate brachytherapy procedures for a low-dose-rate (LDR) radiation seed implant, stabilizing needles are first inserted to provide some rigidity and support to the prostate. Ideally this will provide better seed placement and an overall improved treatment. However, there is much speculation regarding the effectiveness of using regular brachytherapy needles as stabilizers. In this study, we explored the efficacy of two types of needle geometries (regular brachytherapy needle and hooked needle) and several clinically feasible configurations of the stabilization needles. To understand and assess the prostate movement during seed implantation, we collected in vivo data from patients during actual brachytherapy procedures. In vitro experimentation with tissue-equivalent phantoms allowed us to further understand the mechanics behind prostate stabilization. We observed superior stabilization with the hooked needles compared to the regular brachytherapy needles (more than 40% in bilateral parallel needle configuration). Prostate movement was also reduced significantly when regular brachytherapy needles were in an angulated configuration as compared to the parallel configuration (more than 60%). When the hooked needles were angulated for stabilization, further reduction in prostate displacement was observed. In general, for convenience of dosimetric planning and to avoid needle collision, all needles are desired to be in a parallel configuration. In this configuration, hooked needles provide improved stabilization of the prostate. On the other hand, both regular and hooked needles appear to be equally effective in reducing prostate movement when they are in angulated configurations, which will be useful in seed implantation using a robotic system. We have developed nonlinear spring-damper model for the prostate movement which can be used for adapting dosimetric planning during brachytherapy as well as for developing more realistic haptic devices and

Absolute rate constants for the reaction of CF3O2 and CF3O radicals with NO at 295 K

DEFF Research Database (Denmark)

Sehested, J.; Nielsen, O.J.

1993-01-01

Using a pulse radiolysis UV absorption technique and subsequent simulations of experimental NO2 and FNO absorption transients, rate constants for reaction between CF3O and CF3O2 radicals with NO were determined, CF3O2+NO-->CF3O+NO2 (3), CF3O+NO-->CF2O+FNO (5). k3 was derived to be (1.68+/-0.26)x10...

Results of the intestitial brachytherapy and of the combination external radiation-brachytherapy in 150 patients with carcinoma of the oral tongue and floor of the mouth

Energy Technology Data Exchange (ETDEWEB)

Sannazzari, G L; Negri, G L; Ozzello, F

1986-01-01

The authors report their experience on the treatment of carcinoma of the oral tongue and floor of the mouth with interstitial brachytherapy, alone or in conbination with external irradiation. One hundred and fifty patients were treated; among these, 116 with brachytherapy alone, 34 with combined treatment. The five years local control in those patients treated with brachytherapy alone was 72.5% in T1, 61.2% in T2 and 35% in T3; in those patients treated with external irradiation and brachytherapy the global five years control was 42.5%. The global five years survival was 64% in the patients treated with brachytherapy alone 48% in the patients treated with combined therapy. 42 refs.

Results of the intestitial brachytherapy and of the combination external radiation-brachytherapy in 150 patients with carcinoma of the oral tongue and floor of the mouth

International Nuclear Information System (INIS)

Sannazzari, G.L.; Negri, G.L.; Ozzello, F.

1986-01-01

The authors report their experience on the treatment of carcinoma of the oral tongue and floor of the mouth with interstitial brachytherapy, alone or in conbination with external irradiation. One hundred and fifty patients were treated; among these, 116 with brachytherapy alone, 34 with combined treatment. The five years local control in those patients treated with brachytherapy alone was 72.5% in T1, 61.2% in T2 and 35% in T3; in those patients treated with external irradiation and brachytherapy the global five years control was 42.5%. The global five years survival was 64% in the patients treated with brachytherapy alone 48% in the patients treated with combined therapy

46 CFR 252.33 - Hull and machinery insurance.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...

Scandinavian Nurse Specialist Group/Cystic Fibrosis (SNSG/CF)

DEFF Research Database (Denmark)

Bregnballe, Vibeke; Erwander, Inger

2006-01-01

/CF comprises one CF nurse from each of the centers. The board meets twice a year to plan workshops and courses. SNSG/CF is part of the International Nurse Specialist Group/Cystic Fibrosis (INSG/CF). Results: Within the framework of SNSG/CF a 2-day workshop is held every second year for approximately 40...

Atmospheric chemistry of 4 : 2 fluorotelomer alcohol (CF3(CF2)(3)CH2CH2OH): Products and mechanism of Cl atom initiated oxidation

DEFF Research Database (Denmark)

Hurley, MD; Ball, JC; Wallington, TJ

2004-01-01

Smog chamber/FTIR techniques were used to study the products and mechanism of the Cl atom initiated oxidation of 4:2 fluorotelomer alcohol (CF3(CF2)(3)CH2CH2OH) in 700 Torr of N-2/O-2 diluent at 296 K. CF3(CF2)(3)CH2CHO is the sole primary oxidation product. CF3(CF2)(3)CHO, CF3(CF2)(3)CH2COOH...... respectively. Using relative rate techniques, a value of k(Cl + CF3(CF2)(3)CH2CHO) = (1.84 +/- 0.30) x 10(-11) cm(3) molecule(-1) s(-1) was determined. The yield of the perfluorinated acid, CF3(CF2)(3)COOH, from the 4:2 fluorotelomer alcohol increased with the diluent gas oxygen concentration......, and CF3(CF2)(3)CH2C(O)OOH are secondary oxidation products. Further irradiation results in the formation of CF3(CF2)(3)COOH, COF2, and CF3OH. CF3(CF2)(3)CHO, CF3(CF2)(3)CH2COOH, and CF3(CF2)(3)CH2C(O)OOH are formed from CF3(CF2)(3)CH2CHO oxidation in yields of 46 27 and less than or equal to 27...

National audit of a system for rectal contact brachytherapy

Directory of Open Access Journals (Sweden)

Laia Humbert-Vidan

2017-01-01

Full Text Available Background and purpose: Contact brachytherapy is used for the treatment of early rectal cancer. An overview of the current status of quality assurance of the rectal contact brachytherapy systems in the UK, based on a national audit, was undertaken in order to assist users in optimising their own practices. Material and methods: Four UK centres using the Papillon 50 contact brachytherapy system were audited. Measurements included beam quality, output and radiation field size and uniformity. Test frequencies and tolerances were reviewed and compared to both existing recommendations and published reviews on other kV and electronic brachytherapy systems. External validation of dosimetric measurements was provided by the National Physical Laboratory. Results: The maximum host/audit discrepancy in beam quality determination was 6.5%; this resulted in absorbed dose variations of 0.2%. The host/audit agreement in absorbed dose determination was within 2.2%. The median of the radiation field uniformity measurements was 2.7% and the host/audit agreement in field size was within 1 mm. Test tolerances and frequencies were within the national recommendations for kV units. Conclusions: The dosimetric characterisation of the Papillon 50 was validated by the audit measurements for all participating centres, thus providing reassurance that the implementation had been performed within the standards stated in previously published audit work and recommendations for kV and electronic brachytherapy units. However, optimised and standardised quality assurance testing could be achieved by reducing some methodological differences observed. Keywords: Contact brachytherapy, Electronic brachytherapy, Audit

Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

Czech Academy of Sciences Publication Activity Database

Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.

2005-01-01

Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

Outcomes and toxicities in patients with intermediate-risk prostate cancer treated with brachytherapy alone or brachytherapy and supplemental external beam radiation therapy.

Science.gov (United States)

Schlussel Markovic, Emily; Buckstein, Michael; Stone, Nelson N; Stock, Richard G

2018-05-01

To evaluate the cancer control outcomes and long-term treatment-related morbidity of brachytherapy as well as combination brachytherapy and external beam radiation therapy (EBRT) in patients with intermediate-risk prostate cancer. A retrospective review was conducted in a prospectively collected database of patients with intermediate-risk prostate cancer who were treated either with brachytherapy or brachytherapy and EBRT, with or without androgen deprivation therapy (ADT), in the period 1990-2014. Urinary and erectile dysfunction symptoms were measured using the International Prostate Symptom Score (IPSS), the Mount Sinai erectile function scale and the Sexual Health Inventory for Men (SHIM). Cancer control endpoints included biochemical failure and development of distant metastases. All statistical analyses were carried out using the Statistical Package for Social Science (SPSS). Survival curves were calculated using Kaplan-Meier actuarial methods and compared using log-rank tests. Cox regression multivariate analyses were used to test the effect of multiple variables on treatment outcomes. A total of 902 patients were identified, with a median follow-up of 91 months. Of these, 390 received brachytherapy and 512 received combination therapy with EBRT. In patients with one intermediate-risk factor, the addition of EBRT did not significantly affect freedom from biochemical failure or distant metastases. Among patients with two or three intermediate-risk factors, added EBRT did not improve freedom from biochemical failure. Significant differences in late toxicity between patients treated with brachytherapy vs combination brachytherapy and EBRT were identified including urge incontinence (P actuarial methods showed that patients receiving combination therapy more frequently experienced loss of potency, as measured by the Mount Sinai erectile function scale (P = 0.040). Brachytherapy monotherapy results in equal biochemical and distant control in both patients with

Utilization and Outcomes of Breast Brachytherapy in Younger Women

International Nuclear Information System (INIS)

Smith, Grace L.; Huo, Jinhai; Giordano, Sharon H.; Hunt, Kelly K.; Buchholz, Thomas A.; Smith, Benjamin D.

2015-01-01

Purpose: To directly compare (1) radiation treatment utilization patterns; (2) risks of subsequent mastectomy; and (3) costs of radiation treatment in patients treated with brachytherapy versus whole-breast irradiation (WBI), in a national, contemporary cohort of women with incident breast cancer, aged 64 years and younger. Methods and Materials: Using MarketScan health care claims data, we identified 45,884 invasive breast cancer patients (aged 18-64 years), treated from 2003 to 2010 with lumpectomy, followed by brachytherapy (n=3134) or whole-breast irradiation (n=42,750). We stratified patients into risk groups according to age (Age<50 vs Age≥50) and endocrine therapy status (Endocrine− vs Endocrine+). “Endocrine+” patients filled an endocrine therapy prescription within 1 year after lumpectomy. Pathologic hormone receptor status was not available in this dataset. In brachytherapy versus WBI patients, utilization trends and 5-year subsequent mastectomy risks were compared. Stratified, adjusted subsequent mastectomy risks were calculated using proportional hazards regression. Results: Brachytherapy utilization increased from 2003 to 2010: in patients Age<50, from 0.6% to 4.9%; patients Age≥50 from 2.2% to 11.3%; Endocrine− patients, 1.3% to 9.4%; Endocrine+ patients, 1.9% to 9.7%. Age influenced treatment selection more than endocrine status: 17% of brachytherapy patients were Age<50 versus 32% of WBI patients (P<.001); whereas 41% of brachytherapy patients were Endocrine–versus 44% of WBI patients (P=.003). Highest absolute 5-year subsequent mastectomy risks occurred in Endocrine−/Age<50 patients (24.4% after brachytherapy vs 9.0% after WBI (hazard ratio [HR] 2.18, 95% confidence interval [CI] 1.37-3.47); intermediate risks in Endocrine−/Age≥50 patients (8.6% vs 4.9%; HR 1.76, 95% CI 1.26-2.46); and lowest risks in Endocrine+ patients of any age: Endocrine+/Age<50 (5.5% vs 4.5%; HR 1.18, 95% CI 0.61-2.31); Endocrine+/Age≥50 (4.2% vs 2

Utilization and Outcomes of Breast Brachytherapy in Younger Women

Energy Technology Data Exchange (ETDEWEB)

Smith, Grace L. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Health Services Research, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Huo, Jinhai [Department of Health Services Research, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Giordano, Sharon H. [Department of Health Services Research, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Breast Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Hunt, Kelly K. [Department of Surgical Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Buchholz, Thomas A. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Smith, Benjamin D., E-mail: bsmith3@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Health Services Research, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

2015-09-01

Purpose: To directly compare (1) radiation treatment utilization patterns; (2) risks of subsequent mastectomy; and (3) costs of radiation treatment in patients treated with brachytherapy versus whole-breast irradiation (WBI), in a national, contemporary cohort of women with incident breast cancer, aged 64 years and younger. Methods and Materials: Using MarketScan health care claims data, we identified 45,884 invasive breast cancer patients (aged 18-64 years), treated from 2003 to 2010 with lumpectomy, followed by brachytherapy (n=3134) or whole-breast irradiation (n=42,750). We stratified patients into risk groups according to age (Age<50 vs Age≥50) and endocrine therapy status (Endocrine− vs Endocrine+). “Endocrine+” patients filled an endocrine therapy prescription within 1 year after lumpectomy. Pathologic hormone receptor status was not available in this dataset. In brachytherapy versus WBI patients, utilization trends and 5-year subsequent mastectomy risks were compared. Stratified, adjusted subsequent mastectomy risks were calculated using proportional hazards regression. Results: Brachytherapy utilization increased from 2003 to 2010: in patients Age<50, from 0.6% to 4.9%; patients Age≥50 from 2.2% to 11.3%; Endocrine− patients, 1.3% to 9.4%; Endocrine+ patients, 1.9% to 9.7%. Age influenced treatment selection more than endocrine status: 17% of brachytherapy patients were Age<50 versus 32% of WBI patients (P<.001); whereas 41% of brachytherapy patients were Endocrine–versus 44% of WBI patients (P=.003). Highest absolute 5-year subsequent mastectomy risks occurred in Endocrine−/Age<50 patients (24.4% after brachytherapy vs 9.0% after WBI (hazard ratio [HR] 2.18, 95% confidence interval [CI] 1.37-3.47); intermediate risks in Endocrine−/Age≥50 patients (8.6% vs 4.9%; HR 1.76, 95% CI 1.26-2.46); and lowest risks in Endocrine+ patients of any age: Endocrine+/Age<50 (5.5% vs 4.5%; HR 1.18, 95% CI 0.61-2.31); Endocrine+/Age≥50 (4.2% vs 2

