The Role of Unlearning in Metamorphosis and Strategic Resilience

Science.gov (United States)

Morais-Storz, Marta; Nguyen, Nhien

2017-01-01

Purpose: This paper aims to conceptualize what it means to be resilient in the face of our current reality of indisputable turbulence and uncertainty, suggest that continual metamorphosis is key to resilience, demonstrate the role of unlearning in that metamorphosis and suggest that problem formulation is a key deliberate mechanism of driving…

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

The multiple personalities of Watson and Crick strands.

Science.gov (United States)

Cartwright, Reed A; Graur, Dan

2011-02-08

In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

The multiple personalities of Watson and Crick strands

Directory of Open Access Journals (Sweden)

Graur Dan

2011-02-01

Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

Vicarious learning and unlearning of fear in childhood via mother and stranger models.

Science.gov (United States)

Dunne, Güler; Askew, Chris

2013-10-01

Evidence shows that anxiety runs in families. One reason may be that children are particularly susceptible to learning fear from their parents. The current study compared children's fear beliefs and avoidance preferences for animals following positive or fearful modeling by mothers and strangers in vicarious learning and unlearning procedures. Children aged 6 to 10 years (N = 60) were exposed to pictures of novel animals either alone (control) or together with pictures of their mother or a stranger expressing fear or happiness. During unlearning (counterconditioning), children saw each animal again with their mother or a stranger expressing the opposite facial expression. Following vicarious learning, children's fear beliefs increased for animals seen with scared faces and this effect was the same whether fear was modeled by mothers or strangers. Fear beliefs and avoidance preferences decreased following positive counterconditioning and increased following fear counterconditioning. Again, learning was the same whether the model was the child's mother or a stranger. These findings indicate that children in this age group can vicariously learn and unlearn fear-related cognitions from both strangers and mothers. This has implications for our understanding of fear acquisition and the development of early interventions to prevent and reverse childhood fears and phobias.

The Effect of Absorptive Capacity on Green Customer Capital under an Organizational Unlearning Context

Directory of Open Access Journals (Sweden)

Silvia Martelo-Landroguez

2018-01-01

Full Text Available Environmental management is becoming increasingly important within organizations and forms an essential part of their strategies. As customers are more concerned with the care of the environment, companies are required to be more aware of their actions. Consequently, companies must ignore their historical mindsets and assumptions to be able to adopt green-oriented practices and processes. Our specific research questions are: (i How can firms become (more green-oriented? and (ii how can knowledge-based organizational capabilities drive this shift into greener companies, which may enhance green customer capital? The research model describes how the complementary roles of absorptive capacity (direct effect and the fostering of an organizational unlearning context (moderating effect affects green customer capital within the Spanish automotive component manufacturing sector. Empirical results reveal that to create green customer capital, companies should absorb new knowledge and build a context of organizational unlearning. In today’s competitive environment, knowledge rapidly becomes obsolete, so companies need to encourage unlearning to make space for new knowledge that meets environmental needs and keeps pace with changing customer preferences. The research hypotheses were tested using partial least squares (PLS path-modeling.

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

Replication infidelity via a mismatch with Watson–Crick geometry

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

2011-01-01

In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

Unlearning of Mixed States in the Hopfield Model —Extensive Loading Case—

Science.gov (United States)

Hayashi, Kao; Hashimoto, Chinami; Kimoto, Tomoyuki; Uezu, Tatsuya

2018-05-01

We study the unlearning of mixed states in the Hopfield model for the extensive loading case. Firstly, we focus on case I, where several embedded patterns are correlated with each other, whereas the rest are uncorrelated. Secondly, we study case II, where patterns are divided into clusters in such a way that patterns in any cluster are correlated but those in two different clusters are not correlated. By using the replica method, we derive the saddle point equations for order parameters under the ansatz of replica symmetry. The same equations are also derived by self-consistent signal-to-noise analysis in case I. In both cases I and II, we find that when the correlation between patterns is large, the network loses its ability to retrieve the embedded patterns and, depending on the parameters, a confused memory, which is a mixed state and/or spin glass state, emerges. By unlearning the mixed state, the network acquires the ability to retrieve the embedded patterns again in some parameter regions. We find that to delete the mixed state and to retrieve the embedded patterns, the coefficient of unlearning should be chosen appropriately. We perform Markov chain Monte Carlo simulations and find that the simulation and theoretical results agree reasonably well, except for the spin glass solution in a parameter region due to the replica symmetry breaking. Furthermore, we find that the existence of many correlated clusters reduces the stabilities of both embedded patterns and mixed states.

London home for Crick archive.

Science.gov (United States)

Williams, Nigel

2002-01-08

Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.

Unlearning to Learn: Investigating the Lived Experience of Learning English

Science.gov (United States)

Hickey, Pamela J.

2012-01-01

What is the journey of acquiring language? What is the journey of sharing it? These are the questions that compelled the hermeneutic phenomenological investigation (Gadamer, 1960/2004; van Manen, 1997) that led to this paper. Guided by the voice of Heidegger (1954/2008), I discovered the necessity of "un-learning to learn" in order to hear the…

The Journey of Organizational Unlearning: A Conversation with William H. Starbuck

Science.gov (United States)

Nguyen, Nhien

2017-01-01

Purpose: This paper aims to provide an overview of the concept "organizational unlearning" and its development since it was first introduced to the management literature and presents a useful perspective that can help to advance the conceptual development of this topic. Design/methodology/approach: Through a conversation with celebrated…

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Learning unlearnable problems with perceptrons

Science.gov (United States)

Watkin, Timothy L. H.; Rau, Albrecht

1992-03-01

We study how well perceptrons learn to solve problems for which there is no perfect answer (the usual case), taking as examples a rule with a threshold, a rule in which the answer is not a monotonic function of the overlap between question and teacher, and a rule with many teachers (a ``hard'' unlearnable problem). In general there is a tendency for first-order transitions, even using spherical perceptrons, as networks compromise between conflicting requirements. Some existing learning schemes fail completely-occasionally even finding the worst possible solution; others are more successful. High-temperature learning seems more satisfactory than zero-temperature algorithms and avoids ``overlearning'' and ``overfitting,'' but care must be taken to avoid ``trapping'' in spurious free-energy minima. For some rules examples alone are not enough to learn from, and some prior information is required.

The Francis Crick Institute.

Science.gov (United States)

Peters, Keith; Smith, Jim

2017-04-01

The Francis Crick Institute Laboratory, opened in 2016, is supported by the Medical Research Council, Cancer Research UK, the Wellcome Trust, and University College London, King's College London and Imperial College London. The emphasis on research training and early independence of gifted scientists in a multidisciplinary environment provides unique opportunities for UK medical science, including clinical and translational research. © Royal College of Physicians 2017. All rights reserved.

Francis Crick (1916–2004)

Indian Academy of Sciences (India)

Administrator

The death of Francis Crick deprives us of one of the great- est scientists of the 20th century, whose creativity and power of mind dominated molecular biology in its golden years. Many people have told the story of his achievements; here I would simply like to recollect some of the qualities of this remarkable man. The first ...

Learning, Unlearning and Relearning--Knowledge Life Cycles in Library and Information Science Education

Science.gov (United States)

Bedford, Denise A. D.

2015-01-01

The knowledge life cycle is applied to two core capabilities of library and information science (LIS) education--teaching, and research and development. The knowledge claim validation, invalidation and integration steps of the knowledge life cycle are translated to learning, unlearning and relearning processes. Mixed methods are used to determine…

Francis Crick, DNA, and the Central Dogma

Science.gov (United States)

Olby, Robert

1970-01-01

This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience.

Science.gov (United States)

Aicardi, Christine

2016-02-01

The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a 'cross-worlds influencer' who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise 'un-disciplined' new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against 'vitalism': anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of 'doing science' and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: 'follow the cross-worlds influencers' who worked to build and organise these semi-institutional gatherings and institutional structures. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience

Science.gov (United States)

Aicardi, Christine

2016-01-01

The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a ‘cross-worlds influencer’ who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise ‘un-disciplined’ new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against ‘vitalism’: anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of ‘doing science’ and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: ‘follow the cross-worlds influencers’ who worked to build and organise these semi-institutional gatherings and institutional structures. PMID:26383132

How the dual process model of human cognition can inform efforts to de-implement ineffective and harmful clinical practices: A preliminary model of unlearning and substitution.

Science.gov (United States)

Helfrich, Christian D; Rose, Adam J; Hartmann, Christine W; van Bodegom-Vos, Leti; Graham, Ian D; Wood, Suzanne J; Majerczyk, Barbara R; Good, Chester B; Pogach, Leonard M; Ball, Sherry L; Au, David H; Aron, David C

2018-02-01

One way to understand medical overuse at the clinician level is in terms of clinical decision-making processes that are normally adaptive but become maladaptive. In psychology, dual process models of cognition propose 2 decision-making processes. Reflective cognition is a conscious process of evaluating options based on some combination of utility, risk, capabilities, and/or social influences. Automatic cognition is a largely unconscious process occurring in response to environmental or emotive cues based on previously learned, ingrained heuristics. De-implementation strategies directed at clinicians may be conceptualized as corresponding to cognition: (1) a process of unlearning based on reflective cognition and (2) a process of substitution based on automatic cognition. We define unlearning as a process in which clinicians consciously change their knowledge, beliefs, and intentions about an ineffective practice and alter their behaviour accordingly. Unlearning has been described as "the questioning of established knowledge, habits, beliefs and assumptions as a prerequisite to identifying inappropriate or obsolete knowledge underpinning and/or embedded in existing practices and routines." We hypothesize that as an unintended consequence of unlearning strategies clinicians may experience "reactance," ie, feel their professional prerogative is being violated and, consequently, increase their commitment to the ineffective practice. We define substitution as replacing the ineffective practice with one or more alternatives. A substitute is a specific alternative action or decision that either precludes the ineffective practice or makes it less likely to occur. Both approaches may work independently, eg, a substitute could displace an ineffective practice without changing clinicians' knowledge, and unlearning could occur even if no alternative exists. For some clinical practice, unlearning and substitution strategies may be most effectively used together. By taking into

On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.

Science.gov (United States)

Teive, Hélio A G

2016-04-01

The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

On Francis Crick, the genetic code, and a clever kid.

Science.gov (United States)

Goldstein, Bob

2018-04-02

A few years ago, Francis Crick's son told me a story that I can't get out of my mind. I had contacted Michael Crick by email while digging through the background of the researchers who had cracked the genetic code in the 1960s. Francis had died in 2004, and I was contacting some of the people who knew him when he was struggling to decipher the code. Francis didn't appear to struggle often - he is known mostly for his successes - and, as it turns out, this one well-known struggle may have had a clue sitting just barely out of sight. Copyright © 2018 Elsevier Ltd. All rights reserved.

A world in one dimension: Linus Pauling, Francis Crick and the central dogma of molecular biology.

Science.gov (United States)

Strasser, Bruno J

2006-01-01

In 1957, Francis Crick outlined a startling vision of life in which the great diversity of forms and shapes of macromolecules was encoded in the one-dimensional sequence of nucleic acids. This paper situates Crick's new vision in the debates of the 1950s about protein synthesis and gene action. After exploring the reception of Crick's ideas, it shows how they differed radically from a different model of protein synthesis which enjoyed wide currency in that decade. In this alternative model, advocated by Linus Pauling and other luminaries, three-dimensional templates directed the folding of proteins. Even though it was always considered somewhat speculative, this theory was supported by a number of empirical results originating in different experimental systems. It was eventually replaced by a model in which the forms and shapes of macromolecules resulted solely from their amino acid sequence, dramatically simplifying the problem of protein synthesis which Crick was attempting to solve in 1957.

On the centenary of the birth of Francis H. C. Crick – from physics to genetics and neuroscience

Directory of Open Access Journals (Sweden)

Hélio A. G. Teive

2016-04-01

Full Text Available ABSTRACT The year 2016 marks the centenary of the birth of Francis Crick (1916–2004, who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

Watson-Crick hydrogen bonds : Nature and role in DNA replication

NARCIS (Netherlands)

Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

2006-01-01

The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

60 years ago, Francis Crick changed the logic of biology.

Science.gov (United States)

Cobb, Matthew

2017-09-01

In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

60 years ago, Francis Crick changed the logic of biology.

Directory of Open Access Journals (Sweden)

Matthew Cobb

2017-09-01

Full Text Available In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

60 years ago, Francis Crick changed the logic of biology

Science.gov (United States)

2017-01-01

In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences. PMID:28922352

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On-line Learning of Unlearnable True Teacher through Mobile Ensemble Teachers

Science.gov (United States)

Hirama, Takeshi; Hukushima, Koji

2008-09-01

The on-line learning of a hierarchical learning model is studied by a method based on statistical mechanics. In our model, a student of a simple perceptron learns from not a true teacher directly, but ensemble teachers who learn from a true teacher with a perceptron learning rule. Since the true teacher and ensemble teachers are expressed as nonmonotonic and simple perceptrons, respectively, the ensemble teachers go around the unlearnable true teacher with the distance between them fixed in an asymptotic steady state. The generalization performance of the student is shown to exceed that of the ensemble teachers in a transient state, as was shown in similar ensemble-teachers models. Furthermore, it is found that moving the ensemble teachers even in the steady state, in contrast to the fixed ensemble teachers, is efficient for the performance of the student.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

Science.gov (United States)

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

NARCIS (Netherlands)

Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

2012-01-01

We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

Improving Reasoning and Recall: The Differential Effects of Elaborative Interrogation and Mnemonic Elaboration.

Science.gov (United States)

Scruggs, Thomas E.; And Others

1993-01-01

Fifty-three adolescents with learning disabilities or mild mental retardation were taught reasons for dinosaur extinction. Those taught in a mnemonic elaborative interrogation condition recalled more reasons than did students who received direct teaching. Students in elaborative interrogation and mnemonic elaborative interrogation groups recalled…

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

Science.gov (United States)

Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

2003-01-01

We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

NARCIS (Netherlands)

Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

Elaboration of Avogadro law

International Nuclear Information System (INIS)

Luk'yanov, A.T.

1999-01-01

In the report on the base of conducted experiments the conclusion about necessity of Avogadro law elaboration is made. It is suggested to add to existing formulation of the law 'In equal volumes of gases at similar pressure and temperature there are equal molecules number' - the elaboration 'and at same spectral content of heat sources'

Putting into practice error management theory: Unlearning and learning to manage action errors in construction.

Science.gov (United States)

Love, Peter E D; Smith, Jim; Teo, Pauline

2018-05-01

Error management theory is drawn upon to examine how a project-based organization, which took the form of a program alliance, was able to change its established error prevention mindset to one that enacted a learning mindfulness that provided an avenue to curtail its action errors. The program alliance was required to unlearn its existing routines and beliefs to accommodate the practices required to embrace error management. As a result of establishing an error management culture the program alliance was able to create a collective mindfulness that nurtured learning and supported innovation. The findings provide a much-needed context to demonstrate the relevance of error management theory to effectively address rework and safety problems in construction projects. The robust theoretical underpinning that is grounded in practice and presented in this paper provides a mechanism to engender learning from errors, which can be utilized by construction organizations to improve the productivity and performance of their projects. Copyright © 2018 Elsevier Ltd. All rights reserved.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Derivation of the Crick-Wyman equation for allosteric proteins defining the difference between the number of binding sites and the Hill coefficient.

Science.gov (United States)

Poitevin, Frédéric; Edelstein, Stuart J

2013-05-13

In response to a 100-word footnote in the 1965 article by Monod, Wyman, and Changeux, a detailed manuscript signed by Francis Crick and Jeffries Wyman with 6000 words and 30 equations entitled "A Footnote on Allostery" circulated in 1965 among a limited group of scientists interested in allosteric interactions. This interesting and provocative document is published in this special issue for the first time. An intriguing equation in their text relates the difference between n (the number of ligand binding sites) and n' (the Hill coefficient) to the ratio of the saturation functions Y¯, for oligomers with n-1 and n binding sites. A compact derivation of this equation was not provided by Crick and Wyman, but one is presented here based on a definition of Y¯ involving the binding polynomial and its first derivative. Copyright © 2013 Elsevier Ltd. All rights reserved.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Stable aesthetic standards delusion: changing 'artistic quality' by elaboration.

Science.gov (United States)

Carbon, Claus-Christian; Hesslinger, Vera M

2014-01-01

The present study challenges the notion that judgments of artistic quality are based on stable aesthetic standards. We propose that such standards are a delusion and that judgments of artistic quality are the combined result of exposure, elaboration, and discourse. We ran two experiments using elaboration tasks based on the repeated evaluation technique in which different versions of the Mona Lisa had to be elaborated deeply. During the initial task either the version known from the Louvre or an alternative version owned by the Prado was elaborated; during the second task both versions were elaborated in a comparative fashion. After both tasks multiple blends of the two versions had to be evaluated concerning several aesthetic key variables. Judgments of artistic quality of the blends were significantly different depending on the initially elaborated version of the Mona Lisa, indicating experience-based aesthetic processing, which contradicts the notion of stable aesthetic standards.

Elaboration in the area of plasma technologies

International Nuclear Information System (INIS)

Mirsaidov, U.M.

2002-01-01

In the Institute of Chemistry the plasma chemical method of forming of fine-dispersed semi-conductors, magnetic and amorphous powders of boron and aluminium nitride was elaborated, the method of aluminium hydride conversion for the receiving of fine-grained magnetic powders and alloys was elaborated

False Memories for Suggestions: The Impact of Conceptual Elaboration

Science.gov (United States)

Zaragoza, Maria S.; Mitchell, Karen J.; Payment, Kristie; Drivdahl, Sarah

2011-01-01

Relatively little attention has been paid to the potential role that reflecting on the meaning and implications of suggested events (i.e., conceptual elaboration) might play in promoting the creation of false memories. Two experiments assessed whether encouraging repeated conceptual elaboration, would, like perceptual elaboration, increase false…

Changes across age groups in self-choice elaboration and incidental memory.

Science.gov (United States)

Toyota, Hiroshi; Tatsumi, Tomoko

2003-04-01

This study investigated differences in the self-choice elaboration and an experimenter-provided elaboration on incidental memory of 7- to 12-yr.-olds. In a self-choice elaboration condition 34 second and 25 sixth graders were asked to choose one of the two sentence frames into which each target could fit more congruously, whereas in an experimenter-provided elaboration they were asked to judge the congruity of each target to each frame. In free recall, sixth graders recalled targets in bizarre sentence frames better than second graders for self-choice elaboration condition. An age difference was not found for the experimenter-provided elaboration. In cued recall self-choice elaboration led to better performance of sixth graders for recalling targets than an experimenter-provided elaboration in both bizarre and common sentence frames. However, the different types of elaboration did not alter the recall of second graders. These results were interpreted as showing that the effectiveness of a self-choice elaboration depends on the subjects' age and the type of sentence.

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Radiotreated cocoa powder for frozen elaboration

International Nuclear Information System (INIS)

Rodriguez Jorge, M.; Alvarez Gil, M.; Prieto Miranda, E.; Morales Valladares, M.

1995-01-01

The aim of the present papers is to study the possibilities of 2.0 kGy gamma radiotreated cocoa powder to be used in the elaboration of powder mixture for the preparation of chocolate frozen. Three industrial productions were carried out. Microbiological and organoleptic evaluations of the final product were performed. The results showed that the use of radurized cocoa powder in the frozen elaboration is feasible. A good hygienic quality of this product was obtained and no organoleptic alterations were detected [es

Of the Helmholtz Club, South-Californian seedbed for visual and cognitive neuroscience, and its patron Francis Crick.

Science.gov (United States)

Aicardi, Christine

2014-03-01

Taking up the view that semi-institutional gatherings such as clubs, societies, research schools, have been instrumental in creating sheltered spaces from which many a 20th-century project-driven interdisciplinary research programme could develop and become established within the institutions of science, the paper explores the history of one such gathering from its inception in the early 1980s into the 2000s, the Helmholtz Club, which brought together scientists from such various research fields as neuroanatomy, neurophysiology, psychophysics, computer science and engineering, who all had an interest in the study of the visual system and of higher cognitive functions relying on visual perception such as visual consciousness. It argues that British molecular biologist turned South Californian neuroscientist Francis Crick had an early and lasting influence over the Helmholtz Club of which he was a founding pillar, and that from its inception, the club served as a constitutive element in his long-term plans for a neuroscience of vision and of cognition. Further, it argues that in this role, the Helmholtz Club served many purposes, the primary of which was to be a social forum for interdisciplinary discussion, where 'discussion' was not mere talk but was imbued with an epistemic value and as such, carefully cultivated. Finally, it questions what counts as 'doing science' and in turn, definitions of success and failure-and provides some material evidence towards re-appraising the successfulness of Crick's contribution to the neurosciences. Copyright © 2013 The Author. Published by Elsevier Ltd.. All rights reserved.

Differentiation of subsequent memory effects between retrieval practice and elaborative study.

Science.gov (United States)

Liu, Yi; Rosburg, Timm; Gao, Chuanji; Weber, Christine; Guo, Chunyan

2017-07-01

Retrieval practice enhances memory retention more than re-studying. The underlying mechanisms of this retrieval practice effect have remained widely unclear. According to the elaborative retrieval hypothesis, activation of elaborative information occurs to a larger extent during testing than re-studying. In contrast, the episodic context account has suggested that recollecting prior episodic information (especially the temporal context) contributes to memory retention. To adjudicate the distinction between these two accounts, the present study used the classical retrieval practice effect paradigm to compare retrieval practice and elaborative study. In an initial behavioral experiment, retrieval practice produced greater retention than elaboration and re-studying in a one-week delayed test. In a subsequent event-related potential (ERP) experiment, retrieval practice resulted in reliably superior accuracy in the delayed test compared to elaborative study. In the ERPs, a frontally distributed subsequent memory effect (SME), starting at 300ms, occurred in the elaborative study condition, but not in the retrieval practice condition. A parietal SME emerged in the retrieval practice condition from 500 to 700ms, but was absent in the elaborative study condition. After 700ms, a late SME was present in the retrieval practice condition, but not in the elaborative study condition. Moreover, SMEs lasted longer in retrieval practice than in elaboration. The frontal SME in the elaborative study condition might be related to semantic processing or working memory-based elaboration, whereas the parietal and widespread SME in the retrieval practice condition might be associated with episodic recollection processes. These findings contradict the elaborative retrieval theory, and suggest that contextual recollection rather than activation of semantic information contributes to the retrieval practice effect, supporting the episodic context account. Copyright © 2017. Published by

Changes across age groups in self-choice elaboration effects on incidental memory.

Science.gov (United States)

Toyota, Hiroshi; Konishi, Tomoko

2004-08-01

The present study investigated age differences in the effects of a self-choice elaboration and an experimenter-provided elaboration on incidental memory. Adults, sixth grade, and second grade subjects chose which of two sentence frames the target fit better in a self-choice elaboration condition. They then judged whether each target made sense in its sentence frame in the experimenter-provided elaboration, then did free recall tests. Only adults recalled better the targets with an image sentence with self-choice elaboration, rather than experimenter-provided elaboration. However, self-choice elaboration was far superior for the recall of targets with nonimage sentences only for second graders. Thus, the effects of self-choice elaboration were determined both by age and by type of sentence frame.

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

Science.gov (United States)

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

Deep-Elaborative Learning of Introductory Management Accounting for Business Students

Science.gov (United States)

Choo, Freddie; Tan, Kim B.

2005-01-01

Research by Choo and Tan (1990; 1995) suggests that accounting students, who engage in deep-elaborative learning, have a better understanding of the course materials. The purposes of this paper are: (1) to describe a deep-elaborative instructional approach (hereafter DEIA) that promotes deep-elaborative learning of introductory management…

The elaboration likelihood model and communication about food risks.

Science.gov (United States)

Frewer, L J; Howard, C; Hedderley, D; Shepherd, R

1997-12-01

Factors such as hazard type and source credibility have been identified as important in the establishment of effective strategies for risk communication. The elaboration likelihood model was adapted to investigate the potential impact of hazard type, information source, and persuasive content of information on individual engagement in elaborative, or thoughtful, cognitions about risk messages. One hundred sixty respondents were allocated to one of eight experimental groups, and the effects of source credibility, persuasive content of information and hazard type were systematically varied. The impact of the different factors on beliefs about the information and elaborative processing examined. Low credibility was particularly important in reducing risk perceptions, although persuasive content and hazard type were also influential in determining whether elaborative processing occurred.

Elaborating on Threshold Concepts

Science.gov (United States)

Rountree, Janet; Robins, Anthony; Rountree, Nathan

2013-01-01

We propose an expanded definition of Threshold Concepts (TCs) that requires the successful acquisition and internalisation not only of knowledge, but also its practical elaboration in the domains of applied strategies and mental models. This richer definition allows us to clarify the relationship between TCs and Fundamental Ideas, and to account…

About the elaboration of pure uranium dicarbide

International Nuclear Information System (INIS)

Besson, J.; Blum, P.; Guinet, Ph.; Spitz, J.

1963-01-01

In order to develop methods for the elaboration of as pure as possible uranium dicarbide, the authors report the study of different elaboration processes based on the reaction between uranium and carbon, or between uranium and hydrocarbon, or between uranium oxide and carbon. They finally choose a method which comprises an arc-induced fusion of a mixture of uranium dioxide and carbon. The fusion process is described. The influence of thermal treatments is discussed as well as the graphite electrode carburization

Sigmund Freud and the Crick-Koch hypothesis. A footnote to the history of consciousness studies.

Science.gov (United States)

Smith, D L

1999-06-01

The author describes Crick and Koch's recently developed theory of the neurophysiological basis of consciousness as synchronised neural oscillations. The thesis that neural oscillations provide the neurophysiological basis for consciousness was anticipated by Sigmund Freud in his 1895 'Project for a scientific psychology'. Freud attempted to solve his neuropsychological 'problem of quality' by means of the hypothesis that information concerning conscious sensory qualities is transmitted through the mental apparatus by means of neural 'periods'. Freud believed that information carried by neural oscillations would proliferate across 'contact-barriers' (synapses) without inhibition. Freud's theory thus appears to imply that synchronised neural oscillations are an important component of the neurophysiological basis of consciousness. It is possible that Freud's thesis was developed in response to the experimental research of the American neuroscientist M. M. Garver.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

Depth and Elaboration of Processing in Relation to Age.

Science.gov (United States)

Simon, Eileen

1979-01-01

The recall effectiveness of semantic and phonemic cues was compared to uncover the pattern of deep and elaborate processing in relation to age and experimental treatment. It was concluded that aging results in poor elaboration, especially in inefficient integration of word events with the context of presentation. (Author/CP)

Elaborative Processing in the Korsakoff Syndrome: Context versus Habit

Science.gov (United States)

Van Damme, Ilse; d'Ydewalle, Gery

2008-01-01

Using a procedure of Hay and Jacoby [Hay, J. F., & Jacoby, L. L. (1999). "Separating habit and recollection in young and older adults: Effects of elaborative processing and distinctiveness." "Psychology and Aging," 14, 122-134], Korsakoff patients' capacity to encode and retrieve elaborative, semantic information was investigated. Habits were…

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

The Effects of Levels of Elaboration on Learners' Strategic Processing of Text

Science.gov (United States)

Dornisch, Michele; Sperling, Rayne A.; Zeruth, Jill A.

2011-01-01

In the current work, we examined learners' comprehension when engaged with elaborative processing strategies. In Experiment 1, we randomly assigned students to one of five elaborative processing conditions and addressed differences in learners' lower- and higher-order learning outcomes and ability to employ elaborative strategies. Findings…

Menyoal Elaboration Likelihood Model (ELM) dan Teori Retorika

OpenAIRE

Yudi Perbawaningsih

2012-01-01

Abstract: Persuasion is a communication process to establish or change attitudes, which can be understood through theory of Rhetoric and theory of Elaboration Likelihood Model (ELM). This study elaborates these theories in a Public Lecture series which to persuade the students in choosing their concentration of study. The result shows that in term of persuasion effectiveness it is not quite relevant to separate the message and its source. The quality of source is determined by the quality of ...

Menyoal Elaboration Likelihood Model (ELM) Dan Teori Retorika

OpenAIRE

Perbawaningsih, Yudi

2012-01-01

: Persuasion is a communication process to establish or change attitudes, which can be understood through theory of Rhetoric and theory of Elaboration Likelihood Model (ELM). This study elaborates these theories in a Public Lecture series which to persuade the students in choosing their concentration of study. The result shows that in term of persuasion effectiveness it is not quite relevant to separate the message and its source. The quality of source is determined by the quality of the mess...

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

El desaprendizaje: propuesta para profesionales de la salud críticos Unlearning: Proposal for critic health professionals

Directory of Open Access Journals (Sweden)

J.L. Medina

2007-12-01

Full Text Available El desaprendizaje como método reflexivo de cuestionamiento crítico de la realidad, ayuda a examinar las estructuras teóricas que cada sujeto ha asimilado, frecuentemente de manera acrítica, durante su trayectoria formativa y profesional. Este examen crítico de las formas habituales de pensar y actuar en el mundo no pretende erigirse como guía del proceso de transición hacia formas de conciencia más verdaderas y fundamentadas. Lo que se busca, por el contrario, es realizar un ejercicio constante de interrogación de lo evidente y de aceptar los límites del pensamiento y las incertidumbres del presente.Unlearning as a reflexive method of critical questioning of reality helps us examine the theoretical structures that each individual has mastered, more often than not in an "acritical" manner, during his or her professional and formative trajectory. This critical examination of the habitual ways of thinking and behaving in today's world is not intended, however, to serve as a guide for this transition process towards more authentic and fundamental forms of awareness. On the contrary, what we are looking for is to perform a continuous questioning exercise of what is evident and to accept the limits of our thinking patterns and the uncertainties of our time.

Preattentive processing, poststimulus elaboration, and memory for emotionally arousing stimuli.

Science.gov (United States)

Migita, Mai; Otani, Hajime; Libkuman, Terry M; Sheffert, Sonya M

2011-01-01

Christianson (1992) proposed two mechanisms to explain emotionally enhanced memory: preattentive processing and poststimulus elaboration. Experiment 1 examined these processes by instructing participants to perform (1) a concurrent distractor task, (2) a continuous distractor task, or (3) both while viewing the negatively arousing, positively arousing, and neutral pictures. Recall of negatively arousing pictures showed a small decline in one of the distractor conditions, indicating that elaboration plays a minor role in remembering these pictures. Experiment 2 partially replicated Experiment 1 with an intentional learning instruction to investigate whether participants in Experiment 1 were anticipating a recall test. For all three picture types, recall declined in the continuous distractor task condition, indicating that elaboration played a role, even when the pictures were negatively arousing. Overall, these results were consistent with the notion that remembering negatively valenced stimuli is largely based on preattentive processing with a minor role played by poststimulus elaboration.

The coevolution of genes and genetic codes: Crick's frozen accident revisited.

Science.gov (United States)

Sella, Guy; Ardell, David H

2006-09-01

The standard genetic code is the nearly universal system for the translation of genes into proteins. The code exhibits two salient structural characteristics: it possesses a distinct organization that makes it extremely robust to errors in replication and translation, and it is highly redundant. The origin of these properties has intrigued researchers since the code was first discovered. One suggestion, which is the subject of this review, is that the code's organization is the outcome of the coevolution of genes and genetic codes. In 1968, Francis Crick explored the possible implications of coevolution at different stages of code evolution. Although he argues that coevolution was likely to influence the evolution of the code, he concludes that it falls short of explaining the organization of the code we see today. The recent application of mathematical modeling to study the effects of errors on the course of coevolution, suggests a different conclusion. It shows that coevolution readily generates genetic codes that are highly redundant and similar in their error-correcting organization to the standard code. We review this recent work and suggest that further affirmation of the role of coevolution can be attained by investigating the extent to which the outcome of coevolution is robust to other influences that were present during the evolution of the code.

Desaprendizagem Organizacional: Um Estudo de Campo na Universidade Federal de Santa Catarina

Directory of Open Access Journals (Sweden)

Gustavo Tomaz Buchele

2016-01-01

Full Text Available While organizations acquire new knowledge, a process called organizational learning, they also discard obsolete knowledge, a process called organizational unlearning. Organizational unlearning focuses on the disposal of old routines to make way for new ones, and its study has received limited attention from research. Thus, due to the need for greater understanding of the unlearning process, the study presented here aims to describe the organizational unlearning process in a public organization, a context even less studied than private organizations. For this, support by the theory of organizational routines, we used field research to describe the organizational unlearning process in one of Colleges of the Federal University of Santa Catarina. Among other things, changes were found to act as levers for organizational unlearning, and organizational learning and unlearning are closely linked through the introduction and disposal of organizational routines.

Emotion processing in the aging brain is modulated by semantic elaboration

Science.gov (United States)

Ritchey, Maureen; Bessette-Symons, Brandy; Hayes, Scott M.; Cabeza, Roberto

2010-01-01

The neural correlates of emotion processing have been shown to vary with age: older adults (OAs) exhibit increased frontal activations and, under some circumstances, decreased amygdala activations relative to young adults (YAs) during emotion processing. Some of these differences are additionally modulated by valence, with age-related biases toward positive versus negative stimuli, and are thought to depend on OAs’ capacity for controlled elaboration. However, the role of semantic elaboration in mediating valence effects in the aging brain has not yet been explicitly tested. In the present study, YAs and OAs were scanned while they viewed negative, neutral, and positive pictures during either a deep, elaborative task or a shallow, perceptual task. FMRI results reveal that emotion-related activity in the amygdala is preserved in aging and insensitive to elaboration demands. This study provides novel evidence that differences in valence processing are modulated by elaboration: relative to YAs, OAs show enhanced activity in the medial prefrontal cortex (PFC) and ventrolateral PFC in response to positive versus negative stimuli, but only during elaborative processing. These positive valence effects are predicted by individual differences in executive function in OAs for the deep but not shallow task. Finally, psychophysiological interaction analyses reveal age effects on valence-dependent functional connectivity between medial PFC and ventral striatum, as well as age and task effects on medial PFC-retrosplenial cortex interactions. Altogether, these findings provide support for the hypothesis that valence shifts in the aging brain are mediated by controlled processes such as semantic elaboration, self-referential processing, and emotion regulation. PMID:20869375

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Emotion processing in the aging brain is modulated by semantic elaboration.

Science.gov (United States)

Ritchey, Maureen; Bessette-Symons, Brandy; Hayes, Scott M; Cabeza, Roberto

2011-03-01

The neural correlates of emotion processing have been shown to vary with age: older adults (OAs) exhibit increased frontal activations and, under some circumstances, decreased amygdala activations relative to young adults (YAs) during emotion processing. Some of these differences are additionally modulated by valence, with age-related biases toward positive versus negative stimuli, and are thought to depend on OAs' capacity for controlled elaboration. However, the role of semantic elaboration in mediating valence effects in the aging brain has not yet been explicitly tested. In the present study, YAs and OAs were scanned while they viewed negative, neutral, and positive pictures during either a deep, elaborative task or a shallow, perceptual task. fMRI results reveal that emotion-related activity in the amygdala is preserved in aging and insensitive to elaboration demands. This study provides novel evidence that differences in valence processing are modulated by elaboration: relative to YAs, OAs show enhanced activity in the medial prefrontal cortex (PFC) and ventrolateral PFC in response to positive versus negative stimuli, but only during elaborative processing. These positive valence effects are predicted by individual differences in executive function in OAs for the deep but not shallow task. Finally, psychophysiological interaction analyses reveal age effects on valence-dependent functional connectivity between medial PFC and ventral striatum, as well as age and task effects on medial PFC-retrosplenial cortex interactions. Altogether, these findings provide support for the hypothesis that valence shifts in the aging brain are mediated by controlled processes such as semantic elaboration, self-referential processing, and emotion regulation. Copyright © 2010 Elsevier Ltd. All rights reserved.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Open Veterinary Journal: Submissions

African Journals Online (AJOL)

Papers describing experiments that demonstrate a lack of concern for current ethical and ... Capitalize trade names and include the manufacturer's full name and address. ... A Book: Durbin, R., Eddy, S.R., Krogh, A. and Mitchison, G. 1999.

Depth and elaboration of processing in relation to age.

Science.gov (United States)

Simon, E

1979-03-01

Processing at encoding and retrieval was jointly manipulated, and then the retrieval effectiveness of different cues was directly compared to uncover the relative pattern of deep and elaborate processing in relation to both age and different experimental manipulations. In experiment 1 phonemic and semantic cues were effective retrieval aids for to-be-remembered words in the youngest group; with increasing age, semantic cues decreased in effectiveness more than phonemic cues. These data showed phonemic features to have an importance that is not recognized in the data generated by the typical levels paradigm. When elaboration of the words was induced in Experiment 2 by presenting them in sentences, semantic and context cues were most effective in the youngest group whereas phonemic cues were most effective in the oldest group. Since the pattern of cue effectiveness in the elderly was similar to that in Experiment 1, where the same words were presented alone, it was concluded that aging results in poor elaboration, in particular, in inefficient integration of word events with the context of presentation. These age effects were mimicked in young subjects in Experiment 3 by experimentally restricting encoding time. The present approach uses somewhat modified views of depth and elaboration.

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Elaboration of invariant safety properties from fault-tree analysis

OpenAIRE

Henry , Sébastien; Faure , Jean-Marc

2003-01-01

International audience; Formal verification of PLC programs using model-checking requires to elaborate previously temporal logic formulae which state in a formal way the properties that must be checked. Unfortunately temporal logic is a formalism totally unknown by automation engineers. This explains why PLC programs developers willing to verify the behavior of their programs are unable to use the existing modelchecking tools. Temporal logic formulae elaboration is a too difficult task. In or...

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Conflict Elaboration and Cognitive Outcomes

OpenAIRE

Buchs, Céline; Butera, Fabrizio; Mugny, Gabriel; Darnon, Céline

2004-01-01

This article presents advice for teachers about using sociocognitive conflicts to promote academic learning. In doing so, the conditions under which sociocognitive conflicts are constructive or disruptive are examined and the relevant research is reviewed on social development, cooperative learning, and social influence. Two types of conflict elaboration—epistemic and relational—are identified. Epistemic elaborations focus students on task resolution leading to positive cognitive outcomes, an...

Using Elaborative Interrogation Enhanced Worked Examples to Improve Chemistry Problem Solving

Science.gov (United States)

Pease, Rebecca Simpson

2012-01-01

Elaborative interrogation, which prompts students to answer why-questions placed strategically within informational text, has been shown to increase learning comprehension through reading. In this study, elaborative interrogation why-questions requested readers to explain why paraphrased statements taken from a reading were "true."…

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

PPR: a database for radiologic protection plan elaboration

International Nuclear Information System (INIS)

Goncalves, M.; Farias, J.T. de; Batista, D.V.

