
Sample records for einsteinium 252

  1. Free ion spectroscopy of einsteinium and comments on fermium

    International Nuclear Information System (INIS)

    Conway, J.G.


    The spectroscopy of einsteinium is presented and other relevant atomic data are cited to give an understanding of the status of that element. Information on the continuing work on einsteinium is given. A few comments on fermium are made. 6 figures, 1 table

  2. Henry's Law vaporization studies and thermodynamics of einsteinium-253 metal dissolved in ytterbium

    International Nuclear Information System (INIS)

    Kleinschmidt, P.D.; Ward, J.W.; Matlack, G.M.; Haire, R.G.


    The cohesive energy of metallic einsteinium determines whether einsteinium is a trivalent or divalent metal. The enthalpy of sublimation, a measure of the cohesive energy, is calculated from the partial pressures of einsteinium over an alloy. The partial pressure of 253 Es has been measured over the range 470--870 K, using combined target and mass spectrometric Knudsen effusion techniques. An alloy was prepared with einsteinium dissolved in a ytterbium solvent to produce a very dilute solution. Partial pressure measurements on the alloy were amenable to the experimental technique and a data analysis using a Henry's law treatment of the data. Vapor pressure data are combined with an estimated crystal entropy S 0 298 and ΔC 0 /sub p/ for ytterbium, to produce enthalpy, entropy, and free energy functions from 298 to 1300 K. The vapor pressure of einsteinium in a dilute einsteinium--ytterbium alloy is described by the equation log P(atm) = -(6815 +- 216)/T+2.576 +- 0.337, from which we calculate for the enthalpy of sublimation of pure einsteinium ΔH 0 298 (second law) = 31.76 kcal/mol. The value of the enthalpy of sublimation is consistent with the conclusion that Es is a divalent metal

  3. Reactor production of 252Cf and transcurium isotopes

    International Nuclear Information System (INIS)

    Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.


    Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs

  4. 5f state interaction with inner coordination sphere ligands: einsteinium 3+ ion fluorescence in aqueous and organic phases

    International Nuclear Information System (INIS)

    Beitz, J.V.; Wester, D.W.; Williams, C.W.


    The interaction between 5f electron states of einsteinium 3+ ion and coordinated ligands in solution has been probed using laser-induced fluorescence. Aquo einsteinium 3+ ion was observed to fluoresce from its first excited J = 5 state in a broad-band peaking at 9260 wavenumbers. The observed fluorescence lifetimes were 1.05 microseconds and 2.78 microseconds in H 2 O and D 2 O (99+ % D atom), respectively. The non-radiative decay rates derived from the lifetime data are compared with previously reported data for Cm, Sm, Eu, Tb, and Dy aquo 3+ ions. The 5f actinide states exhibit substantially greater non-radiative decay rates than do lanthanide 4f states of similar energy gap. This provides evidence that actinide 5f electrons interact more strongly with their inner coordination sphere than do lanthanide ion 4f electrons. The fluorescence lifetime of einsteinium 3+ ion complexed with 1 formal di(2-ethylhexyl)orthophosphoric acid in h-heptane was 2.34 microseconds. 3 figures, 1 table

  5. Electron-capture delayed fission properties of neutron-deficient einsteinium nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Shaughnessy, Dawn A. [Univ. of California, Berkeley, CA (United States)


    Electron-capture delayed fission (ECDF) properties of neutron-deficient einsteinium isotopes were investigated using a combination of chemical separations and on-line radiation detection methods. 242Es was produced via the 233U(14N,5n)242Es reaction at a beam energy of 87 MeV (on target) in the lab system, and was found to decay with a half-life of 11 ± 3 seconds. The ECDF of 242Es showed a highly asymmetric mass distribution with an average pre-neutron emission total kinetic energy (TKE) of 183 ± 18 MeV. The probability of delayed fission (PDF) was measured to be 0.006 ± 0.002. In conjunction with this experiment, the excitation functions of the 233U(14N,xn)247-xEs and 233U(15N,xn)248-xEs reactions were measured for 243Es, 244Es and 245Es at projectile energies between 80 MeV and 100 MeV.

  6. Electron-capture delayed fission properties of neutron-deficient einsteinium nuclei

    International Nuclear Information System (INIS)

    Shaughnessy, Dawn A.


    Electron-capture delayed fission (ECDF) properties of neutron-deficient einsteinium isotopes were investigated using a combination of chemical separations and on-line radiation detection methods. 242 Es was produced via the 233 U( 14 N,5n) 242 Es reaction at a beam energy of 87 MeV (on target) in the lab system, and was found to decay with a half-life of 11 ± 3 seconds. The ECDF of 242 Es showed a highly asymmetric mass distribution with an average pre-neutron emission total kinetic energy (TKE) of 183 ± 18 MeV. The probability of delayed fission (P DF ) was measured to be 0.006 ± 0.002. In conjunction with this experiment, the excitation functions of the 233 U( 14 N,xn) 247-x Es and 233 U( 15 N,xn) 248-x Es reactions were measured for 243 Es, 244 Es and 245 Es at projectile energies between 80 MeV and 100 MeV

  7. Californium-252

    International Nuclear Information System (INIS)


    This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)

  8. Oxidation-reduction properties of americium, curium, berkelium, californium, einsteinium and fermium, and thermodynamic consequences for the 5f series

    International Nuclear Information System (INIS)

    Samhoun, K.


    The amalgamation of 5f elements from Am to Fm has been studied by using 241 Am, 244 Cm, 249 Bk, 249 Cf, 252 Cf, 253 Es, 254 Es, 252 Fm and 255 Fm with two electrochemical methods, radiocoulometry and radiopolarography, perfectly adapted to investigate extremely diluted solutions when the concentration of electroactive species is as low as 10 -16 M. The theory of radiocoulometry has been developed in the general cases of reversible and irreversible electrode process. It has been used to interpret the experimental data on the kinetic curves of amalgamation, and to estimate the standard rate constant of the electrode process in complexing medium (citric). On the other hand the radiopolarographic method has been applied to study the mechanism of reduction at the dropping mercury electrode of cations M 3+ in aqueous medium to the metal M with formation of amalgam. The results are exploited into two directions: 1- Acquisition of some data concerning the oxidation-reduction properties of elements from Am to Fm. Therefore the standard electrode E 0 [M(III-0)] potentials for Bk, Cf and Es, and the standard electrode E 0 [M(II-0)] potential for Fm are estimated and the relative stability of each oxidation state (from II to VII) of 5f elements is discussed; 2- Acquisition of unknown thermodynamic data on transcalifornium elements. Correlations between 4f and 5f elements are precised and some divergences appear for the second half of 4f and 5f series (i.e. for 65 [fr

  9. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  10. 14 CFR 252.9 - Ventilation systems. (United States)


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...

  11. 15 CFR 25.2 - Definitions. (United States)


    ... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...

  12. 7 CFR 3565.252 - Housing types. (United States)


    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...

  13. Graphite moderated 252Cf source

    International Nuclear Information System (INIS)

    Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.


    The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

  14. Radionuclide 252Cf neutron source

    International Nuclear Information System (INIS)

    Kolevatov, Yu.I.; Trykov, L.A.


    Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV

  15. Californium-252 radiotherapy sources for interstitial afterloading

    International Nuclear Information System (INIS)

    Permar, P.H.; Walker, V.W.


    Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute

  16. 48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...

  17. 40 CFR 265.252 - Waste analysis. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...

  18. 7 CFR 252.3 - Administration. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...

  19. 46 CFR 252.13 - Contract. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...

  20. 48 CFR 252.217-7009 - Default. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...

  1. 48 CFR 252.217-7010 - Performance. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...

  2. Medical applications of californium-252

    International Nuclear Information System (INIS)

    Oliver, G.D. Jr.


    Primarily, californium-252 sources have been utilized in medicine for the treatment of neoplastic lesions. For five years, a coordinated effort between several cancer research institutions and national laboratories has developed the necessary physics, radiobiology, and engineering skills to establish an evaluation program for californium. Several more years of combined effort are required before it is known whether californium therapy is as good as or better than conventional therapy with sources like radium. Recently, development of diagnostic applications of californium in medicine has received attention. Studies comparing neutron decay activation analysis versus prompt capture gamma ray analysis are in progress. A hopeful application of prompt analysis with reasonable quantities (200 μg) of californium is the elemental analysis of bone in the human body. (U.S.)

  3. Californium-252: a remarkable versatile radioisotope

    International Nuclear Information System (INIS)

    Osborne-Lee, I.W.; Alexander, C.W.


    A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein

  4. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.


    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  5. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)


    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  6. Dicty_cDB: SLH252 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC

  7. 27 CFR 25.252 - Records. (United States)


    ... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...

  8. 46 CFR 252.31 - Wages of officers and crews. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...

  9. 46 CFR 252.33 - Hull and machinery insurance. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...

  10. 48 CFR 252.217-7002 - Offering property for exchange. (United States)


    ... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...

  11. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    Stoddard, D.H.


    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  12. 48 CFR 252.231-7000 - Supplemental cost principles. (United States)


    ... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...

  13. Crystal and solution spectroscopy of einsteinium

    International Nuclear Information System (INIS)

    Carnall, W.T.


    Work on spectra and electronic structure of Es 3+ is reviewed. Laser-excited fluorescence spectroscopy was used to study Es 3+ -doped LaCl 3 crystals; fluorescence transitions and lifetimes were determined. A complete ground-state splitting diagram was also constructed for Es 3+ : LaCl 3 . Some data on excited states of Fm 3+ are also included. 12 figures

  14. Graphite moderated {sup 252}Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)


    The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

  15. Radiography using californium-252 neutron sources

    International Nuclear Information System (INIS)

    Ray, J.W.


    The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)

  16. Californium Cf-252 for pelvic radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J


    Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.

  17. Health physics aspects of 252Cf

    International Nuclear Information System (INIS)

    Bhagwat, A.M.


    After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)

  18. Neutron shielding for a 252 Cf source

    International Nuclear Information System (INIS)

    Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente


    To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

  19. NAA using Cf-252 after preconcentration

    International Nuclear Information System (INIS)

    Panyo, O.; Moebius, S.; Keller, C.


    Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn

  20. 48 CFR 252.235-7002 - Animal welfare. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...

  1. 48 CFR 252.217-7001 - Surge option. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...

  2. 48 CFR 252.237-7011 - Preparation history. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...

  3. 48 CFR 252.229-7001 - Tax relief. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...

  4. 48 CFR 252.217-7016 - Plant protection. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...

  5. 48 CFR 252.227-7000 - Non-estoppel. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...

  6. 46 CFR 252.23 - Financial and other reporting requirements. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...

  7. DWH MC 252: Subsurface Oil Transport (United States)

    Beegle-Krause, C. J.; Boyer, T.; Murray, D.


    Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations

  8. Californium-252 sales and loans at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    King, L.J.


    The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

  9. Californium-252 interstitial implants in carcinoma of the tongue

    International Nuclear Information System (INIS)

    Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.


    A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy

  10. True ternary fission of 252Cf

    International Nuclear Information System (INIS)

    Vijayaraghavan, K.R.; Balasubramaniam, M.; Oertzen, W. von


    Splitting of heavy radioactive nucleus into three fragments is known as ternary fission. If the size of the fragments are almost equal it is referred to as true ternary fission. Recently, Yu. V. Pyatkov et al observed/reported the experimental observation of true ternary fission in 252 Cf. In this work, the possibilities of different true ternary fission modes of 252 Cf through potential energy surface (PES) calculations based on three cluster model (TCM) are discussed. In TCM a condition on the mass numbers of the fission fragments is implied as A 1 ≥ A 2 ≥ A 3 in order to avoid repetition of combinations. Due to this condition, the values of Z 3 vary from 0 to 36 and Z 2 vary from 16 to 51. Of the different pairs having similar (Z 2 , Z 3 ) with different potential energy, a pair possessing minimum potential energy is chosen. Thus identified favourable combinations are plotted. For the PES calculations the arrangement of the fragments is considered in the order of A 1 +A 2 +A 3 . i.e. the heavy and the lightest fragments are kept at the ends. It is seen that the deepest minimum in the PES occurs for Z 3 =2 labelled as (Z 2 ; 2) indicating He accompanied breakup as the most favourable one. Of which, the breakup with Z 2 around 46 to 48 is the least (shown by dashed (Z 1 = 50) and dotted (Z 1 = 52) lines indicating a constant Z 1 value). The other notable minima in the PES are labelled and they correspond to the (Z 2 , Z 3 ) pairs viz., (20, 20), (28, 20), (28, 28) and (32, 32). Of these four minima, the first three are associated with the magic numbers 20 and 28. For Z 3 =20, there are two minimums at (20,20) and (28,20) among them (28,20) is the lowest minimum through which the minimum-path passes, and it is the ternary decay observed by Yu. V. Pyatkov et al. The fourth minima is the most interesting due to the fact that it corresponds to true ternary fission mode with Z 2 =32, Z 3 =32 and Z 1 =34. The minimum potential energy path also goes through this true

  11. System control for the modulated 252Cf source ''Shuffler''

    International Nuclear Information System (INIS)

    Stephens, M.M.


    The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)

  12. Prompt neutron spectrum of the spontaneous fission of californium-252

    International Nuclear Information System (INIS)

    Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.


    The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

  13. Survey of potential markets for devices using Californium-252

    International Nuclear Information System (INIS)

    Permar, P.H.


    Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US

  14. 24 CFR 252.2 - GNMA right to assignment. (United States)


    ... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...

  15. A survey of uses and users of 252Cf

    International Nuclear Information System (INIS)

    Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.


    Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL

  16. Laboratory-scale shielded cell for 252Cf

    International Nuclear Information System (INIS)

    Anderl, R.A.; Cargo, C.H.


    A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms

  17. Application of californium-252 neutron sources for analytical chemistry

    International Nuclear Information System (INIS)

    Ishii, Daido


    The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)

  18. Teratogenic effect of Californium-252 irradiation in rats

    International Nuclear Information System (INIS)

    Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro


    The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)

  19. Ternary-fragmentation-driving potential energies of 252Cf (United States)

    Karthikraj, C.; Ren, Zhongzhou


    Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

  20. Determination of disintegration half-life of 252Cf

    International Nuclear Information System (INIS)

    Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen


    The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results

  1. Neutron emission during acceleration of 252Cf fission fragments

    International Nuclear Information System (INIS)

    Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.


    We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

  2. 48 CFR 252.227-7033 - Rights in shop drawings. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...

  3. Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 delayed whole p

  4. 48 CFR 252.237-7007 - Termination for default. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...

  5. 48 CFR 252.237-7017 - Individual laundry. (United States)


    ... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...

  6. 48 CFR 252.234-7002 - Earned Value Management System. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...

  7. 46 CFR 252.40 - Payment of subsidy. (United States)


    ... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...

  8. INAA using 252Cf neutron source at University of Pune

    International Nuclear Information System (INIS)

    Rajurkar, N.S.


    The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)

  9. 48 CFR 252.225-7041 - Correspondence in English. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...

  10. Characteristics of polyethylene-moderated 252Cf neutron sources

    International Nuclear Information System (INIS)

    Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.


    Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data

  11. 50 CFR 216.252 - Permissible methods of taking. (United States)


    ... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...

  12. 48 CFR 252.228-7001 - Ground and flight risk. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...

  13. 48 CFR 252.229-7002 - Customs exemptions (Germany). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...

  14. 48 CFR 252.225-7020 - Trade Agreements Certificate. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...

  15. 48 CFR 252.229-7005 - Tax exemptions (Spain). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...

  16. 48 CFR 252.227-7020 - Rights in special works. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...

  17. 48 CFR 252.237-7005 - Performance and delivery. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...

  18. 48 CFR 252.227-7005 - License term. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...

  19. 48 CFR 252.247-7017 - Erroneous shipments. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...

  20. Fabrication of californium-252 sources in the United Kingdom

    International Nuclear Information System (INIS)

    Ainsworth, A.; Brady, M.W.; Thornett, W.H.


    The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)

  1. Production, Distribution, and Applications of Californium-252 Neutron Sources

    International Nuclear Information System (INIS)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.


    The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations

  2. 7 CFR 766.252 - Unauthorized assistance resulting from submission of false information. (United States)


    ... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...

  3. 48 CFR 252.225-7025 - Restriction on acquisition of forgings. (United States)


    ... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...

  4. 48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam. (United States)


    ... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...

  5. 48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting. (United States)


    ... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...

  6. 48 CFR 252.236-7000 - Modification proposals-price breakdown. (United States)


    ...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...

  7. 48 CFR 252.225-7031 - Secondary Arab boycott of Israel. (United States)


    ... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...

  8. 24 CFR 92.252 - Qualification as affordable housing: Rental housing. (United States)


    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...

  9. 48 CFR 252.222-7002 - Compliance with local labor laws (overseas). (United States)


    ... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...

  10. 48 CFR 252.235-7011 - Final scientific or technical report. (United States)


    ... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...

  11. 38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods. (United States)


    ...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...

  12. 24 CFR 252.6 - Method of payment of mortgage insurance premiums. (United States)


    ... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...

  13. 24 CFR 207.252e - Method of payment of mortgage insurance premiums. (United States)


    ... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...

  14. 24 CFR 236.252 - First, second, and third mortgage insurance premiums. (United States)


    ... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...

  15. Evaluation of mass distribution data from 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Liu Tingjin


    The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)

  16. Effective source size as related to 252Cf neutron radiography

    International Nuclear Information System (INIS)

    Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.


    The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)

  17. Shielding experiments in different materials with 252Cf neutron spectra

    International Nuclear Information System (INIS)

    Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.


    Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)

  18. A pneumatic transfer system for special form 252Cf

    International Nuclear Information System (INIS)

    Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.


    A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole

  19. Mass spectrometry with ionization induced by 252Cf fission fragments

    International Nuclear Information System (INIS)

    Sysoev, A.A.; Artaev, V.B.


    The review deals with mass-spectrometry with ionization induced by 252 Cf fission fragments. Equipment and technique of the analysis, analytic possibilities of the method are considered. The method permits to determine molecular masses of large nonvolatile biological molecules. The method is practically nondestructive, it possesses a high resolution over the depth and surface, which permits to use it for the analysis of surface of semiconductors, dielectrics, catalysts, for the study of formation kinetics of complex unstable molecules on the surface

  20. Rotation and Morphology of Comet 252P/LINEAR (United States)

    Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.


    Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.

  1. Neutron shielding for a {sup 252} Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail:


    To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

  2. Undergraduate experiments using the neutron radiation from californium-252

    International Nuclear Information System (INIS)

    Rossel, J.; Golecki, I.


    Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)

  3. Neutron activation analysis detection limits using 252Cf sources

    International Nuclear Information System (INIS)

    DiPrete, D.P.; Sigg, R.A.


    The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

  4. Thermocoagulation of lumbar facet joints: Experience in 252 patients


    Martínez-Suárez, J. E.; Camblor, L.; Salva, S.; Jongh, W. A. de


    Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor. Two hundred fifty two patients with diagnosis of l...

  5. The fast neutron emission spectrum of 252-Cf

    International Nuclear Information System (INIS)

    Bensch, F.


    The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement

  6. Trajectory calculations for the ternary cold fission of 252Cf

    International Nuclear Information System (INIS)

    Misicu, S.


    We compute the final kinetic energies of the fragments emitted in the light charged particle accompanied by cold fission of 252 Cf taking into account the deformation and the finite-size effects of the fragments and integrating the equations of motion for a three-body system subjected only to Coulomb forces. The initial conditions for the trajectory calculations were derived in the framework of a deformed cluster model which includes also the effect due to the absorbative nuclear part. Although the distributions of initial kinetic energies are rather broad we show that in cold fission the initial conditions can be better determined than in the usual spontaneous fission

  7. Radiation ulcers in patients with cancer of the torgue after 252Cf therapy

    International Nuclear Information System (INIS)

    Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.


    Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf

  8. Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy

    Energy Technology Data Exchange (ETDEWEB)

    Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)


    Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.

  9. Termocoagulación facetaria lumbar: Experiencia en 252 pacientes Thermocoagulation of lumbar facet joints: Experience in 252 patients


    J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh


    Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...

  10. A 252Cf based nondestructive assay system for fissile material

    International Nuclear Information System (INIS)

    Menlove, H.O.; Crane, T.W.


    A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)

  11. Physical and biological dosimetries of Cf-252 radiation

    International Nuclear Information System (INIS)

    Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo


    Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)

  12. 48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements. (United States)


    .... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...

  13. 48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings. (United States)


    ... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...

  14. 48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property. (United States)


    ... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...

  15. 48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330). (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...

  16. 50 CFR 14.252 - What definitions do I need to know? (United States)


    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...

  17. 48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan. (United States)


    ... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...

  18. 48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan. (United States)


    ... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...

  19. 48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan. (United States)


    ... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...

  20. 30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD? (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...

  1. 48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement. (United States)


    ....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...

  2. 48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain). (United States)


    ... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...

  3. 48 CFR 252.227-7027 - Deferred ordering of technical data or computer software. (United States)


    ... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...

  4. 48 CFR 252.227-7026 - Deferred delivery of technical data or computer software. (United States)


    ... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...

  5. 48 CFR 252.227-7012 - Patent license and release contract. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...

  6. 48 CFR 252.225-7044 - Balance of Payments Program-Construction Material. (United States)


    ... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...

  7. Average cross sections for the 252Cf neutron spectrum

    International Nuclear Information System (INIS)

    Dezso, Z.; Csikai, J.


    A number of average cross sections have been measured for 252 Cf neutrons in (n, γ), (n,p), (n,2n), (n,α) reactions by the activation method and for fission by fission chamber. Cross sections have been determined for 19 elements and 45 reactions. The (n,γ) cross section values lie in the interval from 0.3 to 200 mb. The data as a function of target neutron number increases up to about N=60 with minimum near to dosed shells. The values lie between 0.3 mb and 113 mb. These cross sections decrease significantly with increasing the threshold energy. The values are below 20 mb. The data do not exceed 10 mb. Average (n,p) cross sections as a function of the threshold energy and average fission cross sections as a function of Zsup(4/3)/A are shown. The results obtained are summarized in tables

  8. 252Cf-source-driven neutron noise analysis method

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; King, W.T.; Blakeman, E.D.


    The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables

  9. Design, Construction, and Modeling of a 252Cf Neutron Irradiator

    Directory of Open Access Journals (Sweden)

    Blake C. Anderson


    Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.

  10. A californium-252 source for radiobiological studies at Hiroshima University

    International Nuclear Information System (INIS)

    Kato, Kazuo; Takeoka, Seiji; Kuroda, Tokue; Tsujimura, Tomotaka; Kawami, Masaharu; Hoshi, Masaharu; Sawada, Shozo


    A 1.93 Ci (3.6 mg) californium-252 source was installed in the radiation facility of the Research Institute for Nuclear Medicine and Biology, Hiroshima University. This source produces fission neutrons (8.7 x 10 9 n/s at the time of its installation), which are similar to neutron spectrum of the atomic bombs. It is useful for studying biological effects of fission neutrons and neutron dosimetry. An apparatus was dosigned to accomodate this source and to apply it to such studies. It has resulted in profitable fission neutron exposures, while suppressing scattered neutrons and secondary gamma rays. This apparatus incorporates many safety systems, including one which interlocks with all of doors and an elevator serving the exposure room, so as to prevent accidents involving users. (author)

  11. Brachytherapy of carcinoma of vulva with 252Cf

    International Nuclear Information System (INIS)

    Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.


    Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment

  12. The status of low dose rate and future of high dose rate Cf-252 brachytherapy

    International Nuclear Information System (INIS)

    Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.


    This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly

  13. 24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act. (United States)


    .... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...

  14. 48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts). (United States)


    ... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...

  15. Use of californium-252 sources in Hungary for teaching and research

    International Nuclear Information System (INIS)

    Csikai, J.


    An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)

  16. Determination of the average number of neutrons per fission event for californium-252

    International Nuclear Information System (INIS)

    Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.


    By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)

  17. Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas

    International Nuclear Information System (INIS)

    Maruyama, J.; Beach, J.L.; Nagell, J.R. van


    Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de

  18. 252Cf-source-driven neutron noise analysis method

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; King, W.T.; Blakeman, E.D.


    The 252 Cf-source-driven neutron noise analysis method has been tested in a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor k/sub eff/ has been satisfactorily detemined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments oriented toward particular applications including dynamic experiments and the development of theoretical methods to predict the experimental observables

  19. Charge distribution in the ternary fragmentation of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)


    We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)

  20. Neutron gauging applications using a small 252Cf source

    International Nuclear Information System (INIS)

    Helf, S.


    The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)

  1. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

    International Nuclear Information System (INIS)

    Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik


    Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated

  2. 48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals. (United States)


    ... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...

  3. Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University

    International Nuclear Information System (INIS)

    Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.


    This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)

  4. Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources

    Energy Technology Data Exchange (ETDEWEB)

    Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.

  5. 8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war. (United States)


    ... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...

  6. K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase

    International Nuclear Information System (INIS)

    Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.


    Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase

  7. Functional design criteria for project W-252, phase II liquid effluent treatment and disposal. Revision 2

    International Nuclear Information System (INIS)

    Hatch, C.E.


    This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams

  8. Automated absolute activation analysis with californium-252 sources

    International Nuclear Information System (INIS)

    MacMurdo, K.W.; Bowman, W.W.


    A 100-mg 252 Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17 O. Detection sensitivities of 239 Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level

  9. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I


    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  10. Long-term effects of an intracavitary treatment with californium-252 on normal tissue

    International Nuclear Information System (INIS)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.


    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra

  11. Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    Martin, R.C.; Laxson, R.R.; Knauer, J.B.


    The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests

  12. Implementation of 252Cf-source-driven power spectrum density measurement system

    International Nuclear Information System (INIS)

    Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming


    The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)

  13. Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum

    International Nuclear Information System (INIS)

    Mannhart, W.


    After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)

  14. Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose

    Energy Technology Data Exchange (ETDEWEB)

    Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)


    {sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.

  15. 48 CFR 252.229-7009 - Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). (United States)


    ... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on Fuel...

  16. 48 CFR 252.216-7000 - Economic price adjustment-basic steel, aluminum, brass, bronze, or copper mill products. (United States)


    ...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...

  17. 48 CFR 252.232-7005 - Reimbursement of subcontractor advance payments-DoD pilot mentor-protege program. (United States)


    ... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...

  18. 48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program. (United States)


    ... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...

  19. 48 CFR 252.225-7035 - Buy American Act-Free Trade Agreements-Balance of Payments Program Certificate. (United States)


    ... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...

  20. Prompt neutron energy spectrum for the spontaneous fission of Cf-252

    International Nuclear Information System (INIS)

    Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.


    The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)

  1. 48 CFR 252.227-7007 - License term-running royalty. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...

  2. 48 CFR 252.227-7006 - License grant-running royalty. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...

  3. 48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software. (United States)


    ..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...

  4. 48 CFR 252.227-7037 - Validation of restrictive markings on technical data. (United States)


    .... However, this clause neither creates nor implies privity of contract between the Government and... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7037 Validation of restrictive markings on... following clause: Validation of Restrictive Markings on Technical Data (SEP 1999) (a) Definitions. The terms...

  5. Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)


    We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.

  6. 48 CFR 252.219-7004 - Small business subcontracting plan (test program). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...

  7. 48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...

  8. 48 CFR 252.222-7004 - Compliance with Spanish social security laws and regulations. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.222-7004 Compliance with Spanish social... Spanish Social Security Laws and Regulations (JUN 1997) (a) The Contractor shall comply with all Spanish...

  9. 48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN 1997...

  10. 48 CFR 252.229-7011 - Reporting of Foreign Taxes-U.S. Assistance Programs. (United States)


    ... all value added taxes and customs duties imposed by the recipient country. This exemption is in... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reporting of Foreign Taxes... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.229-7011 Reporting of Foreign Taxes—U.S...

  11. 48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...

  12. 48 CFR 252.242-7004 - Material management and accounting system. (United States)


    ... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...

  13. Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf

    International Nuclear Information System (INIS)

    Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.


    The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented

  14. Determination of kinetics parameters using stochastic methods in a 252Cf system

    International Nuclear Information System (INIS)

    Difilippo, F.C.


    Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons

  15. Study of the shielding for spontaneous fission sources of Californium-252

    International Nuclear Information System (INIS)

    Davila R, I.


    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  16. An evaluation of the spontaneous fission prompt neutron spectrum of 252Cf

    International Nuclear Information System (INIS)

    Bojkov, G.S.; Yurevich, V.I.


    An evaluation of the spontaneous fission prompt neutron spectrum of 252 Cf from 1 keV to 20 MeV is described. Variance-covariance matrices for a number of recent experimental data sets were constructed and used to evaluate the neutron spectrum following a Bayesian procedure. The evaluated spectrum is compared with various experimental and theoretical representations. (author)

  17. Analysis of geological material and especially ores by means of a 252Cf source

    International Nuclear Information System (INIS)

    Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.


    Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses

  18. 48 CFR 252.228-7006 - Compliance with Spanish laws and insurance. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... CLAUSES Text of Provisions And Clauses 252.228-7006 Compliance with Spanish laws and insurance. As prescribed at 228.370(e), use the following clause: Compliance with Spanish Laws and Insurance (DEC 1998) (a...

  19. 48 CFR 252.228-7000 - Reimbursement for war-hazard losses. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...

  20. Assessment of the neutron component in a neutron-gamma field of a californium-252 source

    International Nuclear Information System (INIS)

    Tetteh, G.K.


    Experiments have been performed to determine the percentages of the different components in the radiation field of californium-252 which has now some clinical applications. Using Rossi Chambers in conjunction with absorption investigations involving lead and aluminium thimbles, it is observed that the dose rates due to the different components are: neutrons 54%; gammas 30%; betas 16%

  1. 48 CFR 252.225-7022 - Trade agreements certificate-inclusion of Iraqi end products. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade agreements... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.225-7022 Trade agreements certificate—inclusion of Iraqi end products. As prescribed in 225.1101(7), use the following provision: Trade Agreements...

  2. 48 CFR 252.227-7021 - Rights in data-existing works. (United States)


    ... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...

  3. The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR) (United States)

    Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco


    Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state

  4. Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

    KAUST Repository

    Koo, Hyunmin; Mojib, Nazia; Huang, Jonathan P.; Donahoe, Rona J.; Bej, Asim K.


    In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

  5. Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

    KAUST Repository

    Koo, Hyunmin


    In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

  6. Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source

    International Nuclear Information System (INIS)

    Silva, Ademir X. da; Crispim, Verginia R.


    This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)

  7. Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe

    International Nuclear Information System (INIS)

    Chien Chung; Jiunnhsing Chao


    Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements

  8. Dispersions and correlations of the distributions of products of 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Vidyakin, G.S.; Vyrodov, V.N.; Gurevich, I.I.; Kirillov, B.F.; Kozlov, Y.V.; Martem'yanov, V.P.; Sukhotin, S.V.; Tarasenkov, V.G.; Khakimov, S.K.


