Up-regulation of eEF1A2 promotes proliferation and inhibits apoptosis in prostate cancer
International Nuclear Information System (INIS)
Sun, Yue; Du, Chengli; Wang, Bo; Zhang, Yanling; Liu, Xiaoyan; Ren, Guoping
2014-01-01
Highlights: • The expression of eEF1A2 is up-regulated in prostate cancer tissues. • Suppression of eEF1A2 inhibits the proliferation and promotes apoptosis. • Inhibition of eEF1A2 enhances the expression of apoptotic relevant proteins. • The expressions of eEF1A2 and cleavage-caspase3 are inversely correlated. - Abstract: Background: eEF1A2 is a protein translation factor involved in protein synthesis, which possesses important function roles in cancer development. This study aims at investigating the expression pattern of eEF1A2 in prostate cancer and its potential role in prostate cancer development. Methods: We examined the expression level of eEF1A2 in 30 pairs of prostate cancer tissues by using RT-PCR and immunohistochemical staining (IHC). Then we applied siRNA specifically targeting eEF1A2 to down-regulate its expression in DU-145 and PC-3 cells. Flow cytometer was used to explore apoptosis and Western-blot was used to detect the pathway proteins of apoptosis. Results: Our results showed that the expression level of eEF1A2 in prostate cancer tissues was significantly higher compared to their corresponding normal tissues. Reduction of eEF1A2 expression in DU-145 and PC-3 cells led to a dramatic inhibition of proliferation accompanied with enhanced apoptosis rate. Western blot revealed that apoptosis pathway proteins (caspase3, BAD, BAX, PUMA) were significantly up-regulated after suppression of eEF1A2. More importantly, the levels of eEF1A2 and caspase3 were inversely correlated in prostate cancer tissues. Conclusion: Our data suggests that eEF1A2 plays an important role in prostate cancer development, especially in inhibiting apoptosis. So eEF1A2 might serve as a potential therapeutic target in prostate cancer
Myostatin inhibits eEF2K-eEF2 by regulating AMPK to suppress protein synthesis.
Deng, Zhao; Luo, Pei; Lai, Wen; Song, Tongxing; Peng, Jian; Wei, Hong-Kui
2017-12-09
Growth of skeletal muscle is dependent on the protein synthesis, and the rate of protein synthesis is mainly regulated in the stage of translation initiation and elongation. Myostatin, a member of the transforming growth factor-β (TGF-β) superfamily, is a negative regulator of protein synthesis. C2C12 myotubes was incubated with 0, 0.01, 0.1, 1, 2, 3 μg/mL myostatin recombinant protein, and then we detected the rates of protein synthesis by the method of SUnSET. We found that high concentrations of myostatin (2 and 3 μg/mL) inhibited protein synthesis by blocking mTOR and eEF2K-eEF2 pathway, while low concentration of myostatin (0.01, 0.1 and 1 μg/mL) regulated eEF2K-eEF2 pathway activity to block protein synthesis without affected mTOR pathway, and myostatin inhibited eEF2K-eEF2 pathway through regulating AMPK pathway to suppress protein synthesis. It provided a new mechanism for myostatin regulating protein synthesis and treating muscle atrophy. Copyright © 2017. Published by Elsevier Inc.
The eEF1A proteins: at the crossroads of oncogenesis, apoptosis and viral infections.
Directory of Open Access Journals (Sweden)
Georges eHerbein
2015-04-01
Full Text Available Eukaryotic translation elongation factors 1 alpha, eEF1A1 and eEF1A2, are not only translation factors, but also pleiotropic proteins that are highly expressed in human tumors, including breast cancer, ovarian cancer and lung cancer. eEF1A1 modulates cytoskeleton, exhibits chaperone-like activity and also controls cell proliferation and cell death. By contrast eEF1A2 protein favors oncogenesis as shown by the fact that overexpression of eEF1A2 leads to cellular transformation and gives rise to tumors in nude mice. The eEF1A2 protein stimulates the phospholipid signaling and activates the Akt-dependent cell migration and actin remodeling that ultimately favors tumorigenesis. By contrast, inactivation of eEF1A proteins leads to immunodeficiency, neural and muscular defects, and favors apoptosis. Finally, eEF1A proteins interact with several viral proteins resulting in enhanced viral replication, decreased apoptosis and increased cellular transformation. This review summarizes the recent findings on eEF1A proteins indicating that eEF1A proteins play a critical role in numerous human diseases through enhancement of oncogenesis, blockade of apoptosis and increased viral pathogenesis.
Energy Technology Data Exchange (ETDEWEB)
Hong, Wen-Xu; Yang, Liang; Chen, Moutong; Yang, Xifei; Ren, Xiaohu; Fang, Shisong; Ye, Jinbo; Huang, Haiyan; Peng, Chaoqiong; Zhou, Li; Huang, Xinfeng; Yang, Fan; Wu, Desheng; Zhuang, Zhixiong; Liu, Jianjun, E-mail: bio-research@hotmail.com
2012-09-01
Emerging evidence indicates that trichloroethylene (TCE) exposure causes severe hepatotoxicity. However, the mechanisms of TCE hepatotoxicity remain unclear. Recently, we reported that TCE exposure up-regulated the expression of the oncoprotein SET/TAF-Iα and SET knockdown attenuated TCE-induced cytotoxicity in hepatic L-02 cells. To decipher the function of SET/TAF-Iα and its contributions to TCE-induced hepatotoxicity, we employed a proteomic analysis of SET/TAF-Iα with tandem affinity purification to identify SET/TAF-Iα-binding proteins. We identified 42 novel Gene Ontology co-annotated SET/TAF-Iα-binding proteins. The identifications of two of these proteins (eEF1A1, elongation factor 1-alpha 1; eEF1A2, elongation factor 1-alpha 2) were confirmed by Western blot analysis and co-immunoprecipitation (Co-IP). Furthermore, we analyzed the effects of TCE on the expression, distribution and interactions of eEF1A1, eEF1A2 and SET in L-02 cells. Western blot analysis reveals a significant up-regulation of eEF1A1, eEF1A2 and two isoforms of SET, and immunocytochemical analysis reveals that eEF1A1 and SET is redistributed by TCE. SET is redistributed from the nucleus to the cytoplasm, while eFE1A1 is translocated from the cytoplasm to the nucleus. Moreover, we find by Co-IP that TCE exposure significantly increases the interaction of SET with eEF1A2. Our data not only provide insights into the physiological functions of SET/TAF-Iα and complement the SET interaction networks, but also demonstrate that TCE exposure induces alterations in the expression, distribution and interactions of SET and its binding partners. These alterations may constitute the mechanisms of TCE cytotoxicity. -- Highlights: ► Identify 62 SET/TAF-Iα-associated proteins in human L-02 cells ► Trichloroethylene (TCE) alters the interaction of SET with eEF1A1 and eEF1A2. ► TCE induces the translocation and up-regulation of SET. ► TCE induces the translocation and up-regulation of eEF1A.
International Nuclear Information System (INIS)
Hong, Wen-Xu; Yang, Liang; Chen, Moutong; Yang, Xifei; Ren, Xiaohu; Fang, Shisong; Ye, Jinbo; Huang, Haiyan; Peng, Chaoqiong; Zhou, Li; Huang, Xinfeng; Yang, Fan; Wu, Desheng; Zhuang, Zhixiong; Liu, Jianjun
2012-01-01
Emerging evidence indicates that trichloroethylene (TCE) exposure causes severe hepatotoxicity. However, the mechanisms of TCE hepatotoxicity remain unclear. Recently, we reported that TCE exposure up-regulated the expression of the oncoprotein SET/TAF-Iα and SET knockdown attenuated TCE-induced cytotoxicity in hepatic L-02 cells. To decipher the function of SET/TAF-Iα and its contributions to TCE-induced hepatotoxicity, we employed a proteomic analysis of SET/TAF-Iα with tandem affinity purification to identify SET/TAF-Iα-binding proteins. We identified 42 novel Gene Ontology co-annotated SET/TAF-Iα-binding proteins. The identifications of two of these proteins (eEF1A1, elongation factor 1-alpha 1; eEF1A2, elongation factor 1-alpha 2) were confirmed by Western blot analysis and co-immunoprecipitation (Co-IP). Furthermore, we analyzed the effects of TCE on the expression, distribution and interactions of eEF1A1, eEF1A2 and SET in L-02 cells. Western blot analysis reveals a significant up-regulation of eEF1A1, eEF1A2 and two isoforms of SET, and immunocytochemical analysis reveals that eEF1A1 and SET is redistributed by TCE. SET is redistributed from the nucleus to the cytoplasm, while eFE1A1 is translocated from the cytoplasm to the nucleus. Moreover, we find by Co-IP that TCE exposure significantly increases the interaction of SET with eEF1A2. Our data not only provide insights into the physiological functions of SET/TAF-Iα and complement the SET interaction networks, but also demonstrate that TCE exposure induces alterations in the expression, distribution and interactions of SET and its binding partners. These alterations may constitute the mechanisms of TCE cytotoxicity. -- Highlights: ► Identify 62 SET/TAF-Iα-associated proteins in human L-02 cells ► Trichloroethylene (TCE) alters the interaction of SET with eEF1A1 and eEF1A2. ► TCE induces the translocation and up-regulation of SET. ► TCE induces the translocation and up-regulation of eEF1A.
Scaggiante, B; Dapas, B; Bonin, S; Grassi, M; Zennaro, C; Farra, R; Cristiano, L; Siracusano, S; Zanconati, F; Giansante, C; Grassi, G
2012-01-03
In prostate adenocarcinoma, the dissection of the expression behaviour of the eukaryotic elongation factors (eEF1A1/2) has not yet fully elucidated. The EEF1A1/A2 expressions were investigated by real-time PCR, western blotting (cytoplasmic and cytoskeletal/nuclear-enriched fractions) and immunofluorescence in the androgen-responsive LNCaP and the non-responsive DU-145 and PC-3 cells, displaying a low, moderate and high aggressive phenotype, respectively. Targeted experiments were also conducted in the androgen-responsive 22Rv1, a cell line marking the progression towards androgen-refractory tumour. The non-tumourigenic prostate PZHPV-7 cell line was the control. Compared with PZHPV-7, cancer cells showed no major variations in EEF1A1 mRNA; eEF1A1 protein increased only in cytoskeletal/nuclear fraction. On the contrary, a significant rise of EEF1A2 mRNA and protein were found, with the highest levels detected in LNCaP. Eukaryotic elongation factor 1A2 immunostaining confirmed the western blotting results. Pilot evaluation in archive prostate tissues showed the presence of EEF1A2 mRNA in near all neoplastic and perineoplastic but not in normal samples or in benign adenoma; in contrast, EEF1A1 mRNA was everywhere detectable. Eukaryotic elongation factor 1A2 switch-on, observed in cultured tumour prostate cells and in human prostate tumour samples, may represent a feature of prostate cancer; in contrast, a minor involvement is assigned to EEF1A1. These observations suggest to consider EEF1A2 as a marker for prostate cell transformation and/or possibly as a hallmark of cancer progression.
Hong, Wen-Xu; Yang, Liang; Chen, Moutong; Yang, Xifei; Ren, Xiaohu; Fang, Shisong; Ye, Jinbo; Huang, Haiyan; Peng, Chaoqiong; Zhou, Li; Huang, Xinfeng; Yang, Fan; Wu, Desheng; Zhuang, Zhixiong; Liu, Jianjun
2012-09-01
Emerging evidence indicates that trichloroethylene (TCE) exposure causes severe hepatotoxicity. However, the mechanisms of TCE hepatotoxicity remain unclear. Recently, we reported that TCE exposure up-regulated the expression of the oncoprotein SET/TAF-Iα and SET knockdown attenuated TCE-induced cytotoxicity in hepatic L-02 cells. To decipher the function of SET/TAF-Iα and its contributions to TCE-induced hepatotoxicity, we employed a proteomic analysis of SET/TAF-Iα with tandem affinity purification to identify SET/TAF-Iα-binding proteins. We identified 42 novel Gene Ontology co-annotated SET/TAF-Iα-binding proteins. The identifications of two of these proteins (eEF1A1, elongation factor 1-alpha 1; eEF1A2, elongation factor 1-alpha 2) were confirmed by Western blot analysis and co-immunoprecipitation (Co-IP). Furthermore, we analyzed the effects of TCE on the expression, distribution and interactions of eEF1A1, eEF1A2 and SET in L-02 cells. Western blot analysis reveals a significant up-regulation of eEF1A1, eEF1A2 and two isoforms of SET, and immunocytochemical analysis reveals that eEF1A1 and SET is redistributed by TCE. SET is redistributed from the nucleus to the cytoplasm, while eFE1A1 is translocated from the cytoplasm to the nucleus. Moreover, we find by Co-IP that TCE exposure significantly increases the interaction of SET with eEF1A2. Our data not only provide insights into the physiological functions of SET/TAF-Iα and complement the SET interaction networks, but also demonstrate that TCE exposure induces alterations in the expression, distribution and interactions of SET and its binding partners. These alterations may constitute the mechanisms of TCE cytotoxicity. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
José Manuel Mingot
2013-11-01
Full Text Available Exportin5 mediates the nuclear export of double-stranded RNAs, including pre-microRNAs, adenoviral RNAs, and tRNAs. When tRNAs are aminoacylated, the Exportin5-aminoacyl (aa-tRNA complex recruits and coexports the translation elongation factor eEF1A. Here, we show that eEF1A binds to Snail transcription factors when bound to their main target, the E-cadherin promoter, facilitating their export to the cytoplasm in association with the aa-tRNA-Exportin5 complex. Snail binds to eEF1A through the SNAG domain, a protein nuclear export signal present in several transcription factor families, and this binding is regulated by phosphorylation. Thus, we describe a nuclear role for eEF1A and provide a mechanism for protein nuclear export that attenuates the activity of SNAG-containing transcription factors.
The Role of Protein Elongation Factor EEF1A2 in Breast Cancer
National Research Council Canada - National Science Library
Lee, Jonathan M
2004-01-01
... overexpression can be used as a breast cancer prognostic factor. In addition, we proposed to test the idea that EEF1A2 expression modulates sensitivity to cisplatin and taxol and that EEF1A2-inactivation could be used as a treatment for breast cancer...
Regulation of eukaryotic elongation factor 1 alpha (eEF1A) by dynamic lysine methylation
DEFF Research Database (Denmark)
Jakobsson, Magnus E; Małecki, Jędrzej; Falnes, Pål Ø
2018-01-01
Lysine methylation is a frequent post-translational protein modification, which has been intensively studied in the case of histone proteins. Lysine methylations are also found on many non-histone proteins, and one prominent example is eukaryotic elongation factor 1 alpha (eEF1A). Besides its...... essential role in the protein synthesis machinery, a number of non-canonical functions have also been described for eEF1A, such as regulation of the actin cytoskeleton and the promotion of viral replication. The functional significance of the extensive lysine methylations on eEF1A, as well as the identity...
Porcine EEF1A1 and EEF1A2 genes: genomic structure, polymorphism, mapping and expression
Czech Academy of Sciences Publication Activity Database
Svobodová, K.; Horák, Pavel; Stratil, Antonín; Bartenschlager, H.; Van Poucke, M.; Chalupová, P.; Dvořáková, Věra; Knorr, Ch.; Stupka, R.; Čítek, J.; Šprysl, M.; Palánová, Anna; Peelman, L. J.; Geldermann, H.; Knoll, A.
2015-01-01
Roč. 42, č. 8 (2015), s. 1257-1264 ISSN 0301-4851 R&D Projects: GA ČR(CZ) GA523/06/1302; GA ČR GA523/09/0844 Institutional support: RVO:67985904 Keywords : EEF1A1 * EEF1A2 * gene expression Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.698, year: 2015
International Nuclear Information System (INIS)
Tomlinson, Victoria AL; Newbery, Helen J; Wray, Naomi R; Jackson, Juliette; Larionov, Alexey; Miller, William R; Dixon, J Michael; Abbott, Catherine M
2005-01-01
The tissue-specific translation elongation factor eEF1A2 was recently shown to be a potential oncogene that is overexpressed in ovarian cancer. Although there is no direct evidence for an involvement of eEF1A2 in breast cancer, the genomic region to which EEF1A2 maps, 20q13, is frequently amplified in breast tumours. We therefore sought to establish whether eEF1A2 expression might be upregulated in breast cancer. eEF1A2 is highly similar (98%) to the near-ubiquitously expressed eEF1A1 (formerly known as EF1-α) making analysis with commercial antibodies difficult. We have developed specific anti-eEF1A2 antibodies and used them in immunohistochemical analyses of tumour samples. We report the novel finding that although eEF1A2 is barely detectable in normal breast it is moderately to strongly expressed in two-thirds of breast tumours. This overexpression is strongly associated with estrogen receptor positivity. eEF1A2 should be considered as a putative oncogene in breast cancer that may be a useful diagnostic marker and therapeutic target for a high proportion of breast tumours. The oncogenicity of eEF1A2 may be related to its role in protein synthesis or to its potential non-canonical functions in cytoskeletal remodelling or apoptosis
Directory of Open Access Journals (Sweden)
Miller William R
2005-09-01
Full Text Available Abstract Background The tissue-specific translation elongation factor eEF1A2 was recently shown to be a potential oncogene that is overexpressed in ovarian cancer. Although there is no direct evidence for an involvement of eEF1A2 in breast cancer, the genomic region to which EEF1A2 maps, 20q13, is frequently amplified in breast tumours. We therefore sought to establish whether eEF1A2 expression might be upregulated in breast cancer. Methods eEF1A2 is highly similar (98% to the near-ubiquitously expressed eEF1A1 (formerly known as EF1-α making analysis with commercial antibodies difficult. We have developed specific anti-eEF1A2 antibodies and used them in immunohistochemical analyses of tumour samples. We report the novel finding that although eEF1A2 is barely detectable in normal breast it is moderately to strongly expressed in two-thirds of breast tumours. This overexpression is strongly associated with estrogen receptor positivity. Conclusion eEF1A2 should be considered as a putative oncogene in breast cancer that may be a useful diagnostic marker and therapeutic target for a high proportion of breast tumours. The oncogenicity of eEF1A2 may be related to its role in protein synthesis or to its potential non-canonical functions in cytoskeletal remodelling or apoptosis.
Sordarin derivatives induce a novel conformation of the yeast ribosome translocation factor eEF2
DEFF Research Database (Denmark)
Søe, Rikke; Mosley, R.T.; Justice, M.
2007-01-01
EF2 that form the ligand binding pocket are oriented in a different manner relative to the rest of eEF2 compared to our previous structure of eEF2 in complex with the parent natural product sordarin. Yeast eEF2 is also shown to bind adenylic nucleotides, which can be displaced by sordarin, suggesting...... that ADP or ATP also bind to the three C-terminal domains of eEF2. Fusidic acid is a universal inhibitor of translation that targets EF-G or eEF2, and is widely used as an antibiotic against gram positive bacteria. Based on mutations conferring resistance to fusidic acid, cryo-EM reconstructions, and X...
Directory of Open Access Journals (Sweden)
Shalak V. F.
2014-11-01
Full Text Available Aim. We intend to characterize the new peptide-specific antibodies against the isoform 2 of translation elongation factor 1A (eEF1A2 and determine its presence in the postoperative samples of human breast, lung and stomach tumor tissues. Methods. The analysis of antibody specificity was performed by enzyme-linked immunosorbent assay, immunoblotting and immunohistochemistry. Immunoblotting and immunohistochemistry were used for the determination of the eEF1A2 in the human tumor samples, as well as in the samples of normal tissues surrounding tumors. Results. The antibodies obtained against the eEF1A2 specifically recognized this protein in the cell extracts and histological sections and did not cross-react with the elongation factor 1A isoform 1. eEF1A2 was revealed in the postoperative samples of breast, lung and stomach tumors as well as in the putative normal tissues surrounding tumors. Conclusions. The antibodies obtained against eEF1A2 are highly specific for the antigen and can be used for the immunological studies of tumors.
DEFF Research Database (Denmark)
Rose, Adam John; Bisiani, Bruno; Vistisen, Bodil
2009-01-01
that the increase in skeletal muscle eEF2 Thr(56) phosphorylation was restricted to type I myofibers. Taken together, these data suggest that the depression of skeletal muscle protein synthesis with endurance-type exercise may be regulated at both initiation (i.e. 4EBP1) and elongation (i.e. eEF2) steps, with eEF2......Protein synthesis in skeletal muscle is known to decrease during exercise and it has been suggested that this may depend on the magnitude of the relative metabolic stress within the contracting muscle. To examine the mechanisms behind this, the effect of exercise intensity on skeletal muscle......) increased during exercise but was not influenced by exercise intensity, and was lower than rest 30min after exercise. On the other hand, 4EBP1 phosphorylation at Thr(37/46) decreased during exercise and this decrease was greater at higher exercise intensities, and was similar to rest 30min after exercise...
Cao, Siqi; Smith, Laura L; Padilla-Lopez, Sergio R; Guida, Brandon S; Blume, Elizabeth; Shi, Jiahai; Morton, Sarah U; Brownstein, Catherine A; Beggs, Alan H; Kruer, Michael C; Agrawal, Pankaj B
2017-09-15
Eukaryotic elongation factor 1A (EEF1A), is encoded by two distinct isoforms, EEF1A1 and EEF1A2; whereas EEF1A1 is expressed almost ubiquitously, EEF1A2 expression is limited such that it is only detectable in skeletal muscle, heart, brain and spinal cord. Currently, the role of EEF1A2 in normal cardiac development and function is unclear. There have been several reports linking de novo dominant EEF1A2 mutations to neurological issues in humans. We report a pair of siblings carrying a homozygous missense mutation p.P333L in EEF1A2 who exhibited global developmental delay, failure to thrive, dilated cardiomyopathy and epilepsy, ultimately leading to death in early childhood. A third sibling also died of a similar presentation, but DNA was unavailable to confirm the mutation. Functional genomic analysis was performed in S. cerevisiae and zebrafish. In S. cerevisiae, there was no evidence for a dominant-negative effect. Previously identified putative de novo mutations failed to complement yeast strains lacking the EEF1A ortholog showing a major growth defect. In contrast, the introduction of the mutation seen in our family led to a milder growth defect. To evaluate its function in zebrafish, we knocked down eef1a2 expression using translation blocking and splice-site interfering morpholinos. EEF1A2-deficient zebrafish had skeletal muscle weakness, cardiac failure and small heads. Human EEF1A2 wild-type mRNA successfully rescued the morphant phenotype, but mutant RNA did not. Overall, EEF1A2 appears to be critical for normal heart function in humans, and its deficiency results in clinical abnormalities in neurologic function as well as in skeletal and cardiac muscle defects. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Davis, William G; Blackwell, Jerry L; Shi, Pei-Yong; Brinton, Margo A
2007-09-01
RNase footprinting and nitrocellulose filter binding assays were previously used to map one major and two minor binding sites for the cell protein eEF1A on the 3'(+) stem-loop (SL) RNA of West Nile virus (WNV) (3). Base substitutions in the major eEF1A binding site or adjacent areas of the 3'(+) SL were engineered into a WNV infectious clone. Mutations that decreased, as well as ones that increased, eEF1A binding in in vitro assays had a negative effect on viral growth. None of these mutations affected the efficiency of translation of the viral polyprotein from the genomic RNA, but all of the mutations that decreased in vitro eEF1A binding to the 3' SL RNA also decreased viral minus-strand RNA synthesis in transfected cells. Also, a mutation that increased the efficiency of eEF1A binding to the 3' SL RNA increased minus-strand RNA synthesis in transfected cells, which resulted in decreased synthesis of genomic RNA. These results strongly suggest that the interaction between eEF1A and the WNV 3' SL facilitates viral minus-strand synthesis. eEF1A colocalized with viral replication complexes (RC) in infected cells and antibody to eEF1A coimmunoprecipitated viral RC proteins, suggesting that eEF1A facilitates an interaction between the 3' end of the genome and the RC. eEF1A bound with similar efficiencies to the 3'-terminal SL RNAs of four divergent flaviviruses, including a tick-borne flavivirus, and colocalized with dengue virus RC in infected cells. These results suggest that eEF1A plays a similar role in RNA replication for all flaviviruses.
Directory of Open Access Journals (Sweden)
Xing Hua Tang
Full Text Available We investigated whether glutamate, NMDA receptors, and eukaryote elongation factor-2 kinase (eEF-2K/eEF-2 regulate P-glycoprotein expression, and the effects of the eEF-2K inhibitor NH125 on the expression of P-glycoprotein in rat brain microvessel endothelial cells (RBMECs.Cortex was obtained from newborn Wistar rat brains. After surface vessels and meninges were removed, the pellet containing microvessels was resuspended and incubated at 37°C in culture medium. Cell viability was assessed by the MTT assay. RBMECs were identified by immunohistochemistry with anti-vWF. P-glycoprotein, phospho-eEF-2, and eEF-2 expression were determined by western blot analysis. Mdr1a gene expression was analyzed by RT-PCR.Mdr1a mRNA, P-glycoprotein and phospho-eEF-2 expression increased in L-glutamate stimulated RBMECs. P-glycoprotein and phospho-eEF-2 expression were down-regulated after NH125 treatment in L-glutamate stimulated RBMECs.eEF-2K/eEF-2 should have played an important role in the regulation of P-glycoprotein expression in RBMECs. eEF-2K inhibitor NH125 could serve as an efficacious anti-multidrug resistant agent.
Murray, Lyndsay M; Thomson, Derek; Conklin, Annalijn; Wishart, Thomas M; Gillingwater, Thomas H
2008-12-01
Wallerian degeneration and dying-back pathology are two well-known cellular pathways capable of regulating the breakdown and loss of axonal and synaptic compartments of neurons in vivo. However, the underlying mechanisms and molecular triggers of these pathways remain elusive. Here, we show that loss of translation elongation factor eEF1A2 expression in lower motor neurons and skeletal muscle fibres in homozygous Wasted mice triggered a dying-back neuropathy. Synaptic loss at the neuromuscular junction occurred in advance of axonal pathology and by a mechanism morphologically distinct from Wallerian degeneration. Dying-back pathology in Wasted mice was accompanied by reduced expression levels of the zinc finger protein ZPR1, as found in other dying-back neuropathies such as spinal muscular atrophy. Surprisingly, experimental nerve lesion revealed that Wallerian degeneration was significantly delayed in homozygous Wasted mice; morphological assessment revealed that approximately 80% of neuromuscular junctions in deep lumbrical muscles at 24 h and approximately 50% at 48 h had retained motor nerve terminals following tibial nerve lesion. This was in contrast to wild-type and heterozygous Wasted mice where < 5% of neuromuscular junctions had retained motor nerve terminals at 24 h post-lesion. These data show that eEF1A2 expression is required to prevent the initiation of dying-back pathology at the neuromuscular junction in vivo. In contrast, loss of eEF1A2 expression significantly inhibited the initiation and progression of Wallerian degeneration in vivo. We conclude that loss of eEF1A2 expression distinguishes mechanisms underlying dying-back pathology from those responsible for Wallerian degeneration in vivo and suggest that eEF1A2-dependent cascades may provide novel molecular targets to manipulate neurodegenerative pathways in lower motor neurons.
Energy Technology Data Exchange (ETDEWEB)
Sun, Yu; Wong, Nicholas; Guan, Yinghui; Salamanca, Clara M.; Cheng, Jung Chien; Lee, Jonathan M.; Gray, Joe W.; Auersperg, Nelly
2008-04-25
Ovarian epithelial carcinomas (OEC) frequently exhibit amplifications at the 20q13 locus which is the site of several oncogenes, including the eukaryotic elongation factor EEF1A2 and the transcription factor ZNF217. We reported previously that overexpressed ZNF217 induces neoplastic characteristics in precursor cells of OEC. Unexpectedly, ZNF217, which is a transcriptional repressor, enhanced expression of eEF1A2. In this study, array comparative genomic hybridization, single nucleotide polymorphism and Affymetrix analysis of ZNF217-overexpressing cell lines confirmed consistently increased expression of eEF1A2 but not of other oncogenes, and revealed early changes in EEF1A2 gene copy numbers and increased expression at crisis during immortalization. We defined the influence of eEF1A2 overexpression on immortalized ovarian surface epithelial cells, and investigated interrelationships between effects of ZNF217 and eEF1A2 on cellular phenotypes. Lentivirally induced eEF1A2 overexpression caused delayed crisis, apoptosis resistance and increases in serum-independence, saturation densities, and anchorage independence. siRNA to eEF1A2 reversed apoptosis resistance and reduced anchorage independence in eEF1A2-overexpressing lines. Remarkably, siRNA to eEF1A2 was equally efficient in inhibiting both anchorage independence and resistance to apoptosis conferred by ZNF217 overexpression. Our data define neoplastic properties that are caused by eEF1A2 in nontumorigenic ovarian cancer precursor cells, and suggest that eEF1A2 plays a role in mediating ZNF217-induced neoplastic progression.
Crepin, Thibaut; Shalak, Vyacheslav F; Yaremchuk, Anna D; Vlasenko, Dmytro O; McCarthy, Andrew; Negrutskii, Boris S; Tukalo, Michail A; El'skaya, Anna V
2014-11-10
Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon-anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the 'GTP'- and 'GDP'-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Fujimura, Masatake, E-mail: fujimura@nimd.go.jp [Department of Basic Medical Sciences, National Institute for Minamata Disease, Kumamoto (Japan); Usuki, Fusako [Department of Clinical Medicine, National Institute for Minamata Disease, Kumamoto (Japan); Cheng, Jinping; Zhao, Wenchang [School of Environmental Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)
2016-05-01
Methylmercury (MeHg) is a highly neurotoxic environmental chemical that can cause developmental impairments. Human fetuses and neonates are particularly susceptible to MeHg toxicity; however, the mechanisms governing its effects in the developing brain are unclear. In the present study, we investigated the effects of prenatal and lactational MeHg exposure on the developing cerebellum in rats. We demonstrated that exposure to 5 ppm MeHg decreased postnatal expression of pre- and postsynaptic proteins, suggesting an impairment in synaptic development. MeHg exposure also reduced neurite outgrowth, as shown by a decrease in the expression of the neurite marker neurofilament H. These changes were not observed in rats exposed to 1 ppm MeHg. In order to define the underlying mechanism, we investigated the effects of MeHg exposure on the tropomyosin receptor kinase (Trk) A pathway, which plays important roles in neuronal differentiation and synapse formation. We demonstrated suppression of the TrkA pathway on gestation day 20 in rats exposed to 5 ppm MeHg. In addition, down-regulation of eukaryotic elongation factor 1A1 (eEF1A1) was observed on postnatal day 1. eEF1A1 knockdown in differentiating PC12 cells impaired neurite outgrowth and synaptic protein expression, similar to the results of MeHg exposure in the cerebellum. These results suggest that suppression of the TrkA pathway and subsequent decreases in eEF1A1 expression induced by prenatal exposure to MeHg may lead to reduced neurite outgrowth and synaptic protein expression in the developing cerebellum. - Highlights: • Prenatal exposure to MeHg decreased postnatal expression of synaptic proteins. • MeHg exposure also reduced neurite outgrowth postnatally. • Suppression of the TrkA pathway and eEF1A1 expression was induced by MeHg exposure. • eEF1A1 knockdown impaired neurite outgrowth and synaptic protein expression.
International Nuclear Information System (INIS)
Fujimura, Masatake; Usuki, Fusako; Cheng, Jinping; Zhao, Wenchang
2016-01-01
Methylmercury (MeHg) is a highly neurotoxic environmental chemical that can cause developmental impairments. Human fetuses and neonates are particularly susceptible to MeHg toxicity; however, the mechanisms governing its effects in the developing brain are unclear. In the present study, we investigated the effects of prenatal and lactational MeHg exposure on the developing cerebellum in rats. We demonstrated that exposure to 5 ppm MeHg decreased postnatal expression of pre- and postsynaptic proteins, suggesting an impairment in synaptic development. MeHg exposure also reduced neurite outgrowth, as shown by a decrease in the expression of the neurite marker neurofilament H. These changes were not observed in rats exposed to 1 ppm MeHg. In order to define the underlying mechanism, we investigated the effects of MeHg exposure on the tropomyosin receptor kinase (Trk) A pathway, which plays important roles in neuronal differentiation and synapse formation. We demonstrated suppression of the TrkA pathway on gestation day 20 in rats exposed to 5 ppm MeHg. In addition, down-regulation of eukaryotic elongation factor 1A1 (eEF1A1) was observed on postnatal day 1. eEF1A1 knockdown in differentiating PC12 cells impaired neurite outgrowth and synaptic protein expression, similar to the results of MeHg exposure in the cerebellum. These results suggest that suppression of the TrkA pathway and subsequent decreases in eEF1A1 expression induced by prenatal exposure to MeHg may lead to reduced neurite outgrowth and synaptic protein expression in the developing cerebellum. - Highlights: • Prenatal exposure to MeHg decreased postnatal expression of synaptic proteins. • MeHg exposure also reduced neurite outgrowth postnatally. • Suppression of the TrkA pathway and eEF1A1 expression was induced by MeHg exposure. • eEF1A1 knockdown impaired neurite outgrowth and synaptic protein expression.
Directory of Open Access Journals (Sweden)
Vislovukh A. A.
2013-01-01
Full Text Available Eukaryotic translation elongation factor 1A exists as two 98 % homologous isoforms: eEF1A1 (A1 and eEF1A2 (A2 which are tissue and development specific. Despite high homology in an open reading frame (ORF region, mRNAs coding for eEF1A1 and eEF1A2 are different in their untranslated regions (UTR, suggesting a possibility of their dissimilar post-transcriptional regulation. Aim. To analyze the existence of cis-acting motifs in the UTRs of EEF1A1/A2 mRNAs, to confirm the possibility of post-transcriptional control of eEF1A1 and eEF1A2 expression. Methods. An ensemble of bioinformatic methods was applied to predict regulatory motifs in the UTRs of EEF1A1/A2 mRNAs. Dual-luciferase reporter assay was employed to detect post-transcriptional regulation of eEF1A1/A2 expression. Results. Numerous regulatory motifs in the UTR of EEF1A1/A2 mRNAs were found bioinformatically. The experimental evidence was obtained for the existence of negative regulation of EEF1A1 and positive regulation of EEF1A2 mRNA in the model of breast cancer development. Conclusions. EEF1A1 and EEF1A2 mRNAs contain distinct motifs in the UTRs and are differently regulated in cancer suggesting the possibility of their control by different cellular signals.
Mapping the human translation elongation factor eEF1H complex using the yeast two-hybrid system
DEFF Research Database (Denmark)
Mansilla, Francisco; Friis, Irene; Jadidi, Mandana
2002-01-01
In eukaryotes, the eukaryotic translation elongation factor eEF1A responsible for transporting amino-acylated tRNA to the ribosome forms a higher-order complex, eEF1H, with its guanine-nucleotide-exchange factor eEF1B. In metazoans, eEF1B consists of three subunits: eEF1B alpha, eEF1B eta and eEF1B...... of in vitro experiments have been proposed for the macromolecular organization of the eEF1H complex. However, these models differ in various aspects. This might be due to the difficulties of handling, particularly the eEF1B beta and eEF1B gamma subunits in vitro. Here, the human eEF1H complex is for the first...... gamma:eEF1B beta, where the last was observed using a three-hybrid approach. Surprisingly, eEF1A2 showed no or only little affinity for the guanine-nucleotide-exchange factors. Truncated versions of the subunits of eEF1B were used to orientate these subunits within the resulting model. The model unit...
Wang, Qiantao; Edupuganti, Ramakrishna; Tavares, Clint D J; Dalby, Kevin N; Ren, Pengyu
2015-01-01
A-484954 is a known eEF2K inhibitor with submicromolar IC50 potency. However, the binding mechanism and the crystal structure of the kinase remains unknown. Here, we employ a homology eEF2K model, docking and alchemical free energy simulations to probe the binding mechanism of eEF2K, and in turn, guide the optimization of potential lead compounds. The inhibitor was docked into the ATP-binding site of a homology model first. Three different binding poses, hypothesis 1, 2, and 3, were obtained and subsequently applied to molecular dynamics (MD) based alchemical free energy simulations. The calculated relative binding free energy of the analogs of A-484954 using the binding pose of hypothesis 1 show a good correlation with the experimental IC50 values, yielding an r (2) coefficient of 0.96 after removing an outlier (compound 5). Calculations using another two poses show little correlation with experimental data, (r (2) of less than 0.5 with or without removing any outliers). Based on hypothesis 1, the calculated relative free energy suggests that bigger cyclic groups, at R1 e.g., cyclobutyl and cyclopentyl promote more favorable binding than smaller groups, such as cyclopropyl and hydrogen. Moreover, this study also demonstrates the ability of the alchemical free energy approach in combination with docking and homology modeling to prioritize compound synthesis. This can be an effective means of facilitating structure-based drug design when crystal structures are not available.
Gagny, B; Rossignol, M; Silar, P
1997-12-01
We have cloned and sequenced the gene encoding the translation elongation factor eEF1A from two filamentous fungi, Podospora curvicolla and Sordaria macrospora. These fungi are close relatives of Podospora anserina and also show senescence syndromes. Comparison of the sequences of the deduced proteins with that of P. anserina reveals that the three proteins differ in several positions. Replacement of the P. anserina gene by either of the two exogenous genes does not entail any modification in P. anserina physiology; the longevity of the fungus is not affected. No alteration of in vivo translational accuracy was detected; however, the exogenous proteins nonetheless promoted a modification of the resistance to the aminoglycoside antibiotic paromomycin. These data suggest that optimization of life span between these closely related fungi has likely not been performed during evolution through modifications of eEF1A activity, despite the fact that mutations in this factor can drastically affect longevity. Copyright 1997 Academic Press.
Structure of eEF3 and the mechanism of transfer RNA release from the E-site
DEFF Research Database (Denmark)
Andersen, Christian Brix Folsted; Becker, T.; Blau, M.
2006-01-01
Elongation factor eEF3 is an ATPase, which, in addition to the two canonical factors eEF1A and eEF2, serves an essential function in the translation cycle of fungi. eEF3 is required for the binding of the aatRNA-eEF1A-GTP ternary complex to the ribosomal A-site and has been suggested to facilitate...... the clearance of deacyl-tRNA from the E-site. Here, we present the crystal structure of eEF3 showing that it consists of an N-terminal HEAT repeat domain, followed by a four-helix bundle and two ABC-type ATPase domains with a chromo-domain inserted in ABC2. Moreover, we present the cryo-EM structure of the ATP......-bound form of eEF3 in complex with the post-translocational state 80S ribosome from yeast. eEF3 uses an entirely new factor binding site near the ribosomal E-site, with the chromodomain stabilizing the ribosomal L1 stalk in an open conformation, thus, allowing tRNA release....