2001-01-01

The Plan of Radiation Protection is a document demanded for Licensing of the Radioactive Installations. It establishes the system of Radioprotection to be implemented by the Service of Radiation Protection. Its main objective is to achieve the requirements of Radiation Protection and Safety constants in the regulations CNEN-NE-3.01 - Basic Guidelines of Radiation Protection and CNEN-NE-3.06 - Requirements of Radiation Protection and Safety for Services of Radiotherapy. The proposal presented here has the aim to easy the development and the uniformity of the elaboration of the Plan of Radiation Protection. Considering the difficulties found by the physicists responsible for the services in developing a Plan of Radiation Protection that contemplate all the necessary requirements, as well as the final analysis accomplished by CNEN, the present project was elaborated. This consists of a software of easy use, developed according to the most modern patterns of programming, allowing to the user to elaborate the Plan of Radiation Protection in agreement with to basic needs of the Installation. Soon the software will be available in the page web of CNEN for download. (author)

Menyoal Elaboration Likelihood Model (ELM dan Teori Retorika

Directory of Open Access Journals (Sweden)

Yudi Perbawaningsih

2012-06-01

Full Text Available Abstract: Persuasion is a communication process to establish or change attitudes, which can be understood through theory of Rhetoric and theory of Elaboration Likelihood Model (ELM. This study elaborates these theories in a Public Lecture series which to persuade the students in choosing their concentration of study. The result shows that in term of persuasion effectiveness it is not quite relevant to separate the message and its source. The quality of source is determined by the quality of the message, and vice versa. Separating the two routes of the persuasion process as described in the ELM theory would not be relevant. Abstrak: Persuasi adalah proses komunikasi untuk membentuk atau mengubah sikap, yang dapat dipahami dengan teori Retorika dan teori Elaboration Likelihood Model (ELM. Penelitian ini mengelaborasi teori tersebut dalam Kuliah Umum sebagai sarana mempersuasi mahasiswa untuk memilih konsentrasi studi studi yang didasarkan pada proses pengolahan informasi. Menggunakan metode survey, didapatkan hasil yaitu tidaklah cukup relevan memisahkan pesan dan narasumber dalam melihat efektivitas persuasi. Keduanya menyatu yang berarti bahwa kualitas narasumber ditentukan oleh kualitas pesan yang disampaikannya, dan sebaliknya. Memisahkan proses persuasi dalam dua lajur seperti yang dijelaskan dalam ELM teori menjadi tidak relevan.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Knowledge-based support system for requirement elaboration in design

International Nuclear Information System (INIS)

Furuta, Kazuo; Kondo, Shunsuke

1994-01-01

Design requirements are the seeds of every design activity, but elicitation and formalization of them are not easy tasks. This paper proposes a method to support designers in such requirement elaboration process with a computer. In this method the cognitive work space of designers is modeled by abstraction and structural hierarchies, and supporting functions of knowledge-based requirement elaboration, requirement classification and assessment of contentment status of requirements are provided on this framework. A prototype system was developed and tested using fast breeder reactor design. (author)

Elaborated contextual framing is necessary for action-based attitude acquisition.

Science.gov (United States)

Laham, Simon M; Kashima, Yoshihisa; Dix, Jennifer; Wheeler, Melissa; Levis, Bianca

2014-01-01

Although arm flexion and extension have been implicated as conditioners of attitudes, recent work casts some doubt on the nature and strength of the coupling of these muscle contractions and stimulus evaluation. We propose that the elaborated contextual framing of flexion and extension actions is necessary for attitude acquisition. Results showed that when flexion and extension were disambiguated via elaborated contextual cues (i.e., framed as collect and discard within a foraging context), neutral stimuli processed under flexion were liked more than neutral stimuli processed under extension. However, when unelaborated framing was used (e.g., mere stimulus zooming effects), stimulus evaluation did not differ as a function of muscle contractions. These results suggest that neither arm contractions per se nor unelaborated framings are sufficient for action-based attitude acquisition, but that elaborated framings are necessary.

Socialization of Past Event Talk: Cultural Differences in Maternal Elaborative Reminiscing

Science.gov (United States)

Tougu, Pirko; Tulviste, Tiia; Schroder, Lisa; Keller, Heidi; De Geer, Boel

2011-01-01

This study examines mother-child reminiscing conversations with respect to variation in use and function of mothers' elaborations, the nature of children's memory elaborations, and the connections between the two, in three Western middle-class cultures where autonomy is valued over relatedness. Mothers participated with their 4-year-old children…

Fulltext PDF

Indian Academy of Sciences (India)

0000384

10.1007/s12041-017-0847-y. © Indian Academy of Sciences. 725. HALDANE AT 125. In the Dark Hours*. Naomi Mitchison. *Naomi M tchison (1897-1999). Article reproduced with permission from J. B. S. Hald ne, a tribute (Indian Statistical ...

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

[Elaboration and critical evaluation of clinical guidelines].

Science.gov (United States)

García Villar, C

2015-11-01

Clinical guidelines are documents to help professionals and patients select the best diagnostic or therapeutic option. Elaborating guidelines requires an efficient literature search and a critical evaluation of the articles found to select the most appropriate ones. After that, the recommendations are formulated and then must be externally evaluated before they can be disseminated. Even when the guidelines are very thorough and rigorous, it is important to know whether they fulfill all the methodological requisites before applying them. With this aim, various scales have been developed to critically appraise guidelines. Of these, the AGREE II instrument is currently the most widely used. This article explains the main steps in elaborating clinical guidelines and the main aspects that should be analyzed to know whether the guidelines are well written. Copyright © 2015 SERAM. Published by Elsevier España, S.L.U. All rights reserved.

Lateral and medial prefrontal contributions to emotion generation by semantic elaboration during episodic encoding.

Science.gov (United States)

Kaneda, Takumi; Shigemune, Yayoi; Tsukiura, Takashi

2017-02-01

Memories for emotion-laden stimuli are remembered more accurately than those for neutral stimuli. Although this enhancement reflects stimulus-driven modulation of memory by emotions, functional neuroimaging evidence of the interacting mechanisms between emotions generated by intentional processes, such as semantic elaboration, and memory is scarce. The present fMRI study investigated how encoding-related activation is modulated by emotions generated during the process of semantic elaboration. During encoding with fMRI, healthy young adults viewed neutral (target) pictures either passively or with semantic elaboration. In semantic elaboration, participants imagined background stories related to the pictures. Encoding trials with semantic elaboration were subdivided into conditions in which participants imagined negative, positive, or neutral stories. One week later, memories for target pictures were tested. In behavioral results, memories for target pictures were significantly enhanced by semantic elaboration, compared to passive viewing, and the memory enhancement was more remarkable when negative or positive stories were imagined. fMRI results demonstrated that activations in the left inferior frontal gyrus and dorsal medial prefrontal cortex (dmPFC) were greater during the encoding of target pictures with semantic elaboration than those with passive viewing, and that these activations further increased during encoding with semantic elaboration of emotional stories than of neutral stories. Functional connectivity between the left inferior frontal gyrus and dmPFC/hippocampus during encoding significantly predicted retrieval accuracies of memories encoded with self-generated emotional stories. These findings suggest that networks including the left inferior frontal region, dmPFC, and hippocampus could contribute to the modulation of memories encoded with the emotion generation.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Elaboration in the area of low temperature chlorination of rare-metal crude ore

International Nuclear Information System (INIS)

Mirsaidov, U.M.

2002-01-01

The chemical base of low temperature chlorination of rare-metal crude ore was elaborated. The chemical nature of chlorination process which pass at low temperature was decoded and scientifically elaborated

Training Mothers in Elaborative Reminiscing Enhances Children's Autobiographical Memory and Narrative

Science.gov (United States)

Reese, Elaine; Newcombe, Rhiannon

2007-01-01

This longitudinal intervention assessed children's memory at 2-1/2 years (short-term posttest; N = 115) and their memory and narrative at 3-1/2 years (long-term posttest; N = 100) as a function of maternal training in elaborative reminiscing when children were 1-1/2 to 2-1/2 years. At both posttests, trained mothers were more elaborative in their…

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Note of the 20 December 2016 on the elaboration of regional biomass schemes

International Nuclear Information System (INIS)

Michel, Laurent; GESLAIN-LANEELLE, Catherine

2016-01-01

This official note informs Region prefects on modalities of elaboration of regional biomass schemes, and provides them with data on mobilizable biomass resources at the regional level. It briefly presents the legal framework of the scheme elaboration, the elaboration agenda, and the scope of usages of biomass to be considered within the scheme. It discusses the articulation between regional and national schemes, from a global point of view as well as in terms works of elaboration. It briefly describes how the regional scheme is to be assessed. Appendices present planning and programming elements to be taken into account, elements of explanation for the regional biomass table, institutions represented in the information and orientation committee of the national scheme, and regional biomass tables which contain detailed assessments of the various biomass resources for each French region

Production improves memory equivalently following elaborative vs non-elaborative processing.

Science.gov (United States)

Forrin, Noah D; Jonker, Tanya R; MacLeod, Colin M

2014-01-01

Words that are read aloud are better remembered than those read silently. Recent research has suggested that, rather than reflecting a benefit for produced items, this production effect may reflect a cost to reading silently in a list containing both aloud and silent items (Bodner, Taikh, & Fawcett, 2013). This cost is argued to occur because silent items are lazily read, receiving less attention than aloud items which require an overt response. We examined the possible role of lazy reading in the production effect by testing whether the effect would be reduced under elaborative encoding, which precludes lazy reading of silent items. Contrary to a lazy reading account, we found that production benefited generated words as much as read words (Experiment 1) and deeply imagined words as much as shallowly imagined words (Experiment 2). We conclude that production stands out as equally distinct-and consequently as equally memorable-regardless of whether it accompanies deep or shallow processing, evidence that is inconsistent with a lazy reading account.

Elaboration of supports for beta emitting sources (with vyns)

International Nuclear Information System (INIS)

Cortes P, A.; Torre O, J. De la; Tejera R, A.; Becerril V, A.; Bribiesca S, L.

1990-04-01

The Laboratory of Radioactive patterns account with a 4 πβ-γ coincidence system of recent acquisition with which absolute measures of radioactive activity with uncertainties of the order of 0.1% can be made. Since the coincidence method for the activity measure consists on detecting to the particle and the photon corresponding to oneself nuclear disintegration, it is necessary to elaborate special radioactive sources on thin supports, in order to allowing the maximum possible fluence of β particles (∼ 100%). This work a technique for the elaboration of these sources and for the measure of the thickness of the walls of the support is presented. (Author)

CONSORT 2010 explanation and elaboration

DEFF Research Database (Denmark)

Moher, David; Hopewell, Sally; Schulz, Kenneth F

2012-01-01

improves the wording and clarity of the previous checklist and incorporates recommendations related to topics that have only recently received recognition, such as selective outcome reporting bias. This explanatory and elaboration document-intended to enhance the use, understanding, and dissemination...... of the CONSORT statement-has also been extensively revised. It presents the meaning and rationale for each new and updated checklist item providing examples of good reporting and, where possible, references to relevant empirical studies. Several examples of flow diagrams are included. The CONSORT 2010 Statement...

Early bactericidal activity of ethambutol, pyrazinamide and the fixed ...

African Journals Online (AJOL)

sputum/day, that for pyrazinamide was 0.003 ± 0.014 log". CFU/ml sputum/day and ... P. R. Donald., O.Oi~ O.T.M.&H~ MAC.?, F.C.P. (S.AJ. South African ... Department of Medical Microbiology, St George's Hospital, London, UK. D. A Mitchison ...

Elaboration of recycled polyethylene foams reticulated by radiation

International Nuclear Information System (INIS)

Galicia M, M.

2000-01-01

In this work some obtained results are presented to make irradiation tests on recycled polymeric material (polyethylene) as well as mixtures of this with certain additive classes (foaming and reticulating agents) which will be used for the foams elaboration, objective of this work. Two types of foaming basically exist which are elaborated with low density polyethylene base. They are: a) the extruded and, b) the reticulated through ionizing radiation and chemically. Some of the properties that the expanded or foamed polyethylene are: flexibility, resistance, thermal stability, inter medium mechanical properties between the highly flexible foams and rigid among others. All of them determined by the cell type which conform them. Also was carried out the characterization of the obtained material contributing of this manner to diminish the quantity of solid wastes generated. (Author)

The protein side of the central dogma: permanence and change.

Science.gov (United States)

Morange, Michel

2006-01-01

There are two facets to the central dogma proposed by Francis Crick in 1957. One concerns the relation between the sequence of nucleotides and the sequence of amino acids, the second is devoted to the relation between the sequence of amino acids and the native three-dimensional structure of proteins. 'Folding is simply a function of the order of the amino acids,' i.e. no information is required for the proper folding of a protein other than the information contained in its sequence. This protein side of the central dogma was elaborated in a scientific context in which the characteristics and functions of proteins, and the mechanisms of protein folding, were seen very differently. This context, which made the folding problem a simple one, supported the bold proposition of Francis Crick. The protein side of the central dogma was not challenged by the discovery of prions if one adopts the definition of information given by Francis Crick. It might have been challenged by the discovery that regulatory enzymes exist in different conformations, and the evidence for the existence of chaperones assisting protein folding. But it was not, and folding remains what it was for Francis Crick, 'simply a function of the order of amino acids'. But the meaning of 'function' has dramatically changed. It is no longer the result of simple physicochemical laws, but that of a long evolutionary process which has optimized protein folding. Molecular mechanistic explanations have to be allied with evolutionary explanations, in a way characteristic of present biology.

Xenopus egg cytoplasm with intact actin.

Science.gov (United States)

Field, Christine M; Nguyen, Phuong A; Ishihara, Keisuke; Groen, Aaron C; Mitchison, Timothy J

2014-01-01

We report optimized methods for preparing Xenopus egg extracts without cytochalasin D, that we term "actin-intact egg extract." These are undiluted egg cytoplasm that contains abundant organelles, and glycogen which supplies energy, and represents the least perturbed cell-free cytoplasm preparation we know of. We used this system to probe cell cycle regulation of actin and myosin-II dynamics (Field et al., 2011), and to reconstitute the large, interphase asters that organize early Xenopus embryos (Mitchison et al., 2012; Wühr, Tan, Parker, Detrich, & Mitchison, 2010). Actin-intact Xenopus egg extracts are useful for analysis of actin dynamics, and interaction of actin with other cytoplasmic systems, in a cell-free system that closely mimics egg physiology, and more generally for probing the biochemistry and biophysics of the egg, zygote, and early embryo. Detailed protocols are provided along with assays used to check cell cycle state and tips for handling and storing undiluted egg extracts. © 2014 Elsevier Inc. All rights reserved.

Emotion processing in the aging brain is modulated by semantic elaboration

OpenAIRE

Ritchey, Maureen; Bessette-Symons, Brandy; Hayes, Scott M.; Cabeza, Roberto

2010-01-01

The neural correlates of emotion processing have been shown to vary with age: older adults (OAs) exhibit increased frontal activations and, under some circumstances, decreased amygdala activations relative to young adults (YAs) during emotion processing. Some of these differences are additionally modulated by valence, with age-related biases toward positive versus negative stimuli, and are thought to depend on OAs’ capacity for controlled elaboration. However, the role of semantic elaboration...

The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

2003-01-01

Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

Elaborative Retrieval: Do Semantic Mediators Improve Memory?

Science.gov (United States)

Lehman, Melissa; Karpicke, Jeffrey D.

2016-01-01

The elaborative retrieval account of retrieval-based learning proposes that retrieval enhances retention because the retrieval process produces the generation of semantic mediators that link cues to target information. We tested 2 assumptions that form the basis of this account: that semantic mediators are more likely to be generated during…

The experience on public consultation in the elaboration of nuclear regulations

International Nuclear Information System (INIS)

Monteiro, Iara A.; Pitta, Maria Adelia R.; Pereira, Enneite S.; Wieland, Patricia

2009-01-01

This paper presents and discusses the process of public consultation followed by the regulatory body, Nuclear Energy National Commission (CNEN), during the elaboration of nuclear regulations. In this paper, the due legislation on federal administration, law n. 9784/99, is referred to and the procedures established by CNEN for the elaboration of a nuclear regulation are described. The public consultation has the objective of improving the democratization of nuclear regulations elaboration process, allowing the participation of interested parties such as professional associations directly involved, organizations interested in its application and the general public. During the process of elaboration of a nuclear regulation, the basic text is, first of all, discussed and improved by a task group. This group is composed by CNEN's officials and representatives of organizations, enterprises and public agencies involved in the related area. Once the first version of the proposed regulation is ready, it is formally open to consultation and posted at CNEN website for a period of time. The suggestions, therein presented on-line, are analyzed by the task group and the conclusions are also posted at the site; those considered pertinent are incorporated to proposed regulation. As an example, the public consultation results obtained in 2008 with the revision of the CNEN-NN-6.02: Licensing of Radioactive Facilities regulation, are presented. Such results cover two aspects: the analysis of the participants profile and the analysis of the contributions. Public participation in the elaboration of nuclear regulations is a new way for CNEN to know the licensees and public demands, doubts and needs. This tool has demonstrated usefulness and therefore must be maintained by the regulatory body. (author)

Elaboration of Statistics Learning Objects for Mobile Devices

Directory of Open Access Journals (Sweden)

Francisco Javier Tapia Moreno

2012-04-01

Full Text Available Mobile learning (m-learning allows a person to study using a mobile computer device anywhere and anytime. In this work we report the elaboration of learning objects for the teaching of introductory statistics using cellular phones.

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Geographic assistance of decontamination strategy elaboration

International Nuclear Information System (INIS)

Davydchuk, V.; Arapis, G.

1996-01-01

Those who elaborates the strategy of decontamination of vast territories is to take into consideration the heterogeneity of such elements of landscape as relief, lithology, humidity and types of soils and, vegetation, both on local and regional level. Geographic assistance includes evaluation of efficacy of decontamination technologies in different natural conditions, identification of areas of their effective application and definition of ecological damage, estimation of balances of the radionuclides in the landscapes to create background of the decontamination strategy

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

Science.gov (United States)

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Origins of knowledge: Insights from precocial species

Directory of Open Access Journals (Sweden)

Elisabetta eVersace

2015-12-01

Full Text Available Behavioural responses are influenced by knowledge acquired during the lifetime of an individual and by predispositions transmitted across generations. Establishing the origin of knowledge and the role of the unlearned component is a challenging task, given that both learned and unlearned knowledge can orient perception, learning, and the encoding of environmental features since the first stages of life. Ethical and practical issues constrain the investigation of unlearned knowledge in altricial species, including human beings. On the contrary, precocial animals can be tested on a wide range of tasks and capabilities immediately after birth and in controlled rearing conditions. Insects and precocial avian species are very convenient models to dissect the knowledge systems that enable young individuals to cope with their environment in the absence of specific previous experience. We present the state of the art of research on the origins of knowledge that come from different models and disciplines. Insects have been mainly used to investigate unlearned sensory preferences and prepared learning mechanisms. The relative simplicity of the neural system and fast life cycle of insects make them ideal models to investigate the neural circuitry and evolutionary dynamics of unlearned traits. Among avian species, chicks of the domestic fowl have been the focus of many studies, and showed to possess unlearned knowledge in the sensory, physical, spatial, numerical and social domains. Solid evidence shows the existence of unlearned knowledge in different domains in several species, from sensory and social preferences to the left-right representation of the mental number line. We show how non-mammalian models of cognition, and in particular precocial species, can shed light into the adaptive value and evolutionary history of unlearned knowledge.

Origins of Knowledge: Insights from Precocial Species.

Science.gov (United States)

Versace, Elisabetta; Vallortigara, Giorgio

2015-01-01

Behavioral responses are influenced by knowledge acquired during the lifetime of an individual and by predispositions transmitted across generations. Establishing the origin of knowledge and the role of the unlearned component is a challenging task, given that both learned and unlearned knowledge can orient perception, learning, and the encoding of environmental features since the first stages of life. Ethical and practical issues constrain the investigation of unlearned knowledge in altricial species, including human beings. On the contrary, precocial animals can be tested on a wide range of tasks and capabilities immediately after birth and in controlled rearing conditions. Insects and precocial avian species are very convenient models to dissect the knowledge systems that enable young individuals to cope with their environment in the absence of specific previous experience. We present the state of the art of research on the origins of knowledge that comes from different models and disciplines. Insects have been mainly used to investigate unlearned sensory preferences and prepared learning mechanisms. The relative simplicity of the neural system and fast life cycle of insects make them ideal models to investigate the neural circuitry and evolutionary dynamics of unlearned traits. Among avian species, chicks of the domestic fowl have been the focus of many studies, and showed to possess unlearned knowledge in the sensory, physical, spatial, numerical and social domains. Solid evidence shows the existence of unlearned knowledge in different domains in several species, from sensory and social preferences to the left-right representation of the mental number line. We show how non-mammalian models of cognition, and in particular precocial species, can shed light into the adaptive value and evolutionary history of unlearned knowledge.

Signaling Elaboration: Combining French Gerund Clauses with Lexical Cohesion Cues

Directory of Open Access Journals (Sweden)

Marianne Vergez-Couret

2012-07-01

Full Text Available In this paper, we focus on the Elaboration relation and on its automatic identification in French, using the theoretical framework of Segmented Discourse Representation Theory (SDRT. One of the information sources identified by the SDRT framework to infer the Elaboration relation is based on the existence of a potential subsumption link between the eventualities at stake, depending on lexical semantics and world knowledge. We investigate this claim by combining a weak syntactic marker of the Elaboration relation, namely the gerund clause, with lexical cohesion cues. We aim at automatically identifying gerund clauses which are Elaborations by finding cohesive links between the host main clause and the gerund clause. This approach makes it possible to accurately detect few cases of intra-sentential Elaborations in our corpus, confirming the fact that lexical cohesion cues are relevant for this task.Dans cet article, nous nous focalisons sur la relation d’Élaboration en français, telle qu’elle est décrite dans le modèle théorique de la SDRT (Segmented Discourse Representation Theory, et sur son identification automatique. Selon la SDRT, une des sources d’information permettant d’inférer la relation d’Élaboration est basée sur l’existence d’un lien de subsomption entre les types des éventualités des segments à relier, indiquant que le type de la seconde éventualité est un sous-type de celui de la première dans la sémantique lexicale des éventualités ou grâce à des connaissances du monde. Nous proposons de contribuer à cette question en combinant un indice de la relation d’Élaboration, i. e. la construction syntaxique du gérondif, et des indices de cohésion lexicale. Notre objectif est d’identifier automatiquement des propositions gérondives qui sont des Élaborations en repérant des indices de cohésion lexicale entre la proposition principale et la proposition gérondive. Cette approche permet de d

Elaboration in the area of aluminium containing alloys

International Nuclear Information System (INIS)

Mirsaidov, U.M.

2002-01-01

In the Institute of Chemistry was elaborated the experimental-industrial installation and technology of deep aluminium purification by the methods of zone melting and recrystallization. The developed technology let receive the metal of model A5 N A6 N dependence from number of induction zone passage

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

Differential-associative processing or example elaboration: Which strategy is best for learning the definitions of related and unrelated concepts?

Science.gov (United States)

Hannon, Brenda

2012-10-01

Definitions of related concepts (e.g., genotype - phenotype ) are prevalent in introductory classes. Consequently, it is important that educators and students know which strategy(s) work best for learning them. This study showed that a new comparative elaboration strategy, called differential-associative processing, was better for learning definitions of related concepts than was an integrative elaborative strategy, called example elaboration. This outcome occurred even though example elaboration was administered in a naturalistic way (Experiment 1) and students spent more time in the example elaboration condition learning (Experiments 1, 2, 3), and generating pieces of information about the concepts (Experiments 2 and 3). Further, with unrelated concepts ( morpheme-fluid intelligence ), performance was similar regardless if students used differential-associative processing or example elaboration (Experiment 3). Taken as a whole, these results suggest that differential-associative processing is better than example elaboration for learning definitions of related concepts and is as good as example elaboration for learning definitions of unrelated concepts.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Elaboration and Autonomy Support in Low-Income Mothers' Reminiscing: Links to Children's Autobiographical Narratives

Science.gov (United States)

Leyva, Diana; Reese, Elaine; Grolnick, Wendy; Price, Carrie

2008-01-01

Maternal elaboration and autonomy support during reminiscing facilitate middle-class children's autobiographical narrative skills. In this study, low-income Hispanic, White, and Black mothers' elaboration and autonomy support in reminiscing were examined in relation to children's joint and independent autobiographical narratives and engagement.…

Controlled elaboration of large-area plasmonic substrates by plasma process

International Nuclear Information System (INIS)

Pugliara, A; Despax, B; Makasheva, K; Bonafos, C; Carles, R

2015-01-01

Elaboration in a controlled way of large-area and efficient plasmonic substrates is achieved by combining sputtering of silver nanoparticles (AgNPs) and plasma polymerization of the embedding dielectric matrix in an axially asymmetric, capacitively coupled RF discharge maintained at low gas pressure. The plasma parameters and deposition conditions were optimized according to the optical response of these substrates. Structural and optical characterizations of the samples confirm the process efficiency. The obtained results indicate that to deposit a single layer of large and closely situated AgNPs, a high injected power and short sputtering times must be privileged. The plasma-elaborated plasmonic substrates appear to be very sensitive to any stimuli that affect their plasmonic response. (paper)

Increasing the Persuasiveness of Fear Appeals: The Effect of Arousal and Elaboration.

OpenAIRE

Keller, Punam Anand; Block, Lauren Goldberg

1996-01-01

We investigate the conditions under which messages that prompt low and high levels of fear are likely to be effective. Our premise is that when a low level of fear is ineffective, it is because there is insufficient elaboration of the harmful consequences of engaging in the destructive behavior. By contrast, when appeals arousing high levels of fear are ineffective, it is because too much elaboration on the harmful consequences interferes with processing of the recommended change in behavior....

ATTITUDE-CHANGE FOLLOWING PERSUASIVE COMMUNICATION - INTEGRATING SOCIAL JUDGMENT THEORY AND THE ELABORATION LIKELIHOOD MODEL

NARCIS (Netherlands)

SIERO, FW; DOOSJE, BJ

1993-01-01

An experiment was conducted to examine the influence of the perceived extremity of a message and motivation to elaborate upon the process of persuasion. The first goal was to test a model of attitude change relating Social Judgment Theory to the Elaboration Likelihood Model. The second objective was

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

The arison data acquisition and elaboration software package running on Hewlett-Packard minicomputer

International Nuclear Information System (INIS)

Diamantidis, Z.

1987-01-01

In this article, a data acquisition and elaboration system is described consisting in a PCM data acquisition and a spectrum analyser system and their data elaboration package for reactor safety or other general purposes. Measurements on temperature, noise fluctuations of temperature or other noise analysis dynamics, pressure, etc. Time series and their conversion in engineering units and their statistical and frequency analysis is provided

Maternal Elaborative Reminiscing Mediates the Effect of Child Maltreatment on Behavioral and Physiological Functioning

Science.gov (United States)

Valentino, Kristin; Hibel, Leah C; Cummings, E. Mark; Nuttall, Amy K.; Comas, Michelle; McDonnell, Christina G.

2016-01-01

Theoretical and empirical evidence suggest that the way in which parents discuss everyday emotional experiences with their young children (i.e., elaborative reminiscing) has significant implications for child cognitive and socio-emotional functioning, and that maltreating parents have a particularly difficult time in engaging in this type of dialogue. This dyadic interactional exchange, therefore, has the potential to be an important process variable linking child maltreatment to developmental outcomes at multiple levels of analysis. The current investigation evaluated the role of maternal elaborative reminiscing in associations between maltreatment and child cognitive, emotional, and physiological functioning. Participants included 43 maltreated and 49 nonmaltreated children (aged 3–6) and their mothers. Dyads participated in a joint reminiscing task about four past emotional events, and children participated in assessments of receptive language and emotion knowledge. Child salivary cortisol was also collected from children three times a day (waking, midday, and bedtime) on two consecutive days to assess daily levels and diurnal decline. Results indicated that maltreating mothers engaged in significantly less elaborative reminiscing than nonmaltreating mothers. Maternal elaborative reminiscing mediated associations between child maltreatment and child receptive language and child emotion knowledge. Additionally, there was support for an indirect pathway between child maltreatment and child cortisol diurnal decline through maternal elaborative reminiscing. Directions for future research are discussed and potential clinical implications are addressed. PMID:26535941

Reconceptualizing Social Influence in Counseling: The Elaboration Likelihood Model.

Science.gov (United States)

McNeill, Brian W.; Stoltenberg, Cal D.

1989-01-01

Presents Elaboration Likelihood Model (ELM) of persuasion (a reconceptualization of the social influence process) as alternative model of attitude change. Contends ELM unifies conflicting social psychology results and can potentially account for inconsistent research findings in counseling psychology. Provides guidelines on integrating…

Review of Elaboration Likelihood Model of persuasion

OpenAIRE

藤原, 武弘; 神山, 貴弥

1989-01-01

This article mainly introduces Elaboration Likelihood Model (ELM), proposed by Petty & Cacioppo, that is, a general attitude change theory. ELM posturates two routes to persuasion; central and peripheral route. Attitude change by central route is viewed as resulting from a diligent consideration of the issue-relevant informations presented. On the other hand, attitude change by peripheral route is viewed as resulting from peripheral cues in the persuasion context. Secondly we compare these tw...

Fulltext PDF

Indian Academy of Sciences (India)

Partha P. Majumder

of us (PPM), Haldane's birth centenary was celebrated in India at the Indian Statistical Institute, Calcutta, where he had worked from 1957 to 1961. Now, 25 years on, the ... An attempt has been made to roughly order the remaining pieces in a sequence that might be described as 'Haldane the person' (Naomi Mitchison, N. A. ...

The effects of refreshing and elaboration on working memory performance, and their contributions to long-term memory formation.

Science.gov (United States)

Bartsch, Lea M; Singmann, Henrik; Oberauer, Klaus

2018-03-19

Refreshing and elaboration are cognitive processes assumed to underlie verbal working-memory maintenance and assumed to support long-term memory formation. Whereas refreshing refers to the attentional focussing on representations, elaboration refers to linking representations in working memory into existing semantic networks. We measured the impact of instructed refreshing and elaboration on working and long-term memory separately, and investigated to what extent both processes are distinct in their contributions to working as well as long-term memory. Compared with a no-processing baseline, immediate memory was improved by repeating the items, but not by refreshing them. There was no credible effect of elaboration on working memory, except when items were repeated at the same time. Long-term memory benefited from elaboration, but not from refreshing the words. The results replicate the long-term memory benefit for elaboration, but do not support its beneficial role for working memory. Further, refreshing preserves immediate memory, but does not improve it beyond the level achieved without any processing.

The Impact of Elaborated Feedback on Competency Assessment of IT Professionals

Directory of Open Access Journals (Sweden)

Elena Alexandra TOADER

2015-01-01

Full Text Available Feedback represents an important component in the process of assessing the competencies of the IT professionals as it allows to evaluate their performance and helps their managers to personalize the learning content according to employees’ needs and profiles. In the current paper we propose a computer-based formative feedback framework that provides personalized feedback for the technical employees. Extensive research has been carried out focusing on formative assessment aspects that includes the elaborate feedback. An online competency assessment tool was designed and it is going to be implemented in order to measure the professionals’ performance in software organizations. The subjects of the study are going to be software developers, working in departments of IT Romanian companies. Their performance is going to be evaluated through the competency-based assessment tool. At the end of the assessment process, an elaborate feedback is provided in order to improve their current level of competency acquired. The current paper reveals the role of the computer-based formative assessment within software organizations as well as the importance of an elaborate feedback that can improve the employees’ knowledge and skills.

Design and construction of a device for elaborate films of Vyns or Cellulose with control thickness

International Nuclear Information System (INIS)

Patlan C, F.

1998-01-01

This work is a part of the studies about the elaboration of reference radioactive sources, which are done in the National Institute of Nuclear Research in Mexico. Specially concerns with the elaboration of α-β radioactive sources. The importance of this work is because their applications increase day by day. Medicine, engineering, agriculture and even the arts cannot escape to the influence and impact of the nuclear sciences. But, what are the radioactive sources?, what is a holder of a radioactive source?, why we elaborate holders with special materials?, which is the best technique to elaborate them?. These topics are commented in this work. The material is as follows: the introduction and objective are described in chapter one. The second chapter deals with concepts about atomic and molecular structures, general description of nuclear radiation and their characteristics, comments about radioactive law decay, interaction of the alpha particles with the matter and a short description about surface barrier detectors. The different methods for elaborate a radioactive source holders are described in the chapter three. This same chapter speaks the topic about the elaboration of vyns or cellulose films and a device is proposed for make them; are some methods described how to take measure of their thickness. Chapter four shows the results, analysis and the respective conclusions. (Author)

Review of technological elaborations in innovation activity in Institute of Atomic Energy

International Nuclear Information System (INIS)

Logachev, U.V.; Koltigin, O.V.

2006-01-01

Full text: One of the most important directions of IAE activity is works on safety substantiation of perspective reactors on fast neutrons with liquid metallic heat-transfer. Hard conditions of reactor and out-of pile experiments have required the elaboration of series of special measurement systems. Realized system parameters allow to use them not only in the experiments above, but in other industrial fields. One of the basic controlled experiment parameters is short-time pressure impulse appeared under melt hitting of fuel composition into metallic heat-transfer. The original measurement system of pressure impulse in liquid sodium was elaborated. System operating conditions are as follows: influence of reactor gamma radiation; operating temperatures span 273-673 K; pressure measurement span 5 MPa and 20 MPa; transfer temperature in impulse 273-1500 K; sizes in power point are no more than diameter 50 mm; At the same time the system should provide pressure measurement error no high than 6 %. Block of factors data did not allow using state or pressure impulse measurement systems offered at the market. During system elaboration a number of difficult technical problems were solved. As the result the pressure impulse measurement system in liquid sodium for reactor experiments with models of reactor channels on fast neutrons with liquid metallic heat-transfer under temperature up to 400 deg.C was elaborated. The system includes a pressure sensor, thermo protective device consisting of a membrane unit and impulse line with metallic extended with boiling temperature higher than 1000 deg. C. The line length is up to 5 m. A generator of pressure impulses for pressure impulse measurement system control was elaborated. The generator allows to form the regulated pressure impulse with amplitude up to 60 MPa and leading edge duration up to 5 ms. Impulse duration is from 20 to 100 ms.The operation results can be used during elaboration of fast operating pressure impulse

Tradeoff between robustness and elaboration in carotenoid networks produces cycles of avian color diversification.

Science.gov (United States)

Badyaev, Alexander V; Morrison, Erin S; Belloni, Virginia; Sanderson, Michael J

2015-08-20

Resolution of the link between micro- and macroevolution calls for comparing both processes on the same deterministic landscape, such as genomic, metabolic or fitness networks. We apply this perspective to the evolution of carotenoid pigmentation that produces spectacular diversity in avian colors and show that basic structural properties of the underlying carotenoid metabolic network are reflected in global patterns of elaboration and diversification in color displays. Birds color themselves by consuming and metabolizing several dietary carotenoids from the environment. Such fundamental dependency on the most upstream external compounds should intrinsically constrain sustained evolutionary elongation of multi-step metabolic pathways needed for color elaboration unless the metabolic network gains robustness - the ability to synthesize the same carotenoid from an additional dietary starting point. We found that gains and losses of metabolic robustness were associated with evolutionary cycles of elaboration and stasis in expressed carotenoids in birds. Lack of metabolic robustness constrained lineage's metabolic explorations to the immediate biochemical vicinity of their ecologically distinct dietary carotenoids, whereas gains of robustness repeatedly resulted in sustained elongation of metabolic pathways on evolutionary time scales and corresponding color elaboration. The structural link between length and robustness in metabolic pathways may explain periodic convergence of phylogenetically distant and ecologically distinct species in expressed carotenoid pigmentation; account for stasis in carotenoid colors in some ecological lineages; and show how the connectivity of the underlying metabolic network provides a mechanistic link between microevolutionary elaboration and macroevolutionary diversification.

An automatic system for elaboration of chip breaking diagrams

DEFF Research Database (Denmark)

Andreasen, Jan Lasson; De Chiffre, Leonardo

1998-01-01

A laboratory system for fully automatic elaboration of chip breaking diagrams has been developed and tested. The system is based on automatic chip breaking detection by frequency analysis of cutting forces in connection with programming of a CNC-lathe to scan different feeds, speeds and cutting...

Guide for the elaboration of plans to control emergencies

International Nuclear Information System (INIS)

1990-01-01

This Venezuelan standard establishes the lines for the elaboration of plans to control emergencies. It includes general aspects for the control of any emergency originated by operational flaws, for the nature or for acts of third, in any industrial installation, working center, public or private building [es

The Effects of Elaboration and Rehearsal on Long-Term Retention of Shape Names by Kindergarteners

Science.gov (United States)

Gallimore, Ronald; And Others

1977-01-01

Elaboration and overt rehearsal are compared as instructional paradigms for memory retention. Superior long-term retention was produced in the elaboration condition when the initial acquisition effects were statistically removed. Short-term data suggest acquisition was complexly affected by experimental condition, I.Q., and task. Elaboration…

Team-Based Learning: Moderating Effects of Metacognitive Elaborative Rehearsal and Middle School History Content Recall

Science.gov (United States)

Roberts, Greg; Scammacca, Nancy; Osman, David J.; Hall, Colby; Mohammed, Sarojani S.; Vaughn, Sharon

2014-01-01

Promoting Acceleration of Comprehension and Content through Text (PACT) and similar team-based models directly engage and support students in learning situations that require cognitive elaboration as part of the processing of new information. Elaboration is subject to metacognitive control, as well (Karpicke, "Journal of Experimental…

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

Institutions, Anomie, and Violent Crime: Clarifying and Elaborating Institutional-Anomie Theory

Directory of Open Access Journals (Sweden)

Richard Rosenfeld

2008-11-01

Full Text Available A limited but accumulating body of research and theoretical commentary offers support for core claims of the “institutional-anomie theory” of crime (IAT and points to areas needing further development. In this paper, which focuses on violent crime, we clarify the concept of social institutions, elaborate the cultural component of IAT, derive implications for individual behavior, summarize empirical applications, and propose directions for future research. Drawing on Talcott Parsons, we distinguish the “subjective” and “objective” dimensions of institutional dynamics and discuss their interrelationship. We elaborate on the theory’s cultural component with reference to Durkheim’s distinction between “moral” and “egoistic” individualism and propose that a version of the egoistic type characterizes societies in which the economy dominates the institutional structure, anomie is rampant, and levels of violent crime are high. We also offer a heuristic model of IAT that integrates macro- and individual levels of analysis. Finally, we discuss briefly issues for the further theoretical elaboration of this macro-social perspective on violent crime. Specifically, we call attention to the important tasks of explaining the emergence of economic dominance in the institutional balance of power and of formulating an institutional account for distinctive punishment practices, such as the advent of mass incarceration in the United States.