48 CFR 252.217-7010 - Performance.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...

Novel treatment options for nonmelanoma skin cancer: focus on electronic brachytherapy

Directory of Open Access Journals (Sweden)

Kasper ME

2015-11-01

Full Text Available Michael E Kasper,1,2 Ahmed A Chaudhary3 1Department of Radiation Oncology, Lynn Cancer Institute at Boca Raton Regional Hospital, Boca Raton, 2Charles E. Schmidt College of Medicine, Florida Atlantic University, FL, 3North Main Radiation Oncology, Warren Alpert School of Medicine, Brown University, RI, USA Abstract: Nonmelanoma skin cancer (NMSC is an increasing health care issue in the United States, significantly affecting quality of life and impacting health care costs. Radiotherapy has a long history in the treatment of NMSC. Shortly after the discovery of X-rays and 226Radium, physicians cured patients with NMSC using these new treatments. Both X-ray therapy and brachytherapy have evolved over the years, ultimately delivering higher cure rates and lower toxicity. Electronic brachytherapy for NMSC is based on the technical and clinical data obtained from radionuclide skin surface brachytherapy and the small skin surface applicators developed over the past 25 years. The purpose of this review is to introduce electronic brachytherapy in the context of the history, data, and utilization of traditional radiotherapy and brachytherapy. Keywords: electronic brachytherapy, superficial radiotherapy, skin surface brachytherapy, electron beam therapy, nonmelanoma skin cancer, basal cell carcinoma, squamous cell carcinoma

Perioperative high dose rate (HDR brachytherapy in unresectable locally advanced pancreatic tumors

Directory of Open Access Journals (Sweden)

Brygida Białas

2011-07-01

Full Text Available Purpose: The aim of the study was to present an original technique of catheter implantation for perioperative HDR-Ir192 brachytherapy in patients after palliative operations of unresectable locally advanced pancreatic tumors and to estimate the influence of perioperative HDR-Ir192 brachytherapy on pain relief in terminal pancreatic cancer patients. Material and methods: Eight patients with pancreatic tumors located in the head of pancreas underwent palliative operations with the use of HDR-Ir192 brachytherapy. All patients qualified for surgery reported pain of high intensity and had received narcotic painkillers prior to operation. During the last phase of the surgery, the Nucletron® catheters were implanted in patients to prepare them for later perioperative brachytherapy. Since the 6th day after surgery HDR brachytherapy was performed. Before each brachytherapy fraction the location of implants were checked using fluoroscopy. A fractional dose was 5 Gy and a total dose was 20 Gy in the area of radiation. A comparative study of two groups of patients (with and without brachytherapy with stage III pancreatic cancer according to the TNM scale was taken in consideration. Results and Conclusions: The authors claim that the modification of catheter implantation using specially designed cannula, facilitates the process of inserting the catheter into the tumor, shortens the time needed for the procedure, and reduces the risk of complications. Mean survival time was 5.7 months. In the group of performed brachytherapy, the mean survival time was 6.7 months, while in the group of no brachytherapy performed – 4.4 months. In the group of brachytherapy, only one patient increased the dose of painkillers in the last month of his life. Remaining patients took constant doses of medicines. Perioperative HDR-Ir192 brachytherapy could be considered as a practical application of adjuvant therapy for pain relief in patients with an advanced pancreatic cancer.

Role of brachytherapy in the treatment of localized prostate cancer

Directory of Open Access Journals (Sweden)

A. D. Kaprin

2015-01-01

Full Text Available The review is devoted to application of brachytherapy for treating the localized prostate cancer (PC. Statistics for incidence and detectability of this pathology and its dynamics for recent years are represented. Brief analysis of other methods which are conveniently used for treatment of PC, such as radical prostatectomy and external-beam radiotherapy, was performed. Advantages and disadvantages of these methods have been discussed. Brief history about the development of brachytherapy from first experience to wide-spread use in clinical practice is reported. The detailed review of series of large trials from Russia and other countries for efficiency and safety of brachytherapy in patients with prostate cancer for recent 15 years is also represented. Two types of brachytherapy in current clinical oncology i.e. low-dose technique with permanent implantation of microsources and high-dose temporary isotope implantation, specifics of its application in different groups of patients have been described. The procedure of brachytherapy and its three main steps i.e. planning, implantation and control assessment after implantation have been characterized in details. The conclusion about benefits of using of brachytherapy in the treatment of prostate cancer as minimally invasive and efficient method was made. 

Calculated and measured brachytherapy dosimetry parameters in water for the Xoft Axxent X-Ray Source: an electronic brachytherapy source.

Science.gov (United States)

Rivard, Mark J; Davis, Stephen D; DeWerd, Larry A; Rusch, Thomas W; Axelrod, Steve

2006-11-01

A new x-ray source, the model S700 Axxent X-Ray Source (Source), has been developed by Xoft Inc. for electronic brachytherapy. Unlike brachytherapy sources containing radionuclides, this Source may be turned on and off at will and may be operated at variable currents and voltages to change the dose rate and penetration properties. The in-water dosimetry parameters for this electronic brachytherapy source have been determined from measurements and calculations at 40, 45, and 50 kV settings. Monte Carlo simulations of radiation transport utilized the MCNP5 code and the EPDL97-based mcplib04 cross-section library. Inter-tube consistency was assessed for 20 different Sources, measured with a PTW 34013 ionization chamber. As the Source is intended to be used for a maximum of ten treatment fractions, tube stability was also assessed. Photon spectra were measured using a high-purity germanium (HPGe) detector, and calculated using MCNP. Parameters used in the two-dimensional (2D) brachytherapy dosimetry formalism were determined. While the Source was characterized as a point due to the small anode size, S700 Source exhibited depth dose behavior similar to low-energy photon-emitting low dose rate sources 125I and l03Pd, yet with capability for variable and much higher dose rates and subsequently adjustable penetration capabilities. This paper presents the calculated and measured in-water brachytherapy dosimetry parameters for the model S700 Source at the aforementioned three operating voltages.

Brachytherapy. High dose rate brachytherapy - Radiation protection: medical sheet ED 4287

International Nuclear Information System (INIS)

Celier, D.; Aubert, B.; Vidal, J.P.; Biau, A.; Lahaye, T.; Gauron, C.; Barret, C.; Boisserie, G.; Branchet, E.; Gambini, D.; Gondran, C.; Le Guen, B.; Guerin, C.; Nguyen, S.; Pierrat, N.; Sarrazin, T.; Donnarieix, D.

2010-02-01

After having indicated the required authorization to implement brachytherapy techniques, this document presents the various aspects and measures related to radiation protection when performing high-dose-rate brachytherapy treatments. It presents the concerned personnel, describes the operational process, indicates the associated hazards and the risk related to ionizing radiation, and describes how the risk is to be assessed and how exposure levels are to be determined (elements of risk assessment, delimitation of controlled and monitored areas, personnel classification, and choice of the dose monitoring method). It describes the various components of a risk management strategy (risk reduction, technical measures regarding the installation and the personnel, training and information, prevention and medical monitoring). It briefly presents how risk management is to be assessed, and mentions other related risks (biological risk, handling and posture, handling of heavy loads, mental workload, chemical risk)

Brachytherapy. Pulsed dose rate brachytherapy - Radiation protection: medical sheet ED 4250

International Nuclear Information System (INIS)

Celier, D.; Aubert, B.; Vidal, J.P.; Biau, A.; Lahaye, T.; Gauron, C.; Barret, C.; Boisserie, G.; Branchet, E.; Gambini, D.; Gondran, C.; Le Guen, B.; Guerin, C.; Nguyen, S.; Pierrat, N.; Sarrazin, T.; Donnarieix, D.

2009-06-01

After having indicated the required authorization to implement brachytherapy techniques, this document presents the various aspects and measures related to radiation protection when performing pulsed-dose-rate brachytherapy treatments. It presents the concerned personnel, describes the operational process, indicates the associated hazards and the risk related to ionizing radiation, and describes how the risk is to be assessed and how exposure levels are to be determined (elements of risk assessment, delimitation of controlled and monitored areas, personnel classification, and choice of the dose monitoring method). It describes the various components of a risk management strategy (risk reduction, technical measures regarding the installation and the personnel, training and information, prevention and medical monitoring). It briefly presents how risk management is to be assessed, and mentions other related risks (biological risk, handling and posture, handling of heavy loads, mental workload, chemical risk)

A robotic device for MRI-guided prostate brachytherapy

NARCIS (Netherlands)

Lagerburg, V.

2008-01-01

One of the treatment options for prostate cancer is brachytherapy with iodine-125 sources. In prostate brachytherapy a high radiation dose is delivered to the prostate with a steep dose fall off to critical surrounding organs. The implantation of the iodine sources is currently performed under

48 CFR 252.217-7009 - Default.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...

High Dose-Rate Versus Low Dose-Rate Brachytherapy for Lip Cancer

Energy Technology Data Exchange (ETDEWEB)

Ghadjar, Pirus, E-mail: pirus.ghadjar@insel.ch [Department of Radiation Oncology, Inselspital, Bern University Hospital, and University of Bern (Switzerland); Bojaxhiu, Beat [Department of Radiation Oncology, Inselspital, Bern University Hospital, and University of Bern (Switzerland); Simcock, Mathew [Swiss Group for Clinical Cancer Research Coordinating Center, Bern (Switzerland); Terribilini, Dario; Isaak, Bernhard [Division of Medical Radiation Physics, Inselspital, Bern University Hospital, and University of Bern, Bern (Switzerland); Gut, Philipp; Wolfensberger, Patrick; Broemme, Jens O.; Geretschlaeger, Andreas; Behrensmeier, Frank; Pica, Alessia; Aebersold, Daniel M. [Department of Radiation Oncology, Inselspital, Bern University Hospital, and University of Bern (Switzerland)

2012-07-15

Purpose: To analyze the outcome after low-dose-rate (LDR) or high-dose-rate (HDR) brachytherapy for lip cancer. Methods and Materials: One hundred and three patients with newly diagnosed squamous cell carcinoma of the lip were treated between March 1985 and June 2009 either by HDR (n = 33) or LDR brachytherapy (n = 70). Sixty-eight patients received brachytherapy alone, and 35 received tumor excision followed by brachytherapy because of positive resection margins. Acute and late toxicity was assessed according to the Common Terminology Criteria for Adverse Events 3.0. Results: Median follow-up was 3.1 years (range, 0.3-23 years). Clinical and pathological variables did not differ significantly between groups. At 5 years, local recurrence-free survival, regional recurrence-free survival, and overall survival rates were 93%, 90%, and 77%. There was no significant difference for these endpoints when HDR was compared with LDR brachytherapy. Forty-two of 103 patients (41%) experienced acute Grade 2 and 57 of 103 patients (55%) experienced acute Grade 3 toxicity. Late Grade 1 toxicity was experienced by 34 of 103 patients (33%), and 5 of 103 patients (5%) experienced late Grade 2 toxicity; no Grade 3 late toxicity was observed. Acute and late toxicity rates were not significantly different between HDR and LDR brachytherapy. Conclusions: As treatment for lip cancer, HDR and LDR brachytherapy have comparable locoregional control and acute and late toxicity rates. HDR brachytherapy for lip cancer seems to be an effective treatment with acceptable toxicity.

How to optimize therapeutic ratio in brachytherapy of head and neck squamous cell carcinoma?

International Nuclear Information System (INIS)

Mazeron, J.J.; Simon, J.M.; Hardiman, C.; Gerbaulet, A.

1998-01-01

Considerable experience has been accumulated with low dose rate (LDR) brachytherapy in the treatment of squamous cell carcinoma of the oral cavity and oropharynx, 4 cm or less in diameter. Recent analysis of large clinical series provided data indicating that modalities of LDR brachytherapy should be optimized in treating these tumours for increasing therapeutic ratio. LDR brachytherapy is now challenged by high dose rate (HDR) brachytherapy and pulsed dose rate (PDR) brachytherapy. Preliminary results obtained with the last two modalities are discussed in comparison with those achieved with LDR brachytherapy. (orig.)

Intra coronary brachytherapy

International Nuclear Information System (INIS)

Ghofourian, H.; Ghahremani, A.; Oliaie, A.; Taghizadeh Asl, M.