Directory of Open Access Journals (Sweden)
Kenji Hashimoto
Full Text Available Cilostazol, a type-3 phosphodiesterase (PDE3 inhibitor, has become widely used as an antiplatelet drug worldwide. A recent second Cilostazol Stroke Prevention Study demonstrated that cilostazol is superior to aspirin for prevention of stroke after an ischemic stroke. However, its precise mechanisms of action remain to be determined. Here, we report that cilostazol, but not the PDE3 inhibitors cilostamide and milrinone, significantly potentiated nerve growth factor (NGF-induced neurite outgrowth in PC12 cells. Furthermore, specific inhibitors for the endoplasmic reticulum protein inositol 1,4,5-triphosphate (IP(3 receptors and several common signaling pathways (PLC-γ, PI3K, Akt, p38 MAPK, and c-Jun N-terminal kinase (JNK, and the Ras/Raf/ERK/MAPK significantly blocked the potentiation of NGF-induced neurite outgrowth by cilostazol. Using a proteomics analysis, we identified that levels of eukaryotic translation elongation factor eEF1A1 protein were significantly increased by treatment with cilostazol, but not cilostamide, in PC12 cells. Moreover, the potentiating effects of cilostazol on NGF-induced neurite outgrowth were significantly antagonized by treatment with eEF1A1 RNAi, but not the negative control of eEF1A1. These findings suggest that eEF1A1 and several common cellular signaling pathways might play a role in the mechanism of cilostazol-induced neurite outgrowth. Therefore, agents that can increase the eEF1A1 protein may have therapeutic relevance in diverse conditions with altered neurite outgrowth.
Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.
Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li
2017-10-01
Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.
Li, Jun; Mahdi, Fakhri; Du, Lin; Datta, Sandipan; Nagle, Dale G.; Zhou, Yu-Dong
2011-01-01
Over 20000 lipid extracts of plants and marine organisms were evaluated in a human breast tumor T47D cell-based reporter assay for hypoxia-inducible factor-1 (HIF-1) inhibitory activity. Bioassay-guided isolation and dereplication-based structure elucidation of an active extract from the Bael tree (Aegle marmelos) afforded two protolimonoids, skimmiarepin A (1) and skimmiarepin C (2). In T47D cells, 1 and 2 inhibited hypoxia-induced HIF-1 activation with IC50 values of 0.063 µM and 0.068 µM, respectively. Compounds 1 and 2 also suppressed hypoxic induction of the HIF-1 target genes GLUT-1 and VEGF. Mechanistic studies revealed that 1 and 2 inhibited HIF-1 activation by blocking the hypoxia-induced accumulation of HIF-1α protein. At the range of concentrations that inhibited HIF-1 activation, 1 and 2 suppressed cellular respiration by selectively inhibiting the mitochondrial electron transport chain at complex I (NADH dehydrogenase). Further investigation indicated that mitochondrial respiration inhibitors such as 1 and rotenone induced the rapid hyperphosphorylation and inhibition of translation initiation factor eIF2α and elongation factor eEF2. The inhibition of protein translation may account for the short-term exposure effects exerted by mitochondrial inhibitors on cellular signaling, while the suppression of cellular ATP production may contribute to the inhibitory effects following extended treatment periods. PMID:21875114
Eukaryotic Elongation Factor 2 (eEF2) mediates translocation in protein synthesis. eEF2 is modified by two post-translational modifications: the phosphorylation of Thr57 in the G domain and a unique conversion of His699 to diphthamide at the tip of domain IV. Diphthamide is the t...
DEFF Research Database (Denmark)
Rose, Adam John; Alsted, Thomas Junker; Jensen, Thomas Elbenhardt
2009-01-01
Skeletal muscle protein synthesis rate decreases during contractions but the underlying regulatory mechanisms are poorly understood. It was hypothesised that there would be a coordinated regulation of eukaryotic elongation factor 2 (eEF2) and eukaryotic initiation factor 4E-binding protein 1 (4EBP1......) phosphorylation by signalling cascades downstream of rises in intracellular [Ca(2+)] and decreased energy charge via AMP activated protein kinase (AMPK) in contracting skeletal muscle. When fast-twitch skeletal muscles were contracted ex vivo using different protocols, the suppression of protein synthesis...... correlated more closely with changes in eEF2 rather than 4EBP1 phosphorylation. Using a combination of Ca(2+) release agents and ATPase inhibitors it was shown that the 60-70% suppression of fast-twitch skeletal muscle protein synthesis during contraction was equally distributed between Ca(2+) and energy...
Insausti, Matías; Fernández Band, Beatriz S
2015-04-05
A highly sensitive spectrofluorimetric method has been developed for the determination of 2-ethylhexyl nitrate in diesel fuel. Usually, this compound is used as an additive in order to improve cetane number. The analytical method consists in building the chemometric model as a first step. Then, it is possible to quantify the analyte with only recording a single excitation-emission fluorescence spectrum (EEF), whose data are introduced in the chemometric model above mentioned. Another important characteristic of this method is that the fuel sample was used without any pre-treatment for EEF. This work provides an interest improvement to fluorescence techniques using the rapid and easily applicable EEF approach to analyze such complex matrices. Exploding EEF was the key to a successful determination, obtaining a detection limit of 0.00434% (v/v) and a limit of quantification of 0.01446% (v/v). Copyright © 2015 Elsevier B.V. All rights reserved.
Miura, P; Coriati, A; Bélanger, G; De Repentigny, Y; Lee, J; Kothary, R; Holcik, M; Jasmin, B J
2010-04-01
The molecular mechanisms regulating expression of utrophin A are of therapeutic interest since upregulating its expression at the sarcolemma can compensate for the lack of dystrophin in animal models of Duchenne Muscular Dystrophy (DMD). The 5'-UTR of utrophin A has been previously shown to drive cap-independent internal ribosome entry site (IRES)-mediated translation in response to muscle regeneration and glucocorticoid treatment. To determine whether the utrophin A IRES displays tissue specific activity, we generated transgenic mice harboring control (CMV/betaGAL/CAT) or utrophin A 5'-UTR (CMV/betaGAL/UtrA/CAT) bicistronic reporter transgenes. Examination of multiple tissues from two CMV/betaGAL/UtrA/CAT lines revealed that the utrophin A 5'-UTR drives cap-independent translation of the reporter gene exclusively in skeletal muscles and no other examined tissues. This expression pattern suggested that skeletal muscle-specific factors are involved in IRES-mediated translation of utrophin A. We performed RNA-affinity chromatography experiments combined with mass spectrometry to identify trans-factors that bind the utrophin A 5'-UTR and identified eukaryotic elongation factor 1A2 (eEF1A2). UV-crosslinking experiments confirmed the specificity of this interaction. Regions of the utrophin A 5'-UTR that bound eEF1A2 also mediated cap-independent translation in C2C12 muscle cells. Cultured cells lacking eEF1A2 had reduced IRES activity compared with cells overexpressing eEF1A2. Together, these results suggest an important role for eEF1A2 in driving cap-independent translation of utrophin A in skeletal muscle. The trans-factors and signaling pathways driving skeletal-muscle specific IRES-mediated translation of utrophin A could provide unique targets for developing pharmacological-based DMD therapies.
Sánchez-Murcia, Pedro A.; Cortés-Cabrera, Álvaro; Gago, Federico
2017-10-01
At least four classes of structurally distinct natural products with potent antiproliferative activities target the translation elongation factor eEF1A1, which is best known as the G-protein that delivers amino acyl transfer RNAs (aa-tRNAs) to ribosomes during mRNA translation. We present molecular models in atomic detail that provide a common structural basis for the high-affinity binding of didemnin B, ternatin, ansatrienin B and nannocystin A to eEF1A1, as well as a rationale based on molecular dynamics results that accounts for the deleterious effect of replacing alanine 399 with valine. The proposed binding site, at the interface between domains I and III, is eminently hydrophobic and exists only in the GTP-bound conformation. Drug binding at this site is expected to disrupt neither loading of aa-tRNAs nor GTP hydrolysis but would give rise to stabilization of this particular conformational state, in consonance with reported experimental findings. The experimental solution of the three-dimensional structure of mammalian eEF1A1 has proved elusive so far and the highly homologous eEF1A2 from rabbit muscle has been crystallized and solved only as a homodimer in a GDP-bound conformation. Interestingly, in this dimeric structure the large interdomain cavity where the drugs studied are proposed to bind is occupied by a mostly hydrophobic α-helix from domain I of the same monomer. Since binding of this α-helix and any of these drugs to domain III of eEF1A(1/2) is, therefore, mutually exclusive and involves two distinct protein conformations, one intriguing possibility that emerges from our study is that the potent antiproliferative effect of these natural products may arise not only from inhibition of protein synthesis, which is the current dogma, but also from interference with some other non-canonical functions. From this standpoint, this type of drugs could be considered antagonists of eEF1A1/2 oligomerization, a hypothesis that opens up novel areas of research.
Pott, Leona L; Hagemann, Sascha; Reis, Henning; Lorenz, Kristina; Bracht, Thilo; Herold, Thomas; Skryabin, Boris V; Megger, Dominik A; Kälsch, Julia; Weber, Frank; Sitek, Barbara; Baba, Hideo A
2017-02-14
Hepatocellular carcinoma is a cancer with increasing incidence and largely refractory to current anticancer drugs. Since Sorafenib, a multikinase inhibitor has shown modest efficacy in advanced hepatocellular carcinoma additional treatments are highly needed. Protein phosphorylation via kinases is an important post-translational modification to regulate cell homeostasis including proliferation and apoptosis. Therefore kinases are valuable targets in cancer therapy. To this end we performed 2D differential gel electrophoresis and mass spectrometry analysis of phosphoprotein-enriched lysates of tumor and corresponding non-tumorous liver samples to detect differentially abundant phosphoproteins to screen for novel kinases as potential drug targets. We identified 34 differentially abundant proteins in phosphoprotein enriched lysates. Expression and distribution of the candidate protein eEF2 and its phosphorylated isoform was validated immunohistochemically on 78 hepatocellular carcinoma and non-tumorous tissue samples. Validation showed that total eEF2 and phosphorylated eEF2 at threonine 56 are prognostic markers for overall survival of HCC-patients. The activity of the regulating eEF2 kinase, compared between tumor and non-tumorous tissue lysates by in vitro kinase assays, is more than four times higher in tumor tissues. Functional analyzes regarding eEF2 kinase were performed in JHH5 cells with CRISPR/Cas9 mediated eEF2 kinase knock out. Proliferation and growth is decreased in eEF2 kinase knock out cells. eEF2 and phosphorylated eEF2 are prognostic markers for survival of hepatocellular carcinoma patients and the regulating eEF2 kinase is a potential drug target for tumor therapy.
Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2016-09-01
Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.
Silar, P; Lalucque, H; Haedens, V; Zickler, D; Picard, M
2001-01-01
Antisuppressor mutations in the eEF1A gene of Podospora anserina were previously shown to impair ascospore formation, to drastically increase life span, and to permit the development of the Crippled Growth degenerative process. Here, we show that eEF1A controls ascospore formation through accuracy level maintenance. Examination of antisuppressor mutant perithecia reveals two main cytological defects, mislocalization of spindle and nuclei and nuclear death. Antisuppression levels are shown to be highly dependent upon both the mutation site and the suppressor used, precluding any correlation between antisuppression efficiency and severity of the sporulation impairment. Nevertheless, severity of ascospore differentiation defect is correlated with resistance to paromomycin. We also show that eEF1A controls fruiting body formation and longevity through a mechanism(s) different from accuracy control. In vivo, GFP tagging of the protein in a way that partly retains its function confirmed earlier cytological observation; i.e., this factor is mainly diffuse within the cytosol, but may transiently accumulate within nuclei or in defined regions of the cytoplasm. These data emphasize the fact that the translation apparatus exerts a global regulatory control over cell physiology and that eEF1A is one of the key factors involved in this monitoring. PMID:11514440
Directory of Open Access Journals (Sweden)
Ibrahim Tekedereli
Full Text Available Eukaryotic elongation factor 2 kinase (eEF-2K, through its phosphorylation of elongation factor 2 (eEF2, provides a mechanism by which cells can control the rate of the elongation phase of protein synthesis. The activity of eEF-2K is increased in rapidly proliferating malignant cells, is inhibited during mitosis, and may contribute to the promotion of autophagy in response to anti-cancer therapies. The purpose of this study was to examine the therapeutic potential of targeting eEF-2K in breast cancer tumors. Through the systemic administration of liposomal eEF-2K siRNA (twice a week, i.v. 150 µg/kg, the expression of eEF-2K was down-regulated in vivo in an orthotopic xenograft mouse model of a highly aggressive triple negative MDA-MB-231 tumor. This targeting resulted in a substantial decrease in eEF2 phosphorylation in the tumors, and led to the inhibition of tumor growth, the induction of apoptosis and the sensitization of tumors to the chemotherapy agent doxorubicin. eEF-2K down-modulation in vitro resulted in a decrease in the expression of c-Myc and cyclin D1 with a concomitant increase in the expression of p27(Kip1. A decrease in the basal activity of c-Src (phospho-Tyr-416, focal adhesion kinase (phospho-Tyr-397, and Akt (phospho-Ser-473 was also detected following eEF-2K down-regulation in MDA-MB-231 cells, as determined by Western blotting. Where tested, similar results were seen in ER-positive MCF-7 cells. These effects were also accompanied by a decrease in the observed invasive phenotype of the MDA-MB-231 cells. These data support the notion that the disruption of eEF-2K expression in breast cancer cells results in the down-regulation of signaling pathways affecting growth, survival and resistance and has potential as a therapeutic approach for the treatment of breast cancer.
Luo, X; Wang, J Y; Zhang, F L; Xia, Y
2018-01-07
Objective: To explore the regulation and mechanism of Prestin protein by identifying the proteins interacted with Prestin in cochlear outer hair cell(OHC) and analyzing their biological function. Methods: Co-immunoprecipitation combined mass spectrometry technology was used to isolate and identify the proteins interacted with Prestin protein of OHC, bioinformatics was used to construct Prestin protein interaction network. The proteins interacted with Prestin in OHC of guinea pig were determined by matching primary interaction mass spectrometry with protein interaction network, and annotated their functions. Results: The results of co-immunoprecipitation combined with mass spectrometry showed that 116 kinds of credible proteins could interact with Prestin. By constructing Prestin protein interaction network, matching the results of mass spectrometry and analyzing of sub-cellular localization, eight kinds of proteins were confirmed that they interacted with Prestin directly, namely EEF2, HSP90AB1, FN1, FLNA, EEF1A1, HSP90B1, ATP5A1, and ERH, respectively, which were mainly involved in the synthesis and transportation, transmembrane folding and localization, structural stability and signal transduction of Prestin protein. Conclusion: EEF2, HSP90AB1, FN1, FLNA, EEF1A1, HSP90B1, ATP5A1 and ERH provide molecular basis for sensory amplification function of OHCs by participating in biotransformation, transmembrane folding and localization, signal transduction and other biological processes of Prestin protein.
International Nuclear Information System (INIS)
Carballo Penela, Adolfo; Sebastian Villasante, Carlos
2008-01-01
Nowadays, the achievement of sustainable development constitutes an important constraint in the design of energy policies, being necessary the development of reliable indicators to obtain helpful information about the use of energy resources. The ecological footprint (EF) provides a referential framework for the analysis of human demand for bioproductivity, including energy issues. In this article, the theoretical bases of the footprint analysis are described by applying input-output tables of energy to estimate the Galician energy ecological footprint (EEF). It is concluded that the location of highly polluting industries in Galicia makes the Galician EEF quite higher than more developed regions of Spain. The relevance of the outer component of the Galician EEF is also studied. First, available information seems to indicate that the energy incorporated to the trading of manufactured goods would notably increase the Galician consumption of energy. On the other hand, the inclusion of electricity trade in the EEF analysis, including an adjustment, following the same philosophy as with manufactured goods is proposed. This adjustment would substantially reduce the Galician EEF, as the exported electricity widely exceeds the imported one
Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis
González-Terán, Bárbara; Cortés, José R.; Manieri, Elisa; Matesanz, Nuria; Verdugo, ρngeles; Rodríguez, María E.; González-Rodríguez, ρgueda; Valverde, ρngela; Martín, Pilar; Davis, Roger J.; Sabio, Guadalupe
2012-01-01
Bacterial LPS (endotoxin) has been implicated in the pathogenesis of acute liver disease through its induction of the proinflammatory cytokine TNF-α. TNF-α is a key determinant of the outcome in a well-established mouse model of acute liver failure during septic shock. One possible mechanism for regulating TNF-α expression is through the control of protein elongation during translation, which would allow rapid cell adaptation to physiological changes. However, the regulation of translational elongation is poorly understood. We found that expression of p38γ/δ MAPK proteins is required for the elongation of nascent TNF-α protein in macrophages. The MKK3/6-p38γ/δ pathway mediated an inhibitory phosphorylation of eukaryotic elongation factor 2 (eEF2) kinase, which in turn promoted eEF2 activation (dephosphorylation) and subsequent TNF-α elongation. These results identify a new signaling pathway that regulates TNF-α production in LPS-induced liver damage and suggest potential cell-specific therapeutic targets for liver diseases in which TNF-α production is involved. PMID:23202732
Identification of a hypothetical membrane protein interactor of ...
Indian Academy of Sciences (India)
Unknown
characterized earlier through co-precipitation studies us- ing antibodies against this conserved carboxyl-terminal region (Rich and Steitz 1987). Protein P0 is also involved at the eEF2 elongation factor-binding domain, as demon- strated in yeast (Justice et al 1999). The P0 protein, and not P1 and P2 proteins, is essential for ...
Directory of Open Access Journals (Sweden)
Lorena M. C. Cursino
2016-02-01
Full Text Available Preparations of Deguelia duckeana, known in Brazil as timbó, are used by indigenous people to kill fish. Reinvestigation of its extracts resulted in the isolation and identification of 11 known flavonoids identified as 3,5,4’-trimethoxy-4-prenylstilbene (1, 4-methoxyderricidine (2, lonchocarpine (3, 4-hydroxylonchocarpine (4, 4-methoxylonchocarpine (5, 5-hydroxy-4’,7-dimethoxy-6-prenylflavanone (6, 4’-hydroxyisolonchocarpine (7, 4’-methoxyisolonchocarpine (8, 3’,4’,7-trimethoxyflavone (9, 3’,4’-methylenedioxy-7-methoxyflavone (10, and 2,2-dimethyl-chromone-5,4’-hydroxy-5’-methoxyflavone (11. Except for 1, 3, and 4 all of these flavonoids have been described for the first time in D. duckeana and the flavanone 6 for the first time in nature. Compounds 2, 3, 4, 7, 9, and 10 were studied for their potential to induce cell death in neuronal SK-N-SH cells. Only the chalcone 4 and the flavanone 7 significantly induced lactate dehydrogenase (LDH release, which was accompanied by activation of caspase-3 and impairment of energy homeostasis in the MTT assay and may explain the killing effect on fish. Interestingly, the flavone 10 reduced cell metabolism in the MTT assay without inducing cytotoxicity in the LDH assay. Furthermore, the flavonoids 2, 3, 4, 7, and 10 induced phosphorylation of the AMP-activated protein kinase (AMPK and the eukaryotic elongation factor 2 (eEF2. The initiation factor eIF4E was dephosphorylated in the presence of these compounds. The initiation factor eIF2alpha was not affected. Further studies are needed to elucidate the importance of the observed effects on protein synthesis and potential therapeutic perspectives.
The life and death of translation elongation factor 2
DEFF Research Database (Denmark)
Jørgensen, Rene; Merrill, A.R.; Andersen, Gregers Rom
2006-01-01
The eukaryotic elongation factor 2 (eEF2) occupies an essential role in protein synthesis where it catalyses the translocation of the two tRNAs and the mRNA after peptidyl transfer on the 80S ribosome. Recent crystal structures of eEF2 and the cryo-EM reconstruction of its 80S complex now provide...... diphthamide residue, which is ADP-ribosylated by diphtheria toxin from Corynebacterium diphtheriae and exotoxin A from Pseudomonas aeruginosa....
International Nuclear Information System (INIS)
De Bortoli, Massimiliano; Man, Tsz-Kwong; Rao, Pulivarthi H; Kim, John YH; Castellino, Robert C; Lu, Xin-Yan; Deyo, Jeffrey; Sturla, Lisa Marie; Adesina, Adekunle M; Perlaky, Laszlo; Pomeroy, Scott L; Lau, Ching C
2006-01-01
Medulloblastoma is the most common malignant brain tumor of childhood. Improvements in clinical outcome require a better understanding of the genetic alterations to identify clinically significant biological factors and to stratify patients accordingly. In the present study, we applied cytogenetic characterization to guide the identification of biologically significant genes from gene expression microarray profiles of medulloblastoma. We analyzed 71 primary medulloblastomas for chromosomal copy number aberrations (CNAs) using comparative genomic hybridization (CGH). Among 64 tumors that we previously analyzed by gene expression microarrays, 27 were included in our CGH series. We analyzed clinical outcome with respect to CNAs and microarray results. We filtered microarray data using specific CNAs to detect differentially expressed candidate genes associated with survival. The most frequent lesions detected in our series involved chromosome 17; loss of 16q, 10q, or 8p; and gain of 7q or 2p. Recurrent amplifications at 2p23-p24, 2q14, 7q34, and 12p13 were also observed. Gain of 8q is associated with worse overall survival (p = 0.0141), which is not entirely attributable to MYC amplification or overexpression. By applying CGH results to gene expression analysis of medulloblastoma, we identified three 8q-mapped genes that are associated with overall survival in the larger group of 64 patients (p < 0.05): eukaryotic translation elongation factor 1D (EEF1D), ribosomal protein L30 (RPL30), and ribosomal protein S20 (RPS20). The complementary use of CGH and expression profiles can facilitate the identification of clinically significant candidate genes involved in medulloblastoma growth. We demonstrate that gain of 8q and expression levels of three 8q-mapped candidate genes (EEF1D, RPL30, RPS20) are associated with adverse outcome in medulloblastoma
Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2
DEFF Research Database (Denmark)
VanderKuur, J; Allevato, G; Billestrup, Nils
1995-01-01
. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...
Zhao, Q; He, Y; Wang, X-L; Zhang, Y-X; Wu, Y-M
2015-08-01
To explore the differentially expressed proteins in normal cervix, cervical intraepithelial neoplasia (CIN) and cervical squamous cell carcinoma (CSCC) tissues by differential proteomics technique. Cervical tissues (including normal cervix, CIN and CSCC) were collected in Department of Gynecologic Oncology of Beijing Obstetrics and Gynecology Hospital. Two-dimensional fluorescence difference in gel electrophoresis (2-D DIGE) and DeCyder software were used to detect the differentially expressed proteins. Matrix-assisted laser desorption/ionization-time-of-flight tandem mass spectrometry (MALDI-TOF/TOF MS) was used to identify the differentially expressed proteins. Western blot (WB) and immunohistochemistry (IHC) were performed to validate the expressions of selected proteins among normal cervix, CIN and CSCC. 2-D DIGE images with high resolution and good repeatability were obtained. Forty-six differentially expressed proteins (27 up-regulated and 19 down-regulated) were differentially expressed among the normal cervix, CIN and CSCC. 26 proteins were successfully identified by MALDI-TOF/TOF MS. S100A9 (S100 calcium-binding protein A9) was the most significantly up-regulated protein. Eukaryotic elongation factor 1-alpha-1 (eEF1A1) was the most significantly down-regulated protein. Pyruvate kinase isozymes M2 (PKM2) was both up-regulated and down-regulated. The results of WB showed that with the increase in the severity of cervical lesions, the expression of S100A9 protein was significantly increased among the three groups (P = 0.010). The expression of eEF1A1 was reduced but without significant difference (P = 0.861). The expression of PKM2 was significantly reduced (P = 0.000). IHC showed that protein S100A9 was mainly expressed in the cytoplasm, and its positive expression rate was 20.0 % in normal cervix, 70.0 % in CIN and 100.0 % in CSCC, with a significant difference among them (P = 0.006). eEF1A1 was mainly expressed in the cell plasma, and its
McLoughlin, Fionn; Basha, Eman; Fowler, Mary E; Kim, Minsoo; Bordowitz, Juliana; Katiyar-Agarwal, Surekha; Vierling, Elizabeth
2016-10-01
The ubiquitous small heat shock proteins (sHSPs) are well documented to act in vitro as molecular chaperones to prevent the irreversible aggregation of heat-sensitive proteins. However, the in vivo activities of sHSPs remain unclear. To investigate the two most abundant classes of plant cytosolic sHSPs (class I [CI] and class II [CII]), RNA interference (RNAi) and overexpression lines were created in Arabidopsis (Arabidopsis thaliana) and shown to have reduced and enhanced tolerance, respectively, to extreme heat stress. Affinity purification of CI and CII sHSPs from heat-stressed seedlings recovered eukaryotic translation elongation factor (eEF) 1B (α-, β-, and γ-subunits) and eukaryotic translation initiation factor 4A (three isoforms), although the association with CI sHSPs was stronger and additional proteins involved in translation were recovered with CI sHSPs. eEF1B subunits became partially insoluble during heat stress and, in the CI and CII RNAi lines, showed reduced recovery to the soluble cell fraction after heat stress, which was also dependent on HSP101. Furthermore, after heat stress, CI sHSPs showed increased retention in the insoluble fraction in the CII RNAi line and vice versa. Immunolocalization revealed that both CI and CII sHSPs were present in cytosolic foci, some of which colocalized with HSP101 and with eEF1Bγ and eEF1Bβ. Thus, CI and CII sHSPs have both unique and overlapping functions and act either directly or indirectly to protect specific translation factors in cytosolic stress granules. © 2016 American Society of Plant Biologists. All Rights Reserved.
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
Elongation factor 1 alpha1 and genes associated with Usher syndromes are downstream targets of GBX2.
Directory of Open Access Journals (Sweden)
David A Roeseler
Full Text Available Gbx2 encodes a DNA-binding transcription factor that plays pivotal roles during embryogenesis. Gain-and loss-of-function studies in several vertebrate species have demonstrated a requirement for Gbx2 in development of the anterior hindbrain, spinal cord, inner ear, heart, and neural crest cells. However, the target genes through which GBX2 exerts its effects remain obscure. Using chromatin immunoprecipitation coupled with direct sequencing (ChIP-Seq analysis in a human prostate cancer cell line, we identified cis-regulatory elements bound by GBX2 to provide insight into its direct downstream targets. The analysis revealed more than 286 highly significant candidate target genes, falling into various functional groups, of which 51% are expressed in the nervous system. Several of the top candidate genes include EEF1A1, ROBO1, PLXNA4, SLIT3, NRP1, and NOTCH2, as well as genes associated with the Usher syndrome, PCDH15 and USH2A, and are plausible candidates contributing to the developmental defects in Gbx2(-/- mice. We show through gel shift analyses that sequences within the promoter or introns of EEF1A1, ROBO1, PCDH15, USH2A and NOTCH2, are directly bound by GBX2. Consistent with these in vitro results, analyses of Gbx2(-/- embryos indicate that Gbx2 function is required for migration of Robo1-expressing neural crest cells out of the hindbrain. Furthermore, we show that GBX2 activates transcriptional activity through the promoter of EEF1A1, suggesting that GBX2 could also regulate gene expression indirectly via EEF1A. Taken together, our studies show that GBX2 plays a dynamic role in development and diseases.
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
A novel multiple-stage antimalarial agent that inhibits protein synthesis
Baragaña, Beatriz; Hallyburton, Irene; Lee, Marcus C. S.; Norcross, Neil R.; Grimaldi, Raffaella; Otto, Thomas D.; Proto, William R.; Blagborough, Andrew M.; Meister, Stephan; Wirjanata, Grennady; Ruecker, Andrea; Upton, Leanna M.; Abraham, Tara S.; Almeida, Mariana J.; Pradhan, Anupam; Porzelle, Achim; Martínez, María Santos; Bolscher, Judith M.; Woodland, Andrew; Norval, Suzanne; Zuccotto, Fabio; Thomas, John; Simeons, Frederick; Stojanovski, Laste; Osuna-Cabello, Maria; Brock, Paddy M.; Churcher, Tom S.; Sala, Katarzyna A.; Zakutansky, Sara E.; Jiménez-Díaz, María Belén; Sanz, Laura Maria; Riley, Jennifer; Basak, Rajshekhar; Campbell, Michael; Avery, Vicky M.; Sauerwein, Robert W.; Dechering, Koen J.; Noviyanti, Rintis; Campo, Brice; Frearson, Julie A.; Angulo-Barturen, Iñigo; Ferrer-Bazaga, Santiago; Gamo, Francisco Javier; Wyatt, Paul G.; Leroy, Didier; Siegl, Peter; Delves, Michael J.; Kyle, Dennis E.; Wittlin, Sergio; Marfurt, Jutta; Price, Ric N.; Sinden, Robert E.; Winzeler, Elizabeth A.; Charman, Susan A.; Bebrevska, Lidiya; Gray, David W.; Campbell, Simon; Fairlamb, Alan H.; Willis, Paul A.; Rayner, Julian C.; Fidock, David A.; Read, Kevin D.; Gilbert, Ian H.
2015-06-01
There is an urgent need for new drugs to treat malaria, with broad therapeutic potential and novel modes of action, to widen the scope of treatment and to overcome emerging drug resistance. Here we describe the discovery of DDD107498, a compound with a potent and novel spectrum of antimalarial activity against multiple life-cycle stages of the Plasmodium parasite, with good pharmacokinetic properties and an acceptable safety profile. DDD107498 demonstrates potential to address a variety of clinical needs, including single-dose treatment, transmission blocking and chemoprotection. DDD107498 was developed from a screening programme against blood-stage malaria parasites; its molecular target has been identified as translation elongation factor 2 (eEF2), which is responsible for the GTP-dependent translocation of the ribosome along messenger RNA, and is essential for protein synthesis. This discovery of eEF2 as a viable antimalarial drug target opens up new possibilities for drug discovery.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Fabregas Canovas, Francisco Javier; López Martínez, Carlos; Broquetas Ibars, Antoni
2000-01-01
The activity of the EEF group in the TMR European Project Radar Polarimetry: Theory and Applications will be presented in this paper. We have developed new polarimetric-interferometric retrieval algorithms and enhancement techniques. These methods will be showed briefly in the next points. Peer Reviewed
RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.
Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin
2016-04-22
Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.
The double bromodomain protein Brd2 promotes B cell expansion and mitogenesis.
Belkina, Anna C; Blanton, Wanda P; Nikolajczyk, Barbara S; Denis, Gerald V
2014-03-01
Bromodomain-containing transcriptional regulators represent new epigenetic targets in different hematologic malignancies. However, bromodomain-mediated mechanisms that couple histone acetylation to transcription in lymphopoiesis and govern mature lymphocyte mitogenesis are poorly understood. Brd2, a transcriptional coregulator that contains dual bromodomains and an extraterminal domain (the BET family), couples chromatin to cell-cycle progression. We reported previously the first functional characterization of a BET protein as an effector of mammalian mitogenic signal transduction: Eμ-Brd2 Tg mice develop "activated B cell" diffuse large B cell lymphoma. No other animal models exist for genetic or lentiviral expression of BET proteins, hampering testing of novel anti-BET anticancer drugs, such as JQ1. We transduced HSCs with Brd2 lentivirus and reconstituted recipient mice to test the hypothesis that Brd2 regulates hematopoiesis in BM and mitogenesis in the periphery. Forced expression of Brd2 provides an expansion advantage to the donor-derived B cell compartment in BM and increases mature B cell mitogenic responsiveness in vitro. Brd2 binds the cyclin A promoter in B cells, shown by ChIP, and increases cyclin A mRNA and protein levels, and S-phase progression in vitro in mitogen-stimulated primary B cells, but not T cells, reinforcing results from Eμ-Brd2 mice. The small molecule BET inhibitor JQ1 reduces B cell mitogenesis, consistent with the interpretation that BET inhibitors are antiproliferative. Brd2-specific knockdown experiments show that Brd2 is also required for hematopoiesis. We conclude that Brd2 plays a critical, independent role in regulation of mitogenic response genes, particularly cyclin A, in B cells.
Promoters and proteins from Clostridium thermocellum and uses thereof
Wu, J. H. David; Newcomb, Michael
2012-11-13
The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.
Suryawan, Agus; Jeyapalan, Asumthia S; Orellana, Renan A; Wilson, Fiona A; Nguyen, Hanh V; Davis, Teresa A
2008-10-01
Skeletal muscle in the neonate grows at a rapid rate due in part to an enhanced sensitivity to the postprandial rise in amino acids, particularly leucine. To elucidate the molecular mechanism by which leucine stimulates protein synthesis in neonatal muscle, overnight-fasted 7-day-old piglets were treated with rapamycin [an inhibitor of mammalian target of rapamycin (mTOR) complex (mTORC)1] for 1 h and then infused with leucine for 1 h. Fractional rates of protein synthesis and activation of signaling components that lead to mRNA translation were determined in skeletal muscle. Rapamycin completely blocked leucine-induced muscle protein synthesis. Rapamycin markedly reduced raptor-mTOR association, an indicator of mTORC1 activation. Rapamycin blocked the leucine-induced phosphorylation of mTOR, S6 kinase 1 (S6K1), and eukaryotic initiation factor (eIF)4E-binding protein-1 (4E-BP1) and formation of the eIF4E.eIF4G complex and increased eIF4E.4E-BP1 complex abundance. Rapamycin had no effect on the association of mTOR with rictor, a crucial component for mTORC2 activation, or G protein beta-subunit-like protein (GbetaL), a component of mTORC1 and mTORC2. Neither leucine nor rapamycin affected the phosphorylation of AMP-activated protein kinase (AMPK), PKB, or tuberous sclerosis complex (TSC)2, signaling components that reside upstream of mTOR. Eukaryotic elongation factor (eEF)2 phosphorylation was not affected by leucine or rapamycin, although current dogma indicates that eEF2 phosphorylation is mTOR dependent. Together, these in vivo data suggest that leucine stimulates muscle protein synthesis in neonates by enhancing mTORC1 activation and its downstream effectors.
DEFF Research Database (Denmark)
Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E
1990-01-01
We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...
Directory of Open Access Journals (Sweden)
Maoyong Fu
Full Text Available Endometrial cancer is the most common gynecologic malignancy diagnosed among women in developed countries. One recent biomarker strongly associated with disease progression and survival is epithelial membrane protein-2 (EMP2, a tetraspan protein known to associate with and modify surface expression of certain integrin isoforms. In this study, we show using a xenograft model system that EMP2 expression is necessary for efficient endometrial tumor formation, and we have started to characterize the mechanism by which EMP2 contributes to this malignant phenotype. In endometrial cancer cells, the focal adhesion kinase (FAK/Src pathway appears to regulate migration as measured through wound healing assays. Manipulation of EMP2 levels in endometrial cancer cells regulates the phosphorylation of FAK and Src, and promotes their distribution into lipid raft domains. Notably, cells with low levels of EMP2 fail to migrate and poorly form tumors in vivo. These findings reveal the pivotal role of EMP2 in endometrial cancer carcinogenesis, and suggest that the association of elevated EMP2 levels with endometrial cancer prognosis may be causally linked to its effect on integrin-mediated signaling.
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Li, Yanan; Jiang, Han; Huang, Guangrong
2017-01-01
Iron (Fe) is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements. PMID:28617327
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Directory of Open Access Journals (Sweden)
Yanan Li
2017-06-01
Full Text Available Iron (Fe is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements.
Directory of Open Access Journals (Sweden)
Tomas Grousl
Full Text Available In response to severe environmental stresses eukaryotic cells shut down translation and accumulate components of the translational machinery in stress granules (SGs. Since they contain mainly mRNA, translation initiation factors and 40S ribosomal subunits, they have been referred to as dominant accumulations of stalled translation preinitiation complexes. Here we present evidence that the robust heat shock-induced SGs of S. cerevisiae also contain translation elongation factors eEF3 (Yef3p and eEF1Bγ2 (Tef4p as well as translation termination factors eRF1 (Sup45p and eRF3 (Sup35p. Despite the presence of the yeast prion protein Sup35 in heat shock-induced SGs, we found out that its prion-like domain is not involved in the SGs assembly. Factors eEF3, eEF1Bγ2 and eRF1 were accumulated and co-localized with Dcp2 foci even upon a milder heat shock at 42°C independently of P-bodies scaffolding proteins. We also show that eEF3 accumulations at 42°C determine sites of the genuine SGs assembly at 46°C. We suggest that identification of translation elongation and termination factors in SGs might help to understand the mechanism of the eIF2α factor phosphorylation-independent repression of translation and SGs assembly.
Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe
2014-03-28
Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.
Sun, Dejuan; Zhu, Lingjuan; Zhao, Yuqian; Jiang, Yingnan; Chen, Lixia; Yu, Yang; Ouyang, Liang
2018-04-01
Triple negative breast cancer (TNBC) is a complex and intrinsically aggressive tumour with poor prognosis, and the discovery of targeted small-molecule drugs for TNBC treatment still remains in its infancy. In this study, we aimed to discover a small-molecule agent for TNBC treatment and illuminate its potential mechanisms. Cell viability was detected by using methylthiazoltetrazolium (MTT) assay. Electron microscopy, GFP-LC3 transfection, monodansylcadaverine staining and apoptosis assay were performed to determine Fluoxetine-induced autophagy and apoptosis. Western blotting and siRNA transfection were carried out to investigate the mechanisms of Fluoxetine-induced autophagy. iTRAQ-based proteomics analysis was used to explore the underlying mechanisms. We have demonstrated that Fluoxetine had remarkable anti-proliferative activities and induced autophagic cell death in MDA-MB-231 and MDA-MB-436 cells. The mechanism for Fluoxetine-induced autophagic cell death was associated with inhibition of eEF2K and activation of AMPK-mTOR-ULK complex axis. Further iTRAQ-based proteomics and network analyses revealed that Fluoxetine-induced mechanism was involved in BIRC6, BNIP1, SNAP29 and Bif-1. These results demonstrate that Fluoxetine induces apoptosis and autophagic cell death in TNBC, which will hold a promise for the future TNBC therapy. © 2017 John Wiley & Sons Ltd.
Choi, Won-Il; Kim, Youngsoo; Kim, Yuri; Yu, Mi-young; Park, Jungeun; Lee, Choong-Eun; Jeon, Bu-Nam; Koh, Dong-In; Hur, Man-Wook
2009-01-01
FBI-1, a member of the POK (POZ and Kruppel) family of transcription factors, plays a role in differentiation, oncogenesis, and adipogenesis. eEF1A is a eukaryotic translation elongation factor involved in several cellular processes including embryogenesis, oncogenic transformation, cell proliferation, and cytoskeletal organization. CCS-3, a potential cervical cancer suppressor, is an isoform of eEF1A. We found that eEF1A forms a complex with FBI-1 by co-immunoprecipitation, SDS-PAGE, and MALDI-TOF Mass analysis of the immunoprecipitate. GST fusion protein pull-downs showed that FBI-1 directly interacts with eEF1A and CCS-3 via the zinc finger and POZ-domain of FBI-1. FBI-1 co-localizes with either eEF1A or CCS-3 at the nuclear periplasm. CCS-3 enhances transcriptional repression of the p21CIP1 gene (hereafter referred to as p21) by FBI-1. The POZ-domain of FBI-1 interacts with the co-repressors, SMRT and BCoR. We found that CCS-3 also interacts with the co-repressors independently. The molecular interaction between the co-repressors and CCS-3 at the POZ-domain of FBI-1 appears to enhance FBI-1 mediated transcriptional repression. Our data suggest that CCS-3 may be important in cell differentiation, tumorigenesis, and oncogenesis by interacting with the proto-oncogene FBI-1 and transcriptional co-repressors. Copyright 2009 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Gao Chen
2012-02-01
Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.