Factors influencing public risk-benefit considerations of nanotechnology: Assessing the effects of mass media, interpersonal communication, and elaborative processing.

Science.gov (United States)

Ho, Shirley S; Scheufele, Dietram A; Corley, Elizabeth A

2013-07-01

This study examines the influence of mass media, interpersonal communication, and elaborative processing on public perception of benefits and risks of nanotechnology, based on a large-scale nationally representative telephone survey of U.S. adult citizens. Results indicate that cognitive processes in the form of news elaboration had a significant positive main effect on benefits outweigh risks perception. The influences of attention to science in newspapers, attention to science news on television, and interpersonal communication about science on public perception of benefits outweigh risks were moderated by elaborative processing, after controlling for socio-demographic variables, religious beliefs, trust in scientists, and scientific knowledge. The findings highlight the importance of elaborative processing when it comes to understanding how the mass media differentially influence public benefits outweigh risks perception of emerging technologies. Specifically, high elaborative processing emphasizes higher levels of perceived benefits outweigh risks than low elaborative processing. This study explores explanations for this phenomenon and offers implications for future research and policy.

Social justifications for moral emotions: when reasons for disgust are less elaborated than for anger.

Science.gov (United States)

Russell, Pascale Sophie; Giner-Sorolla, Roger

2011-06-01

In the present research, we tested the unreasoning disgust hypothesis: moral disgust, in particular in response to a violation of a bodily norm, is less likely than moral anger to be justified with cognitively elaborated reasons. In Experiment 1, participants were asked to explain why they felt anger and disgust toward pedophiles. Participants were more likely to invoke elaborated reasons, versus merely evaluative responses, when explaining their anger, versus disgust. Experiment 2 used a between-participants design; participants explained why they felt either anger or disgust toward seven groups that either violated a sexual or nonsexual norm. Again, elaborated reasons were less prevalent when explaining their disgust versus anger and, in particular, when explaining disgust toward a group that violated a sexual norm. Experiment 3 further established that these findings are due to a lower accessibility of elaborated reasons for bodily disgust, rather than inhibition in using them when provided. From these findings, it can be concluded that communicating external reasons for moral disgust at bodily violations is made more difficult due to the unavailability of those reasons to people.

Procedure for the elaboration of extended sources beta and/or gamma emitting

International Nuclear Information System (INIS)

Tejera R, A.; Cortes P, A.; Becerril V, A.

1991-12-01

In the laboratory of radioactive standards they have been come manufacturing punctual sources gauged gamma emitting during several years. Before the demand of extended radioactive homogeneous sources of beta particles emitting, in particular with nuclides that are simultaneously gamma and beta emitting, it was designed a procedure for it elaboration based on the one that we use at the moment for the elaboration of the punctual gamma sources. This procedure consists on the integration of a compact group of this type of sources on a single extended support, sealed one of its faces with a film of transparent material in satisfactory grade to the beta particles. In this work this procedure is described and it is applied in the elaboration of two sources that its were requested by the Laguna Verde Central (CFE), one with area of 20 cm 2 and the other one of 100 cm 2 . The homogeneity, measure as the dispersion of the activities of the aliquot ones distributed in the active surfaces was inside 2%. The percentage of attenuation of the beta particles was also measured by the film (window) with the one that the sources were sealed. (Author)

Organized mesoporous silica films as templates for the elaboration of organized nanoparticle networks

International Nuclear Information System (INIS)

Gacoin, T; Besson, S; Boilot, J P

2006-01-01

Tremendous work achieved in the last 20 years on nanoparticle synthesis has allowed us to study many new physical properties that are found in the nanometre size range. New developments are now expected when considering assemblies of nanoparticles such as 2D or 3D organized arrays. These systems are indeed expected to exhibit original physical properties resulting from particle-particle interactions. Studies in this field are clearly dependent on the elaboration of materials with controlled particle size, organization and interparticle distance. This paper presents a strategy of elaboration that is based on the use of organized mesoporous silica films as templates. These films are made by sol-gel polymerization around surfactant assemblies and further elimination of the surfactant. This provides porous matrices with a pore organization that is the almost perfect replica of the initial micellar structure. The use of such films for the elaboration of organized arrays of nanoparticles is detailed in the case of CdS and Ag particles. The formation of particles inside the pores is achieved through impregnation with precursors that are allowed to diffuse inside the pores. This leads to particles with a size and a spatial arrangement that is directly related to the initial pore structure of the films. This process opens a wide range of investigations due to the relative ease of fabrication over large surfaces and the numerous possibilities offered by the elaboration of porous films with different pore sizes and organizations

Inferential false memories of events: negative consequences protect from distortions when the events are free from further elaboration.

Science.gov (United States)

Mirandola, Chiara; Toffalini, Enrico; Grassano, Massimo; Cornoldi, Cesare; Melinder, Annika

2014-01-01

The present experiment was conducted to investigate whether negative emotionally charged and arousing content of to-be-remembered scripted material would affect propensity towards memory distortions. We further investigated whether elaboration of the studied material through free recall would affect the magnitude of memory errors. In this study participants saw eight scripts. Each of the scripts included an effect of an action, the cause of which was not presented. Effects were either negatively emotional or neutral. Participants were assigned to either a yes/no recognition test group (recognition), or to a recall and yes/no recognition test group (elaboration + recognition). Results showed that participants in the recognition group produced fewer memory errors in the emotional condition. Conversely, elaboration + recognition participants had lower accuracy and produced more emotional memory errors than the other group, suggesting a mediating role of semantic elaboration on the generation of false memories. The role of emotions and semantic elaboration on the generation of false memories is discussed.

Picture Superiority in Free Recall: The Effects of Organization and Elaboration.

Science.gov (United States)

Ritchey, Gary H.

1980-01-01

Tests the notion that activation in children's semantic memory might best be considered in terms of both between-item and within-item elaboration. Subjects were 192 second, fourth, and sixth graders. (MP)

Elaboration and characterisation of plutonium waste reference materials

International Nuclear Information System (INIS)

Perolat, J.P.

1990-01-01

The Analysis Methods Establishment Commission (CETAMA) has set up a program for the elaboration and characterisation of plutonium waste reference materials. The object of this program is to give laboratories the possibility to test and calibrate apparatus used in non-destructive methods for the analysis of plutonium waste. The different parameters of this program are presented: - characterisation of plutonium, - type and number of containers, - plutonium distribution inside the different containers, - description of the matrix

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

Science.gov (United States)

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

Recommendations for elaboration, transcultural adaptation and validation process of tests in Speech, Hearing and Language Pathology.

Science.gov (United States)

Pernambuco, Leandro; Espelt, Albert; Magalhães, Hipólito Virgílio; Lima, Kenio Costa de

2017-06-08

to present a guide with recommendations for translation, adaptation, elaboration and process of validation of tests in Speech and Language Pathology. the recommendations were based on international guidelines with a focus on the elaboration, translation, cross-cultural adaptation and validation process of tests. the recommendations were grouped into two Charts, one of them with procedures for translation and transcultural adaptation and the other for obtaining evidence of validity, reliability and measures of accuracy of the tests. a guide with norms for the organization and systematization of the process of elaboration, translation, cross-cultural adaptation and validation process of tests in Speech and Language Pathology was created.

Counseling Pretreatment and the Elaboration Likelihood Model of Attitude Change.

Science.gov (United States)

Heesacker, Martin

1986-01-01

Results of the application of the Elaboration Likelihood Model (ELM) to a counseling context revealed that more favorable attitudes toward counseling occurred as subjects' ego involvement increased and as intervention quality improved. Counselor credibility affected the degree to which subjects' attitudes reflected argument quality differences.…

Learning about Posterior Probability: Do Diagrams and Elaborative Interrogation Help?

Science.gov (United States)

Clinton, Virginia; Alibali, Martha W.; Nathan, Mitchell J.

2016-01-01

To learn from a text, students must make meaningful connections among related ideas in that text. This study examined the effectiveness of two methods of improving connections--elaborative interrogation and diagrams--in written lessons about posterior probability. Undergraduate students (N = 198) read a lesson in one of three questioning…

Effects of Forward and Backward Contextual Elaboration on Lexical Inferences: Evidence from a Semantic Relatedness Judgment Task

Science.gov (United States)

Hamada, Akira

2015-01-01

Three experiments examined whether the process of lexical inferences differs according to the direction of contextual elaboration using a semantic relatedness judgment task. In Experiment 1, Japanese university students read English sentences where target unknown words were semantically elaborated by prior contextual information (forward lexical…

Participation of industry experts in the elaboration of monographs and chapters of the European Pharmacopoeia.

Science.gov (United States)

Rose, Ulrich

2016-10-10

The European Pharmacopoeia represents an important element in the European regulatory system for medicines. It is elaborated in a co-operation of experts from authorities, academia and industry, assisted by scientific staff from the European Directorate for the Quality of Medicines & HealthCare (EDQM). This article describes the principles of its elaboration with particular focus on the involvement of industry experts. Copyright © 2016 Elsevier B.V. All rights reserved.

Learning terms and definitions: Drawing and the role of elaborative encoding.

Science.gov (United States)

Wammes, Jeffrey D; Meade, Melissa E; Fernandes, Myra A

2017-09-01

Traditionally, students adopt the strategy of taking written notes when attending a class or learning from a textbook in educational settings. Informed by previous work showing that learning by doing improves memory performance, we examined whether drawing to-be-remembered definitions from university textbooks would improve later memory, relative to a more typical strategy of rote transcription. Participants were asked to either write out the definition, or to draw a picture representative of the definition. Results indicated that drawing, relative to verbatim writing, conferred a reliable memorial benefit that was robust, even when participants' preexisting familiarity with the terms was included as a covariate (in Experiment 1) or when the to-be-remembered terms and definitions were fictitious, thus removing the influence of familiarity (in Experiment 2). We reasoned that drawing likely facilitates retention at least in part because at encoding, participants must retain and elaborate upon information regarding the meaning of the definition, to translate it into a new form (a picture). This is not the case when participants write out the definitions verbatim. In Experiment 3 we showed that paraphrasing during encoding, which, like drawing and in contrast with verbatim writing, requires self-generated elaboration, led to memory performance that was comparable to drawing. Taken together, results suggest that drawing is a powerful tool which improves memory, and that drawing produces a similar level of retention as does paraphrasing. This suggests that elaborative encoding plays a critical role in the memorial benefit that drawing confers to memory for definitions of academic terms. Copyright © 2017 Elsevier B.V. All rights reserved.

ABOUT THE TERMINOLOGY USED DURING ELABORATION OF INNOVATION BIOTECHNOLOGY OF EXPERIMENTAL HAPLOIDY

OpenAIRE

KRUGLOVA N.N.

2017-01-01

From the standpoint of plant embryology the terminology used during elaboration of innovation biotechnology of experimental haploidy is discussed. It is emphasized that morphogenic processes both in vivo and in vitro are universal.

Use of software to optimize time and costs in the elaboration of the basic drawing

Energy Technology Data Exchange (ETDEWEB)

Costa, Tchaikowisky M. [Faculdade de Tecnologia e Ciencias (FTC), Itabuna, BA (Brazil); Bresci, Claudio T.; Franca, Carlos M.M. [Petroleo Brasileiro S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil)

2009-07-01

In order to choose areas to implement pipe yards, terminals, campsite, pipeline path and other areas of assistance for the construction and assembly of the pipeline, it is necessary previous location studies to elaborate the basic drawing. However it is not always possible to contract a company registered in aerial survey to elaborate this type of drawing, either for the cost or time, and where the lack of a basic drawing can lead to an erroneous choice or one which reflects an exaggerated estimate or not adequate logistics. In order to minimize costs and optimizing time, without compromising quality, this study proposes the use of software 'virtual globe' type for mapping and geographic location available on the internet to assist in the gathering of geographical, altimetric, hydro graphic, road, environmental, socioeconomic and aerial images, information necessary to elaborate the basic drawing. This article includes a case study of the oil pipeline Cacimbas-Barra do Riacho project and a proposed procedure to be used in the elaboration of basic drawings using data generated using the referred to software. In 2007 the Pipeline Construction and Assembly sector, CMDPI unit of PETROBRAS Engenharia/IETEG/IEDT was designated to select an area of 2 hectares where the pipe storage yard for pipes to be used in the Oil Pipeline Cacimbas- Barra do Riacho in Espirito Santo state would be constructed. The area was chosen following some pre-requisites and using as main resources in the gathering of information necessary to select the area, 'virtual globe' type software and a CAD type software with the capacity to import images and altimetric identification as well as exporting drawing data to the mentioned. The activity, much simpler than hiring an aerial survey, was elaborated surpassing expectations of time-costs besides complying with the necessary technical demands. (author)

Elaborative rehearsal of nontemporal information interferes with temporal processing of durations in the range of seconds but not milliseconds.

Science.gov (United States)

Rammsayer, Thomas; Ulrich, Rolf

2011-05-01

The distinct timing hypothesis suggests a sensory mechanism for processing of durations in the range of milliseconds and a cognitively controlled mechanism for processing of longer durations. To test this hypothesis, we employed a dual-task approach to investigate the effects of maintenance and elaborative rehearsal on temporal processing of brief and long durations. Unlike mere maintenance rehearsal, elaborative rehearsal as a secondary task involved transfer of information from working to long-term memory and elaboration of information to enhance storage in long-term memory. Duration discrimination of brief intervals was not affected by a secondary cognitive task that required either maintenance or elaborative rehearsal. Concurrent elaborative rehearsal, however, impaired discrimination of longer durations as compared to maintenance rehearsal and a control condition with no secondary task. These findings endorse the distinct timing hypothesis and are in line with the notion that executive functions, such as continuous memory updating and active transfer of information into long-term memory interfere with temporal processing of durations in the second, but not in the millisecond range. 2011 Elsevier B.V. All rights reserved.

The model of post-socialist rural transition: openness and (unlearning versus informal relations

Directory of Open Access Journals (Sweden)

Garri Raagmaa

2002-12-01

Full Text Available The aim of this article is to discuss development issues at the locality level.Below, we are working with the learning economy theory and the conceptof bottom-up indigenous development in combination with other approaches.The principal transformation model for the post-soviet rural areas furtherdevelopment is elaborated. The acknowledgement of local social networks is crucial, especially in eco-nomically decreasing areas. Innovation and development potential in ruralareas with primary sector dominance, where few service industries andjobs have been created, remain usually low. Improving infrastructures andcreating jobs by outside authorities (state subsidies and enterprises onlywill not be enough for the sustainable economic development of a localityor a region. Besides, in the case of strengthening informal structures and behaviour,local (selfexclusion will tend to grow as a side effect in these areas. The(selfcloseness of the society can be considered as an important impedi-ment to indigenous development.

Elaboration Likelihood Model and an Analysis of the Contexts of Its Application

Directory of Open Access Journals (Sweden)

Aslıhan Kıymalıoğlu

2014-12-01

Full Text Available Elaboration Likelihood Model (ELM, which supports the existence of two routes to persuasion: central and peripheral routes, has been one of the major models on persuasion. As the number of studies in the Turkish literature on ELM is limited, a detailed explanation of the model together with a comprehensive literature review was considered to be contributory for this gap. The findings of the review reveal that the model was mostly used in marketing and advertising researches, that the concept most frequently used in elaboration process was involvement, and that argument quality and endorser credibility were the factors most often employed in measuring their effect on the dependant variables. The review provides valuable insights as it presents a holistic view of the model and the variables used in the model.

Methodological aspects to elaborate the management and procedure guides of severe accidents

International Nuclear Information System (INIS)

Gonzalez Gonzalez, F.; Jimenez Fernandez, A.

1995-01-01

The management guides in severe accidents are very important to know the procedures in these accidents. The present articles summarizes the methodological aspects to elaborate the management guides, in order to prevent the severe accidents

Penggunaan Elaboration Likelihood Model dalam Menganalisis Penerimaan Teknologi Informasi

OpenAIRE

vitrian, vitrian2

2010-01-01

This article discusses some technology acceptance models in an organization. Thorough analysis of how technology is acceptable help managers make any planning to implement new teachnology and make sure that new technology could enhance organization's performance. Elaboration Likelihood Model (ELM) is the one which sheds light on some behavioral factors in acceptance of information technology. The basic tenet of ELM states that human behavior in principle can be influenced through central r...

Simulations with Elaborated Worked Example Modeling: Beneficial Effects on Schema Acquisition

Science.gov (United States)

Meier, Debra K.; Reinhard, Karl J.; Carter, David O.; Brooks, David W.

2008-01-01

Worked examples have been effective in enhancing learning outcomes, especially with novice learners. Most of this research has been conducted in laboratory settings. This study examined the impact of embedding elaborated worked example modeling in a computer simulation practice activity on learning achievement among 39 undergraduate students…

Worry, problem elaboration and suppression of imagery: the role of concreteness.

Science.gov (United States)

Stöber, J

1998-01-01

Both lay concept and scientific theory claim that worry may be helpful for defining and analyzing problems. Recent studies, however, indicate that worrisome problem elaborations are less concrete than worry-free problem elaborations. This challenges the problem solving view of worry because abstract problem analyses are unlikely to lead to concrete problem solutions. Instead the findings support the avoidance theory of worry which claims that worry suppresses aversive imagery. Following research findings in the dual-coding framework [Paivio, A. (1971). Imagery and verbal processes. New York: Holt, Rhinehart and Winston; Paivio, A. (1986). Mental representations: a dual coding approach. New York: Oxford University Press.], the present article proposes that reduced concreteness may play a central role in the understanding of worry. First, reduced concreteness can explain how worry reduces imagery. Second, it offers an explanation why worrisome problem analyses are unlikely to arrive at solutions. Third, it provides a key for the understanding of worry maintenance.

Elaborating European Pharmacopoeia monographs for biotherapeutic proteins using substances from a single source.

Science.gov (United States)

Buda, M; Wicks, S; Charton, E

2016-01-01

For more than twenty years, the European Pharmacopoeia (Ph. Eur.) monographs for biotherapeutic proteins have been elaborated using the multisource approach (Procedure 1), which has led to robust quality standards for many of the first-generation biotherapeutics. In 2008, the Ph. Eur. opened up the way towards an alternative mechanism for the elaboration of monographs (Procedure 4-BIO pilot phase), which is applied to substances still under patent protection, based on a close collaboration with the Innovator company, to ensure a harmonised global standard and strengthen the quality of the upcoming products. This article describes the lessons learned during the P4-BIO pilot phase and addresses the current thinking on monograph elaboration in the field of biotherapeutics. Case studies are described to illustrate the standardisation challenges associated with the complexity of biotherapeutics and of analytical procedures, as well as the approaches that help ensure expectations are met when setting monograph specifications and allow for compatibility with the development of biosimilars. Emphasis is put on monograph flexibility, notably by including tests that measure process-dependent microheterogeneity (e.g. glycosylation) in the Production section of the monograph. The European Pharmacopoeia successfully concluded the pilot phase of the P4-BIO during its 156 th session on 22-23 November 2016.

Engagement of the ATEE in the elaboration of regulation texts; L`action de l`atee lors de l`elaboration des textes reglementaires

Energy Technology Data Exchange (ETDEWEB)

Jacubowiez, I. [ATEE, Association Technique Energie Environnement, 94 - Arcueil (France)

1997-12-31

The French technical association for energy savings (ATEE) has been involved in the elaboration of regulations concerning efficiency and pollution of medium-power combustion equipment (boilers, engines, dryers, furnaces...), with the aim of promoting energy efficiency and rational utilization of energy. It has thus been involved in the development of a new classification of these equipment with regard to their fuel and energy sources (decree 2910), and decrees on boiler (lower than 50 MW) efficiency, technical inspections, and classification of heat networks

The Elaboration Likelihood Model: Implications for the Practice of School Psychology.

Science.gov (United States)

Petty, Richard E.; Heesacker, Martin; Hughes, Jan N.

1997-01-01

Reviews a contemporary theory of attitude change, the Elaboration Likelihood Model (ELM) of persuasion, and addresses its relevance to school psychology. Claims that a key postulate of ELM is that attitude change results from thoughtful (central route) or nonthoughtful (peripheral route) processes. Illustrations of ELM's utility for school…

Elaboration over a discourse facilitates retrieval in sentence processing

Directory of Open Access Journals (Sweden)

Melissa eTroyer

2016-03-01

Full Text Available Language comprehension requires access to stored knowledge and the ability to combine knowledge in new, meaningful ways. Previous work has shown that processing linguistically more complex expressions (‘Texas cattle rancher’ vs. ‘rancher’ leads to slow-downs in reading during initial processing, possibly reflecting effort in combining information. Conversely, when this information must subsequently be retrieved (as in filler-gap constructions, processing is facilitated for more complex expressions, possibly because more semantic cues are available during retrieval. To follow up on this hypothesis, we tested whether information distributed across a short discourse can similarly provide effective cues for retrieval. Participants read texts introducing two referents (e.g., two senators, one of whom was described in greater detail than the other (e.g., ‘The Democrat had voted for one of the senators, and the Republican had voted for the other, a man from Ohio who was running for president’. The final sentence (e.g., ‘The senator who the {Republican / Democrat} had voted for…’ contained a relative clause picking out either the Many-Cue referent (with ‘Republican’ or the One-Cue referent (with ‘Democrat’. We predicted facilitated retrieval (faster reading times for the Many-Cue condition at the verb region (‘had voted for’, where readers could understand that ‘The senator’ is the object of the verb. As predicted, this pattern was observed at the retrieval region and continued throughout the rest of the sentence. Participants also completed the Author/Magazine Recognition Tests (ART/MRT; Stanovich & West, 1989, providing a proxy for world knowledge. Since higher ART/MRT scores may index (a greater experience accessing relevant knowledge and/or (b richer/more highly-structured representations in semantic memory, we predicted it would be positively associated with effects of elaboration on retrieval. We did not observe

Dual elaboration models in attitude change processes

Directory of Open Access Journals (Sweden)

Žeželj Iris

2005-01-01

Full Text Available This article examines empirical and theoretical developments in research on attitude change in the past 50 years. It focuses the period from 1980 till present as well as cognitive response theories as the dominant theoretical approach in the field. The postulates of Elaboration Likelihood Model, as most-researched representative of dual process theories are studied, based on review of accumulated research evidence. Main research findings are grouped in four basic factors: message source, message content, message recipient and its context. Most influential criticisms of the theory are then presented regarding its empirical base and dual process assumption. Some possible applications and further research perspectives are discussed at the end.

Vocabulary development at home: A multimedia elaborated picture supporting parent-toddler interaction

NARCIS (Netherlands)

Gremmen, M.C.; Molenaar, I.; Teepe, R.C.

2016-01-01

Some children enter elementary school with large vocabulary delays, which negatively influence their later school performance.A rich home language environment can support vocabulary development through frequent high-quality parent–toddler interaction. Elaborated picture home activities can support

Vocabulary development at home: A multimedia elaborated picture supporting parent-toddler interaction

NARCIS (Netherlands)

Gremmen, M.C.; Molenaar, I.; Teepe, R.C.

2016-01-01

Some children enter elementary school with large vocabulary delays, which negatively influence their later school performance. A rich home language environment can support vocabulary development through frequent high-quality parent-toddler interaction. Elaborated picture home activities can support

Processing Depth, Elaboration of Encoding, Memory Stores, and Expended Processing Capacity.

Science.gov (United States)

Eysenck, Michael W.; Eysenck, M. Christine

1979-01-01

The effects of several factors on expended processing capacity were measured. Expended processing capacity was greater when information was retrieved from secondary memory than from primary memory, when processing was of a deep, semantic nature than when it was shallow and physical, and when processing was more elaborate. (Author/GDC)

Estimation of the intrinsic stresses in α-alumina in relation with its elaboration mode

International Nuclear Information System (INIS)

Boumaza, A.; Djelloul, A.

2010-01-01

The specific signatures of α-Al 2 O 3 by Fourier transform infrared (FTIR) spectroscopy were investigated to estimate the intrinsic stress in this compound according to its elaboration mode. Thus, α-alumina was prepared either by calcination of boehmite or gibbsite and also generated by oxidation of a metallic FeCrAl alloy. FTIR results were mainly supported by X-ray diffraction (XRD) patterns that allowed to determine the crystallite size and the strain in the various alpha aluminas. Moreover, the infrared peak at 378.7 cm -1 was used as a reference for stress free α-alumina and the shift of this peak allowed to estimate intrinsic stresses, which were related to the morphology and to the specific surface area of aluminas according to their elaboration mode. These interpretations were confirmed by results obtained by cathodoluminescence experiments. - Graphical abstract: The infrared peak at 378.7 cm -1 was used as a reference for stress free α-alumina and the shift of this peak allowed to estimate intrinsic stresses, which were related to the morphology and to the specific surface area of aluminas according to their elaboration mode.

Nonlinear generalized synchronization of chaotic systems by pure error dynamics and elaborate nondiagonal Lyapunov function

International Nuclear Information System (INIS)

Ge Zhengming; Chang Chingming

2009-01-01

By applying pure error dynamics and elaborate nondiagonal Lyapunov function, the nonlinear generalized synchronization is studied in this paper. Instead of current mixed error dynamics in which master state variables and slave state variables are presented, the nonlinear generalized synchronization can be obtained by pure error dynamics without auxiliary numerical simulation. The elaborate nondiagonal Lyapunov function is applied rather than current monotonous square sum Lyapunov function deeply weakening the powerfulness of Lyapunov direct method. Both autonomous and nonautonomous double Mathieu systems are used as examples with numerical simulations.

A framework for elaborating a geological disposal safety case: Main issues to be addressed

International Nuclear Information System (INIS)

Besnus, F.; Gay, D.

2002-01-01

International guidance on safety standards for the geological disposal of radioactive waste is being elaborated by IAEA. A comparison of experiences acquired in developing deep repository projects shows that many important issues related to the progressive building of confidence in the safety demonstration of such facilities are commonly addressed by the various organisations involved in radioactive waste management. However, there is still some discrepancies in defining the steps that form the staged elaboration of a safety case. This paper intends to propose a framework for defining the safety case in describing the main issues to be addressed and highlighting questions of consistency between former steps. (author)

Elaboration and characterisation of acids catalyst for the obtention of amines

International Nuclear Information System (INIS)

Khemaissia, S.; Zaoui, B.; Nibou, D.

1997-04-01

The nuclear energy has shown the interest of aminated substances as solvents for removal and purification. These extractants are generally used in uranium ores treatment processes and several technology fields, specially, in organic and pharmaceutical industries. The present work deals with elaboration and characterization of acidic solid catalyst used in aminated extractants obtaining

Australian food life style segments and elaboration likelihood differences

DEFF Research Database (Denmark)

Brunsø, Karen; Reid, Mike

As the global food marketing environment becomes more competitive, the international and comparative perspective of consumers' attitudes and behaviours becomes more important for both practitioners and academics. This research employs the Food-Related Life Style (FRL) instrument in Australia...... in order to 1) determine Australian Life Style Segments and compare these with their European counterparts, and to 2) explore differences in elaboration likelihood among the Australian segments, e.g. consumers' interest and motivation to perceive product related communication. The results provide new...

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Attitude change toward body image: the role of elaboration on attitude strength].

Science.gov (United States)

Gasco, Margarita; Briñol, Pablo; Horcajo, Javier

2010-02-01

Attitude change toward body image: The role of elaboration on attitude strength. Attitudes toward body image have been shown to play a central role in the understanding and treating of eating disorders. In the present research, participants' attitudes toward their body image were changed through a persuasive procedure involving high mental elaboration (self-persuasion) or through a less engaging procedure involving less active participation (passive exposure). As expected, participants in these two groups showed more favourable attitudes toward their bodies than those in the control group. Despite that both treatments were equally efficient in changing attitudes, the strength associated with those attitudes was significantly different depending on the amount of thinking involved in the process of change. Specifically, attitudes were stronger in the high rather than low thinking group of treatment. This finding is important because the strength of the attitude may determine the long-term consequences of an intervention.

SPIRIT 2013 explanation and elaboration: guidance for protocols of clinical trials.

Science.gov (United States)

Chan, An-Wen; Tetzlaff, Jennifer M; Gøtzsche, Peter C; Altman, Douglas G; Mann, Howard; Berlin, Jesse A; Dickersin, Kay; Hróbjartsson, Asbjørn; Schulz, Kenneth F; Parulekar, Wendy R; Krleza-Jeric, Karmela; Laupacis, Andreas; Moher, David

2013-01-08

High quality protocols facilitate proper conduct, reporting, and external review of clinical trials. However, the completeness of trial protocols is often inadequate. To help improve the content and quality of protocols, an international group of stakeholders developed the SPIRIT 2013 Statement (Standard Protocol Items: Recommendations for Interventional Trials). The SPIRIT Statement provides guidance in the form of a checklist of recommended items to include in a clinical trial protocol. This SPIRIT 2013 Explanation and Elaboration paper provides important information to promote full understanding of the checklist recommendations. For each checklist item, we provide a rationale and detailed description; a model example from an actual protocol; and relevant references supporting its importance. We strongly recommend that this explanatory paper be used in conjunction with the SPIRIT Statement. A website of resources is also available (www.spirit-statement.org). The SPIRIT 2013 Explanation and Elaboration paper, together with the Statement, should help with the drafting of trial protocols. Complete documentation of key trial elements can facilitate transparency and protocol review for the benefit of all stakeholders.

ELABORATION OF A DRYING SCHEDULE FOR Eucalyptus spp HYBRIDS CLONES WOODS

Directory of Open Access Journals (Sweden)

Celso Gonçalves Barbosa

2005-03-01

Full Text Available The elaboration of adequate drying schedules is essential to produce high quality conventional kiln dried lumber.Eucalyptus woods are particularly difficult to dry, and, for this reason, it is desirable that the drying schedule be carefullydeveloped. The objectives of this work were to elaborate a drying schedule for woods of ten Eucalyptus hybrids clones and toverify the propensity of these woods to post drying defects. For this purpose, it was applied the methodology of drastic drying at100°C, which associates intensity of defects, time and rate of drying, presented by small wood samples, with the behaviourto be presented by lumber after the conventional drying. The results allowed developing a drying schedule common to the tenclone lumbers. This program is based on an initial temperature of 40°C, final temperature of 66°C and drying potential equal to2.2. The drying time can be reduced, if the clones were grouped in accordance to their drying rate. The clones presented lowpropensity to split and high propensity to collapse.

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

PROFESSIONAL COMPETITIVE EVOLUTION AND QUANTIFICATION MODELS IN ACCOUNTING SERVICE ELABORATION

Directory of Open Access Journals (Sweden)

Gheorghe FATACEAN

2013-12-01

Full Text Available The objective of this article consists in using an assessment framework of the accounting service elaboration. The purpose of this model is the identification and revaluation of an elite group of expert accounts from Romania, which should provide solutions to solve the most complex legal matters in the legal field, in the field of criminal, tax, civil, or commercial clauses making the object of law suits.

Vocabulary Development at Home: A Multimedia Elaborated Picture Supporting Parent-Toddler Interaction

Science.gov (United States)

Gremmen, M. C.; Molenaar, I.; Teepe, R. C.

2016-01-01

Some children enter elementary school with large vocabulary delays, which negatively influence their later school performance. A rich home language environment can support vocabulary development through frequent high-quality parent-toddler interaction. Elaborated picture home activities can support this rich home language environment. This study…

Non-Watson–Crick interactions between PNA and DNA inhibit the ATPase activity of bacteriophage T4 Dda helicase

Science.gov (United States)

Tackett, Alan J.; Corey, David R.; Raney, Kevin D.

2002-01-01

Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106

Effects of Semantic Elaboration and Typicality on Picture Naming in Alzheimer Disease

Science.gov (United States)

Morelli, Claudia A.; Altmann, Lori J. P.; Kendall, Diane; Fischler, Ira; Heilman, Kennneth M.

2011-01-01

Purpose: Individuals with probable Alzheimer disease (pAD) are frequently impaired at picture naming. This study examined whether a semantic elaboration task would facilitate naming in pAD, and whether training either semantically typical or atypical stimulus items facilitated generalized improvement in picture naming and category generation…

Application of the Elaboration Likelihood Model of Attitude Change to Assertion Training.

Science.gov (United States)

Ernst, John M.; Heesacker, Martin

1993-01-01

College students (n=113) participated in study comparing effects of elaboration likelihood model (ELM) based assertion workshop with those of typical assertion workshop. ELM-based workshop was significantly better at producing favorable attitude change, greater intention to act assertively, and more favorable evaluations of workshop content.…

Action-research and the elaboration of teaching knowledge in sciences

Directory of Open Access Journals (Sweden)

Maria Nizete de Azevedo

Full Text Available In this paper we analyze the way in which a training process, in which the methodological option approaches an action-research in teacher education, contributes with the elaboration of teaching knowledge in sciences by a group of teachers of the initial school years. In colaborative situations of teaching knowledge, those teachers elect education problems, for which they seek for solutions through planned, developed and reflected actions. We explored data obtained from a wide research, realized in a public school which took as basis this formative process. The results analysed under a qualitative approach show that the action-research contributes with the elaboration of the teaching knowledge, creating situations of learning necessary to the organization and development of education. We identified important knowledge related to indicating elements of learning about teaching, such as self-organization and formation, the disposition to study and to research, a way to teach sciences through investigative activities, the construction of cooperative practice at school, the articulation of science teaching with the alphabetization process in the native language, the consideration of the school's social and cultural context in its teaching plans, among others. Those results take us to reinforce the potential of action-research on teacher’s formation and on the improvement of the practiced teaching.

ELABORATION OF THE COMPUTATIONAL MODEL OF THE PLANETARY PRECESSIONAL TRANSMISSION

Directory of Open Access Journals (Sweden)

BOSTAN Ion

2010-07-01

Full Text Available The specific character of sphere-spatial motion used in the precessional transmissions makes impossible the utilization of involute profiles of classical teeth. This fact requires the elaboration of new non-standard profiles, which in conditions of using the sphere-spatial motion with an immovable point of the satellite would assure constancy transfer function, the multiplicity of the precessional gear and consequently high carrying capacity of the precessional transmission in general.

ELABORATION OF THE SUPERSTRUCTURE OF THE BULGARIAN HOTEL INDUSTRY

Directory of Open Access Journals (Sweden)

Tanya Dabeva

2010-12-01

Full Text Available The purpose of the paper is to suggest some terms of reference for the elaboration of the superstructure of the Bulgarian hotel industry. The suggestions are based on the analysis of the superstructure at present. Its capacity, main types of accommodation establishments and their distribution by categories and territory are examined. An analysis is made of some resulting indices such as overnight stays and average stay. The main positive, respectively negative features of the superstructure have been analyzed. Concrete terms of reference have been given in order to overcome the problems specified.

Elaborations in the area of complex reprocessing of mineral raw materials

International Nuclear Information System (INIS)

Mirsaidov, U.M.

2002-01-01

In present time complex using of raw materials has important significance as it connected with solving problems of creating of waste less and ecologically clean technologies. Elaboration and assimilation of waste less technologies has special significance for chemical, mountain-chemical, metallurgical branches of industry. In this part of book author gives several methods of waste less and ecologically clean technologies

Teaching and learning grade 7 science concepts by elaborate analogies: Mainstream and East and South Asian ESL students' experiences

Science.gov (United States)

Kim, Judy Joo-Hyun

This study explored the effectiveness of an instructional tool, elaborate analogy, in teaching the particle theory to both Grade 7 mainstream and East or South Asian ESL students. Ten Grade 7 science classes from five different schools in a large school district in the Greater Toronto area participated. Each of the ten classes were designated as either Group X or Y. Using a quasi-experimental counterbalanced design, Group X students were taught one science unit using the elaborate analogies, while Group Y students were taught by their teachers' usual methods of teaching. The instructional methods used for Group X and Y were interchanged for the subsequent science unit. Quantitative data were collected from 95 students (50 mainstream and 45 ESL) by means of a posttest and a follow-up test for each of the units. When the differences between mainstream and East or South Asian ESL students were analyzed, the results indicate that both groups scored higher on the posttests when they were instructed with elaborate analogies, and that the difference between the two groups was not significant. That is, the ESL students, as well as the mainstream students, benefited academically when they were instructed with the elaborate analogies. The students obtained higher inferential scores on the posttest when their teacher connected the features of less familiar and more abstract scientific concepts to the features of the familiar and easy-to-visualize concept of school dances. However, after two months, the students were unable to recall inferential content knowledge. This is perhaps due to the lack of opportunity for the students to represent and test their initial mental models. Rather than merely employing elaborate analogies, perhaps, science teachers can supplement the use of elaborate analogies with explicit guidance in helping students to represent and test the coherence of their mental models.

Sintering by infiltration of loose mixture of powders, a method for metal matrix composite elaboration

International Nuclear Information System (INIS)

Constantinescu, V.; Orban, R.; Colan, H.

1993-01-01

Starting from the observation that Sintering by Infiltration of Loose Mixture of Powders confers large possibilities for both complex shaped and of large dimensions Particulate Reinforced Metal Matrix Composite components elaboration, its mechanism comparative with those of the classical melt infiltration was investigated. Appropriate measures in order to prevent an excessive hydrostatic flow of the melt and, consequently, reinforcement particle dispersion, as well as to promote wetting in both infiltration and liquid phase sintering stages of the process were established as necessary. Some experimental results in the method application to the fusion tungsten carbide and diamond reinforced metal matrix composite elaboration are, also, presented. (orig.)

Evaluation of Smoking Prevention Television Messages Based on the Elaboration Likelihood Model

Science.gov (United States)

Flynn, Brian S.; Worden, John K.; Bunn, Janice Yanushka; Connolly, Scott W.; Dorwaldt, Anne L.