    We report the results of two experiments on study of the dispersions and correlations of the distributions of products of the spontaneous fission of 252 Cf. In each experiment about 10 8 fissions were recorded with simultaneous measurement of the number of neutrons produced and in one case the fragment kinetic energy and in the other case the energy of the prompt #betta# rays. The quantities obtained were the probabilities of production of a given number of neutrons per fission, the dispersions of the distributions of the number of neutrons produced and of the fragment kinetic energy, and the dependence of the average #betta#-ray energy and the average fragment kinetic energy on the number of neutrons produced. A calculation is made of the spectrum of the total energy carried away by fragments and neutrons, and its dispersion is determined. An estimate of the total energy release in the 252 Cf fission process is made

  9. Molecular weight determination of bisbenzyl-isoquinoline alkaloids by 252Cf-plasma desorption mass spectrometer

    International Nuclear Information System (INIS)

    Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao


    Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)

  10. Frequency spectrum analysis of 252Cf neutron source based on LabVIEW

    International Nuclear Information System (INIS)

    Mi Deling; Li Pengcheng


    The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)

  11. Determining {sup 252}Cf source strength by absolute passive neutron correlation counting

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)


    Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.

  12. The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement

    International Nuclear Information System (INIS)

    Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan


    The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)

  13. Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy

    International Nuclear Information System (INIS)

    Maruyama, Y.


    The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)

  14. Cf-252 based neutron radiography using real-time image processing system

    International Nuclear Information System (INIS)

    Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka


    For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)

  15. Power spectral density measurements with 252Cf for a light water moderated research reactor

    International Nuclear Information System (INIS)

    King, W.T.; Mihalczo, J.T.


    A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented

  16. Test and evaluation results of the 252Cf shuffler at the Savannah River Plant

    International Nuclear Information System (INIS)

    Crane, T.W.


    The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant

  17. Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields

    Directory of Open Access Journals (Sweden)

    Simakov Stanislav


    Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.

  18. A Phase I/II Protocol Using 252Cf for the Treatment of Cervical Carcinoma

    International Nuclear Information System (INIS)

    Anita Mahajan; Mark J. Rivard; Evelyn R. Nunez; David E. Wazer


    For this clinical study, external photon beam irradiation will be given in a standard fashion with intravenous cisplatinum (CDDP) every week as a radiosensitizing agent. We will incorporate 252 Cf as the brachytherapy source replacing 192 Ir, theoretically improving patient outcomes with its lack of cell cycle and oxygen dependence, and a therapeutic ratio possibly greater than unity. Local tumor control and control of systemic disease are potentially feasible using 252 Cf to initially debulk and destroy local bulky tumor with CDDP and X rays to enhance treatment efficacy and treat minimal microscopic and distant micrometastases. The initial 22 Cf dose will be 1 Gy per weekly fraction with 0.25-Gy increments toward a 2.5-Gy limit. Patients will be stratified according to their stage, toxicities and outcomes will be monitored closely, and the study will be halted if undo morbidities are noted

  19. A new facility for non-destructive assay using a 252Cf source

    International Nuclear Information System (INIS)

    Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.


    A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques

  20. Methods for Cf-252 cervix cancer therapy and treatment planning for GYN malignancies in Lexington

    International Nuclear Information System (INIS)

    Coffey, C.W.; Yoneda, J.; Beach, J.L.; Maruyama, Y.


    This paper presents the clinical physics methods and treatment planning techniques used in both the external beam and brachytherapy treatment of GYN malignancies in the Radiotherapy Department of the University of Kentucky Medical Center. Specific description of the departmental implant suite and brachytherapy procedures are included. The optimization of brachytherapy applicator placement, source arrangement, and normal and tumor total dose and dose distributions are presented. Quality assurance protocols for teletherapy and brachytherapy and patient and staff safety procedures with Cf-252 are discussed

  1. Burnout and gate rupture of power MOS transistors with fission fragments of 252Cf

    International Nuclear Information System (INIS)

    Tang Benqi; Wang Yanping; Geng Bin; Chen Xiaohua; He Chaohui; Yang Hailiang


    A study to determine the single event burnout (SEB) and single event gate rupture (SEGR) sensitivities of power MOSFET devices is carried out by exposure to fission fragments from 252 Cf source. The test method, test results, a description of observed burnout current waveforms and a discussion of a possible failure mechanism are presented. The test results include the observed dependence upon applied drain or gate to source bias and effect of external capacitors and limited resistors

  2. Advanced conceptual design report. Phase II. Liquid effluent treatment and disposal Project W-252

    International Nuclear Information System (INIS)


    This Advanced Conceptual Design Report (ACDR) provides a documented review and analysis of the Conceptual Design Report (CDR), WHC-SD-W252-CDR-001, June 30, 1993. The ACDR provides further design evaluation of the major design approaches and uncertainties identified in the original CDR. The ACDR will provide a firmer basis for the both the design approach and the associated planning for the performance of the Definitive Design phase of the project

  3. Estimation of the LET threshold of single event upset of microelectronics in experiments with Cf-252

    International Nuclear Information System (INIS)

    Kuznetsov, N.V.; Nymmik, R.A.


    A method is proposed for analyzing single event upsets (SEU) in large scale integration circuits of random access memory (RAM) when exposed to Cf-252 fission fragments. The method makes is possible to find the RAM linear energy transfer (LET) threshold to be used for estimations of RAM SEU rates in space. The method is illustrated by analyzing experimental data for the 2 x 8 kbit CMOS/bulk RAM. (author)

  4. Sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to neutrons emitted by a 252Cf source

    International Nuclear Information System (INIS)

    Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.


    The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr

  5. Discrepancies in the half-lives of 90Sr, 137Cs and 252Cf

    International Nuclear Information System (INIS)

    Rajput, M.U.; Mac Mahon, T.D.


    Recent reports have pointed out that significant discrepancies exist in published half-life data for 90 Sr, 137 Cs and 252 Cr, amongst others. These discrepancies make the estimation of evaluated half-lives for these isotopes difficult and contentious. This paper reviews the current situation, takes into account recently available data and attempts to derive recommended half-lives and associated uncertainties for the three isotopes. 37 refs, 3 tabs

  6. State Waste Discharge Permit application for industrial discharge to land: 200 East Area W-252 streams

    International Nuclear Information System (INIS)


    This document constitutes the WAC 173-216 State Waste Discharge Permit application for six W-252 liquid effluent streams at the Hanford Site. Appendices B through H correspond to Section B through H in the permit application form. Within each appendix, sections correspond directly to the respective questions on the application form. The appendices include: Product or service information; Plant operational characteristics; Water consumption and waterloss; Wastewater information; Stormwater; Other information; and Site assessment

  7. Viability of neutron brachytherapy technique using Cf252 for tumors of salivary glands therapy

    International Nuclear Information System (INIS)

    Andrade, Lidia M.; Campos, Tarcisio P.R.


    Gland salivary tumors, although uncommon, present significant characteristics such as distant metastasis, recurrence and average survive of five year for treated patients. Those tumors presents low response to a conventional radiotherapy, photon and electron therapy; thus, this modality is associated with surgery. Fast neutron therapy has been presented better results in controlling the local tumor in comparison with conventional radiotherapy. Brachytherapy with Cf-252 presents an alternative treatment for tumors. Those radiotherapy technique are discussed and analyzed. (author)

  8. Correlation studies of neutron multiplicities in the 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Alkhazov, I.D.; Dmitriev, V.D.; Kovalenko, S.S.; Kuznetsov, A.V.; Malkin, L.Z.; Petrzhak, K.A.; Petrov, B.F.; Shpakov, V.I.


    Correlations between the numbers of neutrons emitted by the 252 Cf spontaneous fission fragments have been studied as a function of the fragment mass and total kinetic energy. Behaviour of the neutron number dispersions and covariances was studied for the region of symmetric fission. Parameters of the complementary fragment excitation energy distribution (mean values, dispersions, covariances) were determined. Various factors describing correlations between the complementary fragment excitation energies are considered

  9. Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory. (United States)

    Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping


    Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All

  10. Fresnel zone plate imaging of a 252Cf spontaneous fission source

    International Nuclear Information System (INIS)

    Stalker, K.T.; Hessel, K.R.


    The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown

  11. Time domain measurements for fast metal assemblies with /sup 252/Cf

    Energy Technology Data Exchange (ETDEWEB)

    Mihalczo, J T


    Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)

  12. Energy and angular distributions of neutrons from 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.


    Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments

  13. Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field

    International Nuclear Information System (INIS)

    Mannhart, W.


    The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables

  14. Separation of 248Cm (III) from 252Cf (III) and its use in time resolved fluorescence spectroscopic (TRFS) studies

    International Nuclear Information System (INIS)

    Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.


    The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)

  15. Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster

    International Nuclear Information System (INIS)

    Seidel, A.


    Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment


    Energy Technology Data Exchange (ETDEWEB)

    Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail:, E-mail:, E-mail: [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)


    We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.

  17. Calculation of dose distribution for 252Cf fission neutron source in tissue equivalent phantoms using Monte Carlo method

    International Nuclear Information System (INIS)

    Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong


    Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf

  18. Understanding the different rotational behaviors of $^{252}$No and $^{254}$No in terms of high-order deformation

    CERN Document Server

    Liu, H L; Walker, P M


    Total Routhian surface calculations have been performed to investigate rapidly rotating transfermium nuclei, the heaviest nuclei accessible by detailed spectroscopy experiments. The observed fast alignment in $^{252}$No and slow alignment in $^{254}$No are well reproduced by the calculations incorporating high-order deformations. The different rotational behaviors of $^{252}$No and $^{254}$No can be understood for the first time in terms of $\\beta_6$ deformation that decreases the energies of the $\

  19. High energy {gamma} emission in the spontaneous fission of {sup 252}Cf; Emission {gamma} de grande energie dans la fission spontanee de {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Belier, G.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [ Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)


    The prompt {gamma} emission in the spontaneous fission of {sup 252}Cf is characterized by an energy spectrum which extends up to 20 MeV. It was established that the spectrum presents in the neighbourhood of symmetric fission an intensity bump in the 3-8 MeV {gamma} energy interval. The origin of this phenomenon is still not well understood, so that it was found interesting to carry out new measurements. The spectrum of the {gamma} rays emitted in spontaneous fission of {sup 252}Cf has been measurement in the EUROGAM II multidetector using photovoltaic cells to detect fragments. The aim of the experiment was to investigate the {gamma} yield enhancement which appears for mass fragment ratio near 132/120. This enhancement was found to be composed of two peaks located at 4 MeV and 5.5 MeV respectively. The results obtained confirm the intensity bound in the 3-8 MeV region but this augmentation reaches the maximum when the heavy fragment is near the mass 132. Beyond mass 140 the phenomenon diminish and the {gamma} spectrum regains the behaviour expected for a statistic emission. The additional structure at 5.5 MeV does not vary with excitation energy while the excitation function of the 4 MeV structure is more structured and presents a maximum when the excitation energy is near 8 MeV. It is likely that all or part of this observed phenomenon is due to a particular excitation mode of this isotope associated for instance with a low energy dipole resonance. A theoretical study of this collective effect is under way 3 refs.

  20. RBE of Cf-252 neutrons as determined by its lethal, mutagenic, and cytogenetic effects on human cells

    International Nuclear Information System (INIS)

    Ban, Sadayuki


    To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)

  1. Dosimetric analysis of BNCT - Boron Neutron Capture Therapy - coupled to 252Cf brachytherapy

    International Nuclear Information System (INIS)

    Brandao, Samia F.; Campos, Tarcisio P.R.


    The incidence of brain tumors is increasing in world population; however, the treatments employed in this type of tumor have a high rate of failure and in some cases have been considered palliative, depending on histology and staging of tumor. Its necessary to achieve the control tumor dose without the spread irradiation cause damage in the brain, affecting patient neurological function. Stereotactic radiosurgery is a technique that achieves this; nevertheless, other techniques that can be used on the brain tumor control must be developed, in order to guarantee lower dose on health surroundings tissues other techniques must be developing. The 252 Cf brachytherapy applied to brain tumors has already been suggested, showing promising results in comparison to photon source, since the active source is placed into the tumor, providing greater dose deposition, while more distant regions are spared. BNCT - Boron Neutron Capture Therapy - is another technique that is in developing to brain tumors control, showing theoretical superiority on the rules of conventional treatments, due to a selective irradiation of neoplasics cells, after the patient receives a borate compound infusion and be subjected to a epithermal neutrons beam. This work presents dosimetric studies of the coupling techniques: BNCT with 252 Cf brachytherapy, conducted through computer simulation in MCNP5 code, using a precise and well discretized voxel model of human head, which was incorporated a representative Glioblastoma Multiform tumor. The dosimetric results from MCNP5 code were exported to SISCODES program, which generated isodose curves representing absorbed dose rate in the brain. Isodose curves, neutron fluency, and dose components from BNCT and 252 Cf brachytherapy are presented in this paper. (author)

  2. Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.


    The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method

  3. Prompt neutron fission spectrum mean energies for the fissile nuclides and 252Cf

    International Nuclear Information System (INIS)

    Holden, N.E.


    The international standard for a neutron spectrum is that produced from the spontaneous fission of 252 Cf, while the thermal neutron induced fission neutron spectra for the four fissile nuclides, 233 U, 235 U, 239 Pu, and 241 Pu are of interest from the standpoint of nuclear reactors. The average neutron energies of these spectra are tabulated. The individual measurements are recorded with the neutron energy range measured, the method of detection as well as the average neutron energy for each author. Also tabulated are the measurements of the ratio of mean energies for pairs of fission neutron spectra. 75 refs., 9 tabs

  4. Measurement of californium-252 gamma photons depth dose distribution in tissue equivalent material. Vol. 4

    Energy Technology Data Exchange (ETDEWEB)

    Fadel, M A; El-Fiki, M A; Eissa, H M; Abdel-Hafez, A; Naguib, S H [National Institute of Standards, Cairo (Egypt)


    Phantom of tissue equivalent material with and without bone was used measuring depth dose distribution of gamma-rays from californium-252 source. The source was positioned at center of perspex walled phantom. Depth dose measurements were recorded for X, Y and Z planes at different distances from source. TLD 700 was used for measuring the dose distribution. Results indicate that implantation of bone in tissue equivalent medium cause changes in the gamma depth dose distribution which varies according to variation in bone geometry. 9 figs.

  5. Measurements of integral cross sections in the californium-252 fission neutron spectrum

    International Nuclear Information System (INIS)

    Alberts, W.G.; Guenther, E.; Matzke, M.; Rassl, G.


    In a low-scattering arrangement cross sections averaged over the californium-252 spontaneous fission neutron spectrum were measured. The reactions 27 Al(n,α) 46 Ti, 47 Ti, 48 Ti(n,p), 54 Fe, 56 Fe(n,p), 58 Ni(n,p), 64 Zn(n,p), 115 In(n,n') were studied in order to obtain a consistent set of threshold detectors used in fast neutron flux density measurements. Overall uncertainties between 2 and 2.5% could be achieved; corrections due to neutron scattering in source and samples are discussed

  6. Investigation of the far asymmetric region in 252Cf(sf)

    International Nuclear Information System (INIS)

    Hambsch, F.-J.; Oberstedt, S.


    A twin Frisch-gridded ionization chamber has been used to measure the fission fragment mass, kinetic-energy and angular correlations for 252 Cf(sf). In total 2.5 x 10 8 events were collected. The focus was in the far asymmetric mass region, where enhancements in the yield had been found earlier. It could be shown, that these findings are due to false events, coming from either close geometries not properly taking into account the angular-dependent energy loss in the sample and backing, from a too large angular cone selected in case of studies employing ionization chambers, or even from poor target qualities. (orig.)

  7. New isomeric states in 152,154,156Nd produced by spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C.; Belier, G.; Girod, M.; Meot, V.; Peru, S.; Astier, A.; Ducroux, L.; Meyer, M.; Redon, N.


    Isomeric states have been observed in fission-fragments produced by spontaneous fission of 252 Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between γ-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2μs have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the 152,154,156 Nd show evidence for K-isomers. (orig.)

  8. A new facility for non-destructive assay using a 252Cf source. (United States)

    Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G


    A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.


    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  10. Neutron dose rate for {sup 252} Cf AT source in medical applications

    Energy Technology Data Exchange (ETDEWEB)

    Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)


    The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)

  11. Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)

    International Nuclear Information System (INIS)

    Budtz-Joergensen, C.; Knitter, H.H.


    The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)

  12. Development of neutron induced prompt γ-ray spectroscopy system using 252Cf

    International Nuclear Information System (INIS)

    Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong


    For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained

  13. Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.


    A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

  14. Equilibration in the reaction of 175 and 252 MeV 20Ne with 197Au

    International Nuclear Information System (INIS)

    Moulton, J.B.


    The highly inelastic nuclear reaction of 197 Au with 20 Ne at 175 and 252 MeV laboratory energies is studied. Energy-, elemental-, and angular- distributions for atomic numbers 5 to 30 (175 MeV) or 34 (252 MeV) are presented. The means and widths of the kinetic energy spectra for detected elements are compared with a theoretical calculation. The calculation postulates thermalization of the incident projectile kinetic energy, and includes one sha(e-vibrational degree of freedom and rigid rotation of the reaction complex. The effect of particle evaporation is considered. Good agreement of the expurimental mean energies with the theory is obtained. Poorer agreement of the kinetic energy widths with the theory may be due to a low-temperature quantal effect. The relative elemental yields are analyzed for their degree of equilibration, based on a model of diffusive nucleon exchange as described by the master equation. A similar degree of equilibration is observed for both reaction energies. The absolute elemental yields are reproduced qualitatively by employing an advanced diffusion code, coupled with calculation of the subsequent fission of heavy reaction products, including the compound nucleus. The angular distributions are analyzed with a simple model, to estimate the reaction lifetime of selected elements

  15. An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range

    International Nuclear Information System (INIS)

    Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.


    Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)

  16. Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.


    For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)

  17. Feasibility of subcriticality and NDA measurements for spent fuel by frequency analysis techniques with 252Cf

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; Valentine, T.E.; Mattingly, J.K.


    The 252 Cf-source-driven frequency analysis method can be used for measuring the subcritical neutron multiplication factor of arrays of LWR fuel and as little as a single PWR fuel assembly. These measurements can be used to verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. In addition, the data can be used to validate calculational methods for criticality safety. These measurements provide parameters that have a higher sensitivity to changes in fissile mass than neutron multiplication factor and thus serve as a better test of calculational methods. The analysis have also shown that measurement of the cross power spectral density (CPSD) between detectors on one side of a single fuel assembly and an internal or external 252 Cf source driving the fission chain multiplication process can be used for nondestructive assay of fissile mass along the length of the assembly. This CPSD is a smooth function of fissile mass and does not depend on the varying inherent source in the fuel assembly and thus is ideal for fissile mass assay

  18. Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source

    International Nuclear Information System (INIS)

    Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.


    As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported

  19. Convenient method of simultaneously analyzing aluminum and magnesium in pharmaceutical dosage forms using californium-252 thermal neutron activation

    International Nuclear Information System (INIS)

    Landolt, R.R.; Hem, S.L.


    A commercial antacid suspension containing aluminum hydroxide and magnesium hydroxide products was used as a model sample to study the use of a californium-252 thermal neutron activation as a method for quantifying aluminum content as well as for the simultaneous assay of aluminum and magnesium. A 3.5-micrograms californium-252 source was used for the activation, and the induced aluminum-28 and magnesium-27 activity was simultaneously measured by sodium iodide crystal gamma-ray spectrometry using dual single-channel analyzers and scalers. The antacid suspension was contained in a chamber designed with the unique capability of serving as the container for counting the induced radioactivity in addition to being the irradiation chamber itself. This pilot study demonstrated that use of more intense californium-252 sources, which are commonly available, would provide a method that is competitive with the ethylenediaminetetraacetic acid titration method in precision and in other aspects as well

  20. {sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)


    The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.

  1. Young stellar population and ongoing star formation in the H II complex Sh2-252 (United States)

    Jose, Jessy; Pandey, A. K.; Samal, M. R.; Ojha, D. K.; Ogura, K.; Kim, J. S.; Kobayashi, N.; Goyal, A.; Chauhan, N.; Eswaraiah, C.


    In this paper, an extensive survey of the star-forming complex Sh2-252 has been undertaken with an aim to explore its hidden young stellar population as well as to understand the structure and star formation history for the first time. This complex is composed of five prominent embedded clusters associated with the subregions A, C, E, NGC 2175s and Teu 136. We used Two Micron All Sky Survey-near-infrared and Spitzer-Infrared Array Camera, Multiband Imaging Photometer for Spitzer photometry to identify and classify the young stellar objects (YSOs) by their infrared (IR) excess emission. Using the IR colour-colour criteria, we identified 577 YSOs, of which, 163 are Class I, 400 are Class II and 14 are transition disc YSOs, suggesting a moderately rich number of YSOs in this complex. Spatial distribution of the candidate YSOs shows that they are mostly clustered around the subregions in the western half of the complex, suggesting enhanced star formation activity towards its west. Using the spectral energy distribution and optical colour-magnitude diagram-based age analyses, we derived probable evolutionary status of the subregions of Sh2-252. Our analysis shows that the region A is the youngest (˜0.5 Myr), the regions B, C and E are of similar evolutionary stage (˜1-2 Myr) and the clusters NGC 2175s and Teu 136 are slightly evolved (˜2-3 Myr). Morphology of the region in the 1.1 mm map shows a semicircular shaped molecular shell composed of several clumps and YSOs bordering the western ionization front of Sh2-252. Our analyses suggest that next generation star formation is currently under way along this border and that possibly fragmentation of the matter collected during the expansion of the H II region as one of the major processes is responsible for such stars. We observed the densest concentration of YSOs (mostly Class I, ˜0.5 Myr) at the western outskirts of the complex, within a molecular clump associated with water and methanol masers and we suggest that it

  2. Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources

    International Nuclear Information System (INIS)

    Paredes G, L.; Balcazar G, M.; Azorin N, J.; Francois L, J.L.


    The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10 6 n/s-μg and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E n > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E n > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of 252 Cf, to optimize and to individualize the patients treatments. (Author)

  3. Study of the isomer nuclei produced in the spontaneous fission of {sup 252}Cf; Etude des noyaux isomeriques produits dans la fission spontanee de {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Belier, G.; Girod, M.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, G.; Meot, V.; Peru, S. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [ Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)


    Isomeric states have been studied in fission fragments produced by spontaneous fission of {sup 252}Cf. 34 isomeric nuclei have been identified by using coincidences between {gamma}-rays detected in EUROGAM II and fission fragments detected in photovoltaic cells. Lifetimes from 20 ns up to 2 {mu}s have been measured. Microscopic interpretation of the isomeric levels discovered has been tried by means of the Hartree-Fock-Bogolyubov procedure using Gogny force. It was found that the {sup 152,154,156}Nd nuclei have prolate deformation in their ground state; the rotational band built on this ground state is well reproduced by the calculation. For these nuclei the 2 quasi-particle excited states energies are above 1 MeV in agreement with the experiment. The computation confirms the similitude of the {sup 156}Nd and {sup 158}Sm isomeric states associated to neutron 2 quasi-particles of J{sup {pi}} K{sup {pi}} = 5{sup -} ({nu} 5/2 (642) x {nu} 5/2 (523)) while such similitude does not occur for the isotone nuclei {sup 154}Nd and {sup 156}Sm. The computation predicts a proton 2 quasi-particle excited states of J{sup {pi}} = 5{sup -}, near the isomeric level measured in {sup 156}Sm but not for that of {sup 154}Nd. Concerning the {sup 152}Nd the calculated level density is very near that of the states measured in the 1.6 to 2.3 MeV interval. However, the lack of precise information on spins and parities of the measured levels does make not possible a confrontation with the calculations. An up-graded equipment implying 32 photovoltaic cells instead of 2 cells is to be developed and installed by the EUROGAM 3 refs.

  4. 47 CFR 51.807 - Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. (United States)


    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. 51.807 Section 51.807 Telecommunication FEDERAL... Implementation of Section 252 of the Act § 51.807 Arbitration and mediation of agreements by the Commission...

  5. Parameters for several plutonium nuclides and 252Cf of safeguards interest

    International Nuclear Information System (INIS)

    Zucker, M.S.; Holden, N.E.


    Sets of the neutron emission multiplicity distribution gleaned from the literature for plutonium nuclides and 252 Cf are considered. A methodology for rendering the different sets comparable is presented and used to convert the sets to a common basis such that the differences can be evaluated objectively and that allows realistic estimate of the uncertainties. This in turn permits development of a canonical consensus set in certain instances. Evaluated data on the average neutron multiplicity, the total half-lives, and the half-lives for spontaneous fission are also given. A careful search of the literature reveals that the data on neutron multiplicity distributions for many nuclides is surprisingly sparse, considering that almost thirty years has elapsed since the original pioneering work, which in some cases, yield the only reported value. 93 references, 26 tables

  6. Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation

    International Nuclear Information System (INIS)

    Fasso, A.; Ipe, N.E.; Reyna, A.


    A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation

  7. Study of ternary and quaternary spontaneous fission of 252Cf with the NESSI detector

    International Nuclear Information System (INIS)

    Tishchenko, V.G.; Jahnke, U.; Herbach, C.M.; Hilscher, D.


    Ternary and quaternary spontaneous decay of 252 Cf was studied with the NESSI detector, a combination of two 4π detectors for charged particles, neutrons and γ-rays. The applied method of particle identification by measuring the energies and relative time-of-flights of the decay products is shown to be very effective for the study of rare decay modes. The energy and angular distributions of the decay products, the associated neutron multiplicities, the total energy of the prompt γ-radiation as well as correlations between the various observables were measured for the first time in a single full-scale experiment. The characteristics of ternary fission known from previous investigations are confirmed in the frame of a methodically independent experiment. Preliminary estimates of the quaternary fission yield are presented. An attempt is made to determine the mechanism of quaternary fission. (orig.)

  8. Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

    International Nuclear Information System (INIS)

    Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.


    Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads mg -1 h -1 +- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads mg -1 h -1 . These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

  9. Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

    International Nuclear Information System (INIS)

    Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.


    Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads micrograms-1 h-1 +/- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads micrograms-1 h-1. These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

  10. Spectral investigation of neutron radiation in three-sectional concrete labyrinth from a californium-252 source

    International Nuclear Information System (INIS)

    Belogorlov, E.A.; Britvich, G.I.; Getmanov, V.B.


    Construction of labyrinths in points of communication output from the storage-ring under construction is accompanied by numerous difficulties due to a considerable number of gas and cryogenic pipelines, which require large cross sections at the minimal length of the pipelines proper for their location. It results in unfavourable for radiation attenuation ratios between cross section and length of the labyrinth separate sections. Neutron spectra in a model concrete labyrinth, at the entrance to which a neutron source with fission spectrum (californium-252) and the same source in a polyethylene moderator are located, are measured. On the basis of the spectra obtained the formation of fluence and equivalent dose along the labyrinth geometric axis is analyzed. Conditions permitting actually to reduce radiation dose in the labyrinth (dead end provision, the use of cover materials, construction of diaphragms and shielding plates) are simulated

  11. Multiplicity and correlated energy of gamma rays emitted in the spontaneous fission of Californium-252

    International Nuclear Information System (INIS)

    Brunson, G.S. Jr.


    An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented

  12. Shielding of radiation fields generated by {sup 252}Cf in a concrete maze. Part 2 -- Simulation

    Energy Technology Data Exchange (ETDEWEB)

    Fasso, A.; Ipe, N.E.; Reyna, A. [Stanford Univ., CA (US). Stanford Linear Accelerator Center; McCall, R.C. [McCall Associates, Woodside, CA (US)


    A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare {sup 252}Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation.

  13. Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments

    International Nuclear Information System (INIS)

    Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.


    Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)

  14. Resistive plate chamber neutron and gamma sensitivity measurement with a {sup 252}Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Abbrescia, M.; Altieri, S.; Baratti, V.; Barnaba, O.; Belli, G.; Bruno, G.; Colaleo, A.; DeVecchi, C.; Guida, R. E-mail:; Iaselli, G.; Imbres, E.; Loddo, F.; Maggi, M.; Marangelli, B.; Musitelli, G.; Nardo, R.; Natali, S.; Nuzzo, S.; Pugliese, G.; Ranieri, A.; Ratti, S.; Riccardi, C.; Romano, F.; Torre, P.; Vicini, A.; Vitulo, P.; Volpe, F


    A bakelite double gap Resistive Plate Chamber (RPC), operating in avalanche mode, has been exposed to the radiation emitted from a {sup 252}Cf source to measure its neutron and gamma sensitivity. One of the two gaps underwent the traditional electrodes surface coating with linseed oil. RPC signals were triggered by fission events detected using BaF{sub 2} scintillators. A Monte Carlo code, inside the GEANT 3.21 framework with MICAP interface, has been used to identify the gamma and neutron contributions to the total number of collected RPC signals. A neutron sensitivity of (0.63{+-}0.02)x10{sup -3} (average energy 2 MeV) and a gamma sensitivity of (14.0{+-}0.5)x10{sup -3} (average energy 1.5 MeV) have been measured in double gap mode. Measurements done in single gap mode have shown that both neutron and gamma sensitivity are independent of the oiling treatment.

  15. Transport calculations of. gamma. -ray flux density and dose rate about implantable californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    Shapiro, A; Lin, B I [Cincinnati Univ., Ohio (USA). Dept. of Chemical and Nuclear Engineering; Windham, J P; Kereiakes, J G


    ..gamma.. flux density and dose rate distributions have been calculated about implantable californium-252 sources for an infinite tissue medium. Point source flux densities as a function of energy and position were obtained from a discrete-ordinates calculation, and the flux densities were multiplied by their corresponding kerma factors and added to obtain point source dose rates. The point dose rates were integrated over the line source to obtain line dose rates. Container attenuation was accounted for by evaluating the point dose rate as a function of platinum thickness. Both primary and secondary flux densities and dose rates are presented. The agreement with an independent Monte Carlo calculation was excellent. The data presented should be useful for the design of new source configurations.

  16. Metronidazole in the treatment of cervical cancer using Cf-252 neutron brachytherapy

    International Nuclear Information System (INIS)

    Maruyama, Y.