2002-01-01

Despite the initial promise of vasculopathy intervention restenosis- a consequence of the (normal) would healing process-has emerged as a major problem. Angiographic restenosis has been reported in 40-60% of patients after successful P TCA. The basic mechanism of restenosis, (acute recoil, negative remodeling and neo intimal hyperplasia), are only partially counteracted by endovascular prosthetic devices (s tents). The rate of in-s tent restenosis, which is primarily caused by neo intimal hyperplasia due to the (micro) trauma of the arterial wall by the s tent struts, has been reduced to 18-32%. Ionizing (beta or gamma) radiations has been established as a potent treatment for malignant disorders. In recent years, there has also been increasing interest among clinicians in the management of benign lesions with radiation. Over the past several years, there has been a growing body of evidence that endovascular brachytherapy has a major impact on the biology of the restenosis. It must be underlined that understanding the biology and pathophysiology of restenosis and assessing various treatment options should preferably be a team effort, with the three g races b eing interventional cardiologist, nuclear oncologist, and industrial partners. The vast amount of data in over 20000 patients from a wide range of randomized controlled trials, has shown that brachytherapy is the only effective treatment for in-s tent restenosis. We are learning more and more about how to improve brachytherapy. While the new coated s tents that we heard about today is fascinating and extremely promising, brachytherapy still has a very important place in difficult patients, such as those with total occlusions, osti al lesions, left main lesions, multivessel disease and diabetes. Regarding to above mentioned tips, we (a research team work, in the Nuclear Research Center Of the Atomic Energy Organization Of Iran), focused on synthesis and preparation of radioactive materials for use in I c-B T. We

40 CFR 265.252 - Waste analysis.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...

Absolute number density and kinetic analysis of CF, CF{sub 2} and C{sub 2}F{sub 4} molecules in pulsed CF{sub 4}/H{sub 2} rf plasmas

Energy Technology Data Exchange (ETDEWEB)

Stepanov, Sergey

2010-04-26

Tunable Diode Laser Absorption Spectroscopy in the mid InfraRed spectral range (IR-TDLAS) has been applied to investigate the behaviour of CF, CF{sub 2} and C{sub 2}F{sub 4} species produced in pulsed CF{sub 4}/H{sub 2} capacitively coupled radio frequency plasmas (13.56 MHz CCP). This experimental technique was shown to be suitable for temporally resolved measurements of the absolute number density of the target molecules in the studied fluorocarbon discharges. The temporal resolution of about 20..40 ms typically achieved in the standard data acquisition mode (''stream mode'') was sufficient for the real-time measurements of CF{sub 2} and C{sub 2}F{sub 4}, but not of CF whose kinetics was observed to be much faster. Therefore, a more sophisticated approach (''burst mode'') providing a temporal resolution of 0.94 ms was established and successfully applied to CF density measurements. In order to enable the TDLAS measurements of the target species, preliminary investigations on their spectroscopic data had been carried out. In particular, pure C{sub 2}F{sub 4} has been produced in laboratory by means of vacuum thermal decomposition (pyrolysis) of polytetrafluoroethylene and used as a reference gas. Therefore, an absorption structure consisting of several overlapping C{sub 2}F{sub 4} lines around 1337.11 cm{sup -1} was selected and carefully calibrated, which provided the first absolute measurements of the species by means of the applied experimental technique. The absolute number density traces measured for CF, CF{sub 2} and C{sub 2}F{sub 4} in the studied pulsed plasmas were then analysed, in which two differential balance equations were proposed for each of the species to describe their behaviour during both ''plasma on'' and ''plasma off'' phases. Analytical solutions of the balance equations were used to fit the experimental data and hence to deduce important information on the

Absolute number density and kinetic analysis of CF, CF{sub 2} and C{sub 2}F{sub 4} molecules in pulsed CF{sub 4}/H{sub 2} rf plasmas

Energy Technology Data Exchange (ETDEWEB)

Stepanov, Sergey

2010-04-26

Tunable Diode Laser Absorption Spectroscopy in the mid InfraRed spectral range (IR-TDLAS) has been applied to investigate the behaviour of CF, CF{sub 2} and C{sub 2}F{sub 4} species produced in pulsed CF{sub 4}/H{sub 2} capacitively coupled radio frequency plasmas (13.56 MHz CCP). This experimental technique was shown to be suitable for temporally resolved measurements of the absolute number density of the target molecules in the studied fluorocarbon discharges. The temporal resolution of about 20..40 ms typically achieved in the standard data acquisition mode (''stream mode'') was sufficient for the real-time measurements of CF{sub 2} and C{sub 2}F{sub 4}, but not of CF whose kinetics was observed to be much faster. Therefore, a more sophisticated approach (''burst mode'') providing a temporal resolution of 0.94 ms was established and successfully applied to CF density measurements. In order to enable the TDLAS measurements of the target species, preliminary investigations on their spectroscopic data had been carried out. In particular, pure C{sub 2}F{sub 4} has been produced in laboratory by means of vacuum thermal decomposition (pyrolysis) of polytetrafluoroethylene and used as a reference gas. Therefore, an absorption structure consisting of several overlapping C{sub 2}F{sub 4} lines around 1337.11 cm{sup -1} was selected and carefully calibrated, which provided the first absolute measurements of the species by means of the applied experimental technique. The absolute number density traces measured for CF, CF{sub 2} and C{sub 2}F{sub 4} in the studied pulsed plasmas were then analysed, in which two differential balance equations were proposed for each of the species to describe their behaviour during both ''plasma on'' and ''plasma off'' phases. Analytical solutions of the balance equations were used to fit the experimental data and hence to deduce important information on the kinetics of the studied molecules. In particular, during the ''plasma off'' phase

Multiplicity and correlated energy of gamma rays emitted in the spontaneous fission of Californium-252

International Nuclear Information System (INIS)

Brunson, G.S. Jr.

1982-06-01

An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented

Endobronchial brachytherapy: the Saint-Louis Hospital experience

International Nuclear Information System (INIS)

Hennequin, C.; Durdux, C.; Housset, M.; Maylin, C.; Tredaniel, J.; Zalcman, G.; Hirsch, A.; Dray, M.; Manoux, D.; Perret, M.

1997-01-01

During the evolution of lung cancer, bronchial obstruction is often noticed and is sometimes responsible for serious symptoms. Several methods of des-obstruction can be proposed, including brachytherapy. Materials and methods: One hundred forty-nine patients, presenting with endobronchial brachytherapy were included into the study. Seventy-three were treated with curative intent, 47 with palliative intent and 29 with a combination of external irradiation and brachytherapy. We usually delivered a series of two 7-Gy fractions (1 cm from the catheter), the treatment being repeated one, two or three times. Results: When all symptoms were taken into account, respiratory function improvement was present in 79% of the patients. Among the 132 tumors that could be evaluated via a new endoscopy 2 months after treatment, 64 (48.5%) were in complete histological remission. The median survival was 14.4 months for the patients treated with curative intent. Eleven massive hemoptyses and 13 radiation bronchitides were observed. Conclusion: These results confirm the feasibility and good results related to endobronchial brachytherapy, though controlled studies are needed to better define its place in the therapeutic strategy of bronchial carcinomas. (authors)

48 CFR 252.236-7000 - Modification proposals-price breakdown.

Science.gov (United States)

2010-10-01

...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...

Demonstration of brachytherapy boost dose-response relationships in glioblastoma multiforme

International Nuclear Information System (INIS)

Sneed, Penny K.; Lamborn, Kathleen R.; Larson, David A.; Prados, Michael D.; Malec, Mary K.; McDermott, Michael W.; Weaver, Keith A.; Phillips, Theodore L.; Wara, William M.; Gutin, Philip H.

1996-01-01

Purpose: To evaluate brachytherapy dose-response relationships in adults with glioblastoma undergoing temporary 125 I implant boost after external beam radiotherapy. Methods and Materials: Since June 1987, orthogonal radiographs using a fiducial marker box have been used to verify brain implant source positions and generate dose-volume histograms at the University of California, San Francisco. For adults who underwent brachytherapy boost for glioblastoma from June 1987 through December 1992, tumor volumes were reoutlined to ensure consistency and dose-volume histograms were recalculated. Univariate and multivariate analyses of various patient and treatment parameters were performed evaluating for influence of dose on freedom from local failure (FFLF) and actuarial survival. Results: Of 102 implant boosts, 5 were excluded because computer plans were unavailable. For the remaining 97 patients, analyses with adjustment for known prognostic factors (age, KPS, extent of initial surgical resection) and prognostic factors identified on univariate testing (adjuvant chemotherapy) showed that higher minimum brachytherapy tumor dose was strongly associated with improved FFLF (p = 0.001). A quadratic relationship was found between total biological effective dose and survival, with a trend toward optimal survival probability at 47 Gy minimum brachytherapy tumor dose (corresponding to about 65 Gy to 95% of the tumor volume); survival decreased with lower or higher doses. Two patients expired and one requires hospice care because of brain necrosis after brachytherapy doses > 63 Gy to 95% of the tumor volume with 60 Gy to > 18 cm 3 of normal brain. Conclusion: Although higher minimum brachytherapy tumor dose was strongly associated with better local control, a brachytherapy boost dose > 50-60 Gy may result in life-threatening necrosis. We recommend careful conformation of the prescription isodose line to the contrast enhancing tumor volume, delivery of a minimum brachytherapy

Automated intraoperative calibration for prostate cancer brachytherapy

International Nuclear Information System (INIS)

Kuiran Chen, Thomas; Heffter, Tamas; Lasso, Andras; Pinter, Csaba; Abolmaesumi, Purang; Burdette, E. Clif; Fichtinger, Gabor

2011-01-01

Purpose: Prostate cancer brachytherapy relies on an accurate spatial registration between the implant needles and the TRUS image, called ''calibration''. The authors propose a new device and a fast, automatic method to calibrate the brachytherapy system in the operating room, with instant error feedback. Methods: A device was CAD-designed and precision-engineered, which mechanically couples a calibration phantom with an exact replica of the standard brachytherapy template. From real-time TRUS images acquired from the calibration device and processed by the calibration system, the coordinate transformation between the brachytherapy template and the TRUS images was computed automatically. The system instantly generated a report of the target reconstruction accuracy based on the current calibration outcome. Results: Four types of validation tests were conducted. First, 50 independent, real-time calibration trials yielded an average of 0.57 ± 0.13 mm line reconstruction error (LRE) relative to ground truth. Second, the averaged LRE was 0.37 ± 0.25 mm relative to ground truth in tests with six different commercial TRUS scanners operating at similar imaging settings. Furthermore, testing with five different commercial stepper systems yielded an average of 0.29 ± 0.16 mm LRE relative to ground truth. Finally, the system achieved an average of 0.56 ± 0.27 mm target registration error (TRE) relative to ground truth in needle insertion tests through the template in a water tank. Conclusions: The proposed automatic, intraoperative calibration system for prostate cancer brachytherapy has achieved high accuracy, precision, and robustness.

Brachytherapy in vulvar cancer: analysis of 18 patients

International Nuclear Information System (INIS)

Frezza, G.; Baldissera, A.; Bernardi, L.; Bunkheila, F.; Galuppi, A.; Salvi, F.

1996-01-01

INTRODUCTION: Vulvar cancer is a rather common neoplasm in elderly patients. Surgery, followed eventually by postoperative radiotherapy, is the treatment of choice. The results of exclusive radiotherapy (external beam irradiation and/or brachytherapy) are not well defined and in the recent literature only small series are reported. Radiotherapy however is the only therapeutic option in patients who are not fit for radical surgery. It is thus necessary to review its indications and its modalities. PATIENTS METHODS AND RESULTS: From 1990 to 1994 18 pts with a diagnosis of squamous cell carcinoma of the vulva have been submitted to brachytherapy. Age ranged from 60 to 92 years (mean age 76, 1 ys). 14 pts were treated at diagnosis (11 pts) or for recurrent disease after surgery (3 pts). In 8 of them brachytherapy (total dose 35-45 Gy, dose rate: 0,4-0,78 Gy/h) was preceded by external beam irradiation (Co60 or electron beam, 40-50 Gy to primary and inguinal nodes); 6 pts were treated with brachytherapy alone (58-60 Gy; dose rate 0,44-0,63 Gy/h). 4 pts underwent to brachytherapy alone for local recurrence after surgery and postoperative radiotherapy (total dose 45-60 Gy; dose rate 0,37-0,49 Gy/h). Brachytherapy was always performed with 192 Ir. Plastic tubes (2 to 5 lines) were used for single plane implantation of small exophytic lesions limited to the labia (8 cases); a perineal template (10 cases) was employed in lesions extended to the vaginal mucosa or involving the clitoris or the area of the perineum. (10(14)) pts treated at diagnosis are alive and free from local recurrence after 11-48 mos. 3 of them, treated with brachytherapy alone, have presented a nodal recurrence in the groin after 14, 15 and 27 mos. respectively. All of them are alive and free from disease after surgery and external radiotherapy. None of the pts treated for recurrent disease after surgery + external beam radiotherapy has achieved a local control. CONCLUSION: Brachytherapy alone or

A data model of the Climate and Forecast metadata conventions (CF-1.6 with a software implementation (cf-python v2.1

Directory of Open Access Journals (Sweden)

D. Hassell

2017-12-01

Full Text Available The CF (Climate and Forecast metadata conventions are designed to promote the creation, processing, and sharing of climate and forecasting data using Network Common Data Form (netCDF files and libraries. The CF conventions provide a description of the physical meaning of data and of their spatial and temporal properties, but they depend on the netCDF file encoding which can currently only be fully understood and interpreted by someone familiar with the rules and relationships specified in the conventions documentation. To aid in development of CF-compliant software and to capture with a minimal set of elements all of the information contained in the CF conventions, we propose a formal data model for CF which is independent of netCDF and describes all possible CF-compliant data. Because such data will often be analysed and visualised using software based on other data models, we compare our CF data model with the ISO 19123 coverage model, the Open Geospatial Consortium CF netCDF standard, and the Unidata Common Data Model. To demonstrate that this CF data model can in fact be implemented, we present cf-python, a Python software library that conforms to the model and can manipulate any CF-compliant dataset.

48 CFR 252.217-7002 - Offering property for exchange.

Science.gov (United States)

2010-10-01

... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...