2011-01-01

Progress in reducing youth smoking may depend on developing improved methods to communicate with higher risk youth. This study explored the potential of smoking prevention messages based on the Elaboration Likelihood Model (ELM) to address these needs. Structured evaluations of 12 smoking prevention messages based on three strategies derived from…

Elaboration of collisional–radiative models for flows related to planetary entries into the Earth and Mars atmospheres

International Nuclear Information System (INIS)

Bultel, Arnaud; Annaloro, Julien

2013-01-01

The most relevant way to predict the excited state number density in a nonequilibrium plasma is to elaborate a collisional–radiative (CR) model taking into account most of the collisional and radiative elementary processes. Three examples of such an elaboration are given in this paper in the case of various plasma flows related to planetary atmospheric entries. The case of theoretical determination of nitrogen atom ionization or recombination global rate coefficients under electron impact is addressed first. The global rate coefficient can be implemented in multidimensional computational fluid dynamics calculations. The case of relaxation after a shock front crossing a gas of N 2 molecules treated in the framework of the Rankine–Hugoniot assumptions is also studied. The vibrational and electronic specific CR model elaborated in this case allows one to understand how the plasma reaches equilibrium and to estimate the role of the radiative losses. These radiative losses play a significant role at low pressure in the third case studied. This case concerns CO 2 plasma jets inductively generated in high enthalpy wind tunnels used as ground test facilities. We focus our attention on the behaviour of CO and C 2 electronic excited states, the radiative signature of which can be particularly significant in this type of plasma. These three cases illustrate the elaboration of CR models and their coupling with balance equations. (paper)

Revising Tinto's Interactionalist Theory of Student Departure Through Theory Elaboration: Examining the Role of Organizational Attributes in the Persistence Process.

Science.gov (United States)

Berger, Joseph B.; Braxton, John M.

1998-01-01

A study used theory elaboration to help revise Tinto's interactionalist theory of individual student departure from college to include the effects of organizational attributes on student withdrawal. Results provide strong support for including concepts from organizational theory and suggest future research should use theory elaboration to look for…

Discourse, Complexity, Normativity: Tracing the Elaboration of Foucault's Materialist Concept of Discourse

Science.gov (United States)

Olssen, Mark

2014-01-01

In this article, I want to suggest that it is through the elaboration of the concept of discourse that the differences between Foucault and thinkers like Habermas, Hegel and Marx can best be understood. Foucault progressively develops a conception of discourse as a purely historical category that resists all reference to transcendental principles…

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Remembering the past and imagining the future: common and distinct neural substrates during event construction and elaboration

OpenAIRE

Addis, Donna Rose; Wong, Alana T.; Schacter, Daniel L.

2006-01-01

People can consciously re-experience past events and pre-experience possible future events. This fMRI study examined the neural regions mediating the construction and elaboration of past and future events. Participants were cued with a noun for 20 seconds and instructed to construct a past or future event within a specified time period (week, year, 5–20 years). Once participants had the event in mind, they made a button press and for the remainder of the 20 seconds elaborated on the event. Im...

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

On Fair Lotteries

OpenAIRE

STONE, PETER

2008-01-01

PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

Elaboration of biscuits with oatmeal and fat palm with added L-leucine and calcium for sarcopenia

Directory of Open Access Journals (Sweden)

Telma Elita Bertolin

2013-06-01

Full Text Available The objective of this study was to evaluate the effect of the addition of oatmeal and palm fat in the elaboration of biscuits with added L-leucine and calcium in order to develop a product for sarcopenia in the elderly. The biscuits, or cookies, were elaborated applying a central composite rotational design with surface response methodology, and the significant linear, quadratic and interaction terms were used in the second order mathematical model. Physical, physicochemical and sensory analyses were performed by a trained panel. Based on the best results obtained, three cookie formulations were selected for sensory evaluation by the target group and physicochemical determinations. The formulations with the highest sensory scores for appearance and texture and medium scores for color and expansion index were selected. The addition of calcium and leucine increased significantly the concentration of these components in the biscuits elaborated resulting in a cookie with more than 30% of DRI (Dietary Reference Intake for calcium and leucine. The formulations selected showed high acceptance by the target group; therefore, they can be included in the diet of elderly with sarcopenia as a functional food.

For the elaboration of a report that integrates environment and economy: recommendations from the analysis of 122 practical cases; Pour l'elaboration d'un rapport integrant environnement et economie: recommandations a partir de l'analyse de 122 cas pratiques

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

In 1999 the 'Friends of the Earth' association has started an 'eco-management' campaign with 4 main goals: verifying the implementation of the environmental management system and its certification, dialoguing with authorities to fill up the gaps of the system and promoting the participation of companies, spreading the knowledge about these instruments to the public, and working with the different actors (companies, syndicates, associations, employees, organizations..) for the implementation of a reliable and credible environmental management system. The aim of this study is to elaborate recommendations for the elaboration of a report that integrates environment and economy, to use an original approach in the elaboration of the report with an identification of the environmental impact of the activity and/or products of the company due to the production, the use or the recycling, and finally, to provide a methodological sustain to companies through the presentation of the best examples chosen among the analyzed documents. The first part of this report is devoted to the analysis of the actors concerned and to the initiatives performed in the domain of reporting. The second part concerns the presentation of the content of the recommendations elaborated by the committee of control which proposes remarkable examples to be followed. (J.S.)

Simulation, elaboration and analysis of inter-digitated back contacts photovoltaic cells

International Nuclear Information System (INIS)

Nichiporuk, O.

2005-05-01

Solar energy is the most promising and powerful energy source among renewable energies. Photovoltaic electricity is obtained by direct transformation of the sunlight into electricity by means of photovoltaic cells. The objective of this work is to develop photovoltaic cells with back inter-digitated contacts. In the first chapter, we recall the principle of operation and the fundamental parameters of a photovoltaic cell. In a second part, we explain specificities of the inter-digitated back-contact solar cells, as well as the advantages and the disadvantages of such cells. In the second chapter we study the operation of inter-digitated back-contacts solar cells by two dimensional numerical simulation in order to optimize the geometry and doping profiles of the cell. The third chapter relates to the techniques and the methods of characterization of photovoltaic devices and components. In the fourth chapter, we describe the elaboration of inter-digitated back-contact cells. Three technological processes are presented in order to develop a simple technology for cells realization. In particular, we develop the auto-aligned technological process, which enables to elaborate the cells by using only one lithography step. In the last chapter we examine various approaches to reduce the surface recombination: SiO 2 , silicon nitride deposited by UVCVD, hydrogen annealing, etc.. (author)

Simulation, elaboration and analysis of inter-digitated back-contacts photovoltaic cells

International Nuclear Information System (INIS)

Nichiporuk, O.

2005-05-01

Solar energy is the most promising and powerful energy source among renewable energies. Photovoltaic electricity is obtained by direct transformation of the sunlight into electricity by means of photovoltaic cells. The objective of this work is to develop photovoltaic cells with back inter-digitated contacts. In the first chapter, we recall the principle of operation and the fundamental parameters of a photovoltaic cell. In a second part, we explain specificities of the inter-digitated back-contact solar cells, as well as the advantages and the disadvantages of such cells. In the second chapter we study the operation of inter-digitated back-contacts solar cells by two dimensional numerical simulation in order to optimize the geometry and doping profiles of the cell. The third chapter relates to the techniques and the methods of characterization of photovoltaic devices and components. In the fourth chapter, we describe the elaboration of inter-digitated back-contact cells. Three technological processes are presented in order to develop a simple technology for cells realization. In particular, we develop the auto-aligned technological process, which enables to elaborate the cells by using only one lithography step. In the last chapter we examine various approaches to reduce the surface recombination: SiO 2 , silicon nitride deposited by UVCVD, hydrogen annealing, etc... (author)

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

Science.gov (United States)

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

Acceptance- and imagery-based strategies can reduce chocolate cravings: A test of the elaborated-intrusion theory of desire.

Science.gov (United States)

Schumacher, Sophie; Kemps, Eva; Tiggemann, Marika

2017-06-01

The elaborated-intrusion theory of desire proposes that craving is a two-stage process whereby initial intrusions about a desired target are subsequently elaborated with mental imagery. The present study tested whether the craving reduction strategies of cognitive defusion and guided imagery could differentially target the intrusion and elaboration stages, respectively, and thus differentially impact the craving process. Participants were randomly assigned to a cognitive defusion, a guided imagery or a mind-wandering control condition. Pre- and post-intervention chocolate-related thoughts, intrusiveness of thoughts, vividness of imagery, craving intensity, and chocolate consumption were compared. Experiment 1 recruited a general sample of young women (n = 94), whereas Experiment 2 recruited a sample of chocolate cravers who wanted to reduce their chocolate consumption (n = 97). Across both experiments, cognitive defusion lowered intrusiveness of thoughts, vividness of imagery and craving intensity. Guided imagery reduced chocolate-related thoughts, intrusiveness, vividness and craving intensity for chocolate cravers (Experiment 2), but not for the general sample (Experiment 1). There were no group differences in chocolate consumption in either experiment. Results add to existing evidence supporting the elaborated-intrusion theory of desire in the food domain, and suggest that acceptance- and imagery-based techniques have potential for use in combatting problematic cravings. Copyright © 2017 Elsevier Ltd. All rights reserved.

Zeus and Trojan advantage: traces of elaborations of the tradition in the Iliad

Directory of Open Access Journals (Sweden)

Pietro Verzina

2015-12-01

Full Text Available Following a theoretical model, this article assumes that the poet of the Iliad is aware of the potential inconsistency between the traditional account of the wrath and the version which he elaborates, and shows how the poem manages both according to its expressive and structural purposes.

Cross validation in LULOO

DEFF Research Database (Denmark)

Sørensen, Paul Haase; Nørgård, Peter Magnus; Hansen, Lars Kai

1996-01-01

The leave-one-out cross-validation scheme for generalization assessment of neural network models is computationally expensive due to replicated training sessions. Linear unlearning of examples has recently been suggested as an approach to approximative cross-validation. Here we briefly review...... the linear unlearning scheme, dubbed LULOO, and we illustrate it on a systemidentification example. Further, we address the possibility of extracting confidence information (error bars) from the LULOO ensemble....

Regulation imposed to nuclear facility operators for the elaboration of 'waste studies' and 'waste statuses'

International Nuclear Information System (INIS)

2001-01-01

This decision from the French authority of nuclear safety (ASN) aims at validating the new versions of the guidebook for the elaboration of 'waste studies' for nuclear facilities and of the specifications for the elaboration of 'waste statuses' for nuclear facilities. This paper includes two documents. The first one is a guidebook devoted to nuclear facility operators which fixes the rules of production of waste studies according to the articles 20 to 26 of the inter-ministry by-law from December 31, 1999 (waste zoning conditions and ASN's control modalities). The second document concerns the specifications for the establishment of annual waste statuses according to article 27 of the inter-ministry by-law from December 31, 1999 (rational management of nuclear wastes). (J.S.)

Elaboration, structural and optical investigations of ZnO/epoxy nanocomposites

Science.gov (United States)

Moussa, S.; Namouchi, F.; Guermazi, H.

2015-07-01

Hybrid nanocomposites were elaborated by incorporating ZnO nanoparticles into a transparent epoxy polymer matrix, using the direct dispersion method. The effect of the nanoparticles on the structural and optical properties of the polymer matrix was investigated using Fourier transform infrared (FTIR), Raman and UV-Visible spectroscopies. Nanocomposites FTIR spectra showed a variation of band intensities attributed to nanoparticles agglomeration within the polymer. The UV-Visible measurements showed a redshift on the band gap energy of the nanocomposites differently from neat epoxy resin, caused by interactions between ZnO NPs and polymer chains. Raman spectra confirm these interactions and the formation of hydrogen bonds in the nanocomposites. The UV-Visible transmittance spectra revealed that addition of a very low concentration (0.2wt%) of ZnO nanoparticles to a transparent epoxy matrix would maintain high visible-light transparency. The decrease of transmittance with increasing ZnO percentage is due to light scattering which originates from the agglomeration of nanoparticles in the matrix, the mismatch between the refractive index of ZnO and that of the epoxy matrix, and the increase of the surface roughness of the nanocomposite with increasing ZnO addition. Moreover, the UV-vis absorption spectra revealed that adding more than 1wt% ZnO leads to the improvement of the UV shielding properties of the nanocomposites. These results prove that the elaborated ZnO/epoxy nanocomposites can be used as UV shielding materials.

Extrusion: An environmentally friendly process for PEMFC membrane elaboration

Energy Technology Data Exchange (ETDEWEB)

Sanchez, J.-Y.; Iojoiu, C.; Marechal, M. [LEPMI, UMR 5631 CNRS-INPG-UJF, ENSEEG, BP 75, F-38402, Saint Martin d' Heres (France); Chabert, F.; El Kissi, N. [Rheologie, UMR 5520 CNRS-INPG-UJF, ENSHMG, BP 53, F-38041, Grenoble (France); Salomon, J.; Mercier, R. [LMOPS UMR CNRS 5041, BP 24, F-69390 Vernaison (France); Piffard, Y. [CNRS Universite de Nantes, Institut des Materiaux Jean Rouxel, UMR 6502, BP 32229, F-44322, Nantes Cedex 3 (France); Galiano, H. [CEA, Le Ripault Research Center, BP 16, F-37260, Monts (France)

2007-12-31

The paper deals with the use of extrusion to process PEMFC filled and unfilled membranes. Several routes including the sulfonation of filled and unfilled extruded membranes and the extrusion of filled and unfilled ionomers are reported. Thanks to the use of selected water-soluble aid process plasticizers, acid and alkaline forms of sulfonated polyethersulfone were, for the first time, successfully extruded. The extrusion process did not lead to any degradation of the ionomer performances. Decreasing the membrane cost while using environmentally friendly elaboration conditions, it should be helpful to an industrial production. In addition, avoiding filler sedimentation it should allow homogeneous composite membranes to be obtained. (author)

Expanding Evolutionary Theory beyond Darwinism with Elaborating, Self-Organizing, and Fractionating Complex Evolutionary Systems

Science.gov (United States)

Fichter, Lynn S.; Pyle, E. J.; Whitmeyer, S. J.

2010-01-01

Earth systems increase in complexity, diversity, and interconnectedness with time, driven by tectonic/solar energy that keeps the systems far from equilibrium. The evolution of Earth systems is facilitated by three evolutionary mechanisms: "elaboration," "fractionation," and "self-organization," that share…

The Elaboration Likelihood Model and Proxemic Violations as Peripheral Cues to Information Processing.

Science.gov (United States)

Eaves, Michael

This paper provides a literature review of the elaboration likelihood model (ELM) as applied in persuasion. Specifically, the paper addresses distraction with regard to effects on persuasion. In addition, the application of proxemic violations as peripheral cues in message processing is discussed. Finally, the paper proposes to shed new light on…

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

Science.gov (United States)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Grief elaboration in families with handicapped member.

Science.gov (United States)

Calandra, C; Finocchiaro, G; Raciti, L; Alberti, A

1992-01-01

Families with handicapped member seem to follow the same five stages (rejection and isolation, anger, dealing with the problem, depression, acceptance) of Kubler-Ross grief elaboration theory while dealing with the narcissistic wound of a handicapped child. Some of these families show a block in one of the stages. The effort of psychotherapy is to remove the block and let them reach the last stage. In this paper families under systemic psychotherapeutic treatment are analyzed, who had in common the birth of a child with low or modest invalidating signs and psychotic or autistic features. The families structure did not show the characteristics of a psychotic family. Nevertheless either one or both parents ignored the evidence of their child disease and they built a "disease-incongrous" wait around the child, trying to push away the painful reality. The authors explain the importance of this approach for the improvement of the autistic traits.

Elaboration of high-temperature friction polymer material and study of its wear aspects

International Nuclear Information System (INIS)

Gventsadze, L.

2009-01-01

High-temperature friction composite material is elaborated and its physical, mechanical and tribologic features are studied. It is shown, that addition to the friction material composition of filling material having nanopores -diatomite-and its modification with polyethilensilan leads to friction materials friction coefficient stability and wear resistance increase at high temperatures (400-600 ℃). (author)

SOXE neofunctionalization and elaboration of the neural crest during chordate evolution

Science.gov (United States)

Tai, Andrew; Cheung, Martin; Huang, Yong-Heng; Jauch, Ralf; Bronner, Marianne E.; Cheah, Kathryn S. E.

2016-01-01

During chordate evolution, two genome-wide duplications facilitated acquisition of vertebrate traits, including emergence of neural crest cells (NCCs), in which neofunctionalization of the duplicated genes are thought to have facilitated development of craniofacial structures and the peripheral nervous system. How these duplicated genes evolve and acquire the ability to specify NC and their derivatives are largely unknown. Vertebrate SoxE paralogues, most notably Sox9/10, are essential for NC induction, delamination and lineage specification. In contrast, the basal chordate, amphioxus, has a single SoxE gene and lacks NC-like cells. Here, we test the hypothesis that duplication and divergence of an ancestral SoxE gene may have facilitated elaboration of NC lineages. By using an in vivo expression assay to compare effects of AmphiSoxE and vertebrate Sox9 on NC development, we demonstrate that all SOXE proteins possess similar DNA binding and homodimerization properties and can induce NCCs. However, AmphiSOXE is less efficient than SOX9 in transactivation activity and in the ability to preferentially promote glial over neuronal fate, a difference that lies within the combined properties of amino terminal and transactivation domains. We propose that acquisition of AmphiSoxE expression in the neural plate border led to NCC emergence while duplication and divergence produced advantageous mutations in vertebrate homologues, promoting elaboration of NC traits. PMID:27734831

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Elaboration of Ariane 6 operational concept with a concurrent engineering approach

OpenAIRE

David, Emmanuelle

2016-01-01

In December 2014, the ESA Council at Ministerial level has decided to go ahead with the Ariane 6 and Vega-C development programmes. The overarching aim of Ariane 6 is to provide guaranteed access to space for Europe at a competitive price. ESA has the role of Procuring entity and Launch System Architect (LSA). As Launch System Architect, ESA ensures the coherence on the Launcher System and the Launch base in the elaboration of the operational concept. The ambitious High Level R...

A few examples go a long way: Constructing query models from elaborate query formulations

NARCIS (Netherlands)

Balog, K.; Weerkamp, W.; de Rijke, M.; Myaeng, S.-H.; Oard, D.W.; Sebastiani, F.; Chua, T.-S.; Leong, M.-K.

2008-01-01

We address a specific enterprise document search scenario, where the information need is expressed in an elaborate manner. In our scenario, information needs are expressed using a short query (of a few keywords) together with examples of key reference pages. Given this setup, we investigate how the

Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

Science.gov (United States)

Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

2017-12-20

This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

The Role of Elaboration in the Comprehension and Retention of Prose: A Critical Review.

Science.gov (United States)

Reder, Lynne M.

1980-01-01

Recent research in the area of prose comprehension is reviewed, including factors that affect amount of recall, representations of text structures, and use of world knowledge to aid comprehension. The need for more information processing models of comprehension is emphasized. Elaboration is considered important for comprehension and retention.…

Elaboration of mini plates with U-Mo for irradiation in a high flux reactor

International Nuclear Information System (INIS)

Pasqualini, Enrique E.

2005-01-01

Full text: International new efforts for the reconversion of HEU in research, testing and radioisotopes production reactors, have greatly incremented U-Mo fuels qualification activities. These qualifications require the resolution of undesired interaction at high fluxes between UMo particles and the aluminum matrix in the case of dispersed fuels and the development of U-Mo monolithic fuels. These efforts are being manifested in the planning and execution of additional series of irradiation tests of mini plates and full size plates. Recently, CNEA has elaborated mini plates with different proposals for the irradiation at the ATR reactor (250 MWTH, maximum thermal neutron flux 10 15 n.cm -2 .seg -1 ) at Idaho National Laboratory, USA. Uranium 7% (w/w) molybdenum (U-7Mo) particles were coated with silicon. Chemical vapour deposition (CVD) of silane and high temperature diffusion of silicon were used. Hydrided, milled and dehydrated (HMD) particles heat treated at 1000 C degrees during four hours and centrifugal atomized powder were coated and the results compared. Mini plates were elaborated with both kinds of particles. Mini plates were also elaborated with U-7Mo and silicon particles dispersed in the aluminium matrix. Monolithic mini plates were also developed by co lamination of U-7Mo with a Zircaloy-4 cladding. The different steps of this process are detailed and the method is shown to be versatile, can be easily scaled up and is performed with small modifications of usual equipment in fuel plants. The irradiation experiment is called RERTR-7A, includes a total of 32 mini plates and it is planed to finalize by mid 2006. (author) [es

Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

2017-01-01

Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Effects of a Cooperative Learning Program on the Elaborations of Students Working in Dyads

NARCIS (Netherlands)

Krol, K.; Janssen, J.J.H.M.; Veenman, S.A.M.; Linden, A.A.M. van der

2004-01-01

In this study, the effects of a school improvement program on cooperative learning (CL) with respect to the elaborations of 6th-grade students working in mixed-ability and mixed-sex dyads on 2 cooperative tasks were examined. A posttest-only design with a control group was used to investigate the

Elaboration of new ceramic composites containing glass fibre production wastes

International Nuclear Information System (INIS)

Rozenstrauha, I.; Sosins, G.; Krage, L.; Sedmale, G.; Vaiciukyniene, D.

2013-01-01

Two main by-products or waste from the production of glass fibre are following: sewage sludge containing montmorillonite clay as sorbent material and ca 50 % of organic matter as well as waste glass from aluminium borosilicate glass fibre with relatively high softening temperature (> 600 degree centigrade). In order to elaborate different new ceramic products (porous or dense composites) the mentioned by-products and illitic clay from two different layers of Apriki deposit (Latvia) with illite content in clay fraction up to 80-90 % was used as a matrix. The raw materials were investigated by differential-thermal (DTA) and XRD analysis. Ternary compositions were prepared from mixtures of 15 - 35 wt % of sludge, 20 wt % of waste glass and 45 - 65 wt % of clay and the pressed green bodies were thermally treated in sintering temperature range from 1080 to 1120 degree centigrade in different treatment conditions. Materials produced in temperature range 1090 - 1100 degree centigrade with the most optimal properties - porosity 38 - 52 %, water absorption 39 -47 % and bulk density 1.35 - 1.67 g/cm 3 were selected for production of porous ceramics and materials showing porosity 0.35 - 1.1 %, water absorption 0.7 - 2.6 % and bulk density 2.1 - 2.3 g/cm 3 - for dense ceramic composites. Obtained results indicated that incorporation up to 25 wt % of sewage sludge is beneficial for production of both ceramic products and glass-ceramic composites according to the technological properties. Structural analysis of elaborated composite materials was performed by scanning electron microscopy(SEM). By X-ray diffraction analysis (XRD) the quartz, diopside and anorthite crystalline phases were detected. (Author)

Metallic nanoparticle-based strain sensors elaborated by atomic layer deposition

Science.gov (United States)

Puyoo, E.; Malhaire, C.; Thomas, D.; Rafaël, R.; R'Mili, M.; Malchère, A.; Roiban, L.; Koneti, S.; Bugnet, M.; Sabac, A.; Le Berre, M.

2017-03-01

Platinum nanoparticle-based strain gauges are elaborated by means of atomic layer deposition on flexible polyimide substrates. Their electro-mechanical response is tested under mechanical bending in both buckling and conformational contact configurations. A maximum gauge factor of 70 is reached at a strain level of 0.5%. Although the exponential dependence of the gauge resistance on strain is attributed to the tunneling effect, it is shown that the majority of the junctions between adjacent Pt nanoparticles are in a short circuit state. Finally, we demonstrate the feasibility of an all-plastic pressure sensor integrating Pt nanoparticle-based strain gauges in a Wheatstone bridge configuration.

Erotic Education: Elaborating a Feminist and Faith-Based Pedagogy for Experiential Learning in Religious Studies

Science.gov (United States)

Carbine, Rosemary P.

2010-01-01

This essay explores intersections among Jesuit, Quaker, and feminist theologies and pedagogies of social justice education in order to propose and elaborate an innovative theoretical and theological framework for experiential learning in religious studies that prioritizes relationality, called erotic education. This essay then applies the…

Elaboration of Co-60 sources on gilding vyns, with beta efficiencies 80 % or better and its activity measure by the coincidences method

International Nuclear Information System (INIS)

Cortes P, A.; Tejera R, A.; Becerril V, A.; Ortiz C, A.

1991-12-01

The measuring technique of radioactive activity by the coincidences method 4 π β - γ it requires of the elaboration of radioactive sources on thin supports in order to flows the biggest percentage of beta particles, those of the order of the 80 % or but. In this work a procedure for the elaboration of this type of sources, with gilding Vyns is reported. (Author)

Elaboration Likelihood Model and an Analysis of the Contexts of Its Application

OpenAIRE

Aslıhan Kıymalıoğlu

2014-01-01

Elaboration Likelihood Model (ELM), which supports the existence of two routes to persuasion: central and peripheral routes, has been one of the major models on persuasion. As the number of studies in the Turkish literature on ELM is limited, a detailed explanation of the model together with a comprehensive literature review was considered to be contributory for this gap. The findings of the review reveal that the model was mostly used in marketing and advertising researches, that the concept...

Degree of elaborative processing in two implicit and two explicit memory tasks

OpenAIRE

Pitarque, Alfonso; Algarabel González, Salvador; Meseguer, Enrique

1992-01-01

The level of elaborative processing made by subjects to pairs of words (read vs. generated) and the degree of relationship between the words of each pair (related, rhymed, or rhymed and related) were manipulated on two explicit tasks (cued recall and recognition) and two implicit tasks (word-stem completion and tachistoscopic word identification) to test the empirical validity of the processing-approach theory (see, e.g., Roediger, 1990a, 1990b; Roediger, Srinivas, & Weldon, 1989) of explicit...

A Modern Approach to the Elaboration and Selection of Strategic Alternatives for Resource Regions

Directory of Open Access Journals (Sweden)

Valeriy Anatolyevich Kryukov

2017-03-01

Full Text Available For many countries and regions (both in Russia and abroad, natural resources are the crucial factor for socio-economic development. The role and significance of natural resources in the economy of different areas substantially depend on the institutional environment, including the resource regime. Today, we have a qualitative complication of conditions for mineral resources exploitation, we start to develop new, non-traditional types of resources, which haven’t been available (or demanded earlier for the economic and technological reasons. The changes in the characteristics of natural objects, as well as the increasing of uncertainty in the resource sector, actualize the search for alternatives of the development of resource-type regions and for the elaboration of appropriate strategies. In new conditions of resource regions, it is necessary to place emphasis on the aspects of expanded specific understanding of inclusiveness. It implies the possibility of active participation of regional authorities in the management and regulation of the mineral complex, as well as their involvement in the development of the association of a wide range of communities. These communities consist of the organizations representing the interests of indigenous peoples as well as professional communities: industry associations, environmental organizations, representatives of the innovation industry. Modern approaches to the elaboration of strategic directions for the resource regions development (primarily based on the development of the mineral industry should be based on sustainable development principles, the principles of inclusiveness and the need for innovations. As a result of the convergence of these characteristics, a new socio-economic concept is formed. This concept can be defined as the harmonious development that is extremely important for the Russian regions. The proposed approach can be used for the elaboration of strategic alternatives of the

Elaboration of supports for beta emitting sources (with vyns); Elaboracion de soportes para fuentes emisoras beta (con vyns)

Energy Technology Data Exchange (ETDEWEB)

Cortes P, A.; Torre O, J. De la; Tejera R, A.; Becerril V, A.; Bribiesca S, L

1990-04-15

The Laboratory of Radioactive patterns account with a 4 {pi}{beta}-{gamma} coincidence system of recent acquisition with which absolute measures of radioactive activity with uncertainties of the order of 0.1% can be made. Since the coincidence method for the activity measure consists on detecting to the particle and the photon corresponding to oneself nuclear disintegration, it is necessary to elaborate special radioactive sources on thin supports, in order to allowing the maximum possible fluence of {beta} particles ({approx} 100%). This work a technique for the elaboration of these sources and for the measure of the thickness of the walls of the support is presented. (Author)

Elaboration of a concept for the cumulative environmental exposure assessment of biocides

Energy Technology Data Exchange (ETDEWEB)

Gross, Rita; Bunke, Dirk; Moch, Katja [Oeko-Institut e.V. - Institut fuer Angewandte Oekologie e.V., Freiburg im Breisgau (Germany); Gartiser, Stefan [Hydrotox GmbH, Freiburg im Breisgau (Germany)

2011-12-15

Article 10(1) of the EU Biocidal Products Directive 98/8/EC (BPD) requires that for the inclusion of an active substance in Annex I, Annex IA or IB, cumulation effects from the use of biocidal products containing the same active substance shall be taken into account, where relevant. The study proves the feasibility of a technical realisation of Article 10(1) of the BPD and elaborates a first concept for the cumulative environmental exposure assessment of biocides. Existing requirements concerning cumulative assessments in other regulatory frameworks have been evaluated and their applicability for biocides has been examined. Technical terms and definitions used in this context were documented with the aim to harmonise terminology with other frameworks and to set up a precise definition within the BPD. Furthermore, application conditions of biocidal products have been analysed to find out for which cumulative exposure assessments may be relevant. Different parameters were identified which might serve as indicators for the relevance of cumulative exposure assessments. These indicators were then integrated in a flow chart by means of which the relevance of cumulative exposure assessments can be checked. Finally, proposals for the technical performance of cumulative exposure assessments within the Review Programme have been elaborated with the aim to bring the results of the project into the upcoming development and harmonization processes on EU level. (orig.)

Methodological guide for the follow-up and elaboration of performance assessments of a methanization plant

International Nuclear Information System (INIS)

Bastide, Guillaume

2014-06-01

This guide aims at giving indications required for a good implementation of an exploitation follow-up of a methanization plant. More precisely, it aims at foreseeing equipment necessary to the follow-up of installation construction, at preparing the operator to the follow-up and command of his installation, at elaborating operation assessments and performance interpretations, at proposing solutions and/or improvements. The described follow-up process can be applied to all the process stages (from receipt to by-product valorization), and addresses technical as well as economic aspects. Thus, four types of assessments are made: technical, energetic, environmental, and social-economic. This guide comprises five parts: a presentation of follow-up objectives (information to be looked for, benefits and drawbacks, follow-up level to be implemented), the follow-up methodology, follow-up assessments (what they are and how to elaborate them), practical sheets (practical presentation of techniques, typical Excel spreadsheets), and a glossary which explains the main technical terms

Elaboration of titanium nitride coatings by activated reactive evaporation

International Nuclear Information System (INIS)

Granier, Jean

1978-01-01

As titanium nitride is a very interesting and promising material for the protection against wear and corrosion of metals and alloys with a low fusion point, and notably steels, this research thesis reports the study of the elaboration of a TiN coating by activated reactive evaporation. In a first part, the author describes deposition processes based on evaporation and their characteristics. He explains the choice of the studied process. He discusses published data and results related to the titanium-nitrogen system. He describes the apparatus and reports the operation mode adjustment, and reports the study of the influence of operating conditions (substrate temperature, nitrogen pressure, evaporation rate, possible use of a discharge) on growth kinetics and on coating properties. A reaction mechanism is then proposed to describe and explain the obtained results [fr

Applying the elaboration likelihood model of persuasion to a videotape-based eating disorders primary prevention program for adolescent girls.

Science.gov (United States)

Withers, Giselle F; Wertheim, Eleanor H

2004-01-01

This study applied principles from the Elaboration Likelihood Model of Persuasion to the prevention of disordered eating. Early adolescent girls watched either a preventive videotape only (n=114) or video plus post-video activity (verbal discussion, written exercises, or control discussion) (n=187); or had no intervention (n=104). Significantly more body image and knowledge improvements occurred at post video and follow-up in the intervention groups compared to no intervention. There were no outcome differences among intervention groups, or between girls with high or low elaboration likelihood. Further research is needed in integrating the videotape into a broader prevention package.

Homogenous reactor, elaborations, not released up to end

International Nuclear Information System (INIS)

Takibayev, Zh.S.

2002-01-01

Nowadays the nuclear power uses mainly water moderated reactors, where water or heavy water works as neutron inhibitor or coolant, and fuel solid state is situated in reactor core discretely as fuel element packed in fuel assembly. Such fuel composition in solid state reactors leads to rise in price of reactor itself and, of course, many other inconveniences. Firstly, burning out depth is limited; secondary, agents absorbed neutrons are accumulated in fission products, i. e. it leads to poisoning slag derive and thirdly, there are too many outside agents in reactor core in the form of fuel elements and different constructional materials. It worsens neutron balance of reactor. There are many other inconveniences. Specialists understand this problem. They are looking for escaping of difficulty proposing to begin a wide-ranging design, for example, of a new generation of homogeneous reactor especially with salt liquid, liquid metal fuel. But this problem nowadays can not be nearly decided. It is clear enough that within at least 50-100 years the existing monopoly will not change its attitude to use of new elaboration, for example, reactor with salt liquid fuel unless a sharp necessity of opening up not only 1-2 % of uranium in the case of reactors on thermal neutrons or nearby 10-20 % for fast reactors as nowadays but effective use of all potential of nuclear fission energy contained in natural uranium and thorium resources will be realized. In the report the scheme of nuclear reactor with liquid metal or salt liquid is shown. Such approach can be in future one of possible variants of problem solution in effective opening up of all uranium-plutonium energy resource of our planet. The scheme shows only possible allocations of the container and the pipeline. Their proportioning is one of main problems of future elaborations. A mutual allocation of the container and pipelines was carried out in such way, that demand to the last ones where less than to the container

Multiple motives and persuasive communication : Creative elaboration as a result of impression motivation and accuracy motivation

NARCIS (Netherlands)

Nienhuis, AE; Manstead, ASR; Spears, R

The authors examined the influence of impression motivation (Experiments 1 and 2) and the combined effects of accuracy motivation and impression motivation (Experiment 3) on the elaboration of persuasive messages as reflected in attitude change and cognitive responses. Intermediate levels of

Chapter 5. Technological aspects of obtaining of ethynyl-piperidol polymers. 5.1. Elaboration of method of continuous production of bandaging material

International Nuclear Information System (INIS)

Khalikov, D.Kh.

2012-01-01

The elaboration of method of continuous production of styptic and antibacterial material was the purpose of present scientific research. The flowsheet of continuous production of styptic and antibacterial material was elaborated and described. The process of iodine sorption by modified materials was studied. The iodine sorption by modified materials in moment of its formation from the potassium iodide was studied as well. The influence of nature of grafted polymer on sorption of iodide ions was studied as well.

Unlearning American Patriotism

Science.gov (United States)

Miller, Richard W.

2007-01-01

Immoral excesses of American foreign policy are so severe and so deep-rooted that American patriotism is now a moral burden. This love, which pulls toward amnesia, wishful thinking and inattention to urgent foreign interests, should be replaced by commitment to a global social movement that seeks to hem in the American empire. Teachers can advance…

Optimization of the elaboration conditions of an adsorber for the hydrogen storage; Optimisation des conditions d'elaboration d'un adsorbant pour le stockage d'hydrogene

Energy Technology Data Exchange (ETDEWEB)

Fierro, V.; Mareche, J.F.; Furdin, G. [Nancy-1 Univ. Henri Poincare, UMR - CNRS 7555, Laboratoire de Chimie du Solide Mineral, 54 - Vandoeuvre-les-Nancy (France); Szczurek, A.; Albiniak, A. [Wroclaw Univ. of Technology, Laboratory for Lignites and Carbon Adsorbents, Institute of Chemistry and Technology of Petroleum and Coal (Poland); Latroche, M. [Chimie Metallurgique des Terres Rares, ICMPE, UMR 7182, CNRS, 94 - Thiais (France); Celzard, A. [Nancy-Univ., ENSTIB, Laboratoire de Chimie du Solide Mineral, UMR CNRS 7555, 88 - Epinal (France)

2008-07-01

The microporous carbon are very efficient adsorbents for the hydrogen storage, because of pores size under 2 nm. This study describes the optimization of the elaboration conditions for a carbon adsorbent for the hydrogen storage by adsorption. The storage capacity has been measured at 25 C for 20 MPa and also at 77 K for pressures between 6 and 9 MPa. the porous texture characterization has been realized by four molecule probes of increasing diameter: CO{sub 2}, N{sub 2}, C{sub 6}H{sub 6} and CCl{sub 4}. (A.L.B.)

Examining Sex Differences in Altering Attitudes About Rape: A Test of the Elaboration Likelihood Model.

Science.gov (United States)

Heppner, Mary J.; And Others

1995-01-01

Intervention sought to improve first-year college students' attitudes about rape. Used the Elaboration Likelihood Model to examine men's and women's attitude change process. Found numerous sex differences in ways men and women experienced and changed during and after intervention. Women's attitude showed more lasting change while men's was more…

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Conceptual elaboration versus direct lexical access in WAIS-similarities: differential effects of white-matter lesions and gray matter volumes.

Science.gov (United States)

Fernaeus, Sven-Erik; Hellström, Åke

2017-09-18

Wechsler Adult Intelligence Scale (WAIS) subscale Similarities have been classified as a test of either verbal comprehension or of inductive reasoning. The reason may be that items divide into two categories. We tested the hypothesis of heterogeneity of items in WAIS-Similarities. Consecutive patients at a memory clinic and healthy controls participated in the study. White-matter hyperintensities (WMHs) and normalized temporal lobe volumes were measured based on Magnetic resonance Imaging (MRI), and tests of verbal memory and attention were used in addition to WAIS-Similarities to collect behavioural data. Factor analysis supported the hypothesis that two factors are involved in the performance of WAIS-similarities: (1) semiautomatic lexical access and (2) conceptual elaboration. These factors were highly correlated but provided discriminative diagnostic information: In logistic regression analyses, scores of the lexical access factor and of the conceptual elaboration factor discriminated patients with mild cognitive impairment from Alzheimer's disease patients and from healthy controls, respectively. High scores of WMH, indicating periventricular white-matter lesions, predicted factor scores of direct lexical access but not those of conceptual elaboration, which were predicted only by medial and lateral temporal lobe volumes.

Exploring the utility of narrative analysis in diagnostic decision making: picture-bound reference, elaboration, and fetal alcohol spectrum disorders.