    Metronidazole was tested for its possible use in the Cf-252 brachytherapy of cervical cancer as a radiosensitizer and to deal with anaerobic pelvic infection. 15 patients were treated by only 14 were evaluable. All stages from stage IB-IVB were treated and complete local tumor regression was noted in all cases although it could take place very slowly. 5/14 (36%) are 1.5-3 year survivors but only among the patients with stage I-II disease. No unusual radio-enhancing action was observed but metronidazole appeared to be useful to treat the vaginal, cervix and uterine infections often associated with high stage disease and bulky, ulcerative or necrotic tumors

  17. Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission

    Energy Technology Data Exchange (ETDEWEB)

    Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)


    Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}

  18. Investigation of short-living fission products from the spontaneous fission of Cf-252

    International Nuclear Information System (INIS)

    Klonk, H.


    In this paper, a method of separating and measuring fission products of Cf-252 is presented. The measurement was achieved by means of γ-spectrometry and thus provides a quantitative analysis with a good separation of the fission products with respect to both atomic number Z and mass number A. The separation of the fission products from the fission source was achieved by means of solid traps. An automatic changing apparatus made it possible to keep irradiation and measuring times short, so even very short-lived fission products could be registered. The quantitative evaluation of primary fission products was made possible by correction according to Bateman equations. With that, the yields of single nuclides and the dispersion of charge can be determined. (orig./WL) [de

  19. Physics of the 252Cf-source-driven noise analysis measurement

    International Nuclear Information System (INIS)

    Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.


    The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement

  20. Measurement of Neutron Energy Spectrum Emitted by Cf-252 Source Using Time-of-Flight Method

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Cheol Ho; Son, Jaebum; Kim, Tae Hoon; Lee, Sangmin; Kim, Yong-Kyun [Hanyang University, Seoul (Korea, Republic of)


    The techniques proposed to detect the neutrons usually require the detection of a secondary recoiling nucleus in a scintillator (or other type of detector) to indicate the rare collision of a neutron with a nucleus. This is the same basic technique, in this case detection of a recoil proton that was used by Chadwick in the 1930 s to discover and identify the neutron and determine its mass. It is primary technique still used today for detection of fast neutron, which typically involves the use of a hydrogen based organic plastic or liquid scintillator coupled to a photo-multiplier tube. The light output from such scintillators is a function of the cross section and nuclear kinematics of the n + nucleus collision. With the exception of deuterated scintillators, the scintillator signal does not necessarily produce a distinct peak in the scintillator spectrum directly related to the incident neutron energy. Instead neutron time-of-flight (TOF) often must be utilized to determine the neutron energy, which requires generation of a prompt start signal from the nuclear source emitting the neutrons. This method takes advantage of the high number of prompt gamma rays. The Time-of-Flight method was used to measure neutron energy spectrum emitted by the Cf-252 neutron source. Plastic scintillator that has a superior discrimination ability of neutron and gamma-ray was used as a stop signal detector and liquid scintillator was used as a stat signal detector. In experiment, neutron and gamma-ray spectrum was firstly measured and discriminated using the TOF method. Secondly, neutron energy spectrum was obtained through spectrum analysis. Equation of neutron energy spectrum that was emitted by Cf-252 source using the Gaussian fitting was obtained.

  1. Exclusive radiation therapy of endometrial carcinoma using HDR Co-60 and Cf-252 sources

    International Nuclear Information System (INIS)

    Inciura, A.; Janulionis, E.; Atkocius, V.


    Although the main treatment of endometrial cancer is surgery, the gross spread of carcinoma in pelvis, elderly age of the patients and serious therapeutical diseases do not allow to operate 20% of the patients. For these patients only radical treatment decision is the combined radiation therapy. However, using various modalities of combined radiotherapy, the treatment results are not satisfying: only 52% of patients survive 5 years. There was implemented a new method of combined radiotherapy, using a three-channel applicator with two-positional locating of HDR Co-60 radioactive sources (group I). A new method of brachytherapy for endometrial carcinoma using a HDR Cf 252 sources (group II) was implemented too. For group I the medium total dose of the point A was 77.6 Gy, point I - 69.6 Gy. point 2 - 84.2 Gy, point B - 52.6 Gy, For group II the medium total dose the points A, 3 and 4 was 50 iGy. For group I 1 year overaII survival rate was 85%, 3 year - 73%. The 3 year survival rate for stage I was 79%, for stage II - 89%, for stage III - 33%. 3 year survival for highly virulent tumours - 56% and for low virulent (adenocarcinoma) - 82% was statistically different. The loss of tumour differentiation correlated with the worse prognosis: 3 year survival for G1 and G2 tumours was 92%, for G3 - 45%. Low hemoglobin level was also associated with low survival rate: 2 year survival for Hb≥120g/l was 85% and Hb<120g/l - 23%. 1 year survival rate was 87%, 3 year - 66%, 5 year - 58% for group II, treated with Cf-252. Radiation complications occurred for 13.8% of the patients for group I and 6.2% for group II. Good survival rates and a small number of complications sufficiently proofed treatment method. (author)

  2. Neutron-neutron angular correlations in spontaneous fission of 252Cf and 240Pu (United States)

    Verbeke, J. M.; Nakae, L. F.; Vogt, R.


    Background: Angular anisotropy has been observed between prompt neutrons emitted during the fission process. Such an anisotropy arises because the emitted neutrons are boosted along the direction of the parent fragment. Purpose: To measure the neutron-neutron angular correlations from the spontaneous fission of 252Cf and 240Pu oxide samples using a liquid scintillator array capable of pulse-shape discrimination. To compare these correlations to simulations combining the Monte Carlo radiation transport code MCNPX with the fission event generator FREYA. Method: Two different analysis methods were used to study the neutron-neutron correlations with varying energy thresholds. The first is based on setting a light output threshold while the second imposes a time-of-flight cutoff. The second method has the advantage of being truly detector independent. Results: The neutron-neutron correlation modeled by FREYA depends strongly on the sharing of the excitation energy between the two fragments. The measured asymmetry enabled us to adjust the FREYA parameter x in 240Pu, which controls the energy partition between the fragments and is so far inaccessible in other measurements. The 240Pu data in this analysis was the first available to quantify the energy partition for this isotope. The agreement between data and simulation is overall very good for 252Cf(sf ) and 240Pu(sf ) . Conclusions: The asymmetry in the measured neutron-neutron angular distributions can be predicted by FREYA. The shape of the correlation function depends on how the excitation energy is partitioned between the two fission fragments. Experimental data suggest that the lighter fragment is disproportionately excited.

  3. Discovery of a 7.6-hour high-spin isomer of einsteinium-256

    International Nuclear Information System (INIS)

    Hoffman, D.C.; Daniels, W.R.; Wilhelmy, J.B.; Bunker, M.E.; Starner, J.W.; Jackson, S.V.; Lougheed, R.W.; Landrum, J.H.


    A 7.6-hour, beta-emitting isomer of 256 Es has been produced via the (t,p) reaction by bombarding /sup 254g/Es with 16-MeV tritons. No evidence for an alpha branch was found. A number of gamma rays were observed, on the basis of which a partial decay scheme is proposed. It is concluded that the isomer has spin 7 or 8

  4. 48 CFR 252.225-7007 - Prohibition on Acquisition of United States Munitions List Items from Communist Chinese Military... (United States)


    ... of United States Munitions List Items from Communist Chinese Military Companies. 252.225-7007 Section... Chinese Military Companies. As prescribed in 225.1103(4), use the following clause: Prohibition On Acquisition of United States Munitions List Items From Communist Chinese Military Companies (SEP 2006) (a...

  5. Detection alpha particles and Cf-252 fission fragments with track solid detectors and with surface barrier detectors: efficiency determination

    International Nuclear Information System (INIS)

    Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.R.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.


    The technique of particle detection by solid track detectors, types of developing and analysis of results are presented. Efficiency measurements of alpha particle detection with Makrofol e and surface barrier detector are made. Detection of Cf-252 fission fragments is shown. (L.C.)

  6. 7 CFR 1726.252 - Prior approved contract modification related to liability for special and consequential damages. (United States)


    ... consequential damages on account of breach of this contract shall not exceed in total an amount equal to... 7 Agriculture 11 2010-01-01 2010-01-01 false Prior approved contract modification related to... CONSTRUCTION POLICIES AND PROCEDURES Modifications to RUS Standard Contract Forms § 1726.252 Prior approved...

  7. Detection of alpha particles and Cf-252 fission fragments with solid track detectors and surface barrier detector. Efficiency calculation

    International Nuclear Information System (INIS)

    Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.E.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.


    A technique for particle detection by using track solid detector and also types of revealing and result analysis are presented concerned to Cf-252 fission fragments detection. Measurements of alpha particles detection efficiency using Makrofol E and surface barrier detector are performed. (L.C.J.A.)

  8. The temperature of fission fragments from spontaneous fission of 252Cf measured by time-of-flight spectrometer

    International Nuclear Information System (INIS)

    Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R.


    The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of 252 Cf. The determination of the temperature was based on the measurement of the neutron spectra

  9. The temperature of fission fragments from spontaneous fission of {sup 252}Cf measured by time-of-flight spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R. [Warsaw Univ., Inst. of Experimental Physics, Nuclear Physics Div., Warsaw (Poland)


    The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of {sup 252}Cf. The determination of the temperature was based on the measurement of the neutron spectra. 5 refs, 2 figs.

  10. 48 CFR 252.247-7026 - Evaluation Preference for Use of Domestic Shipyards-Applicable to Acquisition of Carriage by... (United States)


    ... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.247-7026 Evaluation Preference for Use of... Noncontiguous Trade. As prescribed in 247.574(e), use the following provision: Evaluation Preference For Use of... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Evaluation Preference for...

  11. Interactive effects between Lymphotoxin α +252 polymorphism and habits of substance use on risk of hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Jung-Fa Tsai


    Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.

  12. Comparison of 252Cf time correlated induced fission with AmLi induced fission on fresh MTR reserach reactor fuel

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Jay Prakash [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The objectives of this project are to calibrate the Advanced Experimental Fuel Counter (AEFC), benchmark MCNP simulations using experimental results, investigate the effects of change in fuel assembly geometry, and finally to show the boost in doubles count rates with 252Cf active soruces due to the time correlated induced fission (TCIF) effect.

  13. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    International Nuclear Information System (INIS)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong


    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  14. A new type-B cask design for transporting 252Cf

    International Nuclear Information System (INIS)

    Simmons, C.M.


    A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask

  15. Efficacy of brachytherapy with californium-252 neutrons versus cesium-137 photons for eradication of bulky localized cervical cancer: single-institution study

    International Nuclear Information System (INIS)

    Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.


    A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf

  16. Automated box/drum waste assay (252Cf shuffler) through the material access and accountability boundary

    International Nuclear Information System (INIS)

    Horley, E.C.; Bjork, C.W.; Bourret, S.C.; Polk, P.J.; Schneider, C.J.; Studley, R.V.


    For the first time, a shuffler waste-assay system has been made a part of material access and accountability boundary (MAAB). A 252 Cf Pass-Thru shuffler integrated with a conveyor handling system, will process box or drum waste across the MAAB. This automated system will significantly reduce personnel operating costs because security forces will not be required at the MAAB during waste transfer. Further, the system eliminates the chance of a mix-up between measured and nonmeasured waste. This Pass-Thru shuffler is to be installed in the Westinghouse Savannah River Company 321M facility to screen waste boxes and drums for 235 U. An automated conveyor will load waste containers into the shuffler, and upon verification, will transfer the containers across the MAAB. Verification will consist of a weight measurement followed by active neutron interrogation. Containers that pass low-level waste criteria will be conveyed to an accumulator section outside the MAAB. If a container fails to meet the waste criteria, it will be rejected and sent back to the load station for manual inspection and repackaging

  17. Transport-level description of the 252Cf-source method using the Langevin technique

    International Nuclear Information System (INIS)

    Stolle, A.M.; Akcasu, A.Z.


    The fluctuations in the neutron number density and detector outputs in a nuclear reactor can be analyzed conveniently by using the Langevin equation approach. This approach can be implemented at any level of approximation to describe the time evolution of the neutron population, from the most complete transport-level description to the very basic point reactor analysis of neutron number density fluctuations. In this summary, the complete space- and velocity-dependent transport-level formulation of the Langevin equation approach is applied to the analysis of the 252 Cf-source-driven noise analysis (CSDNA) method, an experimental technique developed by J.T. Mihalczo at Oak Ridge National Laboratory, which makes use of noise analysis to determine the reactivity of subcritical media. From this analysis, a theoretical expression for the subcritical multiplication factor is obtained that can then be used to interpret the experimental data. Results at the transport level are in complete agreement with an independent derivation performed by Sutton and Doub, who used the probability density method to interpret the CSDNA experiment, but differed from other expressions that have appeared in the literature

  18. Structures of the neutron-rich nuclei observed in fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Ramayya, A. V.; Hamilton, J. H.; Goodin, C. J.; Brewer, N. T.; Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Luo, Y. X. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Liu, S. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and UNRIB/Oak Ridge Associated Universities, Oak Ridge, Tennessee 37831 (United States); Rasmussen, J. O.; Lee, I. Y. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Stone, N. J. [Department of Physics, Oxford University, Oxford OX1 3PU (United Kingdom); Daniel, A. V. [Flerov Laboratory of Nuclear Reactions, JINR, Dubna (Russian Federation); Zhu, S. J. [Department of Physics, Tsinghua University, Beijing 100084 (China)


    Analysis of high statistics triple coincidence fission γ data from {sup 252}Cf at Gammasphere including angular correlations yielded well-expanded high-spin level schemes with more complete and reliable spin/parity assignments for {sup 82}Ge, {sup 118,120,122}Cd and {sup 114,115}Rh. Both the quasi-particle/hole couplings and quasi-rotational degrees of freedom are implied to play roles in these Cd isotopes. Evidence for triaxial shapes and octupole components in the Cd isotopes is presented. These Cd isotopes may have triaxial deformations. High-spin level schemes of {sup 114,115}Rh have been established for the first time. The existence of a relatively large signature splitting and an yrare band shows typical features of a triaxially deformed nucleus. Possible excited deformed rotational bands are observed, for the first time, in {sup 82}Ge. From the multipole mixing ratio measurement, the ground state configurations of {sup 109,111}Ru, as well as excited states in {sup 103,107}Mo and {sup 111}Ru were determined.

  19. Design and construction of an explosive detection system by Tna methods, using 252Cf radioisotope source

    International Nuclear Information System (INIS)

    Tavakkoli Farsouli, A.


    Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given

  20. Measurements of gamma-ray dose from a moderated 252Cf source

    International Nuclear Information System (INIS)

    McDonald, J.C.; Griffith, R.V.; Plato, P.; Miklos, J.


    The gamma-ray dose fraction from a moderated 252 Cf source was determined by using three types of dosimetry systems. Measurements were carried out in air at a distance of 35 cm from the surface of the moderating sphere (50 cm from the source which is at the center of the sphere) to the geometrical center of each detector. The moderating sphere is 0.8-mm-thick stainless steel shell filled with D 2 O and covered with 0.5 mm of cadmium. Measurements were also carried out with instruments and dosimeters positioned at the surface of a 40 cm x 40 cm x 15 cm plexiglass irradiation phantom whose front surface was also 35 cm from the surface of the moderating sphere. A-150 tissue-equivalent (TE) plastic ionization chambers and a TE proportional counter (TEPC) were used to measure tissue dose, from which the neutron dose equivalent was computed. The ratio of gamma-ray dose to the neutron dose equivalent was determined by using a relatively neutron-insensitive Geiger-Mueller (GM) counter and thermoluminescent dosimeters (TLD). In addition, the event-size spectrum measured by the TEPC was also used to compute the gamma-ray dose fraction. The average value for the ratio of gamma-ray dose to neutron dose equivalent was found to be 0.18 with an uncertainty of about +-18%

  1. Neutron calibration field of bare {sup 252}Cf source in Vietnam

    Energy Technology Data Exchange (ETDEWEB)

    Le, Ngoc Thiem; Tran, Hoai Nam; Nguyen, Khai Tuan [Institute for Nuclear Science and Technology, Hanoi (Viet Nam); Trinh, Glap Van [Institute of Research and Development, Duy Tan University, Da Nang (Viet Nam)


    This paper presents the establishment and characterization of a neutron calibration field using a bare {sup 252}Cf source of low neutron source strength in Vietnam. The characterization of the field in terms of neutron flux spectra and neutron ambient dose equivalent rates were performed by Monte Carlo simulations using the MCNP5 code. The anisotropy effect of the source was also investigated. The neutron ambient dose equivalent rates at three reference distances of 75, 125, and 150 cm from the source were calculated and compared with the measurements using the Aloka TPS-451C neutron survey meters. The discrepancy between the calculated and measured values is found to be about 10%. To separate the scattered and the direct components from the total neutron flux spectra, an in-house shadow cone of 10% borated polyethylene was used. The shielding efficiency of the shadow cone was estimated using the MCNP5 code. The results confirmed that the shielding efficiency of the shadow cone is acceptable.

  2. Induction of external abnormalities in offspring of male mice irradiated with 252Cf neutron

    International Nuclear Information System (INIS)

    Kurishita, Akihiro; Ono, Tetsuya; Mori, Yuriko; Okada, Shigefumi; Sawada, Syozo


    To assess the genetic effects of fission neutron, the induction of external malformations was studied in F 1 fetuses after F 0 male mice were irradiated. Male mice of the ICR:MCH strain were irradiated with 252 Cf neutron at doses of 0.238, 0.475, 0.95 and 1.9 Gy. They were mated with non-irradiated female mice at 71-120 days after irradiation. Pregnant females were autopsied on day 18 of gestation and their fetuses were examined for deaths and external abnormalities. No increases of pre- and post-implantation losses were noted at any dose. External abnormalities were observed at rates of 1.40% in the 0.238 Gy, 2.23% in the 0.475 Gy, 3.36% in the 0.95 and 3.26% in the 1.9 Gy groups; the rate in the control group was 1.65%. The dose-response curve was linear up to 0.95 Gy, and then flattened out; the induction rate of external abnormalities was 2.7x10 -4 /gamete/cGy based on the linear regression. These results indicated that fission neutron effectively induces external abnormalities in F 1 fetuses after spermatogonial irradiation. (author). 29 refs.; 1 fig.; 2 tabs

  3. Gamma-ray multiplicity distribution in ternary fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Kliman, J [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Krupa, L [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Morhac, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Hamilton, J H [Department of Physics, Vanderbilt University, Nashville, TN (United States); Kormicki, J [Department of Physics, Vanderbilt University, Nashville, TN (United States); Ramayya, A V [Department of Physics, Vanderbilt University, Nashville, TN (United States); Hwang, J K [Department of Physics, Vanderbilt University, Nashville, TN (United States); Luo, Y X [Department of Physics, Vanderbilt University, Nashville, TN (United States); Fong, D [Department of Physics, Vanderbilt University, Nashville, TN (United States); Gore, P [Department of Physics, Vanderbilt University, Nashville, TN (United States); Akopian, G M Ter; Oganessian, Yu Ts; Rodin, A M; Fomichev, A S; Popeko, G S; Daniel, A V [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna (Russian Federation); Rasmussen, J O; Macchiavelli, A O [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Stoyer, M A [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R [Instituto de Fisica, Universidade Federal do Rio de Janeiro, 21945-970 Rio de Janeiro (Brazil); Cole, J D [Idaho National Engineering and Environmental Laboratory, Idaho Falls, ID (United States)


    From multiparameter data obtained at Lawrence Berkeley National Laboratory, the integral characteristics of the prompt {gamma}-ray emission were extracted for tripartition of {sup 252}Cf with He, Be and C being the third light charged particle. We used multifold {gamma}-ray coincidence spectra for the determination of {gamma}-ray multiplicities assuming a Gaussian distribution for {gamma}-ray multiplicity. The multiplicity distribution characteristics, i.e. mean multiplicity and its dispersion were obtained by minimizing with respect to the calculated values of probabilities of multifold {gamma}-ray coincidences using a combinatoric method. Comparison with the known experimental data from binary fission was made. Further, we investigated dependencies of the mean {gamma}-ray multiplicity on the kinetic energy of the light charged particle. The mean {gamma}-ray multiplicity for He ternary fission is found to increase rapidly with increasing kinetic energy of He in the region less than 11 MeV and then decrease slowly with increasing kinetic energy of He. The anomalous behaviour of {gamma}-ray emission is discussed. The mean {gamma}-ray multiplicity was determined for the first time for Be and C ternary fission. For Be, the {gamma}-ray multiplicity as a function of kinetic energy was obtained as well.

  4. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

    International Nuclear Information System (INIS)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55 Mn (n.gamma) 56 Mn, high concentration of manganese in the matrix and short half - life of 56 Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56 Fe(n,p) 56 Mn and 59 Co (n, α) 56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  5. Particle and heavy ion transport code system, PHITS, version 2.52

    International Nuclear Information System (INIS)

    Sato, Tatsuhiko; Matsuda, Norihiro; Hashimoto, Shintaro; Iwamoto, Yosuke; Noda, Shusaku; Ogawa, Tatsuhiko; Nakashima, Hiroshi; Fukahori, Tokio; Okumura, Keisuke; Kai, Tetsuya; Niita, Koji; Iwase, Hiroshi; Chiba, Satoshi; Furuta, Takuya; Sihver, Lembit


    An upgraded version of the Particle and Heavy Ion Transport code System, PHITS2.52, was developed and released to the public. The new version has been greatly improved from the previously released version, PHITS2.24, in terms of not only the code itself but also the contents of its package, such as the attached data libraries. In the new version, a higher accuracy of simulation was achieved by implementing several latest nuclear reaction models. The reliability of the simulation was improved by modifying both the algorithms for the electron-, positron-, and photon-transport simulations and the procedure for calculating the statistical uncertainties of the tally results. Estimation of the time evolution of radioactivity became feasible by incorporating the activation calculation program DCHAIN-SP into the new package. The efficiency of the simulation was also improved as a result of the implementation of shared-memory parallelization and the optimization of several time-consuming algorithms. Furthermore, a number of new user-support tools and functions that help users to intuitively and effectively perform PHITS simulations were developed and incorporated. Due to these improvements, PHITS is now a more powerful tool for particle transport simulation applicable to various research and development fields, such as nuclear technology, accelerator design, medical physics, and cosmic-ray research. (author)

  6. Study of scission shapes in spontaneous ternary fission of 252Cf

    International Nuclear Information System (INIS)

    Singer, P.; Schwalm, D.; Thirolf, P.; Goennenwein, F.; Hesse, M.


    A new kinematic study on the ternary fission of 252 Cf has been conducted by registering prompt neutrons and fission γ rays coincidence with light charged particles (LCP) and fission fragments. The aim is to investigate changes in fragment deformation energy between the binary and ternary fission modes from measured prompt neutron angular distributions and multiplicities, and to explore the influence of light particle emission on the energy distribution, multiplicity and angular anisotropy of γ rays emitted during fragment de-excitation. The experiment was performed at the MPI Heidelberg using the Darmstadt-Heidelberg crystal ball spectrometer as γ-ray and neutron detector. Fragments were identified by a double-E measurement with an angular sensitive twin ionization chamber (IC). Light charged particles from fission were measured by ΔE-E telescopes composed of ΔE ICs and silicon PIN diodes. The telescopes enable to identify various LCPs which are emitted much more rarely than ternary α particles. The parameters of the experiment and the method of data analysis are described and first results presented. (orig.)

  7. Calculation of neutron spectra for a 252Cf transport cask using ANISN running on a PC

    International Nuclear Information System (INIS)

    West, L.; Akin, B.P.; Lemley, E.C.


    Neutron spectra have been calculated using the ANISN one-dimensional discrete ordinates code for the case of a 152 Cf source in a transport cask of a particular design. All computations were done on personal computers (PCs) (mostly 486 models) with the ANISN-ORNL (486 version) computer code. With a source of 252 Cf fission neutrons, the neutron flux spectrum in the cask cannot be characterized as open-quotes moderated.close quotes Concern about an appropriate choice for the cross-section data set has led to a comparison, for this application, of three different cross-section libraries: DABL, HILO, and BUGLE-80. Although the cross-section sets were not originally designed for PC use, the libraries have been successfully employed for PC computations. Work with yet another data library, BUGLE-93, is incomplete at this stage. From neutron flux spectra on the surface of the cask, personnel dosimetric quantities (such as dose equivalent) have been determined for the DABL, HILO, and BUGLE-80 ANISN calculations

  8. In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe

    International Nuclear Information System (INIS)

    Chung Chien; Tseng Tzucheng


    A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)

  9. Matrix effects correction on 252Cf shufflers by application of the alternating conditional expectation to neutron flux monitor data

    International Nuclear Information System (INIS)

    Pickrell, M.M.


    The 252 Cf shuffler assays fissile uranium and plutonium using active neutron interrogation and then counting the induced delayed neutrons. Using the shuffler, we conducted over 1700 assays of 55-gal. drums with 28 different matrices and several different fissionable materials. We measured the drums to diagnose the matrix and position effects on 252 Cf shuffler assays. The matrices incorporated metals, neutron poisons, and hydrogen in densities ranging from 0≤ pH ≤ 0.086 g/cm 3 , a range of cases more extreme than typically found in routine plant use. We used several neutron flux monitors during irradiation and kept statistics on the count rates of individual detector banks. The intent of these measurements was to gauge the effect of the matrix independently from the uranium assay

  10. Inverse gamma ray dose rate effect in californium-252 RBE experiment with human T-1 cells irradiated in vitro

    International Nuclear Information System (INIS)

    Todd, P.; Feola, J.M.


    Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)

  11. HeLa cell tumor response to 60Co, Cs-137, Cf-252 radiations and cisplatin chemotherapy in nude mice

    International Nuclear Information System (INIS)

    Maruyama, Y.; Feola, J.M.; Beach, J.L.


    HeLa cells were implanted into athymic nude mice from tissue culture and solid tumors established (HeLa cell tumor or HCT). Large cell numbers of 1 X 10 7 were required to obtain consistent and progressive growth, and tumor growth followed a Gompertzian mode. Irradiation studies were carried out using acute Cobalt-60 (60Co), low-dose-rate (LDR) Cs-137 and LDR Cf-252. Cf-252, a neutron-emitting radioisotope, produced an immediate tumor shrinkage and regression response after a dose of 279 cGy. Acute 60Co or LDR Cs-137 irradiation with 1000 cGy had little effect on the HCT. After a dose of 2000 cGy of 60Co radiation tumor shrinkage followed a latent period of approximately 5 days. Cisplatin had no effect on the HCT in nude mice in stationary or late exponential growth

  12. 252Cf-source-driven noise analysis measurements for characterization of concrete highly enriched uranium (HEU) storage vaults

    International Nuclear Information System (INIS)

    Valentine, T.E.; Mihalczo, J.T.


    The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material

  13. Fabrication of 50-mg 252Cf neutron sources for the FDA [Food and Drug Administration] activation analysis facility

    International Nuclear Information System (INIS)

    Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.


    The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing

  14. In situ prompt gamma-ray measurement of river water salinity in northern Taiwan using HPGe-252Cf probe

    International Nuclear Information System (INIS)

    Jiunnhsing Chao; Chien Chung


    A portable HPGe- 252 Cf probe dedicated to in situ survey of river water salinity was placed on board a fishing boat to survey the Tamsui River in northern Taiwan. The variation of water salinity is surveyed by measuring the 6111 keV chlorine prompt photopeak along the river. Results indicate that the probe can be used as a salinometer for rapid, in situ measurement in polluted rivers or sea. (author)

  15. Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane

    International Nuclear Information System (INIS)

    Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.


    A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites

  16. {sup 252}Cf spontaneous prompt fission neutron spectrum measured at 0 degree and 180 degree relative to the fragment motion

    Energy Technology Data Exchange (ETDEWEB)

    Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)


    The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.

  17. Spectroscopy of neutron-rich nuclei populated in the spontaneous fission of 252Cf and 248Cm

    International Nuclear Information System (INIS)

    Smith, A. G.; Simpson, G. S.; Billowes, J.; Durell, J. L.; Phillips, W. R.; Dagnall, P. J.; Freeman, S. J.; Leddy, M.; Roach, A. A.; Smith, J. F.


    In this paper we present research that has been carried out using the Euroball and Eurogam arrays to detect γ rays emitted from spontaneously fissioning 248 Cm and 252 Cf. The paper focuses on three sub-areas of current activity, namely, the measurement of yields of secondary fragment pairs, the measurement of state lifetimes at around spin 10, and recent measurements of g-factors of excited states in fission fragments. (c) 1999 American Institute of Physics

  18. 4π-spectrometer technique for measurements of secondary neutron average number in nuclear fission by 252Cf neutrons

    International Nuclear Information System (INIS)

    Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.


    A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet

  19. Fast neutron therapy with high intensity Cf-252 sources by remotely controlled afterloading and clinical experiences in the treatment of gynaecological cancers

    International Nuclear Information System (INIS)

    Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.


    Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure

  20. Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF

    Energy Technology Data Exchange (ETDEWEB)

    Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.

  1. Feasibility and market potential of protein determination of wheat using californium-252

    International Nuclear Information System (INIS)

    Roberts, T.C. Jr.; Eckhoff, N.D.; Clack, R.W.; Roberts, T.C. Sr.


    To evaluate the feasibility of protein determination by capture gamma-ray analysis using californium-252 neutrons, an in-situ protein analysis system for use by grain handlers has been examined. Three 227 kilogram (approximately) lots of wheat were used to determine the amount of nitrogen present. Protein analyses by the Kjeldahl method were obtained from samples taken before and after the capture gamma-ray analyses. The 5.267-MeV gamma-ray was selected for use in this study as a compromise between efficiency and interference from other elements. The associated counting equipment was a multichannel analyzer with pulse shaping electronic and analysis computing equipment. A linear regression program was used to compare the regions of interest to the Kjeldahl protein averages. The counts composing each peak were summed and normalized using the total count of the hydrogen peak. The normalized nitrogen percentages indicate a significant correlation between the spectral regions and the Kjeldahl analyses. To a first approximation, the value of wheat is the wheat protein. At the present time, protein testing of wheat is destructive, cumbersome, and time-consuming as compared to the potential for capture gamma-ray analysis testing. Assuming that such a protein analysis unit can analyze 42 tonne of wheat per hour, over 120 units would be needed to monitor one-half the U.S. annual wheat production. A 0.5% improvement in processor realizations and grain throughput value of $167.00 per tonne will result in a projected savings of $150,000 per year per unit


    Energy Technology Data Exchange (ETDEWEB)

    Shimoikura, Tomomi; Dobashi, Kazuhito [Department of Astronomy and Earth Sciences, Tokyo Gakugei University, Koganei, Tokyo 184-8501 (Japan); Saito, Hiro; Nakamura, Fumitaka [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Matsumoto, Tomoaki [Hosei University, Fujimi, Chiyoda-ku, Tokyo 102-8160 (Japan); Nishimura, Atsushi; Kimura, Kimihiro; Onishi, Toshikazu; Ogawa, Hideo, E-mail: [Department of Physical Science, Osaka Prefecture University, Sakai, Osaka 599-8531 (Japan)


    We present results of the observations carried out toward the S247, S252, and BFS52 H II regions with various molecular lines using the 1.85 m radio telescope and the 45 m telescope at Nobeyama Radio Observatory. There are at least 11 young infrared clusters (IR clusters) within the observed region. We found that there are two velocity components in {sup 12}CO (J = 2-1), and also that their spatial distributions show an anti-correlation. The IR clusters are located at their interfaces, suggesting that two distinct clouds with different velocities are colliding with each other, which may have induced the cluster formation. Based on {sup 13}CO (J = 1-0) and C{sup 18}O (J = 1-0) observations, we identified 16 clumps in and around the three H II regions. Eleven of the clumps are associated with the IR clusters and the other five clumps are not associated with any known young stellar objects. We investigated variations in the velocity dispersions of the 16 clumps as a function of the distance from the center of the clusters or the clumps. Clumps with clusters tend to have velocity dispersions that increase with distance from the cluster center, while clumps without clusters show a flat velocity dispersion over the clump extents. A {sup 12}CO outflow has been found in some of the clumps with IR clusters but not in the other clumps, supporting a strong relation of these clumps to the broader velocity dispersion region. We also estimated a mean star formation efficiency of {approx}30% for the clumps with IR clusters in the three H II regions.