BRIT manual after loading brachytherapy kit for intracavitary: initial experience

International Nuclear Information System (INIS)

Aggarwal, Lalit M.; Mandal, Abhijit; Asthana, Anupam K.; Shahi, Uday P.; Pradhan, Satyajit

2007-01-01

Brachytherapy continues to serve as an important and rapidly evolving tool in the management of cancer. Technological developments in the last two decades have dramatic impact on the safe practice of brachytherapy. A wide range of brachytherapy sources and equipment are available for new therapeutic possibilities. However, decision making with regard to new brachytherapy facilities are need based and depend on the patient load, socioeconomic status of the patients, and funds available with the institution. Remote afterloading equipments are fast replacing the Manual After Loading (MAL) systems. However, keeping in view the large number of patients, who can not afford expensive treatment, the utility of manual after loading system which is inexpensive, cannot be ignored

Trends in the Utilization of Brachytherapy in Cervical Cancer in the United States

Energy Technology Data Exchange (ETDEWEB)

Han, Kathy, E-mail: Kathy.Han@rmp.uhn.on.ca [Radiation Medicine Program, Princess Margaret Hospital, University Health Network, Toronto, Ontario (Canada); Milosevic, Michael; Fyles, Anthony [Radiation Medicine Program, Princess Margaret Hospital, University Health Network, Toronto, Ontario (Canada); Pintilie, Melania [Department of Biostatistics, Princess Margaret Hospital, Toronto, Ontario (Canada); Viswanathan, Akila N. [Department of Radiation Oncology, Dana-Farber Cancer Institute/Brigham and Women' s Hospital, Boston, Massachusetts (United States)

2013-09-01

Purpose: To determine the trends in brachytherapy use in cervical cancer in the United States and to identify factors and survival benefits associated with brachytherapy treatment. Methods and Materials: Using the Surveillance, Epidemiology, and End Results (SEER) database, we identified 7359 patients with stages IB2-IVA cervical cancer treated with external beam radiation therapy (EBRT) between 1988 and 2009. Propensity score matching was used to adjust for differences between patients who received brachytherapy and those who did not from 2000 onward (after the National Cancer Institute alert recommending concurrent chemotherapy). Results: Sixty-three percent of the 7359 women received brachytherapy in combination with EBRT, and 37% received EBRT alone. The brachytherapy utilization rate has decreased from 83% in 1988 to 58% in 2009 (P<.001), with a sharp decline of 23% in 2003 to 43%. Factors associated with higher odds of brachytherapy use include younger age, married (vs single) patients, earlier years of diagnosis, earlier stage and certain SEER regions. In the propensity score-matched cohort, brachytherapy treatment was associated with higher 4-year cause-specific survival (CSS; 64.3% vs 51.5%, P<.001) and overall survival (OS; 58.2% vs 46.2%, P<.001). Brachytherapy treatment was independently associated with better CSS (hazard ratio [HR], 0.64; 95% confidence interval [CI], 0.57-0.71), and OS (HR 0.66; 95% CI, 0.60 to 0.74). Conclusions: This population-based analysis reveals a concerning decline in brachytherapy utilization and significant geographic disparities in the delivery of brachytherapy in the United States. Brachytherapy use is independently associated with significantly higher CSS and OS and should be implemented in all feasible cases.

Construction balance analysis of dose rate medium brachytherapy TDS

International Nuclear Information System (INIS)

Sandi Parapak

2011-01-01

One of the most important part of brachytherapy instrument design activities is analyze by determining the centroid point of construction in order to maintain the balance of brachytherapy instrument, either during operation as well as when transported. Operation of brachytherapy is not only done in one place so it is necessary to balance the analysis of the forces at the time did not move, moved on the horizontal floor and sloping floor. Calculation approach who is done to calculate the weight of mechanical components on each module, and then calculate the centroid of each module, for the balance of forces analysis performed with the assumption at the time of brachytherapy in the position of not moving on a horizontal floor, moved from a place to another on the horizontal floor and on the floor with sloping angle 30°. Base on the results of this analysis are expected to balance the four wheels can move without slipping at the time of decline or incline. Also, results of analysis can be used in designing a mobile construction brachytherapy taking into consideration the aesthetic ideal, easy to operate, ensure the safety of equipment, operator and patient. (author)

Electronic brachytherapy management of atypical fibroxanthoma: report of 8 lesions

Directory of Open Access Journals (Sweden)

Stephen Doggett

2017-01-01

Full Text Available Purpose : To evaluate the suitability of treating atypical fibroxanthoma (AFX, an uncommon skin malignancy, with electronic brachytherapy. Material and methods : From Feb 2013 to Sep 2014, we were referred a total of 8 cases of AFX in 7 patients, all involving the scalp. All of them were treated with electronic brachytherapy 50 Kev radiations (Xoft Axxent®, Fremont, California. All lesions received 40 Gy in two fractions per week with 5mm margins. Results : At a median follow-up of 23.7 months, the local recurrence rate is 12.5%. The single lesion that failed was not debulked surgically prior to electronic brachytherapy. Conclusions : To our knowledge, this is the first report in the literature on the use of radiation therapy as curative primary treatment for AFX. No contraindication to the use of radiations is found in the literature, with surgery being the sole treatment for AFX noted. Our recurrence rate is 0% for debulked lesions. Risk of recurrence is mitigated with surgical debulking prior to brachytherapy. Electronic brachytherapy appears to be a safe and effective treatment for debulked AFX. Multiple excisions, skin grafting, and wound care can be avoided in elderly patients by the use of electronic brachytherapy.

High Dose-Rate Versus Low Dose-Rate Brachytherapy for Lip Cancer

International Nuclear Information System (INIS)

Ghadjar, Pirus; Bojaxhiu, Beat; Simcock, Mathew; Terribilini, Dario; Isaak, Bernhard; Gut, Philipp; Wolfensberger, Patrick; Brömme, Jens O.; Geretschläger, Andreas; Behrensmeier, Frank; Pica, Alessia; Aebersold, Daniel M.

2012-01-01

Purpose: To analyze the outcome after low-dose-rate (LDR) or high-dose-rate (HDR) brachytherapy for lip cancer. Methods and Materials: One hundred and three patients with newly diagnosed squamous cell carcinoma of the lip were treated between March 1985 and June 2009 either by HDR (n = 33) or LDR brachytherapy (n = 70). Sixty-eight patients received brachytherapy alone, and 35 received tumor excision followed by brachytherapy because of positive resection margins. Acute and late toxicity was assessed according to the Common Terminology Criteria for Adverse Events 3.0. Results: Median follow-up was 3.1 years (range, 0.3–23 years). Clinical and pathological variables did not differ significantly between groups. At 5 years, local recurrence-free survival, regional recurrence-free survival, and overall survival rates were 93%, 90%, and 77%. There was no significant difference for these endpoints when HDR was compared with LDR brachytherapy. Forty-two of 103 patients (41%) experienced acute Grade 2 and 57 of 103 patients (55%) experienced acute Grade 3 toxicity. Late Grade 1 toxicity was experienced by 34 of 103 patients (33%), and 5 of 103 patients (5%) experienced late Grade 2 toxicity; no Grade 3 late toxicity was observed. Acute and late toxicity rates were not significantly different between HDR and LDR brachytherapy. Conclusions: As treatment for lip cancer, HDR and LDR brachytherapy have comparable locoregional control and acute and late toxicity rates. HDR brachytherapy for lip cancer seems to be an effective treatment with acceptable toxicity.

Calculated and measured brachytherapy dosimetry parameters in water for the Xoft Axxent X-Ray Source: An electronic brachytherapy source

International Nuclear Information System (INIS)

Rivard, Mark J.; Davis, Stephen D.; DeWerd, Larry A.; Rusch, Thomas W.; Axelrod, Steve

2006-01-01

A new x-ray source, the model S700 Axxent trade mark sign X-Ray Source (Source), has been developed by Xoft Inc. for electronic brachytherapy. Unlike brachytherapy sources containing radionuclides, this Source may be turned on and off at will and may be operated at variable currents and voltages to change the dose rate and penetration properties. The in-water dosimetry parameters for this electronic brachytherapy source have been determined from measurements and calculations at 40, 45, and 50 kV settings. Monte Carlo simulations of radiation transport utilized the MCNP5 code and the EPDL97-based mcplib04 cross-section library. Inter-tube consistency was assessed for 20 different Sources, measured with a PTW 34013 ionization chamber. As the Source is intended to be used for a maximum of ten treatment fractions, tube stability was also assessed. Photon spectra were measured using a high-purity germanium (HPGe) detector, and calculated using MCNP. Parameters used in the two-dimensional (2D) brachytherapy dosimetry formalism were determined. While the Source was characterized as a point due to the small anode size, P (5) were 0.20, 0.24, and 0.29 for the 40, 45, and 50 kV voltage settings, respectively. For 1 125 I and 103 Pd, yet with capability for variable and much higher dose rates and subsequently adjustable penetration capabilities. This paper presents the calculated and measured in-water brachytherapy dosimetry parameters for the model S700 Source at the aforementioned three operating voltages

Reconstitution of CF1-depleted thylakoid membranes with complete and fragmented chloroplast ATPase. The role of the delta subunit for proton conduction through CF0

NARCIS (Netherlands)

Engelbrecht, Siegfried; Lill, H; Junge, Wolfgang

1986-01-01

Chloroplast ATPase (CF1) was isolated from spinach, pea and maize thylakoids by EDTA extraction followed by anion-exchange chromatography. CF1 was purified and resolved by HPLC into integral CF1, and CF1 lacking the delta & epsilon subunits: CF1(-delta) and CF1(-epsilon). Washing Mono-Q-bound CF1

American Brachytherapy Society consensus report for accelerated partial breast irradiation using interstitial multicatheter brachytherapy.

Science.gov (United States)

Hepel, Jaroslaw T; Arthur, Douglas; Shaitelman, Simona; Polgár, Csaba; Todor, Dorin; Zoberi, Imran; Kamrava, Mitchell; Major, Tibor; Yashar, Catheryn; Wazer, David E

To develop a consensus report for the quality practice of accelerated partial breast irradiation (APBI) using interstitial multicatheter brachytherapy (IMB). The American Brachytherapy Society Board appointed an expert panel with clinical and research experience with breast brachytherapy to provide guidance for the current practice of IMB. This report is based on a comprehensive literature review with emphasis on randomized data and expertise of the panel. Randomized trials have demonstrated equivalent efficacy of APBI using IMB compared with whole breast irradiation for select patients with early-stage breast cancer. Several techniques for placement of interstitial catheters are described, and importance of three-dimensional planning with appropriate optimization is reviewed. Optimal target definition is outlined. Commonly used dosing schemas include 50 Gy delivered in pulses of 0.6-0.8 Gy/h using pulsed-dose-rate technique and 34 Gy in 10 fractions, 32 Gy in eight fractions, or 30 Gy in seven fractions using high-dose-rate technique. Potential toxicities and strategies for toxicity avoidance are described in detail. Dosimetric constraints include limiting whole breast volume that receives ≥50% of prescription dose to 0.75 (>0.85 preferred), V 150  < 45 cc, and V 200  < 14 cc. Using an optimal implant technique coupled with optimal planning and appropriate dose constraints, a low rate of toxicity and a good-to-excellent cosmetic outcome of ≥90% is expected. IMB is an effective technique to deliver APBI for appropriately selected women with early-stage breast cancer. This consensus report has been created to assist clinicians in the appropriate practice of APBI using IMB. Copyright © 2017 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

Urethral toxicity after LDR brachytherapy: experience in Japan.

Science.gov (United States)

Tanaka, Nobumichi; Asakawa, Isao; Hasegawa, Masatoshi; Fujimoto, Kiyohide

2015-01-01

Urinary toxicity is common after low-dose-rate (LDR) brachytherapy, and the resolution of urinary toxicity is a concern. In particular, urinary frequency is the most common adverse event among the urinary toxicities. We have previously reported that approximately 70% of patients experience urinary frequency during the first 6 months after seed implantation. Most urinary adverse events were classified as Grade 1, and Grade 2 or higher adverse events were rare. The incidence of urinary retention was approximately 2-4%. A high International Prostate Symptom Score before seed implantation was an independent predictor of acute urinary toxicity of Grade 2 or higher. Several previous reports from the United States also supported this trend. In Japan, LDR brachytherapy was legally approved in 2003. A nationwide prospective cohort study entitled Japanese Prostate Cancer Outcome Study of Permanent Iodine-125 Seed Implantation was initiated in July 2005. It is an important issue to limit urinary toxicities in patients who undergo LDR brachytherapy. Copyright © 2015 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

[Developments in brachytherapy].

Science.gov (United States)

Ikeda, H

1995-09-01

Brachytherapy is one of the ideal methods of radiotherapy because of the concentration of a high dose on the target. Recent developments, including induction of afterloading method, utilization of small-sized high-activity sources such as Iridium-192, and induction of high technology and computerization, have made for shortening of irradiation time and source handling, which has led to easier management of the patient during treatment. Dose distribution at high dose rate (HDR) is at least as good as that of low dose rate (LDR), and selection of fractionation and treatment time assures even greater biological effects on hypoxic tumor cells than LDR. Experience with HDR brachytherapy in uterine cervix cancer using Cobalt-60 during the past 20 years in this country has gradually been evaluated in U.S. and Europe. The indications for HDR treatment have extended to esophagus, bronchus, bile duct, brain, intraoperative placement of source guide, and perineal region using templates, as well as the conventional use for uterus, tongue and so on.

Indication of brachytherapy of prostate with permanent implants

International Nuclear Information System (INIS)

Chauveinc, L.; Solignac, S.; Rosenwald, J.C.; Firmin, F.; Cosset, J.M.; Flam, T.; Thiounn, N.

2002-01-01

In the last decade, brachytherapy emerged as a particularly appealing new way of treating localized prostate cancer. Recently published 10-12 years biochemical control results appear to be superimposable to the best percentages achieved by surgery or conformal radiotherapy, with a small percentage of complications. This applied to severely patients. Only patients with T1/T2, PSA 60 g, hip mobility limitations, a urinary obstructive syndrome and previous trans-urethral resection lead to difficulties in technical implantation and therefore must be taken into account when discussing brachytherapy. In conclusion, for adequately selected patients, brachytherapy offers a particularly applied alternative to surgery and external radiotherapy, with satisfactory long term biochemical control rates and limited complications. (author)

Low dose rate Ir-192 interstitial brachytherapy for prostate cancer

Energy Technology Data Exchange (ETDEWEB)

Oki, Yosuke; Dokiya, Takushi; Yorozu, Atsunori; Suzuki, Takayuki; Saito, Shiro; Monma, Tetsuo; Ohki, Takahiro [National Tokyo Medical Center (Japan); Murai, Masaru; Kubo, Atsushi

2000-04-01

From December 1997 through January 1999, fifteen prostatic cancer patients were treated with low dose rate Ir-192 interstitial brachytherapy using TRUS and perineal template guidance without external radiotherapy. Up to now, as no apparent side effects were found, the safety of this treatment is suggested. In the future, in order to treat prostatic cancer patients with interstitial brachytherapy using I-125 or Pd-103, more investigation for this low dose rate Ir-192 interstitial brachytherapy is needed. (author)

Experimental study of APE1 RNA interference enhancing the sensitivity of neutron radiation in osteosarcoma

International Nuclear Information System (INIS)

Wang Dong; Qing Yi; Zhong Zhaoyang; Li Zengpeng; Zhang Xinhong; Yang Yuxin

2007-01-01

Objective: To knock down APE1 gene expression in HOS cells, and explore its antitumor effects in combination with 252 Cf neutron radiotherapy. Methods: pSilence APE1 siBNA plasmid was transfected into HOS cells by SuperFect Transfection liposome. The transfected HOS cells were irradiated by 252 Cf neutron, then MTY assay, clone formation assay and alkaline comet assay were used to detect the radiobiological reaction, and cell apoptosis was detected with flow cytometry. Results: The D 37 value was 3.02 vs. 2.42 in the control and transfected HOS cells respectively after irradiation with 252 Cf neutron, the DMF value is 1.43. The tail moments and cell apoptosis rate at 200, 500 and 1000 cGy showed significant difference between the two groups (P 252 Cf neutron radiotherapy may be a promising approach to therapy of human osteosarcoma in the future. (authors)

Severe rectal complications after prostate brachytherapy

International Nuclear Information System (INIS)

Wallner, Kent; Sutlief, Stephen; Bergsagel, Carl; Merrick, Gregory S.