Science.gov (United States)

Thorne, John C; Coggins, Truman E; Carmichael Olson, Heather; Astley, Susan J

2007-04-01

To evaluate classification accuracy and clinical feasibility of a narrative analysis tool for identifying children with a fetal alcohol spectrum disorder (FASD). Picture-elicited narratives generated by 16 age-matched pairs of school-aged children (FASD vs. typical development [TD]) were coded for semantic elaboration and reference strategy by judges who were unaware of age, gender, and group membership of the participants. Receiver operating characteristic (ROC) curves were used to examine the classification accuracy of the resulting set of narrative measures for making 2 classifications: (a) for the 16 children diagnosed with FASD, low performance (n = 7) versus average performance (n = 9) on a standardized expressive language task and (b) FASD (n = 16) versus TD (n = 16). Combining the rates of semantic elaboration and pragmatically inappropriate reference perfectly matched a classification based on performance on the standardized language task. More importantly, the rate of ambiguous nominal reference was highly accurate in classifying children with an FASD regardless of their performance on the standardized language task (area under the ROC curve = .863, confidence interval = .736-.991). Results support further study of the diagnostic utility of narrative analysis using discourse level measures of elaboration and children's strategic use of reference.

Psychoanalytic psychodrama in France and group elaboration of counter-transference: Therapeutic operators in play therapy.

Science.gov (United States)

Blanc, Adrien; Boutinaud, Jérôme

2017-06-01

In France, psychoanalytic psychodrama is mainly envisioned in its individual form - that is, a single patient working with a group of therapists. Its originality consists in bringing together several clinicians within a clinical experience that is shared as a group. This experience is fundamentally different from traditional individual therapies, psychotherapies or group co-led therapies. Its configuration may be confusing or overwhelming due to the large number of co-therapists involved in the setting. However, thanks to group elaboration based on the transferential-countertransferential dynamics induced by the treated patient, this potential 'cacophony' can lead to fruitful psychic development embedded in play. This is tied to the co-therapists' positioning in the transitional space shared with the patient as well as to the patient's subjective appropriation of their initiatives. By reflecting on clinical material taken from actual sessions as well as from the exchanges and elaborations occurring at their margins, this article shows how psychodrama and group come to metabolize the transferential elements, shaping the engagement of participants in the context of improvised play. Copyright © 2016 Institute of Psychoanalysis.

Elaboration of a semiconductive thin film device technology on the basis of monocrystalline gallium arsenide

International Nuclear Information System (INIS)

Antoshenko, V.; Taurbaev, T.; Skirnevskaya, E.; Shorin, V.; Mihajlov, L.; Bajganatova, Sh.

1996-01-01

The aim of the project: To elaborate the economical technological process of preparing super thin monocrystalline GaAs substrates and device structures for semiconductive electronics. To realize the project it is necessary to solve following problems: o to elaborate and produce the equipment for preparing of separated films and thin film multilayer structures with p-n-junction; - to study conditions of preparing plane crystal perfect separated Ga(Al)As - films; - to optimize regimes of preparing thin film structures with p- and n-conductive - layers; - to determine the optimal methods of transferring autonomous films and structures over the second substrates; - to work out preparing methods of ohmic contacts and electrical commutation; - to optimize the process of repeated use of initial monocrystalline GaAs substrate; - to prepare the samples of discrete thin film photo- and emitting devices. As the result of project realization there will be created cheap ecological technology of heterojunction optoelectronic devices on the basis of GaAs and AlGaAs solid solutions, the laboratory samples of thin film devices will be presented

2-Furoylmethyl amino acids as indicators of Maillard reaction during the elaboration of black garlic.

Science.gov (United States)

Ríos-Ríos, Karina L; Vázquez-Barrios, M Estela; Gaytán-Martínez, Marcela; Olano, Agustín; Montilla, Antonia; Villamiel, Mar

2018-02-01

This study reports the formation of 2-furomethyl-amino acids (2-FM-AA) as indicators of Maillard reaction (MR) in black garlic elaboration, followed by the determination of furosine by ion-pair RP-HPLC-UV. The method was assessed for accuracy, repeatability and detection and quantitation limits indicating its adequacy. Traditional procedure of black garlic obtainment and the inclusion of convective drying (CDP) and ohmic heating (OHP) were assayed. For comparison purposes, three commercial black garlic samples were used. Together with furosine (2-FM-lysine), 2-furoylmethyl-γ-aminobutyric acid and 2-FM-arginine were detected. Levels of furosine were higher in CDP (46.6-110.1mg/100g protein) than in OHP (13.7-42.0mg/100g protein) samples, probably due to the most severe processing conditions used in the former. These results highlight the suitability of 2-FM-AA as chemical indicators to monitor the process of black garlic elaboration in order to obtain high quality products. Copyright © 2017 Elsevier Ltd. All rights reserved.

Elaboration of metallic and composite fillings by plasma transferred arc. Process analysis and tribological study

International Nuclear Information System (INIS)

Rochette, Philippe

1987-01-01

The experimental part of this research thesis addresses the parametric study of two surface filling processes (by plasma transferred arc, and by plasma arc projection followed by a coating remelting by electron beam), the elaboration by plasma transferred arc and the metallurgical characterization of fillings of nickel base alloys and composite materials made of tungsten carbides dispersed in a nickel matrix, and the characterization of fretting wear of the so-elaborated fillings in aqueous environment. The results show that the plasma transferred arc filling technique allows coating quality and microstructure to be controlled by adjusting the mass energy of the transferred arc. Besides, this technique results in a very good control of nickel alloy coatings. The various studied composites show that it is better to use a matrix with very few alloying elements or pre-coated carbides in order to avoid any cracking phenomenon. The content of dispersed carbides must not be greater than 60 per cent in weight. The best wear behaviour is obtained with polyhedral tungsten carbides dispersed within a low alloyed nickel matrix [fr

The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

Principles elaboration and creation of information-analytical system ''RI Operation Safety with SSC RIAR Research Reactors''

International Nuclear Information System (INIS)

Ivanov, V.B.; Grachev, A.F.; Kinsky, O.M.; Makin, P.S.; Okhrimenko, A.I.; Demidov, L.I.; Karpyuk, V.I.; Afonin, V.K.; Iskanderov, R.G.

1995-01-01

In this paper an approach is described, which is accepted at elaboration and creation of computer-aided control system of technological process (CCS TP) at the installations with research reactors. The tasks and the main technological requirements to elaborated information-analytical system, are formulated, based on the accepted approach, experience of computer-aided systems and analysis of technological processes at reactor installations (RI) of SSC RIAR. The system includes the following installations: the SM-3, the VK-50, the RBT-10, the BOR-60 and the MIR. Based on the given example there is a classification and the purposes of the modern system of information personnel support of research reactors are formulated as well as approaches to its creation, including creation of determined models of the processes, which are realized in simulators and statistic methods of time series. According to the accepted approaches the results of systematic-technical synthesis and modern states with system simulation are described. (author). 17 refs, 3 figs, 4 tabs

Elaboration and characterization of silver sheathed YBaCuO and BiSrCaCuO wires

International Nuclear Information System (INIS)

Regnier, P.; Chaffron, L.; Schmirgeld, L.

1990-01-01

We report on our recent progress in the elaboration of silver sheathed high-Tc superconducting wires. It is shown that careful optimization of the swaging and pressing stages leads to a compacity of nearly 100% for the green ceramic, which considerably reduces the problem of its shrinkage in the silver clad during sintering, and consequently increases the critical current density far above 10 3 A/cm 2 at 77 K. Electrical and microstructural characterization of the wires are presented and compared with other published data. In particular, for both YBaCuO and BiSrCaCuO ribbons, it is shown that the thinner the ribbon the higher the critical current density. But this effect is much more pronounced for BiSrCaCuO because, due to partial melting of the former ceramic during the elaboration process, there is a pronounced enhancement of its texture as its thickness is reduced

The Elaborated Environmental Stress Hypothesis as a Framework for Understanding the Association Between Motor Skills and Internalizing Problems: A Mini-Review

Science.gov (United States)

Mancini, Vincent O.; Rigoli, Daniela; Cairney, John; Roberts, Lynne D.; Piek, Jan P.

2016-01-01

Poor motor skills have been shown to be associated with a range of psychosocial issues, including internalizing problems (anxiety and depression). While well-documented empirically, our understanding of why this relationship occurs remains theoretically underdeveloped. The Elaborated Environmental Stress Hypothesis by Cairney et al. (2013) provides a promising framework that seeks to explain the association between motor skills and internalizing problems, specifically in children with developmental coordination disorder (DCD). The framework posits that poor motor skills predispose the development of internalizing problems via interactions with intermediary environmental stressors. At the time the model was proposed, limited direct evidence was available to support or refute the framework. Several studies and developments related to the framework have since been published. This mini-review seeks to provide an up-to-date overview of recent developments related to the Elaborated Environmental Stress Hypothesis. We briefly discuss the past research that led to its development, before moving to studies that have investigated the framework since it was proposed. While originally developed within the context of DCD in childhood, recent developments have found support for the model in community samples. Through the reviewed literature, this article provides support for the Elaborated Environmental Stress Hypothesis as a promising theoretical framework that explains the psychosocial correlates across the broader spectrum of motor ability. However, given its recent conceptualization, ongoing evaluation of the Elaborated Environmental Stress Hypothesis is recommended. PMID:26941690

Source and Message Factors in Persuasion: A Reply to Stiff's Critique of the Elaboration Likelihood Model.

Science.gov (United States)

Petty, Richard E.; And Others

1987-01-01

Answers James Stiff's criticism of the Elaboration Likelihood Model (ELM) of persuasion. Corrects certain misperceptions of the ELM and criticizes Stiff's meta-analysis that compares ELM predictions with those derived from Kahneman's elastic capacity model. Argues that Stiff's presentation of the ELM and the conclusions he draws based on the data…

Exploring gender and gender pairing in the knowledge elaboration processes of students using computer-supported collaborative learning

NARCIS (Netherlands)

Ding, N.; Bosker, R. J.; Harskamp, E. G.

The aim of the study is to investigate the influence of gender and gender pairing on students' learning performances and knowledge elaboration processes in Computer-Supported Collaborative Learning (CSCL). A sample of ninety-six secondary school students, participated in a two-week experiment.

A Novel Hall Effect Sensor Using Elaborate Offset Cancellation Method

Directory of Open Access Journals (Sweden)

Vlassis N. Petoussis

2009-01-01

Full Text Available The Hall effect is caused by a traverse force that is formed in the electrons or holes of metal element or semiconductor when are polarized by current source and simultaneously all the system it is found vertical in external magnetic field. Result is finally the production of difference of potential (Hall voltage in address vertical in that of current and magnetic field directions. In the present work is presented a new Hall sensor exploiting the former operation. In combination with his pioneering form and using dynamic spinning current technique with an elaborate sequence, it leads to satisfactory results of produced Hall voltage with small noise in a presence of external magnetic field. Anyone can see both the spinning current and anti-Hall technique in the same sensor simultaneously.

Elaboration of austenitic stainless steel samples with bimodal grain size distributions and investigation of their mechanical behavior

Science.gov (United States)

Flipon, B.; de la Cruz, L. Garcia; Hug, E.; Keller, C.; Barbe, F.

2017-10-01

Samples of 316L austenitic stainless steel with bimodal grain size distributions are elaborated using two distinct routes. The first one is based on powder metallurgy using spark plasma sintering of two powders with different particle sizes. The second route applies the reverse-annealing method: it consists in inducing martensitic phase transformation by plastic strain and further annealing in order to obtain two austenitic grain populations with different sizes. Microstructural analy ses reveal that both methods are suitable to generate significative grain size contrast and to control this contrast according to the elaboration conditions. Mechanical properties under tension are then characterized for different grain size distributions. Crystal plasticity finite element modelling is further applied in a configuration of bimodal distribution to analyse the role played by coarse grains within a matrix of fine grains, considering not only their volume fraction but also their spatial arrangement.

Effects of self-schema elaboration on affective and cognitive reactions to self-relevant information.

Science.gov (United States)

Petersen, L E; Stahlberg, D; Dauenheimer, D

2000-02-01

The basic assumption of the integrative self-schema model (ISSM; L.-E. Petersen, 1994; L.-E. Petersen, D. Stahlberg, & D. Dauenheimer, 1996; D. Stahlberg, L.-E. Petersen, & D. Dauenheimer, 1994, 1999) is that self-schema elaboration (schematic vs. aschematic) affects reactions to self-relevant information. This assumption is based on the idea that schematic dimensions occupy a more central position in the cognitive system than aschematic dimensions. In the first study, this basic prediction could be clearly confirmed: The results showed that schematic dimensions possessed stronger cognitive associations with other self-relevant cognitions as well as a higher resistance to change than aschematic dimensions did. In the second study, the main assumptions of the ISSM concerning the affective and cognitive reactions to self-relevant feedback were tested: The ISSM proposes that, on schematic dimensions, reactions to self-relevant feedback will most likely follow principles of self-consistency theory, whereas on aschematic dimensions positive feedback should elicit the most positive reactions that self-enhancement theory would predict. The experimental results clearly confirmed the hypotheses derived from the ISSM for affective reactions. Cognitive reactions, however, were in line with self-consistency principles and were not modified by the elaboration of the self-schema dimension involved.

Elaboration of the technology of forming a conical product of sheet metal

Directory of Open Access Journals (Sweden)

W. Matysiak

2010-01-01

Full Text Available The work presents a general knowledge about spinning draw pieces of sheets, one of multi-operational processes of spinning a sheet metal conical product without machining. The objective of the work was to elaborate both the technology of forming conical products of sheet metal and execution of technological tests as well as to determine the technological parameters for the process of spinning a conical insert. As a result of the investigations, the products with improved mechanical properties, stricter execution tolerance and low roughness have been obtained. The series of 200 prototype conical inserts for the shipbuilding industry have been made.

Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

Science.gov (United States)

2010-03-01

that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

The Elaborated Environmental Stress Hypothesis as a Framework for Understanding the Association between Motor Skills and Internalizing Problems: A mini-review

Directory of Open Access Journals (Sweden)

Vincent Oreste Mancini

2016-02-01

Full Text Available Poor motor skills have been shown to be associated with a range of psychosocial issues, including internalizing problems (anxiety and depression. While well-documented empirically, our understanding of why this relationship occurs remains theoretically underdeveloped. The Elaborated Environmental Stress Hypothesis by Cairney, Rigoli, and Piek (2013 provides a promising framework that seeks to explain the association between motor skills and internalizing problems, specifically in children with Developmental Coordination Disorder (DCD. The framework posits that poor motor skills predispose the development of internalizing problems via interactions with intermediary environmental stressors. At the time the model was proposed, limited direct evidence was available to support or refute the framework. Several studies and developments related to the framework have since been published. This mini-review seeks to provide an up-to-date overview of recent developments related to the Elaborated Environmental Stress Hypothesis. We briefly discuss the past research that led to its development, before moving to studies that have investigated the framework since it was proposed. While originally developed within the context of DCD in childhood, recent developments have found support for the model in community samples. Through the reviewed literature, this article provides support for the Elaborated Environmental Stress Hypothesis as a promising theoretical framework that explains the psychosocial correlates across the broader spectrum of motor ability. This evidence promotes the external validity of the framework for use across the broader spectrum of motor ability. However, given its recent conceptualisation, ongoing evaluation of the Elaborated Environmental Stress Hypothesis is recommended.

CONSORT 2010 Explanation and Elaboration: Updated guidelines for reporting parallel group randomised trials

DEFF Research Database (Denmark)

Moher, David; Hopewell, Sally; Schulz, Kenneth F

2010-01-01

improves the wording and clarity of the previous checklist and incorporates recommendations related to topics that have only recently received recognition, such as selective outcome reporting bias. This explanatory and elaboration document-intended to enhance the use, understanding, and dissemination...... of the CONSORT statement-has also been extensively revised. It presents the meaning and rationale for each new and updated checklist item providing examples of good reporting and, where possible, references to relevant empirical studies. Several examples of flow diagrams are included. The CONSORT 2010 Statement...

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

The Effects of Elaboration on the Strength of Doping-Related Attitudes: Resistance to Change and Behavioral Intentions.

Science.gov (United States)

Horcajo, Javier; Luttrell, Andrew

2016-06-01

This experiment analyzed whether attitudes toward the legalization of several doping behaviors would resist change and predict behavioral intentions when they were initially formed through thoughtful (i.e., high elaboration) versus nonthoughtful (i.e., low elaboration) processes. Participants were randomly assigned first to a persuasive message either against or in favor of the legalization, which they read with relatively high or low degrees of deliberative thinking. Attitudes and intentions regarding legalization were assessed following that message. Next, each participant received a second message that was opposed to the first one, serving as an attack against the attitude that participants had just formed. Finally, attitudes were again assessed. As hypothesized, participants showed greater attitude-consistent intentions when they formed their initial attitudes through thoughtful (vs. nonthoughtful) consideration of the first message. Moreover, the second message resulted in greater resistance to attitude change when participants formed their initial attitudes through thoughtful (vs. nonthoughtful) processes.

Nursing Care Interpersonal Relationship Questionnaire: elaboration and validation.

Science.gov (United States)

Borges, José Wicto Pereira; Moreira, Thereza Maria Magalhães; Andrade, Dalton Franscisco de

2018-01-08

to elaborate an instrument for the measurement of the interpersonal relationship in nursing care through the Item Response Theory, and the validation thereof. methodological study, which followed the three poles of psychometry: theoretical, empirical and analytical. The Nursing Care Interpersonal Relationship Questionnaire was developed in light of the Imogene King's Interpersonal Conceptual Model and the psychometric properties were studied through the Item Response Theory in a sample of 950 patients attended in Primary, Secondary and Tertiary Health Care. the final instrument consisted of 31 items, with Cronbach's alpha of 0.90 and McDonald's Omega of 0.92. The parameters of the Item Response Theory demonstrated high discrimination in 28 items, being developed a five-level interpretive scale. At the first level, the communication process begins, gaining a wealth of interaction. Subsequent levels demonstrate qualitatively the points of effectiveness of the interpersonal relationship with the involvement of behaviors related to the concepts of transaction and interaction, followed by the concept of role. the instrument was created and proved to be consistent to measure interpersonal relationship in nursing care, as it presented adequate reliability and validity parameters.

Nursing Care Interpersonal Relationship Questionnaire: elaboration and validation

Directory of Open Access Journals (Sweden)

José Wicto Pereira Borges

2018-01-01

Full Text Available ABSTRACT Objective: to elaborate an instrument for the measurement of the interpersonal relationship in nursing care through the Item Response Theory, and the validation thereof. Method: methodological study, which followed the three poles of psychometry: theoretical, empirical and analytical. The Nursing Care Interpersonal Relationship Questionnaire was developed in light of the Imogene King’s Interpersonal Conceptual Model and the psychometric properties were studied through the Item Response Theory in a sample of 950 patients attended in Primary, Secondary and Tertiary Health Care. Results: the final instrument consisted of 31 items, with Cronbach’s alpha of 0.90 and McDonald’s Omega of 0.92. The parameters of the Item Response Theory demonstrated high discrimination in 28 items, being developed a five-level interpretive scale. At the first level, the communication process begins, gaining a wealth of interaction. Subsequent levels demonstrate qualitatively the points of effectiveness of the interpersonal relationship with the involvement of behaviors related to the concepts of transaction and interaction, followed by the concept of role. Conclusion: the instrument was created and proved to be consistent to measure interpersonal relationship in nursing care, as it presented adequate reliability and validity parameters.

Influencing Attitudes Regarding Special Class Placement Using a Psychoeducational Report: An Investigation of the Elaboration Likelihood Model.

Science.gov (United States)

Andrews, Lester W.; Gutkin, Terry B.

1994-01-01

Investigates variables drawn from the Elaboration Likelihood Model (ELM) that might be manipulated to enhance the persuasiveness of a psychoeducational report. Results showed teachers in training were more persuaded by reports with high message quality. Findings are discussed in terms of the ELM and professional school psychology practice. (RJM)

Self-referential processing is distinct from semantic elaboration: evidence from long-term memory effects in a patient with amnesia and semantic impairments.

Science.gov (United States)

Sui, Jie; Humphreys, Glyn W

2013-11-01

We report data demonstrating that self-referential encoding facilitates memory performance in the absence of effects of semantic elaboration in a severely amnesic patient also suffering semantic problems. In Part 1, the patient, GA, was trained to associate items with the self or a familiar other during the encoding phase of a memory task (self-ownership decisions in Experiment 1 and self-evaluation decisions in Experiment 2). Tests of memory showed a consistent self-reference advantage, relative to a condition where the reference was another person in both experiments. The pattern of the self-reference advantage was similar to that in healthy controls. In Part 2 we demonstrate that GA showed minimal effects of semantic elaboration on memory for items he semantically classified, compared with items subject to physical size decisions; in contrast, healthy controls demonstrated enhanced memory performance after semantic relative to physical encoding. The results indicate that self-referential encoding, not semantic elaboration, improves memory in amnesia. Self-referential processing may provide a unique scaffold to help improve learning in amnesic cases. Copyright © 2013 Elsevier Ltd. All rights reserved.

Elaboration of gluten free cupcakes from xanthosoma flours, taro, rice, cassava and their mixtures

International Nuclear Information System (INIS)

Quiros Alpizar, Silvia Maria

2013-01-01

The effect of taro flour, xanthosoma, cassava and rice, their possible mixtures and two different percentages of egg protein in cupcakes with total substitution of wheat flour are studied. Flours of xanthosoma and taro were elaborated and have utilized flours of cassava and rice existing in market. The moisture was evaluated and found that taro flour presents a lower water content compared to rice flour, xanthosoma and cassava in all flours. 22 formulations of cupcakes were elaborated using the flours (100% substitutions), flour mixture (substitution 50:50 of each flour) and wheat as control, also the egg content (standard content to egg and lower content to egg), to analyze their sensory characteristics and consumer preferences. The study data was carried out with two independents groups of people, a trained panel that has conducted the descriptive analysis and a consumer group that has made the study of acceptance. An analysis of variance was applied to data, test Fisher LSD and external preference mapping, an analysis of ''cluster '' for proof of acceptance, with witch were identified the three consumer groups, composed by 19, 51, 35 people. All three groups have preferred the control samples with wheat in groups 2 and 3 cupcakes with rice-cassava with content standard and less content of egg, and cassava with less egg, have showed without significant differences in preference (p [es

A review of studies on persuasion from the viewpoint of the Elaboration Likelihood Model (1)

OpenAIRE

Fukada, Hiromi; Kimura, Kenichi; Makino, Koshi; Higuchi, Masataka

2000-01-01

The purpose of this paper was to review studies on persuasion from the viewpoint of the Elaboration Likelihood Model based on Petty & Wegener (1998). The paper consists of the following four parts. 1. Introduction. 2. Multiple roles for persuasion variables. 3. Source variables: (1) credibility (expertise, trustworthiness), (2) attractiveness/likableness, (3) power, (4) additional source factors related to credibility, liking and power (speed of speech, demographic variables, majority/minorit...

Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

Science.gov (United States)

2010-10-01

DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

Science.gov (United States)

2011-10-01

or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

Ecofriendly bricks elaborated from coal waste of Moroccan Jerrada Mining

Directory of Open Access Journals (Sweden)

Ez-zaki H.

2018-01-01

Full Text Available Solid waste generated during mining is one of the major environmental problems associated with this industrial activity. The best solution to overcome the environmental impact of this waste is to find recycling facilities in mass-produced products that can absorb the large quantities of these available byproducts. The present study shows the feasibility of using the coal waste of Moroccan Jerrada mining in the production of ecological brick. The first step consists of consecutive stages of crushing, grinding and heating at 650°C of the coal waste with a small amount of lime in order to promote the reactive products of elaborated binders. The second step of the process consists of mixing treated coal waste with a small amount of marble dust, sand, gravel, and water, then pressed and dried at room temperature to manufacture a laboratory ecofriendly bricks. The mechanical strength and thermal conductivity are investigated.

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Soundscape elaboration from anthrophonic adaptation of community noise

Science.gov (United States)

Teddy Badai Samodra, FX

2018-03-01

Under the situation of an urban environment, noise has been a critical issue in affecting the indoor environment. A reliable approach is required for evaluation of the community noise as one factor of anthrophonic in the urban environment. This research investigates the level of noise exposure from different community noise sources and elaborates the advantage of the noise disadvantages for soundscape innovation. Integrated building element design as a protector for noise control and speech intelligibility compliance using field experiment and MATLAB programming and modeling are also carried out. Meanwhile, for simulation analysis and building acoustic optimization, Sound Reduction-Speech Intelligibility and Reverberation Time are the main parameters for identifying tropical building model as case study object. The results show that the noise control should consider its integration with the other critical issue, thermal control, in an urban environment. The 1.1 second of reverberation time for speech activities and noise reduction more than 28.66 dBA for critical frequency (20 Hz), the speech intelligibility index could be reached more than fair assessment, 0.45. Furthermore, the environmental psychology adaptation result “Close The Opening” as the best method in high noise condition and personal adjustment as the easiest and the most adaptable way.

Elaboration of optical glass-ceramic for frequency doubling

International Nuclear Information System (INIS)

Vigouroux, H.

2012-01-01

The High power laser development required the need of materials with nonlinear properties. Glass materials can be considered as ideal materials as they can be transparent and elaborated in very large dimension. Precipitation of non-centro symmetric crystalline particles in bulk glass leads to a material with bulk nonlinear properties. This glass-ceramic should be then easily integrated in such laser facilities. In this thesis, the results concerning the precipitation of the phase LiNbO 3 in the glassy-matrix 35 Li 2 O - 25 Nb 2 O 5 - 40 SiO 2 are detailed. The crystallization mechanism of this phase is studied through thermal analysis, optical and electronic microscopy as well as in-situ analyses. These studies reveal glass-ceramics are obtained through a precipitation of the lithium niobate crystalline phase in spherulite shape. The nonlinear optical properties are investigated on this materials and an original, isotropic Second Harmonic Generation Signal (SHG) is registered in the bulk glass-ceramic. A complete study using a multi-scale approach allows the correlation between the spherulite structure and the nonlinear optical properties. A mechanism at the origin of the SHG signal is proposed. This leads to a new approach for transparent inorganic materials development for isotropic SHG conversion. (author) [fr

METHODS ELABORATION ON DETECTION OF SOME ATYPICAL NEUROLYTIC AGENTS FOR CHEMICAL AND TOXICOLOGICAL ANALYSIS

Directory of Open Access Journals (Sweden)

I. P. Remezova

2014-01-01

Full Text Available It is necessary to elaborate methods of atypical neuroleptic agents detection as individual substances and in different combinations as well for diagnosis of poisoning by some of them: clozapine, risperidone, sertindole, olanzapine, aripiprazole. The purpose of this work is methods elaboration of detection of clozapine, risperidone, sertindole, olanzapine, aripiprazole, haloperidol, oxazepam, carbamazapine using TLC, HPLC and UV spectrophotometry methods. During this work we used tablet forms of clozapine, risperidone, sertindole, olanzapine, aripiprazole. It is possible to use solution systems like ethanol-water-25% ammonia solution (8:1:1, toluolacetone-ethanol-25% ammonia solution (45:45:7.5:2.5, dioxan-chloroform-acetone-25% ammonia solution (47.5:45:5:2.5 for preliminary examination of atypical neuroleptic agents under study in combination with typical neuroleptics and tranquilizers with undirected analysis (general screening. System of solvents ethyl-acetate-chloroform-25% ammonia solution (85:10:5 is recommended to use for individual screening of risperidone, sertindole, olanzapine, haloperidol, benzol-ethanol-25% ammonia solution (50:10:0.5 system to use for clozapine, sertindole, olanzapine. Ethanol-25% ammonia solution (100:1.5 system is reasonable to use for chromatographic clearance of extracts from biological substances under study. We recommend using HPLC method and UV spectrophotometry for carrying out of a principal examination of clozapine, risperidone, sertindole, olanzapine and aripiprazole in case one of the substances under study is determined in the object.

Elaboration and Validation of the Medication Prescription Safety Checklist 1

Science.gov (United States)

Pires, Aline de Oliveira Meireles; Ferreira, Maria Beatriz Guimarães; do Nascimento, Kleiton Gonçalves; Felix, Márcia Marques dos Santos; Pires, Patrícia da Silva; Barbosa, Maria Helena

2017-01-01

ABSTRACT Objective: to elaborate and validate a checklist to identify compliance with the recommendations for the structure of medication prescriptions, based on the Protocol of the Ministry of Health and the Brazilian Health Surveillance Agency. Method: methodological research, conducted through the validation and reliability analysis process, using a sample of 27 electronic prescriptions. Results: the analyses confirmed the content validity and reliability of the tool. The content validity, obtained by expert assessment, was considered satisfactory as it covered items that represent the compliance with the recommendations regarding the structure of the medication prescriptions. The reliability, assessed through interrater agreement, was excellent (ICC=1.00) and showed perfect agreement (K=1.00). Conclusion: the Medication Prescription Safety Checklist showed to be a valid and reliable tool for the group studied. We hope that this study can contribute to the prevention of adverse events, as well as to the improvement of care quality and safety in medication use. PMID:28793128

Elaboration and test of the method of separation of alkaline metals ions with tin phosphate

International Nuclear Information System (INIS)

Smirnov, G.I.; Chernyak, A.S.; Kostromina, O.N.; Kachur, N.Ya.; Shpeyzer, B.G.

1986-01-01

Present work is devoted to elaboration and test of the method of separation of alkaline metals ions with tin phosphate. Thus, the isotherms of sorption of lithium, sodium, potassium, rubidium and cesium ions with amorphous tin phosphate depending on their concentration, ph of solution, sorbent quantity are obtained. The parameters of extraction of potassium microquantities from sodium salts are defined. Ultra pure sodium chloride, sodium iodide, sodium sulphate, sodium nitrate, sodium nitrite, sodium phosphate are synthesized.

Elaborations of grounded theory in information research: arenas/social worlds theory, discourse and situational analysis

OpenAIRE

Vasconcelos, A.C.; Sen, B.A.; Rosa, A.; Ellis, D.

2012-01-01

This paper explores elaborations of Grounded Theory in relation to Arenas/Social Worlds Theory. The notions of arenas and social worlds were present in early applications of Grounded Theory but have not been as much used or recognised as the general Grounded Theory approach, particularly in the information studies field. The studies discussed here are therefore very unusual in information research. The empirical contexts of these studies are those of (1) the role of discourse in the organisat...

Fidelity Mechanisms of DNA Polymerase Alpha

Science.gov (United States)

2008-07-23

between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

Elaborations of Institute of Chemistry by name V.I. Nikitin-to the industry (by the example of aluminium plant)

International Nuclear Information System (INIS)

Mirsaidov, U.M.

2002-01-01

In this monograph elaborations of sciences of Institute of Chemistry by name V.I. Nikitin for country needs was systematized . Special attention is devote to complex wastes reprocessing of aluminium plant in Tajikistan. This book mean to scientists and engineer-technical employees

The Effects of Elaboration and Rehearsal on Long-Term Retention of Shape Names by Kindergarteners. Technical Report #31.

Science.gov (United States)

Gallimore, Ronald; And Others

This paper examines the use of elaboration and overt rehearsal as strategies for increasing kindergarten children's retention and recall of shape names. The study is part of a large scale investigation concerned with improving the school achievement of Hawaiian and part-Hawaiian children. Twenty-four kindergarten children enrolled in a…

Ignition and flame spread properties of wood, elaborated during a new test method based on convective heat flux

DEFF Research Database (Denmark)

Sørensen, Lars Schiøtt; Poulsen, Annemarie

2007-01-01

Ignition and flame spread properties on selected types of wood are elaborated. The tests are established in a new test setup in which the test specimen can be fixed in different angles due to a horizontal level. The heat exposing the test objects is arranged as a convective flux. This principle...

Environmental Impact Report from Santa Rita Hydroelectric Power Plant (Minas Gerais State - Brazil): technical strategic for its elaboration

International Nuclear Information System (INIS)

Souza, J.A. de; Marques Neto, F.P.

1989-01-01

The steps for developing the technical strategies used on the elaboration of Environmental Impact Report from Santa Rita Hydroelectric Power Plant, Minas Gerais State, are described, including the influence area, technical requirements, impact identification, technical selection of mitigative measures, impact meaning and strategy for evaluating the identified impacts. (C.G.C.)

The elaboration of motor programs for the automation of letter production.

Science.gov (United States)

Thibon, Laurence Séraphin; Gerber, Silvain; Kandel, Sonia

2018-01-01

We investigated how children learn to write letters. Letter writing evolves from stroke-by-stroke to whole-letter programming. Children of ages 6 to 9 (N=98) wrote letters of varying complexity on a digitizer. At ages 6 and 7 movement duration, dysfluency and trajectory increased with stroke number. This indicates that the motor program they activated mainly coded information on stroke production. Stroke number affected the older children's production much less, suggesting that they programmed stroke chunks or the whole letter. The fact that movement duration and dysfluency decreased from ages 6 to 8, and remained stable at ages 8 and 9 suggests that automation of letter writing begins at age 8. Automation seems to require the elaboration of stroke chunks and/or letter-sized motor programs. Copyright © 2017 Elsevier B.V. All rights reserved.

CONSORT 2010 Explanation and Elaboration: Updated guidelines for reporting parallel group randomised trials

DEFF Research Database (Denmark)

Moher, David; Hopewell, Sally; Schulz, Kenneth F

2010-01-01

Overwhelming evidence shows the quality of reporting of randomised controlled trials (RCTs) is not optimal. Without transparent reporting, readers cannot judge the reliability and validity of trial findings nor extract information for systematic reviews. Recent methodological analyses indicate...... that inadequate reporting and design are associated with biased estimates of treatment effects. Such systematic error is seriously damaging to RCTs, which are considered the gold standard for evaluating interventions because of their ability to minimise or avoid bias. A group of scientists and editors developed......, this revised explanatory and elaboration document, and the associated website (www.consort-statement.org) should be helpful resources to improve reporting of randomised trials....

Elaboration of Langmuir-Blodgett films of oligothiophenes derivatives for solid state polymerisation

International Nuclear Information System (INIS)

Isz, Sandrine

1995-01-01

Molecular electronics requires the elaboration of highly organised conductive architectures, and this research thesis addresses the fabrication of oriented conductive molecular wires. Precursors can be oriented by using the Langmuir-Blodgett technique. Synthesized molecules are oligothiophenes. After a UV-visible study in solution, these molecules have been tested under the form of Langmuir-Blodgett films. Their behaviour at the air-water interface has been characterized by using various techniques (compression isothermal, Brewster angle microscope, transmission electronic microscope, atomic force microscope) to check that higher oligothiophenes are forming a molecular film. Crystal structure reveals an almost vertical orientation of molecules at the water surface. A solid state coupling between these organised molecules has been attempted by electrochemical, thermal, and chemical ways [fr

A real-time data acquisition and elaboration system for instabilities control in the FTU tokamak

Energy Technology Data Exchange (ETDEWEB)

Alessi, E., E-mail: alessi@ifp.cnr.it [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); Boncagni, L. [Associazione EURATOM-ENEA, C.R. Frascati (Italy); Galperti, C.; Marchetto, C.; Nowak, S.; Sozzi, C. [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); Apruzzese, G. [Associazione EURATOM-ENEA, C.R. Frascati (Italy); Bin, W. [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); Belli, F.; Botrugno, A. [Associazione EURATOM-ENEA, C.R. Frascati (Italy); Bruschi, A.; Cirant, S. [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); D' Antona, G.; Davoudi, M. [Politecnico di Milano, Dipartimento di Elettrotecnica (Italy); Figini, L. [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); Ferrero, R. [Politecnico di Milano, Dipartimento di Elettrotecnica (Italy); Gabellieri, L. [Associazione EURATOM-ENEA, C.R. Frascati (Italy); Garavaglia, S.; Granucci, G. [Associazione EURATOM-ENEA, IFP-CNR, Milano (Italy); Grosso, A. [Associazione EURATOM-ENEA, C.R. Frascati (Italy); and others

2013-08-21

A real-time data acquisition and elaboration system is being implemented to control the new ECH launcher recently installed at FTU (Frascati Tokamak Upgrade). The system is aimed at controlling different kinds of magnetohydrodynamic instabilities, in particular the deleterious 3/2 and 2/1 (neoclassical) tearing modes, (N)TM, and the saw teeth period in order to prevent the seeding of NTMs. The complete system is presented here together with preliminary offline and real-time tests. © 2001 Elsevier Science. All rights reserved.

Nursing Care Interpersonal Relationship Questionnaire: elaboration and validation 1

Science.gov (United States)

Borges, José Wicto Pereira; Moreira, Thereza Maria Magalhães; de Andrade, Dalton Franscisco

2018-01-01

ABSTRACT Objective: to elaborate an instrument for the measurement of the interpersonal relationship in nursing care through the Item Response Theory, and the validation thereof. Method: methodological study, which followed the three poles of psychometry: theoretical, empirical and analytical. The Nursing Care Interpersonal Relationship Questionnaire was developed in light of the Imogene King’s Interpersonal Conceptual Model and the psychometric properties were studied through the Item Response Theory in a sample of 950 patients attended in Primary, Secondary and Tertiary Health Care. Results: the final instrument consisted of 31 items, with Cronbach’s alpha of 0.90 and McDonald’s Omega of 0.92. The parameters of the Item Response Theory demonstrated high discrimination in 28 items, being developed a five-level interpretive scale. At the first level, the communication process begins, gaining a wealth of interaction. Subsequent levels demonstrate qualitatively the points of effectiveness of the interpersonal relationship with the involvement of behaviors related to the concepts of transaction and interaction, followed by the concept of role. Conclusion: the instrument was created and proved to be consistent to measure interpersonal relationship in nursing care, as it presented adequate reliability and validity parameters. PMID:29319743

Aluminosilicate glass thin films elaborated by pulsed laser deposition

Energy Technology Data Exchange (ETDEWEB)

Carlier, Thibault [Univ. Lille, CNRS, Centrale Lille, ENSCL, Univ. Artois, UMR 8181 – UCCS – Unité de Catalyse et Chimie du Solide, F-59000 Lille (France); Saitzek, Sébastien [Univ. Artois, CNRS, Centrale Lille, ENSCL, Univ. Lille, UMR 8181, Unité de Catalyse et de Chimie du Solide (UCCS), F-62300 Lens (France); Méar, François O., E-mail: francois.mear@univ-lille1.fr [Univ. Lille, CNRS, Centrale Lille, ENSCL, Univ. Artois, UMR 8181 – UCCS – Unité de Catalyse et Chimie du Solide, F-59000 Lille (France); Blach, Jean-François; Ferri, Anthony [Univ. Artois, CNRS, Centrale Lille, ENSCL, Univ. Lille, UMR 8181, Unité de Catalyse et de Chimie du Solide (UCCS), F-62300 Lens (France); Huvé, Marielle; Montagne, Lionel [Univ. Lille, CNRS, Centrale Lille, ENSCL, Univ. Artois, UMR 8181 – UCCS – Unité de Catalyse et Chimie du Solide, F-59000 Lille (France)

2017-03-01

Highlights: • Successfully deposition of a glassy thin film by PLD. • A good homogeneity and stoichiometry of the coating. • Influence of the deposition temperature on the glassy thin-film structure. - Abstract: In the present work, we report the elaboration of aluminosilicate glass thin films by Pulsed Laser Deposition at various temperatures deposition. The amorphous nature of glass thin films was highlighted by Grazing Incidence X-Ray Diffraction and no nanocristallites were observed in the glassy matrix. Chemical analysis, obtained with X-ray Photoelectron Spectroscopy and Time of Flight Secondary Ion Mass Spectroscopy, showed a good transfer and homogeneous elementary distribution with of chemical species from the target to the film a. Structural studies performed by Infrared Spectroscopy showed that the substrate temperature plays an important role on the bonding configuration of the layers. A slight shift of Si-O modes to larger wavenumber was observed with the synthesis temperature, assigned to a more strained sub-oxide network. Finally, optical properties of thins film measured by Spectroscopic Ellipsometry are similar to those of the bulk aluminosilicate glass, which indicate a good deposition of aluminosilicate bulk glass.