  3. In situ x-ray fluorescence and californium-252 neutron activation analysis for marine and terrestrial mineral exploration

    International Nuclear Information System (INIS)

    Wogman, N.A.


    Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables

  4. The legacy of Cf-252 operations at Savannah River Technology Center: Continuous releases of radioiodine to the atmosphere

    International Nuclear Information System (INIS)

    Kantelo, M.V.; Crandall, B.S.


    The iodine isotopes I-132, 1-133, I-134, and I-135, which have half-lives ranging from 53 minutes to 21 hours, are measured in the atmospheric effluent from the Savannah River Technology Center (SRTC) at the Savannah River Site (SRS) near Aiken, South Carolina. SRS is operated by Westinghouse Savannah River Company for the US Department of Energy (DOE). The isotopes' release rates range from 10 to 300 microcuries per week compared to the rate. The resulting annual dose from all iodine isotopes is minor; it comprises 0.01 percent of the total offsite dose due to atmospheric releases from SRS in 1990. Circumstantial evidence indicates the radioiodine originates from traces of unencapsulated Cf-252. The determination that spontaneous fission of Cf-252 is the source of the radioiodine has several ramifications. Radioactive fission-product isotopes of the noble gas elements krypton and xenon must also be released. Noble gases are more volatile and mobile than iodine. Also, the released iodine isotopes decay to xenon isotopes. The noble gases decay to non-gaseous elements that are transported along with radioiodine to the terrestrial environment by deposition from the SRTC plume. Only Sr-89 is believed to accumulate sufficiently in the environment to approach detectable levels. Given similar conditions in earlier years, releases of short-lived radioiodine have occurred undetected in routine monitoring since the early 1970s. Release rates 20 years ago would have been 200 times greater than current release rates. This report documents preliminary experiments conducted by SRTC and Environmental Monitoring Section (EMS) scientists. The release process and the environmental impact of fission products from Cf-252 should be thoroughly researched

  5. A search for back-to-back e+e- pairs in the spontaneous-fission disintegration of 252Cf

    International Nuclear Information System (INIS)

    Tsunoda, T.; Nakamura, S.; Orito, S.; Minowa, M.


    A back-to-back electron-positron pair is searched for in spontaneous-fission disintegration of 252 Cf. The emission of such a pair, if observed, might be a manifestation of production and prompt decay of a heretofore unknown neutral particle. The emission rate of such a pair is found to be less than (2.5-5.5) . 10 -10 per fission at the 95% confidence level depending on the mass of the hypothetical particle which is between 40 and 200 MeV/c 2 . (orig.)

  6. Absolute measurement of ν/sub p/-bar for 252Cf by the large liquid scintillator tank technique

    International Nuclear Information System (INIS)

    Spencer, R.R.


    A vigorous effect to dispel the scandal of the approx. 2% dispersion in reported experimental values of 252 Cf ν-bar, the average number of neutrons emitted in spontaneous fission, has been underway over the past 5 years. The goal is to reduce the uncertainty in this fundamental parameter to the +- 0.25% level needed for reactor physics applications. Both new measurements and revaluation of older measurements are involved. At ORNL a new measurement is being carried out using the leage liquid scintillator neutron detector. Findings of the most recent experiment, incorporating improvements suggested in a preliminary study are discussed. 6 figures, 2 tables

  7. Possibilities of activation analysis with 252Cf sources in the area of earth sciences and mining prospection

    International Nuclear Information System (INIS)

    Melky, Sami.


    The 252 Cf neutron activation experimental set-up is composed of four sources of 225μg each, symmetrically disposed with regard to the sample axis. This installation permits the irradiation of 5 to 40cm 3 of ores, so that the analysis is done on sample weighing about 100g. This method allows, not only the determination of major and minor constituents in the sample, but also the determination of some trace elements. The experimental sensitivity of some important elements are given in mining prospection and it is shown that direct gamma spectrometry after activation permits a fast and precise determination of many elements in ores [fr

  8. Analysis of the boron pile measurement of the average neutron yield per fission of 252Cf: (AWBA development program)

    International Nuclear Information System (INIS)

    Ullo, J.J.


    The Harwell Boron Pile measurement of the average number of prompt neutrons emitted per fission, ν-bar/sub p/, of 252 Cf was analyzed in detail by a Monte Carlo method. From the calculated energy dependence of the neutron detection efficiency a value of ν-bar/sub p/ = 3.733 +- 0.022 was obtained. This value is 0.76 percent higher than the original reported value of 3.705 +- 0.015. Possible causes for this increase are discussed. 3 figures, 6 tables

  9. New isomeric states in {sup 152,154,156}Nd produced by spontaneous fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C. [Commissariat l`Energie Atomique de Saclay, Gif sur Yvette (France). DSM/DAPINA/SPhN; Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires de Bordeaux-Gradignan, Domaine du Haut Vigneau, F-33175 Gradignan (France); Belier, G.; Girod, M.; Meot, V.; Peru, S. [Commissariat a l`Energie Atomique de Bruyeres-le-Chatel, DAM/SPN, BP12, F-91680 Bruyeres-le-Chatel (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Institut de Physique Nucleaire de Lyon, F-69622 Villeurbanne Cedex (France)


    Isomeric states have been observed in fission-fragments produced by spontaneous fission of {sup 252}Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between {gamma}-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2{mu}s have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the {sup 152,154,156}Nd show evidence for K-isomers. (orig.) With 8 figs., 27 refs.

  10. A search for fine structure of the time-of-flight spectrum of the fission neutrons of 252Cf

    International Nuclear Information System (INIS)

    Scobie, J.; Scott, R.D.; Feather, N.; Vass, D.G.


    A standard time-of-flight arrangement, in which start pulses were supplied by fission fragments and stop pulses by neutrons, has been employed in an attempt to check recent claims of the existence of fine structures in the time-of-flight spectrum of the fission neutrons of 252 Cf. This structure, in the form of spikes with tails towards longer times, has been attributed to the emission of neutrons of short delay (with half-lives of a few to a hundred or so nanoseconds) in the fission process. It has not been possible to find any convincing evidence for the existence of such structure. (author)

  11. Study of biological effects of varying mixtures of Cf-252 and gamma radiation on the acute radiation syndromes: Relevance to clinical radiotherapy of radioresistant cancer

    International Nuclear Information System (INIS)

    Maruyama, Y.; Wierzbicki, J.; Feola, J.M.


    Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs

  12. Relative biological effectiveness (R.B.E.) of Cf-252 vs. acute Co-60 and low dose rate Cs-137 irradiation by spleen weight loss

    International Nuclear Information System (INIS)

    Maruyama, Y.; Feola, J.M.; Magura, C.; Beach, J.L.


    R.B.E. of Cf-252 on lymphoid tissue was assessed by radiation study of spleen weight loss following acute Co-60, and low dose rate (L.D.R.) Cs-137 and Cf-252 irradiations. Acute Co-60 and L.D.R. Cs-137 dose-response followed two component exponential curves with a 1.3-fold greater effect of L.D.R. Cs-137 vs. acute Co-60 on the first slope and 1.9-fold greater effect for the 2nd slope. L.D.R. Cf-252 response was 1.3 x greater than acute Co-60 but was 1.0 vs. L.D.R. Cs-137 for the first slope indicating a similar effect of Cf-252 mixed neutron/gamma radiation to L.D.R. gamma radiation in producing spleen shrinkage. There was no effect of different sequences and schedules of mixing acute Co-60 with Cf-252 irradiation observed by endogenous CFU-S survival. The R.B.E. of 1.0 - 1.9 indicates that lymphohemopoietic in vivo, presumably well oxygenated, does not respond acutely or as sensitively as hypoxic tumor where R.B.E. is 5 - 7. (author)

  13. Neutron reflector design with Californium 252 neutron for Boron neutron chapter therapy facility using MCNP5 simulation method

    International Nuclear Information System (INIS)

    Muhammad Fakhrurreza; Kusminanto; Y Sardjono


    In this research has made a reflector design to provide beams of Neutron for BNCT with Californium-252 radioactive source. This collimator is useful to obtain optimum epithermal neutron flux with the smallest impurity radiation (thermal neutron, fast neutron, and gamma). The design process is done using Monte Carlo N-Particle simulation version 5 (MCNP5) code to calculate the neutron flux tally form. The chosen reflector design is the reflectors which use material such as BeO ceramic with 13 cm thick. Moderator use sulfur material with the slope angle of the cone is 30°. From the calculation result, it is obtained that Reflector with 1 gram Californium-252 source can produce a neutron output thermal which has thermal neutron specification 2.23189 x 10 9 n/ 2 , epithermal neutron 3.51548 x 10 9 n/ 2 , and fast neutron 4.82241 x 10 9 n/ 2 From the result, it needs additional collimator because the BNCT requirement. (author)

  14. Photon contributions from the 252Cf and 241Am–Be neutron sources at the PSI Calibration Laboratory

    International Nuclear Information System (INIS)

    Hoedlmoser, H.; Boschung, M.; Meier, K.; Stadtmann, H.; Hranitzky, C.; Figel, M.; Mayer, S.


    At the accredited PSI Calibration Laboratory neutron reference fields traceable to the national standards of the Physikalisch-Technische Bundesanstalt (PTB) in Germany are available for the calibration of ambient and personal dose equivalent (rate) meters and passive dosimeters. The photon contribution to the ambient dose equivalent in the neutron fields of the 252 Cf and 241 Am–Be sources was measured using various photon dose rate meters and active and passive dosimeters. Measuring photons from a neutron source usually involves considerable uncertainties due to the presence of neutron induced photons in the room, due to a non-zero neutron sensitivity of the photon detector, and last but not least due to the energy response of the photon detectors. Therefore eight independent detectors and methods were used to obtain a reliable estimate for the photon contribution of the two sources as an average of the individual methods. For the 241 Am–Be source a photon contribution of approximately 4.9% was determined and for the 252 Cf source a contribution of 3.6%.

  15. Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission

    CERN Document Server

    Greenwood, R C; Gehrke, R J; Meikrantz, D H


    A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s252/Cf spontaneous fission, is currently underway using the Idaho ESOL (Elemental Separation On Line) Facility. The chemistry system used for the rare-earth elemental separations consists of two high-performance chromatography columns connected in series and coupled to the /sup 252 /Cf fission source via a helium gas-jet transport arrangement. The time delay for separation and initiation of gamma -ray counting with results which have been obtained to date with this system include the identification of a number of new neutron-rich rare-earth isotopes including /sup 155/Pm (t/sub 1/2/=48+or-4 s) and /sup 163/Gd (t/sub 1 /2/=68+or-3 s), in addition to 5.51 min /sup 158/Sm which was identified in an earlier series of experiments. (11 refs).

  16. Study the Possibility of measuring Heavy Metals Arising from Gold Mining Sample using 252Cf Neutron Source

    International Nuclear Information System (INIS)

    Soliman, N.F.


    Mining activities contribute immensely to trace element pollution .The present work studied the possibility of measuring heavy metals arising from gold mining areas Eastern Desert in Egypt using the isotopic 252 Cf neutron source. 38.5 g of the sample is irradiated in a neutron field of 252 Cf for 36.75 days and 0.3 mg of the sample is irradiated at the Pneumatic Irradiation Rabbit System (PIRS) built in the vertical thermal column of the ET-RR-2 reactor . The induced activities in the samples are measured using two high resolution f ray spectrometry systems (including two calibrated HPGe detectors). The kο standardization neutron activation analysis (kο-NAA) method was used to analyze the sample under investigation. Thermal to epithermal flux ratio fat the two irradiation positions are measured. The obtained results indicated that the values of the suspected heavy metals such as sodium, magnesium, potassium, manganese, arsenic, ruthenium and tantalum were higher than the background values, signifying accumulation of these heavy metals due to gold mining activities .The accuracy and precision of the method has been evaluated

  17. Development of the neutron reference calibration field using a {sup 252}Cf standard source surrounded with PMMA moderators

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)


    The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.

  18. Development of the neutron reference calibration field using a 252Cf standard source surrounded with PMMA moderators

    International Nuclear Information System (INIS)

    Yoshida, T.; Kanai, K.; Tsujimura, N.


    The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments

  19. Bias in calculated keff from subcritical measurements by the 252Cf-source-driven noise analysis method

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; Valentine, T.E.


    The development of MCNP-DSP, which allows direct calculation of the measured time and frequency analysis parameters from subcritical measurements using the 252 Cf-source-driven noise analysis method, permits the validation of calculational methods for criticality safety with in-plant subcritical measurements. In addition, a method of obtaining the bias in the calculations, which is essential to the criticality safety specialist, is illustrated using the results of measurements with 17.771-cm-diam, enriched (93.15), unreflected, and unmoderated uranium metal cylinders. For these uranium metal cylinders the bias obtained using MCNP-DSP and ENDF/B-V cross-section data increased with subcriticality. For a critical experiment [height (h) = 12.629 cm], it was -0.0061 ± 0.0003. For a 10.16-cm-high cylinder (k ∼ 0.93), it was 0.0060 ± 0.0016, and for a subcritical cylinder (h = 8.13 cm, k ∼ 0.85), the bias was -0.0137 ± 0.0037, more than a factor of 2 larger in magnitude. This method allows the nuclear criticality safety specialist to establish the bias in calculational methods for criticality safety from in-plant subcritical measurements by the 252 Cf-source-driven noise analysis method

  20. High sensitivity isotope analysis with a 252Cf--235U fueled subcritical multiplier and low background photon detector systems

    International Nuclear Information System (INIS)

    Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.


    A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent

  1. Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources; Importancia del coeficiente de kerma de neutrones en la planeacion de tratamientos de Braquiterapia con fuentes de Cf-252

    Energy Technology Data Exchange (ETDEWEB)

    Paredes G, L.; Balcazar G, M. [ININ, 52045 Ocoyocac, Estado de Mexico (Mexico); Azorin N, J. [Universidad Autonoma Metropolitana, 09000 Mexico D.F. (Mexico); Francois L, J.L. [UNAM, 04500 Mexico D.F. (Mexico)]. e-mail:


    The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10{sup 6} n/s-{mu}g and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E{sub n} > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E{sub n} > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of {sup 252}Cf, to optimize and to individualize the patients treatments. (Author)

  2. Determination of 114Pd cumulative yield and investigation of the fine-structure at light peak in mass distribution of 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Yu Runlan; Li Xueliang; Cui Anzhi; Guo Jingru; Yan Shuhen; Tang Peijia; Liu Daming


    A rapid radiochemical procedure for Pd separation was developed. It was the first time to use radiochemical techniques to determine 114 Pd cumulative yield (2.50 ± 0.14)% in 252 Cf spontaneous fission. The cumulative yields of (3.50 ± 0.13)% and (3.70 ± 0.11)% for 112 Pd and 113g Ag were also obtained. These are in agreement with Skovorodkin's results. The cumulative yields determined show that there is a fine-structure at light peak of mass number A = 113 in the mass distribution of 252 Cf spontaneous fission

  3. 252Cf-source-driven neutron noise measurements of subcriticality for a slab tank containing aqueous Pu-U nitrate

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; Blakeman, E.D.; Ragan, G.E.; Kryter, R.C.; Robinson, R.C.; Seino, H.


    In order to study nuclear criticality safety related to the development of fast breeder technology, 252 Cf-source-driven neutron noise analysis measurements were performed with a Pu-U nitrate solution in a slab tank of various heights and thickness varying 11.43 cm to 19.05 cm. The results and conclusions of these experiments are (1) a capability to measure the subcriticality of a multiplying system of slab geometry to a k/sub eff/ as low as 0.7 was demonstrated, (2) calculated neutron multiplication factors agreed with those from the experiments within ∼0.02, and (3) the applicability of the method for plutonium solution systems was demonstrated. This paper describes measurements in which the height of the slab was varied for a fixed thickness and the thickness varied for a fixed height, which are the first applications of this measurement method to slab geometry

  4. Neutron activation analysis of the calcium content in vivo, using a 50μg source of californium 252

    International Nuclear Information System (INIS)

    Guey, A.; Zech, P.Y.; Meary, M.F.; Leitienne, P.


    Owing to the recent commercialisation of californium 252 it is now possible to obtain neutron fluxes strong enough for precise activation of the calcium content of biological targets. After the preliminary measurements necessary to establish the most suitable conditions for irradiating 3 to 5cm thick targets, two parallel sets of experiments were developed. In the first the medium-term total calcium variation was studied in 20 rats, 16 suffering from chronic kidney deficiency. In the second the precision expected as a function of the calcium content of the irradiated target was examined, using 3 sets of tissue equivalent standards of calcium contents 5, 20 and 50g respectively. The first results obtained on calcium 49 in vivo show that a calcium content variation can be followed with a sensitivity threshold below that obtained by conventional methods [fr

  5. Experimental research on specific activity of 24Na using Chinese reference man phantom irradiated by 252Cf neutrons source

    International Nuclear Information System (INIS)

    Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan


    Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)

  6. A Monte Carlo Study on the Effect of Various Neutron Capturers on Dose Distribution in Brachytherapy with 252Cf Source

    Directory of Open Access Journals (Sweden)

    Firoozabadi M. M.


    Full Text Available Background: In neutron interaction with matter and reduction of neutron energy due to multiple scatterings to the thermal energy range, increasing the probability of thermal neutron capture by neutron captures makes dose enhancement in the tumors loaded with these materials. Objective: The purpose of this study is to evaluate dose distribution in the presence of 10B, 157Gd and 33S neutron capturers and to determine the effect of these materials on dose enhancement rate for 252Cf brachytherapy source. Methods: Neutron-ray flux and energy spectra, neutron and gamma dose rates and dose enhancement factor (DEF are determined in the absence and presence of 10B, 157Gd and 33S using Monte Carlo simulation. Results: The difference in the thermal neutron flux rate in the presence of 10B and 157Gd is significant, while the flux changes in the fast and epithermal energy ranges are insensible. The dose enhancement factor has increased with increasing distance from the source and reached its maximum amount equal to 258.3 and 476.1 cGy/h/µg for 157Gd and 10B, respectively at about 8 cm distance from the source center. DEF for 33S is equal to one. Conclusion: Results show that the magnitude of dose augmentation in tumors containing 10B and 157Gd in brachytherapy with 252Cf source will depend not only on the capture product dose level, but also on the tumor distance from the source. 33S makes dose enhancement under specific conditions that these conditions depend on the neutron energy spectra of source, the 33S concentration in tumor and tumor distance from the source.

  7. [An improved method of preparing protein and peptide probes in mass spectrometry with ionization of division fragments by californium-252 (TOF-PDMS)]. (United States)

    Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A


    The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.

  8. The use of polyimide foils to prevent contamination from self-sputtering of {sup 252}Cf deposits in high-accuracy fission counting

    Energy Technology Data Exchange (ETDEWEB)

    Gilliam, David M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail:; Yue, Andrew [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Scott Dewey, M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)


    It is demonstrated that a thin polyimide foil can be employed to prevent contamination from the self-sputtering of a {sup 252}Cf source under vacuum, with small energy loss of the emitted fission fragments, with very small effect on the efficiency of counting the fission fragments, and with a long lifetime of the plastic foils.

  9. Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

    Czech Academy of Sciences Publication Activity Database

    Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.


    Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

  10. Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Brandao, Samia de Freitas, E-mail: [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Campos, Tarcisio Passos Ribeiro de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)


    Objective: comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and methods: simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results: intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively, on the healthy tissue, on the balloon periphery and on the /{sub 1} and /{sub 2} tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively on the healthy tissue, on the target tumor and on the /{sub 1} and /{sub 2} infiltration zones. Conclusion: Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones. (author)

  11. Watermelon germplasm lines USVL246-FR2 and USVL252-FR2 tolerant to fusarium oxysporum f. sp. niveum race 2 (United States)

    Two improved germplasm lines of wild watermelon (Citrullus lanatus var. citroides) designated USVL246-FR2 and USVL252-FR2 were released in 2012 by the Agricultural Research Service of the U.S. Department of Agriculture (Wechter et al. 2012). These lines are each highly uniform for growth characteri...

  12. Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

    Directory of Open Access Journals (Sweden)

    Samia de Freitas Brandao


    Full Text Available Objective Comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and Methods Simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results Intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h-1.p-1.s, respectively, on the healthy tissue, on the balloon periphery and on the I 1 and I 2 tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h-1.p-1.s, respectively on the healthy tissue, on the target tumor and on the I 1 and I 2 infiltration zones. Conclusion Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones.

  13. Use of polyethylene pellets in the design and construction of a storage safe, a transport vessel and a portable shield for californium-252

    International Nuclear Information System (INIS)

    Sharma, S.


    A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields

  14. Time-of-flight mass spectrometer with 252Cf surface ionisation coupled with high-pressure liquid chromatography for determining pharmaceutical substances in the blood

    International Nuclear Information System (INIS)

    Danigel, H.


    Cf-252 PDMS is well suited for routine applications and can be combined with HPLC. This combined analytical system can be used for measuring the concentrations of pharmaceutical substances in body fluids on the basis of an internal standard. The results (pharmacokinetics, metabolism) indicate the necessary therapeutical dose and the efficacy of the substance applied. (DG) [de

  15. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  16. Nuclear isomerism in fission fragments produced by the spontaneous fission of {sup 252}Cf; Isomerisme nucleaire dans les fragments de fission produits dans la fission spontanee du {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Gautherin, C


    This thesis is devoted to the study of the nuclear structure of neutron-rich nuclei, via the search of isomeric nuclear states. Neutron-rich nuclei were produced in the spontaneous fission of {sup 252}Cf. The experimental study of isomeric states in these nuclei was performed with the {gamma}-array EUROGAM II, coupled to an additional and original fission fragment detector composed by photovoltaic cells, SAPhIR. The photovoltaic cells are well adapted to detect low energy heavy ions and have good energy and time resolutions to obtain a good fission fragment detection. This experiment led to the discovery of new isomeric states in {sup 135}Xe, {sup 104}Mo, {sup 146,147,148}Ce and {sup 152,154,156}Nd, with lifetimes between 60 ns and 2 {mu}s. Level schemes of these nuclei have been completed. An interpretation of the isomeric states in the nuclei {sup 154,156}Nd and {sup 156,158}Sm was performed by Hartree-Fock-Bogolyubov calculations using the DIS Gogny force with two quasi-particles excitations. The confrontation with the experimental results led to an interpretation of these isomeric states as K-isomers. (author)

  17. Abscesso pulmonar de aspiração: análise de 252 casos consecutivos estudados de 1968 a 2004 Lung abscess: analysis of 252 consecutive cases diagnosed between 1968 and 2004

    Directory of Open Access Journals (Sweden)

    José da Silva Moreira


    Full Text Available OBJETIVO: Apresentar a experiência de um serviço especializado em doenças respiratórias no manejo de casos de abscesso pulmonar de aspiração. MÉTODOS: Descrevem-se aspectos diagnósticos e resultados terapêuticos de 252 casos consecutivos de pacientes com abscesso de pulmão, hospitalizados de 1968 a 2004. RESULTADOS: Dos 252 casos, 209 ocorreram em homens e 43 em mulheres, com média de idade de 41,4 anos. Eram alcoolistas 70,2% dos pacientes. Tosse, expectoração, febre e comprometimento do estado geral ocorreram em mais de 97% dos casos, 64% tinham dor torácica, 30,2% hipocratismo digital, 82,5% apresentavam dentes em mau estado de conservação, 78,6% tiveram episódio de perda de consciência e 67,5% apresentavam odor fétido de secreções broncopulmonares. Em 85,3% dos casos as lesões localizavam-se nos segmentos posterior de lobo superior ou superior de lobo inferior, 96,8% delas unilateralmente. Em 24 pacientes houve associação de empiema pleural (9,5%. Flora mista foi identificada em secreções broncopulmonares ou pleurais em 182 pacientes (72,2 %. Todos os doentes foram inicialmente tratados com antibióticos (principalmente penicilina ou clindamicina e 98,4 % deles foram submetidos à drenagem postural. Procedimentos cirúrgicos foram efetuados em 52 (20,6% pacientes (24 drenagens de empiema, 22 ressecções pulmonares e 6 pneumostomias. Cura foi obtida em 242 pacientes (96,0% e 10 faleceram (4,0%. CONCLUSÃO: O abscesso pulmonar de aspiração ocorreu predominantemente em indivíduos adultos masculinos com doença dentária e episódio antecedente de perda de consciência (especialmente por alcoolismo. A maioria dos pacientes foi tratada clinicamente (antibióticos e drenagem postural. Um quinto deles submeteu-se a algum procedimento cirúrgico.OBJECTIVE: To relate the experience of the staff at a health care facility specializing in the management of patients with aspiration lung abscess. METHODS: Diagnostic aspects

  18. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)


    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  19. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  20. Comparison Of 252Cf Time Correlated Induced Fisssion With AmLi Induced Fission On Fresh MTR Research Reactor Fuel

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Jay Prakash [Los Alamos National Laboratory


    The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six 3He detectors as well as a shielded and collimated ion chamber. The 3He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a 252Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the 252Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The 252Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the 3He detector, which helps reduce the statistical errors in doubles when using the 252Cf interrogation source instead of

  1. Differential and integral comparisons of three representations of the prompt neutron spectrum for the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Madland, D.G.; LaBauve, R.J.; Nix, J.R.


    Because of their importance as neutron standards, we present comparisons of measured and calculated prompt fission neutron spectra N(E) and average prompt neutron multiplicities anti nu/sub p/ for the spontaneous fission of 252 Cf. In particular, we test three representations of N(E) against recent experimental measurements of the differential spectrum and threshold integral cross sections. These representations are the Maxwellian spectrum, the NBS spectrum, and the Los Alamos spectrum of Madland and Nix. For the Maxwellian spectrum, we obtain the value of the Maxwellian temperature T/sub M/ by a least-squares adjustment to the experimental differential spectrum of Poenitz and Tamura. For the Los Alamos spectrum, a similar least-squares adjustment determines the nuclear level-density parameter a, which is the single unknown parameter that appears. The NBS spectrum has been previously constructed by adjustments to eight differential spectra measured during the period 1965 to 1974. Among these three representations, we find that the Los Alamos spectrum best reproduces both the differential and integral measurements, assuming ENDF/B-V cross sections in the calculation of the latter. Although the NBS spectrum reproduces the integral measurements fairly well, it fails to satisfactorily reproduce the new differential measurement, and the Maxwellian spectrum fails to satisfactorily reproduce the integral measurements. Additionally, we calculate a value of anti nu/sub p/ from the Los Alamos theory that is within approximately 1% of experiment. 25 references

  2. Measurement of the energy spectrum of {sup 252}Cf fission fragments using nuclear track detectors and digital image processing

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa, G.; Golzarri, J. I. [UNAM, Instituto de Fisica, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Castano, V. M. [UNAM, Centro de Fisica Aplicada y Tecnologia Avanzada, Boulevard Juriquilla 3001, Santiago de Queretaro, 76230 Queretaro (Mexico); Gaso, I. [ININ, Carretera Mexico-Toluca s/n, Ocoyoacac 52750, Estado de Mexico (Mexico); Mena, M.; Segovia, N. [UNAM, Instituto de Geofisica, Circuito de la Investigacion Cientifica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)


    The energy spectrum of {sup 252}Cf fission fragments was measured using nuclear track detectors and digital image analysis system. The detection material was fused silica glass. The detectors were chemically etched in an 8% HF solution. After experimenting with various etching time, it was found that the best resolution of the track diameter distribution was obtained after 30 minutes of etching. Both Gaussian and Lorentzian curves were fit to the track diameter distribution histograms and used to determine the basic parameters of the distribution of the light (N{sub L}) and heavy (N{sub H}) formed peaks and the minimum of the central valley (N{sub V}). Advantages of the method presented here include the fully-automated analysis process, the low cost of the nuclear track detectors and the simplicity of the nuclear track method. The distribution resolution obtained by this method is comparable with the resolution obtained by electronic analysis devices. The descriptive variables calculated were very close to those obtained by other methods based on the use of semiconductor detectors. (Author)

  3. Neutron flux characterization of californium-252 Neutron Research Facility at the University of Texas - Pan American by nuclear analytical technique (United States)

    Wahid, Kareem; Sanchez, Patrick; Hannan, Mohammad


    In the field of nuclear science, neutron flux is an intrinsic property of nuclear reaction facilities that is the basis for experimental irradiation calculations and analysis. In the Rio Grande Valley (Texas), the UTPA Neutron Research Facility (NRF) is currently the only neutron facility available for experimental research purposes. The facility is comprised of a 20-microgram californium-252 neutron source surrounded by a shielding cascade containing different irradiation cavities. Thermal and fast neutron flux values for the UTPA NRF have yet to be fully investigated and may be of particular interest to biomedical studies in low neutron dose applications. Though a variety of techniques exist for the characterization of neutron flux, neutron activation analysis (NAA) of metal and nonmetal foils is a commonly utilized experimental method because of its detection sensitivity and availability. The aim of our current investigation is to employ foil activation in the determination of neutron flux values for the UTPA NSRF for further research purposes. Neutron spectrum unfolding of the acquired experimental data via specialized software and subsequent comparison for consistency with computational models lends confidence to the results.