2015-01-01

Purpose: Some investigators have reported severe rectal complications after brachytherapy. Due to the low number of such events, their relationship to dosimetric parameters has not been well characterized. Methods and materials: A total of 3126 patients were treated with low dose rate brachytherapy from 1998 through 2010. 2464 had implant alone, and 313 had implant preceded by 44–46 Gy supplemental external beam radiation (EBRT). Post-implant dosimetry was based on a CT scan obtained on the day of implant, generally within 30 min of the procedure. Every patient’s record was reviewed for occurrence of rectal complications. Results: Eight of 2464 patients (0.32%) treated with brachytherapy alone developed a radiation-related rectal fistula. Average prostatic and rectal dose parameters were moderately higher for fistula patients than for patients without a severe rectal complication. For instance, the average R100 was 1.2 ± 0.75 cc for fistula patients, versus 0.37 ± 0.88 cc for non-fistula patients. However, the fistula patients’ values were well within the range of values for patients without a rectal complication. Four patients had some attempt at repair or reconstruction, but long-term functional outcomes were not favorable. Conclusions: Rectal fistulas are a very uncommon potential complication of prostate brachytherapy, which can occur even in the setting of acceptable day 0 rectal doses. Their occurrence is not easily explained by standard dosimetric or clinical factors

A study on applying Ra needle interstitial brachytherapy for oral cancer

International Nuclear Information System (INIS)

Yoshida, Shunichi; Komiya, Yoshiaki; Uchida, Ikuhiro; Tashiro, Kazuyoshi

1999-01-01

To investigate applicability of Ra needle interstitial brachytherapy, 93 cases of oral squamous carcinoma were examined. The patients underwent Ra needle interstitial brachytherapy as thorough therapy in our hospital. The criteria of applying Ra needle interstitial brachytherapy was diameter of within 5 cm and depth within 2 cm of tumor size. Ra needle interstitial brachytherapy was applied to 82 cases of tongue, 10 cases of oral floor and one case of lower lip carcinomas. The local control rate was 92.5%, and secondary neck metastasis was 32.3% in all cases applied Ra needle interstitial brachytherapy. The results were not bad compared with surgical treatment. However, the 5-year cumulative survival rate was 64.9%, which was not good enough at the result to obtain a good local control rate and secondary neck metastasis rate. The result was relative to low treatment result of local recurrence cases with Ra needle interstitial brachytherapy. To improve the result, it is important to distinguish local recurrence from radioinduced ulcer, and to start early secondary treatment. The cases in which cervical lymph node metastasis was found as the first examination underwent neck dessection after Ra needle interstitial brachytherapy. The 5-year cumulative survival rate was 83.3% in N1 cases and 40.6% in N2 cases, and the result of N2 cases was poorer than N1 cases with a significant difference. The results indicate that a needle having a diameter of within 5 cm, depth of within 2 cm and less than N1 can be applied during Ra needle interstitial brachytherapy for complete cure of cancer. (author)

A survey of current clinical practice in permanent and temporary prostate brachytherapy: 2010 update.

Science.gov (United States)

Buyyounouski, Mark K; Davis, Brian J; Prestidge, Bradley R; Shanahan, Thomas G; Stock, Richard G; Grimm, Peter D; Demanes, D Jeffrey; Zaider, Marco; Horwitz, Eric M

2012-01-01

To help establish patterns of care and standards of care of interstitial permanent low-dose-rate (LDR) and temporary high-dose-rate brachytherapy for prostate cancer and to compare the results with a similar 1998 American Brachytherapy Society (ABS) survey. A comprehensive questionnaire intended to survey specific details of current clinical brachytherapy practice was provided to the participants of the seventh ABS Prostate Brachytherapy School. Responses were tabulated and descriptive statistics are reported. Sixty-five brachytherapy practitioners responded to the survey. Eighty-nine percent (89%) of respondents performed LDR and 49% perform high-dose-rate brachytherapy. The median number of years of experience for LDR brachytherapists increased from 5 to 10 years over the course of the 12 years since the preceding survey. Compared with the first ABS, a smaller proportion of respondents received formal brachytherapy residency training (43% vs. 56%) or formal "hands-on" brachytherapy training (15% vs. 63%). There has been a marked decline in the utilization of the Mick applicator (Mick Radio-Nuclear Instruments, Inc., Mount Vernon, NY, USA) (60% vs. 28%) and an increase in the use of stranded seeds (40% vs. 11%). Compliance with postimplant dosimetry was higher in the 2010 survey. This survey does suggest an evolution in the practice of LDR brachytherapy since 1998 and aids in identifying aspects that require further progress or investigation. ABS guidelines and other practice recommendations appear to impact the practice of brachytherapy. Copyright © 2012 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

Efficacy of prophylactic single-dose therapy using fluoroquinolone for prostate brachytherapy

International Nuclear Information System (INIS)

Nomura, Takeo; Hirai, Kenichi; Yamasaki, Mutsushi; Inoue, Toru; Takahashi, Mika; Kawashima, Takayuki; Sato, Fuminori; Mimata, Hiromitsu

2012-01-01

There is little definitive evidence to guide the use of prophylactic antibiotics for prostate brachytherapy. The purpose of this study is to evaluate the incidence of postimplant infections in patients who receive antimicrobial prophylaxis with pazufloxacin (PZFX). A total of 84 patients who underwent prostate brachytherapy received a single intravenous dose of PZFX at 500 mg perioperatively for 1 day. No postimplant antibiotic medication was prescribed. Urinalysis, plasma white blood cell (WBC) count, and C reactive protein (CRP) levels were evaluated before the implantation, on the day after implantation, and on the 7th and 28th days after brachytherapy. None of the 84 patients (0.0%) developed a symptomatic urinary tract infection or had febrile infectious complications after brachytherapy. There were statistically significant elevations in the levels of erythrocytes, leukocytes, bacteria in urine, plasma WBC and CRP postoperatively, but these values did not exceed the normal range or were only slightly elevated on the day after brachytherapy (day 1) and on day 7. All laboratory examinations had returned to the normal range on day 28. Single-dose therapy with fluoroquinolone helps to prevent infections after prostate brachytherapy. (author)

46 CFR 252.31 - Wages of officers and crews.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...

Studying fission neutrons with 2E-2v and 2E

Directory of Open Access Journals (Sweden)

Al-Adili Ali

2018-01-01

The 2E technique utilizes an ionization chamber together with two liquid scintillator detectors. Two measurements have been performed, one of 252Cf(sf and another one of thermal-neutron induced fission in 235U(n,f. Results from 252Cf(sf are reported here.

Decomposition of Potent Greenhouse Gases SF6, CF4 and SF5CF3 by Dielectric Barrier Discharge

International Nuclear Information System (INIS)

Zhang Renxi; Wang Jingting; Cao Xu; Hou Huiqi

2016-01-01

For their distinguished global warming potential (GWP100) and long atmosphere lifespan, CF 4 , SF 6 and SF 5 CF 3 were significant in the field of greenhouse gas research. The details of discharging character and the optimal parameter were discussed by using a Dielectric Barrier Discharge (DBD) reactor to decompose these potent greenhouse gases in this work. The results showed that SF 6 could be decomposed by 92% under the conditions of 5 min resident time and 3000 V applied voltage with the partial pressure of 2.0 kPa, 28.2 kPa, and 1.8 kPa for SF 6 , air and water vapor, respectively. 0.4 kPa CF 4 could be decomposed by 98.2% for 4 min resident time with 30 kPa Ar added. The decomposition of SF 5 CF 3 was much more effective than that of SF 6 and CF 4 and moreover, 1.3 kPa SF 5 CF 3 , discharged with 30 kPa O 2 , Ar and air, could not be detected when the resident time was 80 s, 40 s, and 120 s, respectively. All the results indicated that DBD was a feasible technique for the abatement of potent greenhouse gases. (paper)

48 CFR 252.237-7011 - Preparation history.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...

48 CFR 252.217-7016 - Plant protection.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...

48 CFR 252.227-7000 - Non-estoppel.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...

Evaluation of rectal bleeding factors associated with prostate brachytherapy

International Nuclear Information System (INIS)

Aoki, Manabu; Miki, Kenta; Sasaki, Hiroshi; Kido, Masato; Shirahama, Jun; Takagi, Sayako; Kobayashi, Masao; Honda, Chikara; Kanehira, Chihiro

2009-01-01

The purpose of this study was to analyze rectal bleeding prognostic factors associated with prostate brachytherapy (PB) or in combination with external-beam radiation therapy (EBRT) and to examine dosimetric indications associated with rectal bleeding. The study included 296 patients followed up for >36 months (median, 48 months). PB was performed alone in 252 patients and in combination with EBRT in 44 patients. PB combined with EBRT is indicated for patients with a Gleason score >6. The prescribed dose was 144 Gy for monotherapy and 110 Gy for PB+EBRT (44-46 Gy). Although 9.1% who received monotherapy had 2.3% grade 2 rectal bleeding, 36.3% who received combined therapy had 15.9% grade 2 rectal bleeding. Combined therapy was associated with higher incidence of rectal bleeding (P=0.0049) and higher percentage of grade 2 bleeding (P=0.0005). Multivariate analysis revealed that R-150 was the only significant factor for rectal bleeding, and modified Radiation Therapy Oncology Group (RTOG) grade in monotherapy and biologically equivalent dose (BED) were significant for combined therapy. Moreover, grade 2 rectal bleeding increased significantly at D90 >130 Gy. Although R-150 was the significant prognostic factor for rectal bleeding and modified RTOG rectal toxicity grade, BED was the significant prognostic factor for modified RTOG rectal toxicity grade. (author)

Encapsulation plant at Forsmark

International Nuclear Information System (INIS)

Nystroem, Anders

2007-08-01

SKB has already carried out a preliminary study of an encapsulation plant detached from Clab (Central interim storage for spent fuels). This stand-alone encapsulation plant was named FRINK and its assumed siting was the above-ground portion of the final repository, irrespective of the repository's location. The report previously presented was produced in cooperation with BNFL Engineering Ltd in Manchester and the fuel reception technical solution was examined by Gesellschaft fuer Nuklear-Service mbH (GNS) in Hannover and by Societe Generale pour les Techniques Nouvelles (SGN) in Paris. This report is an update of the earlier preliminary study report and is based on the assumption that the encapsulation plant and also the final repository will be sited in the Forsmark area. SKB's main alternative for siting the encapsulation plant is next to Clab. Planning of this facility is ongoing and technical solutions from the planning work have been incorporated in this report. An encapsulation plant placed in proximity to any final repository in Forsmark forms part of the alternative presentation in the application for permission to construct and operate an installation at Clab. The main technical difference between the planned encapsulation plant at Clab and an encapsulation plant at a final repository at Forsmark is how the fuel is managed and prepared before actual encapsulation. Fuel reception at the encapsulation plant in Forsmark would be dry, i.e. there would be no water-filled pools at the facility. Clab is used for verificatory fuel measurements, sorting and drying of the fuel before transport to Forsmark. This means that Clab will require a measure of rebuilding and supplementary equipment. In purely technical terms, the prospects for building an encapsulation plant sited at Forsmark are good. A description of the advantages and drawbacks of siting the encapsulation plant at Clab as opposed to any final repository at Forsmark is presented in a separate report

Encapsulation plant at Forsmark

Energy Technology Data Exchange (ETDEWEB)

Nystroem, Anders

2007-08-15

SKB has already carried out a preliminary study of an encapsulation plant detached from Clab (Central interim storage for spent fuels). This stand-alone encapsulation plant was named FRINK and its assumed siting was the above-ground portion of the final repository, irrespective of the repository's location. The report previously presented was produced in cooperation with BNFL Engineering Ltd in Manchester and the fuel reception technical solution was examined by Gesellschaft fuer Nuklear-Service mbH (GNS) in Hannover and by Societe Generale pour les Techniques Nouvelles (SGN) in Paris. This report is an update of the earlier preliminary study report and is based on the assumption that the encapsulation plant and also the final repository will be sited in the Forsmark area. SKB's main alternative for siting the encapsulation plant is next to Clab. Planning of this facility is ongoing and technical solutions from the planning work have been incorporated in this report. An encapsulation plant placed in proximity to any final repository in Forsmark forms part of the alternative presentation in the application for permission to construct and operate an installation at Clab. The main technical difference between the planned encapsulation plant at Clab and an encapsulation plant at a final repository at Forsmark is how the fuel is managed and prepared before actual encapsulation. Fuel reception at the encapsulation plant in Forsmark would be dry, i.e. there would be no water-filled pools at the facility. Clab is used for verificatory fuel measurements, sorting and drying of the fuel before transport to Forsmark. This means that Clab will require a measure of rebuilding and supplementary equipment. In purely technical terms, the prospects for building an encapsulation plant sited at Forsmark are good. A description of the advantages and drawbacks of siting the encapsulation plant at Clab as opposed to any final repository at Forsmark is presented in a separate

High-dose-rate interstitial brachytherapy for the treatment of penile carcinoma

Energy Technology Data Exchange (ETDEWEB)

Petera, J.; Odrazka, K.; Zouhar, M.; Bedrosova, J.; Dolezel, M. [Dept. of Oncology and Radiotherapy, Charles Univ. Medical School and Teaching Hospital, Hradec Kralove (Czech Republic)

2004-02-01

Background: interstitial low-dose-rate (LDR) brachytherapy allows conservative treatment of T1-T2 penile carcinoma. High-dose-rate (HDR) is often considered to be dangerous for interstitial implants because of a higher risk of complications, but numerous reports suggest that results may be comparable to LDR. Nevertheless, there are no data in the literature available regarding HDR interstitial brachytherapy for carcinoma of the penis. Case report: a 64-year-old man with T1 NO MO epidermoid carcinoma of the glans is reported. Interstitial HDR brachytherapy was performed using the stainless hollow needle technique and a breast template for fixation and good geometry. The dose delivered was 18 x 3 Gy twice daily. Results: after 232 days from brachytherapy, the patient was without any evidence of the tumor, experienced no serious radiation-induced complications, and had a fully functional organ. Conclusion: HDR interstitial brachytherapy is feasible in selected case of penis carcinoma, when careful planning and small single fractions are used. (orig.)