Race of source effects in the elaboration likelihood model.

Science.gov (United States)

White, P H; Harkins, S G

1994-11-01

In a series of experiments, we investigated the effect of race of source on persuasive communications in the Elaboration Likelihood Model (R.E. Petty & J.T. Cacioppo, 1981, 1986). In Experiment 1, we found no evidence that White participants responded to a Black source as a simple negative cue. Experiment 2 suggested the possibility that exposure to a Black source led to low-involvement message processing. In Experiments 3 and 4, a distraction paradigm was used to test this possibility, and it was found that participants under low involvement were highly motivated to process a message presented by a Black source. In Experiment 5, we found that attitudes toward the source's ethnic group, rather than violations of expectancies, accounted for this processing effect. Taken together, the results of these experiments are consistent with S.L. Gaertner and J.F. Dovidio's (1986) theory of aversive racism, which suggests that Whites, because of a combination of egalitarian values and underlying negative racial attitudes, are very concerned about not appearing unfavorable toward Blacks, leading them to be highly motivated to process messages presented by a source from this group.

Regulation imposed to nuclear facility operators for the elaboration of 'waste studies' and 'waste statuses'; Reglementation imposee aux exploitants d'installations nucleaires pour l'elaboration ''des etudes dechets'' et ''des bilans dechets''

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-09-04

This decision from the French authority of nuclear safety (ASN) aims at validating the new versions of the guidebook for the elaboration of 'waste studies' for nuclear facilities and of the specifications for the elaboration of 'waste statuses' for nuclear facilities. This paper includes two documents. The first one is a guidebook devoted to nuclear facility operators which fixes the rules of production of waste studies according to the articles 20 to 26 of the inter-ministry by-law from December 31, 1999 (waste zoning conditions and ASN's control modalities). The second document concerns the specifications for the establishment of annual waste statuses according to article 27 of the inter-ministry by-law from December 31, 1999 (rational management of nuclear wastes). (J.S.)

Transformative Learning: The Role of Research in Traditional Clinical Disciplines

Science.gov (United States)

Tims, Michael

2014-01-01

One of an educator’s main tasks is to develop the intellectual openness of students that is necessary for transformative learning to take place. An initial step in removing the constraint of assumption is to employ the process of unlearning in the classroom. Unlearning in its simplest form can be described as the process through which the student learns to ask questions about a subject on which they are passionate, and through critical reflection, to construct and validate a new understanding based on observations and information generated by the original questions. Developing the ability to improvise and innovate are clear and positive indications that unlearning has occurred, and the Maryland University of Integrative Health’s (MUIH’s) educators have found that integrating research methods into class and group projects can accelerate the unlearning process. MUIH promotes students’ effort to solve interesting problems using the community found within the classroom. The natural state of relativism found in group processes lends itself to making explicit the assumptions each individual brings to the process. MUIH’s methods include engaging students in visual deconstruction of research data found in graphs, tables, and images; having students identify the end point of a line of inquiry; and evaluating a previously accumulated body of evidence to determine if it supports a product’s claims (eg, claims about general health, structure-function, or therapeutic value). The ultimate aim in asking students to take part in research embedded in coursework is to provide an assessment of their abilities that is more closely linked to discipline-specific experience. MUIH’s method of ingraining a culture of inquiry into both classroom and independent research serves to enhance students’ self-awareness about the constraints of their own a priori thinking and to nurture a deeper trust in their own informed intuition. PMID:26770105

Online epistemic communities: theoretical and methodological directions for understanding knowledge co-elaboration in new digital spaces.

Science.gov (United States)

Détienne, Françoise; Barcellini, Flore; Baker, Michael; Burkhardt, Jean-Marie; Fréard, Dominique

2012-01-01

This paper presents, illustrates and discusses a generic framework for studying knowledge co-elaboration in online epistemic communities ("OECs"). Our approach is characterised by: considering knowledge co-elaboration as a design activity; distinguishing discussion and production spaces in OECs; characterising participation via the notion of role; fine-grained analyses of meaning, content and communicative functions in interactions. On this basis, three key issues for ergonomics research on OECs are discussed and illustrated by results from our previous studies on OSS and Wikipedia. One issue concerns the interrelation between design (task) and regulation. Whereas design task-oriented activity is distributed among participants, we illustrate that OCEs function with specialised emerging roles of group regulation. However, the task-oriented activity also functions at an interpersonal level, as an interplay of knowledge-based discussion with negotiation of competencies. Another issue concerns the foci of activity on the (designed) knowledge object. Based on a generic task model, we illustrate asymmetry and distinctiveness in tasks' foci of participants. The last issue concerns how design-use mediation is ensured by specific forms of mediation roles in OECs. Finally we discuss the degree of generality of our framework and draw some perspectives for extending our framework to other OECs.

Preparation of metallic uranium tubes; Elaboration des tubes d'uranium metallique

Energy Technology Data Exchange (ETDEWEB)

Lerouge, G; Decours, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1964-07-01

The production furnace is an induction heated vacuum furnace having a capacity at the moment of 250 kg. Previously the crucible was heated by the inductor, the mould being outside the inductor. The tubes thus produced contained cavities, the alloy structure was fine; this was cold-mould casting, At the moment the top of the moulds are pre-heated, this is the so called hot-mould casting. This method has the advantage of eliminating the cavities but leads to a less fine microstructure. The alloy used for the 18 x 40 mm and 23 x 43 mm tubes is U-Mo (1.1 per cent). Since the moulds are now heated at the top, the solidification of the metal is very slow in this zone leading to a pronounced {gamma} grain, whereas towards the base the faster cooling leads to a smaller {gamma} grain. The {gamma} structure depends essentially on the solidification rate and on the time spent in this zone. In order to obtain a fine and homogeneous grain along the whole length of the tube, a controlled cooling treatment is effected. It consists in heating the uranium tubes in the {gamma} place and then in cooling them at a rate of between 20 and 50 deg C/mm down to 400 deg C. The 77 x 95 mm and 54 x 70 mm annular elements are at the moment being produced for research purposes. Their preparation is similar to that of 18 x 40 mm and 23 x 43 mm elements. The 77 x 95 mm tubes are at the moment made from U-Cr alloy (0.1 per cent); because of their size, their preparation is carried out in 600 mm diameter furnaces. (authors) [French] Le four d'elaboration est un four sous vide chaufffe par induction, dont la capacite actuelle est de 250 kg. Anterieurement le creuset seul etait chauffe par l'inducteur, les moules etaient hors de l'inducteur. Les tubes obtenus presentaient des cavites, la structure de l'alliage etait fine, c'etait la coulee en moules froids. Actuellement on prechauffe le haut des moules, c'est la coulee dite en moules chauds. Cette facon de faire a l'avantage de supprimer les cavites

Research on elaboration of the evaluation guidelines for activities implemented jointly; Kyodo jisshi katsudo hyoka guide line sakutei chosa

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-03-01

Elaboration of the evaluation guidelines for activities implemented jointly (AIJ) was researched to prevent the earth from warming. AIJ is the means to globally promote countermeasures against global warming cost-effectively by optimally combining every country`s technology, know-how and fund. AIJ was established in the 1st Conference of the Parties (COPI) of the United Nations Framework Convention on Climate Change in March, 1995. The pilot phase of AIJ is first carried out by voluntary workers jointly with developing countries under the agreement of the parties. The current situation of activities is reported in COPI as materials for evaluation of AIJ. To promote AIJ, elaboration of the evaluation guidelines for AIJ Japan program is also necessary for Japan. This research arranged the contents of the evaluation guidelines and the method of classifying projects for AIJ Japan program, and carried out some case studies of promising projects to reduce greenhouse gas emission for future proposal. 3 figs., 31 tabs.

Elaboration of procedure for analysis of industrial and economic activities: the experience of LUKoil petroleum company

International Nuclear Information System (INIS)

Ulanov, V.L.; Kirpichev, V.M.

1996-01-01

The research and engineering centre within LUKoil company for economic studies has elaborated a method permitting analysis of production and economic activities of the LUKOIL petroleum production complex. The method envisages the following trends of analysis: general assessment of production and economic activities, analysis of basic production assets, manpower and wages use, net cost of marketable products, the state of finances, as well as specific features in analyzing the activities undertaken by joint ventures

Conceptual design of a system to help the elaboration of healthcare waste management plans

International Nuclear Information System (INIS)

Reis, Sergio C. dos; Silva, Eliane M.P. da; Vasconcelos, Vanderley de; Cussiol, Noil A.M.; Bahia, Jean V.

2007-01-01

Nowadays the daily amount of wastes generated in the world is enormous. There are several categories of wastes with specific characteristics, some of them hazardous. These features, when associated with not properly waste disposal can put at risk both life quality and natural resources of present-day as well as future generations. From 10% to 25% of the wastes generated by health care facilities require special handling care due to their physical, biological, chemical, or radiological characteristics. This requires, among other things, the implementation of specific measures for their environmentally safe management. These measures shall be provided in a formal document, named Health care Waste Management Plan, which shall be written by all health care providers. In Brazil, general guides for elaboration of these documents are well defined by regulatory bodies and technical advices. At federal level, these directives are given by the following organizations: National Health Surveillance Agency - ANVISA, National Council for the Environment - CONAMA, and Brazilian Nuclear Energy Commission - CNEN. At CDTN (Center of Nuclear Technology Development), as part of a doctoral thesis at State University of Campinas (UNICAMP), a methodology that systematizes the management of the several activities involved with hazardous and radioactive wastes was developed, in order to be used as a guidance tool for this task. The objective of this present work is to adapt this methodology to health care waste management and present a conceptual design of a semi-expert system to help the elaboration of Health care Waste Management Plans. (author)

Conceptual design of a system to help the elaboration of healthcare waste management plans

Energy Technology Data Exchange (ETDEWEB)

Reis, Sergio C. dos; Silva, Eliane M.P. da; Vasconcelos, Vanderley de; Cussiol, Noil A.M. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mails: reissc@cdtn.br; silvaem@cdtn.br; vasconv@cdtn.br; cussiol@cdtn.br; Bahia, Jean V. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Quimica]. E-mail: jeanvb@cdtn.br; Jordao, Elizabete [Universidade Estadual de Campinas (UNICAMP), Campinas, SP (Brazil)]. E-mail: bete@feq.unicamp.br

2007-07-01

Nowadays the daily amount of wastes generated in the world is enormous. There are several categories of wastes with specific characteristics, some of them hazardous. These features, when associated with not properly waste disposal can put at risk both life quality and natural resources of present-day as well as future generations. From 10% to 25% of the wastes generated by health care facilities require special handling care due to their physical, biological, chemical, or radiological characteristics. This requires, among other things, the implementation of specific measures for their environmentally safe management. These measures shall be provided in a formal document, named Health care Waste Management Plan, which shall be written by all health care providers. In Brazil, general guides for elaboration of these documents are well defined by regulatory bodies and technical advices. At federal level, these directives are given by the following organizations: National Health Surveillance Agency - ANVISA, National Council for the Environment - CONAMA, and Brazilian Nuclear Energy Commission - CNEN. At CDTN (Center of Nuclear Technology Development), as part of a doctoral thesis at State University of Campinas (UNICAMP), a methodology that systematizes the management of the several activities involved with hazardous and radioactive wastes was developed, in order to be used as a guidance tool for this task. The objective of this present work is to adapt this methodology to health care waste management and present a conceptual design of a semi-expert system to help the elaboration of Health care Waste Management Plans. (author)

Application of sol-gel process on the elaboration of SnO2 based ceramics

International Nuclear Information System (INIS)

Prescatan, R.T.; Silva, D.V. da; Hiratsuka, R.S.; Santilli, C.V.; Pulcinelli, S.H.

1990-01-01

The electrical, optical and chemical peculiar properties of SnO 2 confers it-self some potential application. The densification difficulty during sintering of SnO 2 compromises its elaboration by ceramic conventional process. In this work the preparation of SnO 2 ceramics by sol-gel process was investigated. Some parameters envolved on the colloidal stability, sol-gel transition and drying process were analysed. The obtained materials were characterized by rheological, X-ray diffraction, infra-red spectroscopy and pores size distribution measurements. The results show that a considerable densification during sintering at 400 and 600 0 C was obtained. (author) [pt

The Effects of Word Exposure Frequency and Elaboration of Word Processing on Incidental L2 Vocabulary Acquisition through Reading

Science.gov (United States)

Eckerth, Johannes; Tavakoli, Parveneh

2012-01-01

Research on incidental second language (L2) vocabulary acquisition through reading has claimed that repeated encounters with unfamiliar words and the relative elaboration of processing these words facilitate word learning. However, so far both variables have been investigated in isolation. To help close this research gap, the current study…

Elaboration of a guide including relevant project and logistic information: a case study

Energy Technology Data Exchange (ETDEWEB)

Costa, Tchaikowisky M. [Faculdade de Tecnologia e Ciencias (FTC), Itabuna, BA (Brazil); Bresci, Claudio T.; Franca, Carlos M.M. [PETROBRAS, Rio de Janeiro, RJ (Brazil)

2009-07-01

For every mobilization of a new enterprise it is necessary to quickly obtain the greatest amount of relative information in regards to location and availability of infra-structure, logistics, and work site amenities. Among this information are reports elaborated for management of the enterprise, (organizational chart, work schedule, objectives, contacts, etc.) as well as geographic anomalies, social-economic and culture of the area to be developed such as territorial extension, land aspects, local population, roads and amenities (fuel stations ,restaurants and hotels), infra-structure of the cities (health, education, entertainment, housing, transport, etc.) and logistically the distance between cities the estimated travel time, ROW access maps and notable points, among other relevant information. With the idea of making this information available for everyone involved in the enterprise, it was elaborated for GASCAC Spread 2A a rapid guide containing all the information mentioned above and made it available for all the vehicles used to transport employees and visitors to the spread. With this, everyone quickly received the majority of information necessary in one place, in a practical, quick, and precise manner, since the information is always used and controlled by the same person. This study includes the model used in the gas pipeline GASCAC Spread 2A project and the methodology used to draft and update the information. Besides the above, a file in the GIS format was prepared containing all necessary planning, execution and tracking information for enterprise activities, from social communication to the execution of the works previously mentioned. Part of the GIS file information was uploaded to Google Earth so as to disclose the information to a greater group of people, bearing in mind that this program is free of charge and easy to use. (author)

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

Science.gov (United States)

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

The dorsolateral prefrontal cortex plays a role in self-initiated elaborative cognitive processing during episodic memory encoding: rTMS evidence.

Directory of Open Access Journals (Sweden)

Colin Hawco

Full Text Available During episodic memory encoding, elaborative cognitive processing can improve later recall or recognition. While multiple studies examined the neural correlates of encoding strategies, few studies have explicitly focused on the self-initiation of elaborative encoding. Repetitive transcranial magnetic stimulation (rTMS, a method which can transiently disrupt neural activity, was administered during an associative encoding task. rTMS was either applied to the left dorsolateral prefrontal cortex (DLPFC or to the vertex (a control region not involved in memory encoding during presentation of pairs of words. Pairs could be semantically related or not related. Two encoding instructions were given, either cueing participants to analyze semantic relationships (cued condition, or to memorize the pair without any specific strategy cues (the self-initiated condition. Participants filled out a questionnaire regarding their use of memory strategies and performed a cued-recall task. We hypothesized that if the DLPFC plays a role in the self-initiation of elaborative encoding we would observe a reduction in memory performance in the self-initiated condition, particularly for related. We found a significant correlation between the effects of rTMS and strategy use, only in the self-initiated condition with related pairs. High strategy users showed reduced performance following DLPFC stimulation, while low strategy users tended to show increased recall following DLPFC stimulation during encoding. These results suggest the left DLPFC may be involved in the self-initiation of memory strategy use, and individuals may utilize different neural networks depending on their use of encoding strategies.

Attribution-based motivation treatment efficacy in an online learning environment for students who differ in cognitive elaboration

OpenAIRE

Hamm, Jeremy M.; Perry, Raymond P.; Chipperfield, Judith G.; Murayama, Kou; Weiner, Bernard

2017-01-01

Attribution-based motivation treatments can boost performance in competitive achievement settings (Perry and Hamm 2017), yet their efficacy relative to mediating processes and affect-based treatments remains largely unexamined. In a two-semester, pre-post, randomized treatment study (n = 806), attributional retraining (AR) and stress-reduction (SR) treatments were administered in an online learning environment to first-year college students who differed in cognitive elaboration (low, high). L...

An Elaboration Likelihood Model Based Longitudinal Analysis of Attitude Change during the Process of IT Acceptance via Education Program

Science.gov (United States)

Lee, Woong-Kyu

2012-01-01

The principal objective of this study was to gain insight into attitude changes occurring during IT acceptance from the perspective of elaboration likelihood model (ELM). In particular, the primary target of this study was the process of IT acceptance through an education program. Although the Internet and computers are now quite ubiquitous, and…

Genetic, epigenetic and exogenetic information in development and evolution.

Science.gov (United States)

Griffiths, Paul E

2017-10-06

The idea that development is the expression of information accumulated during evolution and that heredity is the transmission of this information is surprisingly hard to cash out in strict, scientific terms. This paper seeks to do so using the sense of information introduced by Francis Crick in his sequence hypothesis and central dogma of molecular biology. It focuses on Crick's idea of precise determination. This is analysed using an information-theoretic measure of causal specificity. This allows us to reconstruct some of Crick's claims about information in transcription and translation. Crick's approach to information has natural extensions to non-coding regions of DNA, to epigenetic marks, and to the genetic or environmental upstream causes of those epigenetic marks. Epigenetic information cannot be reduced to genetic information. The existence of biological information in epigenetic and exogenetic factors is relevant to evolution as well as to development.

Elaboration of silicon carbides nano particles (SiC): from the powder synthesis to the sintered ceramic; Elaboration de ceramiques nanostructurees en carbure de silicium (SiC): de la synthese de poudre a la ceramique frittee

Energy Technology Data Exchange (ETDEWEB)

Reau, A. [CEA Saclay, Dept. des Materiaux pour le Nucleaire (DEN/DANS/DMN/SRMA), 91 - Gif-sur-Yvette (France)

2008-07-01

Materials for the reactor cores of the fourth generation will need materials supporting high temperatures with fast neutrons flux. SiC{sub f}/SiC ceramics are proposed. One of the possible elaboration process is to fill SiC fiber piece with nano particles SiC powder and to strengthen by sintering. The aim of this thesis is to obtain a nano structured SiC ceramic as a reference for the SiC{sub f}/SiC composite development and to study the influence of the fabrication parameters. (A.L.B.)

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

The protist, Monosiga brevicollis, has a tyrosine kinase signaling network more elaborate and diverse than found in any known metazoan.

Science.gov (United States)

Manning, Gerard; Young, Susan L; Miller, W Todd; Zhai, Yufeng

2008-07-15

Tyrosine kinase signaling has long been considered a hallmark of intercellular communication, unique to multicellular animals. Our genomic analysis of the unicellular choanoflagellate Monosiga brevicollis discovers a remarkable count of 128 tyrosine kinases, 38 tyrosine phosphatases, and 123 phosphotyrosine (pTyr)-binding SH2 proteins, all higher counts than seen in any metazoan. This elaborate signaling network shows little orthology to metazoan counterparts yet displays many innovations reminiscent of metazoans. These include extracellular domains structurally related to those of metazoan receptor kinases, alternative methods for membrane anchoring and phosphotyrosine interaction in cytoplasmic kinases, and domain combinations that link kinases to small GTPase signaling and transcription. These proteins also display a wealth of combinations of known signaling domains. This uniquely divergent and elaborate signaling network illuminates the early evolution of pTyr signaling, explores innovative ways to traverse the cellular signaling circuitry, and shows extensive convergent evolution, highlighting pervasive constraints on pTyr signaling.

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

An interview with Jim Smith.

Science.gov (United States)

Maartens, Aidan

2017-08-01

Jim Smith is Director of Science at the Wellcome Trust and a group leader at the Francis Crick Institute, where he was formerly Director of Research. A Fellow of both the Royal Society and the Academy of Medical Sciences, he was knighted for his services to medical research and science education in 2016. His lab works on mesoderm induction in the early vertebrate embryo. We met Jim in the Crick to hear about his life in science, his visions for the Crick and the Wellcome Trust, and his advice for early career scientists. © 2017. Published by The Company of Biologists Ltd.

Preparation of metallic uranium tubes; Elaboration des tubes d'uranium metallique

Energy Technology Data Exchange (ETDEWEB)

Lerouge, G.; Decours, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1964-07-01

The production furnace is an induction heated vacuum furnace having a capacity at the moment of 250 kg. Previously the crucible was heated by the inductor, the mould being outside the inductor. The tubes thus produced contained cavities, the alloy structure was fine; this was cold-mould casting, At the moment the top of the moulds are pre-heated, this is the so called hot-mould casting. This method has the advantage of eliminating the cavities but leads to a less fine microstructure. The alloy used for the 18 x 40 mm and 23 x 43 mm tubes is U-Mo (1.1 per cent). Since the moulds are now heated at the top, the solidification of the metal is very slow in this zone leading to a pronounced {gamma} grain, whereas towards the base the faster cooling leads to a smaller {gamma} grain. The {gamma} structure depends essentially on the solidification rate and on the time spent in this zone. In order to obtain a fine and homogeneous grain along the whole length of the tube, a controlled cooling treatment is effected. It consists in heating the uranium tubes in the {gamma} place and then in cooling them at a rate of between 20 and 50 deg C/mm down to 400 deg C. The 77 x 95 mm and 54 x 70 mm annular elements are at the moment being produced for research purposes. Their preparation is similar to that of 18 x 40 mm and 23 x 43 mm elements. The 77 x 95 mm tubes are at the moment made from U-Cr alloy (0.1 per cent); because of their size, their preparation is carried out in 600 mm diameter furnaces. (authors) [French] Le four d'elaboration est un four sous vide chaufffe par induction, dont la capacite actuelle est de 250 kg. Anterieurement le creuset seul etait chauffe par l'inducteur, les moules etaient hors de l'inducteur. Les tubes obtenus presentaient des cavites, la structure de l'alliage etait fine, c'etait la coulee en moules froids. Actuellement on prechauffe le haut des moules, c'est la coulee dite en moules chauds. Cette facon de faire a l

In situ elaboration of a binary Ti–26Nb alloy by selective laser melting of elemental titanium and niobium mixed powders

Energy Technology Data Exchange (ETDEWEB)

Fischer, M. [Laboratoire d' Etude des Microstructures et de Mécanique des Matériaux LEM3 (UMR CNRS 7239), Université de Lorraine, Ile de Saulcy, F-57045 Metz (France); Joguet, D. [Laboratoire d' Etudes et de Recherches sur les Matériaux, les Procédés et les Surfaces LERMPS, Université de Technologie de Belfort Montbéliard, Sevenans, 90010 Belfort (France); Robin, G. [Laboratoire d' Etude des Microstructures et de Mécanique des Matériaux LEM3 (UMR CNRS 7239), Université de Lorraine, Ile de Saulcy, F-57045 Metz (France); Peltier, L. [Laboratoire d' Etude des Microstructures et de Mécanique des Matériaux LEM3 (UMR CNRS 7239), Ecole Nationale Supérieure d' Arts et Métiers, F-57078 Metz (France); Laheurte, P. [Laboratoire d' Etude des Microstructures et de Mécanique des Matériaux LEM3 (UMR CNRS 7239), Université de Lorraine, Ile de Saulcy, F-57045 Metz (France)

2016-05-01

Ti–Nb alloys are excellent candidates for biomedical applications such as implantology and joint replacement because of their very low elastic modulus, their excellent biocompatibility and their high strength. A low elastic modulus, close to that of the cortical bone minimizes the stress shielding effect that appears subsequent to the insertion of an implant. The objective of this study is to investigate the microstructural and mechanical properties of a Ti–Nb alloy elaborated by selective laser melting on powder bed of a mixture of Ti and Nb elemental powders (26 at.%). The influence of operating parameters on porosity of manufactured samples and on efficacy of dissolving Nb particles in Ti was studied. The results obtained by optical microscopy, SEM analysis and X-ray microtomography show that the laser energy has a significant effect on the compactness and homogeneity of the manufactured parts. Homogeneous and compact samples were obtained for high energy levels. Microstructure of these samples has been further characterized. Their mechanical properties were assessed by ultrasonic measures and the Young's modulus found is close to that of classically elaborated Ti–26Nb ingot. - Highlights: • Biomimetic implants can be provided from additive manufacturing with Ti–Nb. • We made parts in a Ti–Nb alloy elaborated in situ from a mixture of elemental powders. • Process parameters have a significant impact on homogeneity and compactness. • Non-columnar elongated beta-grains are stacked with an orientation {001}<100 >. • Low Young's modulus is achieved by this texture.

Elaboration of technology organizational models of constructing high-rise buildings in plans of construction organization

Science.gov (United States)

Osipenkova, Irina; Simankina, Tatyana; Syrygina, Taisiia; Lukinov, Vitaliy

2018-03-01

This article represents features of the elaboration of technology organizational models of high-rise building construction in technology organizational documentation on the example of the plan of construction organization. Some examples of enhancing the effectiveness of high-rise building construction based on developments of several options of the organizational and technological plan are examined. Qualitative technology organizational documentation allows to increase the competitiveness of construction companies and provides prime cost of construction and assembly works reductions. Emphasis is placed on the necessity to comply with the principle of comprehensiveness of engineering, scientific and research works, development activities and scientific and technical support.

Technical feasibility for the incorporation of a drinking water treatment and its standardization as ingredient in the elaboration of juices and drinks based of orange

International Nuclear Information System (INIS)

Martinez Rivas, Allan Roberto

2014-01-01

The technical feasibility for the incorporation of a drinking water treatment and standardization is determined as ingredient in the elaboration of juices and drinks based of orange. A bibliographic research is realized about the processing of fruit juices, water use as ingredient, current legislation and the main techniques for water purification. Chlorine dissolved in water used as ingredient in the reconstitution and oxygen dissolved in the reconstituted juice, have determined the parameters in damage of the quality of juices and drinks based of orange. Water values as raw material have been compared with the values defined as quality parameters. The water purification processes are described. A selection matrix is elaborated to obtain the appropriate technology. An activated carbon filter has been implemented to remove the residual free chlorine in water. A vacuum deaerator has been selected to remove the oxygen dissolved from the orange juice. A buffer tank has been implemented to guarantee the existence of free purified water of residual chlorine dissolved for operation until an hour. A preliminary costing has been elaborated to determine the initial investment for the purchase of equipment and accessories of the selected technology [es

Elaboration of functionally graded materials for plasma facing components of the thermonuclear machines

International Nuclear Information System (INIS)

Autissier, Emmanuel

2014-01-01

The objective of this study was to develop a Functionally Graded Material (FGM) W/Cu to replace the compliance layer (Cu-OFHC) in the plasma facing components of thermonuclear fusion reactor like ITER. The peculiarity of this work is to elaborate these materials without exceeding the melting temperature of copper in order to control its microstructure. The co-sintering is the most attractive solution to achieve this goal. The first phase of this study has been to decrease the sintering temperature of the tungsten to achieve this co-sintering. The elaboration of a Functionally Graded Materials being delicate, thermomechanical calculations were performed in order to determine the number and chemical composition in order to increase the lifespan of Plasma Facing Components. Spark Plasma Sintering conditions were optimized in order to achieve maximum density of W x Cu 1-x composites. The effect of copper content and density of the W x Cu 1-x composites on thermal and mechanical properties was investigated. The SPS conditions were applied for W/CuCrZr assemblies with a compliance layer composed of several interlayers. The importance of time for the integrity of assemblies thereof has been highlighted. The study of the dwell time during W/CuCrZr assembly leads to identify a parameter to characterize the integrity of the interface regardless of the composition and the nature of the layer of compliance. Moreover, the phenomena associated with the formation of the interface assembly have been identified. The interface W/W x Cu 1-x is formed by the extrusion of the copper layer of the W x Cu 1-x inside the tungsten porosities. The W y Cu 1-y /CuCrZr interface is formed by copper migration of CuCrZr layer inside the W y Cu 1-y layer. Finally optimization assembly conditions showed that the mechanical stresses due to the densification of the Functionally Graded Materials can be limited by sintering the FGM before the assembly. (author)

Social representations elaborated by nurses about climacteric women in primary health care

Directory of Open Access Journals (Sweden)

Smithanny Barros da Silva

2016-01-01

Full Text Available Objective : to understand the social representations elaborated by nurses from the family health strategy concerning the assistance to climacteric women. Methods : qualitative research conducted with 28 nurses. One adopted the reference of procedural approach of the theory of social representations. The interviews were recorded and transcribed completely and processed by the Software of Lexical Analysis of co-occurrence in simple statements of a text, version 4.7. Results: nurses recognize the menopause as a phase of women’s life that needs to be assisted in its entirety, however, they showed difficulty in helping them, as they just carry out the cytological examination collection, request laboratory tests and forward them to a doctor. Conclusion: the climacteric period is a multifaceted phenomenon and the assistance to those people should be systematized from a qualified listening, in an approach that respects its uniqueness and autonomy.

Elaboration of training and methodological guidance for handling with radioactive waste issues in Kazakhstan

International Nuclear Information System (INIS)

Kayukov, P.; Fyodorov, G.; Belych, V.; Shkolnick, T.

1998-01-01

With a great potential for the development and civilian use of the uranium industrial complex in Kazakhstan, there are several existing obstacles in the form of public opinion which still possesses a strong ''radiation phobia'' as a result of past military activity in the Republic. It is not enough to have talks on the radio or articles in newspapers from famous authoritative individuals to overcome this radiation phobia. Systematic education of the public is necessary in order to cultivate a new generation of ecological specialists and business specialists. Therefore, it is necessary to create a plan to carry out this daunting task. In this paper, the creation of such a plan is elaborated. (author)

Contribution to the elaboration and implementation of LEP-L3 second level microcoded Trigger

International Nuclear Information System (INIS)

Chollet, F.

1988-03-01

This thesis is devoted to the elaboration of the L3 second level trigger which is based on the dedicated programmable XOP processor. This system will reduce the trigger rate by a factor of ten and will ensure that the hardwired level-one processors function correctly. The present document describes all developments that L.A.P.P. is engaged in from the system design up to the complete experimental set up, especially: - The hardware development of the fast input memories as well as the FASTBUS interface unit which allows the microprocessor XOP to run as a performant FASTBUS Master, - the associated software developments, - the implementation of a VME test system dedicated to all control tasks [fr

Acquiring concepts and features of novel words by two types of learning: direct mapping and inference.

Science.gov (United States)

Chen, Shuang; Wang, Lin; Yang, Yufang

2014-04-01

This study examined the semantic representation of novel words learnt in two conditions: directly mapping a novel word to a concept (Direct mapping: DM) and inferring the concept from provided features (Inferred learning: IF). A condition where no definite concept could be inferred (No basic-level meaning: NM) served as a baseline. The semantic representation of the novel word was assessed via a semantic-relatedness judgment task. In this task, the learned novel word served as a prime, while the corresponding concept, an unlearned feature of the concept, and an unrelated word served as targets. ERP responses to the targets, primed by the novel words in the three learning conditions, were compared. For the corresponding concept, smaller N400s were elicited in the DM and IF conditions than in the NM condition, indicating that the concept could be obtained in both learning conditions. However, for the unlearned feature, the targets in the IF condition produced an N400 effect while in the DM condition elicited an LPC effect relative to the NM learning condition. No ERP difference was observed among the three learning conditions for the unrelated words. The results indicate that conditions of learning affect the semantic representation of novel word, and that the unlearned feature was only activated by the novel word in the IF learning condition. Copyright © 2014 Elsevier Ltd. All rights reserved.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Elaboration of silicon carbides nano particles (SiC): from the powder synthesis to the sintered ceramic

International Nuclear Information System (INIS)

Reau, A.

2008-01-01

Materials for the reactor cores of the fourth generation will need materials supporting high temperatures with fast neutrons flux. SiC f /SiC ceramics are proposed. One of the possible elaboration process is to fill SiC fiber piece with nano particles SiC powder and to strengthen by sintering. The aim of this thesis is to obtain a nano structured SiC ceramic as a reference for the SiC f /SiC composite development and to study the influence of the fabrication parameters. (A.L.B.)

A methodology proposal for collaborative business process elaboration using a model-driven approach

Science.gov (United States)

Mu, Wenxin; Bénaben, Frédérick; Pingaud, Hervé

2015-05-01

Business process management (BPM) principles are commonly used to improve processes within an organisation. But they can equally be applied to supporting the design of an Information System (IS). In a collaborative situation involving several partners, this type of BPM approach may be useful to support the design of a Mediation Information System (MIS), which would ensure interoperability between the partners' ISs (which are assumed to be service oriented). To achieve this objective, the first main task is to build a collaborative business process cartography. The aim of this article is to present a method for bringing together collaborative information and elaborating collaborative business processes from the information gathered (by using a collaborative situation framework, an organisational model, an informational model, a functional model and a metamodel and by using model transformation rules).

Elaboration of pellets of LiF: Mg, Cu, P and its dosimetric properties

International Nuclear Information System (INIS)

Gutierrez C, A.; Gonzalez M, P.R.; Azorin N, J.

1991-03-01

The LiF: Mg, Cu, P is at the moment in the entire world one of the TL materials of more interest, by its equivalence with the tissue, as well as for its high sensitivity, which is 25 to 35 times greater than of the TLD-100 of Harshaw (USA). In our laboratory dosemeters of this material have been developed in form of sinterized pellets. The importance of these new dosemeters in pellet form is due to that in this form its manipulation is facilitated. Due to its high sensitivity, these dosemeters result to be those but appropriate to measure the ionizing radiations, in intervals of extremely low dose. In this report the method of elaboration of the pellets, as well as its main dosimetric characteristics are presented. (Author)

Plasma-based ion implantation: a valuable technology for the elaboration of innovative materials and nanostructured thin films

International Nuclear Information System (INIS)

Vempaire, D; Pelletier, J; Lacoste, A; Bechu, S; Sirou, J; Miraglia, S; Fruchart, D

2005-01-01

Plasma-based ion implantation (PBII), invented in 1987, can now be considered as a mature technology for thin film modification. After a brief recapitulation of the principle and physics of PBII, its advantages and disadvantages, as compared to conventional ion beam implantation, are listed and discussed. The elaboration of thin films and the modification of their functional properties by PBII have already been achieved in many fields, such as microelectronics (plasma doping/PLAD), biomaterials (surgical implants, bio- and blood-compatible materials), plastics (grafting, surface adhesion) and metallurgy (hard coatings, tribology), to name a few. The major advantages of PBII processing lie, on the one hand, in its flexibility in terms of ion implantation energy (from 0 to 100 keV) and operating conditions (plasma density, collisional or non-collisional ion sheath), and, on the other hand, in the easy transferrability of processes from the laboratory to industry. The possibility of modifying the composition and physical nature of the films, or of drastically changing their physical properties over several orders of magnitude makes this technology very attractive for the elaboration of innovative materials, including metastable materials, and the realization of micro- or nanostructures. A review of the state of the art in these domains is presented and illustrated through a few selected examples. The perspectives opened up by PBII processing, as well as its limitations, are discussed

Genetics by the Numbers

Science.gov (United States)

... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

Social Information-Processing Patterns of Maltreated Children in Two Social Domains

Science.gov (United States)

Keil, Vivien; Price, Joseph M.

2009-01-01

This study examined relations among social information-processing (SIP) variables in the domains of peer provocation and peer group entry. Using Crick and Dodge's [Crick, N. R., & Dodge, K. A. (1994). "A review and reformulation of social information-processing mechanisms in children's social adjustment." "Psychological Bulletin," 115, 74-101]…

CONSORT 2010 Explanation and Elaboration: updated guidelines for reporting parallel group randomised trials (Chinese version)

DEFF Research Database (Denmark)

Moher, David; Hopewell, Sally; Schulz, Kenneth F

2010-01-01

Overwhelming evidence shows the quality of reporting of randomised controlled trials (RCTs) is not optimal. Without transparent reporting, readers cannot judge the reliability and validity of trial findings nor extract information for systematic reviews. Recent methodological analyses indicate...... that inadequate reporting and design are associated with biased estimates of treatment effects. Such systematic error is seriously damaging to RCTs, which are considered the gold standard for evaluating interventions because of their ability to minimise or avoid bias. A group of scientists and editors developed......, this revised explanatory and elaboration document, and the associated website (www.consort-statement.org) should be helpful resources to improve reporting of randomised trials....

Fulltext PDF

Indian Academy of Sciences (India)

University, to suggest that a meaningful gesture, given that it was Franklin's data that the Watson and Crick ... However,. Maddox also adds that Franklin understood her capabilities and \\vas forthright about speaking ... did not allow him to see how much of her work had influenced the DNA model he and Crick had proposed.

Thesis Abstract Fermented milk elaborated with Camellia sinensis.