Directory of Open Access Journals (Sweden)
Xiao Feng
2015-01-01
Full Text Available Background: Abnormal neuronal differentiation plays an important role in central nervous system (CNS development abnormalities such as Down syndrome (DS, a disorder that results directly from overexpression of genes in trisomic cells. Receptor-interacting protein 140 (RIP140 is significantly upregulated in DS brains, suggesting its involvement in DS CNS development abnormalities. However, the role of RIP140 in neuronal differentiation is still not clear. The current study aimed to investigate the effect of RIP140 overexpression on the differentiation of neuro-2a (N2a neuroblastoma cells, in vitro. Methods: Stably RIP140-overexpressing N2a (N2a-RIP140 cells were used as a neurodevelopmental model, and were constructed by lipofection and overexpression validated by real-time polymerase chain reaction and Western blot. Retinoic acid (RA was used to stimulate N2a differentiation. Combining the expression of Tuj1 at the mRNA and protein levels, the percentage of cells baring neurites, and the number of neurites per cell body was semi-quantified to determine the effect of RIP140 on differentiation of N2a cells. Furthermore, western blot and the ERK1/2 inhibitor U0126 were used to identify the specific signaling pathway by which RIP140 induces differentiation of N2a cells. Statistical significance of the differences between groups was determined by one-way analysis of variance followed by the Dunnett test. Results: Compared to untransfected N2a cells RIPl40 expression in N2a-RIP140 cells was remarkably upregulated at both the mRNA and protein levels. N2a-RIP140 cells had a significantly increased percentage of cells baring neurites, and numbers of neurites per cell, as compared to N2a cells, in the absence and presence of RA (P < 0.05. In addition, Tuj1, a neuronal biomarker, was strongly upregulated in N2a-RIP140 cells (P < 0.05 and phosphorylated ERK1/2 (p-ERK1/2 levels in N2a-RIP140 cells were dramatically increased, while differentiation was
Directory of Open Access Journals (Sweden)
So Masaki
Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.
Multi-protein delivery by nanodiamonds promotes bone formation.
Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D
2013-11-01
Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR.
Heat stress substantially reduces crop productivity worldwide, and will become more severe due to global warming. Identification of proteins involved in heat stress response may help develop varieties for heat tolerance. Eukaryotic elongation factor 1A (eEF1A) is a cytosolic, multifunctional protei...
Ikegami, Tetsuro; Narayanan, Krishna; Won, Sungyong; Kamitani, Wataru; Peters, C J; Makino, Shinji
2009-02-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD) or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR)-mediated eukaryotic initiation factor (eIF)2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
Health issues of whey proteins: 3. gut health promotion
Gertjan Schaafsma
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protein, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
Directory of Open Access Journals (Sweden)
Sasnauskas Kęstutis
2011-05-01
Full Text Available Abstract Background The expression of human virus surface proteins, as well as other mammalian glycoproteins, is much more efficient in cells of higher eukaryotes rather than yeasts. The limitations to high-level expression of active viral surface glycoproteins in yeast are not well understood. To identify possible bottlenecks we performed a detailed study on overexpression of recombinant mumps hemagglutinin-neuraminidase (MuHN and measles hemagglutinin (MeH in yeast Saccharomyces cerevisiae, combining the analysis of recombinant proteins with a proteomic approach. Results Overexpressed recombinant MuHN and MeH proteins were present in large aggregates, were inactive and totally insoluble under native conditions. Moreover, the majority of recombinant protein was found in immature form of non-glycosylated precursors. Fractionation of yeast lysates revealed that the core of viral surface protein aggregates consists of MuHN or MeH disulfide-linked multimers involving eukaryotic translation elongation factor 1A (eEF1A and is closely associated with small heat shock proteins (sHsps that can be removed only under denaturing conditions. Complexes of large Hsps seem to be bound to aggregate core peripherally as they can be easily removed at high salt concentrations. Proteomic analysis revealed that the accumulation of unglycosylated viral protein precursors results in specific cytosolic unfolded protein response (UPR-Cyto in yeast cells, characterized by different action and regulation of small Hsps versus large chaperones of Hsp70, Hsp90 and Hsp110 families. In contrast to most environmental stresses, in the response to synthesis of recombinant MuHN and MeH, only the large Hsps were upregulated whereas sHsps were not. Interestingly, the amount of eEF1A was also increased during this stress response. Conclusions Inefficient translocation of MuHN and MeH precursors through ER membrane is a bottleneck for high-level expression in yeast. Overexpression of
Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.
Kalveram, Birte; Ikegami, Tetsuro
2013-04-01
Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells.
Growth-promoting effect on iron-sulfur proteins on axenic cultures of Entamoeba dispar
Directory of Open Access Journals (Sweden)
Khalifa S.A.M.
2006-03-01
Full Text Available A growth-promoting factor (GPF that promotes the growth of Entamoeba dispar under axenic culture conditions was found in fractions of mitochondria (Mt, hydrogenosomes (Hg and chloroplasts (Cp obtained from cells of six different protozoan, mammalian and plant species. We were able to extract the GPF from the Cp-rich leaf cells of a plant (spiderwort: Commelina communis L. in an acetone-soluble fraction as a complex of chlorophyll with low molecular weight proteins (molecular weight [MW] approximately 4,600. We also found that on treatment with 0.6 % complexes of 2-mercapthoethanol (2ME, complexes of chlorophyll-a with iron-sulphur (Fe-S proteins (e.g., ferredoxins [Fd] from spinach and Clostridium pasteurianum and noncomplex rubredoxin (Rd from C. pasteurianum have a growth-promoting effect on E. dispar. These findings suggest that E. dispar may lack a sufficient quantity of some essential components of Fe-S proteins, such as Fe-S center.
Cartilage Acidic Protein 2 a hyperthermostable, high affinity calcium-binding protein.
Anjos, Liliana; Gomes, Ana S; Melo, Eduardo P; Canário, Adelino V; Power, Deborah M
2013-03-01
Cartilage Acidic Protein 2 (CRTAC2) is a novel protein present from prokaryotes to vertebrates with abundant expression in the teleost fish pituitary gland and an isoform of CRTAC1, a chondrocyte marker in humans. The two proteins are non-integrins containing N-terminal integrin-like Ca(2+)-binding motifs and their structure and function remain to be assigned. Structural studies of recombinant sea bream (sb)CRTAC2 revealed it is composed of 8.8% α-helix, 33.4% β-sheet and 57.8% unordered protein. sbCRTAC2 bound Ca(2+) with high affinity (K(d)=1.46nM) and favourable Gibbs free energy (∆G=-12.4kcal/mol). The stoichiometry for Ca(2+) bound to sbCRTAC2 at saturation indicated six Ca(2+) ligand-binding sites exist per protein molecule. No conformational change in sbCRTAC2 occurred in the presence of Ca(2+). Fluorescence emission revealed that the tertiary structure of the protein is hyperthermostable between 25°C and 95°C and the fully unfolded state is only induced by chemical denaturing (4M GndCl). sbCRTAC has a widespread tissue distribution and is present as high molecular weight aggregates, although strong reducing conditions promote formation of the monomer. sbCRTAC2 promotes epithelial cell outgrowth in vitro suggesting it may share functional homology with mammalian CRTAC1, recently implicated in cell-cell and cell-matrix interactions. Copyright © 2012 Elsevier B.V. All rights reserved.
Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J.; Xing, Zheng
2016-01-01
Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. PMID:27226560
A high-throughput screening assay for eukaryotic elongation factor 2 kinase inhibitors
Directory of Open Access Journals (Sweden)
Ting Xiao
2016-10-01
Full Text Available Eukaryotic elongation factor 2 kinase (eEF2K inhibitors may aid in the development of new therapeutic agents to combat cancer. Purified human eEF2K was obtained from an Escherichia coli expression system and a luminescence-based high-throughput screening (HTS assay was developed using MH-1 peptide as the substrate. The luminescent readouts correlated with the amount of adenosine triphosphate remaining in the kinase reaction. This method was applied to a large-scale screening campaign against a diverse compound library and subsequent confirmation studies. Nine initial hits showing inhibitory activities on eEF2K were identified from 56,000 synthetic compounds during the HTS campaign, of which, five were chosen to test their effects in cancer cell lines.
Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V
2016-02-01
Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
Tetsuro Ikegami
2009-02-01
Full Text Available Rift Valley fever virus (RVFV (genus Phlebovirus, family Bunyaviridae is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR-mediated eukaryotic initiation factor (eIF2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
Health issues of whey proteins: 3. Gut health promotion
Schaafsma, G.
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protei, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
Characterization of a Lactococcus lactis promoter for heterologous protein production
Directory of Open Access Journals (Sweden)
Christian E. Ogaugwu
2018-03-01
Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.
Mutational analysis of the UCP2 core promoter and relationships of variants with obesity
DEFF Research Database (Denmark)
Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H
2003-01-01
To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....
Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J; Xing, Zheng
2016-07-29
Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Zeinalian, Mehrdad; Eshaghi, Mehdi; Hadian, Mahdi; Naji, Homayoun; Marandi, Sayed Mohammad Masoud; Asgary, Sedigheh
2017-01-01
Eight essential foods (EEF) described in Iranian traditional medicine (ITM) have a determinant role to balance human temperament insuring health and well-being. EEF included oral, imaginary, auditory, visual, olfactory, touch, sexual, and familiarity food. Oral foods should be halal, compatible with individual temper, consumed up twice a day, and compatible with different seasons and geographic conditions. Imaginary food consists of the individual thought content which is directly related to mental and physical fitness. It helps to balance temperament if be free of negative thoughts such as suspicion and distrust to others. Auditory food includes all sounds surrounding us, some of which are sedative and help to balance temperaments, such as natural sounds, and spiritual and beautiful words. Visual food includes everything in the range of human vision which is impressive on his/her thought. Natural beautiful scenes have almost a warm temper and help to balance human temperament. Olfactory food includes odors which stimulate the smell. Touch food includes all materials in direct contact with body skin, like clothes, which have a determinant role in temper moderation in the case of being natural. Sexual food complies with the human need to express his/her love and/or is loved, so its fulfillment could prevent human mal-temperament. Familiarity food can be provided by companion with friends and family members and has a significant role to insure well-being. Given the comprehensiveness of EEF in ITM which covers all human health-related aspects, we can insure health and well-being among our population by promoting and public educating of these principles.
Interplay between chaperones and protein disorder promotes the evolution of protein networks.
Directory of Open Access Journals (Sweden)
Sebastian Pechmann
2014-06-01
Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the
Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva
2008-10-01
The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.
Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing
2017-02-20
We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.
Lu, Ming-Chi; Yu, Chia-Li; Yu, Hui-Chun; Huang, Hsien-Bin; Koo, Malcolm; Lai, Ning-Sheng
2016-01-01
We hypothesized that anti-citrullinated protein antibodies (ACPAs) react with osteoblast surface citrullinated proteins and affect cell function, leading to joint damage in patients with rheumatoid arthritis (RA). First, we purified ACPAs by cyclic citrullinated peptide (CCP)-conjugated affinity column chromatography. The cognate antigens of ACPAs on Saos-2 cells, a sarcoma osteogenic cell line generated from human osteoblasts, were probed by ACPAs, and the reactive bands were analyzed using proteomic analyses. We found that ACPAs bind to Saos-2 cell membrane, and several protein candidates, including HSP60, were identified. We then cloned and purified recombinant heat shock protein 60 (HSP60) and citrullinated HSP60 (citHSP60) and investigated the effect of ACPAs on Saos-2 cell. We confirmed that HSP60 obtained from Saos-2 cell membrane were citrullinated and reacted with ACPAs, which induces Saos-2 cells apoptosis via binding to surface-expressed citHSP60 through Toll-like receptor 4 signaling. ACPAs promoted interleukin (IL)-6 and IL-8 expression in Saos-2 cells. Finally, sera from patients with RA and healthy controls were examined for their titers of anti-HSP60 and anti-citHSP60 antibodies using an enzyme-linked immunosorbent assay. The radiographic change in patients with RA was evaluated using the Genant-modified Sharp scoring system. Patients with RA showed higher sera titers of anti-citHSP60, but not anti-HSP60, antibodies when compared with controls. In addition, the anti-citHSP60 level was positively associated with increased joint damage in patients with RA. In conclusion, Saos-2 cell apoptosis was mediated by ACPAs via binding to cell surface-expressed citHSP60 and the titer of anti-citHSP60 in patients with RA positively associated with joint damage. Copyright © 2015 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Manuel Hiss
2017-10-01
Full Text Available The moss Physcomitrella patens is used both as an evo-devo model and biotechnological production system for metabolites and pharmaceuticals. Strong in vivo expression of genes of interest is important for production of recombinant proteins, e.g., selectable markers, fluorescent proteins, or enzymes. In this regard, the choice of the promoter sequence as well as codon usage optimization are two important inside factors to consider in order to obtain optimum protein accumulation level. To reliably quantify fluorescence, we transfected protoplasts with promoter:GFP fusion constructs and measured fluorescence intensity of living protoplasts in a plate reader system. We used the red fluorescent protein mCherry under 2x 35S promoter control as second reporter to normalize for different transfection efficiencies. We derived a novel endogenous promoter and compared deletion variants with exogenous promoters. We used different codon-adapted green fluorescent protein (GFP genes to evaluate the influence of promoter choice and codon optimization on protein accumulation in P. patens, and show that the promoter of the gene of P. patens chlorophyll a/b binding protein lhcsr1 drives expression of GFP in protoplasts significantly (more than twofold better than the commonly used 2x 35S promoter or the rice actin1 promoter. We identified a shortened 677 bp version of the lhcsr1 promoter that retains full activity in protoplasts. The codon optimized GFP yields significantly (more than twofold stronger fluorescence signals and thus demonstrates that adjusting codon usage in P. patens can increase expression strength. In combination, new promotor and codon optimized GFP conveyed sixfold increased fluorescence signal.
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor
International Nuclear Information System (INIS)
Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank
2006-01-01
Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
Directory of Open Access Journals (Sweden)
Eunhee G. Kim
2016-01-01
Full Text Available BackgroundThe prevalence of novel type 1 diabetes mellitus (T1DM antibodies targeting eukaryote translation elongation factor 1 alpha 1 autoantibody (EEF1A1-AAb and ubiquitin-conjugating enzyme 2L3 autoantibody (UBE2L3-AAb has been shown to be negatively correlated with age in T1DM subjects. Therefore, we aimed to investigate whether age affects the levels of these two antibodies in nondiabetic subjects.MethodsEEF1A1-AAb and UBE2L3-AAb levels in nondiabetic control subjects (n=150 and T1DM subjects (n=101 in various ranges of age (18 to 69 years were measured using an enzyme-linked immunosorbent assay. The cutoff point for the presence of each autoantibody was determined based on control subjects using the formula: [mean absorbance+3×standard deviation].ResultsIn nondiabetic subjects, there were no significant correlations between age and EEF1A1-AAb and UBE2L3-AAb levels. However, there was wide variation in EEF1A1-AAb and UBE2L3-AAb levels among control subjects <40 years old; the prevalence of both EEF1A1-AAb and UBE2L3-AAb in these subjects was 4.4%. When using cutoff points determined from the control subjects <40 years old, the prevalence of both autoantibodies in T1DM subjects was decreased (EEFA1-AAb, 15.8% to 8.9%; UBE2L3-AAb, 10.9% to 7.9% when compared to the prevalence using the cutoff derived from the totals for control subjects.ConclusionThere was no association between age and EEF1A1-AAb or UBE2L3-AAb levels in nondiabetic subjects. However, the wide variation in EEF1A1-AAb and UBE2L3-AAb levels apparent among the control subjects <40 years old should be taken into consideration when determining the cutoff reference range for the diagnosis of T1DM.
Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.
2015-01-01
Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245
Phosphorylation of stress protein pp80 is related to promotion of transformation
International Nuclear Information System (INIS)
Smith, B.M.; Gindhart, T.D.; Hirano, K.; Colburn, N.H.
1986-01-01
The JB6 mouse epidermal cell system is an in vitro model of late stage promotion, and includes cell lines sensitive (P+) or resistant (P-) to phorbol ester-induced anchorage independent transformation, and transformed (T/sub x/) lines. Certain promoter-induced changes in phosphoproteins, identified by gel electrophoresis, are unique to cells of one phenotype, and occur only with specific promoters. An 80Kd protein is inversely correlated with phenotype: P- cells have a constitutively higher level (p 35 S-methionine. pp80 shares properties with the 80Kd heat stress protein: molecular weight relative abundance, and isoelectric point (4.5). Pharmacological analogs of calcium, the lanthanides, promote transformation of JB6 cells, but have no effect on phosphorylation of the 80Kd protein. If pp80 is on the promotion pathway, it is limited to a specific subset of transformation promoters
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
Directory of Open Access Journals (Sweden)
Hatica Han
2018-07-01
Full Text Available Flaxseed (Linum usitatissimum L. is important source of oil and protein for industrial, pharmaceutical, and nutritional applications. In order to estimate the effects of lyophilized aqueous extract of flaxseed shell (AEF and evaporated ethanolic extract of flaxseed shell (EEF, we studied their DPPH, ABTS, DMPD and O 2 •- scavenging effects. Total antioxidant activity by ferric thiocyanate method, Fe 3+, Cu 2+ and [Fe 3+-(TPTZ 2] 3+ reducing ability, and Fe 2+ chelating activity. Also, α-tocopherol, BHA, trolox, and BHT were used as positive controls. The results clearly AEF and EEF demonstrated effective antioxidant activity. The quantity of p-hydroxybenzoic, vanillin, p-coumaric acid, ascorbic acid, ferulic acid, and ellagic acid were investigated by LC-MS/MS. The present study will introduce a novelty for further studies on the antioxidant effects of AEF and EEF.
Xiang, Yi; Yao, Xiaohong; Chen, Keqiang; Wang, Xiafei; Zhou, Jiamin; Gong, Wanghua; Yoshimura, Teizo; Huang, Jiaqiang; Wang, Rongquan; Wu, Yuzhang; Shi, Guochao; Bian, Xiuwu; Wang, Jiming
2016-01-01
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human colon is unclear. Our investigation revealed that a considerable number of human colon cancer cell lines expressed FPR2 and its ligands promoted cell migration and proliferation. Human colon cancer cell lines expressing high levels of FPR2 also formed more rapidly growing tumors in immunocompromised mice as compared with cell lines expressing lower levels of FPR2. Knocking down of FPR2 from colon cancer cell lines highly expressing FPR2 reduced their tumorigenicity. Clinically, FPR2 is more highly expressed in progressive colon cancer, associated with poorer patient prognosis. These results suggest that FPR2 can be high-jacked by colon cancer cells for their growth advantage, thus becoming a potential target for therapeutic development. PMID:27904774
Directory of Open Access Journals (Sweden)
Mehrdad Zeinalian
2017-01-01
Full Text Available Eight essential foods (EEF described in Iranian traditional medicine (ITM have a determinant role to balance human temperament insuring health and well-being. EEF included oral, imaginary, auditory, visual, olfactory, touch, sexual, and familiarity food. Oral foods should be halal, compatible with individual temper, consumed up twice a day, and compatible with different seasons and geographic conditions. Imaginary food consists of the individual thought content which is directly related to mental and physical fitness. It helps to balance temperament if be free of negative thoughts such as suspicion and distrust to others. Auditory food includes all sounds surrounding us, some of which are sedative and help to balance temperaments, such as natural sounds, and spiritual and beautiful words. Visual food includes everything in the range of human vision which is impressive on his/her thought. Natural beautiful scenes have almost a warm temper and help to balance human temperament. Olfactory food includes odors which stimulate the smell. Touch food includes all materials in direct contact with body skin, like clothes, which have a determinant role in temper moderation in the case of being natural. Sexual food complies with the human need to express his/her love and/or is loved, so its fulfillment could prevent human mal-temperament. Familiarity food can be provided by companion with friends and family members and has a significant role to insure well-being. Given the comprehensiveness of EEF in ITM which covers all human health-related aspects, we can insure health and well-being among our population by promoting and public educating of these principles.
DEFF Research Database (Denmark)
Seeger, Michael; Hartmann-Petersen, Rasmus; Wilkinson, Caroline R M
2003-01-01
Fission yeast Rhp23 and Pus1 represent two families of multiubiquitin chain-binding proteins that associate with the proteasome. We show that both proteins bind to different regions of the proteasome subunit Mts4. The binding site for Pus1 was mapped to a cluster of repetitive sequences also found...... in the proteasome subunit SpRpn2 and the anaphase-promoting complex/cyclosome (APC/C) subunit Cut4. The putative role of Pus1 as a factor involved in allocation of ubiquitinylated substrates for the proteasome is discussed....
DEFF Research Database (Denmark)
Mannervik, M; Fan, S; Ström, A C
1999-01-01
of the viral E4 open reading frame 4 (E4-ORF4) protein. This effect does not to require the retinoblastoma protein that previously has been shown to regulate E2F activity. The inhibitory activity of E4-ORF4 appears to be specific because E4-ORF4 had little effect on, for example, E4-ORF6/7 transactivation......Previous studies have shown that the cell cycle-regulated E2F transcription factor is subjected to both positive and negative control by phosphorylation. Here we show that in transient transfection experiments, adenovirus E1A activation of the viral E2 promoter is abrogated by coexpression...... of the E2 promoter. We further show that the repressive effect of E4-ORF4 on E2 transcription works mainly through the E2F DNA-binding sites in the E2 promoter. In agreement with this, we find that E4-ORF4 inhibits E2F-1/DP-1-mediated transactivation. We also show that E4-ORF4 inhibits E2 mRNA expression...
Odagiri, Haruki; Kadomatsu, Tsuyoshi; Endo, Motoyoshi; Masuda, Tetsuro; Morioka, Masaki Suimye; Fukuhara, Shigetomo; Miyamoto, Takeshi; Kobayashi, Eisuke; Miyata, Keishi; Aoi, Jun; Horiguchi, Haruki; Nishimura, Naotaka; Terada, Kazutoyo; Yakushiji, Toshitake; Manabe, Ichiro; Mochizuki, Naoki; Mizuta, Hiroshi; Oike, Yuichi
2014-01-21
The tumor microenvironment can enhance the invasive capacity of tumor cells. We showed that expression of angiopoietin-like protein 2 (ANGPTL2) in osteosarcoma (OS) cell lines increased and the methylation of its promoter decreased with time when grown as xenografts in mice compared with culture. Compared with cells grown in normal culture conditions, the expression of genes encoding DNA demethylation-related enzymes increased in tumor cells implanted into mice or grown in hypoxic, serum-starved culture conditions. ANGPTL2 expression in OS cell lines correlated with increased tumor metastasis and decreased animal survival by promoting tumor cell intravasation mediated by the integrin α5β1, p38 mitogen-activated protein kinase, and matrix metalloproteinases. The tolloid-like 1 (TLL1) protease cleaved ANGPTL2 into fragments in vitro that did not enhance tumor progression when overexpressed in xenografts. Expression of TLL1 was weak in OS patient tumors, suggesting that ANGPTL2 may not be efficiently cleaved upon secretion from OS cells. These findings demonstrate that preventing ANGPTL2 signaling stimulated by the tumor microenvironment could inhibit tumor cell migration and metastasis.
Cai, Wei; Jiang, Haitao; Yu, Yifan; Xu, Yong; Zuo, Wenshan; Wang, Shouguo; Su, Zhen
2017-11-01
Recently, miR-367 is reported to exert either oncogenic or tumor suppressive effects in human malignancies. Recent study reports that miR-367 is up-regulated in OS tissues and cell lines, and abrogates adriamycin-induced apoptosis. The clinical significance of miR-367 and its function in OS need further investigation. In our study, miR-367 expression in OS was markedly elevated compared with corresponding non-tumor tissues. High miR-367 expression was associated with malignant clinical features and poor prognosis of OS patients. In accordance, the levels of miR-367 were dramatically up-regulated in OS cells. Loss of miR-367 expression in Saos-2 cells obviously inhibited the proliferation, migration and invasion of cancer cells in vitro. Meanwhile, miR-367 restoration promoted these malignant behaviors of MG-63 cells. Mechanistically, miR-367 negatively regulated DOC-2/DAB2 interactive protein (DAB2IP) abundance in OS cells. Hereby, DAB2IP was recognized as a direct target gene of miR-367 in OS. DAB2IP mRNA level was down-regulated and inversely correlated with miR-367 expression in OS specimens. DAB2IP overexpression prohibited proliferation, migration and invasion in Saos-2 cells, while DAB2IP knockdown showed promoting effects on proliferation, migration and invasion of MG-63 cells. Furthermore, the role of miR-367 might be mediated by DAB2IP-regulated phosphorylation of ERK and AKT in OS cells. To conclude, miR-367 may function as a biomarker for prediction of prognosis and a target for OS therapy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor
Directory of Open Access Journals (Sweden)
Rian de Laat
2015-03-01
Full Text Available Sequential proteolytic cleavages of amyloid-β protein precursor (AβPP by β-secretase and γ-secretase generate amyloid β (Aβ peptides, which are thought to contribute to Alzheimer's disease (AD. Much of this processing occurs in endosomes following endocytosis of AβPP from the plasma membrane. However, this pathogenic mode of processing AβPP may occur in competition with lysosomal degradation of AβPP, a common fate of membrane proteins trafficking through the endosomal system. Following up on published reports that LINGO-1 binds and promotes the amyloidogenic processing of AβPP we have examined the consequences of LINGO-1/AβPP interactions. We report that LINGO-1 and its paralogs, LINGO-2 and LINGO-3, decrease processing of AβPP in the amyloidogenic pathway by promoting lysosomal degradation of AβPP. We also report that LINGO-1 levels are reduced in AD brain, representing a possible pathogenic mechanism stimulating the generation of Aβ peptides in AD.
DEFF Research Database (Denmark)
Wolford, Johanna K; Gruber, Jonathan D; Ossowski, Victoria M
2003-01-01
of diabetes, independent of adiposity. Because CRP is located on 1q21, we considered it a potential positional candidate gene for T2DM. We therefore evaluated CRP and the nearby serum amyloid P-component, APCS, which is structurally similar to CRP, as candidate diabetes susceptibility genes. Approximately 10......Linkage analysis has identified a susceptibility locus for type 2 diabetes mellitus (T2DM) on chromosome 1q21-q23 in several populations. Results from recent prospective studies indicate that increased levels of C-reactive protein (CRP), a marker of immune system activation, are predictive...... disequilibrium clusters. We genotyped representative SNPs in approximately 1300 Pima samples and found a single variant in the CRP promoter (SNP 133552) that was associated with T2DM (P=0.014), as well as a common haplotype (CGCG) that was associated with both T2DM (P=0.029) and corrected insulin response...
He, Reqing; Li, Xinmei; Zhong, Ming; Yan, Jindong; Ji, Ronghuan; Li, Xu; Wang, Qin; Wu, Dan; Sun, Mengsi; Tang, Dongying; Lin, Jianzhong; Li, Hongyu; Liu, Bin; Liu, Hongtao; Liu, Xuanming; Zhao, Xiaoying; Lin, Chentao
2017-09-01
Floral initiation is regulated by various genetic pathways in response to light, temperature, hormones and developmental status; however, the molecular mechanisms underlying the interactions between different genetic pathways are not fully understood. Here, we show that the photoresponsive gene FOF2 (F-box of flowering 2) negatively regulates flowering. FOF2 encodes a putative F-box protein that interacts specifically with ASK14, and its overexpression results in later flowering under both long-day and short-day photoperiods. Conversely, transgenic plants expressing the F-box domain deletion mutant of FOF2 (FOF2ΔF), or double loss of function mutant of FOF2 and FOL1 (FOF2-LIKE 1) present early flowering phenotypes. The late flowering phenotype of the FOF2 overexpression lines is suppressed by the flc-3 loss-of-function mutation. Furthermore, FOF2 mRNA expression is regulated by autonomous pathway gene FCA, and the repressive effect of FOF2 in flowering can be overcome by vernalization. Interestingly, FOF2 expression is regulated by light. The protein level of FOF2 accumulates in response to light, whereas it is degraded under dark conditions via the 26S proteasome pathway. Our findings suggest a possible mechanistic link between light conditions and the autonomous floral promotion pathway in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Energy Technology Data Exchange (ETDEWEB)
Tong, Yuxin; Li, Yan [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Gu, Hui [Department of Key Laboratory of Health Ministry for Congenital Malformation Shengjing Hospital, China Medical University, Shenyang, Liaoning 110004 (China); Wang, Chunyu [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Liu, Funan [Department of Surgical Oncology, The First Hospital of China Medical University, Shenyang, Liaoning 110001 (China); Shao, Yangguang; Li, Jiabin; Cao, Liu [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Li, Feng, E-mail: fli@mail.cmu.edu.cn [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China)
2015-11-27
ArgBP2 is an adapter protein that plays an important role in actin-dependent processes such as cell adhesion and migration. However, its function and regulation mechanisms in gastric cancer have not yet been investigated. Here, we showed the low expression of ArgBP2 mRNA level in gastric tumor samples and its repressive function in the proliferation, migration, and invasion of gastric cancer cells. Then, we cloned and identified ArgBP2 promoter and verified that MORC2 bound to the promoter. Moreover, we demonstrated that MORC2 enhanced the recruitment of EZH2, which promoted the tri-methylation of H3K27, leading to the transcriptional repression of ArgBP2. Our results might thus contribute to understanding the molecular mechanisms of ArgBP2 regulation and suggesting ArgBP2 as a potential therapeutic target for gastric cancer. - Highlights: • ArgBP2 inhibits proliferation, migration, and invasion of gastric cancer cells. • Identification of ArgBP2 promoter and its transcription factor MORC2. • EZH2 is required in MORC2 down-regulating ArgBP2 via histone methylation.
International Nuclear Information System (INIS)
Tong, Yuxin; Li, Yan; Gu, Hui; Wang, Chunyu; Liu, Funan; Shao, Yangguang; Li, Jiabin; Cao, Liu; Li, Feng
2015-01-01
ArgBP2 is an adapter protein that plays an important role in actin-dependent processes such as cell adhesion and migration. However, its function and regulation mechanisms in gastric cancer have not yet been investigated. Here, we showed the low expression of ArgBP2 mRNA level in gastric tumor samples and its repressive function in the proliferation, migration, and invasion of gastric cancer cells. Then, we cloned and identified ArgBP2 promoter and verified that MORC2 bound to the promoter. Moreover, we demonstrated that MORC2 enhanced the recruitment of EZH2, which promoted the tri-methylation of H3K27, leading to the transcriptional repression of ArgBP2. Our results might thus contribute to understanding the molecular mechanisms of ArgBP2 regulation and suggesting ArgBP2 as a potential therapeutic target for gastric cancer. - Highlights: • ArgBP2 inhibits proliferation, migration, and invasion of gastric cancer cells. • Identification of ArgBP2 promoter and its transcription factor MORC2. • EZH2 is required in MORC2 down-regulating ArgBP2 via histone methylation.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
DEFF Research Database (Denmark)
Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen
2015-01-01
a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
Miyoshi, Yukihiro; Okada, Sanae; Uchimura, Tai; Satoh, Eiichi
2006-07-01
Lactobacillus reuteri is one of the dominant lactobacilli found in the gastrointestinal tract of various animals. A surface protein of L. reuteri 104R, mucus adhesion promoting protein (MapA), is considered to be an adhesion factor of this strain. We investigated the relation between MapA and adhesion of L. reuteri to human intestinal (Caco-2) cells. Quantitative analysis of the adhesion of L. reuteri strains to Caco-2 cells showed that various L. reuteri strains bind not only to mucus but also to intestinal epithelial cells. In addition, purified MapA bound to Caco-2 cells, and this binding inhibited the adhesion of L. reuteri in a concentration-dependent manner. Based on these observations, the adhesion of L. reuteri appears due to the binding of MapA to receptor-like molecules on Caco-2 cells. Further, far-western analysis indicated the existence of multiple receptor-like molecules in Caco-2 cells.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu
2016-03-08
The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.
HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells
DEFF Research Database (Denmark)
Olsen, Jørgen; Laustsen, Lotte; Troelsen, J
1994-01-01
The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....
H2A/K pseudogene mutation may promote cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)
2016-05-15
Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.
International Nuclear Information System (INIS)
Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran
2012-01-01
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-05-12
Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.
Leiva, Natalia; Capmany, Anahí; Damiani, María Teresa
2013-01-01
Chlamydia trachomatis, an obligate intracellular pathogen, survives within host cells in a special compartment named 'inclusion' and takes advantage of host vesicular transport pathways for its growth and replication. Rab GTPases are key regulatory proteins of intracellular trafficking. Several Rabs, among them Rab11 and Rab14, are implicated in chlamydial development. FIP2, a member of the Rab11-Family of Interacting Proteins, presents at the C-terminus a Rab-binding domain that interacts with both Rab11 and Rab14. In this study, we determined and characterized the recruitment of endogenous and GFP-tagged FIP2 to the chlamydial inclusions. The recruitment of FIP2 is specific since other members of the Rab11-Family of Interacting Proteins do not associate with the chlamydial inclusions. The Rab-binding domain of FIP2 is essential for its association. Our results indicate that FIP2 binds to Rab11 at the chlamydial inclusion membrane through its Rab-binding domain. The presence of FIP2 at the chlamydial inclusion favours the recruitment of Rab14. Furthermore, our results show that FIP2 promotes inclusion development and bacterial replication. In agreement, the silencing of FIP2 decreases the bacterial progeny. C. trachomatis likely recruits FIP2 to hijack host intracellular trafficking to redirect vesicles full of nutrients towards the inclusion. © 2012 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Yueting Zheng
2016-01-01
Full Text Available Interferons (IFNs are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC and TERT-immortalized normal human diploid fibroblasts (HDF-TERT. IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib, a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection.
Directory of Open Access Journals (Sweden)
Emily A. Byrd
2017-11-01
Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.
Soy protein isolate inhibits hepatic tumor promotion in mice fed a high-fat liquid diet.
Mercer, Kelly E; Pulliam, Casey F; Pedersen, Kim B; Hennings, Leah; Ronis, Martin Jj
2017-03-01
Alcoholic and nonalcoholic fatty liver diseases are risk factors for development of hepatocellular carcinoma, but the underlying mechanisms are poorly understood. On the other hand, ingestion of soy-containing diets may oppose the development of certain cancers. We previously reported that replacing casein with a soy protein isolate reduced tumor promotion in the livers of mice with alcoholic liver disease after feeding a high fat ethanol liquid diet following initiation with diethylnitrosamine. Feeding soy protein isolate inhibited processes that may contribute to tumor promotion including inflammation, sphingolipid signaling, and Wnt/β-catenin signaling. We have extended these studies to characterize liver tumor promotion in a model of nonalcoholic fatty liver disease produced by chronic feeding of high-fat liquid diets in the absence of ethanol. Mice treated with diethylnitrosamine on postnatal day 14 were fed a high-fat liquid diet made with casein or SPI as the sole protein source for 16 weeks in adulthood. Relative to mice fed normal chow, a high fat/casein diet led to increased tumor promotion, hepatocyte proliferation, steatosis, and inflammation. Replacing casein with soy protein isolate counteracted these effects. The high fat diets also resulted in a general increase in transcripts for Wnt/β-catenin pathway components, which may be an important mechanism, whereby hepatic tumorigenesis is promoted. However, soy protein isolate did not block Wnt signaling in this nonalcoholic fatty liver disease model. We conclude that replacing casein with soy protein isolate blocks development of steatosis, inflammation, and tumor promotion in diethylnitrosamine-treated mice fed high fat diets. Impact statement The impact of dietary components on cancer is a topic of great interest for both the general public and the scientific community. Liver cancer is currently the second leading form of cancer deaths worldwide. Our study has addressed the effect of the protein
Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M
2016-10-01
E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.
Jin, Han; Zhang, Kai; Qiao, Chunyan; Yuan, Anliang; Li, Daowei; Zhao, Liang; Shi, Ce; Xu, Xiaowei; Ni, Shilei; Zheng, Changyu; Liu, Xiaohua; Yang, Bai; Sun, Hongchen
2014-01-01
Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2) gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI–al nanocomposites efficiently deliver the BMP-2 gene to bone marrow mesenchymal stem cells and that BMP-2 gene-engineered cell sheet is an effective way for promoting bone regeneration. PMID:24855355
Interaction of an IHF-like protein with the Rhizobium etli nifA promoter.
Benhassine, Traki; Fauvart, Maarten; Vanderleyden, Jos; Michiels, Jan
2007-06-01
The nifA gene fulfills an essential role in the regulation of nitrogen fixation genes in Rhizobium etli. Transcription analysis of the nifA gene, assessed using promoter deletions, indicated an oxygen-independent expression, threefold higher during symbiosis as compared with free-living conditions. Electrophoretic mobility shift assays using those nifA promoter deletion fragments, which were actively transcribed, demonstrated the specific interaction with R. etli cellular protein(s) resulting in the formation of two DNA-protein complexes. An interacting protein was purified by liquid chromatography on Heparin Sepharose and Mono S columns. The purified 12 kDa R. etli protein cross-reacted with antibodies directed against Escherichia coli integration host factor (IHF). Furthermore, purified E. coli IHF was able to specifically bind to the R. etli nifA promoter region. These results point to an as yet undisclosed function of IHF in the regulation of R. etli nifA expression.
Directory of Open Access Journals (Sweden)
Shifeng Huang
Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Directory of Open Access Journals (Sweden)
D’Urzo Nunzia
2013-02-01
Full Text Available Abstract Background In past years research has focused on the development of alternative Gram positive bacterial expression systems to produce industrially relevant proteins. Brevibacillus choshinensis is an easy to handle non-sporulating bacterium, lacking extracellular proteases, that has been already shown to provide a high level of recombinant protein expression. One major drawback, limiting the applicability of the Brevibacillus expression system, is the absence of expression vectors based on inducible promoters. Here we used the PxylA inducible promoter, commonly employed in other Bacillae expression systems, in Brevibacillus. Results Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA. The GFP expression yields were more than 25 fold higher than those reported for B. megaterium carrying the same vector. All the tested proteins show significant increment in their expression levels (2-10 folds than those obtained using the available plasmids based on the P2 constitutive promoter. Conclusion Combining the components of two different commercially available Gram positive expression systems, such as Brevibacillus (from Takara Bio and B. megaterium (from Mobitec, we demonstrate that vectors based on the B. megaterium PxylA xylose inducible promoter can be successfully used to induce high level of intracellular expression of heterologous proteins in Brevibacillus.
Steiner, Jennifer L; Pruznak, Anne M; Deiter, Gina; Navaratnarajah, Maithili; Kutzler, Lydia; Kimball, Scot R; Lang, Charles H
2014-01-01
Sepsis decreases skeletal muscle protein synthesis in part by impairing mTOR activity and the subsequent phosphorylation of 4E-BP1 and S6K1 thereby controlling translation initiation; however, the relative importance of changes in these two downstream substrates is unknown. The role of 4E-BP1 (and -BP2) in regulating muscle protein synthesis was assessed in wild-type (WT) and 4E-BP1/BP2 double knockout (DKO) male mice under basal conditions and in response to sepsis. At 12 months of age, body weight, lean body mass and energy expenditure did not differ between WT and DKO mice. Moreover, in vivo rates of protein synthesis in gastrocnemius, heart and liver did not differ between DKO and WT mice. Sepsis decreased skeletal muscle protein synthesis and S6K1 phosphorylation in WT and DKO male mice to a similar extent. Sepsis only decreased 4E-BP1 phosphorylation in WT mice as no 4E-BP1/BP2 protein was detected in muscle from DKO mice. Sepsis decreased the binding of eIF4G to eIF4E in WT mice; however, eIF4E•eIF4G binding was not altered in DKO mice under either basal or septic conditions. A comparable sepsis-induced increase in eIF4B phosphorylation was seen in both WT and DKO mice. eEF2 phosphorylation was similarly increased in muscle from WT septic mice and both control and septic DKO mice, compared to WT control values. The sepsis-induced increase in muscle MuRF1 and atrogin-1 (markers of proteolysis) as well as TNFα and IL-6 (inflammatory cytokines) mRNA was greater in DKO than WT mice. The sepsis-induced decrease in myocardial and hepatic protein synthesis did not differ between WT and DKO mice. These data suggest overall basal protein balance and synthesis is maintained in muscle of mice lacking both 4E-BP1/BP2 and that sepsis-induced changes in mTOR signaling may be mediated by a down-stream mechanism independent of 4E-BP1 phosphorylation and eIF4E•eIF4G binding.