Radiological protection of patients in brachytherapy

International Nuclear Information System (INIS)

Sacc, Ricardo; Herrero, Flavia

2008-01-01

Full text: The prefix 'brachy' means short-range, so brachytherapy is the administration of radiation therapy using small radioactive sources in the form of needles, tubes, wires or seeds, which are placed within the tumor -interstitial form- or very near of it, superficially or in an endo-cavity form. This technique, which was limited by the size of the primary tumor, has the advantage, that the radiation, can be adjusted to the size and shape of the tumor volume and the radioisotope used, - short range -, is selected with the criteria of getting the dose in the organs at risk, as low as possible, making what it is known as conformal radiotherapy. Radioactive sources may be permanent or temporary implants. The application of radioactive material, can be manually or automatically. In the first case, a major breakthrough from the radioprotection point of view, was the use of afterloading devices, methodology highly recommended to reduce the radiation exposure to staff. With the development of technology, remotely controlled afterloading devices were introduced, which in addition to complying with the above requirement, allow the source to move in different positions along catheters housed in one or more channels, making therapeutic brachytherapy treatments in tumor volumes possible, that due to its length, decades ago would have been an unthinkable deal. In all cases, sources, which may vary from the 3 mm in length, 125 Iodine or 198 Gold seeds, to extensive wires of 192 Iridium, are encapsulated for two main purposes: preventing leakage of radioactive material and absorption of unwanted radiation, alpha and beta, produced by the radioactive decay. Consequently, it should be highly unlikely that the radioactive material, could be lost or located in the patient, in a different place of the one that was planned. However, history shows us the opposite. Its is known the kind of deterministic effect that radiation is going to produce in the tumor, where the severity of

Temporal relationship between prostate brachytherapy and the diagnosis of colorectal cancer

International Nuclear Information System (INIS)

Gutman, Sarah A.; Merrick, Gregory S.; Butler, Wayne M.; Wallner, Kent E.; Allen, Zachariah A.; Galbreath, Robert W.; Adamovich, Edward

2006-01-01

Purpose: To identify the location of pretreatment and posttreatment colorectal malignancies and posttreatment colorectal polyps in patients with clinically localized prostate cancer managed with brachytherapy. Methods and Materials: From April 1995 through July 2004, 1,351 consecutive patients underwent brachytherapy for clinical stage T1b-T3a (American Joint Committee on Cancer, 2002) prostate cancer. Supplemental external beam radiotherapy (XRT) was administered to 699 patients. The median follow-up was 4.6 years. Operative and pathology reports were reviewed for all patients with pretreatment and posttreatment colorectal cancer and posttreatment colorectal polyps. Multiple parameters were evaluated for the development of colorectal cancer or colorectal polyps. Results: Colorectal cancer was diagnosed in 23 and 25 patients before and after prostate brachytherapy, respectively. No differences were identified in the distribution of colorectal cancers either before or after treatment (3 and 4 rectal cancers in the pre- and postbrachytherapy cohorts). Thirty-five of the 48 colorectal cancers (73%) were diagnosed within 5 years of brachytherapy with a peak incidence 1 year after brachytherapy. One hundred ninety-two colorectal polyps were diagnosed after brachytherapy, 160 (83%) occurred within 4 years of brachytherapy, and only 27 (14%) were located in the rectum. In multivariate Cox regression analysis, prostate D 9 (minimum percentage of the dose covering 90% of the target volume) predicted for posttreatment colorectal cancer. Rectal polyps were most closely related to patient age and percent positive biopsies, whereas sigmoid/colon polyps were best predicted by patient age, planning volume, and supplemental XRT. Conclusions: Colorectal cancer was diagnosed with equal frequency before and after brachytherapy with comparable geographic distributions. In addition, the vast majority of postbrachytherapy colorectal polyps were located beyond the confines of the rectum

LDR vs. HDR brachytherapy for localized prostate cancer: the view from radiobiological models.

Science.gov (United States)

King, Christopher R

2002-01-01

Permanent LDR brachytherapy and temporary HDR brachytherapy are competitive techniques for clinically localized prostate radiotherapy. Although a randomized trial will likely never be conducted comparing these two forms of brachytherapy, a comparative radiobiological modeling analysis proves useful in understanding some of their intrinsic differences, several of which could be exploited to improve outcomes. Radiobiological models based upon the linear quadratic equations are presented for fractionated external beam, fractionated (192)Ir HDR brachytherapy, and (125)I and (103)Pd LDR brachytherapy. These models incorporate the dose heterogeneities present in brachytherapy based upon patient-derived dose volume histograms (DVH) as well as tumor doubling times and repair kinetics. Radiobiological parameters are normalized to correspond to three accepted clinical risk factors based upon T-stage, PSA, and Gleason score to compare models with clinical series. Tumor control probabilities (TCP) for LDR and HDR brachytherapy (as monotherapy or combined with external beam) are compared with clinical bNED survival rates. Predictions are made for dose escalation with HDR brachytherapy regimens. Model predictions for dose escalation with external beam agree with clinical data and validate the models and their underlying assumptions. Both LDR and HDR brachytherapy achieve superior tumor control when compared with external beam at conventional doses (LDR brachytherapy as boost achieves superior tumor control than when used as monotherapy. Stage for stage, both LDR and current HDR regimens achieve similar tumor control rates, in agreement with current clinical data. HDR monotherapy with large-dose fraction sizes might achieve superior tumor control compared with LDR, especially if prostate cancer possesses a high sensitivity to dose fractionation (i.e., if the alpha/beta ratio is low). Radiobiological models support the current clinical evidence for equivalent outcomes in localized

Brachytherapy in childhood rhabdomyosarcoma treatment; Braquiterapia no tratamento do rabdomiossarcoma da infancia

Energy Technology Data Exchange (ETDEWEB)

Novaes, Paulo Eduardo Ribeiro dos Santos

1995-07-01

A retrospective study of 21 children with rhabdomyosarcoma treated by brachytherapy to the primary site of the tumor at the Radiotherapy Department of the A.C.Camargo Hospital between january/1980 to june/1993 was undertaken. The main objectives were to comprove the utility of brachytherapy in childhood rhabdomyosarcoma, to evaluate the local control and survival, in association with chemotherapy, to analyze the late effects of the treatment and to determinate the preferential technique to each clinical situation. All patients received brachytherapy to the tumor site. The radioactive isotopes employed were Gold{sup 198}, Cesium{sup 137} and Iridium{sup 192}. The brachytherapy techniques depended on the tumor site, period of treatment, availability of the radioactive material and stage of the disease. Patients treated exclusively by brachytherapy received 40 Gy to 60 Gy. When brachytherapy was associated with external radiotherapy the dose ranged from 20 Gy to 40 Gy. Local control was achieved in 18 of 20 patients (90%). The global survival and local control survival rates were 61.9% (13/21 patients) and 72,2% (13/18 patients) respectively. (author)

Radiation protection in brachytherapy

International Nuclear Information System (INIS)

Benitez, Manuel

1996-02-01

It covers technical procedures in medical applications for cancer treatment. Radiation protection principles in brachytherapy. Medical uses in therapy for Sr-90, Cs-137, Co-60, Ra-226, Ir-192, Au-198, Bi-214, Pb-214. (The author)

Relation between the CF2 radical and plasma density measured using LIF and cutoff probe in a CF4 inductively coupled plasma

International Nuclear Information System (INIS)

Kim, Jung-Hyung; Shin, Yong-Hyeon; Chung, Kwang-Hwa; Yoo, Yong-Shim

2004-01-01

The behavior of the CF 2 radical was studied in a CF 4 inductively coupled plasma. The CF 2 radical was measured using a laser-induced fluorescence method. Absolute electron density was measured using a cutoff probe and the electron temperature was measured using a double probe to study the relationship between these electron properties and the CF 2 radical. To examine the relationship between them, the CF 2 radical and electron density were measured as a function of the rf power, which is a major external parameter influencing the electron density. As the rf power was increased, the CF 2 radical density increased in the range of low electron density, and then decreased beyond a critical electron density. The dependence of the CF 2 radical density on the electron density was theoretically analyzed with rate equations. The theoretical result was in good agreement with experiment

Prostate brachytherapy in Ghana: our initial experience

Directory of Open Access Journals (Sweden)

James Edward Mensah

2016-10-01

Full Text Available Purpose: This study presents the experience of a brachytherapy team in Ghana with a focus on technology transfer and outcome. The team was initially proctored by experienced physicians from Europe and South Africa. Material and methods : A total of 90 consecutive patients underwent either brachytherapy alone or brachytherapy in combination with external beam radiotherapy for prostate carcinoma between July 2008 and February 2014 at Korle Bu Teaching Hospital, Accra, Ghana. Patients were classified as low-risk, intermediate, and high-risk according to the National Comprehensive Cancer Network (NCCN criteria. All low-risk and some intermediate risk group patients were treated with seed implantation alone. Some intermediate and all high-risk group patients received brachytherapy combined with external beam radiotherapy. Results: The median patient age was 64.0 years (range 46-78 years. The median follow-up was 58 months (range 18-74 months. Twelve patients experienced biochemical failure including one patient who had evidence of metastatic disease and died of prostate cancer. Freedom from biochemical failure rates for low, intermediate, and high-risk cases were 95.4%, 90.9%, and 70.8%, respectively. Clinical parameters predictive of biochemical outcome included: clinical stage, Gleason score, and risk group. Pre-treatment prostate specific antigen (PSA was not a statistically significant predictor of biochemical failure. Sixty-nine patients (76.6% experienced grade 1 urinary symptoms in the form of frequency, urgency, and poor stream. These symptoms were mostly self-limiting. Four patients needed catheterization for urinary retention (grade 2. One patient developed a recto urethral fistula (grade 3 following banding for hemorrhoids. Conclusions : Our results compare favorably with those reported by other institutions with more extensive experience. We believe therefore that, interstitial permanent brachytherapy can be safely and effectively

Atmospheric chemistry of (CF3)2CFOCH3

DEFF Research Database (Denmark)

Andersen, Lene Løffler; Østerstrøm, Freja From; Nielsen, Ole John

2014-01-01

FTIR smog chamber techniques were used to measure k(Cl + (CF 3)2CFOCH3) = (1.80 ± 0.42) × 10-13, k(Cl + (CF3)2CFOCHO) = (1.47 ± 0.56) × 10-14, and k(OH + (CF3) 2CFOCH3) = (1.55 ± 0.24) × 10-14 cm3 molecule-1 s-1. The chlorine-atom initiated oxidation of (CF3)2CFOCH3 in air in the absence of NOX r...

Effect of brachytherapy technique and patient characteristics on cervical cancer implant dosimetry

Energy Technology Data Exchange (ETDEWEB)

Anker, Christopher J., E-mail: chris.anker@hci.utah.edu [Department of Radiation Oncology, Huntsman Cancer Hospital, University of Utah, Salt Lake City, UT (United States); O' Donnell, Kristen [Department of Radiation Oncology, The University of Arizona, Tucson, AZ (United States); Boucher, Kenneth M. [Department of Oncological Sciences, Huntsman Cancer Institute, University of Utah, Salt Lake City, UT (United States); Gaffney, David K. [Department of Radiation Oncology, Huntsman Cancer Hospital, University of Utah, Salt Lake City, UT (United States)

2013-01-01

Our purpose was to evaluate the relationship between brachytherapy technique and patient characteristics on dose to organs-at-risk (OARs) in patients undergoing high dose rate (HDR) brachytherapy for cervical cancer. From 1998 to 2008, 31 patients with cervical cancer with full dosimetric data were identified who received definitive external-beam radiation and HDR brachytherapy with tandem and ovoid applicators. Doses were recorded at point A, the International Commission on Radiation Units and Measurements (ICRU)-38 rectal point, the ICRU-38 bladder point, the vaginal surface, and the pelvic sidewall. Generalized estimating equations were used to determine the significance of changes in OAR to point A dose ratios with differences in brachytherapy technique or patient characteristics. Patients underwent a median of 5 brachytherapy procedures (range, 3 to 5), with a total of 179 procedures for 31 patients. For all brachytherapy treatments, the average ratios between the doses for the rectal, bladder, vaginal surface, and pelvic sidewall reference points to those at point A were 0.49, 0.59, 1.15, and 0.17, respectively. In general, decreased OAR dose was associated with a lower stage, younger age, increased ovoid size, increased tandem length, and earlier implant number. Increased tandem curvature significantly increased bladder dose and decreased rectal dose. Intravenous anesthesia usage was not correlated with improved dosimetry. This study allowed identification of patient and procedure characteristics influencing OAR dosing. Although the advent of 3-dimensional (3D) image-guided brachytherapy will bring new advances in treatment optimization, the actual technique involved at the time of the brachytherapy implant procedure will remain important.