Science.gov (United States)

Ribeiro, O A S; Silva, M I A; Boari, C A

2016-05-13

This study aimed to develop and to characterize fermented dairy beverage formulated with Camellia sinensis. The infusion was elaborated with the addiction of dehydrated leaves of C. sinensis in whey (1g/100g) which added in sweetened milk (10% sucrose w/w) coagulated by Streptococcus salivarius subspecies thermophilus and Lactobacillus delbrueckii subspecies bulgaricus in proportions of 10, 20, 30 and 40% (v/w). The control treatment consisted of yogurt added with sucrose (10% w/w). Analysis were performed to quantify dry mass, moisture, ash, protein, fat, sodium, acidity, total quantification of lactic acid bacteria, total antioxidant activity and viscosity at the initial time of production and at 15 and 30 days of storage. Chromatographic determination of volatile compounds and sensory tests of acceptance and consumption intention were conducted at the initial time of production. Dry matter content, moisture, ash and total count of lactic acid bacteria from fermented milk drink formulations were not significantly affected by the amount of infusion of C. sinensis. However, the content of protein, fat and sodium were significantly lower with the increase of the proportion of infusion incorporated into the product. Significant reduction in apparent viscosity occurs with the increase in the amount of infusion added. The total antioxidant activity of the formulations was significantly higher as higher were the amount of added infusion. The addition of infusion contributed to the diversification of volatile aroma and taste makers in the product. The formulation of fermented dairy drink with addition of 30% infusion C. sinensis was better evaluated in sensory tests, with greater acceptance and greater consumer intent of consumption.

1,1-Dimetallic reagents for the elaboration of stereoselectively di- or trisubstituted linear substrates.

Science.gov (United States)

Normant, J F

2001-08-01

Although gem-dimetallic species have been known for a long time, and reacted once or twice with electrophiles, the allyl zincation of substituted vinyl metals has emerged as a particularly efficient access to such species. This is due to a high face selectivity, in the addition to the C=C bond, which can be governed by vicinal or more remote heteroatoms. This strategy has some aspects in common with the well-known allylations or aldol condensations to carbonyl derivatives. But in the present case, the C=C bond has a low polarity. We present here some examples which lead to di- or polysubstituted linear substrates, of given geometry, where the organodimetallic obtained has been doubly protonated by water. Further elaborations (to alkenes, ketones, etc.) are possible.

The elaborate plumage in peacocks is not such a drag.

Science.gov (United States)

Askew, Graham N

2014-09-15

One of the classic examples of an exaggerated sexually selected trait is the elaborate plumage that forms the train in male peafowl Pavo cristatus (peacock). Such ornaments are thought to reduce locomotor performance as a result of their weight and aerodynamic drag, but this cost is unknown. Here, the effect that the train has on take-off flight in peacocks was quantified as the sum of the rates of change of the potential and kinetic energies of the body (P(CoM)) in birds with trains and following the train's removal. There was no significant difference between P(CoM) in birds with and without a train. The train incurs drag during take-off; however, while this produces a twofold increase in parasite drag, parasite power only accounts for 0.1% of the total aerodynamic power. The train represented 6.9% of body weight and is expected to increase induced power. The absence of a detectable effect on take-off performance does not necessarily mean that there is no cost associated with possessing such ornate plumage; rather, it suggests that given the variation in take-off performance per se, the magnitude of any effect of the train has little meaningful functional relevance. © 2014. Published by The Company of Biologists Ltd.

Hydrogen storage in carbon nano-materials. Elaboration, characterization and properties

International Nuclear Information System (INIS)

Luxembourg, D.

2004-10-01

This work deals with hydrogen storage for supplying fuel cells. Hydrogen storage by adsorption in carbon nano-tubes and nano-fibers is a very controversial issue because experimental results are very dispersed and adsorption mechanisms are not yet elucidated. Physi-sorption cannot explain in fact all the experimental results. All the potential adsorption sites, physical and chemical, are discussed as detailed as possible in a state of the art. Experimental works includes the steps of elaboration, characterization, and measurements of the hydrogen storage properties. Nano-fibers are grown using a CVD approach. Single wall carbon nano-tubes (SWNT) synthesis is based on the vaporization/condensation of a carbon/catalysts mixture in a reactor using a fraction of the available concentrated solar energy at the focus of the 1000 kW solar facility of IMP-CNRS at Odeillo. Several samples are produced using different synthesis catalysts (Ni, Co, Y, Ce). SWNT samples are purified using oxidative and acid treatments. Hydrogen storage properties of these materials are carefully investigated using a volumetric technique. The applied pressure is up to 6 MPa and the temperature is 253 K. Hydrogen uptake of the investigated materials are less than 1 % wt. at 253 K and 6 MPa. (author)

Tensor Calculus: Unlearning Vector Calculus

Science.gov (United States)

Lee, Wha-Suck; Engelbrecht, Johann; Moller, Rita

2018-01-01

Tensor calculus is critical in the study of the vector calculus of the surface of a body. Indeed, tensor calculus is a natural step-up for vector calculus. This paper presents some pitfalls of a traditional course in vector calculus in transitioning to tensor calculus. We show how a deeper emphasis on traditional topics such as the Jacobian can…

UNLEARNED LESSONS OF CONTEMPORARY HISTORY

Directory of Open Access Journals (Sweden)

А Н Данилов

2017-12-01

Full Text Available The article considers the complex geopolitical situation in the global world at the end of the second decade of the 21st century as determined by the consequences of the collapse of the Soviet Union and by the new world order. The author seeks to answer the questions who will define the current geopolitical situation, whose aims it will reflect, what will become the basis of new geopolitical realities, the basis of moral solidarity of humankind, and the spiritual basis of future civilizations. The new challenges give rise to a desperate struggle for different scenarios for building a happy life. Moreover, it is not clear which ideal of the future world will be widely supported as a development guideline. The recognition as such of the standard of living and development of the strongest ones becomes a real threat to the new civilization for it leads to the loss of national interests of sovereign states, and to the loss of an independent future. Today, there is an active search for new theories and concepts that will adequately explain con-temporary global processes. In this thematic context, the author identifies main lessons not learned by the world political elites. The first lesson: new states are not born in an empty place, their common history is a great advantage ensuring prospects for the further development of interstate cooperation. The second lesson: the widespread falsification of history has a negative impact on national, cultural and social-group identity in transforming societies. The third lesson: after the collapse of the Soviet Union, the post-war balance of power was destroyed together with the system of checks and balances in world politics (a bipolar model of the world. The fourth lesson: under radical social transformations, the moral system of the population devaluates with numerous crisis consequences.

Anti-parallel triplexes

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

2015-01-01

about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

Experience-dependent phase-reversal of hippocampal neuron firing during REM sleep.

Science.gov (United States)

Poe, G R; Nitz, D A; McNaughton, B L; Barnes, C A

2000-02-07

The idea that sleep could serve a cognitive function has remained popular since Freud stated that dreams were "not nonsense" but a time to sort out experiences [S. Freud, Letter to Wilhelm Fliess, May 1897, in The Origins of Psychoanalysis - Personal Letters of Sigmund Freud, M. Bonaparte, A. Freud, E. Kris (Eds.), Translated by E. Mosbacher, J. Strachey, Basic Books and Imago Publishing, 1954]. Rapid eye movement (REM) sleep, which is associated with dream reports, is now known to be is important for acquisition of some tasks [A. Karni, D. Tanne, B.S. Rubenstein, J.J.M. Askenasy, D. Sagi, Dependence on REM sleep of overnight improvement of a perceptual skill, Science 265 (1994) 679-682; C. Smith, Sleep states and learning: a review of the animal literature, Biobehav. Rev. 9 (1985) 157-168]; although why this is so remains obscure. It has been proposed that memories may be consolidated during REM sleep or that forgetting of unnecessary material occurs in this state [F. Crick, G. Mitchison, The function of dream sleep, Nature 304 (1983) 111-114; D. Marr, Simple memory: a theory for archicortex, Philos. Trans. R. Soc. B. 262 (1971) 23-81]. We studied the firing of multiple single neurons in the hippocampus, a structure that is important for episodic memory, during familiar and novel experiences and in subsequent REM sleep. Cells active in familiar places during waking exhibited a reversal of firing phase relative to local theta oscillations in REM sleep. Because firing-phase can influence whether synapses are strengthened or weakened [C. Holscher, R. Anwyl, M.J. Rowan, Stimulation on the positive phase of hippocampal theta rhythm induces long-term potentiation that can be depotentiated by stimulation on the negative phase in area CA1 in vivo, J. Neurosci. 15 (1977) 6470-6477; P.T. Huerta, J.E. Lisman, Bidirectional synaptic plasticity induced by a single burst during cholinergic theta oscillation in CA1 in vitro, Neuron 15 (1995) 1053-1063; C. Pavlides, Y

Fulltext PDF

Indian Academy of Sciences (India)

Madhu urs

dogma is something which a true believer cannot doubt”. (Judson 1996) ... with no experimental support (Crick 1988; Judson 1996). During his whole life, Crick ... helping to eliminate lines of research leading to dead ends. The choice of the .... As in the previous example, it is easy to show that it was not the Central. Dogma ...

Economic tools for biodiversity. An elaboration of TEEB recommendations with regard to the Taskforce Biodiversity

International Nuclear Information System (INIS)

Davidson, M.D.; Bergsma, G.C.; Blom, M.J.

2011-07-01

The working group on Economic Instruments of the Biodiversity and Natural Resources Task Force addressed the question how the recommendations of the report of the United Nations 'The Economics of Ecosystems and Biodiversity' (TEEB) can be realized in the Netherlands. A selection of topics has been made for which policy proposals are developed which might be promising and can lead to a better protection of the biodiversity. The following proposals were investigated and/or elaborated: decrease of the social discount rate; further greening of the tax system; import levy on bulk commodities; taxes on non-sustainable wood; levy on the use of open space; differential tax on animal proteins; and a revision of biomass incentives. [nl

Elaborating on systems thinking in health promotion practice.

Science.gov (United States)

Naaldenberg, Jenneken; Vaandrager, Lenneke; Koelen, Maria; Wagemakers, Anne-Marie; Saan, Hans; de Hoog, Kees

2009-03-01

Health and well-being are the result of a series of complex processes in which an individual interacts with other people and the environment. A systematic approach ensures incorporation of individual, ecological, social and political factors. However, interactions between these factors can be overlooked within a systematical approach. A systemic approach can provide additional information by incorporating interactions and communication. The opportunities of a systems thinking perspective for health promotion were investigated for this paper. Although others have also made attempts to explore systems thinking in the field of health promotion, the implications of systems thinking in practice need attention. Other fields such as agricultural extension studies, organizational studies and development studies provide useful experiences with the use of a systems thinking perspective in practice. Building on experiences from these fields, we give a theoretical background in which processes of social learning and innovation play an important role. From this background, we derive an overview of important concepts for the practical application of a systems thinking perspective. These concepts are the structure of the system, meanings attached to actions, and power relations between actors. To make these concepts more explicit and reduce the theoretical character of systems thinking, we use an illustration to elaborate on these concepts in practice. For this purpose, we describe a health promotion partnership in The Netherlands using the concepts structure, meaning and power relations. We show how a systems perspective increases insight in the functioning of a partnership and how this can facilitate processes of social learning and innovation. This article concludes by identifying future opportunities and challenges in adopting systems thinking for health promotion practice. A systems perspective towards health promotion can help projects reaching a more integral and

An OMIC approach to elaborate the antibacterial mechanisms of different alkaloids.

Science.gov (United States)

Avci, Fatma Gizem; Sayar, Nihat Alpagu; Sariyar Akbulut, Berna

2018-05-01

Plant-derived substances have regained interest in the fight against antibiotic resistance owing to their distinct antimicrobial mechanisms and multi-target properties. With the recent advances in instrumentation and analysis techniques, OMIC approaches are extensively used for target identification and elucidation of the mechanism of phytochemicals in drug discovery. In the current study, RNA sequencing based transcriptional profiling together with global differential protein expression analysis was used to comparatively elaborate the activities and the effects of the plant alkaloids boldine, bulbocapnine, and roemerine along with the well-known antimicrobial alkaloid berberine in Bacillus subtilis cells. The transcriptomic findings were validated by qPCR. Images from scanning electron microscope were obtained to visualize the effects on the whole-cells. The results showed that among the three selected alkaloids, only roemerine possessed antibacterial activity. Unlike berberine, which is susceptible to efflux through multidrug resistance pumps, roemerine accumulated in the cells. This in turn resulted in oxidative stress and building up of reactive oxygen species, which eventually deregulated various pathways such as iron uptake. Treatment with boldine or bulbocapnine slightly affected various metabolic pathways but has not changed the growth patterns at all. Copyright © 2018 Elsevier Ltd. All rights reserved.

Microstructural and Optical Properties of Porous Alumina Elaborated on Glass Substrate

Science.gov (United States)

Zaghdoudi, W.; Gaidi, M.; Chtourou, R.

2013-03-01

A transparent porous anodized aluminum oxide (AAO) nanostructure was formed on a glass substrate using the anodization of a highly pure evaporated aluminum layer. A parametric study was carried out in order to achieve a fine control of the microstructural and optical properties of the elaborated films. The microstructural and surface morphologies of the porous alumina films were characterized by x-ray diffraction and atomic force microscopy. Pore diameter, inter-pore separation, and the porous structure as a function of anodization conditions were investigated. It was then found that the pores density decreases with increasing the anodization time. Regular cylindrical porous AAO films with a flat bottom structure were formed by chemical etching and anodization. A high transmittance in the 300-900 nm range is reported, indicating a fulfilled growth of the transparent sample (alumina) from the aluminum metal. The data showed typical interference oscillations as a result of the transparent characteristics of the film throughout the visible spectral range. The thickness and the optical constants ( n and k) of the porous anodic alumina films, as a function of anodizing time, were obtained using spectroscopic ellipsometry in the ultraviolet-visible-near infrared (UV-vis-NIR) regions.

Elaboration of natural polyfunctional preparations with antiparasitic and biostimulating properties for plant growing.

Science.gov (United States)

Iutynska, G O

2012-01-01

Producer of macrolide antibiotic avermectin Streptomyces avermitilis UCM Ac-2179 has been isolated from Ukrainian chernozem soil, its biosynthetic activity has been increased by the traditional selection and chemical mutagenesis methods. Streptomyces avermitilis UCM Ac-2179 synthesizes avermectin with the content of anti-parasitic B-components more than 40%. Addition of exogenous Na-pyruvate (1.5 mg/L) in cultural medium promotes a 2.5-fold augmentation of the avermectin synthesis. The preparation Avercom has been obtained by the method of ethanol extraction from the producer biomass. This preparation includes antibiotic avermectin and other biologically active substances: free amino acids, lipids, phytohormones. Avercom has high nematicidic activity and raises plant resistance to fungal and viral diseases. On the base of Avercom and plant growth regulators the complex preparations Actinolan and Ascoldia have been elaborated. The effectiveness of the biopreparations as nematicidic and plantstimulating means under experimental and industrial conditions was confirmed.

Elaboration, morphology and properties of starch/polyester nano-biocomposites based on sepiolite clay.

Science.gov (United States)

Olivato, J B; Marini, J; Pollet, E; Yamashita, F; Grossmann, M V E; Avérous, L

2015-03-15

The incorporation of nano-sized sepiolite clays into thermoplastic starch/poly(butylene adipate-co-terephthalate) (TPS/PBAT) blends has been investigated with the goal of improving the matrix properties. TPS/PBAT nano-biocomposites were elaborated with two different proportions of the polymeric phases. The influence of the sepiolite nanoclays on the mechanical, thermal and structural properties of the corresponding blends was evaluated. SEM images confirmed the good dispersion of the sepiolite clay, with a low occurrence of small aggregates in the polymeric matrix. Wide-angle X-ray diffraction showed no significant alteration of the crystalline structures of PBAT and starch induced by the sepiolite clay. The addition of sepiolite slightly affected the thermal degradation of the nano-biocomposites; however, the mechanical tests revealed an increase in some mechanical properties, demonstrating that sepiolite is a promising nanofiller for TPS-based materials. Copyright © 2014 Elsevier Ltd. All rights reserved.

Elaboration of strontium ruthenium oxide thin films on metal substrates by chemical solution deposition

International Nuclear Information System (INIS)

Seveno, R.; Braud, A.; Gundel, H.W.

2005-01-01

In order to improve the structural interface between a metal substrate and a lead zirconate titanate (Pb(ZrTi)O 3 , PZT) ferroelectric thin film, the elaboration of strontium ruthenium oxide (SrRuO 3 ) by chemical solution deposition is studied. The SrRuO 3 thin films were realized by multiple spin-coating technique and the temperature of the rapid thermal annealing process was optimized. The crystallization behavior was examined by X-ray diffraction; surface analyses using scanning electron microscope and atomic force microscope techniques showed the influence of the SrRuO 3 layer at the interface PZT/metal on the morphology of the ferroelectric thin film. From the electrical measurements, a coercive electric field around 25 kV/cm and a remanent polarization of approximately 30 μC/cm were found

An analysis on Public Service Announcements (PSA) within the scope of Elaboration Likelihood Model: Orange and Hazelnut Consumption Samples

OpenAIRE

Bical, Adil; Yılmaz, R. Ayhan

2018-01-01

The purpose of the study is to reveal that how persuasion works in public service announcements on hazelnut and orange consumption ones broadcasted in Turkey. According to Petty and Cacioppo, Elaboration Likelihood Model explains the process of persuasion on two routes: central and peripheral. In-depth interviews were conducted to obtain the goal of the study. Respondents were asked whether they process the message of the PSA centrally or peripherally. Advertisements on consumption of hazelnu...

Metal Particles – Hazard or Risk? Elaboration and Implementation of a Research Strategy from a Surface and Corrosion Perspective

OpenAIRE

Midander, Klara

2009-01-01

Do metal particles (including particles of pure metals, alloys, metal oxides and compounds) pose a hazard or risk to human health? In the light of this question, this thesis summarizes results from research conducted on metal particles, and describes the elaboration and implementation of an in vitro test methodology to study metal release from particles through corrosion and dissolution processes in synthetic biological media relevant for human exposure through inhalation/ingestion and dermal...

Commentary

Indian Academy of Sciences (India)

Unknown

2004-11-29

Nov 29, 2004 ... Crick's and Wilkins' reactions were not at all unusual at the time – in fact, book reviews of The Double ... As a youngish man in his mid-thirties at the time when Watson met him, Crick was ... moved into the field of biology instead. .... recent realization that the action is in the proteome rather than the genome ...

Elaboration by tape-casting and co-sintering of multilayer catalytic membrane reactor- performances; Elaboration par coulage en bande et cofrittage de reacteurs catalytiques membranaires multicouches-performances

Energy Technology Data Exchange (ETDEWEB)

Julian, A

2008-12-15

This research deals with the increasing interest of the conversion of natural gas into liquid fuels (diesel, kerosene) using the Gas To Liquid (GTL) process. Within this context, Catalytic Membrane-based Reactors (CMR) would allow an improvement of the process efficiency and a reduction of investment and production costs with respect to the present technologies. They allow performing the separation of oxygen from air, and the conversion of natural gas into synthesis gas within a single step. After having highlighted the economical and technological advantages of using a ceramic membrane for the production of syngas (H{sub 2} + CO{sub 2}), the author describes the protocols of synthesis of powders selected for the dense membrane and the porous support, and their physical characteristics. The obtained powders are then adapted to the tape-casting forming process. Graded-composition multilayer structures and microstructure are then elaborated by co-sintering. Performances in terms of membrane oxygen flows are presented. Mechanisms limiting the oxygen flow are discussed in order to propose ways of improving membrane performances. The limits of the studied system are defined in terms of elastic properties, and optimization ways are proposed for the dense membrane material composition in terms of mechanical properties and performance in oxygen semi-permeation.

Elaboration of Safe Community Assessment System

Directory of Open Access Journals (Sweden)

Birutė Mikulskienė

2013-08-01

Full Text Available The paper aims to design an assessment system to monitor and evaluate safety parameters and administrative efforts with the purpose to increase safety in municipalities. The safety monitoring system considered is to be the most important tool for creation and development of safe communities in Lithuania. Several methods were applied to achieve this purpose. In order to determine the role of local government in ensuring the safety of people, property and environment at the local level of a meta-analysis of research reports, the Lithuanian national legislation, strategic planning documents of the state and local government were carried out. Analysis of statistical data, structural analysis, comparative analysis and synthesis methods were used while investigating the areas of safety uncertainty, risk groups, identifying safety risk factors, determining their relationship, and creating a safe community assessment system. A safe community assessment system, which consists of two types of criteria, has been elaborated. The assessment system is based on the multi-level criteria for safety monitoring and the multi-level criteria for the evaluation of municipal activities in the field of building safety. Links between the criteria, peculiarities of their application and advantages in the process of safe community creation and development are analyzed. Design and implementation of the safe community assessment system is one of the most important stages to implement the idea of safe communities. The proposed system integrates a variety of risk areas, the safety achievement criteria are linked to the criteria used in the strategic planning. Periodic assessment of the safety situation using the proposed system ensures possibility to monitor current local safety conditions and assess the changes and the trends. A safe community assessment system is proposed to be used as a tool to unified municipalities safety comprehensiveness and compare safety level in

Elaboration of Safe Community Assessment System

Directory of Open Access Journals (Sweden)

Algirdas Astrauskas

2011-12-01

Full Text Available The paper aims to design an assessment system to monitor and evaluate safety parameters and administrative efforts with the purpose to increase safety in municipalities. The safety monitoring system considered is to be the most important tool for creation anddevelopment of safe communities in Lithuania. Several methods were applied to achieve this purpose. In order to determine the role of local government in ensuring the safety of people, property and environment at the local level of a meta-analysis of research reports,the Lithuanian national legislation, strategic planning documents of the state and local government were carried out. Analysis of statistical data, structural analysis, comparative analysis and synthesis methods were used while investigating the areas of safety uncertainty, risk groups, identifying safety risk factors, determining their relationship, and creating a safe community assessment system.A safe community assessment system, which consists of two types of criteria, has been elaborated. The assessment system is based on the multi-level criteria for safety monitoring and the multi-level criteria for the evaluation of municipal activities in the field of building safety. Links between the criteria, peculiarities of their application and advantages in the process of safe community creation and development are analyzed.Design and implementation of the safe community assessment system is one of the most important stages to implement the idea of safe communities. The proposed system integrates a variety of risk areas, the safety achievement criteria are linked to the criteria used in thestrategic planning. Periodic assessment of the safety situation using the proposed system ensures possibility to monitor current local safety conditions and assess the changes and the trends. A safe community assessment system is proposed to be used as a tool to unified municipalities safety comprehensiveness and compare safety level in

Group B Streptococcus Induces Neutrophil Recruitment to Gestational Tissues and Elaboration of Extracellular Traps and Nutritional Immunity.

Science.gov (United States)

Kothary, Vishesh; Doster, Ryan S; Rogers, Lisa M; Kirk, Leslie A; Boyd, Kelli L; Romano-Keeler, Joann; Haley, Kathryn P; Manning, Shannon D; Aronoff, David M; Gaddy, Jennifer A

2017-01-01

Streptococcus agalactiae , or Group B Streptococcus (GBS), is a gram-positive bacterial pathogen associated with infection during pregnancy and is a major cause of morbidity and mortality in neonates. Infection of the extraplacental membranes surrounding the developing fetus, a condition known as chorioamnionitis, is characterized histopathologically by profound infiltration of polymorphonuclear cells (PMNs, neutrophils) and greatly increases the risk for preterm labor, stillbirth, or neonatal GBS infection. The advent of animal models of chorioamnionitis provides a powerful tool to study host-pathogen relationships in vivo and ex vivo . The purpose of this study was to evaluate the innate immune response elicited by GBS and evaluate how antimicrobial strategies elaborated by these innate immune cells affect bacteria. Our work using a mouse model of GBS ascending vaginal infection during pregnancy reveals that clinically isolated GBS has the capacity to invade reproductive tissues and elicit host immune responses including infiltration of PMNs within the choriodecidua and placenta during infection, mirroring the human condition. Upon interacting with GBS, murine neutrophils elaborate DNA-containing extracellular traps, which immobilize GBS and are studded with antimicrobial molecules including lactoferrin. Exposure of GBS to holo- or apo-forms of lactoferrin reveals that the iron-sequestration activity of lactoferrin represses GBS growth and viability in a dose-dependent manner. Together, these data indicate that the mouse model of ascending infection is a useful tool to recapitulate human models of GBS infection during pregnancy. Furthermore, this work reveals that neutrophil extracellular traps ensnare GBS and repress bacterial growth via deposition of antimicrobial molecules, which drive nutritional immunity via metal sequestration strategies.

The Elaboration Process of Municipal Education Plans in the Greater São Paulo ABC Region

Directory of Open Access Journals (Sweden)

Paulo Sérgio Garcia

2018-03-01

Full Text Available This study analyzed the elaboration process of the Municipal Education Plans (PME in Greater São Paulo ABC region (Brazil, placing the analysis in a broader framework to understand the influences made by the Lesbian, Gay, Bisexual and Transgender (LGBT movement and those practiced by the Catholic Church. A case study was used as a methodological approach. Results revealed the loosening in the drawing up of plans, the influence of the Church over the councilmen, inducing them to make alterations in final documents, ratifying the Church’s influence, which is historic in Brazil, and the education weakening regarding prejudice and discrimination, that are recognized demands of the LGBT movement. These results are important in order to provoke the debate in Education Departments and universities.

Blow Bits : Creative playgrounds, gamification and virtuosity with hybrid design tools and environments (HDTE)

NARCIS (Netherlands)

Wendrich, Robert E.

2017-01-01

Playgrounds (real or virtual) are universal areas where most people learn to play, interact, engage, immerse to unlearn and relearn repeatedly in order to get more fundamental understanding and insights on their creativity, communication and collaboration patterns with others. Consequently, finding

Elaboration of the methodological referential for life cycle analysis of first generation biofuels in the French context

International Nuclear Information System (INIS)

2008-01-01

This study was made under the particular context of a strong growth of biofuels market, and the implication of French and European public authorities, and certain Member States (Germany, Netherlands, UK), for the development of certification schemes for first generation biofuels. The elaboration of such schemes requires a consensus on the methodology to apply when producing Life Cycle Analysis (LCA) of biofuels. To answer this demand, the study built up the methodological referential for biofuels LCAs in order to assess the Greenhouse Gases (GHG) emissions, fossil fuels consumptions and local atmospheric pollutants emissions induced by the different biofuel production pathways. The work consisted in methodological engineering, and was accomplished thanks to the participation of all the members of the Technical Committee of the study. An initial bibliographic review on biofuels LCAs allowed the identification of the main methodological issues (listed below). For each point, the impact of the methodological choices on the biofuels environmental balances was assessed by several sensitivity analyses. The results of these analyses were taken into account for the elaboration of the recommendations: - Consideration of the environmental burdens associated with buildings, equipments and their maintenance - Quantification of nitrous oxide (N 2 O) emissions from fields - Impact of the Land Use Change (LUC) - Allocation method for the distribution of the environmental impacts of biofuel production pathways between the different products and coproducts generated. Within the framework of this study, we made no distinction in terms of methodological approach between GHG emissions and local pollutants emissions. This results from the fact that the methodological issues cover all the environmental burdens and do not require specific approaches. This executive summary presents the methodological aspects related to biofuels LCAs. The complete report of the study presents in addition

Elaboration of strontium ruthenium oxide thin films on metal substrates by chemical solution deposition

Energy Technology Data Exchange (ETDEWEB)

Seveno, R. [Universite de Nantes, Institut de Recherche en Electrotechnique et Electronique de Nantes Atlantique (IREENA), 2, rue de la Houssiniere, BP 92208, 44322 Nantes Cedex 3 (France)]. E-mail: raynald.seveno@univ-nantes.fr; Braud, A. [Universite de Nantes, Institut de Recherche en Electrotechnique et Electronique de Nantes Atlantique (IREENA), 2, rue de la Houssiniere, BP 92208, 44322 Nantes Cedex 3 (France); Gundel, H.W. [Universite de Nantes, Institut de Recherche en Electrotechnique et Electronique de Nantes Atlantique (IREENA), 2, rue de la Houssiniere, BP 92208, 44322 Nantes Cedex 3 (France)

2005-12-22

In order to improve the structural interface between a metal substrate and a lead zirconate titanate (Pb(ZrTi)O{sub 3}, PZT) ferroelectric thin film, the elaboration of strontium ruthenium oxide (SrRuO{sub 3}) by chemical solution deposition is studied. The SrRuO{sub 3} thin films were realized by multiple spin-coating technique and the temperature of the rapid thermal annealing process was optimized. The crystallization behavior was examined by X-ray diffraction; surface analyses using scanning electron microscope and atomic force microscope techniques showed the influence of the SrRuO{sub 3} layer at the interface PZT/metal on the morphology of the ferroelectric thin film. From the electrical measurements, a coercive electric field around 25 kV/cm and a remanent polarization of approximately 30 {mu}C/cm were found.

Soluble suppressor supernatants elaborated by concanavalin A-activated human mononuclear cells. Characterization of a soluble suppressor of B cell immunoglobulin production

International Nuclear Information System (INIS)

Fleisher, T.A.; Greene, W.C.; Blaese, R.M.; Waldmann, T.A.

1981-01-01

Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells

In situ elaboration of a binary Ti-26Nb alloy by selective laser melting of elemental titanium and niobium mixed powders.

Science.gov (United States)

Fischer, M; Joguet, D; Robin, G; Peltier, L; Laheurte, P

2016-05-01

Ti-Nb alloys are excellent candidates for biomedical applications such as implantology and joint replacement because of their very low elastic modulus, their excellent biocompatibility and their high strength. A low elastic modulus, close to that of the cortical bone minimizes the stress shielding effect that appears subsequent to the insertion of an implant. The objective of this study is to investigate the microstructural and mechanical properties of a Ti-Nb alloy elaborated by selective laser melting on powder bed of a mixture of Ti and Nb elemental powders (26 at.%). The influence of operating parameters on porosity of manufactured samples and on efficacy of dissolving Nb particles in Ti was studied. The results obtained by optical microscopy, SEM analysis and X-ray microtomography show that the laser energy has a significant effect on the compactness and homogeneity of the manufactured parts. Homogeneous and compact samples were obtained for high energy levels. Microstructure of these samples has been further characterized. Their mechanical properties were assessed by ultrasonic measures and the Young's modulus found is close to that of classically elaborated Ti-26 Nbingot. Copyright © 2016 Elsevier B.V. All rights reserved.

Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

Science.gov (United States)

2011-07-01

AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

Elaborate horns in a giant rhinoceros beetle incur negligible aerodynamic costs.

Science.gov (United States)

McCullough, Erin L; Tobalske, Bret W

2013-05-07

Sexually selected ornaments and weapons are among nature's most extravagant morphologies. Both ornaments and weapons improve a male's reproductive success; yet, unlike ornaments that need only attract females, weapons must be robust and functional structures because they are frequently tested during male-male combat. Consequently, weapons are expected to be particularly costly to bear. Here, we tested the aerodynamic costs of horns in the giant rhinoceros beetle, Trypoxylus dichotomus. We predicted that the long, forked head horn would have three main effects on flight performance: increased body mass, an anterior shift in the centre of mass and increased body drag. We found that the horns were surprisingly lightweight, and therefore had a trivial effect on the male beetles' total mass and mass distribution. Furthermore, because beetles typically fly at slow speeds and high body angles, horns had little effect on total body drag. Together, the weight and the drag of horns increased the overall force required to fly by less than 3 per cent, even in the largest males. Because low-cost structures are expected to be highly evolutionarily labile, the fact that horns incur very minor flight costs may have permitted both the elaboration and diversification of rhinoceros beetle horns.

Statistical sources and methodology of elaboration for the regional, national and European energy indicators; Fonti statistiche e metodologie di elaborazione per gli indicatori energetici regionali, nazionali ed europei

Energy Technology Data Exchange (ETDEWEB)

Bianco, R; Perrella, G [ENEA, Centro Ricerche Casaccia, Rome (Italy). Dip. Energia

1996-10-01

This report is aimed to presenting the energy-economic and structural data system called EIS (energy indicators system), about the statistical sources and the different methodologies of data valuation and indicators elaboration. This system, elaborated in the activity of ERG-PROM Division of ENEA (Italian Agency for New Technologies, Energy and the Environment), is aimed to analyze the energy by quantity and quality use, in the different sectors, for each final aim and for every source. In the report are defined all the procedure and unit of measure used to process the data bank, so the reader can to interpret the right meaning of the variables and indicators and can make further process.

Consolidity: Stack-based systems change pathway theory elaborated

Directory of Open Access Journals (Sweden)

Hassen Taher Dorrah

2014-06-01

Full Text Available This paper presents an elaborated analysis for investigating the stack-based layering processes during the systems change pathway. The system change pathway is defined as the path resulting from the combinations of all successive changes induced on the system when subjected to varying environments, activities, events, or any excessive internal or external influences and happenings “on and above” its normal stands, situations or set-points during its course of life. The analysis is essentially based on the important overall system paradigm of “Time driven-event driven-parameters change”. Based on this paradigm, it is considered that any affected activity, event or varying environment is intelligently self-recorded inside the system through an incremental consolidity-scaled change in system parameters of the stack-based layering types. Various joint stack-based mathematical and graphical approaches supported by representable case studies are suggested for the identification, extraction, and processing of various stack-based systems changes layering of different classifications and categorizations. Moreover, some selected real life illustrative applications are provided to demonstrate the (infinite stack-based identification and recognition of the change pathway process in the areas of geology, archeology, life sciences, ecology, environmental science, engineering, materials, medicine, biology, sociology, humanities, and other important fields. These case studies and selected applications revealed that there are general similarities of the stack-based layering structures and formations among all the various research fields. Such general similarities clearly demonstrate the global concept of the “fractals-general stacking behavior” of real life systems during their change pathways. Therefore, it is recommended that concentrated efforts should be expedited toward building generic modular stack-based systems or blocks for the mathematical

Elaborate Mimetic Vocal Displays by Female Superb Lyrebirds

Directory of Open Access Journals (Sweden)

Anastasia H Dalziell

2016-04-01

breeding territories. In sum, this study reveals elaborate female vocal displays in a species widely depicted as an example of sexual selection for male extravagance, and thus highlights the hidden complexity of female vocalizations.

Elaboration of the Reciprocal-Engagement Model of Genetic Counseling Practice: a Qualitative Investigation of Goals and Strategies.

Science.gov (United States)

Redlinger-Grosse, Krista; Veach, Patricia McCarthy; LeRoy, Bonnie S; Zierhut, Heather

2017-12-01

As the genetic counseling field evolves, a comprehensive model of practice is critical. The Reciprocal-Engagement Model (REM) consists of 5 tenets and 17 goals. Lacking in the REM, however, are well-articulated counselor strategies and behaviors. The purpose of the present study was to further elaborate and provide supporting evidence for the REM by identifying and mapping genetic counseling strategies to the REM goals. A secondary, qualitative analysis was conducted on data from two prior studies: 1) focus group results of genetic counseling outcomes (Redlinger-Grosse et al., Journal of Genetic Counseling, 2015); and 2) genetic counselors' examples of successful and unsuccessful genetic counseling sessions (Geiser et al. 2009). Using directed content analysis, 337 unique strategies were extracted from focus group data. A Q-sort of the 337 strategies yielded 15 broader strategy domains that were then mapped to the successful and unsuccessful session examples. Differing prevalence of strategy domains identified in successful sessions versus the prevalence of domains identified as lacking in unsuccessful sessions provide further support for the REM goals. The most prevalent domains for successful sessions were Information Giving and Use Psychosocial Skills and Strategies; and for unsuccessful sessions, Information Giving and Establish Working Alliance. Identified strategies support the REM's reciprocal nature, especially with regard to addressing patients' informational and psychosocial needs. Patients' contributions to success (or lack thereof) of sessions was also noted, supporting a REM tenet that individual characteristics and the counselor-patient relationship are central to processes and outcomes. The elaborated REM could be used as a framework for certain graduate curricular objectives, and REM components could also inform process and outcomes research studies to document and further characterize genetic counselor strategies.

Nano-oxide nucleation in a 14Cr-ODS steel elaborated by reactive-inspired ball-milling: Multiscale characterizations

International Nuclear Information System (INIS)

Brocq, M.; Legendre, F.; Sakasegawa, H.; Radiguet, B.; Cuvilly, F.; Pareige, P.; Mathon, M.H.

2009-01-01

Oxide dispersion strengthened (ODS) steels are promising structural materials for both fusion and fission Generation IV reactors. Indeed, they exhibit excellent mechanical and creep properties and radiation resistance thanks to a fine and dense dispersion of complex nanometric oxides. ODS steels are usually elaborated by ball-milling iron based and yttrium oxide powders and then by thermomechanical treatments. It is expected that ball-milling dissolves yttrium oxides in the metallic matrix and that annealing induces nano-oxide precipitation. However the formation mechanism remains unclear and as a consequence the process is still uncontrolled. In this context, we proposed a new approach based on reactive ball milling of iron oxide (Fe 2 O 3 ), yttria (YFe 3 ) and iron based alloy in a dedicated instrumented ball-milling device. Also, a fine scale characterization, after each step of the process including ball-milling, is performed. A Fe-14Cr-2W-1Ti-0.8Y-0.2O (%wt) ODS steel was synthesized by reactive ball-milling and was characterized at very fine scale in both as-milled and as-annealed state. Atom Probe Tomography (APT) and Small Angle Neutron Scattering (SANS) were combined. After ballmilling, most of Y and O were, as expected, in solution in the ferritic matrix but some complex Y-Ti nano-oxides were also observed, indicating that oxide nucleation can start during ball-milling. With annealing the number of nano-oxides increases. In this presentation, experimental results of APT and SANS will be detailed and compared with what is usually observed in ODS steels elaborated by conventional ball milling. Finally, a formation mechanism of nano-oxides deduced from these results will be proposed. (author)

Such stuff as dreams are made on? Elaborative encoding, the ancient art of memory, and the hippocampus.

Science.gov (United States)

Llewellyn, Sue

2013-12-01

This article argues that rapid eye movement (REM) dreaming is elaborative encoding for episodic memories. Elaborative encoding in REM can, at least partially, be understood through ancient art of memory (AAOM) principles: visualization, bizarre association, organization, narration, embodiment, and location. These principles render recent memories more distinctive through novel and meaningful association with emotionally salient, remote memories. The AAOM optimizes memory performance, suggesting that its principles may predict aspects of how episodic memory is configured in the brain. Integration and segregation are fundamental organizing principles in the cerebral cortex. Episodic memory networks interconnect profusely within the cortex, creating omnidirectional "landmark" junctions. Memories may be integrated at junctions but segregated along connecting network paths that meet at junctions. Episodic junctions may be instantiated during non-rapid eye movement (NREM) sleep after hippocampal associational function during REM dreams. Hippocampal association involves relating, binding, and integrating episodic memories into a mnemonic compositional whole. This often bizarre, composite image has not been present to the senses; it is not "real" because it hyperassociates several memories. During REM sleep, on the phenomenological level, this composite image is experienced as a dream scene. A dream scene may be instantiated as omnidirectional neocortical junction and retained by the hippocampus as an index. On episodic memory retrieval, an external stimulus (or an internal representation) is matched by the hippocampus against its indices. One or more indices then reference the relevant neocortical junctions from which episodic memories can be retrieved. Episodic junctions reach a processing (rather than conscious) level during normal wake to enable retrieval. If this hypothesis is correct, the stuff of dreams is the stuff of memory.