DEFF Research Database (Denmark)
Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne
2007-01-01
of guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7...
Directory of Open Access Journals (Sweden)
Sophie A Comyn
2016-07-01
Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.
FANCG promotes formation of a newly identified protein complex containing BRCA2, FANCD2 and XRCC3.
Wilson, J B; Yamamoto, K; Marriott, A S; Hussain, S; Sung, P; Hoatlin, M E; Mathew, C G; Takata, M; Thompson, L H; Kupfer, G M; Jones, N J
2008-06-12
Fanconi anemia (FA) is a human disorder characterized by cancer susceptibility and cellular sensitivity to DNA crosslinks and other damages. Thirteen complementation groups and genes are identified, including BRCA2, which is defective in the FA-D1 group. Eight of the FA proteins, including FANCG, participate in a nuclear core complex that is required for the monoubiquitylation of FANCD2 and FANCI. FANCD2, like FANCD1/BRCA2, is not part of the core complex, and we previously showed direct BRCA2-FANCD2 interaction using yeast two-hybrid analysis. We now show in human and hamster cells that expression of FANCG protein, but not the other core complex proteins, is required for co-precipitation of BRCA2 and FANCD2. We also show that phosphorylation of FANCG serine 7 is required for its co-precipitation with BRCA2, XRCC3 and FANCD2, as well as the direct interaction of BRCA2-FANCD2. These results argue that FANCG has a role independent of the FA core complex, and we propose that phosphorylation of serine 7 is the signalling event required for forming a discrete complex comprising FANCD1/BRCA2-FANCD2-FANCG-XRCC3 (D1-D2-G-X3). Cells that fail to express either phospho-Ser7-FANCG, or full length BRCA2 protein, lack the interactions amongst the four component proteins. A role for D1-D2-G-X3 in homologous recombination repair (HRR) is supported by our finding that FANCG and the RAD51-paralog XRCC3 are epistatic for sensitivity to DNA crosslinking compounds in DT40 chicken cells. Our findings further define the intricate interface between FANC and HRR proteins in maintaining chromosome stability.
Directory of Open Access Journals (Sweden)
Dawid Krokowski
2017-12-01
Full Text Available Summary: GADD34, a stress-induced regulatory subunit of the phosphatase PP1, is known to function in hyperosmotic stress through its well-known role in the integrated stress response (ISR pathway. Adaptation to hyperosmotic stress is important for the health of corneal epithelial cells exposed to changes in extracellular osmolarity, with maladaptation leading to dry eye syndrome. This adaptation includes induction of SNAT2, an endoplasmic reticulum (ER-Golgi-processed protein, which helps to reverse the stress-induced loss of cell volume and promote homeostasis through amino acid uptake. Here, we show that GADD34 promotes the processing of proteins synthesized on the ER during hyperosmotic stress independent of its action in the ISR. We show that GADD34/PP1 phosphatase activity reverses hyperosmotic-stress-induced Golgi fragmentation and is important for cis- to trans-Golgi trafficking of SNAT2, thereby promoting SNAT2 plasma membrane localization and function. These results suggest that GADD34 is a protective molecule for ocular diseases such as dry eye syndrome. : Here, Krokowski et al. show that GADD34/PP1 protects the microtubule network, prevents Golgi fragmentation, and preserves protein trafficking independent of its action in the integrated stress response (ISR. In osmoadaptation, GADD34 facilitates trans-Golgi-mediated processing of the endoplasmic reticulum (ER-synthesized amino acid transporter SNAT2, which in turn increases amino acid uptake. Keywords: SNAT2, GADD34, hyperosmotic stress, amino acid transport, Golgi fragmentation, ISR
CNPY2 inhibits MYLIP-mediated AR protein degradation in prostate cancer cells.
Ito, Saya; Ueno, Akihisa; Ueda, Takashi; Nakagawa, Hideo; Taniguchi, Hidefumi; Kayukawa, Naruhiro; Fujihara-Iwata, Atsuko; Hongo, Fumiya; Okihara, Koji; Ukimura, Osamu
2018-04-03
The androgen receptor (AR) is a ligand-dependent transcription factor that promotes prostate cancer (PC) cell growth through control of target gene expression. This report suggests that Canopy FGF signaling regulator 2 (CNPY2) controls AR protein levels in PC cells. We found that AR was ubiquitinated by an E3 ubiquitin ligase, myosin regulatory light chain interacting protein (MYLIP) and then degraded through the ubiquitin-proteasome pathway. CNPY2 decreased the ubiquitination activity of MYLIP by inhibition of interaction between MYLIP and UBE2D1, an E2 ubiquitin ligase. CNPY2 up-regulated gene expression of AR target genes such as KLK3 gene which encodes the prostate specific antigen (PSA) and promoted cell growth of PC cells. The cell growth inhibition by CNPY2 knockdown was rescued by AR overexpression. Furthermore, positive correlation of expression levels between CNPY2 and AR/AR target genes was observed in tissue samples from human prostate cancer patients. Together, these results suggested that CNPY2 promoted cell growth of PC cells by inhibition of AR protein degradation through MYLIP-mediated AR ubiquitination.
Directory of Open Access Journals (Sweden)
Thrush Anthony
2010-01-01
Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples
Kandasamy, Saveetha; Loganathan, Karthiba; Muthuraj, Raveendran; Duraisamy, Saravanakumar; Seetharaman, Suresh; Thiruvengadam, Raguchander; Ponnusamy, Balasubramanian; Ramasamy, Samiyappan
2009-12-24
Plant Growth Promoting Rhizobacteria (PGPR), Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
Flavodiiron Proteins Promote Fast and Transient O2 Photoreduction in Chlamydomonas.
Chaux, Frédéric; Burlacot, Adrien; Mekhalfi, Malika; Auroy, Pascaline; Blangy, Stéphanie; Richaud, Pierre; Peltier, Gilles
2017-07-01
During oxygenic photosynthesis, the reducing power generated by light energy conversion is mainly used to reduce carbon dioxide. In bacteria and archae, flavodiiron (Flv) proteins catalyze O 2 or NO reduction, thus protecting cells against oxidative or nitrosative stress. These proteins are found in cyanobacteria, mosses, and microalgae, but have been lost in angiosperms. Here, we used chlorophyll fluorescence and oxygen exchange measurement using [ 18 O]-labeled O 2 and a membrane inlet mass spectrometer to characterize Chlamydomonas reinhardtii flvB insertion mutants devoid of both FlvB and FlvA proteins. We show that Flv proteins are involved in a photo-dependent electron flow to oxygen, which drives most of the photosynthetic electron flow during the induction of photosynthesis. As a consequence, the chlorophyll fluorescence patterns are strongly affected in flvB mutants during a light transient, showing a lower PSII operating yield and a slower nonphotochemical quenching induction. Photoautotrophic growth of flvB mutants was indistinguishable from the wild type under constant light, but severely impaired under fluctuating light due to PSI photo damage. Remarkably, net photosynthesis of flv mutants was higher than in the wild type during the initial hour of a fluctuating light regime, but this advantage vanished under long-term exposure, and turned into PSI photo damage, thus explaining the marked growth retardation observed in these conditions. We conclude that the C. reinhardtii Flv participates in a Mehler-like reduction of O 2 , which drives a large part of the photosynthetic electron flow during a light transient and is thus critical for growth under fluctuating light regimes. © 2017 American Society of Plant Biologists. All Rights Reserved.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
Energy Technology Data Exchange (ETDEWEB)
Mittal, Monika; Pal, Subhashis; China, Shyamsundar Pal; Porwal, Konica [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India); Dev, Kapil [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Shrivastava, Richa [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Raju, Kanumuri Siva Rama; Rashid, Mamunur [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Trivedi, Arun Kumar; Sanyal, Sabyasachi [Biochemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Wahajuddin, Muhammad [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Bhaduria, Smrati [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Rakesh [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chattopadhyay, Naibedya, E-mail: n_chattopadhyay@cdri.res.in [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India)
2017-02-01
Aldehyde dehydrogenases (ALDHs) are a family of enzymes involved in detoxifying aldehydes. Previously, we reported that an ALDH inhibitor, disulfiram caused bone loss in rats and among ALDHs, osteoblast expressed only ALDH2. Loss-of-function mutation in ALDH2 gene is reported to cause bone loss in humans which suggested its importance in skeletal homeostasis. We thus studied whether activating ALDH2 by N-(1, 3-benzodioxol-5-ylmethyl)-2, 6-dichlorobenzamide (alda-1) had osteogenic effect. We found that alda-1 increased and acetaldehyde decreased the differentiation of rat primary osteoblasts and expressions of ALDH2 and bone morphogenetic protein-2 (BMP-2). Silencing ALDH2 in osteoblasts abolished the alda-1 effects. Further, alda-1 attenuated the acetaldehyde-induced lipid-peroxidation and oxidative stress. BMP-2 is essential for bone regeneration and alda-1 increased its expression in osteoblasts. We then showed that alda-1 (40 mg/kg dose) augmented bone regeneration at the fracture site with concomitant increase in BMP-2 protein compared with control. The osteogenic dose (40 mg/kg) of alda-1 attained a bone marrow concentration that was stimulatory for osteoblast differentiation, suggesting that the tissue concentration of alda-1 matched its pharmacologic effect. In addition, alda-1 promoted modeling-directed bone growth and peak bone mass achievement, and increased bone mass in adult rats which reiterated its osteogenic effect. In osteopenic ovariectomized (OVX) rats, alda-1 reversed trabecular osteopenia with attendant increase in serum osteogenic marker (procollagen type I N-terminal peptide) and decrease in oxidative stress. Alda-1 has no effect on liver and kidney function. We conclude that activating ALDH2 by alda-1 had an osteoanabolic effect involving increased osteoblastic BMP-2 production and decreased OVX-induced oxidative stress. - Highlights: • Alda-1 induced osteoblast differentiation that involved upregulation of ALDH2 and BMP-2 • Alda-1
International Nuclear Information System (INIS)
Zhao Lanjuan; Wang Lu; Ren Hao; Cao Jie; Li Li; Ke Jinshan; Qi Zhongtian
2005-01-01
Dysregulation of mitogen-activated protein kinase (MAPK) signaling pathways by various viruses has been shown to be responsible for viral pathogenicity. The molecular mechanism by which hepatitis C virus (HCV) infection caused human liver diseases has been investigated on the basis of abnormal intracellular signal events. Current data are very limited involved in transmembrane signal transduction triggered by HCV E2 protein. Here we explored regulation of the MAPK/extracellular signal-regulated kinase (MAPK/ERK) signaling pathway by E2 expressed in Chinese hamster oval cells. In human hepatoma Huh-7 cells, E2 specifically activated the MAPK/ERK pathway including downstream transcription factor ATF-2 and greatly promoted cell proliferation. CD81 and low density lipoprotein receptor (LDLR) on the cell surface mediated binding of E2 to Huh-7 cells. The MAPK/ERK activation and cell proliferation driven by E2 were suppressed by blockage of CD81 as well as LDLR. Furthermore, pretreatment with an upstream kinase MEK1/2 inhibitor U0126 also impaired the MAPK/ERK activation and cell proliferation induced by E2. Our results suggest that the MAPK/ERK signaling pathway triggered by HCV E2 via its receptors maintains survival and growth of target cells
Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X
2017-02-01
To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4 CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5 CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Thiruvengadam Raguchander
2009-12-01
Full Text Available Abstract Background Plant Growth Promoting Rhizobacteria (PGPR, Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Results Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Conclusion Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Tian, Chenxi; Shi, Herong; Colledge, Clark; Stern, Michael; Waterston, Robert; Liu, Jun
2011-01-01
The proper development of multicellular organisms requires precise regulation and coordination of cell fate specification, cell proliferation and differentiation. Abnormal regulation and coordination of these processes could lead to disease, including cancer. We have examined the function of the sole C. elegans SoxC protein, SEM-2, in the M lineage, which produces the postembryonic mesoderm. We found that SEM-2/SoxC is both necessary and sufficient to promote a proliferating blast cell fate, the sex myoblast fate, over a differentiated striated bodywall muscle fate. A number of factors control the specific expression of sem-2 in the sex myoblast precursors and their descendants. This includes direct control of sem-2 expression by a Hox-PBC complex. The crucial nature of the HOX/PBC factors in directly enhancing expression of this proliferative factor in the C. elegans M lineage suggests a possible more general link between Hox-PBC factors and SoxC proteins in regulating cell proliferation. PMID:21307099
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
Overexpression of MIP2, a novel WD-repeat protein, promotes proliferation of H9c2 cells
International Nuclear Information System (INIS)
Wei, Xing; Song, Lan; Jiang, Lei; Wang, Guiliang; Luo, Xinjing; Zhang, Bin; Xiao, Xianzhong
2010-01-01
WD40 repeat proteins have a wide range of diverse biological functions including signal transduction, cell cycle regulation, RNA splicing, and transcription. Myocardial ischemic preconditioning up-regulated protein 2 (MIP2) is a novel member of the WD40 repeat proteins superfamily that contains five WD40 repeats. Little is known about its biological role, and the purpose of this study was to determine the role of MIP2 in regulating cellular proliferation. Transfection and constitutive expression of MIP2 in the rat cardiomyoblast cell line H9c2 results in enhanced growth of those cells as measured by cell number and is proportional to the amount of MIP2 expressed. Overexpression of MIP2 results in a shorter cell cycle, as measured by flow cytometry. Collectively, these data suggest that MIP2 may participate in the progression of cell proliferation in H9c2 cells.
Knotted vs. unknotted proteins: evidence of knot-promoting loops.
Directory of Open Access Journals (Sweden)
Raffaello Potestio
Full Text Available Knotted proteins, because of their ability to fold reversibly in the same topologically entangled conformation, are the object of an increasing number of experimental and theoretical studies. The aim of the present investigation is to assess, on the basis of presently available structural data, the extent to which knotted proteins are isolated instances in sequence or structure space, and to use comparative schemes to understand whether specific protein segments can be associated to the occurrence of a knot in the native state. A significant sequence homology is found among a sizeable group of knotted and unknotted proteins. In this family, knotted members occupy a primary sub-branch of the phylogenetic tree and differ from unknotted ones only by additional loop segments. These "knot-promoting" loops, whose virtual bridging eliminates the knot, are found in various types of knotted proteins. Valuable insight into how knots form, or are encoded, in proteins could be obtained by targeting these regions in future computational studies or excision experiments.
β-Hydroxy-β-Methylbutyrate (HMB) Promotes Neurite Outgrowth in Neuro2a Cells.
Salto, Rafael; Vílchez, Jose D; Girón, María D; Cabrera, Elena; Campos, Nefertiti; Manzano, Manuel; Rueda, Ricardo; López-Pedrosa, Jose M
2015-01-01
β-Hydroxy-β-methylbutyrate (HMB) has been shown to enhance cell survival, differentiation and protein turnover in muscle, mainly activating phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinases/ extracellular-signal-regulated kinases (MAPK/ERK) signaling pathways. Since these two pathways are related to neuronal survival and differentiation, in this study, we have investigated the neurotrophic effects of HMB in mouse neuroblastoma Neuro2a cells. In Neuro2a cells, HMB promotes differentiation to neurites independent from any effects on proliferation. These effects are mediated by activation of both the PI3K/Akt and the extracellular-signal-regulated kinases (ERK1/2) signaling as demonstrated by the use of specific inhibitors of these two pathways. As myocyte-enhancer factor 2 (MEF2) family of transcription factors are involved in neuronal survival and plasticity, the transcriptional activity and protein levels of MEF2 were also evaluated. HMB promoted MEF2-dependent transcriptional activity mediated by the activation of Akt and ERK1/2 pathways. Furthermore, HMB increases the expression of brain glucose transporters 1 (GLUT1) and 3 (GLUT3), and mTOR phosphorylation, which translates in a higher protein synthesis in Neuro2a cells. Furthermore, Torin1 and rapamycin effects on MEF2 transcriptional activity and HMB-dependent neurite outgrowth support that HMB acts through mTORC2. Together, these findings provide clear evidence to support an important role of HMB in neurite outgrowth.
Directory of Open Access Journals (Sweden)
Jin H
2014-05-01
Full Text Available Han Jin,1 Kai Zhang,2 Chunyan Qiao,1 Anliang Yuan,1 Daowei Li,1 Liang Zhao,1 Ce Shi,1 Xiaowei Xu,1 Shilei Ni,1 Changyu Zheng,3 Xiaohua Liu,4 Bai Yang,2 Hongchen Sun11Department of Pathology, School of Stomatology, Jilin University, Changchun, People’s Republic of China; 2State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun, People’s Republic of China; 3Molecular Physiology and Therapeutics Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD, USA; 4Department of Biomedical Sciences, Texas A&M University Baylor College of Dentistry, Dallas, TX, USAAbstract: Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2 gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al nanocomposites plus human BMP-2 complementary(cDNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI
Thioredoxin Txnl1/TRP32 Is a Redox-active Cofactor of the 26 S Proteasome
DEFF Research Database (Denmark)
Andersen, Katrine M; Klausen, Louise Kjær; Prag, Søren
2009-01-01
in the cytoplasm and nucleus. Txnl1 has thioredoxin activity with a redox potential of about -250 mV. Mutant Txnl1 with one active site cysteine replaced by serine formed disulfide bonds to eEF1A1, a substrate-recruiting factor of the 26S proteasome. eEF1A1 is therefore a likely physiological substrate....... In response to knock-down of Txnl1, ubiquitin-protein conjugates were moderately stabilised. Hence, Txnl1 is the first example of a direct connection between protein reduction and proteolysis, two major intracellular protein quality control mechanisms....
LENUS (Irish Health Repository)
McEneaney, Victoria
2010-01-01
Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.
Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud
2016-04-01
The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.
Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.
Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S
2014-12-01
Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.
Aquaporin 2 promotes cell migration and epithelial morphogenesis.
Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny
2012-09-01
The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.
Ho, Steven C L; Yang, Yuansheng
2014-08-01
Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.
Ma, Yi; Miura, Eriko; Ham, Byung-Kook; Cheng, Hao-Wen; Lee, Young-Jin; Lucas, William J
2010-11-01
In yeast, eIF5A, in combination with eEF2, functions at the translation step, during the protein elongation cycle. This result is of significance with respect to functioning of the enucleate sieve tube system, as eIF5A was recently detected in Cucurbita maxima (pumpkin) phloem sap. In the present study, we further characterized four CmeIF5A isoforms, encoding three proteins, all of which were present in the phloem sap. Although hypusination of CmeIF5A was not necessary for entry into the sieve elements, this unique post-translational modification was necessary for RNA binding. The two enzymes required for hypusination were detected in pumpkin phloem sap, where presumably this modification takes place. A combination of gel-filtration chromatography and protein overlay assays demonstrated that, as in yeast, CmeIF5A interacts with phloem proteins, like eEF2, known to be involved in protein synthesis. These findings are discussed in terms of a potential role for eIF5A in regulating protein synthesis within the enucleate sieve tube system of the angiosperms. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat
2018-04-27
The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D
2000-01-01
Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift
TPA-inducible proteins may account for sensitivity to promotion of transformation
International Nuclear Information System (INIS)
Hirano, K.; Smith, B.; Colburn, N.H.
1986-01-01
The preneoplastic JB6 mouse epidermal cell system includes cell lines sensitive (P + ) or resistant (P - ) to tumor promoter induced neoplastic transformation. The authors investigated whether a difference in TPA-inducible proteins may explain this differential sensitivity. The synthesis of a 39 Kd cytoplasmic protein (Major Excreted Protein) was TPA-inducible, but to a similar extent in both P + and P - cells. TPA stimulated phosphorylation but not synthesis of the previously described stress protein pp80 in both P + and P - cells from 1 to 5 hr after treatment. Pulse labelling of P + and P - cells with 35 S-methionine revealed a TPA dependent P + specific transient increase in the synthesis of 58Kd protein. Induction was observed at 1 hr, and returned to basal levels by 4 hr and 20 hr, in nuclear and cytoplasmic fractions, respectively. This protein is not phosphorylated in response to TPA treatment. P + cells differ from P - cells in one or more genes that specify sensitivity to promotion of transformation, designated pro genes. Antibodies to three peptides representing the pro-1 open reading frame were used in immunoprecipitation and Western blotting to isolate the pro-1 gene product. A 43 Kd protein was immunologically responsive to the pro-1 peptide antibodies, and showed an increased signal 40 min after TPA treatment. Since the predicted molecular weight of a pro-1 gene product is only 7 Kd, the possibility of a modification of the protein by poly(ADP-ribosylation) or glycosylation is being investigated
Energy Technology Data Exchange (ETDEWEB)
Sangsuwan, Jiraporn [Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn [Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand)
2015-09-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function.
International Nuclear Information System (INIS)
Sangsuwan, Jiraporn; Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn
2015-01-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function
Singh, Pawan; Patil, K Neelakanteshwar; Khanduja, Jasbeer Singh; Kumar, P Sanjay; Williams, Alan; Rossi, Franca; Rizzi, Menico; Davis, Elaine O; Muniyappa, K
2010-06-15
DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.
Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O
2015-06-01
Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients
MRG15 activates the cdc2 promoter via histone acetylation in human cells
International Nuclear Information System (INIS)
Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.
2011-01-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
Energy Technology Data Exchange (ETDEWEB)
Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)
2011-07-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
Functional characterization of JMJD2A, a histone deacetylase- and retinoblastoma-binding protein.
Gray, Steven G; Iglesias, Antonio H; Lizcano, Fernando; Villanueva, Raul; Camelo, Sandra; Jingu, Hisaka; Teh, Bin T; Koibuchi, Noriyuki; Chin, William W; Kokkotou, Efi; Dangond, Fernando
2005-08-05
To effectively direct targeted repression, the class I histone deacetylases (HDACs) associate with many important regulatory proteins. In this paper we describe the molecular characterization of a member of the Jumonji domain 2 (JMJD2) family of proteins, and demonstrate its binding to both class I HDACs and the retinoblastoma protein (pRb). JMJD2 proteins are characterized by the presence of two leukemia-associated protein/plant homeodomain (LAP/PHD) zinc fingers, one JmjN, one JmjC (containing an internal retinoblastoma-binding protein 2 (RBBP2)-like sequence), and two Tudor domains. The first member of this group, JMJD2A, is widely expressed in human tissues and cell lines, and high endogenous expression of JMJD2A mRNA was found in several cell types, including human T-cell lymphotropic virus 1 (HTLV-1)-infected cell lines. JMJD2A and JMJD2B exhibit cell type-specific responses to the HDAC inhibitor trichostatin A. We show that the JMJD2A protein associates in vivo with pRb and class I HDACs, and mediates repression of E2F-regulated promoters. In HTLV-1 virus-infected cells, we find that JMJD2A binds to the viral Tax protein. Antibodies to JMJD2A recognize the native protein but also a half-sized protein fragment, the latter up-regulated in THP-1 cells during the G(2)/M phase of the cell cycle. The ability of JMJD2A to associate with pRb and HDACs and potentiate pRb-mediated repression of E2F-regulated promoters implies an important role for this protein in cell proliferation and oncogenesis.
Shen, Qinfang; Shi, Herong; Tian, Chenxi; Ghai, Vikas; Liu, Jun
2017-09-01
Proper development of a multicellular organism relies on well-coordinated regulation of cell fate specification, cell proliferation and cell differentiation. The C. elegans postembryonic mesoderm provides a useful system for uncovering factors involved in these processes and for further dissecting their regulatory relationships. The single Spalt-like zinc finger containing protein SEM-4/SALL is known to be involved in specifying the proliferative sex myoblast (SM) fate. We have found that SEM-4/SALL is sufficient to promote the SM fate and that it does so in a cell autonomous manner. We further showed that SEM-4/SALL acts through the SoxC transcription factor SEM-2 to promote the SM fate. SEM-2 is known to promote the SM fate by inhibiting the expression of two BWM-specifying transcription factors. In light of recent findings in mammals showing that Sall4, one of the mammalian homologs of SEM-4, contributes to pluripotency regulation by inhibiting differentiation, our work suggests that the function of SEM-4/SALL proteins in regulating pluripotency versus differentiation appears to be evolutionarily conserved. Copyright © 2017 Elsevier Inc. All rights reserved.
Kamel, Nancy N.; Ahmed, Ayman M. H.; Mehaisen, Gamal M. K.; Mashaly, Magdi M.; Abass, Ahmed O.
2017-09-01
In tropical and semitropical regions, raising broiler chickens out of their thermal comfort zone can cause an added economic loss in the poultry industry. The cause for the deleterious effects on immunity and growth performance of broilers under high environmental temperatures is still poorly understood. Therefore, the aim of the current investigation was to evaluate the effect of heat stress on leukocytes protein synthesis and immune function as a possible direct cause of low performance in broiler chickens under such condition. In this study, 300 one-day-old male broiler chicks (Cobb500™) were randomly assigned into 2 groups with 5 replicates of 30 chicks each. From 21 to 42 days of age, one group was exposed to non-stressed condition at 24 °C and 50% relative humidity (control group), while the other group was exposed to heat stress at 35 °C and 50% relative humidity (HS group). At 42 days of age, blood samples were collected from each group to evaluate stress indicators, immune function, and leukocytes protein synthesis. Production performance was also recorded. Noteworthy, protein synthesis in leukocytes was significantly ( P < 0.05) inhibited in HS group by 38% compared to control group. In contrast, the phosphorylation level on threonine 56 site (Thr56) of eukaryotic elongation factor (eEF2), which indicates the suppression of protein translation process through altering the protein elongation phase, was significantly threefold higher in HS group than in control ( P < 0.05). In addition, an increase in stress indicators was markedly ( P < 0.05) presented in the HS birds by twofold increase in heterophil/lymphocyte (H/L) ratio and threefold increase in plasma corticosterone level compared to control. Furthermore, the immune function was significantly ( P < 0.05) suppressed in HS birds than control (0.99 vs. 1.88 mg/mL plasma IgG, 89.2 vs. 148.0 μg/mL plasma IgM, 4.80 vs. 7.20 antibody titer against SRBC, and 1.38 vs. 3.39 stimulation index of lymphocyte
HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.
Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael
2016-06-01
Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. Copyright © 2016 Elsevier Inc. All rights reserved.
Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C
2011-08-01
Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
International Nuclear Information System (INIS)
Yang, Zhihong; Zhang, Yuxia; Wang, Li
2012-01-01
Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Directory of Open Access Journals (Sweden)
Stephanie Jemielity
2013-03-01
Full Text Available Human T-cell Immunoglobulin and Mucin-domain containing proteins (TIM1, 3, and 4 specifically bind phosphatidylserine (PS. TIM1 has been proposed to serve as a cellular receptor for hepatitis A virus and Ebola virus and as an entry factor for dengue virus. Here we show that TIM1 promotes infection of retroviruses and virus-like particles (VLPs pseudotyped with a range of viral entry proteins, in particular those from the filovirus, flavivirus, New World arenavirus and alphavirus families. TIM1 also robustly enhanced the infection of replication-competent viruses from the same families, including dengue, Tacaribe, Sindbis and Ross River viruses. All interactions between TIM1 and pseudoviruses or VLPs were PS-mediated, as demonstrated with liposome blocking and TIM1 mutagenesis experiments. In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1. Finally, the blocking of PS receptors on macrophages inhibited the entry of Ebola VLPs, suggesting that PS receptors can contribute to infection in physiologically relevant cells. Notably, infection mediated by the entry proteins of Lassa fever virus, influenza A virus and SARS coronavirus was largely unaffected by TIM1 expression. Taken together our data show that TIM1 and related PS-binding proteins promote infection of diverse families of enveloped viruses, and may therefore be useful targets for broad-spectrum antiviral therapies.
Directory of Open Access Journals (Sweden)
Anchit Khanna
2011-03-01
Full Text Available EGFR-MEK-ERK signaling pathway has an established role in promoting malignant growth and disease progression in human cancers. Therefore identification of transcriptional targets mediating the oncogenic effects of the EGFR-MEK-ERK pathway would be highly relevant. Cancerous inhibitor of protein phosphatase 2A (CIP2A is a recently characterized human oncoprotein. CIP2A promotes malignant cell growth and is over expressed at high frequency (40-80% in most of the human cancer types. However, the mechanisms inducing its expression in cancer still remain largely unexplored. Here we present systematic analysis of contribution of potential gene regulatory mechanisms for high CIP2A expression in cancer. Our data shows that evolutionary conserved CpG islands at the proximal CIP2A promoter are not methylated both in normal and cancer cells. Furthermore, sequencing of the active CIP2A promoter region from altogether seven normal and malignant cell types did not reveal any sequence alterations that would increase CIP2A expression specifically in cancer cells. However, treatment of cancer cells with various signaling pathway inhibitors revealed that CIP2A mRNA expression was sensitive to inhibition of EGFR activity as well as inhibition or activation of MEK-ERK pathway. Moreover, MEK1/2-specific siRNAs decreased CIP2A protein expression. Series of CIP2A promoter-luciferase constructs were created to identify proximal -27 to -107 promoter region responsible for MEK-dependent stimulation of CIP2A expression. Additional mutagenesis and chromatin immunoprecipitation experiments revealed ETS1 as the transcription factor mediating stimulation of CIP2A expression through EGFR-MEK pathway. Thus, ETS1 is probably mediating high CIP2A expression in human cancers with increased EGFR-MEK1/2-ERK pathway activity. These results also suggest that in addition to its established role in invasion and angiogenesis, ETS1 may support malignant cellular growth via regulation of
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera
2016-08-20
The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
Directory of Open Access Journals (Sweden)
Schwarzenbach Heidi
2010-06-01
Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one
Oers, van M.M.; Doitsidou, M.; Thomas, A.A.M.; Maagd, de R.A.; Vlak, J.M.
2003-01-01
Complete cDNA sequences were obtained for ribosomal protein (rp) L15 and eukaryotic initiation factor eIF2 from the lepidopteran insect Spodoptera frugiperda, and for elongation factor eEF2 from S. exigua. The presence of a 5' terminal oligopyrimidine (TOP) tract classified the lepidopteran rpL15
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing
2017-03-01
Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in
de Betue, Carlijn T; van Waardenburg, Dick A; Deutz, Nicolaas E; van Eijk, Hans M; van Goudoever, Johannes B; Luiking, Yvette C; Zimmermann, Luc J; Joosten, Koen F
2011-01-01
Objective The preservation of nutritional status and growth is an important aim in critically ill infants, but difficult to achieve due to the metabolic stress response and inadequate nutritional intake, leading to negative protein balance. This study investigated whether increasing protein and energy intakes can promote anabolism. The primary outcome was whole body protein balance, and the secondary outcome was first pass splanchnic phenylalanine extraction (SPEPhe). Design This was a double-blind randomised controlled trial. Infants (n=18) admitted to the paediatric intensive care unit with respiratory failure due to viral bronchiolitis were randomised to continuous enteral feeding with protein and energy enriched formula (PE-formula) (n=8; 3.1±0.3 g protein/kg/24 h, 119±25 kcal/kg/24 h) or standard formula (S-formula) (n=10; 1.7±0.2 g protein/kg/24 h, 84±15 kcal/kg/24 h; equivalent to recommended intakes for healthy infants <6 months). A combined intravenous-enteral phenylalanine stable isotope protocol was used on day 5 after admission to determine whole body protein metabolism and SPEPhe. Results Protein balance was significantly higher with PE-formula than with S-formula (PE-formula: 0.73±0.5 vs S-formula: 0.02±0.6 g/kg/24 h) resulting from significantly increased protein synthesis (PE-formula: 9.6±4.4, S-formula: 5.2±2.3 g/kg/24 h), despite significantly increased protein breakdown (PE-formula: 8.9±4.3, S-formula: 5.2±2.6 g/kg/24 h). SPEPhe was not statistically different between the two groups (PE-formula: 39.8±18.3%, S-formula: 52.4±13.6%). Conclusions Increasing protein and energy intakes promotes protein anabolism in critically ill infants in the first days after admission. Since this is an important target of nutritional support, increased protein and energy intakes should be preferred above standard intakes in these infants. Dutch Trial Register number: NTR 515. PMID:21673183
Wu, Jiahe; Zhu, Chuanfeng; Pang, Jinhuan; Zhang, Xiangrong; Yang, Chunlin; Xia, Guixian; Tian, Yingchuan; He, Chaozu
2014-12-01
Seed germination is a key developmental process in the plant life cycle that is influenced by various environmental cues and phytohormones through gene expression and a series of metabolism pathways. In the present study, we investigated a C2C2-type finger protein, OsLOL1, which promotes gibberellin (GA) biosynthesis and affects seed germination in Oryza sativa (rice). We used OsLOL1 antisense and sense transgenic lines to explore OsLOL1 functions. Seed germination timing in antisense plants was restored to wild type when exogenous GA3 was applied. The reduced expression of the GA biosynthesis gene OsKO2 and the accumulation of ent-kaurene were observed during germination in antisense plants. Based on yeast two-hybrid and firefly luciferase complementation analyses, OsLOL1 interacted with the basic leucine zipper protein OsbZIP58. The results from electrophoretic mobility shift and dual-luciferase reporter assays showed that OsbZIP58 binds the G-box cis-element of the OsKO2 promoter and activates LUC reporter gene expression, and that interaction between OsLOL1 and OsbZIP58 activates OsKO2 gene expression. In addition, OsLOL1 decreased SOD1 gene expression and accelerated programmed cell death (PCD) in the aleurone layer of rice grains. These findings demonstrate that the interaction between OsLOL1 and OsbZIP58 influences GA biosynthesis through the activation of OsKO2 via OsbZIP58, thereby stimulating aleurone PCD and seed germination. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jay E. Raymond
2016-11-01
Full Text Available This study was conducted to determine the efficacy of using enhanced efficiency fertilizer (EEFs products compared to urea to improve fertilizer nitrogen use efficiency (FNUE in forest plantations. All fertilizer treatments were labeled with 15N (0.5 atom percent and applied to 100 m2 circular plots at 12 loblolly pine stands (Pinus taeda L. across the southeastern United States. Total fertilizer N recovery for fertilizer treatments was determined by sampling all primary ecosystem components and using a mass balance calculation. Significantly more fertilizer N was recovered for all EEFs compared to urea, but there were generally no differences among EEFs. The total fertilizer N ecosystem recovery ranged from 81.9% to 84.2% for EEFs compared to 65.2% for urea. The largest amount of fertilizer N recovered for all treatments was in the loblolly pine trees (EEFs: 38.5%–49.9%, urea: 34.8% and soil (EEFs: 30.6%–38.8%, urea: 28.4%. This research indicates that a greater ecosystem fertilizer N recovery for EEFs compared to urea in southeastern pine plantations can potentially lead to increased FNUE in these systems.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
International Nuclear Information System (INIS)
Zhang, H.; Chen, K.Y.; Liu, A.Y.C.
1987-01-01
The regulation of specific protein synthesis by the phorbol ester tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), was evaluated using the L-8 and C-2 myoblast and the 3T3-L1 fibroblast cell cultures. TPA increased, by 2-4 fold, the synthesis rates of two cytoplasmic proteins with apparent molecular weights of 89,000 and 74,000 as determined by SDS-polyacrylamide gel electrophoresis and autoradiography. The concentration of TPA and the time of incubation needed to elicit this induction was determined to be 10 μg/ml and 20 hrs, respectively. Increasing the concentration of TPA to 100, 200, and 500 ng/ml did not result in a greater magnitude of induction. The possibility that these two TPA-induced proteins may be identical to proteins with similar molecular weights induced under heat-shocked or glucose-starved conditions was evaluated by 1-D and 2-D gel electrophoresis and autoradiography. Results provided evidence that the TPA-induced 89,000- and 74,000-dalton proteins were identical to hsp 89 and hsp 74, 2 out of a set of 8-9 proteins induced under heat shocked conditions. Furthermore, they are identical to two of the set of glucose-regulated proteins induced under a glucose-starved condition
Fujimori, Tsutomu; Suno, Ryoji; Iemura, Shun-Ichiro; Natsume, Tohru; Wada, Ikuo; Hosokawa, Nobuko
2017-08-01
The folding of newly synthesized proteins in the endoplasmic reticulum (ER) is assisted by ER-resident chaperone proteins. BiP (immunoglobulin heavy-chain-binding protein), a member of the HSP70 family, plays a central role in protein quality control. The chaperone function of BiP is regulated by its intrinsic ATPase activity, which is stimulated by ER-resident proteins of the HSP40/DnaJ family, including ERdj3. Here, we report that two closely related proteins, SDF2 and SDF2L1, regulate the BiP chaperone cycle. Both are ER-resident, but SDF2 is constitutively expressed, whereas SDF2L1 expression is induced by ER stress. Both luminal proteins formed a stable complex with ERdj3 and potently inhibited the aggregation of different types of misfolded ER cargo. These proteins associated with non-native proteins, thus promoting the BiP-substrate interaction cycle. A dominant-negative ERdj3 mutant that inhibits the interaction between ERdj3 and BiP prevented the dissociation of misfolded cargo from the ERdj3-SDF2L1 complex. Our findings indicate that SDF2 and SDF2L1 associate with ERdj3 and act as components in the BiP chaperone cycle to prevent the aggregation of misfolded proteins, partly explaining the broad folding capabilities of the ER under various physiological conditions. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.
Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong
2016-05-17
Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
International Nuclear Information System (INIS)
Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih; Zhao, Bo; Kieff, Elliott; Peng, Chih-Wen
2013-01-01
Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection
Energy Technology Data Exchange (ETDEWEB)
Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China); Zhao, Bo; Kieff, Elliott [Department of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, 181 Longwood Ave., Boston 02115, MA (United States); Peng, Chih-Wen, E-mail: pengcw@mail.tcu.edu.tw [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China)
2013-01-18
Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection.
Directory of Open Access Journals (Sweden)
Zhang Hua
2006-08-01
Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.
Liu, Rui; Kenney, Justin W.; Manousopoulou, Antigoni; Johnston, Harvey E.; Kamei, Makoto; Woelk, Christopher H.; Xie, Jianling; Schwarzer, Michael; Proud, Christopher G.
2016-01-01
properties, so this finding indicates it may be involved in metabolic remodeling and also serve as a novel candidate biomarker. Levels of translation factor eEF1 also increased during TAC, likely contributing to faster cell mass accumulation. Interestingly those two candidates were not up-regulated in pregnancy or exercise induced CH, indicating PKM2 and eEF1 were pathological CH specific markers. We anticipate that the methodologies described here will be valuable for other researchers studying protein synthesis in primary cells. PMID:27512079
Bando, Hiroki; Hisada, Hiromoto; Ishida, Hiroki; Hata, Yoji; Katakura, Yoshio; Kondo, Akihiko
2011-11-01
A novel promoter from a hemolysin-like protein encoding the gene, hlyA, was characterized for protein overexpression in Aspergillus oryzae grown in solid-state culture. Using endo-1,4-β-glucanase from A. oryzae (CelA) as the reporter, promoter activity was found to be higher than that of the α-amylase (amyA) and manganese superoxide dismutase (sodM) genes not only in wheat bran solid-state culture but also in liquid culture. Expression of the A. oryzae endoglucanase CelB and two heterologous endoglucanases (TrEglI and TrEglIII from Trichoderma reesei) under the control of the hlyA promoter were also found to be stronger than under the control of the amyA promoter in A. oryzae grown in wheat bran solid-state culture, suggesting that the hlyA promoter may be useful for the overproduction of other proteins as well. In wheat bran solid-state culture, the productivity of the hlyA promoter in terms of protein produced was high when the cultivation temperature was 30°C or 37°C, when the water content was 0.6 or 0.8 ml/g wheat bran, and from 48 to 72 h after inoculation. Because A. oryzae sporulated actively under these conditions and because hemolysin has been reported to play a role in fungal fruiting body formation, high-level expression of hlyA may be related to sporulation.