Brachytherapy in cervix cancers: techniques and concepts evolution

International Nuclear Information System (INIS)

Haie-Meder, C.; Crevoisier, R. de; Petrow, P.; Fromm, S.; Delapierre, M.; Albano, M.; Petit, C.; Briot, E.

2003-01-01

Brachytherapy plays an important role in the treatment of patients with cervical carcinoma. Technical modalities have evolved during the last years and have benefited from imaging modalities development, specially MRI. Imaging modalities contribute to a better knowledge of tumoral extension and critical organs. Ultrasound during brachytherapy has led to the almost complete eradication of uterine perforation. In the future, a more systematic use of systems allowing optimization may induce a better dose distribution in the tumor as well as in the critical organs. Recent data provided information in favor of a better analysis in the relative role of dose-rate, total dose and treated volume and their influence on the local control and complication incidence. Concomitant radio-chemotherapy represents a standard in the treatment of patients with tumoral size exceeding 4 cm. Some questions still remain: is concomitant chemotherapy of benefit during brachytherapy? Is there any place for complementary surgery, specially in patients with complete response after external irradiation with concomitant chemotherapy and brachytherapy? In order to answer the former question, a phase III randomized trial is going to start, with the Federation Nationale des Centres de Lutte Contre le Cancer as a promoter. (authors)

48 CFR 252.217-7001 - Surge option.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...

Accurate localization of intracavitary brachytherapy applicators from 3D CT imaging studies

International Nuclear Information System (INIS)

Lerma, F.A.; Williamson, J.F.

2002-01-01

Purpose: To present an accurate method to identify the positions and orientations of intracavitary (ICT) brachytherapy applicators imaged in 3D CT scans, in support of Monte Carlo photon-transport simulations, enabling accurate dose modeling in the presence of applicator shielding and interapplicator attenuation. Materials and methods: The method consists of finding the transformation that maximizes the coincidence between the known 3D shapes of each applicator component (colpostats and tandem) with the volume defined by contours of the corresponding surface on each CT slice. We use this technique to localize Fletcher-Suit CT-compatible applicators for three cervix cancer patients using post-implant CT examinations (3 mm slice thickness and separation). Dose distributions in 1-to-1 registration with the underlying CT anatomy are derived from 3D Monte Carlo photon-transport simulations incorporating each applicator's internal geometry (source encapsulation, high-density shields, and applicator body) oriented in relation to the dose matrix according to the measured localization transformations. The precision and accuracy of our localization method are assessed using CT scans, in which the positions and orientations of dense rods and spheres (in a precision-machined phantom) were measured at various orientations relative to the gantry. Results: Using this method, we register 3D Monte Carlo dose calculations directly onto post insertion patient CT studies. Using CT studies of a precisely machined phantom, the absolute accuracy of the method was found to be ±0.2 mm in plane, and ±0.3 mm in the axial direction while its precision was ±0.2 mm in plane, and ±0.2 mm axially. Conclusion: We have developed a novel, and accurate technique to localize intracavitary brachytherapy applicators in 3D CT imaging studies, which supports 3D dose planning involving detailed 3D Monte Carlo dose calculations, modeling source positions, shielding and interapplicator shielding

48 CFR 252.225-7025 - Restriction on acquisition of forgings.

Science.gov (United States)

2010-10-01

... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...

48 CFR 252.225-7031 - Secondary Arab boycott of Israel.

Science.gov (United States)

2010-10-01

... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...

24 CFR 92.252 - Qualification as affordable housing: Rental housing.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...

48 CFR 252.235-7011 - Final scientific or technical report.

Science.gov (United States)

2010-10-01

... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...

Advantages of high-dose rate (HDR) brachytherapy in treatment of prostate cancer

Science.gov (United States)

Molokov, A. A.; Vanina, E. A.; Tseluyko, S. S.

2017-09-01

One of the modern methods of preserving organs radiation treatment is brachytherapy. This article analyzes the results of prostate brachytherapy. These studies of the advantages of high dose brachytherapy lead to the conclusion that this method of radiation treatment for prostate cancer has a favorable advantage in comparison with remote sensing methods, and is competitive, preserving organs in comparison to surgical methods of treatment. The use of the method of polyfocal transperineal biopsy during the brachytherapy session provides information on the volumetric spread of prostate cancer and adjust the dosimetry plan taking into account the obtained data.

Underuse of brachytherapy for the treatment of dysphagia owing to esophageal cancer. An Italian survey.

Science.gov (United States)

Fuccio, Lorenzo; Guido, Alessandra; Hassan, Cesare; Frazzoni, Leonardo; Arcelli, Alessandra; Farioli, Andrea; Giaccherini, Lucia; Galuppi, Andrea; Mandolesi, Daniele; Cellini, Francesco; Mantello, Giovanna; Macchia, Gabriella; de Bortoli, Nicola; Repici, Alessandro; Valentini, Vincenzo; Bazzoli, Franco; Morganti, Alessio Giuseppe

2016-10-01

International guidelines strongly recommend brachytherapy as valid alternative or in addition to stenting in patients with dysphagia owing to esophageal cancer. However, for not well understood reasons, brachytherapy is definitively underused for the palliative treatment of malignant dysphagia. Aim of the current survey was to investigate the use of brachytherapy for the treatment of malignant dysphagia in Italy. A structured questionnaire was submitted to the 1510 members of the Italian Association of Radiation Oncologists (AIRO). These members refer to 177 centres of radiotherapy across Italy and in 68 (38.4%) of them brachytherapy is routinely performed. Of the 1510 invited members, 178 completed the survey (11.7%). The answers provided by the 178 participants allowed to get information on 40 out of 68 brachytherapy centres (58.8%). Seven out of 40 (17.5%) centres perform brachytherapy of the oesophagus, in 3 out of 40 (7.5%) centres brachytherapy represents the first line of treatment. The main reason why brachytherapy is not routinely performed is the lack of experience. Despite the strong recommendations of the international guidelines and the wide diffusion of brachytherapy centres across Italy, only very few of them routinely considered brachytherapy for the treatment of dysphagia due to esophageal cancer. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

48 CFR 252.235-7002 - Animal welfare.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...

48 CFR 252.229-7001 - Tax relief.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...

Encapsulation of radioactive waste

International Nuclear Information System (INIS)

Pordes, O.; Plows, J.P.

1980-01-01

A method is described for encapsulating a particular radioactive waste which consists of suspending the waste in a viscous liquid encapsulating material, of synthetic resin monomers or prepolymers, and setting the encapsulating material by addition or condensation polymerization to form a solid material in which the waste is dispersed. (author)

Automated planning volume definition in soft-tissue sarcoma adjuvant brachytherapy

International Nuclear Information System (INIS)

Lee, Eva K.; Fung, Albert Y.C.; Zaider, Marco; Brooks, J. Paul

2002-01-01

soft-tissue sarcoma tumour beds within various anatomical structures. For each of 15 patient cases considered, the algorithm takes approximately 2 min to generate the planning volume. Although the tumour shapes are rather different, the algorithm consistently generates planning volumes that visually demonstrate smooth curves compactly encapsulating the circles. This general-purpose contouring algorithm works well whether the catheters are all close together, spread far apart in the plane or arranged in a convoluted way. The automatic contouring algorithm significantly reduces labour time and provides a consistent and objective method for determining planning volumes for soft-tissue sarcoma. Further studies are needed to validate the significance of the resulting planning volumes in designing treatment plans and the role that sophisticated brachytherapy treatment planning optimization may have in producing good plans. (author)

Automated planning volume definition in soft-tissue sarcoma adjuvant brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Lee, Eva K. [Department of Radiation Oncology, Emory University School of Medicine, Atlanta, GA (United States); School of Industrial and Systems Engineering, Georgia Institute of Technology, Atlanta, GA (United States); Fung, Albert Y.C.; Zaider, Marco [Department of Medical Physics, Memorial Sloan Kettering Cancer Center, New York, NY (United States); Brooks, J. Paul [School of Industrial and Systems Engineering, Georgia Institute of Technology, Atlanta, GA (United States)

2002-06-07

soft-tissue sarcoma tumour beds within various anatomical structures. For each of 15 patient cases considered, the algorithm takes approximately 2 min to generate the planning volume. Although the tumour shapes are rather different, the algorithm consistently generates planning volumes that visually demonstrate smooth curves compactly encapsulating the circles. This general-purpose contouring algorithm works well whether the catheters are all close together, spread far apart in the plane or arranged in a convoluted way. The automatic contouring algorithm significantly reduces labour time and provides a consistent and objective method for determining planning volumes for soft-tissue sarcoma. Further studies are needed to validate the significance of the resulting planning volumes in designing treatment plans and the role that sophisticated brachytherapy treatment planning optimization may have in producing good plans. (author)

Dosimetry of iridium-192 sources used in brachytherapy

International Nuclear Information System (INIS)

Henn, Keli Cristina

1999-09-01

The use of high dose rate brachytherapy (HDR) has been increasing in recent years, due to several advantages relative to conventional low dose rate brachytherapy, such as: shorter treatment times, the ability to fractionate treatment (and thus perform many treatments on an outpatient basis) and reduced worker exposures. Most HDR equipment uses small, high activity 192 Ir sources, which are introduced into the patient using a remote system. The dose distribution around these sources is strongly dependent on the size and shape of the active volume and on the encapsulation of the source. The objective of this work is to compare two methods of calibrating sources of 192 Ir, mamely, measurements in air with an ionization thimble chamber or with a well-type ionization chamber. In addition, we measured the anisotropy of the sources and made comparisons with values supplied by the manufacturer, since this factor is taken into account in the planning system algorithm when dose distributions are calculated. The dose was also evaluated at points of clinical interest (i.e. in the rectum and bladder) and compared to values obtained with the Nucletron PLATO-BPS planning system. The use of lead for rectal protection was evaluated in a cylindrical applicator, aiming the further development of a gynecological applicator. The results of the calibration of seven sources showed that the uncertainty in the calibration in a 'jig' system is smaller than 1%, compared to the value supplied by the source manufacturer. The differences between the results obtained with the well-type ionization camera and the 'jig' system were around 2%. The anisotropy showed good agreement with the values supplied by the manufacturer. The results show that the anisotropy factors, in air and water, are approximately constant and equal to 1.0, for angles between 70 deg and 150 deg. For angles smaller than 70 deg the anisotropy factor in water is larger than in air. Results are also presented for 180 deg, which

Identification of distinct specificity determinants in resistance protein Cf-4 allows construction of a Cf-9 mutant that confers recognition of avirulence protein AVR4

NARCIS (Netherlands)

Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.

2001-01-01

The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,

Brachytherapy in head and neck cancers; Curietherapie des cancers de la sphere ORL

Energy Technology Data Exchange (ETDEWEB)

Mazeron, J.J.; Noel, G.; Simon, J.M.; Racadot, S.; Jauffret, E. [Groupe Hospitalier la Pitie-Salpetriere, Centre des Tumeurs, 75 - Paris (France)

2003-02-01

Experience accumulated over several decades with radiation of Head and Neck tumours by irradiation has demonstrated the need for a high tumour dose to achieve local control. With external beam irradiation alone, it is difficult to spare adjacent normal tissues, resulting in undesirable late effects on the salivary glands; mandible, and muscles of mastication. Interstitial implantation is ideally suited to deliver a high dose limited to the volume of the primary tumor, thus minimizing sequels. A large experience has been accumulated with low dose rate (LDR) brachytherapy in treatment of carcinoma of oral cavity, oropharynx, and nasopharynx. Recent analysis of large clinical series provided data indicating that modalities of low dose rate brachytherapy should be optimized in treating these tumors for increasing therapeutic ratio. Low dose rate brachytherapy is now challenged by high dose rate (HDR) brachytherapy and pulsed dose rate (PDR) brachytherapy. Preliminary results obtained with these two last modalities are discussed regarding to those of low dose rate brachytherapy. (authors)

Comparison of seed brachytherapy or external beam radiotherapy (70 Gy or 74 Gy) in 919 low-risk prostate cancer patients

Energy Technology Data Exchange (ETDEWEB)

Goldner, G.; Poetter, R.; Schmid, M.P.; Kirisits, C. [University Hospital of Vienna (Austria). Dept. of Radiotherapy and Radiobiology; Battermann, J.J.; Sljivic, S.; Vulpen, M. van [University Medical Center Utrecht (Netherlands). Dept. of Radiation Oncology

2012-04-15

The aim of this analysis was to compare the biochemical no evidence of disease (bNED) rates in low-risk prostate cancer patients treated at two centers of excellence using different approaches: seed brachytherapy (BT) and external beam radiotherapy (EBRT). Materials and methods: A total of 919 low-risk prostate cancer patients, treated from 1998-2008, were identified in the two databases. In Utrecht, 667 patients received I-125 BT applying a dose of 144 Gy. In Vienna, 252 patients were treated with EBRT, applying a local dose of 70 Gy in 82 patients and 74 Gy in 170 patients. bNED rates (Phoenix definition) were assessed. Results: The median follow-up was 46 months (range 1-148 months). The 5-year actuarial bNED rates were 94% for BT patients and 88% for EBRT patients (p = 0.002) - 84% for patients receiving 70 Gy and 91% for patients receiving 74 Gy, respectively. In the univariate analysis, patients receiving 70 Gy showed significantly worse outcome compared to BT (p = 0.001) and a difference close to significance compared to 74 Gy (p = 0.06). In the multivariate analysis including tumor stage, Gleason score, initial PSA, hormonal therapy, and dose, patients receiving 70 Gy EBRT showed significantly worse bNED rates compared to BT patients. Conclusion: Low-risk prostate cancer patients receiving 74 Gy by EBRT show comparable biochemical control rates to patients receiving seed brachytherapy, whereas patients receiving 70 Gy show significantly worse outcome. (orig.)