Group B Streptococcus Induces Neutrophil Recruitment to Gestational Tissues and Elaboration of Extracellular Traps and Nutritional Immunity

Science.gov (United States)

Kothary, Vishesh; Doster, Ryan S.; Rogers, Lisa M.; Kirk, Leslie A.; Boyd, Kelli L.; Romano-Keeler, Joann; Haley, Kathryn P.; Manning, Shannon D.; Aronoff, David M.; Gaddy, Jennifer A.

2017-01-01

Streptococcus agalactiae, or Group B Streptococcus (GBS), is a gram-positive bacterial pathogen associated with infection during pregnancy and is a major cause of morbidity and mortality in neonates. Infection of the extraplacental membranes surrounding the developing fetus, a condition known as chorioamnionitis, is characterized histopathologically by profound infiltration of polymorphonuclear cells (PMNs, neutrophils) and greatly increases the risk for preterm labor, stillbirth, or neonatal GBS infection. The advent of animal models of chorioamnionitis provides a powerful tool to study host-pathogen relationships in vivo and ex vivo. The purpose of this study was to evaluate the innate immune response elicited by GBS and evaluate how antimicrobial strategies elaborated by these innate immune cells affect bacteria. Our work using a mouse model of GBS ascending vaginal infection during pregnancy reveals that clinically isolated GBS has the capacity to invade reproductive tissues and elicit host immune responses including infiltration of PMNs within the choriodecidua and placenta during infection, mirroring the human condition. Upon interacting with GBS, murine neutrophils elaborate DNA-containing extracellular traps, which immobilize GBS and are studded with antimicrobial molecules including lactoferrin. Exposure of GBS to holo- or apo-forms of lactoferrin reveals that the iron-sequestration activity of lactoferrin represses GBS growth and viability in a dose-dependent manner. Together, these data indicate that the mouse model of ascending infection is a useful tool to recapitulate human models of GBS infection during pregnancy. Furthermore, this work reveals that neutrophil extracellular traps ensnare GBS and repress bacterial growth via deposition of antimicrobial molecules, which drive nutritional immunity via metal sequestration strategies. PMID:28217556

Effects of deceptive packaging and product involvement on purchase intention: an elaboration likelihood model perspective.

Science.gov (United States)

Lammers, H B

2000-04-01

From an Elaboration Likelihood Model perspective, it was hypothesized that postexposure awareness of deceptive packaging claims would have a greater negative effect on scores for purchase intention by consumers lowly involved rather than highly involved with a product (n = 40). Undergraduates who were classified as either highly or lowly (ns = 20 and 20) involved with M&Ms examined either a deceptive or non-deceptive package design for M&Ms candy and were subsequently informed of the deception employed in the packaging before finally rating their intention to purchase. As anticipated, highly deceived subjects who were low in involvement rated intention to purchase lower than their highly involved peers. Overall, the results attest to the robustness of the model and suggest that the model has implications beyond advertising effects and into packaging effects.

Re-usable templates for documenting the elaboration and architectural design of the CMS software

International Nuclear Information System (INIS)

Wellisch, J.P.; Tuura, L.

2001-01-01

Modern standards and definitions of deliverables for software development are provided by various standards like PSS-05, CMMI, ECSS, Volere, Rational Unified process or SPICE (ISO 15504). Modern document templates and the corresponding documents are based on atomic shells that cross-link, and can be subsequently assembled into a set of complete documents; views of the information in the shells. This makes the information easy to maintain, and enables selective views of the documentation. The authors will present a catalogue of document templates that has been developed in the context of the CMS CAFE forum, as well as their cross-linkage, using UML as the modelling language. The templates allow for documenting the elaboration and architectural design phases of software development. They can be used as the basis for establishing and documenting architecture, while establishing trace-ability to use-cases, requirements, constraints, and important technological choices in a maintainable manner

Elaboration and characterization of Japanese Raisin Tree (Hovenia dulcis Thumb. pseudofruits fermented alcoholic beverage

Directory of Open Access Journals (Sweden)

Juliana Tensol PINTO

Full Text Available Abstract Hovenia dulcis pseudofruits have underexplored properties for food purposes, despite their pleasant sensory characteristics and therapeutic benefits. The aim of this study was the elaboration and chemical characterization of the alcoholic fermented beverage of H. dulcis, using selected strain of Saccharomyces cerevisiae (CCMA 0200. The resulting fermented beverage presented high content of phenolic compounds and antioxidant activity when compared to other fruits and beverages (DPPH and ABTS assay. The alcohol content was 12.9 oGL and total sugars 3.57g/L. By the GC-MS analysis, 39 compounds were identified including metabolites with therapeutic potential such as eugenol, trans-farnesol salicylates. The flavonoid dihidromyricetin was identified and quantified (75.17 mg/L by HPLC-DAD and UPLC-MS/MS. The results reinforce the interest on nutraceutical and functional properties of this beverage and opens perspectives for new studies that value this underexplored pseudofruit.

ELABORATION OF MANAGEMENT PLAN OF SOLID WASTE FROM SMALL CAST IRON FOUNDRIES

Directory of Open Access Journals (Sweden)

Carlos Alberto Mendes Moraes

2013-12-01

Full Text Available The foundry industry contributes to society meeting the demand of metal scrap recycling, but, at the same time, it brings a high risk of environmental impact for its many potentially pollutant wastes. Among these, there are slag and used foundry sand (cold cure molding. Through a survey about the production process of a small cast iron company, the collected data was compiled to determine the organizational setting in terms of generation and segregation of waste. From a complete environmental diagnosis carried out in eight small cast iron foundries, one of them was chosen to be a basis for the elaboration of an industrial solid waste management plan, which is becoming necessary to know and manage the generation of wastes qualitatively and quantitatively. A data assessment about the production process was carried out and compiled to determine the actual organizational scenario. As a result of that, it is possible to create a favorable environment to develop tools for environmental impacts prevention, which will permit the migration for more complex actions on the direction of more efficient process, cleaner production, and internal and external recycling of exceeding materials.

Regional IS Knowledge Networks: Elaborating the Theme of Relevance of IS Research

Directory of Open Access Journals (Sweden)

Mikael Söderström

2003-01-01

Full Text Available The purpose of this paper is to elaborate on the theme of the relevance of IS research. Based on recent experiments and experiences in the borderland between research and practice and politics we suggest some additions to the discussion of the IS research relevance in Fitzgerald (2001. One addition concerns relevance to whom, where we suggest considering a regional relevance through cultivation of regional IS knowledge networks. Such networks comprise regional knowledge production in collaboration between researchers and practitioners, and results are made public and tested in other organizations in addition to the research sites. This is closely related to the view of knowledge and research put forward by American pragmatism. A second addition is to complement Fitzgerald's suggestion to expose researchers to practice with the suggestion to expose practitioners to research. It is just as difficult to learn the 'true nature' of research from reading the executive summary in MIS Quarterly as it is to learn the 'true nature' of practice from a couple of interviews with practitioners. A regional IS knowledge network is an excellent opportunity for such double exposure.

Research on elaboration of the action plan for the New Earth 21; `Chikyu saisei keikaku` no jisshi keikaku sakusei ni kansuru chosa jigyo

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-03-01

Elaboration of the action plan for the New Earth 21 plan proposed by Japan in Houston Summit was researched. In fiscal 1995 three types of energy supply/demand scenarios, sensitivity analysis under various conditions, and cases presupposing CO2 emission regulations or not were evaluated by analysis toward 2050 using the New Earth 21 Model (NE 21 Model). Energy-saving is important, and CO2 recovery/treatment technology is introduced according to CO2 emission regulations, while attention is focussed on biomass energy. The issue of solar and wind power generation is cost reduction. In a presupposed horizontally integrated energy system, methanol represents an important intermediate energy. As a whole, CO2 reduction can be achieved by various combinations of energy-saving, introduction of regenerative energy, and CO2 recovery/treatment technology. Case studies of the action plan were conducted by unifying the evaluation criterion on coal IGCC, photovoltaic generation and biomass. The NE 21 Model was useful for elaboration of the reduction scenarios of CO2 emission. 26 refs., 84 figs., 28 tabs.

Improving the Army’s Next Effort in Technology Forecasting

Science.gov (United States)

2010-09-01

DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

Matter transfer during virgin olive oil elaboration

Directory of Open Access Journals (Sweden)

Gómez Herrera, Carlos

2007-06-01

Full Text Available In the course of the process of elaboration of virgin olive oil (whose main stages are crushing, malaxation and centrifugation the transfer of several minor components to the triacylglycerol constituent of the oily globules originally present in the cells of the fruit mesocarp is produced. Such minor components are chemical species present in the olive fruits, as well as those resulting from chemical or enzymatic processes which take place in the olive paste upon crushing. In this paper several types of transferable minor components, as well as those parameters affecting the rates of transfer are studied.Geometric and physical variations of interfacial regions between the oil and other systems in contact with it are discussed. These systems are olive vegetation water, olive pulp components, and fragments of the woody endocarp, as well as the atmospheric air and the tools and equipment of the oil mill.This article concludes with some considerations about the improvements of virgin olive oils achieved by controlling the transfer of minor components.Durante la elaboración del aceite de oliva virgen (cuyas principales etapas son molturación, batido y centrifugación se producen transferencias de diversos componentes menores a los triacilgliceroles originalmente presentes en los glóbulos oleosos de las células del mesocarpio de los frutos. Estos componentes menores son especies químicas presentes en las aceitunas, así como especies resultantes de procesos químicos o enzimáticos que se producen en la pasta a partir de la molturación. En este artículo se estudian diversos tipos de componentes menores transferibles, así como aquellos parámetros que afectan sus velocidades de transferencia.Se discuten las variaciones geométricas y físicas de las regiones interfaciales situadas entre el aceite y los otros sistemas en contacto con el mismo. Estos sistemas son el agua de vegetación, los componentes de la pulpa y los fragmentos de endocarpio

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

Science.gov (United States)

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Learning Global Leadership via Liberation Projects: An Interdisciplinary Application

Science.gov (United States)

Nguyen, Shelbee

2014-01-01

Global leadership programs framed within singular cultural contexts do not promote authentic leadership. Unilateral methods may exclude individual multicultural experiences or identities, and further, encourage a one-size fits all approach to leadership. An interdisciplinary global leadership course aims to promote authentic unlearning and…

Elaboration and modification of the waste zoning plan in basic nuclear installations. ASN Guide Nr 23, Release of the 2016/08/30

International Nuclear Information System (INIS)

2016-01-01

After having recalled the relevant regulatory texts and guides, this guide aims at detailing conditions of elaboration and of modification of the waste zoning plan which is defined in one of these texts, and applies requirements and recommendations of others of them. It first recalls the general doctrine of waste management in basic nuclear installations. It describes how the waste zoning plan and the reference waste zoning map are elaborated and justified, how the relevancy of this plan and this map are confirmed through radiological controls and based on general operation rules and periodic assessments. It also describes how contamination transfers and material activation are prevented, and discusses waste radiological controls to be performed. The next part addressed waste zoning and ways of management for wastes coming from conventional waste areas, and from areas of possible production of nuclear wastes. Issues of waste zoning downgrading or reclassification are then addressed by distinguishing temporary and definitive modifications (in one way or the other). Some peculiar cases are addressed: delimitation of waste zoning at the level of equipments, conventional processing of some wastes, radioactive waste warehousing, outdoor areas of possible production of nuclear wastes

Ignition and flame spread properties of wood, elaborated during a new test method based on convective heat flux

DEFF Research Database (Denmark)

Sørensen, Lars Schiøtt

Ignition and flame spread properties on selected types of wood and wall papers are elaborated. Tests are established in a new test setup in which the test specimen can be fixed in different angles due to a horizontal level. The heat exposing the test objects is arranged as a convective flux......, established from a Bunsen burners pilot flame. This principal is somewhat in contrast to the more typical radiation established fluxes. For instance, the ISO 9239 (DS 2000) test method is based on a gas fired radiant panel. And in the ISO 5657 standard, the ignition properties are investigated on test...

KNO3/NaNO3 - Graphite materials for thermal energy storage at high temperature: Part I. - Elaboration methods and thermal properties

International Nuclear Information System (INIS)

Acem, Zoubir; Lopez, Jerome; Palomo Del Barrio, Elena

2010-01-01

Composites graphite/salt for thermal energy storage at high temperature (∼200 deg. C) have been developed and tested. As at low temperature in the past, graphite has been used to enhance the thermal conductivity of the eutectic system KNO 3 /NaNO 3 . A new elaboration method has been proposed as an alternative to graphite foams infiltration. It consists of cold-compression of a physical mixing of expanded natural graphite particles and salt powder. Two different compression routes have been investigated: uni-axial compression and isostatic compression. The first part of the paper has been devoted to the analysis of the thermal properties of these new graphite/salt composites. It is proven that cold-compression is a simple and efficient technique for improving the salt thermal conductivity. For instance, graphite amounts between 15 and 20%wt lead to apparent thermal conductivities close to 20 W/m/K (20 times greater than the thermal conductivity of the salt). Furthermore, some advantages in terms of cost and safety are expected because materials elaboration is carried out at room temperature. The second part of the paper is focused on the analyses of the phase transition properties of these graphite/salt composites materials.

Elaboration of a guideline for counterpart testing of integral loop systems

International Nuclear Information System (INIS)

Karwat, H.

1988-01-01

A previous study on the problems of scaling and extrapolation of experimental results indicated the necessity to overcome some uncertainty in the achievable code accuracy when applied to full size reactor systems. The empirical approach in simulating interfacial relationships within systems behaviour codes in combination with the liberty of nodalisation requires a careful assessment of the overall validity of the code verification concept. Several new test facilities are presently under construction to study fluid-dynamic effects of interest for the behaviour of PWRs under small break LOCA conditions in a larger dimension and with somewhat modified scaling considerations. The test results expected from these new facilities may be useful to assess the overall validity of the analytical simulation concept of the applied computer codes. Test facilities of interest within the European Community are the - LOBI Test Facility (vol. scaling 1/700) at JRC-Ispra - SPES Test Facility (vol. scaling 1/425) in Italy - BETHSY Facility (vol scaling 1/100) in France and outside Europe the - ROSA IV Facility (vol. scaling 1/50) in Japan. Main objective of the study was the elaboration of a guideline for the particular requirements of meaningful counterpart testing with the final aim to qualify the overall validity of code simulation concepts and the expected predictive accuracy of code applications for full size prototype PWRs

Consciousness.

Science.gov (United States)

Sejnowski, Terrence J

2015-01-01

No one did more to draw neuroscientists' attention to the problem of consciousness in the twentieth century than Francis Crick, who may be better known as the co-discoverer (with James Watson) of the structure of DNA. Crick focused his research on visual awareness and based his analysis on the progress made over the last fifty years in uncovering the neural mechanisms underlying visual perception. Because much of what happens in our brains occurs below the level of consciousness and many of our intuitions about unconscious processing are misleading, consciousness remains an elusive problem. In the end, when all of the brain mechanisms that underlie consciousness have been identified, will we still be asking: "What is consciousness?" Or will the question shift, just as the question "What is life?" is no longer the same as it was before Francis Crick?

Testing the encoding elaboration hypothesis: The effects of exemplar ranking on recognition and recall.

Science.gov (United States)

Schnur, P

1977-11-01

Two experiments investigated the effects of exemplar ranking on retention. High-ranking exemplars are words judged to be prototypical of a given category; low-ranking exemplars are words judged to be atypical of a given category. In Experiment 1, an incidental learning paradigm was used to measure reaction time to answer an encoding question as well as subsequent recognition. It was found that low-ranking exemplars were classified more slowly but recognized better than high-ranking exemplars. Other comparisons of the effects of category encoding, rhyme encoding, and typescript encoding on response latency and recognition replicated the results of Craik and Tulving (1975). In Experiment 2, unanticipated free recall of live previously learned paired associate lists revealed that a list composed of low-ranking exemplars was better recalled than a comparable list composed of high-ranking exemplars. Moreover, this was true only when the lists were studied in the context of appropriate category cues. These findings are discussed in terms of the encoding elaboration hypothesis.

Intrathalamic Mechanisms of Visual Attention

OpenAIRE

Mayo, J. Patrick

2009-01-01

The classical model of visual processing emphasizes the lateral geniculate nucleus (LGN) as the major intermediary between the retina and visual cortex. Yet, anatomical findings inspired Francis Crick to suggest an alternative model in which the thalamic reticular nucleus, which envelops the LGN, acts as the “guardian” of visual cortex by modulating LGN activity. Recent work by McAlonan and colleagues supports Crick's hypothesis, thereby enhancing our understanding of the early stages of visu...

Glutamate Receptor Aptamers and ALS

Science.gov (United States)

2009-01-01

considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

Intrathalamic mechanisms of visual attention.

Science.gov (United States)

Mayo, J Patrick

2009-03-01

The classical model of visual processing emphasizes the lateral geniculate nucleus (LGN) as the major intermediary between the retina and visual cortex. Yet, anatomical findings inspired Francis Crick to suggest an alternative model in which the thalamic reticular nucleus, which envelops the LGN, acts as the "guardian" of visual cortex by modulating LGN activity. Recent work by McAlonan and colleagues supports Crick's hypothesis, thereby enhancing our understanding of the early stages of visual processing.

What tangled web: barriers to rampant horizontal gene transfer

OpenAIRE

Kurland, Charles

2005-01-01

Dawkins in his The Selfish Gene(1) quite aptly applies the term "selfish" to parasitic repetitive DNA sequences endemic to eukaryotic genomes, especially vertebrates. Doolittle and Sapienza (2) as well as Orgel and Crick (3) enlivened this notion of selfish DNA with the identification of such repetitive sequences as remnants of mobile elements such as transposons. In addition, Orgel and Crick (3) associated parasitic DNA with a potential to outgrow their host genomes by propagating ...

Challenging Liberian attitudes towards violence against women

Directory of Open Access Journals (Sweden)

June Munala

2007-01-01

Full Text Available During the 14-year long civil war, Liberia’s south-east region witnessed extreme levels of sexual violence. Without action to heighten awareness of the root causes of male violence it will not be possible to unlearn destructive notions of masculinity and machismo.

Plaswekker ook succesvol bij 5-7-jarigen met enuresis nocturna [Alarm treatment also successful in children aged 5 to 7 years with nocturnal enuresis

NARCIS (Netherlands)

Zwet, J.M.L. van; Wiertz, Y.D.B.M.; Bolk-Bennink, L.F.; Leerdam, F.J.M. van; Hirasing, R.A.

1998-01-01

Objective. To determine how many bed-wetting children aged 5-7 years unlearn the habit using the alarm treatment. Design. Descriptive. Setting. TNO Prevention and Health, Leiden, the Netherlands. Methods. The population consisted of all children aged 5 to 7 with nocturnal enuresis (defined as ≤ 2

Bivalent alkyne-bisphosphonate as clickable and solid anchor to elaborate multifunctional iron oxide nanoparticles with microwave enhancement

International Nuclear Information System (INIS)

Guénin, Erwann; Hardouin, Julie; Lalatonne, Yoann; Motte, Laurence

2012-01-01

We report the elaboration of clickable superparamagnetic nanoparticles that act as a scaffold for further modifications by click chemistry. This nano platform is easily obtained by coating iron oxide nanoparticle γ-Fe 2 O 3 , with a new bifunctional molecule (1-hydroxy-1-phosphonopent-4-ynyl)phosphonic acid (HMBPyne). The HMBP and the alkyne functions act respectively as anchoring surface group and click chemistry functionality. We evaluate the functionalization of this new “clickable” nanoplateform using Huisgen 1,3-cycloaddition as model reaction and demonstrate the potential of microwave irradiation to increase the grafting yield. The effectiveness of click chemistry for the modification of mNPs is explored with a diverse array of functional species.

Unlearning in feed-forward multi-nets

NARCIS (Netherlands)

Spaanenburg, L; Kurkova,; Steele, NC; Neruda, R; Karny, M

2001-01-01

Multi-nets promise an improved performance over monolithic neural networks by virtue of their distributed implementation. Modular neural networks are multi-nets based on an judicious assembly of functionally different parts. This can be viewed as again a monolithic network, but with more complex

Unlearning: Proposal for critic health professionals

OpenAIRE

Medina, J.L.; Clèries, X.; Nolla, M.

2007-01-01

El desaprendizaje como método reflexivo de cuestionamiento crítico de la realidad, ayuda a examinar las estructuras teóricas que cada sujeto ha asimilado, frecuentemente de manera acrítica, durante su trayectoria formativa y profesional. Este examen crítico de las formas habituales de pensar y actuar en el mundo no pretende erigirse como guía del proceso de transición hacia formas de conciencia más verdaderas y fundamentadas. Lo que se busca, por el contrario, es realizar un ejercicio constan...

Unlearning Racism: The Classroom as Community.

Science.gov (United States)

Dozier, Judy Massey

A female African American educator with dreadlocks in a class of predominantly white college students begins each semester by warning students that the terms "black" and "white" will be used regularly. She also points out factors that might inhibit speaking in class, such as white students' fears that awkward phrasing of their…

Interdisciplinarity and Hermeneutics as Pedagogical Resources for the Elaboration of Learning Projects

Directory of Open Access Journals (Sweden)

Lizbeth Teresa Villamizar Vega

2017-08-01

Full Text Available The so-called Learning Projects (AP are considered a methodological strategy conceived in the school and for the school, that must be elaborated in a school year product of a collaborative work between the educative community: students, teachers and managers, but where some teachers Have no clear idea of the linkage they can give to the syllabus contents of the subjects they teach with the learning project, they also do not know that interdisciplinarity and hermeneutics are pedagogical resources that will enable both teachers and students to seek the answer to What does their daily action mean? It is here that the need for a holistic view of the teachers who manage the different curricular units in the technical schools is recognized, where they must search through the APs That the students demonstrate their ability to grant new knowledge, instrumental functionality and usefulness to solve present and future problems that can create critical, reflective, humanistic, liberating and environmental human beings that benefit the community where they are immersed, Where the solution of the problem is solved with the interpretation of the transmitted knowledge, as well as with the new interdisciplinary competences to look for real solutions to real problems.

A Comparative Study of the Effectiveness of Two Strategies of Etymological Elaboration and Pictorial Elucidation on Idiom Learning: A Case of Young EFL Iranian Learners

Science.gov (United States)

Haghshenas, Mahsa Sadat Mousavi; Hashemian, Mahmood

2016-01-01

This study examined the effect of etymological elaboration, pictorial elucidation, and integration of these 2 strategies on idiom learning by L2 learners. A total number of 80 homogeneous intermediate learners studying English at 3 language institutes in Isfahan, Iran, were selected. The intermediate participants were selected as the result of…

Piezo-tunnel effect in Al/Al2O3/Al junctions elaborated by atomic layer deposition

Science.gov (United States)

Rafael, R.; Puyoo, E.; Malhaire, C.

2017-11-01

In this work, the electrical transport in Al/Al2O3/Al junctions under mechanical stress is investigated in the perspective to use them as strain sensors. The metal/insulator/metal junctions are elaborated with a low temperature process (≤200 °C) fully compatible with CMOS back-end-of-line. The conduction mechanism in the structure is found to be Fowler-Nordheim tunneling, and efforts are made to extract the relevant physical parameters. Gauge factors up to -32.5 were found in the fabricated devices under tensile stress. Finally, theoretical mechanical considerations give strong evidence that strain sensitivity in Al/Al2O3/Al structures originates not only from geometrical deformations but also from the variation of interface barrier height and/or effective electronic mass in the tunneling oxide layer.

A Functional analysis of the e-WAT with specific focus on the mobile ...

African Journals Online (AJOL)

user

nitive Functions: El Diccionario Inglés Español de Contabilidad. Fuertes-Olivera, P.A. and H. Bergenholtz (Eds.). 2011: 168-186. Google. 2013. Our Mobile Planet. [Online] http://think.withgoogle.com/mobileplanet/en/. Gouws, R.H. 2011. Learning, Unlearning and Innovation in the Planning of Electronic Dictionaries.

Aptitude for Destruction. Volume 1: Organizational Learning in Terrorist Groups and Its Implications for Combating Terrorism

Science.gov (United States)

2005-01-01

jihad in Af- ghanistan. Over its history, the group has had active cells in several different coun- tries, including Indonesia, Malaysia , the...and South Armagh, London, UK: Coronet Books, LIR, 2000. Hedberg, Bo, "How Organizations Learn and Unlearn?" in Paul C. Nystrim and William H. Starbuck

Initial training of Portuguese teachers and didactic elaboration of teaching contents: the case of a university in the itajaí valley

Directory of Open Access Journals (Sweden)

Ana Paula Kuczmynda Silveira

2011-04-01

Full Text Available This paper focuses on the didactic elaboration of the notion of speech genres for learning and teaching practices involving reading/listening, writing and linguistics analysis,  which emerged from supervised training projects and reports produced by undergraduate students in the end of their initial training within the context of an English/Portuguese Undergraduate Course of Modern Languages from an university located in the region of Itajaí Valley (Santa Catarina, Brazil. This research comprised the analysis of 40 training documents produced from the first semester of 2002 until the second semester of 2008. This period covers the transition between two curricular frameworks of the researched course. Within the first curricularframework, there was a remarkable concern about classifying texts according to the genre they belonged to and work was frequently guided by the classic school typology of texts (narration, description and dissertation. Within the second curricular framework, although speech genres are not often object of didactic elaboration in efect, we observed a perspective of change that may be verified in the concern about researching the speech genre with which the undergraduate student will work, and about trying to enable the student to acquire a procedimental knowledge about the genre in the articulation between reading and writing practices

Identification of an elaborate NK-specific system regulating HLA-C expression.

Directory of Open Access Journals (Sweden)

Hongchuan Li

2018-01-01

Full Text Available The HLA-C gene appears to have evolved in higher primates to serve as a dominant source of ligands for the KIR2D family of inhibitory MHC class I receptors. The expression of NK cell-intrinsic MHC class I has been shown to regulate the murine Ly49 family of MHC class I receptors due to the interaction of these receptors with NK cell MHC in cis. However, cis interactions have not been demonstrated for the human KIR and HLA proteins. We report the discovery of an elaborate NK cell-specific system regulating HLA-C expression, indicating an important role for HLA-C in the development and function of NK cells. A large array of alternative transcripts with differences in intron/exon content are generated from an upstream NK-specific HLA-C promoter, and exon content varies between HLA-C alleles due to SNPs in splice donor/acceptor sites. Skipping of the first coding exon of HLA-C generates a subset of untranslatable mRNAs, and the proportion of untranslatable HLA-C mRNA decreases as NK cells mature, correlating with increased protein expression by mature NK cells. Polymorphism in a key Ets-binding site of the NK promoter has generated HLA-C alleles that lack significant promoter activity, resulting in reduced HLA-C expression and increased functional activity. The NK-intrinsic regulation of HLA-C thus represents a novel mechanism controlling the lytic activity of NK cells during development.

Bio-Inspiered Blood-Contacting Materials Elaborated For The Heart Assist System

Directory of Open Access Journals (Sweden)

Major R.

2015-09-01

Full Text Available The paper presents the main achievements of the author on the development of blood contacting materials. The main objective of the work is to elaborate materials dedicated for the heart support systems. Appropriately designed biomaterial surfaces enable fully controlled cellular differentiation, proliferation, and even restoration of the tissue structure on solids. The paper presents two approaches to modify the surface, which can control the life processes of tissue. The first solution considers the topography in the form of cell niches. The main objective of the study is a modified surface of thin films deposited on the polymer substrate constituting the microenvironment for the cells caused by residual stress and optimized stiffness of the surface using the plasma methods. The research hypothesis was the plasma surface modification method generating a controlled contribution of residual stress in the coating affect the surface topography in the form of nano- wrinkles similar to the niches in the tissue environment. Topography and stiffness of the surface coating allows the targeted cellular differentiation. The properly formed surface topography effectively inhibits blood clotting processes. The second solution considers implementation of self-organizing feature of extracellular matrix like coatings and selective cell mobilization. The multiscale analysis and phenomenologic description were performed to experimental research. For this purpose, the deposition method was based on electrostatic interactions in polyelectrolytes. This type of cell-polymer structure imitate the native structures.

Using the Elaboration Likelihood Model to Address Drunkorexia Among College Students.

Science.gov (United States)

Glassman, Tavis; Paprzycki, Peter; Castor, Thomas; Wotring, Amy; Wagner-Greene, Victoria; Ritzman, Matthew; Diehr, Aaron J; Kruger, Jessica

2017-12-26

The many consequences related to alcohol consumption among college students are well documented. Drunkorexia, a relatively new term and area of research, is characterized by skipping meals to reduce caloric intake and/or exercising excessively in attempt to compensate for calories associated with high volume drinking. The objective of this study was to use the Elaboration Likelihood Model to compare the impact of central and peripheral prevention messages on alcohol consumption and drunkorexic behavior. Researchers employed a quasi-experimental design, collecting pre- or post-test data from 172 college students living in residence halls at a large Midwestern university, to assess the impact of the prevention messages. Participants in the treatment groups received the message in person (flyer), through email, and via a text message in weekly increments. Results showed that participants exposed to the peripherally framed message decreased the frequency of their alcohol consumption over a 30-day period (p =.003), the number of drinks they consumed the last time they drank (p =.029), the frequency they had more than five drinks over a 30-day period (p =.019), as well as the maximum number of drinks they had on any occasion in the past 30 days (p =.014). Conclusions/Importance: While more research is needed in this area, the findings from this study indicate that researchers and practitioners should design peripheral (short and succinct), rather than central (complex and detailed), messages to prevent drunkorexia and its associated behaviors.

Experimental elaboration and analysis of dye-sensitized TiO2 solar cells (DSSC) dyed by natural dyes and conductive polymers

Science.gov (United States)

KałuŻyński, P.; Maciak, E.; Herzog, T.; Wójcik, M.

2016-09-01

In this paper we propose low cost and easy in development fully working dye-sensitized solar cell module made with use of a different sensitizing dyes (various anthocyanins and P3HT) for increasing the absorption spectrum, transparent conducting substrates (vaccum spattered chromium and gold), nanometer sized TiO2 film, iodide and methyl viologen dichloride based electrolyte, and a counter electrode (vaccum spattered platinum or carbon). Moreover, some of the different technologies and optimization manufacturing processes were elaborated for energy efficiency increase and were presented in this paper.

Inversion defects in MgAl2O4 elaborated by pressureless sintering, pressureless sintering plus hot isostatic pressing, and spark plasma sintering

International Nuclear Information System (INIS)

Mussi, A.; Granger, G. Bernard; Addad, A.; Benameur, N.; Beclin, F.; Bataille, A.

2009-01-01

The distribution of inversion defects of Al was investigated in dense magnesium-aluminate spinel elaborated by pressureless sintering, pressureless sintering plus hot isostatic pressing, and spark plasma sintering. This study was conducted by energy electron loss spectroscopy analyses and more particularly by energy loss near edge structure investigations of the Al-L 2,3 edge. Several aspects are discussed with the purpose of understanding why charged defects dispersal reveals a special configuration.

Elaboration of new ceramic composites containing glass fibre production wastes

Directory of Open Access Journals (Sweden)

Rozenstrauha, I.

2013-04-01

Full Text Available Two main by-products or waste from the production of glass fibre are following: sewage sludge containing montmorillonite clay as sorbent material and ca 50% of organic matter as well as waste glass from aluminiumborosilicate glass fibre with relatively high softening temperature (> 600 ºC. In order to elaborate different new ceramic products (porous or dense composites the mentioned by-products and illitic clay from two different layers of Apriki deposit (Latvia with illite content in clay fraction up to 80-90% was used as a matrix. The raw materials were investigated by differential-thermal (DTA and XRD analysis. Ternary compositions were prepared from mixtures of 15–35 wt % of sludge, 20 wt % of waste glass and 45–65 wt % of clay and the pressed green bodies were thermally treated in sintering temperature range from 1080 to 1120 ºC in different treatment conditions. Materials produced in temperature range 1090–1100 ºC with the most optimal properties - porosity 38-52%, water absorption 39–47% and bulk density 1.35–1.67 g/cm3 were selected for production of porous ceramics and materials showing porosity 0.35–1.1%, water absorption 0.7–2.6 % and bulk density 2.1–2.3 g/cm3 - for dense ceramic composites. Obtained results indicated that incorporation up to 25 wt % of sewage sludge is beneficial for production of both ceramic products and glass-ceramic composites according to the technological properties. Structural analysis of elaborated composite materials was performed by scanning electron microscopy(SEM. By X-ray diffraction analysis (XRD the quartz, diopside and anorthite crystalline phases were detected.Durante la obtención de ciertas fibras de vidrio se generan dos subproductos o residuos principalmente: Lodo de arcilla montmorillonítica capaz de adsorber el 50 % de materia orgánica y un vidrio silicato alumínico con temperatura de reblandecimiento relativamente alta (> 600 ºC. Con el fin de elaborar nuevos

Bill Shakespeare's Blind Date.

Science.gov (United States)

Hadley, Eric

2002-01-01

Argues for the realignment of Shakespeare with the popular forms which influence the social world of young children. Explores what teachers and performers need to learn and unlearn when telling Shakespeare's stories in the company of children. Considers the grounds of creativity for teachers when abandoning prescription in teaching Shakespeare.…

Equal Partners. Austin Teenagers Learn To Expect Respect in Dating Relationships.

Science.gov (United States)

Harrison, Mary M.

1997-01-01

Describes the Teen Dating Violence Project, a 24-week program in the Austin (Texas) schools that offers single sex support groups for young men and women involved in violent relationships. Learning to build equitable and respectful relationships often involves unlearning gender stereotypes, but the program shows that attitudes can change. (SLD)

The Journey To Become a White Ally. Ideas for Training Staff.

Science.gov (United States)

Carter, Margie

2001-01-01

Discusses combating racism in white and black co-worker relationships. Suggests engaging in self-examination, critical thinking, and actions such as building and maintaining genuine relationships, committing to an anti-racist group focused on unlearning racism, monitoring how one thinks and acts, and shifting the center by sharing power and…

Stability of gluten free sweet biscuit elaborated with rice bran, broken rice and okara

Directory of Open Access Journals (Sweden)

Bruna Oliveira TAVARES

2016-01-01

Full Text Available Abstract A challenge to the food sector has been the development of new products incorporating co-products from the food processing industry with minimal impact on their pre-determined structures and adding nutritional quality. In order to add value and develop alternatives for the use of co-products generated during the agroindustrial processing, this work aimed to study the stability of gluten-free sweet biscuits developed with soybean okara, rice bran and broken rice. The formulations were elaborated with increasing percentages of these ingredients and compared with the standard (commercial sweet biscuit for ten months. The analyses were: weight, diameters (internal and external, thickness, specific volume, instrumental parameters of color, texture, scanning electron microscopy, water activity, proximal composition and isoflavones. The experimental sweet biscuits had characteristics of color, weight, volume and diameters (internal and external very similar to the commercial, whereas texture, lipids and energy value decreased, and aw, moisture and protein increased during storage. The sweet biscuits showed the same stability when compared to the standard, and the

Oral melanocytic nevi: Report of two cases with immunohistochemical elaboration of their probable origin and maturation

Directory of Open Access Journals (Sweden)

Dipti Dutta

2015-01-01

Full Text Available Oral melanocytic nevi are localized developmental tissue malformations of nevus cells in the oral mucosa. Relatively rare in occurrence compared to their dermal counterparts, considerable debate exists in the literature related to their origin, development and maturation, and their relationship to oral melanocytes.We report two cases of oral melanocytic nevi with classical clinical presentation. The histopathology was consistent with the known patterns of oral melanocytic nevi. Special stains such as Masson Fontana, further substantiated the observation. S-100 and HMB-45 were applied to immunohistochemically elaborate the cell population. Interestingly two distinct cell populations were detected in the lesions. "Type A" cells in the center of the lesion were S-100 positive, indicating a neural origin and immaturity in development, while peripheral "type B" cells stained positive with HMB-45, indicating melanocytic origin and mature development.

nPEG-TiO₂ nanoparticles: a facile route to elaborate nanostructured surfaces for biological applications.

Science.gov (United States)

Spadavecchia, J; Boujday, S; Landoulsi, J; Pradier, C-M

2011-07-01

We report the synthesis of diacid-terminated PEG-functionalized cubic TiO(2) nanocrystals by a simple one-step solvothermal method, and their further use to form nanostructured surfaces for protein immobilization. The relevance and major interest of the so-obtained nanocrystals are the presence of terminal carboxylic acid groups at their surface, as confirmed by infrared analyses, in addition to the surrounding PEG chains, essential to avoid non specific interactions. These functional chemical groups were used to (i) immobilize the synthesized nanocubes on a cysteamine-modified Au surface, and to (ii) attach proteins via a presumable covalent link. AFM images show that the shapes and the narrow size distribution of the nanocubes, observed by TEM, were preserved after their immobilization on the modified Au surface. Moreover, the efficiency and specificity of antigen recognition were demonstrated using spectroscopic analyses. Our successful approach provides a versatile and facile way to elaborate specific and sensitive nanostructured surfaces for biosensors.

The discovery of the structure of DNA

Science.gov (United States)

Squires, G. L.

2003-04-01

On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

The ATEE action during the drawing up of regulatory texts; L`action de l`ATEE lors de l`elaboration des textes reglementaires

Energy Technology Data Exchange (ETDEWEB)

Jacubowiez, I. [Groupe de Travail Environnement de ATEE, Association Technique Energie Environnement, 94 - Arcueil (France)

1997-12-31

The role of the French Energy Environment Technical Association (ATEE) is to promote the rational and efficient use of energies. In this context, the ATEE participated to the elaboration of regulatory text and in particular to the revision of the nomenclature of classified installations and to the decrees proceeding from the clean air acts and from the rational use of energy. This paper describes the action of the ATEE carried out in both topics. (J.S.)

Predicting and Modeling RNA Architecture

Science.gov (United States)

Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

2011-01-01

SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963