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M
2018-01-01
The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.
Gomes-Santos, Carina S. S.
2011-05-19
Many eukaryotic developmental and cell fate decisions that are effected post-transcriptionally involve RNA binding proteins as regulators of translation of key mRNAs. In malaria parasites (Plasmodium spp.), the development of round, non-motile and replicating exo-erythrocytic liver stage forms from slender, motile and cell-cycle arrested sporozoites is believed to depend on environmental changes experienced during the transmission of the parasite from the mosquito vector to the vertebrate host. Here we identify a Plasmodium member of the RNA binding protein family PUF as a key regulator of this transformation. In the absence of Pumilio-2 (Puf2) sporozoites initiate EEF development inside mosquito salivary glands independently of the normal transmission-associated environmental cues. Puf2- sporozoites exhibit genome-wide transcriptional changes that result in loss of gliding motility, cell traversal ability and reduction in infectivity, and, moreover, trigger metamorphosis typical of early Plasmodium intra-hepatic development. These data demonstrate that Puf2 is a key player in regulating sporozoite developmental control, and imply that transformation of salivary gland-resident sporozoites into liver stage-like parasites is regulated by a post-transcriptional mechanism. 2011 Gomes-Santos et al.
Inhibition of SNW1 association with spliceosomal proteins promotes apoptosis in breast cancer cells
International Nuclear Information System (INIS)
Sato, Naoki; Maeda, Masao; Sugiyama, Mai; Ito, Satoko; Hyodo, Toshinori; Masuda, Akio; Tsunoda, Nobuyuki; Kokuryo, Toshio; Hamaguchi, Michinari; Nagino, Masato; Senga, Takeshi
2015-01-01
RNA splicing is a fundamental process for protein synthesis. Recent studies have reported that drugs that inhibit splicing have cytotoxic effects on various tumor cell lines. In this report, we demonstrate that depletion of SNW1, a component of the spliceosome, induces apoptosis in breast cancer cells. Proteomics and biochemical analyses revealed that SNW1 directly associates with other spliceosome components, including EFTUD2 (Snu114) and SNRNP200 (Brr2). The SKIP region of SNW1 interacted with the N-terminus of EFTUD2 as well as two independent regions in the C-terminus of SNRNP200. Similar to SNW1 depletion, knockdown of EFTUD2 increased the numbers of apoptotic cells. Furthermore, we demonstrate that exogenous expression of either the SKIP region of SNW1 or the N-terminus region of EFTUD2 significantly promoted cellular apoptosis. Our results suggest that the inhibition of SNW1 or its associating proteins may be a novel therapeutic strategy for cancer treatment
Tropomyosin Promotes Lamellipodial Persistence by Collaborating with Arp2/3 at the Leading Edge.
Brayford, Simon; Bryce, Nicole S; Schevzov, Galina; Haynes, Elizabeth M; Bear, James E; Hardeman, Edna C; Gunning, Peter W
2016-05-23
At the leading edge of migrating cells, protrusion of the lamellipodium is driven by Arp2/3-mediated polymerization of actin filaments [1]. This dense, branched actin network is promoted and stabilized by cortactin [2, 3]. In order to drive filament turnover, Arp2/3 networks are remodeled by proteins such as GMF, which blocks the actin-Arp2/3 interaction [4, 5], and coronin 1B, which acts by directing SSH1L to the lamellipodium where it activates the actin-severing protein cofilin [6, 7]. It has been shown in vitro that cofilin-mediated severing of Arp2/3 actin networks results in the generation of new pointed ends to which the actin-stabilizing protein tropomyosin (Tpm) can bind [8]. The presence of Tpm in lamellipodia, however, is disputed in the literature [9-19]. Here, we report that the Tpm isoforms 1.8/9 are enriched in the lamellipodium of fibroblasts as detected with a novel isoform-specific monoclonal antibody. RNAi-mediated silencing of Tpm1.8/9 led to an increase of Arp2/3 accumulation at the cell periphery and a decrease in the persistence of lamellipodia and cell motility, a phenotype consistent with cortactin- and coronin 1B-deficient cells [2, 7]. In the absence of coronin 1B or cofilin, Tpm1.8/9 protein levels are reduced while, conversely, inhibition of Arp2/3 with CK666 leads to an increase in Tpm1.8/9 protein. These findings establish a novel regulatory mechanism within the lamellipodium whereby Tpm collaborates with Arp2/3 to promote lamellipodial-based cell migration. Copyright © 2016 Elsevier Ltd. All rights reserved.
The 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide is a DnaK-like protein
DEFF Research Database (Denmark)
Birkelund, Svend; Lundemose, AG; Christiansen, Gunna
1990-01-01
,980-base-pair open reading frame revealed 94% homology with a 75-kilodalton protein from C. trachomatis serovar D and 57% homology with the DnaK proteins of E. coli and of Bacillus megaterium, while amino acid homology with human heat shock protein 70 (hsp70) was 42%. The promoter region was identified......The gene coding for the 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide has been cloned in Escherichia coli, and the nucleotide sequence has been determined. The cloned DNA fragment contained the coding region as well as the putative promoter. The deduced amino acid sequence of the 1...... by computer search and by primer extension of mRNA synthesized in recombinant E. coli. The promoter region which differed from the putative promoter region in serovar D was shown to be a mixed promoter type in which the -10 region showed a regular TATA box configuration while the -35 region showed high...
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Gardner, Thomas W; Abcouwer, Steven F; Losiewicz, Mandy K; Fort, Patrice E
2015-09-15
Control of protein synthesis in insulin-responsive tissues has been well characterized, but relatively little is known about how this process is regulated in nervous tissues. The retina exhibits a relatively high protein synthesis rate, coinciding with high basal Akt and metabolic activities, with the majority of retinal ATP being derived from aerobic glycolysis. We examined the dependency of retinal protein synthesis on the Akt-mTOR signaling and glycolysis using ex vivo rat retinas. Akt inhibitors significantly reduced retinal protein synthesis but did not affect glycolytic lactate production. Surprisingly, the glycolytic inhibitor 2-deoxyglucose (2-DG) markedly inhibited Akt1 and Akt3 activities, as well as protein synthesis. The effects of 2-DG, and 2-fluorodeoxyglucose (2-FDG) on retinal protein synthesis correlated with inhibition of lactate production and diminished ATP content, with all these effects reversed by provision of d-mannose. 2-DG treatment was not associated with increased AMPK, eEF2, or eIF2α phosphorylation; instead, it caused rapid dephosphorylation of 4E-BP1. 2-DG reduced total mTOR activity by 25%, but surprisingly, it did not reduce mTORC1 activity, as indicated by unaltered raptor-associated mTOR autophosphorylation and ribosomal protein S6 phosphorylation. Dephosphorylation of 4E-BP1 was largely prevented by inhibition of PP1/PP2A phosphatases with okadaic acid and calyculin A, and inhibition of PPM1 phosphatases with cadmium. Thus, inhibition of retinal glycolysis diminished Akt and protein synthesis coinciding with accelerated dephosphorylation of 4E-BP1 independently of mTORC1. These results demonstrate a novel mechanism regulating protein synthesis in the retina involving an mTORC1-independent and phosphatase-dependent regulation of 4E-BP1. Copyright © 2015 the American Physiological Society.
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Dhar, Jayeeta; Cuevas, Rolando A; Goswami, Ramansu; Zhu, Jianzhong; Sarkar, Saumendra N; Barik, Sailen
2015-10-01
2'-5'-Oligoadenylate synthetase-like protein (OASL) is an interferon-inducible antiviral protein. Here we describe differential inhibitory activities of human OASL and the two mouse OASL homologs against respiratory syncytial virus (RSV) replication. Interestingly, nonstructural protein 1 (NS1) of RSV promoted proteasome-dependent degradation of specific OASL isoforms. We conclude that OASL acts as a cellular antiviral protein and that RSV NS1 suppresses this function to evade cellular innate immunity and allow virus growth. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.
Directory of Open Access Journals (Sweden)
Xiaoming Wang
Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
Energy Technology Data Exchange (ETDEWEB)
Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com
2015-10-23
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
International Nuclear Information System (INIS)
Tan, Yongsheng; Li, Yan
2015-01-01
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Directory of Open Access Journals (Sweden)
Zeina Kais
2016-06-01
Full Text Available BRCA1/2 proteins function in homologous recombination (HR-mediated DNA repair and cooperate with Fanconi anemia (FA proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork.
Directory of Open Access Journals (Sweden)
Rosenbaum Joel L
2011-01-01
Full Text Available Abstract Background Chlamydomonas reinhardtii is a model system for the biology of unicellular green algae. Chemically regulated promoters, such as the nickel-inducible CYC6 or the low CO2-inducible CAH1 promoter, may prove useful for expressing, at precise times during its cell cycle, proteins with relevant biological functions, or complementing mutants in genes encoding such proteins. To this date, this has not been reported for the above promoters. Results We fused the CYC6 and CAH1 promoters to an HA-tagged RSP3 gene, encoding a protein of the flagellar radial spoke complex. The constructs were used for chemically regulated complementation of the pf14 mutant, carrying an ochre mutation in the RSP3 gene. 7 to 8% of the transformants showed cells with restored motility after induction with nickel or transfer to low CO2 conditions, but not in non-inducing conditions. Maximum complementation (5% motile cells was reached with very different kinetics (5-6 hours for CAH1, 48 hours for CYC6. The two inducible promoters drive much lower levels of RSP3 protein expression than the constitutive PSAD promoter, which shows almost complete rescue of motility. Conclusions To our knowledge, this is the first example of the use of the CYC6 or CAH1 promoters to perform a chemically regulated complementation of a Chlamydomonas mutant. Based on our data, the CYC6 and CAH1 promoters should be capable of fully complementing mutants in genes whose products exert their biological activity at low concentrations.
Zhang, Weibin; Miley, Natasha; Zastrow, Michael S; MacQueen, Amy J; Sato, Aya; Nabeshima, Kentaro; Martinez-Perez, Enrique; Mlynarczyk-Evans, Susanna; Carlton, Peter M; Villeneuve, Anne M
2012-01-01
During meiosis, chromosomes align with their homologous pairing partners and stabilize this alignment through assembly of the synaptonemal complex (SC). Since the SC assembles cooperatively yet is indifferent to homology, pairing and SC assembly must be tightly coordinated. We identify HAL-2 as a key mediator in this coordination, showing that HAL-2 promotes pairing largely by preventing detrimental effects of SC precursors (SYP proteins). hal-2 mutants fail to establish pairing and lack multiple markers of chromosome movement mediated by pairing centers (PCs), chromosome sites that link chromosomes to cytoplasmic microtubules through nuclear envelope-spanning complexes. Moreover, SYP proteins load inappropriately along individual unpaired chromosomes in hal-2 mutants, and markers of PC-dependent movement and function are restored in hal-2; syp double mutants. These and other data indicate that SYP proteins can impede pairing and that HAL-2 promotes pairing predominantly but not exclusively by counteracting this inhibition, thereby enabling activation and regulation of PC function. HAL-2 concentrates in the germ cell nucleoplasm and colocalizes with SYP proteins in nuclear aggregates when SC assembly is prevented. We propose that HAL-2 functions to shepherd SYP proteins prior to licensing of SC assembly, preventing untimely interactions between SC precursors and chromosomes and allowing sufficient accumulation of precursors for rapid cooperative assembly upon homology verification.
Directory of Open Access Journals (Sweden)
Patrizia Marinelli
2018-04-01
Full Text Available Oxidatively modified forms of proteins accumulate during aging. Oxidized protein conformers might act as intermediates in the formation of amyloids in age-related disorders. However, it is not known whether this amyloidogenic conversion requires an extensive protein oxidative damage or it can be promoted just by a discrete, localized post-translational modification of certain residues. Here, we demonstrate that the irreversible oxidation of a single free Cys suffices to severely perturb the folding energy landscape of a stable globular protein, compromise its kinetic stability, and lead to the formation of amyloids under physiological conditions. Experiments and simulations converge to indicate that this specific oxidation-promoted protein aggregation requires only local unfolding. Indeed, a large scale analysis indicates that many cellular proteins are at risk of undergoing this kind of deleterious transition; explaining how oxidative stress can impact cell proteostasis and subsequently lead to the onset of pathological states. Keywords: Protein oxidation, Protein misfolding, Protein aggregation, Oxidative stress, Post-translational modification
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Direct inhibition of RNAse T2 expression by the HTLV-1 viral protein Tax.
Polakowski, Nicholas; Han, Hongjin; Lemasson, Isabelle
2011-08-01
Adult T-cell leukemia (ATL) is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1) infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP) assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development.
Direct Inhibition of RNAse T2 Expression by the HTLV-1 Viral Protein Tax
Directory of Open Access Journals (Sweden)
Isabelle Lemasson
2011-08-01
Full Text Available Adult T-cell leukemia (ATL is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1 infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development.
George, Suja; Usha, B; Parida, Ajay
2009-05-01
Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. Despite the wealth of information on abiotic stress and stress tolerance in plants, many aspects still remain unclear. Prosopis juliflora is a hardy plant reported to be tolerant to drought, salinity, extremes of soil pH, and heavy metal stress. In this paper, we report the isolation and characterization of the complementary DNA clone for an atypical late embryogenesis abundant (LEA) protein (Pj LEA3) and its putative promoter sequence from P. juliflora. Unlike typical LEA proteins, rich in glycine, Pj LEA3 has alanine as the most abundant amino acid followed by serine and shows an average negative hydropathy. Pj LEA3 is significantly different from other LEA proteins in the NCBI database and shows high similarity to indole-3 acetic-acid-induced protein ARG2 from Vigna radiata. Northern analysis for Pj LEA3 in P. juliflora leaves under 90 mM H2O2 stress revealed up-regulation of transcript at 24 and 48 h. A 1.5-kb fragment upstream the 5' UTR of this gene (putative promoter) was isolated and analyzed in silico. The possible reasons for changes in gene expression during stress in relation to the host plant's stress tolerance mechanisms are discussed.
Directory of Open Access Journals (Sweden)
Shuang Zhang
Full Text Available Leucine-rich repeat flightless-I-interacting protein 2 (LRRFIP2 is a myeloid differentiation factor 88-interacting protein with a positive regulatory function in toll-like receptor signaling. In this study, seven LRRFIP2 protein variants (LvLRRFIP2A-G were identified in Litopenaeus vannamei. All the seven LvLRRFIP2 protein variants encode proteins with a DUF2051 domain. LvLRRFIP2s were upregulated in hemocytes after challenged with lipopolysaccharide, poly I:C, CpG-ODN2006, Vibrio parahaemolyticus, Staphylococcus aureus, and white spot syndrome virus (WSSV. Dual-luciferase reporter assays in Drosophila Schneider 2 cells revealed that LvLRRFIP2 activates the promoters of Drosophila and shrimp AMP genes. The knockdown of LvLRRFIP2 by RNA interference resulted in higher cumulative mortality of L. vannamei upon V. parahaemolyticus but not S. aureus and WSSV infections. The expression of L. vannamei AMP genes were reduced by dsLvLRRFIP2 interference. These results indicate that LvLRRFIP2 has an important function in antibacterials via the regulation of AMP gene expression.
International Nuclear Information System (INIS)
Chen Chengzhong; Lin Zhenshan
2008-01-01
Scientific analysis of energy consumption and its influencing factors is of great importance for energy strategy and policy planning. The energy consumption in China 1953-2006 is estimated by applying the energy ecological footprint (EEF) method, and the fluctuation periods of annual China's per capita EEF (EEF cpc ) growth rate are analyzed with the empirical mode decomposition (EMD) method in this paper. EEF intensity is analyzed to depict energy efficiency in China. The main timescales of the 37 factors that affect the annual growth rate of EEF cpc are also discussed based on EMD and factor analysis methods. Results show three obvious undulation cycles of the annual growth rate of EEF cpc , i.e., 4.6, 14.4 and 34.2 years over the last 53 years. The analysis findings from the common synthesized factors of IMF1, IMF2 and IMF3 timescales of the 37 factors suggest that China's energy policy-makers should attach more importance to stabilizing economic growth, optimizing industrial structure, regulating domestic petroleum exploitation and improving transportation efficiency
Zhenghe Li; Judit Pogany; Steven Tupman; Anthony M Esposito; Terri Goss Kinzy; Peter D Nagy
2010-01-01
Replication of plus-strand RNA viruses depends on host factors that are recruited into viral replicase complexes. Previous studies showed that eukaryotic translation elongation factor (eEF1A) is one of the resident host proteins in the highly purified tombusvirus replicase complex. Using a random library of eEF1A mutants, we identified one mutant that decreased and three mutants that increased Tomato bushy stunt virus (TBSV) replication in a yeast model host. Additional in vitro assays with w...
DEFF Research Database (Denmark)
Frikke-Schmidt, R.; Nordestgaard, Børge; Grande, Peer
2008-01-01
Objectives This study was designed to test the hypotheses that single nucleotide polymorphisms ( SNPs), in zinc finger protein 202 ( ZNF202), predict severe atherosclerosis and ischemic heart disease ( IHD). Background ZNF202 is a transcriptional repressor controlling promoter elements in genes...... involved in vascular maintenance and lipid metabolism. Methods We first determined genotype association for 9 ZNF202 SNPs with severe atherosclerosis ( ankle brachial index >0.7 vs. ...,998 controls. Finally, we determined whether g. -660A>G altered transcriptional activity of the ZNF202 promoter in vitro. Results Cross-sectionally, ZNF202 g. -660 GG versus AA homozygosity predicted an odds ratio for severe atherosclerosis of 2.01 ( 95% confidence interval [CI]: 1.34 to 3.01). Prospectively...
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter
Directory of Open Access Journals (Sweden)
Zhentao Yang
2017-05-01
Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...
Directory of Open Access Journals (Sweden)
Brudvik Kristoffer W
2011-12-01
Full Text Available Abstract Background The adenomatous polyposis coli (APC protein is part of the destruction complex controlling proteosomal degradation of β-catenin and limiting its nuclear translocation, which is thought to play a gate-keeping role in colorectal cancer. The destruction complex is inhibited by Wnt-Frz and prostaglandin E2 (PGE2 - PI-3 kinase pathways. Recent reports show that PGE2-induced phosphorylation of β-catenin by protein kinase A (PKA increases nuclear translocation indicating two mechanisms of action of PGE2 on β-catenin homeostasis. Findings Treatment of ApcMin/+ mice that spontaneously develop intestinal adenomas with a PKA antagonist (Rp-8-Br-cAMPS selectively targeting only the latter pathway reduced tumor load, but not the number of adenomas. Immunohistochemical characterization of intestines from treated and control animals revealed that expression of β-catenin, β-catenin nuclear translocation and expression of the β-catenin target genes c-Myc and COX-2 were significantly down-regulated upon Rp-8-Br-cAMPS treatment. Parallel experiments in a human colon cancer cell line (HCT116 revealed that Rp-8-Br-cAMPS blocked PGE2-induced β-catenin phosphorylation and c-Myc upregulation. Conclusion Based on our findings we suggest that PGE2 act through PKA to promote β-catenin nuclear translocation and tumor development in ApcMin/+ mice in vivo, indicating that the direct regulatory effect of PKA on β-catenin nuclear translocation is operative in intestinal cancer.
DEFF Research Database (Denmark)
Roepstorff, Carsten; Schjerling, P.; Vistisen, Bodil
2005-01-01
AIM: To investigate gender-related differences in the responses of oxidative enzymes and eukaryotic elongation factor-2 (eEF2) to exercise. METHODS: The influence of exercise (90 min, 60%VO(2peak)) on citrate synthase (CS) and beta-hydroxyacyl-CoA dehydrogenase (HAD) activity and mRNA content...... expression and phosphorylation were unaffected by training status (NS). CONCLUSION: Basal transcriptional, translational, and/or post-translational control of CS and HAD seems to be gender-dependent. Also, gender differences in translation and/or post-translational protein modification of CS occur during...... not differ between females and males (NS). In females only, CS activity was enhanced (P differ between UT and ET but, nevertheless, CS activity was 56% higher in ET than in UT volunteers (P
Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina
2006-08-01
E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-07-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus.
The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)
2012-11-02
Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.
Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia
International Nuclear Information System (INIS)
El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.
2009-01-01
Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.
Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan
2016-03-10
Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
Jeyapalan, Asumthia S; Orellana, Renan A; Suryawan, Agus; O'Connor, Pamela M J; Nguyen, Hanh V; Escobar, Jeffery; Frank, Jason W; Davis, Teresa A
2007-08-01
Skeletal muscle protein synthesis is elevated in neonates in part due to an enhanced response to the rise in insulin and amino acids after eating. In vitro studies suggest that glucose plays a role in protein synthesis regulation. To determine whether glucose, independently of insulin and amino acids, is involved in the postprandial rise in skeletal muscle protein synthesis, pancreatic-substrate clamps were performed in neonatal pigs. Insulin secretion was inhibited with somatostatin and insulin was infused to reproduce fasting or fed levels, while glucose and amino acids were clamped at fasting or fed levels. Fractional protein synthesis rates and translational control mechanisms were examined. Raising glucose alone increased protein synthesis in fast-twitch glycolytic muscles but not in other tissues. The response in muscle was associated with increased phosphorylation of protein kinase B (PKB) and enhanced formation of the active eIF4E.eIF4G complex but no change in phosphorylation of AMP-activated protein kinase (AMPK), tuberous sclerosis complex 2 (TSC2), mammalian target of rapamycin (mTOR), 4E-binding protein-1 (4E-BP1), ribosomal protein S6 kinase (S6K1), or eukaryotic elongation factor 2 (eEF2). Raising glucose, insulin, and amino acids increased protein synthesis in most tissues. The response in muscle was associated with phosphorylation of PKB, mTOR, S6K1, and 4E-BP1 and enhanced eIF4E.eIF4G formation. The results suggest that the postprandial rise in glucose, independently of insulin and amino acids, stimulates protein synthesis in neonates, and this response is specific to fast-twitch glycolytic muscle and occurs by AMPK- and mTOR-independent pathways.
Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance
Directory of Open Access Journals (Sweden)
Xiaofei Jiang
2017-05-01
Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.
Energy Technology Data Exchange (ETDEWEB)
Venkitachalam, Srividya; Chueh, Fu-Yu [Department of Microbiology and Immunology, H. M. Bligh Cancer Research Laboratories, Chicago Medical School, Rosalind Franklin University of Medicine and Science, North Chicago, IL 60064 (United States); Yu, Chao-Lan, E-mail: chaolan.yu@rosalindfranklin.edu [Department of Microbiology and Immunology, H. M. Bligh Cancer Research Laboratories, Chicago Medical School, Rosalind Franklin University of Medicine and Science, North Chicago, IL 60064 (United States)
2012-01-20
Highlights: Black-Right-Pointing-Pointer Lmo2 expression is elevated in Lck-transformed cells. Black-Right-Pointing-Pointer Both endogenous and exogenous Lck localize in the nucleus. Black-Right-Pointing-Pointer Nuclear Lck is active in Lck-transformed cells. Black-Right-Pointing-Pointer Lck binds to the promoter region of Lmo2 gene in vivo. Black-Right-Pointing-Pointer In contrast to JAK2, Lck does not increase histone H3 phosphorylation on Tyr 41. -- Abstract: LIM domain only protein 2 (Lmo2) is a transcription factor that plays a critical role in the development of T-acute lymphoblastic leukemia (T-ALL). A previous report established a link between Lmo2 expression and the nuclear presence of oncogenic Janus kinase 2 (JAK2), a non-receptor protein tyrosine kinase. The oncogenic JAK2 kinase phosphorylates histone H3 on Tyr 41 that leads to the relief of Lmo2 promoter repression and subsequent gene expression. Similar to JAK2, constitutive activation of lymphocyte-specific protein tyrosine kinase (Lck) has been implicated in lymphoid malignancies. However, it is not known whether oncogenic Lck regulates Lmo2 expression through a similar mechanism. We show here that Lmo2 expression is significantly elevated in T cell leukemia LSTRA overexpressing active Lck kinase and in HEK 293 cells expressing oncogenic Y505FLck kinase. Nuclear localization of active Lck kinase was confirmed in both Lck-transformed cells by subcellular fractionation and immunofluorescence microscopy. More importantly, in contrast to oncogenic JAK2, oncogenic Lck kinase does not result in significant increase in histone H3 phosphorylation on Tyr 41. Instead, chromatin immunoprecipitation experiment shows that oncogenic Y505FLck kinase binds to the Lmo2 promoter in vivo. This result raises the possibility that oncogenic Lck may activate Lmo2 promoter through direct interaction.
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Directory of Open Access Journals (Sweden)
Luisina De Tullio
2017-10-01
Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.
Koike, Eiko; Yanagisawa, Rie; Takigami, Hidetaka; Takano, Hirohisa
2014-03-01
Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in consumer products. Humans can be exposed to PBDEs mainly through the inhalation of air or dust. Thus, PBDEs can affect respiratory and immune systems. In the present study, we investigated whether PBDEs stimulate bronchial epithelial cells. We examined commercial penta-BDE (DE-71), octa-BDE (DE-79), and deca-BDE (DE-83R). Human bronchial epithelial cells (BEAS-2B) were exposed to each PBDE for 24h. Subsequently, the expression of intercellular adhesion molecule-1 (ICAM-1) and proinflammatory cytokines were investigated. DE-71 and DE-79, but not DE-83R, significantly increased the expression of ICAM-1, interleukin-6 (IL-6), and IL-8 in BEAS-2B. Because these remarkable effects were observed with DE-71, we further investigated the underlying intracellular mechanisms. DE-71 promoted epidermal growth factor receptor (EGFR) phosphorylation. Inhibitors of EGFR-selective tyrosine kinase and p38 mitogen-activated protein kinase effectively blocked the increase of IL-6 and IL-8. Furthermore, antagonists of thyroid hormone receptor and aryl hydrocarbon receptor significantly suppressed the increase in IL-6 and/or IL-8 production. In conclusion, penta- and octa-BDE, but not deca-BDE, might promote the expression of proinflammatory proteins in bronchial epithelial cells possibly by activating protein kinases and/or stimulating nuclear receptors related to subsequent activation of transcriptional factors. Copyright © 2013 Elsevier Ltd. All rights reserved.
Performance of large electron energy filter in large volume plasma device
International Nuclear Information System (INIS)
Singh, S. K.; Srivastava, P. K.; Awasthi, L. M.; Mattoo, S. K.; Sanyasi, A. K.; Kaw, P. K.; Singh, R.
2014-01-01
This paper describes an in-house designed large Electron Energy Filter (EEF) utilized in the Large Volume Plasma Device (LVPD) [S. K. Mattoo, V. P. Anita, L. M. Awasthi, and G. Ravi, Rev. Sci. Instrum. 72, 3864 (2001)] to secure objectives of (a) removing the presence of remnant primary ionizing energetic electrons and the non-thermal electrons, (b) introducing a radial gradient in plasma electron temperature without greatly affecting the radial profile of plasma density, and (c) providing a control on the scale length of gradient in electron temperature. A set of 19 independent coils of EEF make a variable aspect ratio, rectangular solenoid producing a magnetic field (B x ) of 100 G along its axis and transverse to the ambient axial field (B z ∼ 6.2 G) of LVPD, when all its coils are used. Outside the EEF, magnetic field reduces rapidly to 1 G at a distance of 20 cm from the center of the solenoid on either side of target and source plasma. The EEF divides LVPD plasma into three distinct regions of source, EEF and target plasma. We report that the target plasma (n e ∼ 2 × 10 11 cm −3 and T e ∼ 2 eV) has no detectable energetic electrons and the radial gradients in its electron temperature can be established with scale length between 50 and 600 cm by controlling EEF magnetic field. Our observations reveal that the role of the EEF magnetic field is manifested by the energy dependence of transverse electron transport and enhanced transport caused by the plasma turbulence in the EEF plasma
The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex
International Nuclear Information System (INIS)
Nakagawa, Koji; Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie; Asaka, Masahiro; Takeda, Hiroshi; Kobayashi, Masanobu
2012-01-01
Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.
DEFF Research Database (Denmark)
Peng, Nan; Deng, Ling; Mei, Yuxia
2012-01-01
Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...
Directory of Open Access Journals (Sweden)
Chanjuan Li
2016-08-01
Full Text Available Background/Aims: Forkhead Box Protein C2 (FOXC2 has been reported to be overexpressed in a variety of human cancers. However, it is unclear whether FOXC2 regulates epithelial-mesenchymal transition (EMT in CDDP-resistant ovarian cancer cells. The aim of this study is to investigate the effects of FOXC2 on EMT and invasive characteristics of CDDP-resistant ovarian cancer cells and the underlying molecular mechanism. Methods: MTT, Western blot, scratch wound healing, matrigel transwell invasion, attachment and detachment assays were performed to detect half maximal inhibitory concentration (IC50 of CDDP, expression of EMT-related proteins and invasive characteristics in CDDP-resistant ovarian cancer cell line (SKOV3/CDDP and its parental cell line (SKOV3. Small hairpin RNA (shRNA was used to knockdown FOXC2 and analyze the effect of FOXC2 knockdown on EMT and invasive characteristics of SKOV3/CDDP cells. Also, the effect of FOXC2 upregulation on EMT and invasive characteristics of SKOV3 cells was analyzed. Furthermore, the molecular mechanism underlying FOXC2-regulating EMT in ovarian cancer cells was determined. Results: Compared with parental SKOV3 cell line, SKOV3/CDDP showed higher IC50 of CDDP (43.26μM (PConclusions: Taken together, these data demonstrate that FOXC2 may be a promoter of EMT phenotype in CDDP-resistant ovarian cancer cells and a potential therapeutic target for the treatment of advanced ovarian cancer.
Directory of Open Access Journals (Sweden)
Éva Korpos
2015-01-01
Full Text Available The extracellular matrix (ECM performs essential functions in the differentiation, maintenance and remodeling of tissues during development and regeneration, and it undergoes dynamic changes during remodeling concomitant to alterations in the cell-ECM interactions. Here we discuss recent data addressing the critical role of the widely expressed ECM protein, matrilin-2 (Matn2 in the timely onset of differentiation and regeneration processes in myogenic, neural and other tissues and in tumorigenesis. As a multiadhesion adaptor protein, it interacts with other ECM proteins and integrins. Matn2 promotes neurite outgrowth, Schwann cell migration, neuromuscular junction formation, skeletal muscle and liver regeneration and skin wound healing. Matn2 deposition by myoblasts is crucial for the timely induction of the global switch toward terminal myogenic differentiation during muscle regeneration by affecting transforming growth factor beta/bone morphogenetic protein 7/Smad and other signal transduction pathways. Depending on the type of tissue and the pathomechanism, Matn2 can also promote or suppress tumor growth.
Kao, Michelle; Columbus, Daniel A.; Suryawan, Agus; Steinhoff-Wagner, Julia; Hernandez-Garcia, Adriana; Nguyen, Hanh V.; Fiorotto, Marta L.
2016-01-01
Many low-birth weight infants are at risk for poor growth due to an inability to achieve adequate protein intake. Administration of the amino acid leucine stimulates protein synthesis in skeletal muscle of neonates. To determine the effects of enteral supplementation of the leucine metabolite β-hydroxy-β-methylbutyrate (HMB) on protein synthesis and the regulation of translation initiation and degradation pathways, overnight-fasted neonatal pigs were studied immediately (F) or fed one of five diets for 24 h: low-protein (LP), high-protein (HP), or LP diet supplemented with 4 (HMB4), 40 (HMB40), or 80 (HMB80) μmol HMB·kg body wt−1·day−1. Cell replication was assessed from nuclear incorporation of BrdU in the longissimus dorsi (LD) muscle and jejunum crypt cells. Protein synthesis rates in LD, gastrocnemius, rhomboideus, and diaphragm muscles, lung, and brain were greater in HMB80 and HP and in brain were greater in HMB40 compared with LP and F groups. Formation of the eIF4E·eIF4G complex and S6K1 and 4E-BP1 phosphorylation in LD, gastrocnemius, and rhomboideus muscles were greater in HMB80 and HP than in LP and F groups. Phosphorylation of eIF2α and eEF2 and expression of SNAT2, LAT1, MuRF1, atrogin-1, and LC3-II were unchanged. Numbers of BrdU-positive myonuclei in the LD were greater in HMB80 and HP than in the LP and F groups; there were no differences in jejunum. The results suggest that enteral supplementation with HMB increases skeletal muscle protein anabolism in neonates by stimulation of protein synthesis and satellite cell proliferation. PMID:27143558
Peng, Tao; Zhou, Wei; Guo, Feng; Wu, He-shui; Wang, Chun-you; Wang, Li; Yang, Zhi-yong
2017-01-01
Centrosomal protein 55 (CEP55) is a microtubule-bundling protein that participants in cell mitosis. It is overexpressed in several solid tumours and promotes the growth and invasion of cancer cells. However, the role of CEP55 in pancreatic cancer (PANC) remains unclear. Herein, upregulated expression of CEP55 (associated with poor prognosis) was detected in PANC using quantitative real-time reverse transcription PCR, western blotting, and immunohistochemistry. Cell migration, colony formation...
Wang, Jianjun; Luo, Jiansong; Aryal, Dipendra K; Wetsel, William C; Nass, Richard; Benovic, Jeffrey L
2017-04-07
G protein-coupled receptors (GPCRs) regulate many animal behaviors. GPCR signaling is mediated by agonist-promoted interactions of GPCRs with heterotrimeric G proteins, GPCR kinases (GRKs), and arrestins. To further elucidate the role of GRKs in regulating GPCR-mediated behaviors, we utilized the genetic model system Caenorhabditis elegans Our studies demonstrate that grk-2 loss-of-function strains are egg laying-defective and contain low levels of serotonin (5-HT) and high levels of the 5-HT metabolite 5-hydroxyindole acetic acid (5-HIAA). The egg laying defect could be rescued by the expression of wild type but not by catalytically inactive grk-2 or by the selective expression of grk-2 in hermaphrodite-specific neurons. The addition of 5-HT or inhibition of 5-HT metabolism also rescued the egg laying defect. Furthermore, we demonstrate that AMX-2 is the primary monoamine oxidase that metabolizes 5-HT in C. elegans , and we also found that grk-2 loss-of-function strains have abnormally high levels of AMX-2 compared with wild-type nematodes. Interestingly, GRK-2 was also found to interact with and promote the phosphorylation of AMX-2. Additional studies reveal that 5-HIAA functions to inhibit egg laying in a manner dependent on the 5-HT receptor SER-1 and the G protein GOA-1. These results demonstrate that GRK-2 modulates 5-HT metabolism by regulating AMX-2 function and that 5-HIAA may function in the SER-1 signaling pathway. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Xu, Qian; Chai, Shou-jie; Qian, Ying-ying; Zhang, Min; Wang, Kai
2012-12-01
To determine the roles of breast regression protein-39 (BRP-39) in regulating dendritic cell maturation and in pathology of acute asthma. Mouse bone marrow-derived dendritic cells (BMDCs) were prepared, and infected with adenovirus over-expressing BRP-39. Ovalbumin (OVA)-induced murine model of acute asthma was made in female BALB/c mice by sensitizing and challenging with chicken OVA and Imject Alum. The transfected BMDCs were adoptively transferred into OVA-treated mice via intravenous injection. Airway hyperresponsiveness (AHR), inflammation and pulmonary histopathology were characterized. The expression of BRP-39 mRNA and protein was significantly increased in lung tissues of OVA-treated mice. The BMDCs infected with adenovirus BRP-39 exhibited greater maturation and higher activity in vitro. Adoptive transfer of the cells into OVA-treated mice significantly augmented OVA-induced AHR and eosinophilic inflammation. Meanwhile, BRP-39 further enhanced the production of OVA-induced Th2 cytokines IL-4, IL-5 and IL-13, but significantly attenuated OVA-induced IFN-γ production in bronchoalveolar lavage fluid. In OVA-induced murine model of acute asthma, BRP-39 is over-expressed in lung tissue and augments Th2 inflammatory response and AHR. BRP-39 promotes dendritic cell maturation in vitro. Therefore, BRP-39 may be a potential therapeutic target of asthma.
p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.
Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo
2005-04-10
The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Kim, Jinku; Hollinger, Jeffrey O
2012-01-01
The purposes of this study were to determine the pharmacokinetics of recombinant human bone morphogenetic protein-2 (rhBMP-2) from a polyurethane (PUR)-based porous scaffold and to determine the biological responses of human mesenchymal stem cells (hMSCs) to the rhBMP-2 released from those scaffolds. The rhBMP-2 was incorporated into the PUR three-dimensional (3D) porous scaffolds and release profiles were determined using enzyme-linked immunosorbent assay. The bioactivity of the rhBMP-2 containing releasates was determined using hMSCs and compared with exogenous rhBMP-2. Release of rhBMP-2 from PUR-based systems was bi-phasic and characterized by an initial burst followed by a sustained release for up to 21 days. Expression of alkaline phosphatase activity by hMSCs treated with the rhBMP-2 releasates was significantly greater than the cells alone (control) throughout the time periods. Furthermore, after 14 days of culture, the hMSCs cultured with rhBMP-2 releasate had a greater amount of mineralization compared to exogenous rhBMP-2. Overall, the rhBMP-2 release from the PUR-based scaffolds was sustained for 21 days and the releasates appeared to be bioactive and promoted earlier osteogenic differentiation and mineralization of hMSCs than the exogenous rhBMP-2. (paper)
SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK
Energy Technology Data Exchange (ETDEWEB)
Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States
2017-10-24
The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.
Energy Technology Data Exchange (ETDEWEB)
Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)
2015-08-21
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and
The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.
Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique
2014-06-01
Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Juhásová, Barbora; Mentel, Marek; Bhatia-Kiššová, Ingrid; Zeman, Igor; Kolarov, Jordan; Forte, Michael; Polčic, Peter
2011-09-02
Proteins of the Bcl-2 family regulate programmed cell death in mammals by promoting the release of cytochrome c from mitochondria in response to various proapoptotic stimuli. The mechanism by which BH3-only members of the family activate multidomain proapoptotic proteins Bax and Bak to form a pore in mitochondrial membranes remains under dispute. We report that cell death promoting activity of BH3-only protein Bim can be reconstituted in yeast when both Bax and antiapoptotic protein Bcl-X(L) are present, suggesting that Bim likely activates Bax indirectly by inhibiting antiapoptotic proteins. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Hjelm, Anna; Karyolaimos, Alexandros; Zhang, Zhe; Rujas, Edurne; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
Membrane and secretory protein production in Escherichia coli requires precisely controlled production rates to avoid the deleterious saturation of their biogenesis pathways. Based on this requirement, the E. coli L-rhamnose PBAD promoter (PrhaBAD) is often used for membrane and secretory protein
Cross-talk between amyloidogenic proteins in type-2 diabetes and Parkinson’s disease
Horvath, Istvan; Wittung-Stafshede, Pernilla
2016-01-01
Protein assembly into ordered so-called amyloid fibers is a process that promotes several neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). Also type-2 diabetes (T2D) is a disease involving amyloid formation, although it occurs in the pancreas. Since the protein that forms amyloids in PD, α-synuclein (aS), is also expressed in the pancreas, we investigated whether it could affect aggregation of the peptide involved in T2D, and vice versa. Using in vitro methods an...
van Erpecum, K. J.; Portincasa, P.; Eckhardt, E.; Go, P. M.; vanBerge-Henegouwen, G. P.; Groen, A. K.