Image-robot coupling for the prostate brachytherapy

International Nuclear Information System (INIS)

Coelen, V.; Lartigau, E.; Merzouki, R.

2009-01-01

The results allows to contemplate a robot use in the prostate brachytherapy but equally in other applications such prostate biopsy. The tests to come are going to be directed towards on the use of a prostate phantom in order to calibrate the ultrasonography. thereafter, we contemplate the conception of an intelligent gripping system placed on the robot arm and allowing a good control in closed loop of the brachytherapy needle placement and allowing the setting up of an online monitoring. (N.C.)

Brachytherapy for Buccal Cancer: From Conventional Low Dose Rate (LDR) or Mold Technique to High Dose Rate Interstitial Brachytherapy (HDR-ISBT).

Science.gov (United States)

Kotsuma, Tadayuki; Yamazaki, Hideya; Masui, Koji; Yoshida, Ken; Shimizutani, Kimishige; Akiyama, Hironori; Murakami, Shumei; Isohashi, Fumiaki; Yoshioka, Yasuo; Ogawa, Kazuhiko; Tanaka, Eiichi

2017-12-01

To examine the effectiveness of newly-installed high-dose-rate interstitial brachytherapy (HDR-ISBT) for buccal cancer. We retrospectively reviewed 36 patients (25 men and 11 women) with buccal cancer treated with curative brachytherapy with or without external radiotherapy with a median follow-up of 99 months. A total of 15 HDR-ISBT (median 48 Gy/ 8 fractions, range=24-60 Gy) patients were compared to conventional 15 cases LDR-ISBT (70 Gy, range=42.8-110 Gy) and 7 molds techniques (15 Gy, range=9-74 Gy). A total of 31 patients also underwent external radiotherapy (30 Gy, range=24-48 Gy). They comprised of 3T1, 23 T2, 8 T3, 3 T4 including 11 node positive cases. HDR-ISBT provided 82% of local control rate at 5 years, whereas conventional brachytherapy showed 72% [p=0.44; LDR-ISBT (65%), mold therapy (85.7%)]. Patients with early lesions (T1-2 or stage I-II) showed better local control rates than those with advanced lesions (T3-4 or stage III-IV). Severe late grade 3 complications developed in two patients treated with LDR-ISBT and EBRT. There is no significant difference in toxicity grade ≤2 between conventional brachytherapy (5/15=33%) and HDR-ISBT (7/32=32%, p=0.92). HDR-ISBT achieved good and comparable local control rates to conventional brachytherapy without elevating the toxicity. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Modeling of silicon etching in CF sub 4 /O sub 2 and CF sub 4 /H sub 2 plasmas

Energy Technology Data Exchange (ETDEWEB)

Trachtenberg, I.; Edgar, T.F. (Dept. of Chemical Engineering, Univ. of Texas at Austin, Austin, TX (US)); Venkatesan, S.P. (Morgantown Energy Technology Center, Morgantown, WV (US))

1990-07-01

A one-dimensional radial flow reactor model that includes fairly detailed free radical gas-phase chemistry has been developed for the etching of silicon in CF{sub 4}/O{sub 2} and CF{sub 4}/H{sub 2} plasmas. Attention has been restricted to transport and reaction of neutral species. The model equations were solved by orthogonal collocation. The sensitivities of the model predictions to flow rate, inlet gas composition, electron density, silicon loading, and other factors have been examined. The major loss path for fluorine atoms is different in CF{sub 4}/O{sub 2} and CF{sub 4}/H{sub 2} systems, and this results in significant qualitative differences in the parametric sensitivities of the two systems.

A fibre optic dosimeter customised for brachytherapy

Energy Technology Data Exchange (ETDEWEB)

Suchowerska, N. [Department of Radiation Oncology, Royal Prince Alfred Hospital, Camperdown, NSW 2050 (Australia); School of Physics, University of Sydney, NSW 2006 (Australia)], E-mail: Natalka@email.cs.nsw.gov.au; Lambert, J.; Nakano, T. [Department of Radiation Oncology, Royal Prince Alfred Hospital, Camperdown, NSW 2050 (Australia); School of Physics, University of Sydney, NSW 2006 (Australia); Law, S. [School of Physics, University of Sydney, NSW 2006 (Australia); Optical Fibre Technology Centre, University of Sydney, 206 National Innovation Centre, Australian Technology Park, Eveleigh, NSW 1430 (Australia); Elsey, J. [Bandwidth Foundry Pty Ltd, Australian Technology Park, NSW, 1430 (Australia); McKenzie, D.R. [School of Physics, University of Sydney, NSW 2006 (Australia)

2007-04-15

In-vivo dosimetry for brachytherapy cancer treatment requires a small dosimeter with a real time readout capability that can be inserted into the patient to determine the dose to critical organs. Fibre optic scintillation dosimeters, consisting of a plastic scintillator coupled to an optical fibre, are a promising dosimeter for this application. We have implemented specific design features to optimise the performance of the dosimeter for specific in-vivo dosimetry during brachytherapy. Two sizes of the BrachyFOD{sup TM} scintillation dosimeter have been developed, with external diameters of approximately 2 and 1 mm. We have determined their important dosimetric characteristics (depth dose relation, angular dependence, energy dependence). We have shown that the background signal created by Cerenkov and fibre fluorescence does not significantly affect the performance in most clinical geometries. The dosimeter design enables readout at less than 0.5 s intervals. The clinical demands of real time in-vivo brachytherapy dosimetry can uniquely be satisfied by the BrachyFOD{sup TM}.

Oncentra brachytherapy planning system.

Science.gov (United States)

Yang, Jack

2018-03-27

In modern cancer management, treatment planning has progressed as a contemporary tool with all the advances in computing power in recent years. One of the advanced planning tools uses 3-dimensional (3D) data sets for accurate dose distributions in patient prescription. Among these planning processes, brachytherapy has been a very important part of a successful cancer management program, offering clinical benefits with specific or combined treatments with external beam therapy. In this chapter, we mainly discussed the Elekta Oncentra planning system, which is the main treatment planning tool for high-dose rate (HDR) modality in our facility and in many other facilities in the United States. HDR is a technically advanced form of brachytherapy; a high-intensity radiation source (3.6 mm in length) is delivered with step motor in submillimeter precision under computer guidance directly into the tumor areas while minimizing injury to surrounding normal healthy tissue. Oncentra planning is the key component to generate a deliverable brachytherapy procedure, which is executed on the microSelectron V3 remote afterloader treatment system. Creating a highly conformal plan can be a time-consuming task. The development of Oncentra software (version 4.5.3) offers a variety of useful tools that facilitate many of the clinical challenging tasks for planning, such as contouring and image reconstruction, as well as rapid planning calculations with dose and dose volume histogram analysis. Oncentra Brachy module creates workflow and optimizes the planning accuracy for wide varieties of clinical HDR treatments, such as skin, gynecologic (GYN), breast, prostate, and many other applications. The treatment file can also be transferred to the afterloader control station for speedy delivery. The design concept, calculation algorithms, and optimization modules presented some key characteristics to plan and treat the patients effectively and accurately. The dose distribution and accuracy of

Brachytherapy for elderly patients with stage II tongue cancer

International Nuclear Information System (INIS)

Kimura, Tomoki; Hirokawa, Yutaka; Fujita, Minoru; Murakami, Yuji; Kenjo, Masahiro; Kaneyasu, Yuko; Ito, Katsuhide

2003-01-01

In treatment choices of stage II (T2N0M0) tongue cancer, brachytherapy is less invasive and superior in function preservation, therefore its role is more important in elderly patients. The aim of this study was to evaluate treatment results and morbidity of brachytherapy for elderly patients with stage II tongue cancer. Between 1980 and 2001, 198 patients with stage II tongue cancer were treated with brachytherapy at Hiroshima University Hospital. Patient ages ranged from 21 to 89 years old (median: 62 years old). Patients were divided into three groups as follows: 119 patients younger than 65 years old (Non-Elderly group), 53 patients between 65 and 75 years old (Junior Elderly group), and 26 patients 75 years or older (Senior Elderly group). Radiotherapy was performed in 101 patients with brachytherapy alone, and in 97 patients with brachytherapy and external radiotherapy. Chemotherapy was also performed in 77 patients. Follow-up period ranged from 4 to 243 months (median: 55 months). The 5-year local control rate was 85% in the Non-Elderly group, 85% in the Junior Elderly group and 81% in the Senior Elderly group. There was no significant difference among these groups. The 5-year cause-specific survival rate was 85%, 81% and 70% respectively. The Senior Elderly group showed poorer cause-specific survival rate than the other two groups (p=0.03). There was also a tendency of higher incidence of neck metastasis and low salvage rate by neck dissection in the Senior Elderly group. Although the Senior Elderly group showed poorer cause-specific survival rate, the local control rate was similar to those of the other two groups. Brachytherapy is an effective treatment option for elderly patients with stage II tongue cancer. (author)

Image guided, adaptive, accelerated, high dose brachytherapy as model for advanced small volume radiotherapy

International Nuclear Information System (INIS)

Haie-Meder, Christine; Siebert, Frank-Andre; Poetter, Richard

2011-01-01

Brachytherapy has consistently provided a very conformal radiation therapy modality. Over the last two decades this has been associated with significant improvements in imaging for brachytherapy applications (prostate, gynecology), resulting in many positive advances in treatment planning, application techniques and clinical outcome. This is emphasized by the increased use of brachytherapy in Europe with gynecology as continuous basis and prostate and breast as more recently growing fields. Image guidance enables exact knowledge of the applicator together with improved visualization of tumor and target volumes as well as of organs at risk providing the basis for very individualized 3D and 4D treatment planning. In this commentary the most important recent developments in prostate, gynecological and breast brachytherapy are reviewed, with a focus on European recent and current research aiming at the definition of areas for important future research. Moreover the positive impact of GEC-ESTRO recommendations and the highlights of brachytherapy physics are discussed what altogether presents a full overview of modern image guided brachytherapy. An overview is finally provided on past and current international brachytherapy publications focusing on 'Radiotherapy and Oncology'. These data show tremendous increase in almost all research areas over the last three decades strongly influenced recently by translational research in regard to imaging and technology. In order to provide high level clinical evidence for future brachytherapy practice the strong need for comprehensive prospective clinical research addressing brachytherapy issues is high-lighted.

Application of TSH bioindicator for studying the biological efficiency of radiation

International Nuclear Information System (INIS)

Kim, Jin Kyu; Cebulska-Wasilewska, A.

1996-10-01

Dose response relationships for various endpoints (gene and lethal mutations, cell cycle alterations) in somatic cells of Tradescantia clone 4430 were established for X-rays and for mixed fast and thermal neutrons from Cf-252 source of KAERI and from U-120 cyclotron of INP. This was a pilot experiment to check if it is possible to establish the relative biological effectiveness values for Cf-252 irradiated TSH cells, with and without boron ion pretreatment, in conditions of mutual KAERI-INP experiment. When T-4430 was pretreated with boron ion, there was and enhancement in biological efficacy of neutron form Cf-252 source. 2 tabs., 7 figs., 7 refs. (Author)

Current status of brachytherapy in cancer treatment – short overview

Directory of Open Access Journals (Sweden)

Janusz Skowronek

2017-12-01

Full Text Available Cancer incidence and mortality depend on a number of factors, including age, socio-economic status and geographical location, and its prevalence is growing around the world. Most of cancer treatments include external beam radiotherapy or brachytherapy. Brachytherapy, a type of radiotherapy with energy from radionuclides inserted directly into the tumor, is increasingly used in cancer treatment. For cervical and skin cancers, it has become a standard therapy for more than 100 years as well as an important part of the treatment guidelines for other malignancies, including head and neck, skin, breast, and prostate cancers. Compared to external beam radiotherapy, brachytherapy has the potential to deliver an ablative radiation dose over a short period of time directly to the altered tissue area with the advantage of a rapid fall-off in dose, and consequently, sparing of adjacent organs. As a result, the patient is able to complete the treatment earlier, and the risks of occurrence of another cancer are lower than in conventional radiotherapy treatment. Brachytherapy has increased its use as a radical or palliative treatment, and become more advanced with the spread of pulsed-dose-rate and high-dose-rate afterloading machines; the use of new 3D/4D planning systems has additionally improved the quality of the treatment. The aim of the present study was to present short summaries of current studies on brachytherapy for the most frequently diagnosed tumors. Data presented in this manuscript should help especially young physicians or physicists to explore and introduce brachytherapy in cancer treatments.

Selective encapsulation by Janus particles

Energy Technology Data Exchange (ETDEWEB)

Li, Wei, E-mail: wel208@mrl.ucsb.edu [Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Ruth, Donovan; Gunton, James D. [Department of Physics, Lehigh University, Bethlehem, Pennsylvania 18015 (United States); Rickman, Jeffrey M. [Department of Physics, Lehigh University, Bethlehem, Pennsylvania 18015 (United States); Department of Materials Science and Engineering, Lehigh University, Bethlehem, Pennsylvania 18015 (United States)

2015-06-28

We employ Monte Carlo simulation to examine encapsulation in a system comprising Janus oblate spheroids and isotropic spheres. More specifically, the impact of variations in temperature, particle size, inter-particle interaction range, and strength is examined for a system in which the spheroids act as the encapsulating agents and the spheres as the encapsulated guests. In this picture, particle interactions are described by a quasi-square-well patch model. This study highlights the environmental adaptation and selectivity of the encapsulation system to changes in temperature and guest particle size, respectively. Moreover, we identify an important range in parameter space where encapsulation is favored, as summarized by an encapsulation map. Finally, we discuss the generalization of our results to systems having a wide range of particle geometries.

Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

International Nuclear Information System (INIS)