  4. A cumulative analysis of odontogenic cysts from major dental institutions of Bangalore city: A study of 252 cases. (United States)

    Ramachandra, Prashanth; Maligi, Prathima; Raghuveer, Hp


    The objective of this study was to perform a cumulative analysis of odontogenic cysts obtained from the data of major dental institutions of Bangalore city, as well as to evaluate their distribution during a 5-year period and compare the results with other international studies. Data for the study were obtained from the reports of patients diagnosed with odontogenic cysts between 2005 and 2010 from different dental institutions of Bangalore. Case records of patients that fit the histological classification of the World Health Organization (WHO) (2005) were included in the study and the following variables were analyzed: age, gender, anatomic location, and histological type. In a total of 252 cyst specimens diagnosed, 79.76% were odontogenic cysts and 20.24% were nonodontogenic cysts. Among the odontogenic cysts most frequent lesions were radicular cysts (50.25%), followed by keratocysts (27.36%) and dentigerous cysts (22.39%). Our study provides a cumulative data of odontogenic cysts in the population of Bangalore city. The results of our study showed a similar frequency of odontogenic cysts as compared to other populations of the world, with radicular cyst being identified as the most frequent odontogenic cyst. Keratocyst was the second most common cyst followed by dentigerous cyst.

  5. 252Cf-source-correlated transmission measurements for uranyl fluoride deposit in a 24-in.-OD process pipe

    International Nuclear Information System (INIS)

    Uckan, T.; Mihalczo, J.T.; Valentine, T.E.; Mullens, J.A.


    Characterization of a hydrated uranyl fluoride (UO 2 F 2 ·nH 2 O) deposit in a 17-ft-long, 24-in.-OD process pipe at the former Oak Ridge Gaseous Diffusion Plant was successfully performed by using 252 Cf-source-correlated time-of-flight (TOF) transmission measurements. These measurements of neutrons and gamma rays through the pipe from an external 2521 Cf fission source were used to measure the deposit profile and its distribution along the pipe, the hydration (or H/U), and the total uranium mass. The measurements were performed with a source in an ionization chamber on one side of the pipe and detectors on the other. Scanning the pipe vertically and horizontally produced a spatial and time-dependent radiograph of the deposit in which transmitted gamma rays and neutrons were separated in time. The cross-correlation function between the source and the detector was measured with the Nuclear Weapons Identification System. After correcting for pipe effects, the deposit thickness was determined from the transmitted neutrons and H/U from the gamma rays. Results were consistent with a later intrusive observation of the shape and the color of the deposit; i.e., the deposit was annular and was on the top of the pipe at some locations, demonstrating the usefulness of this method for deposit characterization

  6. Sensitivity of the 252Cf(sf neutron observables to the FREYA input yield functions Y(A, Z, TKE

    Directory of Open Access Journals (Sweden)

    Randrup Jørgen


    Full Text Available Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A and Y (TKE|A. For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.

  7. Sensitivity of the 252Cf(sf) neutron observables to the FREYA input yield functions Y(A, Z, TKE) (United States)

    Randrup, Jørgen; Talou, Patrick; Vogt, Ramona


    Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE) used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A) and Y (TKE|A). For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.

  8. Challenges using a 252Cf shuffler instrument in a plant environment to measure mixtures of uranium and plutonium transuranic waste

    International Nuclear Information System (INIS)

    Hurd, J.R.


    An active-passive 252 Cf shuffler instrument, installed and certified several years ago at Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU) waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here

  9. In Plant Measurement and Analysis of Mixtures of Uranium and Plutonium TRU-Waste Using a 252Cf Shuffler Instrument

    International Nuclear Information System (INIS)

    Hurd, J.R.


    The active-passive 252 Cf shuffler instrument, installed and certified several years ago in Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU)-waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here

  10. Experimental Investigation on Propagation Characteristics of PD Radiated UHF Signal in Actual 252 kV GIS

    Directory of Open Access Journals (Sweden)

    Tianhui Li


    Full Text Available For partial discharge (PD diagnostics in gas insulated switchgears (GISs based on the ultra-high-frequency (UHF method, it is essential to study the attenuation characteristics of UHF signals so as to improve the application of the UHF technique. Currently, the performance of UHF has not been adequately considered in most experimental research, while the constructive conclusions about the installation and position of UHF sensors are relatively rare. In this research, by using a previously-designed broadband sensor, the output signal is detected and analyzed experimentally in a 252 kV GIS with L-shaped structure and disconnecting switch. Since the relative position of the sensor and the defect is usually fixed by prior research, three circumferential angle positions of the defect in cross section are performed. The results are studied by time, statistics and frequency analyses. This identifies that the discontinuity conductor of DS will lead to a rise of both the peak to peak value (Vpp and the transmission rate of the UHF signal. Then, the frequency analysis indicates that the reason for the distinction of signal amplitude and transmission rate is that the mode components of the PD signal are distinctively affected by the special structure of GIS. Finally, the optimal circumferential angle position of the UHF Sensor is given based on the comparison of transmission rates.

  11. Feasibility of fissile mass assay of spent nuclear fuel using 252Cf-source-driven frequency-analysis

    International Nuclear Information System (INIS)

    Mattingly, J.K.; Valentine, T.E.; Mihalczo, J.T.


    The feasibility was evaluated using MCNP-DSP, an analog Monte Carlo transport cod to simulate source-driven measurements. Models of an isolated Westinghouse 17x17 PWR fuel assembly in a 1500-ppM borated water storage pool were used. In the models, the fuel burnup profile was represented using seven axial burnup zones, each with isotopics estimated by the PDQ code. Four different fuel assemblies with average burnups from fresh to 32 GWd/MTU were modeled and analyzed. Analysis of the fuel assemblies was simulated by inducing fission in the fuel using a 252 Cf source adjacent to the assembly and correlating source fissions with the response of a bank of 3 He detectors adjacent to the assembly opposite the source. This analysis was performed at 7 different axial positions on each of the 4 assemblies, and the source-detector cross-spectrum signature was calculated for each of these 28 simulated measurements. The magnitude of the cross-spectrum signature follows a smooth upward trend with increasing fissile material ( 235 U and 239 Pu) content, and the signature is independent of the concentration of spontaneously fissioning isotopes (e.g., 244 Cm) and (α,n) sources. Furthermore, the cross-spectrum signature is highly sensitive to changes in fissile material content. This feasibility study indicated that the signature would increase ∼100% in response to an increase of only 0.1 g/cm 3 of fissile material

  12. Monte Carlo design study of a moderated {sup 252}Cf source for in vivo neutron activation analysis of aluminium

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, D.G.; Natto, S.S.A.; Evans, C.J. [Swansea In Vivo Analysis and Cancer Research Group, Department of Physics, University of Wales, Swansea (United Kingdom); Ryde, S.J.S. [Swansea In Vivo Analysis and Cancer Research Group, Department of Medical Physics and Clinical Engineering, Singleton Hospital, Swansea (United Kingdom)


    The Monte Carlo computer code MCNP has been used to design a moderated 2{sup 52}Cf neutron source for in vivo neutron activation analysis of aluminium (Al) in the bones of the hand. The clinical motivation is the need to monitor l body burden in subjects with renal dysfunction, at risk of Al toxicity. The design involves the source positioned on the central axis at one end of a cylindrical deuterium oxide moderator. The moderator is surrounded by a graphite reflector, with the hand inserted at the end of the moderator opposing the source. For a 1 mg {sup 252}Cf source, 15 cm long x 20 cm radius moderator and 20 cm thick reflector, the estimated minimum detection limit is .5 mg Al for a 20 min irradiation, with an equivalent dose of 16.5 mSv to the hand. Increasing the moderator length and/or introducing a fast neutron filter (for example silicon) further reduces interference from fast-neutron-induced reactions on phosphorus in bone, at the expense of decreased fluence of the thermal neutrons which activate Al. Increased source strengths may be necessary to compensate for this decreased thermal fluence, or allow measurements to be made within an acceptable time limit for the comfort of the patient. (author)

  13. Cross-sections of 197Au(n,α)198Au and 63Cu(n,α)64Cu induced by 252Cf neutrons

    International Nuclear Information System (INIS)

    Mandal, Ranjita; Sengupta, D.; Roy, Malobika; Naik, Mamta; Bhoraskar, V.N.


    Analytical work, employing nuclear techniques, is normally carried out through (n,α) reaction because of the availability of neutrons either from reactors or laboratory sources such as Sb-Be, Am-Be, Ra-Be, Po-Be, 252 Cf, etc. The laboratory neutron sources are though portable and adaptable to a particular experimental arrangement, suffer from the disadvantage of slow neutron yield (except 252 Cf). In this set up since the neutrons available are monoenergetic, it was thought appropriate to initiate a program to measure cross-sections of a few nuclear reactions which have practical applications. Earlier studies on cross-section measurement of the reaction 197 Au(n,α) 198 Au and 63 Cu(n,α) 64 Cu has been carried out using different sources, monitors and techniques

  14. Gamma-ray multiplicity measurement of the spontaneous fission decay of 252Cf in a segmented HPGe/BGO detector array

    Energy Technology Data Exchange (ETDEWEB)

    Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M


    Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.

  15. Design of a thermal neutron field by 252Cf source for measurement of 10B concentrations in the blood samples for BNCT

    International Nuclear Information System (INIS)

    Naito, H.; Sakurai, Y.; Maruhashi, A.


    10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)

  16. Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

  17. Project 252Cf-D2O. The multisphere system of neutron dosimetry and spectrometry (M.S.-N.D.S.). Studies of applications to health physics

    International Nuclear Information System (INIS)

    Zaborowski, H.L.


    The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr

  18. Calculation of neutron and gamma-ray energy spectra in liquid air and liquid nitrogen due to 14-MeV neutron and californium-252 sources

    International Nuclear Information System (INIS)

    Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.


    Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data

  19. Multielemental nondestructive neutron activation analysis of Dy, Mn, Eu, Na, Ga, W, La and Sm involving cyclic irradiations with 252Cf

    International Nuclear Information System (INIS)

    Narkhede, S.S.; Turel, Z.R.


    Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs

  20. Shielding evaluation of a medical linear accelerator vault in preparation for installing a high-dose rate 252Cf remote after-loader

    International Nuclear Information System (INIS)

    Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.


    In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)

  1. Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1

    International Nuclear Information System (INIS)

    Kim, Kang Seog


    The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.

  2. Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kang Seog [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States). Consortium for Advanced Simulation of LWRs (CASL)


    The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.

  3. Deepwater Horizon MC252 incident wellhead location and bathymetry data from the Environmental Resource Management Application (ERMA) collected between 2010-06-01 to 2010-07-31 in the Northern Gulf of Mexico (NCEI Accession 0163804) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This Archival Information Package (AIP) contains three Environmental Resource Management Application (ERMA) GIS layers that depict the Mississippi Canyon 252...

  4. Quantum mechanical/molecular mechanical calculated reactivity networks reveal how cytochrome P450cam and Its T252A mutant select their oxidation pathways. (United States)

    Wang, Binju; Li, Chunsen; Dubey, Kshatresh Dutta; Shaik, Sason


    Quantum mechanical/molecular mechanical calculations address the longstanding-question of a "second oxidant" in P450 enzymes wherein the proton-shuttle, which leads to formation of the "primary-oxidant" Compound I (Cpd I), was severed by mutating the crucial residue (in P450cam: Threonine-252-to-Alanine, hence T252A). Investigating the oxidant candidates Cpd I, ferric hydroperoxide, and ferric hydrogen peroxide (Fe(III)(O2H2)), and their reactions, generates reactivity networks which enable us to rule out a "second oxidant" and at the same time identify an additional coupling pathway that is responsible for the epoxidation of 5-methylenylcamphor by the T252A mutant. In this "second-coupling pathway", the reaction starts with the Fe(III)(O2H2) intermediate, which transforms to Cpd I via a O-O homolysis/H-abstraction mechanism. The persistence of Fe(III)(O2H2) and its oxidative reactivity are shown to be determined by interplay of substrate and protein. The substrate 5-methylenylcamphor prevents H2O2 release, while the protein controls the Fe(III)(O2H2) conversion to Cpd I by nailing-through hydrogen-bonding interactions-the conformation of the HO(•) radical produced during O-O homolysis. This conformation prevents HO(•) attack on the porphyrin's meso position, as in heme oxygenase, and prefers H-abstraction from Fe(IV)OH thereby generating H2O + Cpd I. Cpd I then performs substrate oxidations. Camphor cannot prevent H2O2 release and hence the T252A mutant does not oxidize camphor. This "second pathway" transpires also during H2O2 shunting of the cycle of wild-type P450cam, where the additional hydrogen-bonding with Thr252 prevents H2O2 release, and contributes to a successful Cpd I formation. The present results lead to a revised catalytic cycle of Cytochrome P450cam.

  5. Polycyclic aromatic hydrocarbon concentrations across the Florida Panhandle continental shelf and slope after the BP MC 252 well failure

    International Nuclear Information System (INIS)

    Snyder, Richard A.; Ederington-Hagy, Melissa; Hileman, Fredrick; Moss, Joseph A.; Amick, Lauren; Carruth, Rebecca; Head, Marie; Marks, Joel; Tominack, Sarah; Jeffrey, Wade H.


    Graphical abstract: The R/V Bellows, Florida Institute of Oceanography (FIO), with faculty and students from the University of West Florida (UWF), sampling mats of oil floating over the continental shelf south of Pensacola Florida during the BP MC 252 well failure. PAH concentrations in sediments on the shelf declined over time after the well was capped with a half life of ∼200 days. - Highlights: • PAHs concentrations were highest in slope sediments near the failed well site. • PAH concentrations in the shelf sediments were highest during the oil spill. • PAHs concentrations declined over time since the spill. - Abstract: The Florida Panhandle continental shelf environment was exposed to oil from the BP oil well failure in the Gulf of Mexico during 2010. Floating mats of oil were documented by satellite, but the distribution of dissolved components of the oil in this region was unknown. Shipek® grab samples of sediments were taken during repeated cruises between June 2010 and June 2012 to test for selected polycyclic aromatic hydrocarbons (PAHs) as indicators of this contamination. Sediments were collected as composite samples, extracted using standard techniques, and PAHs were quantified by GC/MS-SIM. PAHs in samples from the continental slope in May 2011 were highest near to the failed well site and were reduced in samples taken one year later. PAHs from continental shelf sediments during the spill (June 2010) ranged from 10 to 165 ng g −1 . Subsequent cruises yielded variable and reduced amounts of PAHs across the shelf. The data suggest that PAHs were distributed widely across the shelf, and their subsequent loss to background levels suggests these compounds were of oil spill origin. PAH half-life estimates by regression were 70–122 days for slope and 201 days for shelf stations

  6. Effect of Macondo Prospect 252 Oil on Microbiota Associated with Pelagic Sargassum in the Northern Gulf of Mexico. (United States)

    Torralba, Manolito G; Franks, James S; Gomez, Andres; Yooseph, Shibu; Nelson, Karen E; Grimes, D Jay


    The environmental impact of major oil spills on marine microorganisms has yet to be thoroughly investigated using molecular biology techniques. The Deepwater Horizon (DWH) drilling rig explosion of 2010 affected an approximately 176,000 km 2 surface area of the Gulf of Mexico (GOM) when an estimated 210 million gallons of oil from the Macondo Prospect spilled into the environment. Pelagic Sargassum, a complex of two surface drifting species (Sargassum natans and Sargassum fluitans) of marine brown macroalgae and a critically important habitat in the GOM ecosystem, was suffused by Macondo Prospect 252 oil released during the DWH event. Using 16S rRNA PCR and Roche 454 pyrosequencing, the effect of the oil on the bacterial population associated with pelagic Sargassum and contiguous waters was examined by comparing sequence data generated from samples collected from oiled and non-oiled locations in the northern GOM. Sequence data showed similar microbial composition in Sargassum regardless of exposure to oil primarily dominated by five phyla; Proteobacteria, Bacteroidetes, Actinobacteria, Verrucomicrobia, and unclassified bacteria. The microbial composition in water samples was significantly less diverse than for Sargassum and consisted primarily of Proteobacteria, Firmicutes, and Bacteroidetes. Due to the evenly distributed abundance of microbial species on oiled and non-oiled pelagic Sargassum, study findings indicate that DWH spilled oil had minimal effect on the composition and diversity of the microbial community associated with Sargassum and contiguous waters. However, higher abundances of Sulfitobacter and one species of Psychrobacter were found in oiled water samples when compared to non-oiled water samples indicating some effect of DHW oil in the microbial composition of seawater. Though there are a number of marine studies using molecular biology approaches, this is the first molecular examination of the impact of the DWH oil spill on bacterial communities

  7. 1987 Neutron and gamma personnel dosimeter intercomparison study using a D2O-moderated 252Cf source

    International Nuclear Information System (INIS)

    Swaja, R.E.; West, L.E.; Sims, C.S.; Welty, T.J.


    The thirteenth Personnel Dosimetry Intercomparison Study (i.e., PDIS 13) was conducted during April 1987 as a joint effort by Oak Ridge National Laboratory's (ORNL) Dosimetry Applications Research Group and the Southwest Radiation Calibration Center at the University of Arkansas. A total of 48 organizations (34 from the US and 14 from abroad) participated in PDIS 13. Participants submitted a total of 1,113 neutron and gamma dosimeters for this mixed field study. The dosimeters were transferred by mail and were handled by experimental personnel at ORNL and the University of Arkansas. The type of neutron dosimeter and the percentage of participants submitting that type are as follows: TLD-albedo (49%), direct interaction TLD (31%), CR-39 (17%), film (3%). The type of gamma dosimeter and the percentage of participants submitting that type are as follows: Li 2 B 4 O 7 , alone or in combination with CaSO 4 , (69%), 7 LiF (28%), natural LiF (3%). Radiation exposures in PDIS 13 were limited to 0.5 and 1.5 mSv from 252 Cf moderated by 15-cm of D 2 O. Traditional exposures using the Health Physics Research Reactor (HPRR) were not possible due to the fact that all reactors at ORNL, including the HPRR, were shutdown by order of the Department of Energy at the time the intercomparison was performed. Planned exposures using a 238 PuBe source were negated by a faulty timing mechanism. Based on accuracy and precision, direct interaction TLD dosimeters exhibited the best performance in PDIS 13 neutron measurements. They were followed, in order of best performance, by CR-39, TLD albedo, and film. The Li 2 B 4 O 7 type TLD dosimeters exhibited the best performance in PDIS 13 gamma measurements. They were followed by natural LiF, 7 LiF, and film. 12 refs., 1 fig., 5 tabs

  8. Editorial 25.2


    Guimarães, Ailton Vitor


    A Trabalho & Educação publica, neste número, artigos que tratam desde as questões relacionadas a uma análise clínica do trabalho, considerando a organização da saúde do trabalhador e uma análise do trabalho prescrito e sua distinção do trabalho real, passando por abordagens do trabalho docente, no que diz respeito ao envelhecimento dos(as) trabalhadores(as) da educação, seu desgaste na função docente, a produção de saberes na sua atuação em disciplinas de formação técnica e como a interação e...

  9. Use of californium-252 neutron irradiator for in-vivo analysis of the bone calcium content of the hand

    International Nuclear Information System (INIS)

    Guey, A.; Leitienne, P.; Zech, P.Y.; Traeger, J.; Doyen, J.B.; Breton, J.P.


    With californium-252 it is easy to obtain a high neutron flux of the order of 10 9 n/s. The mean energy of this radiation, which is close on 2 MeV, activates calcium very well. The authors describe a storage and irradiator unit with a 100 μg californium source, with which it will henceforth be possible to develop this technique of measuring the calcium of the hand in a hospital. The test programme has three distinct phases: (1) irradiation of the biological target for 10 min; (2) after a transfer period of 30 s, detection of the radiation emitted by the 49 Ca for 600 s; (3) processing of the numerical data received, which are transmitted on line to a T 1600 calculator. The weight is found by comparing the activity induced in the unknown calcium mass with that induced in a phantom chosen as the activity standard. The reproducibility of the method is of the order of 3% (5% at the worst). The gross standardized result is edited automatically. For physical and clinical reasons, the hand is chosen as the reference part of the body in 70 control subjects. The local irradiation dose is less than 2 rem. The bone calcium content is 14.3+-1.9 g in men and 10.1+-1.3 g in women. In clinical application of the technique it is necessary to differentiate between the normal calcium content and the calcium content found with a pathological state. This makes it necessary to express the measurement in the form of a volume mass (rho). The volume of the hand skeleton (V in cm 3 ) is calculated from the corresponding bone surface (S in cm 2 ) measured by planimetry with the relationship V=8.925 exp 0.0205.S, found after studying 80 hand skeletons. In our control subjects the calcium bone volume mass was 0.288 g/cm 3 in men and 0.282 g/cm 3 in women. There is a very significant difference (p<0.001) in a population of 88 subjects with chronic renal insufficiencies at the terminal stage: rho=0.233 in men and 0.235 in women

  10. Microarray analysis of DNA damage repair gene expression profiles in cervical cancer cells radioresistant to 252Cf neutron and X-rays

    International Nuclear Information System (INIS)

    Qing, Yi; Wang, Ge; Wang, Dong; Yang, Xue-Qin; Zhong, Zhao-Yang; Lei, Xin; Xie, Jia-Yin; Li, Meng-Xia; Xiang, De-Bing; Li, Zeng-Peng; Yang, Zhen-Zhou


    The aim of the study was to obtain stable radioresistant sub-lines from the human cervical cancer cell line HeLa by prolonged exposure to 252 Cf neutron and X-rays. Radioresistance mechanisms were investigated in the resulting cells using microarray analysis of DNA damage repair genes. HeLa cells were treated with fractionated 252 Cf neutron and X-rays, with a cumulative dose of 75 Gy each, over 8 months, yielding the sub-lines HeLaNR and HeLaXR. Radioresistant characteristics were detected by clone formation assay, ultrastructural observations, cell doubling time, cell cycle distribution, and apoptosis assay. Gene expression patterns of the radioresistant sub-lines were studied through microarray analysis and verified by Western blotting and real-time PCR. The radioresistant sub-lines HeLaNR and HeLaXR were more radioresisitant to 252 Cf neutron and X-rays than parental HeLa cells by detecting their radioresistant characteristics, respectively. Compared to HeLa cells, the expression of 24 genes was significantly altered by at least 2-fold in HeLaNR cells. Of these, 19 genes were up-regulated and 5 down-regulated. In HeLaXR cells, 41 genes were significantly altered by at least 2-fold; 38 genes were up-regulated and 3 down-regulated. Chronic exposure of cells to ionizing radiation induces adaptive responses that enhance tolerance of ionizing radiation and allow investigations of cellular radioresistance mechanisms. The insights gained into the molecular mechanisms activated by these 'radioresistance' genes will lead to new therapeutic targets for cervical cancer

  11. Crystal structure of the tyrosine kinase domain of the hepatocyte growth factor receptor c-Met and its complex with the microbial alkaloid K-252a. (United States)

    Schiering, Nikolaus; Knapp, Stefan; Marconi, Marina; Flocco, Maria M; Cui, Jean; Perego, Rita; Rusconi, Luisa; Cristiani, Cinzia


    The protooncogene c-met codes for the hepatocyte growth factor receptor tyrosine kinase. Binding of its ligand, hepatocyte growth factor/scatter factor, stimulates receptor autophosphorylation, which leads to pleiotropic downstream signaling events in epithelial cells, including cell growth, motility, and invasion. These events are mediated by interaction of cytoplasmic effectors, generally through Src homology 2 (SH2) domains, with two phosphotyrosine-containing sequence motifs in the unique C-terminal tail of c-Met (supersite). There is a strong link between aberrant c-Met activity and oncogenesis, which makes this kinase an important cancer drug target. The furanosylated indolocarbazole K-252a belongs to a family of microbial alkaloids that also includes staurosporine. It was recently shown to be a potent inhibitor of c-Met. Here we report the crystal structures of an unphosphorylated c-Met kinase domain harboring a human cancer mutation and its complex with K-252a at 1.8-A resolution. The structure follows the well established architecture of protein kinases. It adopts a unique, inhibitory conformation of the activation loop, a catalytically noncompetent orientation of helix alphaC, and reveals the complete C-terminal docking site. The first SH2-binding motif (1349YVHV) adopts an extended conformation, whereas the second motif (1356YVNV), a binding site for Grb2-SH2, folds as a type II Beta-turn. The intermediate portion of the supersite (1353NATY) assumes a type I Beta-turn conformation as in an Shc-phosphotyrosine binding domain peptide complex. K-252a is bound in the adenosine pocket with an analogous binding mode to those observed in previously reported structures of protein kinases in complex with staurosporine.

  12. Spectrum-averaged cross-section measurement of /sup 103/Rh(n,n)/sup 103m/Rh in the /sup 252/Cf fission neutron spectrum

    International Nuclear Information System (INIS)

    Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.


    Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given

  13. Analysis of existing data and specification of an experiment to determine the 252Cf half-life to the required degree of accuracy

    International Nuclear Information System (INIS)

    Lorenz, A.; Kharitonov, I.A.


    The methods used and the results obtained in measurements of the 252 Cf half-life are analyzed. In calculating the weighted mean value, additional error components as well as those given by the authors are taken into account. In order to reduce the error in the weighted mean value to less than 0.1%, the need and the requirements for an exact measurement are specified. A half-life of 2.6473±0.0028 years is recommended. (author). 16 refs, 3 tabs

  14. Determination of the multiplication factor and its bias by the 252Cf-source technique: A method for code benchmarking with subcritical configurations

    International Nuclear Information System (INIS)

    Perez, R.B.; Valentine, T.E.; Mihalczo, J.T.; Mattingly, J.K.


    A brief discussion of the Cf-252 source driven method for subcritical measurements serves as an introduction to the concept and use of the spectral ratio, Γ. It has also been shown that the Monte Carlo calculation of spectral densities and effective multiplication factors have as a common denominator the transport propagator. This commonality follows from the fact that the Neumann series expansion of the propagator lends itself to the Monte Carlo method. On this basis a linear relationship between the spectral ratio and the effective multiplication factor has been shown. This relationship demonstrates the ability of subcritical measurements of the ratio of spectral densities to validate transport theory methods and cross sections

  15. Study of fission mechanism with the reactions 230Th, 231Pa, 235U, 237Np(n,f) and 252Cf(fs)

    International Nuclear Information System (INIS)

    Benfoughal, T.


    In this work, the different stages of the nuclear fission process have been investigated. The analysis of fission cross-section and fission fragment angular distribution measurements are made using the hypothesis of asymmetrically deformed states. From the correlation between fissioning nucleus excitation energy and fragment total kinetic energy measurement for several fissioning systems, it is shown that the nuclear viscosity is relatively strong during the saddle-point to scission-point transition. The study of the spontaneous fission of 252 Cf shows that the fragment mass and kinetic energy distributions are mainly determinated by the nucleon shell effects and pairing correlations [fr

  16. Thermal neutron imaging with rare-earth-ion-doped LiCaAlF6 scintillators and a sealed 252Cf source

    International Nuclear Information System (INIS)

    Kawaguchi, Noriaki; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei; Fukuda, Kentaro; Suyama, Toshihisa; Watanabe, Kenichi; Yamazaki, Atsushi; Chani, Valery; Yoshikawa, Akira


    Thermal neutron imaging with Ce-doped LiCaAlF 6 crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF 6 scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF 6 single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm 2 was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The 252 Cf source ( 6 .

  17. The magnetic properties of oxide spinel Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} solid solutions

    Energy Technology Data Exchange (ETDEWEB)

    Masrour, R., E-mail: [Laboratory of Materials, Processes, Environment and Quality, Cady Ayyed University, National School of Applied Sciences, Sidi bouzid, Safi (Morocco); LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Hamedoun, M. [Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco); Benyoussef, A. [LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco)


    The exchange interactions (J{sub BB} and J{sub AB} are the intra and the inter-sublattice exchange interactions between neighbouring spins, respectively) are obtained by using the general expressions of canting angle and critical temperature obtained by mean field theory of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4}. The expression of magnetic energy of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained for different spin configurations and dilution x. The saturation magnetisation of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained with different values of dilution x. The magnetic phase diagram of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} materials is obtained by high temperature series expansions (HTSEs). The critical exponent associated with the magnetic susceptibility of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is deduced.

  18. Rapid Evolution to Blast Crisis Associated with a Q252H ABL1 Kinase Domain Mutation in e19a2 BCR-ABL1 Chronic Myeloid Leukaemia

    Directory of Open Access Journals (Sweden)

    Sarah L. McCarron


    Full Text Available A minority of chronic myeloid leukaemia (CML patients express variant transcripts of which the e19a2 BCR-ABL1 fusion is the most common. Instances of tyrosine kinase inhibitor (TKI resistance in e19a2 BCR-ABL1 CML patients have rarely been reported. A case of e19a2 BCR-ABL1 CML is described in whom imatinib resistance, associated with a Q252H ABL1 kinase domain mutation, became apparent soon after initiation of TKI therapy. The patient rapidly transformed to myeloid blast crisis (BC with considerable bone marrow fibrosis and no significant molecular response to a second generation TKI. The clinical course was complicated by comorbidities with the patient rapidly succumbing to advanced disease. This scenario of Q252H-associated TKI resistance with rapid BC transformation has not been previously documented in e19a2 BCR-ABL1 CML. This case highlights the considerable challenges remaining in the management of TKI-resistant BC CML, particularly in the elderly patient.

  19. Influence of paternal 252Cf neutron exposure on abnormal sperm, embryonal lethality, and liver tumorigenesis in the F1 offspring of mice

    International Nuclear Information System (INIS)

    Watanabe, Hiromitsu; Takahashi, Tadateru; Lee, Juing-Yi


    Experiments were conducted to determine whether neutron-induced genetic damage in parental germline cells can lead to the development of cancer in the offspring. Seven-week-old C3H male mice were irradiated with 252 Cf neutrons at a dose of 0, 50, 100, or 200 cGy. Two weeks or 3 months after irradiation, the male mice were mated with virgin 9-week-old C57BL females. Two weeks after irradiation, the irradiated male mice showed an increased incidence of sperm abnormalities, which led to embryo lethalities in a dose-dependent manner when they were mated with unirradiated female mice. Furthermore, liver tumors in male offspring of male mice in the 50 cGy group were significantly increased in 19 of 44 (43.2%) animals, in clear contrast to the unirradiated group (1 of 31; 3.2%) (P 1 generation may be caused by genetic transmission of hepatoma-associated trait (s) induced by 252 Cf neutron irradiation. (author)

  20. Evaluation of the 252Cf-source-driven neutron noise analysis method for measuring the subcriticality of LWR fuel storage casks

    International Nuclear Information System (INIS)

    Mihalczo, J.T.


    The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed

  1. Optical and near-infrared survey of the stellar contents associated with the star-forming complex Sh2-252 (United States)

    Jose, Jessy; Pandey, A. K.; Ogura, K.; Samal, M. R.; Ojha, D. K.; Bhatt, B. C.; Chauhan, N.; Eswaraiah, C.; Mito, H.; Kobayashi, N.; Yadav, R. K.