1996-01-01
Background & Aims: Ursodeoxycholic acid prevents gallstone formation in selected patients. The aim of this study was to examine whether decreased concentration and nucleation-promoting activity of various proteins contribute to this beneficial effect. Methods: Gallbladder bile of 13 patients with
International Nuclear Information System (INIS)
Qadri, Ishtiaq; Hu, L.-J.; Iwahashi, Mieko; Al-Zuabi, Subhi; Quattrochi, Linda C.; Simon, Francis R.
2009-01-01
Multidrug resistance-associated protein 2 (MRP2) (ABCC2) is an ATP-binding cassette membrane protein located primarily on apical surface of hepatocytes that mediates transport of conjugated xenobiotics and endogenous compounds into bile. MRP2 is highly expressed in hepatocytes, and at lower levels in small intestines, stomach and kidney. Previous reports have characterized mammalian MRP2 promoters, but none have established the molecular mechanism(s) involved in liver enriched expression. This study aims to investigate the mechanism of hepatic MRP2 regulation. A 2130 bp of MRP2 promoter was cloned from PAC-1 clone P108G1-7, to identify putative liver specific/hormone responsive functional DNA binding sites. Using deletion analysis, site specific mutagenesis and co-transfection studies, liver specific expression was determined. MRP2 promoter-LUC constructs were highly expressed in liver cell lines compared to non-liver cells. The region extending from - 3 to+ 458 bp of MRP2 promoter starting from AUG contained the potential binding sites for CAAATT box enhancer binding protein (C/EBP), hepatocytes nuclear factor 1, 3 and 4 (HNF1, HNF3, and HNF4. Only HNF1 and HNF4 co-transfection with MRP2 luciferase increased expression. Site specific mutational analysis of HNF1 binding site indicated an important role for HNF1α. HNF4α induction of MRP2 was independent of HNF1 binding site. C/EBP, HNF3, and HNF6 inhibited HNF1α while HNF4α induced MRP2 luciferase expression and glucocorticoids stimulated MRP2 expression. This study emphasizes the complex regulation of MRP2 with HNF1α and HNF4α playing a central role. The coordinated regulation of xenobiotic transporters and oxidative conjugation may determine the adaptive responses to cellular detoxification processes
Reddien, Peter W; Andersen, Erik C; Huang, Michael C; Horvitz, H Robert
2007-04-01
The genes egl-1, ced-9, ced-4, and ced-3 play major roles in programmed cell death in Caenorhabditis elegans. To identify genes that have more subtle activities, we sought mutations that confer strong cell-death defects in a genetically sensitized mutant background. Specifically, we screened for mutations that enhance the cell-death defects caused by a partial loss-of-function allele of the ced-3 caspase gene. We identified mutations in two genes not previously known to affect cell death, dpl-1 and mcd-1 (modifier of cell death). dpl-1 encodes the C. elegans homolog of DP, the human E2F-heterodimerization partner. By testing genes known to interact with dpl-1, we identified roles in cell death for four additional genes: efl-1 E2F, lin-35 Rb, lin-37 Mip40, and lin-52 dLin52. mcd-1 encodes a novel protein that contains one zinc finger and that is synthetically required with lin-35 Rb for animal viability. dpl-1 and mcd-1 act with efl-1 E2F and lin-35 Rb to promote programmed cell death and do so by regulating the killing process rather than by affecting the decision between survival and death. We propose that the DPL-1 DP, MCD-1 zinc finger, EFL-1 E2F, LIN-35 Rb, LIN-37 Mip40, and LIN-52 dLin52 proteins act together in transcriptional regulation to promote programmed cell death.
International Nuclear Information System (INIS)
Yamane, Takumi; Kobayashi-Hattori, Kazuo; Oishi, Yuichi
2011-01-01
Highlights: ► Adiponectin promotes hyaluronan synthesis along with an increase in HAS2 transcripts. ► Adiponectin also increases the phosphorylation of AMPK. ► A pharmacological activator of AMPK increases mRNA levels of PPARα and HAS2. ► Adiponectin-induced HAS2 mRNA expression is blocked by a PPARα antagonist. ► Adiponectin promotes hyaluronan synthesis via an AMPK/PPARα-dependent pathway. -- Abstract: Although adipocytokines affect the functions of skin, little information is available on the effect of adiponectin on the skin. In this study, we investigated the effect of adiponectin on hyaluronan synthesis and its regulatory mechanisms in human dermal fibroblasts. Adiponectin promoted hyaluronan synthesis along with an increase in the mRNA levels of hyaluronan synthase 2 (HAS2), which plays a primary role in hyaluronan synthesis. Adiponectin also increased the phosphorylation of AMP-activated protein kinase (AMPK). A pharmacological activator of AMPK, 5-aminoimidazole-4-carboxamide-1β-ribofuranoside (AICAR), increased mRNA levels of peroxisome proliferator-activated receptor-α (PPARα), which enhances the expression of HAS2 mRNA. In addition, AICAR increased the mRNA levels of HAS2. Adiponectin-induced HAS2 mRNA expression was blocked by GW6471, a PPARα antagonist, in a concentration-dependent manner. These results show that adiponectin promotes hyaluronan synthesis along with increases in HAS2 transcripts through an AMPK/PPARα-dependent pathway in human dermal fibroblasts. Thus, our study suggests that adiponectin may be beneficial for retaining moisture in the skin, anti-inflammatory activity, and the treatment of a variety of cutaneous diseases.
Directory of Open Access Journals (Sweden)
Kiran Sree Pokkuluri
2014-01-01
Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.
Directory of Open Access Journals (Sweden)
Vidya P Nair
2016-04-01
Full Text Available Hepatitis E virus (HEV causes acute hepatitis in many parts of the world including Asia, Africa and Latin America. Though self-limiting in normal individuals, it results in ~30% mortality in infected pregnant women. It has also been reported to cause acute and chronic hepatitis in organ transplant patients. Of the seven viral genotypes, genotype-1 virus infects humans and is a major public health concern in South Asian countries. Sporadic cases of genotype-3 and 4 infection in human and animals such as pigs, deer, mongeese have been reported primarily from industrialized countries. Genotype-5, 6 and 7 viruses are known to infect animals such as wild boar and camel, respectively. Genotype-3 and 4 viruses have been successfully propagated in the laboratory in mammalian cell culture. However, genotype-1 virus replicates poorly in mammalian cell culture and no other efficient model exists to study its life cycle. Here, we report that endoplasmic reticulum (ER stress promotes genotype-1 HEV replication by inducing cap-independent, internal initiation mediated translation of a novel viral protein (named ORF4. Importantly, ORF4 expression and stimulatory effect of ER stress inducers on viral replication is specific to genotype-1. ORF4 protein sequence is mostly conserved among genotype-1 HEV isolates and ORF4 specific antibodies were detected in genotype-1 HEV patient serum. ORF4 interacted with multiple viral and host proteins and assembled a protein complex consisting of viral helicase, RNA dependent RNA polymerase (RdRp, X, host eEF1α1 (eukaryotic elongation factor 1 isoform-1 and tubulinβ. In association with eEF1α1, ORF4 stimulated viral RdRp activity. Furthermore, human hepatoma cells that stably express ORF4 or engineered proteasome resistant ORF4 mutant genome permitted enhanced viral replication. These findings reveal a positive role of ER stress in promoting genotype-1 HEV replication and pave the way towards development of an efficient
The LIM-only protein FHL2 attenuates lung inflammation during bleomycin-induced fibrosis.
Directory of Open Access Journals (Sweden)
Abdulaleem Alnajar
Full Text Available Fibrogenesis is usually initiated when regenerative processes have failed and/or chronic inflammation occurs. It is characterised by the activation of tissue fibroblasts and dysregulated synthesis of extracellular matrix proteins. FHL2 (four-and-a-half LIM domain protein 2 is a scaffolding protein that interacts with numerous cellular proteins, regulating signalling cascades and gene transcription. It is involved in tissue remodelling and tumour progression. Recent data suggest that FHL2 might support fibrogenesis by maintaining the transcriptional expression of alpha smooth muscle actin and the excessive synthesis and assembly of matrix proteins in activated fibroblasts. Here, we present evidence that FHL2 does not promote bleomycin-induced lung fibrosis, but rather suppresses this process by attenuating lung inflammation. Loss of FHL2 results in increased expression of the pro-inflammatory matrix protein tenascin C and downregulation of the macrophage activating C-type lectin receptor DC-SIGN. Consequently, FHL2 knockout mice developed a severe and long-lasting lung pathology following bleomycin administration due to enhanced expression of tenascin C and impaired activation of inflammation-resolving macrophages.
G1/S-regulated E2F-containing protein complexes bind to the mouse thymidine kinase gene promoter
DEFF Research Database (Denmark)
Dou, Q P; Zhao, S; Levin, A H
1994-01-01
report that MT2 includes an E2F-like binding site (GTTCGCGGGCAAA), as shown by the following evidence. (i) MT2 bound specifically to an affinity-purified fusion human E2F protein. (ii) Both MT2 and an authentic E2F site (TTTCGCGCGCTTT) bound specifically to similar or identical nuclear protein complexes...... complexes were also investigated. Studies using specific antibodies revealed that p107, a retinoblastoma-like protein, was present in both E2F-G0/G1 and E2F.S, whereas cyclin E.cyclin A.cdk2 were only present in E2F.S complex(es). These data suggest that removal of the p107-containing E2F.G0/G1 complex...
LENUS (Irish Health Repository)
Jablensky, A
2011-10-04
In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.
De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C
2017-10-17
Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
NSA2, a novel nucleolus protein regulates cell proliferation and cell cycle
International Nuclear Information System (INIS)
Zhang, Heyu; Ma, Xi; Shi, Taiping; Song, Quansheng; Zhao, Hongshan; Ma, Dalong
2010-01-01
NSA2 (Nop seven-associated 2) was previously identified in a high throughput screen of novel human genes associated with cell proliferation, and the NSA2 protein is evolutionarily conserved across different species. In this study, we revealed that NSA2 is broadly expressed in human tissues and cultured cell lines, and located in the nucleolus of the cell. Both of the putative nuclear localization signals (NLSs) of NSA2, also overlapped with nucleolar localization signals (NoLSs), are capable of directing nucleolar accumulation. Moreover, over-expression of the NSA2 protein promoted cell growth in different cell lines and regulated the G1/S transition in the cell cycle. SiRNA silencing of the NSA2 transcript attenuated the cell growth and dramatically blocked the cell cycle in G1/S transition. Our results demonstrated that NSA2 is a nucleolar protein involved in cell proliferation and cell cycle regulation.
The miR-599 promotes non-small cell lung cancer cell invasion via SATB2
International Nuclear Information System (INIS)
Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran
2017-01-01
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
Directory of Open Access Journals (Sweden)
Weixiang Guo
2015-06-01
Full Text Available Fragile X mental retardation protein (FMRP and its autosomal paralog FXR2P are selective neuronal RNA-binding proteins, and mice that lack either protein exhibit cognitive deficits. Although double-mutant mice display more severe learning deficits than single mutants, the molecular mechanism behind this remains unknown. In the present study, we discovered that FXR2P (also known as FXR2 is important for neuronal dendritic development. FMRP and FXR2P additively promote the maturation of new neurons by regulating a common target, the AMPA receptor GluA1, but they do so via distinct mechanisms: FXR2P binds and stabilizes GluA1 mRNA and enhances subsequent protein expression, whereas FMRP promotes GluA1 membrane delivery. Our findings unveil important roles for FXR2P and GluA1 in neuronal development, uncover a regulatory mechanism of GluA1, and reveal a functional convergence between fragile X proteins in neuronal development.
TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding
Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John?H.J.; Boulton, Simon?J.
2015-01-01
Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to?prevent catastrophic t-loop processing by structure-specific nucleases. We show that ...
Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.
Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke
2014-12-01
Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.
The LIKE system, a novel protein expression toolbox for Bacillus subtilis based on the liaI promoter
2012-01-01
Background Bacillus subtilis is a very important Gram-positive model organism of high biotechnological relevance, which is widely used as a host for the production of both secreted and cytoplasmic proteins. We developed a novel and efficient expression system, based on the liaI promoter (PliaI) from B. subtilis, which is under control of the LiaRS antibiotic-inducible two-component system. In the absence of a stimulus, this promoter is kept tightly inactive. Upon induction by cell wall antibiotics, it shows an over 100-fold increase in activity within 10 min. Results Based on these traits of PliaI, we developed a novel LiaRS-controlled gene expression system for B. subtilis (the “LIKE" system). Two expression vectors, the integrative pLIKE-int and the replicative pLIKE-rep, were constructed. To enhance the performance of the PliaI-derived system, site-directed mutagenesis was employed to optimize the ribosome binding site and alter its spacing to the initiation codon used for the translational fusion. The impact of these genetic modifications on protein production yield was measured using GFP as a model protein. Moreover, a number of tailored B. subtilis expression strains containing different markerless chromosomal deletions of the liaIH region were constructed to circumvent undesired protein production, enhance the positive autoregulation of the LiaRS system and thereby increase target gene expression strength from the PliaI promoter. Conclusions The LIKE protein expression system is a novel protein expression system, which offers a number of advantages over existing systems. Its major advantages are (i) a tightly switched-off promoter during exponential growth in the absence of a stimulus, (ii) a concentration-dependent activation of PliaI in the presence of suitable inducers, (iii) a very fast but transient response with a very high dynamic range of over 100-fold (up to 1,000-fold) induction, (iv) a choice from a range of well-defined, commercially available
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-01-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus. PMID:21543505
Directory of Open Access Journals (Sweden)
Rajesh S.
2008-10-01
Full Text Available Late embryogenesis abundant (LEA proteins are speculated to protect against water stress deficit in plants. An over expression system for mungbean late embryogenesis abundant protein, emv2 was constructed in a pET29a vector, designated pET-emv2 which is responsible for higher expression under the transcriptional/translational control of T7/lac promoter incorporated in the Escherichia coli BL21 (DE3.Induction protocol was optimized for pET recombinants harboring the target gene. Overexpressed EMV2 protein was purified to homogeneity and the protein profile monitored by SDS-PAGE.
Directory of Open Access Journals (Sweden)
Doerthe Kuester
2007-03-01
Full Text Available Esophageal Barrett's adenocarcinoma (BA develops through a multistage process, which is associated with the transcriptional silencing of tumor-suppressor genes by promoter CpG island hypermethylation. In this study, we explored the promoter hypermethylation and protein expression of proapoptotic deathassociated protein kinase (DAPK during the multistep Barrett's carcinogenesis cascade. Early BA and paired samples of premalignant lesions of 61 patients were analyzed by methylation-specific polymerase chain reaction and immunohistochemistry. For the association of clinicopathological markers and protein expression, an immunohistochemical tissue microarray analysis of 66 additional BAs of advanced tumor stages was performed. Hypermethylation of DAPK promoter was detected in 20% of normal mucosa, 50% of Barrett's metaplasia, 53% of dysplasia, and 60% of adenocarcinomas, and resulted in a marked decrease in DAPK protein expression (P < .01. The loss of DAPK protein was significantly associated with advanced depth of tumor invasion and advanced tumor stages (P < .001. Moreover, the severity of reflux esophagitis correlated significantly with the hypermethylation rate of the DAPK promoter (P < .003. Thus, we consider DAPK inactivation by promoter hypermethylation as an early event in Barrett's carcinogenesis and suggest that a decreased protein expression of DAPK likely plays a role in the development and progression of BA.
Control of autogenous activation of Herbaspirillum seropedicae nifA promoter by the IHF protein.
Wassem, Roseli; Pedrosa, Fábio O; Yates, Marshall G; Rego, Fabiane G M; Chubatsu, Leda S; Rigo, Liu U; Souza, Emanuel M
2002-07-02
Analysis of the expression of the Herbaspirillum seropedicae nifA promoter in Escherichia coli and Herbaspirillum seropedicae, showed that nifA expression is primarily dependent on NtrC but also required NifA for maximal expression under nitrogen-fixing conditions. Deletion of the IHF (integration host factor)-binding site produced a promoter with two-fold higher activity than the native promoter in the H. seropedicae wild-type strain but not in a nifA strain, indicating that IHF controls NifA auto-activation. IHF is apparently required to prevent overexpression of the NifA protein via auto-activation under nitrogen-fixing conditions in H. seropedicae.
Boiani, Mariana; Daniel, Cristina; Liu, Xueyuan; Hogarty, Michael D; Marnett, Lawrence J
2013-03-08
Members of the Bcl-2 family of proteins are important inhibitors of apoptosis in human cancer and are targets for novel anticancer agents such as the Bcl-2 antagonists, ABT-263 (Navitoclax), and its analog ABT-737. Unlike Bcl-2, Mcl-1 is not antagonized by ABT-263 or ABT-737 and is considered to be a major factor in resistance. Also, Mcl-1 exhibits differential regulation when compared with other Bcl-2 family members and is a target for anticancer drug discovery. Here, we demonstrate that BAG3, an Hsp70 co-chaperone, protects Mcl-1 from proteasomal degradation, thereby promoting its antiapoptotic activity. Using neuroblastoma cell lines, with a defined Bcl-2 family dependence, we found that BAG3 expression correlated with Mcl-1 dependence and ABT-737 resistance. RNA silencing of BAG3 led to a marked reduction in Mcl-1 protein levels and overcame ABT-737 resistance in Mcl-1-dependent cells. In ABT-737-resistant cells, Mcl-1 co-immunoprecipitated with BAG3, and loss of Mcl-1 after BAG3 silencing was prevented by proteasome inhibition. BAG3 and Mcl-1 were co-expressed in a panel of diverse cancer cell lines resistant to ABT-737. Silencing BAG3 reduced Mcl-1 protein levels and overcame ABT-737 resistance in several of the cell lines, including triple-negative breast cancer (MDA-MB231) and androgen receptor-negative prostate cancer (PC3) cells. These studies identify BAG3-mediated Mcl-1 stabilization as a potential target for cancer drug discovery.
Boiani, Mariana; Daniel, Cristina; Liu, Xueyuan; Hogarty, Michael D.; Marnett, Lawrence J.
2013-01-01
Members of the Bcl-2 family of proteins are important inhibitors of apoptosis in human cancer and are targets for novel anticancer agents such as the Bcl-2 antagonists, ABT-263 (Navitoclax), and its analog ABT-737. Unlike Bcl-2, Mcl-1 is not antagonized by ABT-263 or ABT-737 and is considered to be a major factor in resistance. Also, Mcl-1 exhibits differential regulation when compared with other Bcl-2 family members and is a target for anticancer drug discovery. Here, we demonstrate that BAG3, an Hsp70 co-chaperone, protects Mcl-1 from proteasomal degradation, thereby promoting its antiapoptotic activity. Using neuroblastoma cell lines, with a defined Bcl-2 family dependence, we found that BAG3 expression correlated with Mcl-1 dependence and ABT-737 resistance. RNA silencing of BAG3 led to a marked reduction in Mcl-1 protein levels and overcame ABT-737 resistance in Mcl-1-dependent cells. In ABT-737-resistant cells, Mcl-1 co-immunoprecipitated with BAG3, and loss of Mcl-1 after BAG3 silencing was prevented by proteasome inhibition. BAG3 and Mcl-1 were co-expressed in a panel of diverse cancer cell lines resistant to ABT-737. Silencing BAG3 reduced Mcl-1 protein levels and overcame ABT-737 resistance in several of the cell lines, including triple-negative breast cancer (MDA-MB231) and androgen receptor-negative prostate cancer (PC3) cells. These studies identify BAG3-mediated Mcl-1 stabilization as a potential target for cancer drug discovery. PMID:23341456
An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.
Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B
2017-03-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.
McCarty, Mark F
2016-02-12
The serum total and LDL cholesterol levels of long-term vegans tend to be very low. The characteristically low ratio of saturated to unsaturated fat in vegan diets, and the absence of cholesterol in such diets, clearly contribute to this effect. But there is reason to suspect that the quantity and composition of dietary protein also play a role in this regard. Vegan diets of moderate protein intake tend to be relatively low in certain essential amino acids, and as a result may increase hepatic activity of the kinase GCN2, which functions as a gauge of amino acid status. GCN2 activation boosts the liver's production of fibroblast growth factor 21 (FGF21), a factor which favorably affects serum lipids and metabolic syndrome. The ability of FGF21 to decrease LDL cholesterol has now been traced to at least two mechanisms: a suppression of hepatocyte expression of sterol response element-binding protein-2 (SREBP-2), which in turn leads to a reduction in cholesterol synthesis; and up-regulated expression of hepatocyte LDL receptors, reflecting inhibition of a mechanism that promotes proteasomal degradation of these receptors. In mice, the vascular benefits of FGF21 are also mediated by favorable effects on adipocyte function - most notably, increased adipocyte secretion of adiponectin, which directly exerts anti-inflammatory effects on the vasculature which complement the concurrent reduction in LDL particles in preventing or reversing atherosclerosis. If, as has been proposed, plant proteins preferentially stimulate glucagon secretion owing to their amino acid composition, this would represent an additional mechanism whereby plant protein promotes FGF21 activity, as glucagon acts on the liver to boost transcription of the FGF21 gene.
Hoggett, J G; Brierley, I
1992-11-01
The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid.
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Vitamin K2 promotes mesenchymal stem cell differentiation by inhibiting miR‑133a expression.
Zhang, Yuelei; Weng, Shiyang; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, Youshui
2017-05-01
Vitamin K2 has been demonstrated to promote the osteogenic differentiation of mesenchymal stem cells; however, the mechanisms underlying this effect remain unclear. As microRNA (miR)‑133a has been identified as a negative regulator of osteogenic differentiation, the present study hypothesized that vitamin K2 promoted osteogenesis by inhibiting miR‑133a. Using human bone marrow stromal cells (hBMSCs) overexpressing miR‑133a, or a control, the expression levels of osteogenesis‑associated proteins, including runt‑related transcription factor 2, alkaline phosphatase and osteocalcin, were analyzed. miR‑133a significantly suppressed the osteogenic differentiation of hBMSCs. To determine the effect of vitamin K2 on miR‑133a expression and osteogenesis, hBMSCs were treated with vitamin K2. Vitamin K2 inhibited miR‑133a expression, which was accompanied by enhanced osteogenic differentiation. Furthermore, the expression levels of vitamin K epoxide reductase complex subunit 1, the key protein in γ‑carboxylation, were downregulated by miR‑133a overexpression and upregulated by vitamin K2 treatment, indicating a positive feedback on γ‑carboxylation. The results of the present study suggested that vitamin K2 targets miR‑133a to regulate osteogenesis.
Three Pseudomonas putida FNR Family Proteins with Different Sensitivities to O2.
Ibrahim, Susan A; Crack, Jason C; Rolfe, Matthew D; Borrero-de Acuña, José Manuel; Thomson, Andrew J; Le Brun, Nick E; Schobert, Max; Stapleton, Melanie R; Green, Jeffrey
2015-07-03
The Escherichia coli fumarate-nitrate reduction regulator (FNR) protein is the paradigm for bacterial O2-sensing transcription factors. However, unlike E. coli, some bacterial species possess multiple FNR proteins that presumably have evolved to fulfill distinct roles. Here, three FNR proteins (ANR, PP_3233, and PP_3287) from a single bacterial species, Pseudomonas putida KT2440, have been analyzed. Under anaerobic conditions, all three proteins had spectral properties resembling those of [4Fe-4S] proteins. The reactivity of the ANR [4Fe-4S] cluster with O2 was similar to that of E. coli FNR, and during conversion to the apo-protein, via a [2Fe-2S] intermediate, cluster sulfur was retained. Like ANR, reconstituted PP_3233 and PP_3287 were converted to [2Fe-2S] forms when exposed to O2, but their [4Fe-4S] clusters reacted more slowly. Transcription from an FNR-dependent promoter with a consensus FNR-binding site in P. putida and E. coli strains expressing only one FNR protein was consistent with the in vitro responses to O2. Taken together, the experimental results suggest that the local environments of the iron-sulfur clusters in the different P. putida FNR proteins influence their reactivity with O2, such that ANR resembles E. coli FNR and is highly responsive to low concentrations of O2, whereas PP_3233 and PP_3287 have evolved to be less sensitive to O2. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Wanitchang, Asawin; Wongthida, Phonphimon; Jongkaewwattana, Anan
2016-01-01
The M2 protein (AM2 and BM2) of influenza A and B viruses function as a proton channel essential for viral replication. They also carry a cytoplasmic tail whose functions are not fully delineated. It is currently unknown whether these proteins could be replaced functionally in a viral context. Here, we generated single-cycle influenza A viruses (scIAV-ΔHA) carrying various M2-2A-mCherry constructs in the segment 4 (HA) and evaluated their growth in complementing cells. Intriguingly, the scIAV-ΔHA carrying AM2 and that bearing BM2 grew comparably well in MDCK-HA cells. Furthermore, while the virus carrying chimeric B-AM2 in which the BM2 transmembrane fused with the AM2 cytoplasmic tail produced robust infection, the one bearing the AM2 transmembrane fused with the BM2 cytoplasmic tail (A-BM2) exhibited severely impaired growth. Altogether, we demonstrate that AM2 and BM2 are functionally interchangeable and underscore the role of compatibility between transmembrane and cytoplasmic tail of the M2 protein. -- Highlights: •Flu A M2 protein (AM2) can be functionally replaced by that of Flu B (BM2). •Both AM2 and BM2 with extended cytoplasmic tail are functional. •Compatibility between the ion channel and the cytoplasmic tail is critical for M2 function. •M2 with higher ion channel activity may augment influenza virus replication.
Energy Technology Data Exchange (ETDEWEB)
Wanitchang, Asawin; Wongthida, Phonphimon; Jongkaewwattana, Anan, E-mail: anan.jon@biotec.or.th
2016-11-15
The M2 protein (AM2 and BM2) of influenza A and B viruses function as a proton channel essential for viral replication. They also carry a cytoplasmic tail whose functions are not fully delineated. It is currently unknown whether these proteins could be replaced functionally in a viral context. Here, we generated single-cycle influenza A viruses (scIAV-ΔHA) carrying various M2-2A-mCherry constructs in the segment 4 (HA) and evaluated their growth in complementing cells. Intriguingly, the scIAV-ΔHA carrying AM2 and that bearing BM2 grew comparably well in MDCK-HA cells. Furthermore, while the virus carrying chimeric B-AM2 in which the BM2 transmembrane fused with the AM2 cytoplasmic tail produced robust infection, the one bearing the AM2 transmembrane fused with the BM2 cytoplasmic tail (A-BM2) exhibited severely impaired growth. Altogether, we demonstrate that AM2 and BM2 are functionally interchangeable and underscore the role of compatibility between transmembrane and cytoplasmic tail of the M2 protein. -- Highlights: •Flu A M2 protein (AM2) can be functionally replaced by that of Flu B (BM2). •Both AM2 and BM2 with extended cytoplasmic tail are functional. •Compatibility between the ion channel and the cytoplasmic tail is critical for M2 function. •M2 with higher ion channel activity may augment influenza virus replication.
NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function
International Nuclear Information System (INIS)
Zhao Guohua; Shi Lingfang; Qiu Daoming; Hu Hong; Kao, Peter N.
2005-01-01
NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthesy, J. Biol. Chem. 269 (1994) 20691-20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2
Directory of Open Access Journals (Sweden)
Bat-Erdene Jugder
2016-07-01
Full Text Available Hydrogenases are metalloenzymes that reversibly catalyse the oxidation or production of molecular hydrogen (H2. Amongst a number of promising candidates for application in the oxidation of H2 is a soluble [Ni–Fe] uptake hydrogenase (SH produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for functional SH synthesis, was investigated by developing a green fluorescent protein (GFP reporter system to characterise PSH promoter activity using several gene cloning approaches. A PSH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the PSH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator H16. The fusion construct allowed for the design of a simple screening assay to evaluate PSH activity. Furthermore, the constructed reporter system can serve as a model to develop a rapid fluorescent based reporter for subsequent small-scale process optimisation experiments for SH expression.
Montoya, Gonzalo; Arenas, Jesús; Romo, Enrique; Zeichner-David, Margarita; Alvarez, Marco; Narayanan, A Sampath; Velázquez, Ulises; Mercado, Gabriela; Arzate, Higinio
2014-12-01
Cementum extracellular matrix is similar to other mineralized tissues; however, this unique tissue contains molecules only present in cementum. A cDNA of these molecules, cementum attachment protein (hrPTPLa/CAP) was cloned and expressed in a prokaryotic system. This molecule is an alternative splicing of protein tyrosine phosphatase-like A (PTPLa). In this study, we wanted to determine the structural and functional characteristics of this protein. Our results indicate that hrPTPLa/CAP contains a 43.2% α-helix, 8.9% β-sheet, 2% β-turn and 45.9% random coil secondary structure. Dynamic light scattering shows that this molecule has a size distribution of 4.8 nm and aggregates as an estimated mass of 137 kDa species. AFM characterization and FE-SEM studies indicate that this protein self-assembles into nanospheres with sizes ranging from 7.0 to 27 nm in diameter. Functional studies demonstrate that hrPTPLa/CAP promotes hydroxyapatite crystal nucleation: EDS analysis revealed that hrPTPLa/CAP-induced crystals had a 1.59 ± 0.06 Ca/P ratio. Further confirmation with MicroRaman spectrometry and TEM confirm the presence of hydroxyapatite. In vivo studies using critical-size defects in rat cranium showed that hrPTPLa/CAP promoted 73% ± 2.19% and 87% ± 1.97% new bone formation at 4 and 8 weeks respectively. Although originally identified in cementum, PTPLa/CAP is very effective at inducing bone repair and healing and therefore this novel molecule has a great potential to be used for mineralized tissue bioengineering and tissue regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.
Fu, Ssu-Ju; Jeng, Chung-Jiuan; Ma, Chia-Hao; Peng, Yi-Jheng; Lee, Chi-Ming; Fang, Ya-Ching; Lee, Yi-Ching; Tang, Sung-Chun; Hu, Meng-Chun; Tang, Chih-Yung
2017-03-01
Voltage-gated Ca V 2.1 channels comprise a pore-forming α 1A subunit with auxiliary α 2 δ and β subunits. Ca V 2.1 channels play an essential role in regulating synaptic signaling. Mutations in the human gene encoding the Ca V 2.1 subunit are associated with the cerebellar disease episodic ataxia type 2 (EA2). Several EA2-causing mutants exhibit impaired protein stability and exert dominant-negative suppression of Ca V 2.1 wild-type (WT) protein expression via aberrant proteasomal degradation. Here, we set out to delineate the protein degradation mechanism of human Ca V 2.1 subunit by identifying RNF138, an E3 ubiquitin ligase, as a novel Ca V 2.1-binding partner. In neurons, RNF138 and Ca V 2.1 coexist in the same protein complex and display notable subcellular colocalization at presynaptic and postsynaptic regions. Overexpression of RNF138 promotes polyubiquitination and accelerates protein turnover of Ca V 2.1. Disrupting endogenous RNF138 function with a mutant (RNF138-H36E) or shRNA infection significantly upregulates the Ca V 2.1 protein level and enhances Ca V 2.1 protein stability. Disrupting endogenous RNF138 function also effectively rescues the defective protein expression of EA2 mutants, as well as fully reversing EA2 mutant-induced excessive proteasomal degradation of Ca V 2.1 WT subunits. RNF138-H36E coexpression only partially restores the dominant-negative effect of EA2 mutants on Ca V 2.1 WT functional expression, which can be attributed to defective membrane trafficking of Ca V 2.1 WT in the presence of EA2 mutants. We propose that RNF138 plays a critical role in the homeostatic regulation of Ca V 2.1 protein level and functional expression and that RNF138 serves as the primary E3 ubiquitin ligase promoting EA2-associated aberrant degradation of human Ca V 2.1 subunits. SIGNIFICANCE STATEMENT Loss-of-function mutations in the human Ca V 2.1 subunit are linked to episodic ataxia type 2 (EA2), a dominantly inherited disease characterized by
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Directory of Open Access Journals (Sweden)
Proud Christopher G
2002-05-01
Full Text Available Abstract Background Activation of human resting T lymphocytes results in an immediate increase in protein synthesis. The increase in protein synthesis after 16–24 h has been linked to the increased protein levels of translation initiation factors. However, the regulation of protein synthesis during the early onset of T cell activation has not been studied in great detail. We studied the regulation of protein synthesis after 1 h of activation using αCD3 antibody to stimulate the T cell receptor and αCD28 antibody to provide the co-stimulus. Results Activation of the T cells with both antibodies led to a sustained increase in the rate of protein synthesis. The activities and/or phosphorylation states of several translation factors were studied during the first hour of stimulation with αCD3 and αCD28 to explore the mechanism underlying the activation of protein synthesis. The initial increase in protein synthesis was accompanied by activation of the guanine nucleotide exchange factor, eukaryotic initiation factor (eIF 2B, and of p70 S6 kinase and by dephosphorylation of eukaryotic elongation factor (eEF 2. Similar signal transduction pathways, as assessed using signal transduction inhibitors, are involved in the regulation of protein synthesis, eIF2B activity and p70 S6 kinase activity. A new finding was that the p38 MAPK α/β pathway was involved in the regulation of overall protein synthesis in primary T cells. Unexpectedly, no changes were detected in the phosphorylation state of the cap-binding protein eIF4E and the eIF4E-binding protein 4E-BP1, or the formation of the cap-binding complex eIF4F. Conclusions Both eIF2B and p70 S6 kinase play important roles in the regulation of protein synthesis during the early onset of T cell activation.
Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping
2014-06-10
The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.
ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion
Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.
2016-01-01
Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041
Gonyo, P; Bergom, C; Brandt, A C; Tsaih, S-W; Sun, Y; Bigley, T M; Lorimer, E L; Terhune, S S; Rui, H; Flister, M J; Long, R M; Williams, C L
2017-12-14
The chaperone protein and guanine nucleotide exchange factor SmgGDS (RAP1GDS1) is a key promoter of cancer cell proliferation and tumorigenesis. SmgGDS undergoes nucleocytoplasmic shuttling, suggesting that it has both cytoplasmic and nuclear functions that promote cancer. Previous studies indicate that SmgGDS binds cytoplasmic small GTPases and promotes their trafficking to the plasma membrane. In contrast, little is known about the functions of SmgGDS in the nucleus, or how these nuclear functions might benefit cancer cells. Here we show unique nuclear localization and regulation of gene transcription pathways by SmgGDS. Strikingly, SmgGDS depletion significantly reduces expression of over 600 gene products that are targets of the DREAM complex, which is a transcription factor complex that regulates expression of proteins controlling the cell cycle. The cell cycle regulators E2F1, MYC, MYBL2 (B-Myb) and FOXM1 are among the DREAM targets that are diminished by SmgGDS depletion. E2F1 is well known to promote G1 cell cycle progression, and the loss of E2F1 in SmgGDS-depleted cells provides an explanation for previous reports that SmgGDS depletion characteristically causes a G1 cell cycle arrest. We show that SmgGDS localizes in nucleoli, and that RNAi-mediated depletion of SmgGDS in cancer cells disrupts nucleolar morphology, signifying nucleolar stress. We show that nucleolar SmgGDS interacts with the RNA polymerase I transcription factor upstream binding factor (UBF). The RNAi-mediated depletion of UBF diminishes nucleolar localization of SmgGDS and promotes proteasome-mediated degradation of SmgGDS, indicating that nucleolar sequestration of SmgGDS by UBF stabilizes SmgGDS protein. The ability of SmgGDS to interact with UBF and localize in the nucleolus is diminished by expressing DiRas1 or DiRas2, which are small GTPases that bind SmgGDS and act as tumor suppressors. Taken together, our results support a novel nuclear role for SmgGDS in protecting malignant
Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp
Directory of Open Access Journals (Sweden)
Fei Mo
2014-09-01
Full Text Available Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus under various conditions (sex, age, water temperature, and drug treatments, seven reference genes, including beta actin (ACTB, beta-2 microglobulin (B2M, embryonic elongation factor-1 alpha (EEF1A, glyceraldehyde phosphate dehydrogenase (GAPDH, alpha tubulin (TUBA, ribosomal protein l8 (RPL8 and glucose-6-phosphate dehydrogenase (G6PDH, were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species.
Directory of Open Access Journals (Sweden)
Simona Rosu
Full Text Available For most organisms, chromosome segregation during meiosis relies on deliberate induction of DNA double-strand breaks (DSBs and repair of a subset of these DSBs as inter-homolog crossovers (COs. However, timing and levels of DSB formation must be tightly controlled to avoid jeopardizing genome integrity. Here we identify the DSB-2 protein, which is required for efficient DSB formation during C. elegans meiosis but is dispensable for later steps of meiotic recombination. DSB-2 localizes to chromatin during the time of DSB formation, and its disappearance coincides with a decline in RAD-51 foci marking early recombination intermediates and precedes appearance of COSA-1 foci marking CO-designated sites. These and other data suggest that DSB-2 and its paralog DSB-1 promote competence for DSB formation. Further, immunofluorescence analyses of wild-type gonads and various meiotic mutants reveal that association of DSB-2 with chromatin is coordinated with multiple distinct aspects of the meiotic program, including the phosphorylation state of nuclear envelope protein SUN-1 and dependence on RAD-50 to load the RAD-51 recombinase at DSB sites. Moreover, association of DSB-2 with chromatin is prolonged in mutants impaired for either DSB formation or formation of downstream CO intermediates. These and other data suggest that association of DSB-2 with chromatin is an indicator of competence for DSB formation, and that cells respond to a deficit of CO-competent recombination intermediates by prolonging the DSB-competent state. In the context of this model, we propose that formation of sufficient CO-competent intermediates engages a negative feedback response that leads to cessation of DSB formation as part of a major coordinated transition in meiotic prophase progression. The proposed negative feedback regulation of DSB formation simultaneously (1 ensures that sufficient DSBs are made to guarantee CO formation and (2 prevents excessive DSB levels that could
FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin
2018-01-01
E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722
Shoc2/Sur8 protein regulates neurite outgrowth.
Directory of Open Access Journals (Sweden)
Gonzalo Leon
Full Text Available The Shoc2 protein has been implicated in the positive regulation of the Ras-ERK pathway by increasing the functional binding interaction between Ras and Raf, leading to increased ERK activity. Here we found that Shoc2 overexpression induced sustained ERK phosphorylation, notably in the case of EGF stimulation, and Shoc2 knockdown inhibited ERK activation. We demonstrate that ectopic overexpression of human Shoc2 in PC12 cells significantly promotes neurite extension in the presence of EGF, a stimulus that induces proliferation rather than differentiation in these cells. Finally, Shoc2 depletion reduces both NGF-induced neurite outgrowth and ERK activation in PC12 cells. Our data indicate that Shoc2 is essential to modulate the Ras-ERK signaling outcome in cell differentiation processes involved in neurite outgrowth.
Downregulation of bone morphogenetic protein receptor 2 promotes the development of neuroblastoma
International Nuclear Information System (INIS)
Cui, Ximao; Yang, Yili; Jia, Deshui; Jing, Ying; Zhang, Shouhua; Zheng, Shan; Cui, Long; Dong, Rui; Dong, Kuiran
2017-01-01
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. In this study, we examined the expression of bone morphogenetic protein receptor 2 (BMPR2) in primary NB and adjacent non-tumor samples (adrenal gland). BMPR2 expression was significantly downregulated in NB tissues, particularly in high-grade NB, and was inversely related to the expression of the NB differentiation markers ferritin and enolase. The significance of the downregulation was further explored in cultured NB cells. While enforced expression of BMPR2 decreased cell proliferation and colony-forming activity, shRNA-mediated knockdown of BMPR2 led to increased cell growth and clonogenicity. In mice, NB cells harboring BMPR2 shRNA showed significantly increased tumorigenicity compared with control cells. We also performed a retrospective analysis of NB patients and identified a significant positive correlation between tumor BMPR2 expression and overall survival. These findings suggest that BMPR2 may play an important role in the development of NB. - Highlights: • BMPR2 expression was downregulated in primary NB and was more signifcant in high grade NB. • BMPR2 expression was accompanied by the decrease of NB markers ferritin and enolase. • Enforced expression of BMPR2 decreased proliferation and colony formation ability of cultured NB cells. • Knockdown of BMPR2 led to increased cell growth, clonality and tumorigenicity in mice. • Patients with NB expressing higher level of BMPR2 had significant better overall survival than those with low level.
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway
DEFF Research Database (Denmark)
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-01-01
in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function...
Berberine promotes glucose consumption independently of AMP-activated protein kinase activation.
Directory of Open Access Journals (Sweden)
Miao Xu
Full Text Available Berberine is a plant alkaloid with anti-diabetic action. Activation of AMP-activated protein kinase (AMPK pathway has been proposed as mechanism for berberine's action. This study aimed to examine whether AMPK activation was necessary for berberine's glucose-lowering effect. We found that in HepG2 hepatocytes and C2C12 myotubes, berberine significantly increased glucose consumption and lactate release in a dose-dependent manner. AMPK and acetyl coenzyme A synthetase (ACC phosphorylation were stimulated by 20 µmol/L berberine. Nevertheless, berberine was still effective on stimulating glucose utilization and lactate production, when the AMPK activation was blocked by (1 inhibition of AMPK activity by Compound C, (2 suppression of AMPKα expression by siRNA, and (3 blockade of AMPK pathway by adenoviruses containing dominant-negative forms of AMPKα1/α2. To test the effect of berberine on oxygen consumption, extracellular flux analysis was performed in Seahorse XF24 analyzer. The activity of respiratory chain complex I was almost fully blocked in C2C12 myotubes by berberine. Metformin, as a positive control, showed similar effects as berberine. These results suggest that berberine and metformin promote glucose metabolism by stimulating glycolysis, which probably results from inhibition of mitochondrial respiratory chain complex I, independent of AMPK activation.
Energy Technology Data Exchange (ETDEWEB)
Nakatani, Miyuki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Ito, Jumpei [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Japan Society for the Promotion of Science, Tokyo, 102-0083 (Japan); Koyama, Riko [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Iijima, Masumi; Yoshimoto, Nobuo [The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Niimi, Tomoaki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Kuroda, Shun' ichi [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Maturana, Andrés D., E-mail: maturana@agr.nagoya-u.ac.jp [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan)
2016-05-27
Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. -- Highlights: •Enigma Homolog 1 (ENH1) is a scaffold protein. •ENH1 binds to inhibitor of DNA binding 2 (Id2) in myoblasts. •ENH1 overexpression overcomes the Id2's repression of myogenesis. •The Id2-ENH1 complex play an important role in the activation of myogenesis.
Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1
Energy Technology Data Exchange (ETDEWEB)
Culiat, Cymbeline T.
2018-03-20
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1
Culiat, Cymbeline T [Oak Ridge, TN
2011-03-22
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Evolution and Virulence of Influenza A Virus Protein PB1-F2
Directory of Open Access Journals (Sweden)
Ram P. Kamal
2017-12-01
Full Text Available PB1-F2 is an accessory protein of most human, avian, swine, equine, and canine influenza A viruses (IAVs. Although it is dispensable for virus replication and growth, it plays significant roles in pathogenesis by interfering with the host innate immune response, inducing death in immune and epithelial cells, altering inflammatory responses, and promoting secondary bacterial pneumonia. The effects of PB1-F2 differ between virus strains and host species. This can at least partially be explained by the presence of multiple PB1-F2 sequence variants, including premature stop codons that lead to the expression of truncated PB1-F2 proteins of different lengths and specific virulence-associated residues that enhance susceptibility to bacterial superinfection. Although there has been a tendency for human seasonal IAV to gradually reduce the number of virulence-associated residues, zoonotic IAVs contain a reservoir of PB1-F2 proteins with full length, virulence-associated sequences. Here, we review the molecular mechanisms by which PB1-F2 may affect influenza virulence, and factors associated with the evolution and selection of this protein.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1991-08-30
Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).
Gerasymenko, I M; Sheludko, Y V
2017-07-01
To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.
Characterization of the retinoblastoma binding proteins RBP1 and RBP2
DEFF Research Database (Denmark)
Fattaey, A R; Helin, K; Dembski, M S
1993-01-01
The retinoblastoma gene product, pRB, regulates cell proliferation by binding to and inhibiting the activity of key growth promoting proteins. Several cellular proteins have been shown to bind directly to pRB and the genes encoding a number of them have been isolated. The protein product of one...
Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping
2008-08-01
To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.
2017-01-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M. persicae-host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. PMID:28100451
Wang, Songbo; Wang, Guoqing; Zhang, Mengyuan; Zhuang, Lu; Wan, Xiaojuan; Xu, Jingren; Wang, Lina; Zhu, Xiaotong; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Shu, Gang; Jiang, Qingyan
2016-11-15
It has been implicated that IGF-1 secretion can be regulated by dietary protein. However, whether the dipeptides, one of digested products of dietary protein, have influence on IGF-1 secretion remain largely unknown. Our study aimed to investigate the effects of the dipeptide Pro-Asp on IGF-1 secretion and expression in hepatocytes and to explore the possible underlying mechanisms. Our findings demonstrated that Pro-Asp promoted the secretion and gene expression of IGF-1 in HepG2 cells and primary porcine hepatocytes. Meanwhile, Pro-Asp activated the ERK and Akt signaling pathways, downstream of IGF-1. In addition, Pro-Asp enhanced GH-mediated JAK2/STAT5 signaling pathway, while inhibition of JAK2/STAT5 blocked the promotive effect of Pro-Asp on IGF-1 secretion and expression. Moreover, acute injection of Pro-Asp stimulated IGF-1 expression and activated JAK2/STAT5 signaling pathway in mice liver. Together, these results suggested that the dipeptide Pro-Asp promoted IGF-1 secretion and expression in hepatocytes by enhancing GH-mediated JAK2/STAT5 signaling pathway. Copyright © 2016. Published by Elsevier Ireland Ltd.
Transcriptional activation of melanocortin 2 receptor accessory protein by PPARγ in adipocytes
Energy Technology Data Exchange (ETDEWEB)
Kim, Nam Soo; Kim, Yoon-Jin [Department of Biology, Research Institute for Basic Science, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Cho, Si Young [R and D Center, Amore Pacific Corporation, Yongin-si, Gyeonggi-do 446-729 (Korea, Republic of); Lee, Tae Ryong, E-mail: trlee@amorepacific.com [R and D Center, Amore Pacific Corporation, Yongin-si, Gyeonggi-do 446-729 (Korea, Republic of); Kim, Sang Hoon, E-mail: shkim@khu.ac.kr [Department of Biology, Research Institute for Basic Science, Kyung Hee University, Seoul 130-701 (Korea, Republic of)
2013-09-27
Highlights: •MRAP enhanced HSL expression. •ACTH-mediated MRAP reduced glycerol release. •PPARγ induced MRAP expression. •PPARγ bound to the MRAP promoter. -- Abstract: Adrenocorticotropic hormone (ACTH) in rodents decreases lipid accumulation and body weight. Melanocortin receptor 2 (MC2R) and MC2R accessory protein (MRAP) are specific receptors for ACTH in adipocytes. Peroxisome proliferator-activated receptor γ (PPARγ) plays a role in the transcriptional regulation of metabolic pathways such as adipogenesis and β-oxidation of fatty acids. In this study we investigated the transcriptional regulation of MRAP expression during differentiation of 3T3-L1 cells. Stimulation with ACTH affected lipolysis in murine mature adipocytes via MRAP. Putative peroxisome proliferator response element (PPRE) was identified in the MRAP promoter region. In chromatin immunoprecipitation and reporter assays, we observed binding of PPARγ to the MRAP promoter. The mutagenesis experiments showed that the −1209/−1198 region of the MRAP promoter could function as a PPRE site. These results suggest that PPARγ is required for transcriptional activation of the MRAP gene during adipogenesis, which contributes to understanding of the molecular mechanism of lipolysis in adipocytes.
Transcriptional activation of melanocortin 2 receptor accessory protein by PPARγ in adipocytes
International Nuclear Information System (INIS)
Kim, Nam Soo; Kim, Yoon-Jin; Cho, Si Young; Lee, Tae Ryong; Kim, Sang Hoon
2013-01-01
Highlights: •MRAP enhanced HSL expression. •ACTH-mediated MRAP reduced glycerol release. •PPARγ induced MRAP expression. •PPARγ bound to the MRAP promoter. -- Abstract: Adrenocorticotropic hormone (ACTH) in rodents decreases lipid accumulation and body weight. Melanocortin receptor 2 (MC2R) and MC2R accessory protein (MRAP) are specific receptors for ACTH in adipocytes. Peroxisome proliferator-activated receptor γ (PPARγ) plays a role in the transcriptional regulation of metabolic pathways such as adipogenesis and β-oxidation of fatty acids. In this study we investigated the transcriptional regulation of MRAP expression during differentiation of 3T3-L1 cells. Stimulation with ACTH affected lipolysis in murine mature adipocytes via MRAP. Putative peroxisome proliferator response element (PPRE) was identified in the MRAP promoter region. In chromatin immunoprecipitation and reporter assays, we observed binding of PPARγ to the MRAP promoter. The mutagenesis experiments showed that the −1209/−1198 region of the MRAP promoter could function as a PPRE site. These results suggest that PPARγ is required for transcriptional activation of the MRAP gene during adipogenesis, which contributes to understanding of the molecular mechanism of lipolysis in adipocytes
Ma'ruf, Anwar; Iswati, Sri; Hidajati, Nove; Damayanti, Ratna
2017-09-01
The long-term objective of this study was to produce STAT synthetic protein in chicken during growth period resulting from the increase of growth hormone (GH) as growth promoter. This study used ten male chicken Lohman from PT. Multibreeder Indonesia. The chicken were kept within batteried cage, with a capacity of one chicken in each cage. The chickens were fed twice a day, at 6 a.m. and 6 p.m. with the amount of feed 10% less than standard. On day 21 the chicken were slaughtered to obtain the samples, i.e., adipose, liver and muscles for the following examinations (1) isolation of STAT-3 signaling protein from adipose, liver and muscles of the chicken, (2) analysis of STAT-3 signaling protein using SDS-PAGE method, and (3) identification of STAT-3 signaling protein using Western blot method by means of protein detection using electrophoresis with polyacrylamide gels. Results of examination on protein in hepatic, muscle and adipose of chickens in growth period revealed that STAT protein was positively present in those tissues. This finding was followed-up with SDS-PAGE examination, from which we found the presence of protein band between the markers of 116 kDa and 14.4 kDa. The protein band was supposedly the STAT-3 protein. To prove that protein band formed was the STAT-3, Western blot examination was conducted using rabbit polyclonal antibody STAT-3. The result showed the formation of the protein band, indicating the presence of reaction between antigen (STAT-3 protein) and STAT-3 protein antibody. In conclusion, STAT-3 protein is present in hepatic, muscular, and adipose tissues, with molecular weight of 59.4 kDa.
Dhar, Jayeeta; Barik, Sailen
2016-12-01
Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.
A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution
DEFF Research Database (Denmark)
Maida, Adriano; Zota, Annika; Sjøberg, Kim Anker
2016-01-01
of impaired glucose homeostasis independently of obesity and food intake. DPD-mediated metabolic inefficiency and improvement of glucose homeostasis were independent of uncoupling protein 1 (UCP1), but required expression of liver-derived fibroblast growth factor 21 (FGF21) in both lean and obese mice. FGF21...... expression and secretion as well as the associated metabolic remodeling induced by DPD also required induction of liver-integrated stress response-driven nuclear protein 1 (NUPR1). Insufficiency of select nonessential amino acids (NEAAs) was necessary and adequate for NUPR1 and subsequent FGF21 induction...... and secretion in hepatocytes in vitro and in vivo. Taken together, these data indicate that DPD promotes improved glucose homeostasis through an NEAA insufficiency-induced liver NUPR1/FGF21 axis....
Directory of Open Access Journals (Sweden)
Cai-lin GE
2007-12-01
Full Text Available The effects of 5 mg/L 1,2,4-trichlorobenzene (TCB and 0.1 mmol/L mercury ion (Hg2+ stresses on Ca2+ fluxion and protein phosphorylation in rice seedlings were investigated by isotope exchange kinetics and in vitro phosphorylation assay. The Ca2+ absorption in rice leaves and Ca2+ transportation from roots to leaves were promoted significantly in response to Hg2+ and TCB treatments for 4-48 h. The Ca2+ absorption peaks presented in the leaves when the rice seedlings were exposed to Hg2+ for 8-12 h or to TCB for 12-24 h. Several Ca2+ absorption peaks presented in the roots during rice seedlings being exposed to Hg2+ and TCB, and the first Ca2+ absorption peak was at 8 h after being exposed to Hg2+ and TCB. The result of isotope exchange kinetic analysis confirmed that short-term (8 h Hg2+ and TCB stresses caused Ca2+ channels or pumps located on plasmalemma to open transiently. The phosphorylation assay showed that short-term TCB stress enhanced protein phosphorylation in rice roots (TCB treatment for 4-8 h and leaves (TCB treatment for 4-24 h, and short-term (4-8 h Hg2+ stress also enhanced protein phosphorylation in rice leaves. The enhancement of protein phosphorylation in both roots and leaves corresponded with the first Ca2+ absorption peak, which confirmed that the enhancement of protein phosphorylation caused by TCB or Hg2+ stress might be partly triggered by the increases of cytosolic calcium. TCB treatment over 12 h inhibited protein phosphorylation in rice roots, which might be partly due to that TCB stress suppressed the protein kinase activity. Whereas, Hg2+ treatment inhibited protein phosphorylation in rice roots, and Hg2+ treatment over 12 h inhibited protein phosphorylation in rice leaves. This might be attributed to that not only the protein kinase activity, but also the expressions of phosphorylation proteins were restrained by Hg2+ stress.
FAN1 acts with FANCI-FANCD2 to promote DNA interstrand cross-link repair.
Liu, Ting; Ghosal, Gargi; Yuan, Jingsong; Chen, Junjie; Huang, Jun
2010-08-06
Fanconi anemia (FA) is caused by mutations in 13 Fanc genes and renders cells hypersensitive to DNA interstrand cross-linking (ICL) agents. A central event in the FA pathway is mono-ubiquitylation of the FANCI-FANCD2 (ID) protein complex. Here, we characterize a previously unrecognized nuclease, Fanconi anemia-associated nuclease 1 (FAN1), that promotes ICL repair in a manner strictly dependent on its ability to accumulate at or near sites of DNA damage and that relies on mono-ubiquitylation of the ID complex. Thus, the mono-ubiquitylated ID complex recruits the downstream repair protein FAN1 and facilitates the repair of DNA interstrand cross-links.
Wang, Fengping; Qiu, Ye; Zhang, Huifang M; Hanson, Paul; Ye, Xin; Zhao, Guangze; Xie, Ronald; Tong, Lei; Yang, Decheng
2017-07-01
We previously demonstrated that coxsackievirus B3 (CVB3) infection upregulated heat shock protein 70 (Hsp70) and promoted CVB3 multiplication. Here, we report the underlying mechanism by which Hsp70 enhances viral RNA translation. By using an Hsp70-overexpressing cell line infected with CVB3, we found that Hsp70 enhanced CVB3 VP1 translation at two stages. First, Hsp70 induced upregulation of VP1 translation at the initiation stage via upregulation of internal ribosome entry site trans-acting factor lupus autoantigen protein and activation of eIF4E binding protein 1, a cap-dependent translation suppressor. Second, we found that Hsp70 increased CVB3 VP1 translation by enhancing translation elongation. This was mediated by the Akt-mammalian target of rapamycin complex 1 signal cascade, which led to the activation of eukaryotic elongation factor 2 via p70S6K- and cell division cycle protein 2 homolog (Cdc2)-mediated phosphorylation and inactivation of eukaryotic elongation factor 2 kinase. We also determined the position of Cdc2 in this signal pathway, indicating that Cdc2 is regulated by mammalian target of rapamycin complex 1. This signal transduction pathway was validated using a number of specific pharmacological inhibitors, short interfering RNAs (siRNAs) and a dominant negative Akt plasmid. Because Hsp70 is a central component of the cellular network of molecular chaperones enhancing viral replication, these data may provide new strategies to limit this viral infection. © 2017 John Wiley & Sons Ltd.
Hou, Jiun-Nan; Chen, Tien-Huang; Chiang, Yi-Hsuan; Peng, Jing-Yun; Yang, Tsong-Han; Cheng, Chih-Chieh; Sofiyatun, Eny; Chiu, Cheng-Hsun; Chiang-Ni, Chuan; Chen, Wei-June
2017-09-20
Survival of mosquitoes from dengue virus (DENV) infection is a prerequisite of viral transmission to the host. This study aimed to see how mosquito cells can survive the infection during prosperous replication of the virus. In C6/36 cells, global protein translation was shut down after infection by DENV type 2 (DENV2). However, it returned to a normal level when infected cells were treated with an inhibitor of the protein kinase RNA (PKR)-like ER kinase (PERK) signaling pathway. Based on a 7-Methylguanosine 5'-triphosphate (m7GTP) pull-down assay, the eukaryotic translation initiation factor 4F (eIF4F) complex was also identified in DENV2-infected cells. This suggests that most mosquito proteins are synthesized via canonical cap-dependent translation. When the PERK signal pathway was inhibited, both accumulation of reactive oxygen species and changes in the mitochondrial membrane potential increased. This suggested that ER stress response was alleviated through the PERK-mediated shutdown of global proteins in DENV2-infected C6/36 cells. In the meantime, the activities of caspases-9 and -3 and the apoptosis-related cell death rate increased in C6/36 cells with PERK inhibition. This reflected that the PERK-signaling pathway is involved in determining cell survival, presumably by reducing DENV2-induced ER stress. Looking at the PERK downstream target, α-subunit of eukaryotic initiation factor 2 (eIF2α), an increased phosphorylation status was only shown in infected C6/36 cells. This indicated that recruitment of ribosome binding to the mRNA 5'-cap structure could have been impaired in cap-dependent translation. It turned out that shutdown of cellular protein translation resulted in a pro-survival effect on mosquito cells in response to DENV2 infection. As synthesis of viral proteins was not affected by the PERK signal pathway, an alternate mode other than cap-dependent translation may be utilized. This finding provides insights into elucidating how the PERK signal
Domínguez-Santos, Rebeca; Kosalková, Katarina; García-Estrada, Carlos; Barreiro, Carlos; Ibáñez, Ana; Morales, Alejandro; Martín, Juan-Francisco
2017-03-06
Transport of penicillin intermediates and penicillin secretion are still poorly characterized in Penicillium chrysogenum (re-identified as Penicillium rubens). Calcium (Ca 2+ ) plays an important role in the metabolism of filamentous fungi, and casein phosphopeptides (CPP) are involved in Ca 2+ internalization. In this study we observe that the effect of CaCl 2 and CPP is additive and promotes an increase in penicillin production of up to 10-12 fold. Combination of CaCl 2 and CPP greatly promotes expression of the three penicillin biosynthetic genes. Comparative proteomic analysis by 2D-DIGE, identified 39 proteins differentially represented in P. chrysogenum Wisconsin 54-1255 after CPP/CaCl 2 addition. The most interesting group of overrepresented proteins were a peroxisomal catalase, three proteins of the methylcitrate cycle, two aminotransferases and cystationine β-synthase, which are directly or indirectly related to the formation of penicillin amino acid precursors. Importantly, two of the enzymes of the penicillin pathway (isopenicillin N synthase and isopenicillin N acyltransferase) are clearly induced after CPP/CaCl 2 addition. Most of these overrepresented proteins are either authentic peroxisomal proteins or microbody-associated proteins. This evidence suggests that addition of CPP/CaCl 2 promotes the formation of penicillin precursors and the penicillin biosynthetic enzymes in peroxisomes and vesicles, which may be involved in transport and secretion of penicillin. Penicillin biosynthesis in Penicillium chrysogenum is one of the best characterized secondary metabolism processes. However, the mechanism by which penicillin is secreted still remains to be elucidated. Taking into account the role played by Ca 2+ and CPP in the secretory pathway and considering the positive effect that Ca 2+ exerts on penicillin production, the analysis of global protein changes produced after CPP/CaCl 2 addition is very helpful to decipher the processes related to the
Directory of Open Access Journals (Sweden)
Noriko Umegaki-Arao
Full Text Available Karyopherin proteins mediate nucleocytoplasmic trafficking and are critical for protein and RNA subcellular localization. Recent studies suggest KPNA2 expression is induced in tumor cells and is strongly associated with prognosis, although the precise roles and mechanisms of KPNA2 overexpression in proliferative disorders have not been defined. We found that KPNA2 expression is induced in various proliferative disorders of the skin such as psoriasis, Bowen's disease, actinic keratosis, squamous cell carcinoma, Paget's disease, Merkel cell carcinoma, and mycosis fungoides. siRNA-mediated KPNA suppression revealed that KPNA2 is essential for significant suppression of HaCaT proliferation under starvation conditions. Ribosomal RNA transcription and protein synthesis were suppressed by starvation combined with knockdown of KPNA (including KPNA2 expression. KPNA2 localized to the nucleolus and interacted with proteins associated with mRNA processing, ribonucleoprotein complex biogenesis, chromatin modification, and transcription, as demonstrated by tandem affinity purification and mass spectrometry. KPNA2 may be an important promoter of ribosomal RNA and protein synthesis in tumor cells.
FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin
2018-07-01
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2013-01-01
Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816
Energy Technology Data Exchange (ETDEWEB)
Murphy, Jane; Hall, William W. [Centre for Research in Infectious Diseases, School of Medicine and Medical Science, University College Dublin, Belfield, Dublin 4 (Ireland); Ratner, Lee [Department of Medicine, Division of Molecular Oncology, Washington University School of Medicine, Saint Louis, Missouri, United States of America (United States); Sheehy, Noreen [Centre for Research in Infectious Diseases, School of Medicine and Medical Science, University College Dublin, Belfield, Dublin 4 (Ireland)
2016-07-15
The human T-cell leukaemia virus type 1 and type 2 (HTLV-1/HTLV-2) antisense proteins HBZ and APH-2 play key roles in the HTLV lifecycles and persistence in the host. Nuclear Factors Associated with double-stranded RNA (NFAR) proteins NF90/110 function in the lifecycles of several viruses and participate in host innate immunity against infection and oncogenesis. Using GST pulldown and co-immunoprecipitation assays we demonstrate specific novel interactions between HBZ/APH-2 and NF90/110 and characterised the protein domains involved. Moreover we show that NF90/110 significantly enhance Tax mediated LTR activation, an effect that was abolished by HBZ but enhanced by APH-2. Additionally we found that HBZ and APH-2 modulate the promoter activity of survivin and are capable of antagonising NF110-mediated survivin activation. Thus interactions between HTLV antisense proteins and the NFAR protein family have an overall positive impact on HTLV infection. Hence NFARs may represent potential therapeutic targets in HTLV infected cells. - Highlights: • This study demonstrates for the first time interactions between NF90/110 and the HTLV antisense proteins HBZ and APH-2. • We show that NF90/110 significantly enhance LTR activation by the HTLV Tax protein, an effect that is abolished by HBZ but enhanced by APH-2. • The study shows that even though the HTLV antisense proteins activate survivin expression they antagonize the ability of NF90/110 to do so. • Overall we found that NF90/110 positively regulate HTLV infection and as such might represent a therapeutic target in infected cells.
International Nuclear Information System (INIS)
Murphy, Jane; Hall, William W.; Ratner, Lee; Sheehy, Noreen
2016-01-01
The human T-cell leukaemia virus type 1 and type 2 (HTLV-1/HTLV-2) antisense proteins HBZ and APH-2 play key roles in the HTLV lifecycles and persistence in the host. Nuclear Factors Associated with double-stranded RNA (NFAR) proteins NF90/110 function in the lifecycles of several viruses and participate in host innate immunity against infection and oncogenesis. Using GST pulldown and co-immunoprecipitation assays we demonstrate specific novel interactions between HBZ/APH-2 and NF90/110 and characterised the protein domains involved. Moreover we show that NF90/110 significantly enhance Tax mediated LTR activation, an effect that was abolished by HBZ but enhanced by APH-2. Additionally we found that HBZ and APH-2 modulate the promoter activity of survivin and are capable of antagonising NF110-mediated survivin activation. Thus interactions between HTLV antisense proteins and the NFAR protein family have an overall positive impact on HTLV infection. Hence NFARs may represent potential therapeutic targets in HTLV infected cells. - Highlights: • This study demonstrates for the first time interactions between NF90/110 and the HTLV antisense proteins HBZ and APH-2. • We show that NF90/110 significantly enhance LTR activation by the HTLV Tax protein, an effect that is abolished by HBZ but enhanced by APH-2. • The study shows that even though the HTLV antisense proteins activate survivin expression they antagonize the ability of NF90/110 to do so. • Overall we found that NF90/110 positively regulate HTLV infection and as such might represent a therapeutic target in infected cells.
Hughes, M A; Downs, R M; Webb, G W; Crocker, C L; Kinsey, S T; Baumgarner, Bradley L
2017-04-01
Caffeine is a highly catabolic dietary stimulant. High caffeine concentrations (1-10 mM) have previously been shown to inhibit protein synthesis and increase protein degradation in various mammalian cell lines. The purpose of this study was to examine the effect of short-term caffeine exposure on cell signaling pathways that regulate protein metabolism in mammalian skeletal muscle cells. Fully differentiated C2C12 skeletal myotubes either received vehicle (DMSO) or 5 mM caffeine for 6 h. Our analysis revealed that caffeine promoted a 40% increase in autolysosome formation and a 25% increase in autophagic flux. In contrast, caffeine treatment did not significantly increase the expression of the skeletal muscle specific ubiquitin ligases MAFbx and MuRF1 or 20S proteasome activity. Caffeine treatment significantly reduced mTORC1 signaling, total protein synthesis and myotube diameter in a CaMKKβ/AMPK-dependent manner. Further, caffeine promoted a CaMKII-dependent increase in myostatin mRNA expression that did not significantly contribute to the caffeine-dependent reduction in protein synthesis. Our results indicate that short-term caffeine exposure significantly reduced skeletal myotube diameter by increasing autophagic flux and promoting a CaMKKβ/AMPK-dependent reduction in protein synthesis.
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
Statins Activate Human PPAR Promoter and Increase PPAR mRNA Expression and Activation in HepG2 Cells
Directory of Open Access Journals (Sweden)
Makoto Seo
2008-01-01
Full Text Available Statins increase peroxisome proliferator-activated receptor (PPAR mRNA expression, but the mechanism of this increased PPAR production remains elusive. To examine the regulation of PPAR production, we examined the effect of 7 statins (atorvastatin, cerivastatin, fluvastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin on human PPAR promoter activity, mRNA expression, nuclear protein levels, and transcriptional activity. The main results are as follows. (1 Majority of statins enhanced PPAR promoter activity in a dose-dependent manner in HepG2 cells transfected with the human PPAR promoter. This enhancement may be mediated by statin-induced HNF-4. (2 PPAR mRNA expression was increased by statin treatment. (3 The PPAR levels in nuclear fractions were increased by statin treatment. (4 Simvastatin, pravastatin, and cerivastatin markedly enhanced transcriptional activity in 293T cells cotransfected with acyl-coenzyme A oxidase promoter and PPAR/RXR expression vectors. In summary, these data demonstrate that PPAR production and activation are upregulated through the PPAR promoter activity by statin treatment.
Functional comparison of antisense proteins of HTLV-1 and HTLV-2 in viral pathogenesis
Directory of Open Access Journals (Sweden)
Benoit eBarbeau
2013-08-01
Full Text Available The production of antisense transcripts from the 3’ long terminal repeat (LTR in human T-lymphotropic retroviruses has now been clearly demonstrated. After the identification of the antisense strand-encoded HTLV-1 bZIP (HBZ factor, we reported that HBZ could interact with CREB transcription factors and consequently turn off the important activating potential of the viral Tax protein on HTLV-1 5’ LTR promoter activity. We have recently accumulated new results demonstrating that antisense transcripts also exist in HTLV-2, -3 and -4. Furthermore, our data have confirmed the existence of encoded proteins from these antisense transcripts (termed antisense proteins of HTLVs or APHs. APHs are also involved in the down-regulation of Tax-dependent viral transcription. In this review, we will focus on the different molecular mechanisms used by HBZ and APH-2 to control viral expression. While HBZ interacts with CREB through its basic zipper domain, APH-2 binds to this cellular factor through a five amino acid motif localized in its carboxyl terminus. Moreover, unlike APH-2, HBZ possesses an N-terminal activation domain that also contributes to the inhibition of the viral transcription by interacting with the KIX domain of p300/CBP. On the other hand, HBZ was found to induce T-cell proliferation while APH-2 was unable to promote such proliferation. Interestingly, HTLV-2 has not been causally linked to human T-cell leukemia, while HTLV-1 is responsible for the development of the Adult T-cell Leukemia/Lymphoma (ATLL. We will further discuss the possible role played by antisense proteins in the establishment of pathologies induced by viral infection.
Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H
2015-01-01
Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.
22 CFR 101.2 - Promotion of American interests.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...
Deb, Debasish; Shrestha, Ankita; Maiti, Indu B.; Dey, Nrisingha
2018-01-01
Development of disease-resistant plant varieties achieved by engineering anti-microbial transgenes under the control of strong promoters can suffice the inhibition of pathogen growth and simultaneously ensure enhanced crop production. For evaluating the prospect of such strong promoters, we comprehensively characterized the full-length transcript promoter of Cassava Vein Mosaic Virus (CsVMV; -565 to +166) and identified CsVMV8 (-215 to +166) as the highest expressing fragment in both transient and transgenic assays. Further, we designed a new chimeric promoter ‘MUASCsV8CP’ through inter-molecular hybridization among the upstream activation sequence (UAS) of Mirabilis Mosaic Virus (MMV; -297 to -38) and CsVMV8, as the core promoter (CP). The MUASCsV8CP was found to be ∼2.2 and ∼2.4 times stronger than the CsVMV8 and CaMV35S promoters, respectively, while its activity was found to be equivalent to that of the CaMV35S2 promoter. Furthermore, we generated transgenic tobacco plants expressing the totiviral ‘Killer protein KP4’ (KP4) under the control of the MUASCsV8CP promoter. Recombinant KP4 was found to accumulate both in the cytoplasm and apoplast of plant cells. The agar-based killing zone assays revealed enhanced resistance of plant-derived KP4 against two deuteromycetous foliar pathogenic fungi viz. Alternaria alternata and Phoma exigua var. exigua. Also, transgenic plants expressing KP4 inhibited the growth progression of these fungi and conferred significant fungal resistance in detached-leaf and whole plant assays. Taken together, we establish the potential of engineering “in-built” fungal stress-tolerance in plants by expressing KP4 under a novel chimeric caulimoviral promoter in a transgenic approach. PMID:29556246
Directory of Open Access Journals (Sweden)
Sungho Ghil
Full Text Available Protease-activated receptor 1 (PAR1 is a G-protein coupled receptor (GPCR that is activated by natural proteases to regulate many physiological actions. We previously reported that PAR1 couples to Gi, Gq and G12 to activate linked signaling pathways. Regulators of G protein signaling (RGS proteins serve as GTPase activating proteins to inhibit GPCR/G protein signaling. Some RGS proteins interact directly with certain GPCRs to modulate their signals, though cellular mechanisms dictating selective RGS/GPCR coupling are poorly understood. Here, using bioluminescence resonance energy transfer (BRET, we tested whether RGS2 and RGS4 bind to PAR1 in live COS-7 cells to regulate PAR1/Gα-mediated signaling. We report that PAR1 selectively interacts with either RGS2 or RGS4 in a G protein-dependent manner. Very little BRET activity is observed between PAR1-Venus (PAR1-Ven and either RGS2-Luciferase (RGS2-Luc or RGS4-Luc in the absence of Gα. However, in the presence of specific Gα subunits, BRET activity was markedly enhanced between PAR1-RGS2 by Gαq/11, and PAR1-RGS4 by Gαo, but not by other Gα subunits. Gαq/11-YFP/RGS2-Luc BRET activity is promoted by PAR1 and is markedly enhanced by agonist (TFLLR stimulation. However, PAR1-Ven/RGS-Luc BRET activity was blocked by a PAR1 mutant (R205A that eliminates PAR1-Gq/11 coupling. The purified intracellular third loop of PAR1 binds directly to purified His-RGS2 or His-RGS4. In cells, RGS2 and RGS4 inhibited PAR1/Gα-mediated calcium and MAPK/ERK signaling, respectively, but not RhoA signaling. Our findings indicate that RGS2 and RGS4 interact directly with PAR1 in Gα-dependent manner to modulate PAR1/Gα-mediated signaling, and highlight a cellular mechanism for selective GPCR/G protein/RGS coupling.
Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi
2016-02-15
FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.
Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2
Directory of Open Access Journals (Sweden)
Ning Song
2016-01-01
Full Text Available Background/Aims: The aggressive manner of ovarian cancer (OVC cells accounts for the majority of its lethality. Recently, we have shown that placental growth factor (PLGF promotes metastases of OVC cells through miR-543-regulated MMP7. In the current study, we analyzed the effects of PLGF on another cell invasion associated protein, ZEB2, in OVC cells. Methods: The PLGF and ZEB2 levels in OVC tissues were compared to the paired adjacent non-tumor ovary tissue. We modified ZEB2 levels in OVC cells, and examined its effects on PLGF mRNA and protein levels by RT-qPCR and by Western blot, respectively. We also modified PLGF levels in OVC cells, and examined its effects on ZEB2 mRNA and protein levels by RT-qPCR and by Western blot, respectively. Then, we examined the cell invasiveness in PLGF-modified OVC cells in a transwell cell invasion assay. Finally, we used specific signal pathway inhibitors to treat PLGF-modified OVC cells and examined the effects on ZEB2 activation. Results: PLGF and ZEB2 levels were both significantly increased in OVC tissues, compared to the paired adjacent non-tumor ovary tissue. The PLGF and ZEB2 levels were strongly correlated. ZEB2 modification did not alter PLGF levels. Overexpression of PLGF in OVC cells significantly increased ZEB2 levels and cell invasiveness, while PLGF depletion in OVC cells significantly decreased ZEB2 levels and cell invasiveness. Application of a specific MAPK-p38 inhibitor, but not application of specific inhibitors for MAPK-p42/p44, PI3k/Akt, or JNK signaling pathways, to PLGF-overexpressing OVC cells substantially abolished the PLGF-induced ZEB2 activation. Conclusion: PLGF enhances OVC cell invasion through MAPK-p38-dependent activation of ZEB2.
Tumor promoter induced membrane-bound protein kinase C - its influence on hematogenous metastasis
International Nuclear Information System (INIS)
Gopalakrishna, R.; Barsky, S.H.
1987-01-01
A correlation between the amount of membrane-bound detergent-extractable protein kinase C activity in various B16 melanoma sublines (F10, F1, BL6) and their lung metastasizing abilities following intravenous injection was found. The F10 subline which exhibits higher metastasizing ability was found to have higher membrane-bound protein kinase C compared to the lower metastasizing subline, F1. Treatment of F1 cells with 100 nM 12-0 tetradecanoylphorbol-13-acetate (TPA) for 1h resulted in 90% decrease in protein kinase C activity in the cytosol with a concommitent increase in membrane-bound activity. These TPA-treated cells when injected intravenously in C57BL/6 mice produced 6-fold increase in pulmonary metastases compared to untreated F1 cells. However, biologically inactive analogues 4 α-phorbol 12,13-didecanoate and phorbol 13-acetate had no effect on either membrane-bound protein kinase C activity or pulmonary metastases. Treating F1 cells with the second-stage tumor promoter, mezerin, resulted in increase in both membrane association of protein kinase C and also lung metastases. Thus, these results strongly suggests that membrane associated protein kinase C activity influences hematogenous metastasis of these melanoma cells
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.
2014-01-01
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477
Hamada, Junichi; Shoda, Katsutoshi; Masuda, Kiyoshi; Fujita, Yuji; Naruto, Takuya; Kohmoto, Tomohiro; Miyakami, Yuko; Watanabe, Miki; Kudo, Yasusei; Fujiwara, Hitoshi; Ichikawa, Daisuke; Otsuji, Eigo; Imoto, Issei
2016-03-29
T-cell intracellular antigen-1 (TIA1) is an RNA-binding protein involved in many regulatory aspects of mRNA metabolism. Here, we report previously unknown tumor-promoting activity of TIA1, which seems to be associated with its isoform-specific molecular distribution and regulation of a set of cancer-related transcripts, in esophageal squamous cell carcinoma (ESCC). Immunohistochemical overexpression of TIA1 ectopically localized in the cytoplasm of tumor cells was an independent prognosticator for worse overall survival in a cohort of 143 ESCC patients. Knockdown of TIA1 inhibited proliferation of ESCC cells. By exogenously introducing each of two major isoforms, TIA1a and TIA1b, only TIA1a, which was localized to both the nucleus and cytoplasm, promoted anchorage-dependent and anchorage-independent ESCC cell proliferation. Ribonucleoprotein immunoprecipitation, followed by microarray analysis or massive-parallel sequencing, identified a set of TIA1-binding mRNAs, including SKP2 and CCNA2. TIA1 increased SKP2 and CCNA2 protein levels through the suppression of mRNA decay and translational induction, respectively. Our findings uncover a novel oncogenic function of TIA1 in esophageal tumorigenesis, and implicate its use as a marker for prognostic evaluation and as a therapeutic target in ESCC.
P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.
Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang
2015-01-01
As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.
ALDH2(E487K) mutation increases protein turnover and promotes murine hepatocarcinogenesis.