    We present the analyses of the stellar contents associated with the extended H II region Sh2-252 using deep optical UBVRI photometry, slit and slitless spectroscopy along with the near-infrared (NIR) data from Two-Micron All-Sky Survey (2MASS) for an area ˜ 1 × 1 deg2. We have studied the sub-regions of Sh2-252, which includes four compact-H II (CH II ) regions, namely A, B, C and E, and two clusters, NGC 2175s and Teutsch 136 (Teu 136). Of the 15 spectroscopically observed bright stars, eight have been identified as massive members of spectral class earlier than B3. From the spectrophotometric analyses, we derived the average distance of the region as 2.4 ± 0.2 kpc, and the reddening E(B - V) of the massive members is found to vary between 0.35 and 2.1 mag. We found that NGC 2175s and Teu 136, located towards the eastern edge of the complex, are the sub-clusters of Sh2-252. The stellar surface density distribution in K band shows clustering associated with the regions A, C, E, NGC 2175s and Teu 136. We have also identified the candidate ionizing sources of the CH II regions. 61 Hα emission sources are identified using slitless spectroscopy. The distribution of the Hα emission sources and candidate young stellar objects (YSOs) with IR excess on the V/(V - I) colour-magnitude diagram (CMD) shows that a majority of them have approximate ages between 0.1 and 5 Myr and masses in the range of 0.3-2.5 M⊙. The optical CMDs of the candidate pre-main-sequence (PMS) sources in the individual regions also show an age spread of 0.1-5 Myr for each of them. We calculated the K-band luminosity functions (KLFs) for the sub-regions A, C, E, NGC 2175s and Teu 136. Within errors, the KLFs for all the sub-regions are found to be similar and comparable to that of young clusters of age <5 Myr. We also estimated the mass function of the PMS sample of the individual regions in the mass range of 0.3-2.5 M⊙. In general, the slopes of the MFs of all the sub-regions are found

  2. The observation of quasi-molecular ions from a tiger snake venom component (Msub(r) 13309) using 252Cf-plasma desorption mass spectrometry

    International Nuclear Information System (INIS)

    Kamensky, I.; Haakansson, P.; Kjellberg, J.; Sundqvist, B.; Fohlman, J.; Peterson, P.A.


    A method involving fast heavy-ion bombardment of a solid sample called 252 Cf-plasma desorption mass spectrometry has been used to study a non-enzymatic, non-toxic phospholipase homolog from Australian tiger snake (Notechis scutatus) venom. The protein consists of 119 amino acids in a single polypeptide chain cross-linked by 7 disulfide bridges. The isotopically averaged molecular mass as determined by protein sequence analysis is 13309 atomic mass units (amu). The mass distributions were studied by means of time-of-flight measurements. Quasi-molecular ions associated to the molecule and its dimer were observed. The mass of the quasi-molecular ion corresponding to the molecule was determined to be 13285 +- 25 amu. (Auth.)

  3. Coulomb effects in isobaric cold fission from reactions 233U(nth,f), 235U(nth,f),239Pu(nth,f) and 252Cf(sf)

    International Nuclear Information System (INIS)

    Montoya, Modesto


    The Coulomb effect hypothesis, formerly used to interpret fluctuations in the curve of maximal total kinetic energy as a function of light fragment mass in reactions 233 U(n th ,f), 235 U(n th ,f) and 239 Pu(n th ,f), is confirmed in high kinetic energy as well as in low excitation energy windows, respectively. Data from reactions 233 U(n th ,f), 235 U(n th ,f), 239 Pu(n th ,f) and 252 Cf(sf) show that, between two isobaric fragmentations with similar Q-values, the more asymmetric charge split reaches the higher value of total kinetic energy. Moreover, in isobaric charge splits with different Q-values, similar preference for asymmetrical fragmentations is observed in low excitation energy windows. (author).

  4. Analysis of linear energy transfers and quality factors of charged particles produced by spontaneous fission neutrons from 252Cf and 244Pu in the human body

    International Nuclear Information System (INIS)

    Endo, A.; Sato, T.


    Absorbed doses, linear energy transfers (LETs) and quality factors of secondary charged particles in organs and tissues, generated via the interactions of the spontaneous fission neutrons from. 252 Cf and. 244 Pu within the human body, were studied using the Particle and Heavy Ion Transport Code System (PHITS) coupled with the ICRP Reference Phantom. Both the absorbed doses and the quality factors in target organs generally decrease with increasing distance from the source organ. The analysis of LET distributions of secondary charged particles led to the identification of the relationship between LET spectra and target-source organ locations. A comparison between human body-averaged mean quality factors and fluence-averaged radiation weighting factors showed that the current numerical conventions for the radiation weighting factors of neutrons, updated in ICRP103, and the quality factors for internal exposure are valid. (authors)

  5. The development and medical applications of a simple facility for partial body in vivo neutron activation analysis using californium-252 sources

    International Nuclear Information System (INIS)

    Boddy, K.


    A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations

  6. Lawrence Livermore National Laboratory and Sandia National Laboratory Nuclear Accident Dosimetry Support of IER 252 and the Dose Characterization of the Flattop Reactor at the DAF

    Energy Technology Data Exchange (ETDEWEB)

    Hickman, D. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Jeffers, K. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Radev, R. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tai, L. I. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ward, D. C. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Leonard, E. I. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)


    In support of IER 252 “Characterization of the Flattop Reactor at the NCERC”, LLNL performed ROSPEC measurements of the neutron spectrum and deployed 129 Personnel Nuclear Accident Dosimeters (PNAD) to establish the need for height corrections and verification of neutron spectrum evaluation of the fluences and dose. A very limited number of heights (typically only one or two heights) can be measured using neutron spectrometers, therefore it was important to determine if any height correction would be needed in future intercomparisons and studies. Specific measurement positions around the Flatttop reactor are provided in Figure 1. Table 1 provides run and position information for LLNL measurements. The LLNL ROSPEC (R2) was used for run numbers 1 – 7, and vi. PNADs were positioned on trees during run numbers 9, 11, and 13.

  7. A fast neutron and dual-energy gamma-ray absorption method (NEUDEG) for investigating materials using a 252Cf source

    International Nuclear Information System (INIS)

    Bartle, C. Murray


    DEXA (dual-energy X-ray absorption) is widely used in airport scanners, industrial scanners and bone densitometers. DEXA determines the properties of materials by measuring the absorption differences of X-rays from a bremsstrahlung tube source with and without filtering. Filtering creates a beam with a higher mean energy, which causes lower material absorption. The absorption difference between measurements (those with a filter subtracted from those without a filter) is a positive number that increases with the effective atomic number of the material. In this paper, the concept of using a filter to create a dual beam and an absorption difference in materials is applied to radiation from a 252 Cf source, called NEUDEG (neutron and dual-energy gamma absorption). NEUDEG includes absorptions for fast neutrons as well as the dual photon beams and thus an incentive for developing the method is that, unlike DEXA, it is inherently sensitive to the hydrogen content of materials. In this paper, a model for the absorption difference and absorption sum in NEUDEG is presented using the combined gamma ray and fast neutron mass attenuation coefficients. Absorption differences can be either positive or negative in NEUDEG, increasing with increases in the effective atomic number and decreasing with increases in the hydrogen content. Sample sets of absorption difference curves are calculated for materials with typical gamma-ray and fast neutron mass attenuation coefficients. The model, which uses tabulated mass attenuated coefficients, agrees with experimental data for porcelain tiles and polyethylene sheets. The effects of “beam hardening” are also investigated. - Highlights: • Creation of a dual neutron/gamma beam from 252 Cf is described. • An absorption model is developed using mass attenuation coefficients. • A graphical method is used to show sample results from the model. • The model is successfully compared with experimental results. • The importance of

  8. Comparative analysis of bacterial community-metagenomics in coastal Gulf of Mexico sediment microcosms following exposure to Macondo oil (MC252)

    KAUST Repository

    Koo, Hyunmin


    The indigenous bacterial communities in sediment microcosms from Dauphin Island (DI), Petit Bois Island (PB) and Perdido Pass (PP) of the coastal Gulf of Mexico were compared following treatment with Macondo oil (MC252) using pyrosequencing and culture-based approaches. After quality-based trimming, 28,991 partial 16S rRNA sequence reads were analyzed by rarefaction, confirming that analyses of bacterial communities were saturated with respect to species diversity. Changes in the relative abundances of Proteobacteria, Bacteroidetes and Firmicutes played an important role in structuring bacterial communities in oil-treated sediments. Proteobacteria were dominant in oil-treated samples, whereas Firmicutes and Bacteroidetes were either the second or the third most abundant taxa. Tenericutes, members of which are known for oil biodegradation, were detected shortly after treatment, and continued to increase in DI and PP sediments. Multivariate statistical analyses (ADONIS) revealed significant dissimilarity of bacterial communities between oil-treated and untreated samples and among locations. In addition, a similarity percentage analysis showed the contribution of each species to the contrast between untreated and oil-treated samples. PCR amplification using DNA from pure cultures of Exiguobacterium,  Pseudoalteromonas,  Halomonas and Dyadobacter, isolated from oil-treated microcosm sediments, produced amplicons similar to polycyclic aromatic hydrocarbon-degrading genes. In the context of the 2010 Macondo blowout, the results from our study demonstrated that the indigenous bacterial communities in coastal Gulf of Mexico sediment microcosms responded to the MC252 oil with altered community structure and species composition. The rapid proliferation of hydrocarbonoclastic bacteria suggests their involvement in the degradation of the spilt oil in the Gulf of Mexico ecosystem.

  9. Corrective Action Investigation Plan for Corrective Action Unit 252: Area 25 Engine Test Stand 1 Decontamination Pad, Nevada Test Site, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, Nevada Operations Office


    This Corrective Action Investigation Plan contains the U.S. Department of Energy, Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 252 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 252 consists of Corrective Action Site (CAS) 25-07-02, Engine Test Stand-1 (ETS-1) Decontamination Pad. Located in Area 25 at the intersection of Road H and Road K at the Nevada Test Site, ETS-1 was designed for use as a mobile radiation checkpoint and for vehicle decontamination. The CAS consists of a concrete decontamination pad with a drain, a gravel-filled sump, two concrete trailer pads, and utility boxes. Constructed in 1966, the ETS-1 facility was part of the Nuclear Rocket Development Station (NRDS) complex and used to test nuclear rockets. The ETS-1 Decontamination Pad and mobile radiation check point was built in 1968. The NRDS complex ceased primary operations in 1973. Based on site history, the focus of the field investigation activities will be to determine if any primary contaminants of potential concern (COPCs) (including radionuclides, total volatile organic compounds, total semivolatile organic compounds, total petroleum hydrocarbons as diesel-range organics, Resource Conservation and Recovery Act metals, total pesticides, and polychlorinated biphenyls) are present at this site. Vertical extent of migration of suspected vehicle decontamination effluent COPCs is expected to be less than 12 feet below ground surface. Lateral extent of migration of COPCs is expected to be limited to the sump area or near the northeast corner of the decontamination pad. Using a biased sampling approach, near-surface and subsurface sampling will be conducted at the suspected worst-case areas including the sump and soil near the northeast corner of the decontamination pad. The results of this field investigation will support a defensible e

  10. Nonmosaic tetrasomy 15q25.2 → qter identified with SNP microarray in a patient with characteristic facial appearance and review of the literature. (United States)

    Xu, Huihui; Xiao, Bing; Ji, Xing; Hu, Qin; Chen, Yingwei; Qiu, Wenjuan


    Tetrasomy for the distal chromosome 15q is rare, and only 22 patients (including 6 cases without detailed information) have been described to date in the literature. Here we report on another patient with nonmosaic tetrasomy 15q25.2-qter resulted from an inverted duplication of distal chromosome 15. This patient presents with features of development delay, arachnodactyly, joint contractures and typical facial dysmorphism including frontal bossing, short palpebral fissures, long philtrum, low-set ears, high-arched palate and retrognathia. Unlike most of the related patients, abdominal ultrasound test and brain MRI showed normal. Karyotyping analysis revealed a supernumerary marker chromosome presented in all metaphase cells examined. Parental karyotyping analysis was normal, indicating a de novo chromosome aberration of the patient. SNP microarray analysis found a two copy gain of 17.7 Mb from the distal long arm of chromosome 15 (15q25.2-qter). Further FISH analysis using SureFISH 15q26.3 IGF1R probe proved an inverted duplication of distal long arm of chromosome 15. The segmental duplications which lie in the hotspots of 15q24-26 might increase the susceptibility of chromosome rearrangement. Compared with the George-Abraham' study [2012], ADAMTSL3 might be more related to the cardiac disorders in tetrasomy 15q patients. Considering all patients reported in the literature, different mosaic degrees and segmental sizes don't correlate to the severity of phenotypes. A clear delineation on tetrasomy for distal chromosome 15q could still be investigated. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. Some characteristics of two azoreductase systems in rat liver. Relevance to the activity of 2-[4'-di(2"-bromopropyl)-aminophenylazo]benzoic acid (CB10-252), a compound possessing latent cytotoxic activity

    DEFF Research Database (Denmark)

    Autrup, Herman; Warwick, Gerald P.


    -azoreductase was reduced by menadione (vitamin K3), cyanide and propylgallate. A diaphorase preparation from pig heart reduced both CB10-252 and methylred with both NADPH- and NADH-generating systems. The properties listed above and dependency of enzyme activity on both NADH and NADPH indicate a similarity of CB-10...

  12. Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub-Saharan Africa: implications for the susceptibility to meningococcal disease. (United States)

    Franco-Jarava, C; Comas, D; Orren, A; Hernández-González, M; Colobran, R


    Complement C5 deficiency (C5D) is a rare primary immunodeficiency associated with recurrent infections, particularly meningitis, by Neisseria species. To date, studies to elucidate the molecular basis of hereditary C5D have included fewer than 40 families, and most C5 mutations (13 of 17) have been found in single families. However, the recently described C5 p.A252T mutation is reported to be associated with approximately 7% of meningococcal disease cases in South Africa. This finding raises the question of whether the mutation may be prevalent in other parts of Africa or other continental regions. The aim of this study was to investigate the prevalence of C5 p.A252T in Africa and other regions and discuss the implications for prophylaxis against meningococcal disease. In total, 2710 samples from healthy donors within various populations worldwide were analysed by quantitative polymerase chain reaction (qPCR) assay to detect the C5 p.A252T mutation. Eleven samples were found to be heterozygous for p.A252T, and nine of these samples were from sub-Saharan African populations (allele frequency 0·94%). Interestingly, two other heterozygous samples were from individuals in populations outside Africa (Israel and Pakistan). These findings, together with data from genomic variation databases, indicate a 0·5-2% prevalence of the C5 p.A252T mutation in heterozygosity in sub-Saharan Africa. Therefore, this mutation may have a relevant role in meningococcal disease susceptibility in this geographical area. © 2017 British Society for Immunology.

  13. Characterization of neutron spectra using sources of {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderated in water; Caracterização de espectros neutrônicos com fontes de {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderados em água

    Energy Technology Data Exchange (ETDEWEB)

    Gonçalves, A.S.; Silva, F.S.; Patrão, K.C.S.; Fonseca, E.S. da; Pereira, W.W., E-mail: [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Laboratório de Metrologia de Nêutrons


    Recent studies have demonstrated the importance of characterizing the spectrum of neutron sources for various energies in order to make the understanding of neutron interaction closer to reality they work with. This work presents the determination of neutron energy flux from the source of {sup 241}AmBe (0.6 TBq), {sup 238}PuBe (1.8 TBq) and {sup 252}Cf (120 μg) free in the air and inserted into spheres of various diameters containing distilled water. The determination of the spectrum is based on the measurement and simulation by the Monte Carlo computational method, using the sources under study, with the Bonner multisphere spectrometer containing readings with the detector without sphere and covered with polyethylene balls of diameters: 5,08 cm (2 ″), 7.62 cm (3″), 12.70 cm (5 ″), 20.32 cm (8 ″), 25.40 cm (10 ″) and 30.48 cm (12 ″). It is sought to characterize a new moderate spectrum in water using the sources of {sup 241}AmBe, {sup 238}PuBe and {sup 252}Cf that may be useful for testing, calibration and irradiation of individual and area monitors for neutrons.

  14. 5He, 7He, and 8Li (E*=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Kopatch, Yu.N.; Mutterer, M.; Schwalm, D.; Thirolf, P.; Goennenwein, F.


    The neutron-unstable odd-N isotopes 5 He, 7 He, and 8 Li (in its excited state of E*=2.26 MeV) were measured to show up as short-lived (τ≅10 -21 -10 -20 s) intermediate light charged particles (LCPs) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs, and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1x10 -21 s, and 4x10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E*=2.26 MeV (lifetime: 2x10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the 'true' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α particles registered, and to 16.4(3) MeV for the true ternary α particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li* was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed

  15. 5He, 7He and 8Li (E=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Kopatch, Yu. N.; Goennenwein, F.


    The neutron-unstable odd-N isotopes 5 He, 7 He and 8 Li (in its excited state of E * = 2.26 MeV) were measured to show up as short-lived intermediate light-charged-particles (LCP) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1 x 10 -21 s, and 4 x 10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E * = 2.26 MeV (lifetime: 2 x 10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the ''true'' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α-particles registered, and to 16.4(3) MeV for the true ternary α-particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li * was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed. (orig.)

  16. Standard test method for nondestructive assay of nuclear material in scrap and waste by passive-Active neutron counting using 252Cf shuffler

    CERN Document Server

    American Society for Testing and Materials. Philadelphia


    1.1 This test method covers the nondestructive assay of scrap and waste items for U, Pu, or both, using a 252Cf shuffler. Shuffler measurements have been applied to a variety of matrix materials in containers of up to several 100 L. Corrections are made for the effects of matrix material. Applications of this test method include measurements for safeguards, accountability, TRU, and U waste segregation, disposal, and process control purposes (1, 2, 3). 1.1.1 This test method uses passive neutron coincidence counting (4) to measure the 240Pu-effective mass. It has been used to assay items with total Pu contents between 0.03 g and 1000 g. It could be used to measure other spontaneously fissioning isotopes such as Cm and Cf. It specifically describes the approach used with shift register electronics; however, it can be adapted to other electronics. 1.1.2 This test method uses neutron irradiation with a moveable Cf source and counting of the delayed neutrons from the induced fissions to measure the 235U equiva...

  17. Angular distributions of target fragments from the reactions of 292 MeV - 25.2 GeV 12C with 197Au and 238U

    International Nuclear Information System (INIS)

    Morita, Y.


    The angular distributions of the 197 Au target fragments were all forwardly peaked. Extensively forward peaked angular distributions were observed at the non-relativistic projectile energies (292 MeV, 1.0 GeV). No obvious differences were observed in the angular distributions at the different relativistic projectile energies of 3.0 GeV, 12.0 GeV and 25.2 GeV. The characteristic angular distribution pattern from the relativistic projectile energy experiments was also observed in the non-relativistic energy experiments. Maximum degree of forward-peaking in the angular distributions at each projectile energy was observed at the product mass number (A) around 190 from the 292 MeV projectile energy, at A = 180 from 1.0 GeV and at A =175 from 3.0 GeV and 12.0 GeV. In general, two different types of angular distributions were observed in the relativistic projectile energy experiments with the 238 U target. Isotropic angular distributions were observed for the fission product nuclides. The angular distributions of the fission products at the intermediate (292 MeV) energy showed slightly forward peaked angular distributions. Because of the long projectile-target interaction time in the primary nuclear reaction, larger momentum was transferred from the projectile to the target nucleus. Steep forward-peaked angular distributions were also observed with the 238 U target

  18. p.Ser252Trp and p.Pro253Arg mutations in FGFR2 gene causing Apert syndrome: the first clinical and molecular report of Indonesian patients. (United States)

    Mundhofir, Farmaditya E P; Sistermans, Erik A; Faradz, Sultana M H; Hamel, Ben C J


    Apert syndrome (AS) is a rare autosomal dominant disorder characterised by craniosynostosis and limb malformations, and is associated with congenital heart disease and other systemic malformations, including intellectual disability. We report two Indonesian patients with AS, in whom molecular analysis detected p.Ser252Trp (c.755C>G) and p.Pro253Arg (c.758C>G) mutations in the fibroblast growth factor receptor 2 (FGFR2) gene, respectively. Although the syndrome has been frequently described, this is the first clinical report of AS confirmed by molecular analysis in Indonesia. The difference in severity of clinical features in the two patients may be consistent with a genotype-phenotype correlation of the FGFR2mutation. The management of individuals with AS is best achieved within a multidisciplinary setting. However, in most developing countries, early intervention may be delayed due to late diagnosis, a lack of facilities and financial constraints. This report underpins the benefits of early diagnosis for AS management.

  19. Measurement of the fission yields of selected prompt and decay fission product gamma-rays of spontaneously fissioning 252Cf and 244Cm

    International Nuclear Information System (INIS)

    Reber, E.L.; Gehrke, R.J.; Aryaeinejad, R.; Hartwell, J.K.


    Gamma-ray spectrometry measurements have been made of the fission yields of selected γ -rays emitted by the spontaneously fissioning isotopes 252 Cf and 244 Cm. The measured γ-rays were selected based on their relative abundance in the spectrum and their freedom from interference or, in a few instances, ease of interference correction. From these data and the cumulative and independent yield data of England and Rider, those γ-rays that are primarily produced by radioactive decay, as opposed to direct yield, were converted into the decays per spontaneous fission expressed in percent and compared to cumulative yield values of England and Rider. For those γ-rays whose production is dominated by direct (independent) yield, the ratio of γ-rays per spontaneous fission is reported. The γ-ray yield can be compared to the independent yield values of England and Rider when 100% of the direct feeding passes through the γ-ray. In those cases where both cumulative and independent yields contribute to the observed γ-ray emission rate, a direct comparison is not possible but a method to quantify the contribution from each is proposed. (author)

  20. Study of the average charge states of 188Pb and 252,254No ions at the gas-filled separator TASCA

    International Nuclear Information System (INIS)

    Khuyagbaatar, J.; Ackermann, D.; Andersson, L.-L.; Ballof, J.; Brüchle, W.; Düllmann, Ch.E.; Dvorak, J.; Eberhardt, K.; Even, J.; Gorshkov, A.; Graeger, R.; Heßberger, F.-P.; Hild, D.; Hoischen, R.; Jäger, E.; Kindler, B.


    The average charge states of 188 Pb and 252,254 No ions in dilute helium gas were measured at the gas-filled recoil separator TASCA. Hydrogen gas was also used as a filling gas for measurements of the average charge state of 254 No. Helium and hydrogen gases at pressures from 0.2 mbar to 2.0 mbar were used. A strong dependence of the average charge state on the pressure of the filling gases was observed for both, helium and hydrogen. The influence of this dependence, classically attributed to the so-called “density effect”, on the performance of TASCA was investigated. The average charge states of 254 No ions were also measured in mixtures of helium and hydrogen gases at low gas pressures around 1.0 mbar. From the experimental results simple expressions for the prediction of average charge states of heavy ions moving in rarefied helium gas, hydrogen gas, and in their mixture were derived.

  1. Thermal neutron imaging with rare-earth-ion-doped LiCaAlF{sub 6} scintillators and a sealed {sup 252}Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Kawaguchi, Noriaki, E-mail: [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fukuda, Kentaro; Suyama, Toshihisa [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Watanabe, Kenichi; Yamazaki, Atsushi [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center, Tohoku University, Sendai 980-8579 (Japan)


    Thermal neutron imaging with Ce-doped LiCaAlF{sub 6} crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF{sub 6} scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF{sub 6} single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm{sup 2} was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The {sup 252}Cf source (<1 MBq) was sealed with 43 mm of polyethylene for neutron thermalization. Alphabet-shaped Cd pieces with a thickness of 2 mm were used as a mask for the thermal neutrons. After corrections for the pedestals and gain of each pixel, we successfully obtained two-dimensional neutron images using Ce-doped LiCaAlF{sub 6}.

  2. Experimental microcosm study of the effects of Deepwater Horizon MC-252 oil on the geochemistry and microbiology of Gulf Coast sediment (United States)

    Donahoe, R. J.; Bej, A.; Raulerson, A.; Rentschler, E. K.


    Microcosm experiments were conducted to examine the impact of oil contamination on Gulf Coast sediment geochemistry and microbial population dynamics. Coastal sediment and seawater were collected from a salt marsh at Bayou la Batre, Alabama, which was not severely impacted by the BP Deepwater Horizon accident of April 2010. Sediment/seawater microcosms were set up in glass jars combusted for 5 hours at 450 degrees C. Non-sterile microcosms spiked with 500 ppm of MC-252 oil were sacrificed in duplicate at various time intervals over a 14 day period to establish a data time series. Sterile controls with and without oil and a non-sterile control without oil were sacrificed in duplicate at 14 days for comparison with the time-series experiments. Solid and aqueous phases were separated by centrifugation and prepared for analysis. Sediment mineralogy was determined using X-ray diffraction and acid-extractable sediment chemistry determined using EPA Method 3051A and ICP-OES analysis. The aqueous phase chemistry was analyzed by ICP-OES and ion chromatography. The mineralogy of the salt marsh sediment is predominantly quartz, but includes reactive phases such as clays (smectite, illite), feldspar, and iron oxide. Iron-bearing clays and iron oxides can serve as electron acceptors for the growth of Fe(III)-reducing bacteria. Microwave digestions of the microcosm substrate samples were performed in triplicate and show no significant variation in major element chemistry over the course of the two week experiment, suggesting that observed temporal trends in aqueous geochemistry may be due to ion exchange processes, rather than mineral dissolution reactions. Microcosm substrate trace element data which indicate possible differences with time are being analyzed for statistical significance. Analysis of aqueous solution geochemistry reveals several interesting temporal trends. Iron and manganese were released to solution after 2 days, suggesting the presence of facultative

  3. New fit of thermal neutron constants (TNC for 233,235U, 239,241Pu and 252Cf(sf: Microscopic vs. maxwellian data

    Directory of Open Access Journals (Sweden)

    Pronyaev Vladimir G.


    Full Text Available An IAEA project to update the Neutron Standards is near completion. Traditionally, the Thermal Neutron Constants (TNC evaluated data by Axton for thermal-neutron scattering, capture and fission on four fissile nuclei and the total nu-bar of 252Cf(sf are used as input in the combined least-square fit with neutron cross section standards. The evaluation by Axton (1986 was based on a least-square fit of both thermal-spectrum averaged cross sections (Maxwellian data and microscopic cross sections at 2200 m/s. There is a second Axton evaluation based exclusively on measured microscopic cross sections at 2200 m/s (excluding Maxwellian data. Both evaluations disagree within quoted uncertainties for fission and capture cross sections and total multiplicities of uranium isotopes. There are two factors, which may lead to such difference: Westcott g-factors with estimated 0.2% uncertainties used in the Axton's fit, and deviation of the thermal spectra from Maxwellian shape. To exclude or mitigate the impact of these factors, a new combined GMA fit of standards was undertaken with Axton's TNC evaluation based on 2200 m/s data used as a prior. New microscopic data at the thermal point, available since 1986, were added to the combined fit. Additionally, an independent evaluation of TNC was undertaken using CONRAD code. Both GMA and CONRAD results are consistent within quoted uncertainties. New evaluation shows a small increase of fission and capture thermal cross sections, and a corresponding decrease in evaluated thermal nubar for uranium isotopes and 239Pu.

  4. Distinct difference in relative biological effectiveness of 252Cf neutrons for the induction of mitotic crossing over and intragenic reversion of the white-ivory allele in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Yoshikawa, Isao; Hoshi, Masaharu; Ikenaga, Mituo


    The relative biological effectiveness (RBE) of 252 Cf neutrons was determined for two different types of somatic mutations, i.e., loss of heterozygosity for wing-hair mutations and reversion of the mutant white-ivory eye-color, in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change in the white locus on the X-chromosome. For a quantitative comparison of RBE values for these events, we have constructed a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clones can be detected simultaneously in the same individuals. Larvae were irradiated at the age of 80±4 h post-oviposition with 252 Cf neutrons or 137 Cs γ-rays, and male adult flies were examined under the microscope for the presence of the two types of clonal mosaic spots appearing. The induction of wing-hair spots per dose unit was much greater for 252 Cf neutrons than for 137 Cs γ -rays, whereas the frequencies of eye-color reversion were similar for neutrons and γ-rays. The estimated RBE values of neutrons were 8.5 and 1.2 for the induction of mutant wing-hair spots and revertant eye-color spots, respectively. These results indicate that the RBE of neutrons is much greater for mitotic crossing over in comparison to the intragenic white-ivory reversion events. Possible causes for the difference in RBE are discussed

  5. Neutron beam experiments using nuclear research reactors: honoring the retirement of professor Bernard W. Wehring -II. 5. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

    International Nuclear Information System (INIS)

    Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik


    In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient

  6. Measurement of the average number of prompt neutrons emitted per fission of 235U relative to 252Cf for the energy region 500 eV to 10 MeV

    International Nuclear Information System (INIS)

    Gwin, R.; Spencer, R.R.; Ingle, R.W.; Todd, J.H.; Weaver, H.


    The average number of prompt neutrons emitted per fission ν/sub p/-bar(E), was measured for 235 U relative to ν/sub p/-bar for the spontaneous fission of 252 Cf over the neutron energy range from 500 eV to 10 MeV. The samples of 235 U and 252 Cf were contained in fission chambers located in the center of a large liquid scintillator. Fission neutrons were detected by the large liquid scintillator. The present values of ν/sub p/-bar(E) for 235 U are about 0.8% larger than those measured by Boldeman. In earlier work with the present system, it was noted that Boldeman's value of ν/sub p/-bar(E) for thermal energy neutrons was about 0.8% lower than obtained at ORELA. It is suggested that the thickness of the fission foil used in Boldeman's experiment may cause some of the discrepancy between his and the present values of ν/sub p/-bar(E). For the energy region up to 700 keV, the present values of ν/sub p/-bar(E) for 235 U agree, within the uncertainty, with those given in ENDF/B-V. Above 1 MeV the present results for ν/sub p/-bar(E) range about the ENDF/B-V values with differences up to 1.3%. 6 figures, 1 table

  7. Measurement of Inclusive ep Cross Sections at High Q2 at sqrt(s) = 225 and 252 GeV and of the Longitudinal Proton Structure Function FL at HERA

    CERN Document Server

    Andreev, V.; Baghdasaryan, S.; Begzsuren, K.; Belousov, A.; Belov, P.; Boudry, V.; Brandt, G.; Brinkmann, M.; Brisson, V.; Britzger, D.; Buniatyan, A.; Bylinkin, A.; Bystritskaya, L.; Campbell, A.J.; Cantun Avila, K.B.; Ceccopieri, F.; Cerny, K.; Chekelian, V.; Contreras, J.G.; Dainton, J.B.; Daum, K.; De Wolf, E.A.; Diaconu, C.; Dobre, M.; Dodonov, V.; Dossanov, A.; Dubak, A.; Eckerlin, G.; Egli, S.; Elsen, E.; Favart, L.; Fedotov, A.; Feltesse, J.; Ferencei, J.; Fleischer, M.; Fomenko, A.; Gabathuler, E.; Gayler, J.; Ghazaryan, S.; Glazov, A.; Goerlich, L.; Gogitidze, N.; Gouzevitch, M.; Grab, C.; Grebenyuk, A.; Greenshaw, T.; Grindhammer, G.; Habib, S.; Haidt, D.; Henderson, R.C.W.; Herbst, M.; Hildebrandt, M.; Hladky, J.; Hoffmann, D.; Horisberger, R.; Hreus, T.; Huber, F.; Jacquet, M.; Janssen, X.; Jung, A.W.; Jung, H.; Kapichine, M.; Kiesling, C.; Klein, M.; Kleinwort, C.; Kogler, R.; Kostka, P.; Kretzschmar, J.; Kruger, K.; Landon, M.P.J.; Lange, W.; Laycock, P.; Lebedev, A.; Levonian, S.; Lipka, K.; List, B.; List, J.; Lobodzinski, B.; Lubimov, V.; Malinovski, E.; Martyn, H.U.; Maxfield, S.J.; Mehta, A.; Meyer, A.B.; Meyer, H.; Meyer, J.; Mikocki, S.; Morozov, A.; Muller, K.; Naumann, Th.; Newman, P.R.; Niebuhr, C.; Nowak, G.; Nowak, K.; Olivier, B.; Olsson, J.E.; Ozerov, D.; Pahl, P.; Pascaud, C.; Patel, G.D.; Perez, E.; Petrukhin, A.; Picuric, I.; Pirumov, H.; Pitzl, D.; Placakyte, R.; Pokorny, B.; Polifka, R.; Radescu, V.; Raicevic, N.; Raspereza, A.; Ravdandorj, T.; Reimer, P.; Rizvi, E.; Robmann, P.; Roosen, R.; Rostovtsev, A.; Rotaru, M.; Rusakov, S.; Salek, D.; Sankey, D.P.C.; Sauter, M.; Sauvan, E.; Schmitt, S.; Schoeffel, L.; Schoning, A.; Schultz-Coulon, H.C.; Sefkow, F.; Shushkevich, S.; Soloviev, Y.; Sopicki, P.; South, D.; Spaskov, V.; Specka, A.; Steder, M.; Stella, B.; Straumann, U.; Sykora, T.; Thompson, P.D.; Traynor, D.; Truol, P.; Tsakov, I.; Tseepeldorj, B.; Turnau, J.; Valkarova, A.; Vallee, C.; Van Mechelen, P.; Vazdik, Y.; Wegener, D.; Wunsch, E.; Zacek, J.; Zhang, Z.; Zlebcik, R.; Zohrabyan, H.; Zomer, F.


    Inclusive ep double differential cross sections for neutral current deep inelastic scattering are measured with the H1 detector at HERA. The data were taken with a lepton beam energy of 27.6 GeV and two proton beam energies of Ep = 460 and 575 GeV corresponding to centre-of-mass energies of 225 and 252 GeV, respectively. The measurements cover the region of 6.5 *10^{-4}<=x<= 0.65 for 35<=Q^2<=800 GeV^2 up to y = 0.85. The measurements are used together with previously published H1 data at Ep = 920 GeV and lower Q2 data at Ep = 460, 575 and 920 GeV to extract the longitudinal proton structure function FL in the region 1.5<=Q^2 <=800 GeV^2.

  8. Oxidation of M252 but not M428 in hu-IgG1 is responsible for decreased binding to and activation of hu-FcγRIIa (His131). (United States)

    Cymer, Florian; Thomann, Marco; Wegele, Harald; Avenal, Cecile; Schlothauer, Tilman; Gygax, Daniel; Beck, Hermann


    Oxidation of monoclonal therapeutic antibodies (mAbs) can affect binding to Fc-receptors and potentially influence pharmacokinetics or effector functions like e.g. antibody dependent cellular phagocytosis (ADCP). Recently, it has been demonstrated that binding to FcγRIIa (H131) is affected by methionine oxidation of the Fc-portion but it is currently unknown which methionine is responsible for decreased binding. We separated an oxidized IgG1 monoclonal antibody based on the oxidation state of methionine 252 and analyzed fractionated material in receptor binding experiments as well as in functional (cell-based) assays. Although the unfractionated mixture demonstrated weaker interaction/activation of the receptor, differently oxidized isolated subspecies can lead both to stronger as well as weaker binding and activation of the histidine variant of FcγRIIa. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Transuranium processing plant report of production, status, and plans for the period October 1, 1978-September 30, 1980

    International Nuclear Information System (INIS)

    King, L.J.; Bigelow, J.E.; Collins, E.D.


    During this period, transuranium elements were obtained from 26 irradiated HFIT targets. The products included 86 mg of 249 Bk, 686 mg of 252 Cf, 3.1 mg of 253 Es, and an estimated 1.4 pg of 257 Fm. In addition, about 326 mg of high-purity 248 Cm was separated from previously purified 252 Cf. One hundred seven product shipments were made from TRU; recipients and the amounts of nuclides shipped are listed in a table. Forty-two standard and two special HFIR targets were fabricated. During the next 18 months, production totals of 110 mg of 249 Bk, 1200 mg of 252 Cf, 5.5 mg of 253 Es, and 2 pg of 257 Fm are anticipated. Also, a total of 225 mg of 248 Cm is expected to be made available. During this report period, a charcoal adsorber system for radioiodine removal was installed, tested, and placed in service. This system serves as a backup to the Hopcalite-charcoal system for adsorption of 131 I from the VOG stream. Seven 252 Cf neutron sources were fabricated during this report period. A total of 100 neutron sources have been fabricated previously at TRU. The original and current contents ( 252 Cf and 248 Cm) of the existing sources and the individuals to whom the sources are currently loaned are listed in a table. In addition to neutron sources, nine fission sources were prepared by electroplating 252 Cf onto platinum disks or foils.Special projects during this report period included (1) purification of two batches of isotopically pure 240 Pu, (2) fabrication of two special HFIR targets, (3) repurification of the residues of the einsteinium product from Campaign 56, (4) production of approx. 235 μg of 250 Cf by irradiation of 249 Bk, (5) radiography of 28 irradiated, stainless steel alloy, fracture-strain specimens, and (6) preparations for the production of 40 μg of 245 Es by irradiation of 253 Es

  10. Use of neutron activation and X-ray fluorescence with radioactive sources (Cf-252 and Am-241) for the instrumental qualiquantitative simultaneous analysis of some elements in samples of mineral supplement for animals

    International Nuclear Information System (INIS)

    Simabuco, S.M.


    To study the possibility of using two non-destructive (neutron activation and X-ray fluorescence) analyses in simultaneous quali-quantitative evaluations of some elements in mineral supplement for animals, a Cf-252 neutron source (11.3 mCi; 21.1 μgrams) and a Am-241 low energy gamma-ray emitter source (59.5 KeV; 100 mCi) were employed. For these sources, shieldings and sample irradiation systems were built. For the neutron activation analysis a reservoir of 72 cm height and 43 cm diameter was filled with paraffine, and the samples and neutron sources were put inside this reservoir using polypropilene and nylon tubes. To detect the gamma-rays emitted by the radioisotopes a well-type solid NaI(Tl) crystal scintillator (3x3') was used, coupled to a multi-channel analyser. For the X-ray fluorescence analysis a lead cylinder of 9.75 cm height and 5.6 cm diameter (with 0.7 cm thickness) was made and internally lined with a 0.36 mm copper and 0.1 mm aluminium foil. (Author) [pt

  11. Testing of an oral dosing technique for double-crested cormorants, Phalacocorax auritus, laughing gulls, Leucophaeus atricilla, homing pigeons, Columba livia, and western sandpipers, Calidris mauri, with artificially weather MC252 oil. (United States)

    Dean, K M; Cacela, D; Carney, M W; Cunningham, F L; Ellis, C; Gerson, A R; Guglielmo, C G; Hanson-Dorr, K C; Harr, K E; Healy, K A; Horak, K E; Isanhart, J P; Kennedy, L V; Link, J E; Lipton, I; McFadden, A K; Moye, J K; Perez, C R; Pritsos, C A; Pritsos, K L; Muthumalage, T; Shriner, S A; Bursian, S J


    Scoping studies were designed to determine if double-crested cormorants (Phalacocorax auritus), laughing gulls (Leucophaues atricilla), homing pigeons (Columba livia) and western sandpipers (Calidris mauri) that were gavaged with a mixture of artificially weathered MC252 oil and food for either a single day or 4-5 consecutive days showed signs of oil toxicity. Where volume allowed, samples were collected for hematology, plasma protein electrophoresis, clinical chemistry and electrolytes, oxidative stress and organ weigh changes. Double-crested cormorants, laughing gulls and western sandpipers all excreted oil within 30min of dose, while pigeons regurgitated within less than one hour of dosing. There were species differences in the effectiveness of the dosing technique, with double-crested cormorants having the greatest number of responsive endpoints at the completion of the trial. Statistically significant changes in packed cell volume, white cell counts, alkaline phosphatase, alanine aminotransferase, creatine phosphokinase, gamma glutamyl transferase, uric acid, chloride, sodium, potassium, calcium, total glutathione, glutathione disulfide, reduced glutathione, spleen and liver weights were measured in double-crested cormorants. Homing pigeons had statistically significant changes in creatine phosphokinase, total glutathione, glutathione disulfide, reduced glutathione and Trolox equivalents. Laughing gulls exhibited statistically significant decreases in spleen and kidney weight, and no changes were observed in any measurement endpoints tested in western sandpipers. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. About the first experiment on investigation of 129I, 237Np, 238Pu and 239Pu transmutation at the nuclotron 2.52 GeV deuteron beam in neutron field generated in U/Pb-assembly 'Energy plus transmutation'

    International Nuclear Information System (INIS)

    Krivopustov, M.I.; Pavliouk, A.V.; Malakhov, A.I.


    Preliminary results of the first experiment with energy 2.52 GeV at the electronuclear setup which consists of Pb-target (diameter 8.4 cm, length 45.6 cm) and nat U-blanket (206.4 kg), transmutation samples of 129 I, 237 Np, 238 Pu and 239 Pu (radioecological aspect) are described. Hermetically sealed samples in notable amounts are gathered in atomic reactors and setups of industries which use nuclear materials and nuclear technologies were irradiated in the field of neutrons produced in the Pb-target and propagated in the nat U-blanket. Estimates of transmutations were obtained as a result of measurements of gamma activities of the samples. The information about the space and energy distribution of neutrons in the volume of the lead target and the uranium blanket was obtained with the help of sets of activation threshold detectors (Al, Co, Y, I, Au, Bi and others), solid-state nuclear track detectors, 3 He neutron detectors and nuclear emulsion. Comparison of the experimental data with the results of simulation with the MCNPX program was performed

  13. Non-flipping 13C spins near an NV center in diamond: hyperfine and spatial characteristics by density functional theory simulation of the C510[NV]H252 cluster (United States)

    Nizovtsev, A. P.; Kilin, S. Ya; Pushkarchuk, A. L.; Pushkarchuk, V. A.; Kuten, S. A.; Zhikol, O. A.; Schmitt, S.; Unden, T.; Jelezko, F.


    Single NV centers in diamond coupled by hyperfine interaction (hfi) to neighboring 13C nuclear spins are now widely used in emerging quantum technologies as elements of quantum memory adjusted to a nitrogen-vacancy (NV) center electron spin qubit. For nuclear spins with low flip-flop rate, single shot readout was demonstrated under ambient conditions. Here we report on a systematic search for such stable NV-13C systems using density functional theory to simulate the hfi and spatial characteristics of all possible NV-13C complexes in the H-terminated cluster C510[NV]-H252 hosting the NV center. Along with the expected stable ‘NV-axial-13C’ systems wherein the 13C nuclear spin is located on the NV axis, we found for the first time new families of positions for the 13C nuclear spin exhibiting negligible hfi-induced flipping rates due to near-symmetric local spin density distribution. Spatially, these positions are located in the diamond bilayer passing through the vacancy of the NV center and being perpendicular to the NV axis. Analysis of available publications showed that, apparently, some of the predicted non-axial near-stable NV-13C systems have already been observed experimentally. A special experiment performed on one of these systems confirmed the prediction made.

  14. Measurement of inclusive ep cross sections at high Q{sup 2} at √(s) = 225 and 252 GeV and of the longitudinal proton structure function F{sub L} at HERA

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, V.; Belousov, A.; Fomenko, A.; Gogitidze, N.; Lebedev, A.; Malinovski, E.; Rusakov, S.; Vazdik, Y. [Lebedev Physical Institute, Moscow (Russian Federation); Baghdasaryan, A.; Baghdasaryan, S.; Zohrabyan, H. [Yerevan Physics Institute, Yerevan (Armenia); Begzsuren, K.; Ravdandorj, T.; Tseepeldorj, B. [Institute of Physics and Technology of the Mongolian Academy of Sciences, Ulaanbaatar (Mongolia); Belov, P.; Brinkmann, M.; Britzger, D.; Campbell, A.J.; Dodonov, V.; Eckerlin, G.; Elsen, E.; Fleischer, M.; Gayler, J.; Ghazaryan, S.; Glazov, A.; Gouzevitch, M.; Grebenyuk, A.; Habib, S.; Haidt, D.; Kleinwort, C.; Krueger, K.; Levonian, S.; Lipka, K.; List, B.; List, J.; Lobodzinski, B.; Meyer, A.B.; Meyer, J.; Niebuhr, C.; Olsson, J.E.; Ozerov, D.; Pahl, P.; Petrukhin, A.; Pirumov, H.; Pitzl, D.; Placakyte, R.; Radescu, V.; Raspereza, A.; Schmitt, S.; Sefkow, F.; Shushkevich, S.; South, D.; Steder, M.; Wuensch, E. [DESY, Hamburg (Germany); Boudry, V.; Specka, A. [LLR, Ecole Polytechnique, CNRS/IN2P3, Palaiseau (France); Bradt, G. [Oxford University, Department of Physics, Oxford (United Kingdom); Brisson, V.; Jacquet, M.; Pascaud, C.; Zhang, Z.; Zomer, F. [LAL, Universite Paris-Sud, CNRS/IN2P3, Orsay (France); Buniatyan, A.; Huber, F.; Sauter, M.; Schoening, A. [Universitaet Heidelberg, Physikalisches Institut, Heidelberg (Germany); Bylinkin, A.; Bystritskaya, L.; Fedotov, A.; Rostovtsev, A. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Cantun Avila, K.B.; Contreras, J.G. [CINVESTAV, Departamento de Fisica Aplicada, Merida, Yucatan (Mexico); Ceccopieri, F.; Wolf, E.A. de; Favart, L.; Hreus, T.; Janssen, X.; Roosen, R.; Mechelen, P. van [Brussels and Universiteit Antwerpen, Inter-University Institute for High Energies ULB-VUB, Antwerp (Belgium); Cerny, K.; Pokorny, B.; Polifka, R.; Salek, D.; Valkarova, A.; Zacek, J.; Zlebcik, R. [Charles University, Faculty of Mathematics and Physics, Prague (Czech Republic); Chekelian, V.; Grindhammer, G.; Kiesling, C.; Olivier, B. [Max-Planck-Institut fuer Physik, Munich (Germany); Dainton, J.B.; Gabathuler, E.; Greenshaw, T.; Klein, M.; Kretzschmar, J.; Laycock, P.; Maxfield, S.J.; Mehta, A.; Patel, G.D. [University of Liverpool, Department of Physics, Liverpool (United Kingdom); Daum, K.; Meyer, H. [Universitaet Wuppertal, Fachbereich C, Wuppertal (Germany); Diaconu, C.; Hoffmann, D.; Sauvan, E.; Vallee, C. [CPPM, Aix-Marseille Univ, CNRS/IN2P3, Marseille (France); Dobre, M.; Rotaru, M. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Dossanov, A. [Universitaet Hamburg, Institut fuer Experimentalphysik, Hamburg (Germany); Max-Planck-Institut fuer Physik, Munich (Germany); Dubak, A. [Max-Planck-Institut fuer Physik, Munich (Germany); University of Montenegro, Faculty of Science, Podgorica (Montenegro); Egli, S.; Hildebrandt, M.; Horisberger, R. [Paul Scherrer Institut, Villigen (Switzerland); Feltesse, J.; Perez, E.; Schoeffel, L. [CEA, DSM/Irfu, CE-Saclay, Gif-sur-Yvette (France); Ferencei, J. [Slovak Academy of Sciences, Institute of Experimental Physics, Kosice (Slovakia); Goerlich, L.; Mikocki, S.; Nowak, G.; Sopicki, P.; Turnau, J. [Institute for Nuclear Physics, Cracow (Poland); Grab, C. [ETH, Institut fuer Teilchenphysik, Zurich (Switzerland); Henderson, R.C.W. [University of Lancaster, Department of Physics, Lancaster (United Kingdom); Herbst, M.; Jung, A.W.; Schultz-Coulon, H.C. [Universitaet Heidelberg, Kirchhoff-Institut fuer Physik, Heidelberg (Germany); Hladka, J.; Reimer, P. [Academy of Sciences of the Czech Republic, Institute of Physics, Prague (Czech Republic); Jung, H. [Brussels and Universiteit Antwerpen, Inter-University Institute for High Energies ULB-VUB, Antwerp (Belgium); DESY, Hamburg (Germany); Kapichine, M.; Morozov, A.; Spaskov, V. [Joint Institute for Nuclear Research, Dubna (RU); Kogler, R.; Nowak, K. [Universitaet Hamburg, Institut fuer Experimentalphysik, Hamburg (DE); Kostka, P.; Lange, W.; Naumann, T. [DESY, Zeuthen (DE); Landon, M.P.J.; Rizvi, E.; Traynor, D. [University of London, School of Physics and Astronomy, Queen Mary, London (GB); Lubimov, V. [Institute for Theoretical and Experimental Physics, Moscow (RU); Martyn, H.U. [I. Physikalisches Institut der RWTH, Aachen (DE); Mueller, K.; Robmann, P.; Straumann, U.; Truoel, P. [Physik-Institut der Universitaet Zuerich, Zurich (CH); Newman, P.R.; Thompson, P.D. [School of Physics and Astronomy, University of Birmingham, Birmingham (GB); Picuric, I.; Raicevic, N. [University of Montenegro, Faculty of Science, Podgorica (ME); Sankey, D.P.C. [STFC, Rutherford Appleton Laboratory, Oxfordshire (GB); Soloviev, Y. [DESY, Hamburg (DE); Lebedev Physical Institute, Moscow (RU); Stella, B. [Universita di Roma Tre (IT); INFN Roma 3, Dipartimento di Fisica, Rome (IT); Sykora, T. [Brussels and Universiteit Antwerpen, Inter-University Institute for High Energies ULB-VUB, Antwerp (BE); Charles University, Faculty of Mathematics and Physics, Prague (CZ); Tsakov, I. [Institute for Nuclear Research and Nuclear Energy, Sofia (BG); Wegener, D. [Institut fuer Physik, TU Dortmund, Dortmund (DE); Collaboration: H1 Collaboration


    Inclusive ep double differential cross sections for neutral current deep inelastic scattering are measured with the H1 detector at HERA.The data were taken with a lepton beam energy of 27.6 GeV and two proton beam energies of E{sub p} = 460 and 575 GeV corresponding to centre-of-mass energies of 225 and 252 GeV, respectively. The measurements cover the region of 6.5 x 10{sup -4} ≤ x ≤ 0.65 for 35 ≤ Q{sup 2} ≤ 800 GeV{sup 2} up to y = 0.85. The measurements are used together with previously published H1 data at E{sub p} = 920 GeV and lower Q{sup 2} data at E{sub p} = 460, 575 and 920 GeV to extract the longitudinal proton structure function F{sub L} in the region 1.5 ≤ Q{sup 2} ≤ 800 GeV{sup 2}. (orig.)

  15. Measurements of the prompt neutron spectra in 233U, 235U, 239Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252Cf spontaneous fission in the energy range of 0.01-10 MeV

    International Nuclear Information System (INIS)

    Starostov, B.I.; Semenov, A.F.; Nefedov, V.N.


    The measurement results on the prompt neutron spectra in 233 U, 235 U, 239 Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252 Cf spontaneous fission in the energy range of 0.01-10 MeV are presented. The time-of-flight method was used. The exceeding of the spectra over the Maxwell distributions is observed at E 252 Cf neutron fission spectra. The spectra analysis was performed after normalization of the spectra and corresponding Maxwell distributions for one and the same area. In the range of 0.05-0.22 MeV the yield of 235 U + nsub(t) fission neutrons is approximately 8 and approximately 15 % greater than the yield of 252 Cf and 239 Pu + nsub(t) fission neutrons, respectively. In the range of 0.3-1.2 MeV the yield of 235 U + nsub(t) fission neutrons is 8 % greater than the fission neutron yield in case of 239 Pu + nsub(t) fission. The 235 U + nsub(t) and 233 U + nsub(t) fission neutron spectra do not differ from one another in the 0.05-0.6 MeV range

  16. 46 CFR 252.12 - Approval. (United States)


    ... of the United States. (c) The applicant owns or leases, or can and will build or purchase or lease, a... conditions and to promote U.S. foreign commerce; (d) The applicant possesses the ability, experience...

  17. H:\\PMKER 25(2)

    African Journals Online (AJOL)


    5Ecole Régionale Post-Universitaire d'Aménagement et de gestion Intégrés des ... de valorisation écotouristique du baï de Momba, la dynamique saisonnière des ... filariosis in the baï of Momba suggests that strategies of flies control need to.

  18. Reference: 252 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available s were modestly sensitive to exogenous Ca2+ and also displayed a 22% reduction in vacuolar H+-ATPase activit...nd pronounced sensitivity to exogenous Ca2+ and other ions. These growth defects were partially suppressed by addition of exogenous

  19. 48 CFR 252.217-7007 - Payments. (United States)


    ... Officer shall approve progress payments based on the value, computed on the price of the job order, of... Contracting Officer may require. (c) The Government will retain until final completion and acceptance of all... direct that progress payments be based on the price of the job order as adjusted as a result of change...

  20. Publications | Page 252 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Reductions in frequency of consumption and portions of imported... Impacts of the global economic crisis on foreign trade in lower-income economies in the Greater Mekong Sub-region and policy responses : the case of Vietnam and its implications for Lao PDR and Cambodia (restricted access). Like other developing ...

  1. 6 CFR 25.2 - Definitions. (United States)


    ... “OSAI” means the office within the Department of Homeland Security's Directorate of Science and... Science and Technology, SAFETY Act/room 4320, Department of Homeland Security, Washington, DC 20528... information and projections, actuarial calculations, liability estimates, insurance quotations, and business...

  2. 48 CFR 252.217-7006 - Title. (United States)


    ... performance of a job order shall vest in the Government upon delivery at the location specified for the performance of the work. (b) Upon completion of the job order, or with the approval of the Contracting Officer during performance of the job order, all Contractor-furnished materials and equipment not incorporated in...

  3. 48 CFR 252.239-7002 - Access. (United States)


    ..., unless the service failure results from the Contractor's fault or negligence. (b) During periods when the... acceptable rates for the loss of or damage to the equipment due to the fault or negligence of the Government...

  4. 29 CFR 1910.252 - General requirements. (United States)


    ... confine the heat, sparks, and slag, and to protect the immovable fire hazards. (iii) Restrictions. If the... enclosed in an individual booth painted with a finish of low reflectivity such as zinc oxide (an important... protection is not necessary. (6) Zinc—(i) Confined spaces. In confined spaces welding or cutting involving...

  5. 7 CFR 1944.252 - Definitions. (United States)


    ... location to another for activities such as going to the doctor and shopping, but must be mobile. The mobility requirement does not exclude persons in wheelchairs or those requiring mobility devices.) (2) Each... services described in section 802(k)(16). Under this Program, health-related services mean non-medical...

  6. 36 CFR 25.2 - License. (United States)


    ... condition, honest, intelligent, tactful, and of good repute. They must be thoroughly familiar with the..., solicitor, representative, or runner for any business or enterprise whatever (except in offering my services...

  7. 7 CFR 1209.252 - Exemption procedures. (United States)


    ... in section 2103 of the Organic Foods Production Act of 1990 (7 U.S.C. 6502), a signed certification.... (2) To apply for an exemption for organic mushrooms: (i) An eligible mushroom producer shall submit a...) The request shall include the following: The producer's name and address, a copy of the organic farm...

  8. 24 CFR 213.252 - Definitions. (United States)


    ... indicated. (a) Contract of Insurance means the agreement evidenced by endorsement of the credit instrument... been insured by the endorsement of the credit instrument by the Commissioner. (c) Mortgage means such a... is located, together with the credit instrument or instruments, if any, secured thereby. In any...

  9. Publications | Page 252 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Rules of origin and development of regional production network in Asia : case studies of selected industries (restricted access). Simpler Rules of Origin (RoO) with product specific rules can act as a catalyst in trade even if tariff rates are not low. Sector specific restrictiveness across trade agreements are assessed, in view of ...

  10. H:\\PMKER 25(2)\\PDF 25(2)\\TCHIO.xps

    African Journals Online (AJOL)


    La graine est l'organe principal de propagation du papayer (Carica papaya), chez qui les problèmes de germination sont récurrents. L'influence du mode de pollinisation et de la conservation des papayes sur la qualité de leurs semences est étudiée. Six cents fleurs hermaphrodites, de la lignée Solo n°8, sont marquées au ...

  11. H:\\PMKER 25(2)\\PDF 25(2)\\MBETID BESSANE.xps

    African Journals Online (AJOL)


    cours internationaux de la fibre, de la faillite économique des Etats ... l'approche orthodoxe néoclassique, le marché était le seul ... hétérodoxes, les modes de coordination devaient prendre en ... la sécurité alimentaire (disponibilité et accès à.

  12. H:\\PMKER 25(2)\\PDF 25(2)\\BAN KOFFI.xps

    African Journals Online (AJOL)


    L.R., Montville T.J. (Eds.). Food Microbiology-. Fundamentals and frontiers. ASM Press,. Washington, D.C., pp. 721 -733. Timbie D. J., Sechrist L. and P. G. Keeney. 1978. Application of high pressure liquid chromatography to the study of variables affecting theobromine and caffeine concentrations in cocoa beans. J Food Sci.

  13. H:\\PMKER 25(2)\\PDF 25(2)\\YONGO.xps

    African Journals Online (AJOL)


    son fonctionnement (son dynamisme, ses potentialités de régénération naturelle et ses risques de dégradation) est essentielle. D'où l'intérêt de cette étude. La régénération de la végétation désigne la reconstitution du couvert végétal à la suite de sa destruction naturelle ou du fait de l'Homme (Ramade, 1993). Lorsque.

  14. H:\\PMKER 25(2)\\PDF 25(2)\\LOKONON.xps

    African Journals Online (AJOL)


    on plant species population are often described by changes in ..... UVorg : Specific Use Values ; IU : Interspecific Use Values / + : the treatment of the given disease needs moreover the ... competition for light may explain the height of trees in ...

  15. Alternative synthetic route for the heterometallic CO-releasing [Sb@Rh12(CO27]3− icosahedral carbonyl cluster and synthesis of its new unsaturated [Sb@Rh12(CO24]4− and dimeric [{Sb@Rh12Sb(CO25}2Rh(CO2PPh3]7− derivatives

    Directory of Open Access Journals (Sweden)

    Cristina Femoni


    Full Text Available The hetero-metallic [Sb@Rh12(CO27]3− cluster has been known as for over three decades thanks to Vidal and co-workers, and represents the first example of an E-centered (E=heteroatom icosahedral rhodium carbonyl cluster. However, its synthesis required high temperature (140–160 °C and elevated CO pressure (400 atm. Applying the redox condensation method for cluster preparation, we herein report a new synthetic, high-yield route for preparing [Sb@Rh12(CO27]3− under much milder conditions of temperature and pressure. Notably, when the same synthesis was carried out under N2 instead of CO atmosphere, the new isostructural but unsaturated derivative [Sb@Rh12(CO24]4− was obtained, for which we report the full X-ray structural characterization. This species represents one of the few examples of an icosahedral cluster disobeying the electron-counting Wade-Mingos rules, possessing less than the expected 170 cluster valence electrons (CVEs. Judging from IR monitoring, the two species can be obtained one from the other by switching between N2 and CO atmosphere, making [Sb@Rh12(CO27]3− a spontaneous CO-releasing molecule. Finally, the study of the chemical reactivity of [Sb@Rh12(CO27]3− with PPh3 allowed us to obtain the new [{Sb@Rh12Sb(CO25}2Rh(CO2PPh3]7− dimeric compound, for which we herein report the full X-ray structural and 31P NMR analyses.

  16. 48 CFR 252.217-7027 - Contract definitization. (United States)


    ...., fixed-price or cost-and-fee) proposal and cost or pricing data supporting its proposal. (b) The schedule for definitizing this contract is as follows (insert target date for definitization of the contract... of the make-or-buy and subcontracting plans and cost or pricing data). (c) If agreement on a...

  17. 48 CFR 552.252-6 - Authorized Deviations in Clauses. (United States)


    ... published in the General Services Administration Acquisition Regulation (48 CFR chapter 5). (2) This... published in the General Services Administration Acquisition Regulation by the addition of “(DEVIATION (FAR... ADMINISTRATION CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552...

  18. Savannah River Plant californium-252 Shuffler electronics manual

    International Nuclear Information System (INIS)

    Bourret, S.C.; Crane, T.W.; Eccleston, G.W.; Gallegos, E.A.; Garcia, D.L.


    Detailed information is presented in this report, an electronics manual for the Savannah River Plant Shuffler, about the electronics associated with the various control and data acquisition functions of the Shuffler subsystems. Circuit diagrams, interconnection information, and details about computer control and programming are included

  19. Neutron radiography with 252Cf in forensic science

    International Nuclear Information System (INIS)

    Cason, J.L.


    Equipment and methods for neutron radiographic examination of objects in forensic science are described. Examples discussed include booby-trapped ammunition, bomb in a matchbook, gun barrel analysis, narcotics in pen, and chemicals and metals in body tissue

  20. Investigation of the characteristics of 252Cf-detectors

    International Nuclear Information System (INIS)

    Karlsson, Erik


    In the first chapter the characteristic behaviors of two Cf detectors have been investigated by performing pilot measurements. The detector with the stronger source gives an unstable signal with a low signal/noise ratio. Therefore this detector has not been further investigated. The ionization chamber reacts on both fission products and alpha decay. An energy experiment showed that there were large difficulties to separate those decays. A plastic scintillator, which reacts on both photons and neutrons, was used for neutron detection. Energy spectrums were performed and the result showed that it is difficult to set an energy threshold to separate the neutrons and the photons. The discrimination will rather be achieved by time of flight methods which is discussed under the second chapter in this thesis; Experimental results. An other experiment was done in order to investigate whether it is possible to detect any delayed components from the spontaneous fission of Cf. The result showed that delayed components existed. Either they are delayed neutrons from exited fission products, or it is some delay related to the charge collection in the Cf detector. Correlation measurements showed that few events are coincident. Only 50% of the signals from the plastic scintillator are correlated with the Cf source

  1. 48 CFR 252.243-7002 - Requests for equitable adjustment. (United States)


    ... clause does not apply to— (1) Requests for routine contract payments; for example, requests for payment for accepted supplies and services, routine vouchers under a cost-reimbursement type contract, or progress payment invoices; or (2) Final adjustment under an incentive provision of the contract. (End of...

  2. All projects related to | Page 252 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Displaying 2511 - 2520 of 6834. Thinking Globally, Acting Locally: Preparing the Canadian Foreign Policy Community to Meet the Challenges of the World in 2020. Project. Development of an Ottawa-based Foreign Policy Network will help to bridge gaps, strengthen the foreign policy community in the national capital region ...

  3. Table of radionuclides (Vol. 4 - A = 133 to 252)

    International Nuclear Information System (INIS)

    Be, M.M.; Chiste, V.; Dulieu, Ch.; Browne, E.; Chechev, V.; Kuzmenko, N.; Kondev, F.G.; Luca, A.; Galan, M.; Pearce, A.; Huang, X.


    This monograph is one of several published in a series by the Bureau International des Poids et Mesures (BIPM) on behalf of the Comite Consultatif des Rayonnements Ionisants (CCRI), previously known as the Comite Consultatif pour les Etalons de Mesure des Rayonnements Ionisants (CCEMRI). The aim of this series of publications is to review topics that are of importance for the measurement of ionizing radiation and especially of radioactivity, in particular those techniques normally used by participants in international comparisons. It is hoped that these publications will prove to be useful reference volumes both for those who are already engaged in this field and for those who are approaching such measurements for the first time. The purpose of this monograph, number 4 in the series, is to present the recommended values of nuclear and decay data for a wide range of radionuclides. Activity measurements for more than fifty-five of these radionuclides have already been the subject of comparisons under the auspices of Section II (dedicated to the Measurement of radionuclides) of the CCRI. The material for this monograph is now covered in four volumes. The first two volumes contain the primary recommended data relating to half-lives, decay modes, x-rays, gamma-rays, electron emissions; alpha- and beta-particle transitions and emissions, and their uncertainties for a set of sixty-eight radionuclides, Volume I for those radionuclides with mass number up to and including 150 and Volume 2 for those radionuclides with mass number over 150. Volume 3 contains the equivalent data for twenty-six additional radionuclides as listed and reevaluations for 125 Sb and 153 Sm while Volume 4 contains the data for a further thirty-one radionuclides with re-evaluation for 226 Ra. The data have been collated and evaluated by an international working group (Decay Data Evaluation Project) led by the LNE-LNHB. The evaluators have agreed on the methodologies to be used and the CD-ROM included with this monograph contains the evaluators' comments for each radionuclide in addition to the data tables included in the monograph. The work involved in evaluating nuclear data is on-going and the recommended values are updated on the LNHB web site at The publication of further volumes of Monograph 5 is envisaged as and when necessary to add new radionuclide data or re-evaluations in a more permanent format that can be referenced easily. Although other data sets may still be used when evaluating radionuclide activity, use of this common, recommended data set should help to reduce the uncertainties in activity evaluations and lead to more coherent results for comparisons. In order to update the data of the nuclides already present and to add new evaluations, the Laboratoire National Henri Becquerel (LNHB, France) and the Physikalisch-Technische Bundesanstalt (PTB, Germany) established a cooperative agreement; they were then joined by the Idaho National Engineering and Environmental Laboratory (INEEL, USA), the Lawrence Berkeley National Laboratory (LBNL, USA) and the Khlopin Radium Institute (KRI, Russia). This international collaboration is base d on an informal agreement, the initial work of this group was to discuss and to agree on a methodology t o be used in these evaluations. The data and associated uncertainties were evaluated from all available experiments and taking into account theoretical considerations. The main steps for the evaluation of the data and their uncertainties are: - a critical analysis of all available original publications in order to accept or not each value and it s uncertainty reduced to the combined standard uncertainty; - the determination of the best value which is either the weighted or the unweighted average of the retained values, this is decided after examination of the reduced χ 2 value. For a weighted average of discrepant data, each weight is limited to 50 %, and the uncertainty, designated u,, is the larger of the internal or external uncertainty values, which may be expanded to cover the most precise input value. A value given without an uncertainty is considered questionable. It is provided for information and often its order of magnitude is estimated from the decay scheme

  4. 48 CFR 252.217-7012 - Liability and insurance. (United States)


    ...) The Contractor shall not make any allowance in the job order price for the inclusion of any premium... of and shall not affect the pricing structure of the contract, and are additional to the compensation...

  5. 46 CFR 252.41 - Subsidy billing procedures. (United States)


    ... dates From To No. of reduced crew days (a) No. of crew reduced Man-days Man-day amount Reduced crew... Operator for the purpose of inducing the Maritime Administration to make a payment pursuant to the...

  6. The protective cell petrus for the production of californium 252

    International Nuclear Information System (INIS)

    Sontag, R.; Berger, R.


    The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10 9 -2 .s -1 . The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [fr

  7. 48 CFR 252.215-7002 - Cost estimating system requirements. (United States)


    ... contract awards. Estimating system includes the Contractor's— (1) Organizational structure; (2) Established... (e) of this clause apply if the Contractor is a large business and either— (1) In its fiscal year...

  8. 7 CFR 252.4 - Application to participate and agreement. (United States)


    ... integrity, business ethics and performance. In addition, the processors must demonstrate their ability to sell end products under NCP by submitting supporting documentation such as written intent to purchase... purchased, the processor shall invoice the recipient agency at the net case price which shall reflect the...

  9. 24 CFR 983.252 - PHA information for accepted family. (United States)


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false PHA information for accepted family... family. (a) Oral briefing. When a family accepts an offer of PBV assistance, the PHA must give the family... of how the program works; and (2) Family and owner responsibilities. (b) Information packet. The PHA...

  10. 48 CFR 252.237-7016 - Delivery tickets. (United States)


    ...), and (e) to the basic clause: (c) Before the Contractor picks up articles for service under this... of serviced laundry on the delivery ticket. The Contracting Officer will ensure that this weight and... articles for service under this contract, the Contracting Officer will ensure that each bag is weighed and...

  11. 48 CFR 252.246-7001 - Warranty of data. (United States)


    ... exceed ten percent of the total contract price. (ii) If the breach of the warranty is with respect to the..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... contract entitled, Rights in Technical Data and Computer Software. (b) Warranty. Notwithstanding inspection...

  12. 48 CFR 252.225-7021 - Trade agreements. (United States)


    ..., Hong Kong, Hungary, Iceland, Ireland, Israel, Italy, Japan, Korea (Republic of), Latvia, Liechtenstein... (Australia, Bahrain, Canada, Chile, Costa Rica, Dominican Republic, El Salvador, Guatemala, Honduras, Mexico..., Chapter 98, Subchapter II, Articles Exported and Returned, Advanced or Improved Abroad, U.S. Note 7(b). (4...

  13. 48 CFR 252.247-7006 - Removal of contractor's employees. (United States)


    ... use only experienced, responsible, and capable people to perform the work. The Contracting Officer may... continued employment under this contract is inconsistent with the interest of military security. (End of...

  14. 48 CFR 252.247-7007 - Liability and insurance. (United States)


    ... harmless from, bodily injury and death of persons, resulting either in whole or in part from the negligence..., contributed jointly with the fault or negligence of the Contractor in causing such damage, injury, or death...-insurer under applicable provision of law. (2) Bodily injury liability insurance in an amount of not less...

  15. 48 CFR 252.217-7014 - Discharge of liens. (United States)


    ... discharged, any lien or right in rem of any kind, other than in favor of the Government, that exists or...) If any lien or right in rem is not immediately discharged, the Government, at the expense of the Contractor, may discharge, or cause to be discharged, the lien or right. (End of clause) ...

  16. 38 CFR 21.252 - Job development and placement services. (United States)


    ... AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under... providing for special consideration or emphasis or preference of the veteran in employment or training...

  17. 48 CFR 252.247-7008 - Evaluation of bids. (United States)


    ... other factors, the Contracting Officer will evaluate bids on the basis of advantages or disadvantages to... evaluation, the Contracting Officer will assume that the administrative cost to the Government for issuing... Government, including the administrative costs in paragraph (b)(1). (c) When drayage is necessary for the...

  18. 48 CFR 52.252-2 - Clauses Incorporated by Reference. (United States)


    ..., with the same force and effect as if they were given in full text. Upon request, the Contracting Officer will make their full text available. Also, the full text of a clause may be accessed... (CONTINUED) CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 52...

  19. 40 CFR 98.252 - GHGs to report. (United States)


    ... units. (b) CO2, CH4, and N2O coke burn-off emissions from each catalytic cracking unit, fluid coking unit, and catalytic reforming unit under this subpart. (c) CO2 emissions from sour gas sent off site...

  20. 7 CFR 765.252 - Lease of security. (United States)


    ... as security for FLP loans. (1) For loans secured by real estate before December 23, 1985, the Agency has a security interest in any mineral rights the borrower has on the real estate pledged as... Lease of security. (a) Real estate leases. The borrower may lease real estate security provided the...

  1. 27 CFR 41.252 - Change in ownership or control. (United States)


    ..., so notify the appropriate TTB officer in writing, giving the identity of such person. When there is... importer of processed tobacco results in a change in the identity of the principal stockholders exercising actual or legal control of the operations of the corporation, the corporate manufacturer must, within 30...

  2. Dicty_cDB: VSI252 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AGCTAATCTTTAATAGNATTAACAAACCC sequence update 2001. 3.22 Translated Amino Acid sequence ltk**milkkrlttlvll*l...VSSMEAKSMTW*rfryrtwfiifs kknktlklkyenkik*s*slixltn Frame B: ltk**milkkrlttlvll*lhflfqnln*rnsqsnkklylpntlqklv...yri*qrslsqkn *ilp*kklkii*kiltdlaeqii*kllvffkkrfhlwrlnl*lgkdlgielgslfflkki kh*n*nmkik*NKANHLIVINKPSLYVKLKKK--- ---ltk**milk

  3. 7 CFR 252.1 - Purpose and scope. (United States)


    ... industry, acting in cooperation with the States and FNS, to develop new markets in which donated food may... private processors of food may enter into agreements under which the processor will process and distribute... conditions set forth in this part are those under which processors may enter into agreements with FNS for the...

  4. 48 CFR 252.215-7000 - Pricing adjustments. (United States)


    ... clauses entitled “Price Reduction for Defective Cost or Pricing Data—Modifications,” “Subcontractor Cost or Pricing Data,” and “Subcontractor Cost or Pricing Data—Modifications,” means the aggregate increases and/or decreases in cost plus applicable profits. (End of clause) [56 FR 36479, July 31, 1991, as...

  5. 48 CFR 252.246-7002 - Warranty of construction (Germany). (United States)


    ... workmanship performed. (d) The Contractor shall restore any work damaged in fulfilling the terms and... damage at the Contractor's expense. (g) With respect to all warranties, express or implied, from... all warranties to be executed in writing, for the benefit of the Government, if directed by the...

  6. 46 CFR 252.34 - Protection and indemnity insurance. (United States)


    ... subsidy per voyage day ($27,336,900÷3,500 days)=$7,810.54. Ratio P&I deductible ODS to wage ODS $287.85÷$7,810.54=3.69%. T.R. 98 ship type Daily wage ODS 1/1/85 Ratio P&I ded. to wage ODS (pct) Daily P&I ded. ODS 1/1/85 C4-A $9,000 ×3.69 $332.10 C5-B 9,300 ×3.69 343.17 C6-C 9,600 ×3.69 354.34 (ii) In cases...

  7. Savannah River Plant Californium-252 Shuffler software manual

    International Nuclear Information System (INIS)

    Johnson, S.S.; Crane, T.W.; Eccleston, G.W.


    A software manual for operating the Savannah River Plant Shuffler nondestructive assay instrument is presented. The procedures for starting up the instrument, making assays, calibrating, and checking the performance of the hardware units are described. A list of the error messages with an explanation of the circumstances prompting the message and possible corrective measures is given. A summary of the software package is included showing the names and contents of the files and subroutines. The procedure for modifying the software package is outlined

  8. 48 CFR 252.211-7006 - Radio Frequency Identification. (United States)


    ... supply, as defined in DoD 4140.1-R, DoD Supply Chain Materiel Management Regulation, AP1.1.11: (A... International and the Uniform Code Council to establish and support the EPC network as the global standard for immediate, automatic, and accurate identification of any item in the supply chain of any company, in any...

  9. 48 CFR 252.247-7010 - Scope of contract. (United States)


    ... containers (Federal Specification PPP-B-580), all equipment, plant and labor; and (2) Perform all work in accomplishing containerization of personal property for overseas or domestic movement or storage, including— (i... property (including servicing of appliances) for movement or storage, drayage and related services. Unless...

  10. 48 CFR 252.227-7008 - Computation of royalties. (United States)


    ... performing under a cost-reimbursement contract. With respect to such articles or materials made by the... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Computation of royalties... REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...

  11. 48 CFR 252.211-7003 - Item identification and valuation. (United States)


    ... Defense Logistics Information System (DLIS) Commercial and Government Entity (CAGE) Code). Issuing agency... Standard 15434), in accordance with the Air Transport Association Common Support Data Dictionary; and (ii...

  12. The protective cell petrus for the production of californium 252; Cellule blindee petrus pour la production et l'etude du californium 252

    Energy Technology Data Exchange (ETDEWEB)

    Sontag, R; Berger, R [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires


    The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10{sup 9}{sup -2}.s{sup -1}. The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [French] La cellule alpha, beta, gamma, neutron, qui fait l'objet du present article, est destinee a la production et a l'etude des elements transplutoniens. Elle est construite au C.E.N. de Fontenay-aux-Roses (France). La protection biologique, calculee pour une activite de 1000 curies de rayonnement gamma d'energie 1 MeV accompagnee d'un flux de neutrons rapides de 10{sup 9}/cm{sup 2}s, est constituee par des parois en beton de 1,20 m d'epaisseur. L'enceinte alpha est une boite etanche qui comporte devx systemes de transferts: l'un consiste en une boite parallelepipedique etanche logee dans un barillet, l'autre fait appel a des recipients cylindriques standard en polyethylene. L'equipement general et les installations les plus importantes sont ensuite decrits. (auteurs)

  13. WHC-SD-W252-FHA-001, Rev. 0: Preliminary fire hazard analysis for Phase II Liquid Effluent Treatment and Disposal Facility, Project W-252

    International Nuclear Information System (INIS)

    Barilo, N.F.


    A Fire Hazards Analysis was performed to assess the risk from fire and other related perils and the capability of the facility to withstand these hazards. This analysis will be used to support design of the facility

  14. 48 CFR 252.237-7023 - Continuation of Essential Contractor Services. (United States)


    ... provide a written plan for continuing the performance of essential contractor services identified in...; and (v) The approach for communicating expectations to contractor employees regarding their roles and... or other designated representative as expeditiously as possible and use its best efforts to cooperate...

  15. A Randomized Experiment Using Absenteeism Information to "Nudge" Attendance. REL 2017-252 (United States)

    Rogers, Todd; Duncan, Teresa; Wolford, Tonya; Ternovski, John; Subramanyam, Shruthi; Reitano, Adrienne


    Reducing student absenteeism is a key part of the School District of Philadelphia's plan to boost graduation rates. One of the district's goals is to increase guardians' awareness of absenteeism, with the hope that greater awareness will lead to guardians' taking a more active role in improving their student's attendance and academic performance.…

  16. Standardized UXO Technology Demonstration Site Blind Grid Scoring Record No. 252

    National Research Council Canada - National Science Library

    Overbay, Larry, Jr; Boutin, Matthew; Fling, Rick; McClung, Christina


    ...) utilizing the APG Standardized UXO Technology Demonstration Site Blind Grid. The scoring record was coordinated by Larry Overbay and the Standardized UXO Technology Demonstration Site Scoring Committee...

  17. Detection of the ternary alpha particles from 252Cr spontaneous source with timepix pixeleted detector

    International Nuclear Information System (INIS)

    Ahmadov, G.S.; Telezhnikov, S.A.; Ahmadov, F.I.; Garibov, A.A.; Ahmadov, G.S.; Ahmadov, F.I.; Granja, C.; Pospisil, S.


    A third charged particle is emitted besides the two main fission fragments in ternary fission. Because of the ternary fission is a unique tool to explore the dynamics and structure of atomic nuclei by probing the fissioning system near the scission point and observing fissioning reaction and decay mechanisms main tool to study nuclear fission processes

  18. 48 CFR 252.225-7012 - Preference for certain domestic commodities. (United States)


    ..., office, or other use); and (D) Parachutes (Federal Supply Class 1670); or (ii) The fibers and yarns are..., materials, or manufactured articles). (10) Any item of individual equipment (Federal Supply Class 8465... end product; and (ii) Does not exceed the simplified acquisition threshold in FAR part 2; (3) To waste...

  19. 48 CFR 252.236-7012 - Military construction on Kwajalein Atoll-evaluation preference. (United States)


    ... the laws of the Marshall Islands, that— (i) Is more than 50 percent owned by citizens of the Marshall Islands; or (ii) Complies with the following: (A) The firm has done business in the Marshall Islands on a... that complies with the following: (i) The corporate headquarters are in the United States; (ii) The...

  20. World Hunger: A Challenge to American Policy. Headline Series No. 252. (United States)

    Linowitz, Sol M.

    This booklet examines one of the most tragic and dangerous paradoxes facing the nations of the world at the end of the 20th century: hunger amid plenty. Even though the world does not lack for food, the problem lies in the distribution and power of ownership. There are serious moral, economic and political reasons why the U.S. in particular should…

  1. Distribution of hydrocarbons released during the 2010 MC252 oil spill in deep offshore waters

    International Nuclear Information System (INIS)

    Spier, Chelsea; Stringfellow, William T.; Hazen, Terry C.; Conrad, Mark


    The explosion of the Deepwater Horizon oil platform on April 20th, 2010 resulted in the second largest oil spill in history. The distribution and chemical composition of hydrocarbons within a 45 km radius of the blowout was investigated. All available certified hydrocarbon data were acquired from NOAA and BP. The distribution of hydrocarbons was found to be dispersed over a wider area in subsurface waters than previously predicted or reported. A deepwater hydrocarbon plume predicted by models was verified and additional plumes were identified. Because the samples were not collected systematically, there is still some question about the presence and persistence of an 865 m depth plume predicted by models. Water soluble compounds were extracted from the rising oil in deepwater, and were found at potentially toxic levels outside of areas previously reported to contain hydrocarbons. Application of subsurface dispersants was found to increase hydrocarbon concentration in subsurface waters. - Highlights: ► The hydrocarbon distribution was more widely spread than previously predicted or reported. ► 4 subsurface plumes were identified. ► More soluble compounds were preferentially extracted in the deepwater. ► Percentage of detectable results is a useful data analysis technique. ► Subsurface dispersants application increased hydrocarbons in subsurface waters. - All available certified Deepwater Horizon data was used to determine the spatial, temporal, and chemical distribution of hydrocarbons in subsurface of the Gulf of Mexico.

  2. 48 CFR 252.217-7005 - Inspection and manner of doing work. (United States)


    ... over activities taking place in the vicinity of the vessel's magazines, fuel oil tanks, or storerooms... the extent necessary, clean, wash, and steam out or otherwise make safe, all tanks under alteration or repair; (6) Furnish the Contracting Officer or designated representative with a copy of the “gas-free” or...

  3. 48 CFR 252.223-7004 - Drug-free work force. (United States)


    ... “Mandatory Guidelines for Federal Workplace Drug Testing Programs” (53 FR 11980 (April 11 1988)), issued by... that those issues that are in conflict will be a subject of negotiation at the next collective...

  4. Californium-252 neutron activation analysis of high-level processed nuclear tank waste

    International Nuclear Information System (INIS)

    Troyer, G.L.; Purcell, M.A.


    The basis for production assessment of the vitrification of Hanford nuclear fuel reprocessing wastes will be high-precision measurements of the elemental sodium content. However, the chemical analysis of both radioactive and nonradioactive components in nuclear waste can be challenged by high radiation dose rates. The dose rates compromise many analytical techniques as well as pose personnel dosimetry risks. In many cases, reduction of dose rates through dilution compromises the precision and sensitivity for certain key components. The use of neutron activation analysis (NAA) provides a method of analysis that avoids the need for dilutions or extensive sample preparation. These waste materials also contain trace quantities of fissionable isotopes, which, through neutron activation, can be estimated by delayed neutron counting of fissioned fragments

  5. 48 CFR 252.209-7007 - Prohibited Financial Interests for Lead System Integrators. (United States)


    ... for the procurement of services, the primary purpose of which is to perform acquisition functions... failure to comply with the terms and conditions of award or may take other remedial measures as... at the time of award or has violated the agreement in paragraph (c) of this clause, the Government...

  6. 48 CFR 252.237-7013 - Instruction to offerors (bulk weight). (United States)


    ...) Offers shall be submitted on a unit price per pound of serviced laundry. Unit prices shall include all costs to the Government of providing the service, including pickup and delivery charges. (b) The Contracting Officer will evaluate bids based on the estimated pounds of serviced laundry stated in the...

  7. 48 CFR 252.237-7015 - Loss or damage (weight of articles). (United States)


    ... shall— (1) Be liable for return of the articles furnished for service under this contract; and (2... in servicing the laundry is ____ percent of the weight recorded on delivery tickets when the laundry...

  8. Sud du Sahara | Page 252 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Langue English. Read more about Évaluation des réseaux d'ACACIA. Langue French. Read more about Research on Business Process Outsourcing. Langue English. Read more about Recherche sur l'impartition des processus administratifs. Langue French. Read more about Réseau électronique sans fil à Fez (Maroc).

  9. People and things. CERN Courier, Mar 1985, v. 25(2)

    Energy Technology Data Exchange (ETDEWEB)



    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. The main decisions taken at the eleventh meeting of the International Committee for Future Accelerators (ICFA) - held last October at the Leningrad Institute of Nuclear Physics, Gatchina - concerned the setting up of the four international panels which were proposed and agreed at the ICFA Seminar held at the Japanese KEK Laboratory earlier in the year. On 14 January the last of the 48 bending magnets of DESY-II, the new 9 GeV injection synchrotron for electrons and positrons, was installed in the tunnel of the 20 year-old DESY synchrotron in Hamburg. An international history symposium on 'Particle Physics in the 1950s: pions to quarks,' will be held at Fermilab in Batavia, Illinois on 1-4 May 1985.

  10. Activation analysis of stainless steel flux monitors using 252Cf neutron sources

    International Nuclear Information System (INIS)

    Williams, J.G.; Newton, T.H. Jr.; Cogburn, C.O.


    Activation analysis was performed on stainless steel beads from a chain which is used in reactor pressure vessel surveillance experiments at the Arkansas Power and Light Company reactors. The beads allow monitoring of two fast and three thermal neutron induced reactions: 58 Ni(n,p) 58 Co, 54 Fe(n,p) 54 Mn, 58 Fe(n,γ) 59 Fe, 59 Co(n,γ) 60 Co and 50 Cr(n,γ) 51 Cr. The analysis was performed using 12 beads from various positions along 5 different batches of chain and standard materials in an H 2 O moderator tank using two intense californium sources which had a total neutron emission rate of 3.97 x 10 10 /s. Semiconductor gamma spectrometers were used to count the products of the above reactions in the specimens. The percentage by weight of the iron, chromium and cobalt in the beads were found to be 62.1%, 20.2% and 0.120%, respectively. The excellent uniformity found in the bead compositions demonstrates the reproducibility of the experimental techniques and enhances considerably the value of the beads as neutron flux montitors

  11. 48 CFR 252.229-7010 - Relief from customs duty on fuel (United Kingdom). (United States)


    ..., February 1973, entitled “Relief from Customs Duty and/or Value Added Tax on United States Government... Office. (b) Specific information should be included in the request for tax relief, such as the number of...

  12. 48 CFR 252.227-7013 - Rights in technical data-Noncommercial items. (United States)


    ... management information. (15) Unlimited rights means rights to use, modify, reproduce, perform, display...) In no event shall the Contractor use its obligation to recognize and protect subcontractor or... designs. For a vessel design (including a vessel design embodied in a useful article) that is developed or...

  13. Oil release from Macondo well MC252 following the Deepwater Horizon accident. (United States)

    Griffiths, Stewart K


    Oil flow rates and cumulative discharge from the BP Macondo Prospect well in the Gulf of Mexico are calculated using a physically based model along with wellhead pressures measured at the blowout preventer (BOP) over the 86-day period following the Deepwater Horizon accident. Parameters appearing in the model are determined empirically from pressures measured during well shut-in and from pressures and flow rates measured the preceding day. This methodology rigorously accounts for ill-characterized evolution of the marine riser, installation and removal of collection caps, and any erosion at the wellhead. The calculated initial flow rate is 67,100 stock-tank barrels per day (stbd), which decays to 54,400 stbd just prior to installation of the capping stack and subsequent shut-in. The calculated cumulative discharge is 5.4 million stock-tank barrels, of which 4.6 million barrels entered the Gulf. Quantifiable uncertainties in these values are -9.3% and +7.5%, yielding a likely total discharge in the range from 4.9 to 5.8 million barrels. Minimum and maximum credible values of this discharge are 4.6 and 6.2 million barrels. Alternative calculations using the reservoir and sea-floor pressures indicate that any erosion within the BOP had little affect on cumulative discharge.

  14. 48 CFR 52.252-1 - Solicitation Provisions Incorporated by Reference. (United States)


    ... given in full text. Upon request, the Contracting Officer will make their full text available. The... and submitted with its quotation or offer. In lieu of submitting the full text of those provisions... with its quotation or offer. Also, the full text of a solicitation provision may be accessed...

  15. 48 CFR 252.225-7009 - Restriction on Acquisition of Certain Articles Containing Specialty Metals. (United States)


    ... metal (by mass). (ii) If two metals are specified in the name (e.g., nickel-iron alloy), those metals..., billet, wire, slab, plate, or sheet, and in the grade appropriate for the production of— (i) A finished... of the following elements: Aluminum, chromium, cobalt, molybdenum, nickel, niobium (columbium...

  16. Case 252: Acute Hyperammonemic Encephalopathy Resulting from Late-Onset Ornithine Transcarbamylase Deficiency. (United States)

    Hershman, Michelle; Carmody, Raymond; Udayasankar, Unni K


    History A 19-year-old woman with no pertinent medical history was brought to the emergency department after being found unconscious on her bathroom floor by her roommate. In the preceding weeks, she had reported intractable nausea and vomiting, for which she had been taking ondansetron. No other medications had been prescribed. The day prior to presentation, she had contacted her mother and described increasing confusion. Glasgow coma scale score on arrival in the emergency department was 4. Intravenous naloxone was administered, without immediate response. Initial blood glucose level was 232 mg/dL (12.8 mmol/L) (normal range, 79-140 mg/dL [4.4- 7.7 mmol/L]), and other routine laboratory test results were normal. Urine toxicology results were negative. Cerebrospinal fluid evaluation revealed levels were within normal limits. Neurologic examination revealed dilated pupils, which showed a sluggish response to light, and left lower extremity rigidity with intermittent tremors. Initial unenhanced cranial computed tomographic (CT) findings were negative. Magnetic resonance (MR) imaging of the brain was performed. The patient's condition deteriorated, with increasing cerebral edema over the next week, and she was declared brain dead. Her liver was transplanted into an adult recipient, who subsequently developed cerebral edema and elevated plasma ammonia levels, resulting in death in the immediate postoperative period.

  17. Calculated neutron air kerma strength conversion factors for a generically encapsulated Cf-252 brachytherapy source

    CERN Document Server

    Rivard, M J; D'Errico, F; Tsai, J S; Ulin, K; Engler, M J


    The sup 2 sup 5 sup 2 Cf neutron air kerma strength conversion factor (S sub K sub N /m sub C sub f) is a parameter needed to convert the radionuclide mass (mu g) provided by Oak Ridge National Laboratory into neutron air kerma strength required by modern clinical brachytherapy dosimetry formalisms indicated by Task Group No. 43 of the American Association of Physicists in Medicine (AAPM). The impact of currently used or proposed encapsulating materials for sup 2 sup 5 sup 2 Cf brachytherapy sources (Pt/Ir-10%, 316L stainless steel, nitinol, and Zircaloy-2) on S sub K sub N /m sub C sub f was calculated and results were fit to linear equations. Only for substantial encapsulation thicknesses, did S sub K sub N /m sub C sub f decrease, while the impact of source encapsulation composition is increasingly negligible as Z increases. These findings are explained on the basis of the non-relativistic kinematics governing the majority of sup 2 sup 5 sup 2 Cf neutron interactions. Neutron kerma and energy spectra resul...

  18. 48 CFR 252.227-7038 - Patent Rights-Ownership by the Contractor (Large Business). (United States)


    ... modifying the license, the agency— (A) Will furnish the Contractor a written notice of its intention to... 3 years after final payment under this contract, have the right to examine any books (including...

  19. 48 CFR 252.227-7014 - Rights in noncommercial computer software and noncommercial computer software documentation. (United States)


    ...) Restricted rights in computer software, limited rights in technical data, or government purpose license... necessary to perfect a license or licenses in the deliverable software or documentation of the appropriate... the license rights obtained. (e) Identification and delivery of computer software and computer...

  20. 48 CFR 252.225-7033 - Waiver of United Kingdom levies. (United States)


    ... waiver of levies included in the price of this contract, the U.S. Government reserves the right to reduce the contract price by the amount of the levy waived plus associated indirect costs and profit or fee... attempt to obtain a waiver of any commercial exploitation levies included in the price of this contract...