Jin, Shengfang; Chen, Jiang; Chen, Lizao; Histen, Gavin; Lin, Zhizhong; Gross, Stefan; Hixon, Jeffrey; Chen, Yue; Kung, Charles; Chen, Yiwei; Fu, Yufei; Lu, Yuxuan; Lin, Hui; Cai, Xiujun; Yang, Hua; Cairns, Rob A; Dorsch, Marion; Su, Shinsan M; Biller, Scott; Mak, Tak W; Cang, Yong
2015-07-21
Mitochondrial aldehyde dehydrogenase 2 (ALDH2) in the liver removes toxic aldehydes including acetaldehyde, an intermediate of ethanol metabolism. Nearly 40% of East Asians inherit an inactive ALDH2*2 variant, which has a lysine-for-glutamate substitution at position 487 (E487K), and show a characteristic alcohol flush reaction after drinking and a higher risk for gastrointestinal cancers. Here we report the characterization of knockin mice in which the ALDH2(E487K) mutation is inserted into the endogenous murine Aldh2 locus. These mutants recapitulate essentially all human phenotypes including impaired clearance of acetaldehyde, increased sensitivity to acute or chronic alcohol-induced toxicity, and reduced ALDH2 expression due to a dominant-negative effect of the mutation. When treated with a chemical carcinogen, these mutants exhibit increased DNA damage response in hepatocytes, pronounced liver injury, and accelerated development of hepatocellular carcinoma (HCC). Importantly, ALDH2 protein levels are also significantly lower in patient HCC than in peritumor or normal liver tissues. Our results reveal that ALDH2 functions as a tumor suppressor by maintaining genomic stability in the liver, and the common human ALDH2 variant would present a significant risk factor for hepatocarcinogenesis. Our study suggests that the ALDH2*2 allele-alcohol interaction may be an even greater human public health hazard than previously appreciated.
Montgomery, Tinika A; Xu, Leyuan; Mason, Sherene; Chinnadurai, Amirtha; Lee, Chun Geun; Elias, Jack A; Cantley, Lloyd G
2017-11-01
The normal response to kidney injury includes a robust inflammatory infiltrate of PMNs and macrophages. We previously showed that the small secreted protein breast regression protein-39 (BRP-39), also known as chitinase 3-like 1 (CHI3L1) and encoded by the Chi3l1 gene, is expressed at high levels by macrophages during the early stages of kidney repair and promotes tubular cell survival via IL-13 receptor α 2 (IL13R α 2)-mediated signaling. Here, we investigated the role of BRP-39 in profibrotic responses after AKI. In wild-type mice, failure to resolve tubular injury after unilateral ischemia-reperfusion injury (U-IRI) led to sustained low-level Chi3l1 mRNA expression by renal cells and promoted macrophage persistence and severe interstitial fibrosis. Analysis of macrophages isolated from wild-type kidneys 14 days after U-IRI revealed high-level expression of the profibrotic BRP-39 receptor Ptgdr2 / Crth2 and expression of the profibrotic markers Lgals3 , Pdgfb , Egf , and Tgfb In comparison, injured kidneys from mice lacking BRP-39 had significantly fewer macrophages, reduced expression of profibrotic growth factors, and decreased accumulation of extracellular matrix. BRP-39 depletion did not affect myofibroblast accumulation but did attenuate myofibroblast expression of Col1a1 , Col3a1 , and Fn1 Together, these results identify BRP-39 as an important activator of macrophage-myofibroblast crosstalk and profibrotic signaling in the setting of maladaptive kidney repair. Copyright © 2017 by the American Society of Nephrology.
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
DA-9801 promotes neurite outgrowth via ERK1/2-CREB pathway in PC12 cells.
Won, Jong Hoon; Ahn, Kyong Hoon; Back, Moon Jung; Ha, Hae Chan; Jang, Ji Min; Kim, Ha Hyung; Choi, Sang-Zin; Son, Miwon; Kim, Dae Kyong
2015-01-01
In the present study, we examined the mechanisms underlying the effect of DA-9801 on neurite outgrowth. We found that DA-9801 elicits its effects via the mitogen-activated protein kinase (MEK) extracellular signal-regulated kinase (ERK)1/2-cAMP response element-binding protein (CREB) pathway. DA-9801, an extract from a mixture of Dioscorea japonica and Dioscorea nipponica, was reported to promote neurite outgrowth in PC12 cells. The effects of DA-9801 on cell viability and expression of neuronal markers were evaluated in PC12 cells. To investigate DA-9801 action, specific inhibitors targeting the ERK signaling cascade were used. No cytotoxicity was observed in PC12 cells at DA-9801 concentrations of less than 30 µg/mL. In the presence of nerve growth factor (NGF, 2 ng/mL), DA-9801 promoted neurite outgrowth and increased the relative mRNA levels of neurofilament-L (NF-L), a marker of neuronal differentiation. The Raf-1 inhibitor GW5074 and MEK inhibitor PD98059 significantly attenuated DA-9801-induced neurite outgrowth. Additionally, the MEK1 and MEK2 inhibitor SL327 significantly attenuated the increase in the percentage of neurite-bearing PC12 cells induced by DA-9801 treatment. Conversely, the selective p38 mitogen-activated protein kinase inhibitor SB203580 did not attenuate the DA-9801 treatment-induced increase in the percentage of neurite-bearing PC12 cells. DA-9801 enhanced the phosphorylation of ERK1/2 and CREB in PC12 cells incubated with and without NGF. Pretreatment with PD98059 blocked the DA-9801-induced phosphorylation of ERK1/2 and CREB. In conclusion, DA-9801 induces neurite outgrowth by affecting the ERK1/2-CREB signaling pathway. Insights into the mechanism underlying this effect of DA-9801 may suggest novel potential strategies for the treatment of peripheral neuropathy.
Directory of Open Access Journals (Sweden)
Nannenga Brent L
2011-12-01
Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.
An, Ming-Xin; Li, Si; Yao, Han-Bing; Li, Chao; Wang, Jia-Mei; Sun, Jia; Li, Xin-Yu; Meng, Xiao-Na; Wang, Hua-Qin
2017-12-04
Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents. © 2017 An et al.
Directory of Open Access Journals (Sweden)
Popović Svetlana S.
2011-01-01
Full Text Available Membrane filtration has become one of the major technologies in the food industry. It is widely applied in the dairy industry, and it is mostly used for the concentration and fractionation of milk proteins and for the whey processing. Of all pressure driven membrane processes, ultrafiltration is the most widely used. The major disadvantage of pressure driven membrane processes is severe fouling of membrane during filtration particularly when the fluids containing proteins are processed. Fouling with proteins is complex phenomenon because it occurs at the membrane surface as well as in the pores of membrane, and depends on the operating conditions and on the interactions of proteins and membrane material. In order to reduce fouling of the membrane different techniques have been developed, and one of them relies on the changing of the hydrodynamic conditions in the membrane or module. In this study, influence of twisted tape turbulence promoters on the fouling reduction in cross-flow microfiltration of skim milk was investigated. Twisted tapes with tree characteristic ratios of helix element length to the tape diameter (aspect ratio were studied. It was shown that twisted tapes with different aspect ratios reduce fouling of membrane by a factor of three or more. The presence of twisted tape induces changes in the flow patterns from straight to helicoidally thus producing turbulence flow at the lower cross-flow rates. Turbulence intensification prevents accumulation of proteins at membrane surface enabling reduction in reversible fouling what results in the reduction of overall membrane fouling. The best performance was achieved using a twisted tape with the lowest aspect ratio of 1.0. This promoter reduces fouling seven times at low transmembrane pressure and low cross-flow velocity. The twisted tape with aspect ratio 1.0 induces the most intensive turbulence, the longest helicoidal flow path, and appearance of vortices near the membrane surfaces
Energy Technology Data Exchange (ETDEWEB)
Seo, Young-Kyo [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Zhu, Bing [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0144 (United States); Jeon, Tae-Il [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Osborne, Timothy F., E-mail: tfosborn@uci.edu [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States)
2009-11-01
In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.
International Nuclear Information System (INIS)
Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.
2009-01-01
In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.
Directory of Open Access Journals (Sweden)
D Malfacini
Full Text Available Nociceptin/orphanin FQ (N/OFQ controls several biological functions by selectively activating an opioid like receptor named N/OFQ peptide receptor (NOP. Biased agonism is emerging as an important and therapeutically relevant pharmacological concept in the field of G protein coupled receptors including opioids. To evaluate the relevance of this phenomenon in the NOP receptor, we used a bioluminescence resonance energy transfer technology to measure the interactions of the NOP receptor with either G proteins or β-arrestin 2 in the absence and in presence of increasing concentration of ligands. A large panel of receptor ligands was investigated by comparing their ability to promote or block NOP/G protein and NOP/arrestin interactions. In this study we report a systematic analysis of the functional selectivity of NOP receptor ligands. NOP/G protein interactions (investigated in cell membranes allowed a precise estimation of both ligand potency and efficacy yielding data highly consistent with the known pharmacological profile of this receptor. The same panel of ligands displayed marked differences in the ability to promote NOP/β-arrestin 2 interactions (evaluated in whole cells. In particular, full agonists displayed a general lower potency and for some ligands an inverted rank order of potency was noted. Most partial agonists behaved as pure competitive antagonists of receptor/arrestin interaction. Antagonists displayed similar values of potency for NOP/Gβ1 or NOP/β-arrestin 2 interaction. Using N/OFQ as reference ligand we computed the bias factors of NOP ligands and a number of agonists with greater efficacy at G protein coupling were identified.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Cunzhen; Chen, Xiaochang; Wu, Wenjing; Wang, Wusu; Pang, Weijun; Yang, Gongshe, E-mail: gsyang999@hotmail.com
2016-05-15
Intramuscular fat (IMF) has been demonstrated as one of the crucial factors of livestock meat quality. The MAT2B protein with MAT2α catalyzes the formation of methyl donor S- adenosylmethionine (SAMe) to mediate cell metabolism including proliferation and apoptosis. However, the regulatory effect of MAT2B on IMF deposition is still unclear. In this study, the effect of MAT2B on adipogenesis and its potential mechanism during porcine intramuscular preadipocyte differentiation was studied. The results showed that overexpression of MAT2B promoted adipogenesis and significantly up-regulated the mRNA and protein levels of adipogenic marker genes including FASN, PPARγ and aP2, consistently, knockdown of MAT2B inhibited lipid accumulation and down-regulated the mRNA and protein levels of the above genes. Furthermore, flow cytometry and EdU-labeling assay indicated that MAT2B regulate adipogenesis was partly due to influence intracellular SAMe levels and further affect cell clonal expansion. Also, increased expression of MAT2B activated the phosphorylations of AKT and ERK1/2, whereas knockdown of MAT2B blocked AKT signaling and repressed the phosphorylation of ERK1/2. Moreover, the inhibitory effect of LY294002 (a specific PI3K inhibitor) on the activities of AKT and ERK1/2 was partially recovered by overexpression of MAT2B in porcine intramuscular adipocytes. Finally, Co-IP experiments showed that MAT2B can directly interact with AKT. Taken together, our findings suggested that MAT2B acted as a positive regulator through modifying SAMe levels as well as activating AKT/ERK signaling pathway to promote porcine intramuscular adipocyte differentiation. - Highlights: • MAT2B up-regulates the expression of adipogenic marker genes and promotes porcine intramuscular preadipocyte differentiation. • MAT2B influences intracellular SAMe levels and further affects cell clonal expansion. • MAT2B interacts with AKT and activates AKT/ERK signaling pathway.
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73
International Nuclear Information System (INIS)
Zhang Heng; Wu Shengnan
2011-01-01
p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.
Lead inhibition of DNA-binding mechanism of Cys(2)His(2) zinc finger proteins.
Hanas, J S; Rodgers, J S; Bantle, J A; Cheng, Y G
1999-11-01
The association of lead with chromatin in cells suggests that deleterious metal effects may in part be mediated through alterations in gene function. To elucidate if and how lead may alter DNA binding of cysteine-rich zinc finger proteins, lead ions were analyzed for their ability to alter the DNA binding mechanism of the Cys(2)His(2) zinc finger protein transcription factor IIIA (TFIIIA). As assayed by DNase I protection, the interaction of TFIIIA with the 50-bp internal control region of the 5S ribosomal gene was partially inhibited by 5 microM lead ions and completely inhibited by 10 to 20 microM lead ions. Preincubation of free TFIIIA with lead resulted in DNA-binding inhibition, whereas preincubation of a TFIIIA/5S RNA complex with lead did not result in DNA-binding inhibition. Because 5S RNA binds TFIIIA zinc fingers, this result is consistent with an inhibition mechanism via lead binding to zinc fingers. The complete loss of DNase I protection on the 5S gene indicates the mechanism of inhibition minimally involves the N-terminal fingers of TFIIIA. Inhibition was not readily reversible and occurred in the presence of an excess of beta-mercaptoethanol. Inhibition kinetics were fast, progressing to completion in approximately 5 min. Millimolar concentrations of sulfhydryl-specific arsenic ions were not inhibitory for TFIIIA binding. Micromolar concentrations of lead inhibited DNA binding by Sp1, another Cys(2)His(2) finger protein, but not by the nonfinger protein AP2. Inhibition of Cys(2)His(2) zinc finger transcription factors by lead ions at concentrations near those known to have deleterious physiological effects points to new molecular mechanisms for lead toxicity in promoting disease.
Shi, H B; Yu, K; Luo, J; Li, J; Tian, H B; Zhu, J J; Sun, Y T; Yao, D W; Xu, H F; Shi, H P; Loor, J J
2015-10-01
Milk fat originates from the secretion of cytosolic lipid droplets (CLD) synthesized within mammary epithelial cells. Adipocyte differentiation-related protein (ADRP; gene symbol PLIN2) is a CLD-binding protein that is crucial for synthesis of mature CLD. Our hypothesis was that ADRP regulates CLD production and metabolism in goat mammary epithelial cells (GMEC) and thus plays a role in determining milk fat content. To understand the role of ADRP in ruminant milk fat metabolism, ADRP (PLIN2) was overexpressed or knocked down in GMEC using an adenovirus system. Immunocytochemical staining revealed that ADRP localized to the surface of CLD. Supplementation with oleic acid (OA) enhanced its colocalization with CLD surface and enhanced lipid accumulation. Overexpression of ADRP increased lipid accumulation and the concentration of triacylglycerol in GMEC. In contrast, morphological examination revealed that knockdown of ADRP decreased lipid accumulation even when OA was supplemented. This response was confirmed by the reduction in mass of cellular TG when ADRP was knocked down. The fact that knockdown of ADRP did not completely eliminate lipid accumulation at a morphological level in GMEC without OA suggests that some other compensatory factors may also aid in the process of CLD formation. The ADRP reversed the decrease of CLD accumulation induced by adipose triglyceride lipase. This is highly suggestive of ADRP promoting triacylglycerol stability within CLD by preventing access to adipose triglyceride lipase. Collectively, these data provide direct in vitro evidence that ADRP plays a key role in CLD formation and stability in GMEC. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Health issues of whey proteins: 2. Weight management
Schaafsma, G.
2006-01-01
The increasing prevalence in many countries of people with overweight and obesity is undoubtedly one of the biggest threats to public health. Dietary proteins, because of their positive effects on satiation/satiety, may help to reduce energy intake and promote a healthy body composition with Less
Lai, Yu-Chiang; Liu, Yang; Jacobs, Roxane; Rider, Mark H
2012-10-01
PKB (protein kinase B), also known as Akt, is a key component of insulin signalling. Defects in PKB activation lead to insulin resistance and metabolic disorders, whereas PKB overactivation has been linked to tumour growth. Small-molecule PKB inhibitors have thus been developed for cancer treatment, but also represent useful tools to probe the roles of PKB in insulin action. In the present study, we examined the acute effects of two allosteric PKB inhibitors, MK-2206 and Akti 1/2 (Akti) on PKB signalling in incubated rat soleus muscles. We also assessed the effects of the compounds on insulin-stimulated glucose uptake, glycogen and protein synthesis. MK-2206 dose-dependently inhibited insulin-stimulated PKB phosphorylation, PKBβ activity and phosphorylation of PKB downstream targets (including glycogen synthase kinase-3α/β, proline-rich Akt substrate of 40 kDa and Akt substrate of 160 kDa). Insulin-stimulated glucose uptake, glycogen synthesis and glycogen synthase activity were also decreased by MK-2206 in a dose-dependent manner. Incubation with high doses of MK-2206 (10 μM) inhibited insulin-induced p70 ribosomal protein S6 kinase and 4E-BP1 (eukaryotic initiation factor 4E-binding protein-1) phosphorylation associated with increased eEF2 (eukaryotic elongation factor 2) phosphorylation. In contrast, Akti only modestly inhibited insulin-induced PKB and mTOR (mammalian target of rapamycin) signalling, with little or no effect on glucose uptake and protein synthesis. MK-2206, rather than Akti, would thus be the tool of choice for studying the role of PKB in insulin action in skeletal muscle. The results point to a key role for PKB in mediating insulin-stimulated glucose uptake, glycogen synthesis and protein synthesis in skeletal muscle.
PPARγ activates ABCA1 gene transcription but reduces the level of ABCA1 protein in HepG2 cells
International Nuclear Information System (INIS)
Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Orlov, Sergey V.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → PPARγ activates ABCA1 gene expression but decreases ABCA1 protein content in human hepatoma cell line HepG2. → Treatment of HepG2 cells with PPARγ agonist GW1929 leads to dissociation of LXRβ from ABCA1-LXRβ complex. → Inhibition of protein kinases MEK1/2 abolishes PPARγ-mediated dissociation of LXRβ from ABCA1/LXRβ complex. → Activation of PPARγ leads to increasing of the level of LXRβ associated with LXRE within ABCA1 gene promoter. -- Abstract: Synthesis of ABCA1 protein in liver is necessary for high-density lipoproteins (HDL) formation in mammals. Nuclear receptor PPARγ is known as activator of ABCA1 expression, but details of PPARγ-mediated regulation of ABCA1 at both transcriptional and post-transcriptional levels in hepatocytes have not still been well elucidated. In this study we have shown, that PPARγ activates ABCA1 gene transcription in human hepatoma cells HepG2 through increasing of LXRβ binding with promoter region of ABCA1 gene. Treatment of HepG2 cells with PPARγ agonist GW1929 leads to dissociation of LXRβ from ABCA1/LXRβ complex and to nuclear translocation of this nuclear receptor resulting in reduction of ABCA1 protein level 24 h after treatment. Inhibition of protein kinases MEK1/2 abolishes PPARγ-mediated dissociation of LXRβ from ABCA1/LXRβ complex, but does not block PPARγ-dependent down-regulation of ABCA1 protein in HepG2 cells. These data suggest that PPARγ may be important for regulation of the level of hepatic ABCA1 protein and indicate the new interplays between PPARγ, LXRβ and MEK1/2 in regulation of ABCA1 mRNA and protein expression.
Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H
2014-05-23
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
Directory of Open Access Journals (Sweden)
Ramesh K. Jha
2018-06-01
Full Text Available Robust fluorescence-based biosensors are emerging as critical tools for high-throughput strain improvement in synthetic biology. Many biosensors are developed in model organisms where sophisticated synthetic biology tools are also well established. However, industrial biochemical production often employs microbes with phenotypes that are advantageous for a target process, and biosensors may fail to directly transition outside the host in which they are developed. In particular, losses in sensitivity and dynamic range of sensing often occur, limiting the application of a biosensor across hosts. Here we demonstrate the optimization of an Escherichia coli-based biosensor in a robust microbial strain for the catabolism of aromatic compounds, Pseudomonas putida KT2440, through a generalizable approach of modulating interactions at the protein-DNA interface in the promoter and the protein-protein dimer interface. The high-throughput biosensor optimization approach demonstrated here is readily applicable towards other allosteric regulators. Keywords: Whole cell biosensor, Aromatic catabolism, Transcription factor, PcaU, Shikimate
Directory of Open Access Journals (Sweden)
Coker Robert H
2012-12-01
Full Text Available Abstract Background Excess adipose tissue and sarcopenia presents a multifaceted clinical challenge that promotes morbidity and mortality in the obese, elderly population. Unfortunately, the mortality risks of muscle loss may outweigh the potential benefits of weight loss in the elderly. We have previously demonstrated the effectiveness of whey protein and essential amino acids towards the preservation of lean tissue, even under the conditions of strict bedrest in the elderly. Methods In the context of caloric restriction-based weight loss, we hypothesized that a similar formulation given as a meal replacement (EAAMR would foster the retention of lean tissue through an increase in the skeletal muscle fractional synthesis rate (FSR. We also proposed that EAAMR would promote the preferential loss of adipose tissue through the increased energy cost of skeletal muscle FSR. We recruited and randomized 12 elderly individuals to an 8 week, caloric restriction diet utilizing equivalent caloric meal replacements (800 kcal/day: 1 EAAMR or a 2 competitive meal replacement (CMR in conjunction with 400 kcal of solid food that totaled 1200 kcal/day designed to induce 7% weight loss. Combined with weekly measurements of total body weight and body composition, we also measured the acute change in the skeletal muscle FSR to EAAMR and CMR. Results By design, both groups lost ~7% of total body weight. While EAAMR did not promote a significant preservation of lean tissue, the reduction in adipose tissue was greater in EAAMR compared to CMR. Interestingly, these results corresponded to an increase in the acute skeletal muscle protein FSR. Conclusion The provision of EAAMR during caloric restriction-induced weight loss promotes the preferential reduction of adipose tissue and the modest loss of lean tissue in the elderly population.
Directory of Open Access Journals (Sweden)
Javier Encinar del Dedo
2015-03-01
Full Text Available Iron is an essential cofactor, but it is also toxic at high levels. In Schizosaccharomyces pombe, the sensor glutaredoxin Grx4 guides the activity of the repressors Php4 and Fep1 to mediate a complex transcriptional response to iron deprivation: activation of Php4 and inactivation of Fep1 leads to inhibition of iron usage/storage, and to promotion of iron import, respectively. However, the molecular events ruling the activity of this double-branched pathway remained elusive. We show here that Grx4 incorporates a glutathione-containing iron-sulfur cluster, alone or forming a heterodimer with the BolA-like protein Fra2. Our genetic study demonstrates that Grx4-Fra2, but not Fep1 nor Php4, participates not only in iron starvation signaling but also in iron-related aerobic metabolism. Iron-containing Grx4 binds and inactivates the Php4 repressor; upon iron deprivation, the cluster in Grx4 is probably disassembled, the proteins dissociate, and Php4 accumulates at the nucleus and represses iron consumption genes. Fep1 is also an iron-containing protein, and the tightly bound iron is required for transcriptional repression. Our data suggest that the cluster-containing Grx4-Fra2 heterodimer constitutively binds to Fep1, and upon iron deprivation the disassembly of the iron cluster between Grx4 and Fra2 promotes reverse metal transfer from Fep1 to Grx4-Fra2, and de-repression of iron-import genes. Our genetic and biochemical study demonstrates that the glutaredoxin Grx4 independently governs the Php4 and Fep1 repressors through metal transfer. Whereas iron loss from Grx4 seems to be sufficient to release Php4 and allow its nuclear accumulation, total or partial disassembly of the Grx4-Fra2 cluster actively participates in iron-containing Fep1 activation by sequestering its iron and decreasing its interaction with promoters.
Zhang, Ruowen; Che, Xun; Zhang, Jingjie; Li, Yang; Li, Jingxia; Deng, Xu; Zhu, Junlan; Jin, Honglei; Zhao, Qinshi; Huang, Chuanshu
2016-10-11
Cheliensisin A (Chel A), a styryl-lactone compound extracted from Goniothalamus cheliensis, is reported to have significant anti-cancer effects in various cancer cells. Here we demonstrated that Chel A treatment resulted in apoptosis and an inhibition of anchorage-independent growth in human bladder cancer T24, T24T and U5637 cells. Mechanistic studies showed that such effect is mediated by PH domain and Leucine rich repeat Protein Phosphatases (PHLPP2) protein. Chel A treatment led to PHLPP2 degradation and subsequently increased in c-Jun phosphorylation. Moreover PHLPP2 degradation could be attenuated by inhibition of autophagy, which was mediated by Beclin 1. Collectively, we discover that Chel A treatment induces Beclin-dependent autophagy, consequently mediates PHLPP2 degradation and JNK/C-Jun phosphorylation and activation, further in turn contributing to apoptosis in human bladder cancer cells. Current studies provide a significant insight into understanding of anticancer effect of Chel A in treatment of human bladder cancer.
Emanuele, Michael J; Ciccia, Alberto; Elia, Andrew E H; Elledge, Stephen J
2011-06-14
The anaphase-promoting complex/cyclosome (APC/C) is a cell cycle-regulated E3 ubiquitin ligase that controls the degradation of substrate proteins at mitotic exit and throughout the G1 phase. We have identified an APC/C substrate and cell cycle-regulated protein, KIAA0101/PAF15. PAF15 protein levels peak in the G2/M phase of the cell cycle and drop rapidly at mitotic exit in an APC/C- and KEN-box-dependent fashion. PAF15 associates with proliferating cell nuclear antigen (PCNA), and depletion of PAF15 decreases the number of cells in S phase, suggesting a role for it in cell cycle regulation. Following irradiation, PAF15 colocalized with γH2AX foci at sites of DNA damage through its interaction with PCNA. Finally, PAF15 depletion led to an increase in homologous recombination-mediated DNA repair, and overexpression caused sensitivity to UV-induced DNA damage. We conclude that PAF15 is an APC/C-regulated protein involved in both cell cycle progression and the DNA damage response.
The Function of Thioredoxin-Binding Protein-2 (TBP-2 in Different Diseases
Directory of Open Access Journals (Sweden)
Jianghua Hu
2018-01-01
Full Text Available Thioredoxin-binding protein-2 (TBP-2 has an important role in the redox system, but it plays a different role in many different diseases (e.g., various cancers, diabetes mellitus (DM, cardiovascular disease, and cataracts by influencing cell proliferation, differentiation, apoptosis, autophagy, and metabolism. Distinct transcription factors (TFs stimulated by different factors combine with binding sites or proteins to upregulate or downregulate TBP-2 expression, in order to respond to the change in the internal environment. Most research disclosed that the main function of TBP-2 is associating with thioredoxin (Trx to inhibit the antioxidant capacity of Trx. Furthermore, the TBP-2 located in tissues, whether normal or abnormal, has the ability to cause the dysfunctioning of cells and even death through different pathways, such as shortening the cell cycle and inducing apoptosis or autophagy. Through these studies, we found that TBP-2 promoted the development of diseases which are involved in inflammatory and oxidative damage. To a certain extent, we believe that there is some hidden connection between the biological functions which TBP-2 participates in and some distinct diseases. This review presents only a summary of the roles that TBP-2 plays in cancer, DM, cataracts, and so on, as well as its universal mechanisms. Further investigations are needed for the cell signaling pathways of the effects caused by TBP-2. A greater understanding of the mechanisms of TBP-2 could produce potential new targets for the treatment of diseases, including cancer and diabetes, cardiovascular disease, and cataracts.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost
2002-08-01
Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.
Multi-tasking role of the mechanosensing protein Ankrd2 in the signaling network of striated muscle.
Directory of Open Access Journals (Sweden)
Anna Belgrano
Full Text Available Ankrd2 (also known as Arpp together with Ankrd1/CARP and DARP are members of the MARP mechanosensing proteins that form a complex with titin (N2A/calpain 3 protease/myopalladin. In muscle, Ankrd2 is located in the I-band of the sarcomere and moves to the nucleus of adjacent myofibers on muscle injury. In myoblasts it is predominantly in the nucleus and on differentiation shifts from the nucleus to the cytoplasm. In agreement with its role as a sensor it interacts both with sarcomeric proteins and transcription factors.Expression profiling of endogenous Ankrd2 silenced in human myotubes was undertaken to elucidate its role as an intermediary in cell signaling pathways. Silencing Ankrd2 expression altered the expression of genes involved in both intercellular communication (cytokine-cytokine receptor interaction, endocytosis, focal adhesion, tight junction, gap junction and regulation of the actin cytoskeleton and intracellular communication (calcium, insulin, MAPK, p53, TGF-β and Wnt signaling. The significance of Ankrd2 in cell signaling was strengthened by the fact that we were able to show for the first time that Nkx2.5 and p53 are upstream effectors of the Ankrd2 gene and that Ankrd1/CARP, another MARP member, can modulate the transcriptional ability of MyoD on the Ankrd2 promoter. Another novel finding was the interaction between Ankrd2 and proteins with PDZ and SH3 domains, further supporting its role in signaling. It is noteworthy that we demonstrated that transcription factors PAX6, LHX2, NFIL3 and MECP2, were able to bind both the Ankrd2 protein and its promoter indicating the presence of a regulatory feedback loop mechanism.In conclusion we demonstrate that Ankrd2 is a potent regulator in muscle cells affecting a multitude of pathways and processes.
Hamarsland, Håvard; Nordengen, Anne Lene; Nyvik Aas, Sigve; Holte, Kristin; Garthe, Ina; Paulsen, Gøran; Cotter, Matthew; Børsheim, Elisabet; Benestad, Haakon B; Raastad, Truls
2017-01-01
Protein intake is essential to maximally stimulate muscle protein synthesis, and the amino acid leucine seems to possess a superior effect on muscle protein synthesis compared to other amino acids. Native whey has higher leucine content and thus a potentially greater anabolic effect on muscle than regular whey (WPC-80). This study compared the acute anabolic effects of ingesting 2 × 20 g of native whey protein, WPC-80 or milk protein after a resistance exercise session. A total of 24 young resistance trained men and women took part in this double blind, randomized, partial crossover, controlled study. Participants received either WPC-80 and native whey ( n = 10), in a crossover design, or milk ( n = 12). Supplements were ingested immediately (20 g) and two hours after (20 g) a bout of heavy-load lower body resistance exercise. Blood samples and muscle biopsies were collected to measure plasma concentrations of amino acids by gas-chromatography mass spectrometry, muscle phosphorylation of p70S6K, 4E-BP1 and eEF-2 by immunoblotting, and mixed muscle protein synthesis by use of [ 2 H 5 ]phenylalanine-infusion, gas-chromatography mass spectrometry and isotope-ratio mass spectrometry. Being the main comparison, differences between native whey and WPC-80 were analysed by a one-way ANOVA and comparisons between the whey supplements and milk were analysed by a two-way ANOVA. Native whey increased blood leucine concentrations more than WPC-80 and milk ( P whey ingestion induced a greater phosphorylation of p70S6K than milk 180 min after exercise ( P = 0.03). Muscle protein synthesis rates increased 1-3 h hours after exercise with WPC-80 (0.119%), and 1-5 h after exercise with native whey (0.112%). Muscle protein synthesis rates were higher 1-5 h after exercise with native whey than with milk (0.112% vs. 0.064, P = 0.023). Despite higher-magnitude increases in blood leucine concentrations with native whey, it was not superior to WPC-80
Directory of Open Access Journals (Sweden)
Luftig Ronald
2007-09-01
Full Text Available Abstract Background Alpha interferon in combination with ribavirin is the standard therapy for hepatitis C virus infection. Unfortunately, a significant number of patients fail to eradicate their infection with this regimen. The mechanisms of IFN-resistance are unclear. The aim of this study was to determine the contribution of host cell factors to the mechanisms of interferon resistance using replicon cell lines. Results HCV replicons with high and low activation of the IFN-promoter were cultured for a prolonged period of time in the presence of interferon-alpha (IFN-alpha2b. Stable replicon cell lines with resistant phenotype were isolated and characterized by their ability to continue viral replication in the presence of IFN-alpha. Interferon resistant cell colonies developed only in replicons having lower activation of the IFN promoter and no resistant colonies arose from replicons that exhibit higher activation of the IFN promoter. Individual cell clones were isolated and nine IFN resistant cell lines were established. HCV RNA and protein levels in these cells were not altered by IFN- alpha2b. Reduced signaling and IFN-resistant phenotype was found in all Huh-7 cell lines even after eliminating HCV, suggesting that cellular factors are involved. Resistant phenotype in the replicons is not due to lack of interferon receptor expression. All the cell lines show defect in the JAK-STAT signaling and phosphorylation of STAT 1 and STAT 2 proteins were strongly inhibited due to reduced expression of Tyk2 and Jak-1 protein. Conclusion This in vitro study provides evidence that altered expression of the Jak-Stat signaling proteins can cause IFN resistance using HCV replicon cell clones.
Directory of Open Access Journals (Sweden)
Changsong Yu
2016-05-01
Full Text Available Glucagon-like peptide-2 (GLP-2 is important for intestinal barrier function and regulation of tight junction (TJ proteins, but the intracellular mechanisms of action remain undefined. The purpose of this research was to determine the protective effect of GLP-2 mediated TJ and transepithelial electrical resistance (TER in lipopolysaccharide (LPS stressed IPEC-J2 cells and to test the hypothesis that GLP-2 regulate TJ and TER through the phosphatidylinositol 3-kinase (PI3K-protein kinase B (Akt-mammalian target of rapamycin (mTOR signaling pathway in IPEC-J2 cells. Wortmannin and LY294002 are specific inhibitors of PI3K. The results showed that 100 μg/mL LPS stress decreased TER and TJ proteins occludin, claudin-1 and zonula occludens protein 1 (ZO-1 mRNA, proteins expressions (p<0.01 respectively. GLP-2 (100 nmol/L promote TER and TJ proteins occludin, claudin-1, and zo-1 mRNA, proteins expressions in LPS stressed and normal IPEC-J2 cells (p<0.01 respectively. In normal cells, both wortmannin and LY294002, PI3K inhibitors, prevented the mRNA and protein expressions of Akt and mTOR increase induced by GLP-2 (p<0.01 following with the significant decreasing of occludin, claudin-1, ZO-1 mRNA and proteins expressions and TER (p<0.01. In conclusion, these results indicated that GLP-2 can promote TJ’s expression and TER in LPS stressed and normal IPEC-J2 cells and GLP-2 could regulate TJ and TER through the PI3K/Akt/mTOR pathway.
Zhao, Huan-Yu; Han, Yang; Wang, Jian; Yang, Lian-He; Zheng, Xiao-Ying; Du, Jiang; Wu, Guang-Ping; Wang, En-Hua
2017-06-01
IQ-domain GTPase-activating protein 1 is a scaffolding protein with multidomain which plays a role in modulating dishevelled (Dvl) nuclear translocation in canonical Wnt pathway. However, the biological function and mechanism of IQ-domain GTPase-activating protein 1 in invasive ductal carcinoma (IDC) remain unknown. In this study, we found that IQ-domain GTPase-activating protein 1 expression was elevated in invasive ductal carcinoma, which was positively correlated with tumor grade, lymphatic metastasis, and poor prognosis. Coexpression of IQ-domain GTPase-activating protein 1 and Dvl in the nucleus and cytoplasm of invasive ductal carcinoma was significantly correlated but not in the membrane. Postoperative survival in the patients with their coexpression in the nucleus and cytoplasm was obviously lower than that without coexpression. The positive expression rates of c-myc and cyclin D1 were significantly higher in the patients with nuclear coexpression of Dvl and IQ-domain GTPase-activating protein 1 than that with cytoplasmic coexpression, correlating with poor prognosis. IQ-domain GTPase-activating protein 1 significantly enhanced cell proliferation and invasion in invasive ductal carcinoma cell lines by interacting with Dvl in cytoplasm to promote Dvl nuclear translocation so as to upregulate the expression of c-myc and cyclin D1. Collectively, our data suggest that IQ-domain GTPase-activating protein 1 may promote the malignant phenotype of invasive ductal carcinoma via canonical Wnt signaling, and it could be used as a potential prognostic biomarker for breast cancer patients.
Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways.
Corrochano, Alberto R; Buckin, Vitaly; Kelly, Phil M; Giblin, Linda
2018-03-28
Oxidative stress contributes to cell injury and aggravates several chronic diseases. Dietary antioxidants help the body to fight against free radicals and, therefore, avoid or reduce oxidative stress. Recently, proteins from milk whey liquid have been described as antioxidants. This review summarizes the evidence that whey products exhibit radical scavenging activity and reducing power. It examines the processing and treatment attempts to increase the antioxidant bioactivity and identifies 1 enzyme, subtilisin, which consistently produces the most potent whey fractions. The review compares whey from different milk sources and puts whey proteins in the context of other known food antioxidants. However, for efficacy, the antioxidant activity of whey proteins must not only survive processing, but also upper gut transit and arrival in the bloodstream, if whey products are to promote antioxidant levels in target organs. Studies reveal that direct cell exposure to whey samples increases intracellular antioxidants such as glutathione. However, the physiological relevance of these in vitro assays is questionable, and evidence is conflicting from dietary intervention trials, with both rats and humans, that whey products can boost cellular antioxidant biomarkers. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Cho, Eun-Ah [Department of Biochemistry and Molecular Biology, Cancer Research Center, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr [Department of Biochemistry and Molecular Biology, Cancer Research Center, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)
2012-06-01
Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma}-ray irradiation. From
Directory of Open Access Journals (Sweden)
Nomeda Girnius
2017-11-01
Full Text Available Summary: Developmental morphogenesis, tissue injury, and oncogenic transformation can cause the detachment of epithelial cells. These cells are eliminated by a specialized form of apoptosis (anoikis. While the processes that contribute to this form of cell death have been studied, the underlying mechanisms remain unclear. Here, we tested the role of the cJUN NH2-terminal kinase (JNK signaling pathway using murine models with compound JNK deficiency in mammary and kidney epithelial cells. These studies demonstrated that JNK is required for efficient anoikis in vitro and in vivo. Moreover, JNK-promoted anoikis required pro-apoptotic members of the BCL2 family of proteins. We show that JNK acts through a BAK/BAX-dependent apoptotic pathway by increasing BIM expression and phosphorylating BMF, leading to death of detached epithelial cells. : Developmental morphogenesis, tissue injury, and oncogenic transformation can cause epithelial cell detachment. These cells are eliminated by a specialized form of apoptosis termed anoikis. Girnius and Davis show that anoikis is mediated by the cJUN NH2-terminal kinase (JNK, which increases BIM expression and phosphorylates BMF to engage BAK/BAX-dependent apoptosis. Keywords: apoptosis, anoikis, epithelial cell, mammary gland, JNK, BAX, BAK, BH3-only protein, BIM, BMF
DEFF Research Database (Denmark)
Boström, Pontus; Andersson, Linda; Vind, Birgitte
2010-01-01
/cytosolic compartment in the patients with the type 2 diabetes. Expression of the SNARE-interacting protein Munc18c was higher in skeletal muscle from patients with type 2 diabetes. Studies in L6 cells showed that Munc18c promoted the expression of SNAP23. CONCLUSIONS: We have translated our previous in vitro results......OBJECTIVE: Our previous studies suggest that the SNARE protein synaptosomal-associated protein of 23 kDa (SNAP23) is involved in the link between increased lipid levels and insulin resistance in cardiomyocytes. The objective was to determine whether SNAP23 may also be involved in the known...... association between lipid accumulation in skeletal muscle and insulin resistance/type 2 diabetes in humans, as well as to identify a potential regulator of SNAP23. RESEARCH DESIGN AND METHODS: We analyzed skeletal muscle biopsies from patients with type 2 diabetes and healthy, insulin-sensitive control...
Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi
2016-12-28
Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Churchward-Venne, Tyler A; Murphy, Caoileann H; Longland, Thomas M; Phillips, Stuart M
2013-08-01
Amino acids are major nutrient regulators of muscle protein turnover. After protein ingestion, hyperaminoacidemia stimulates increased rates of skeletal muscle protein synthesis, suppresses muscle protein breakdown, and promotes net muscle protein accretion for several hours. These acute observations form the basis for strategized protein intake to promote lean mass accretion, or prevent lean mass loss over the long term. However, factors such as protein dose, protein source, and timing of intake are important in mediating the anabolic effects of amino acids on skeletal muscle and must be considered within the context of evaluating the reported efficacy of long-term studies investigating protein supplementation as part of a dietary strategy to promote lean mass accretion and/or prevent lean mass loss. Current research suggests that dietary protein supplementation can augment resistance exercise-mediated gains in skeletal muscle mass and strength and can preserve skeletal muscle mass during periods of diet-induced energy restriction. Perhaps less appreciated, protein supplementation can augment resistance training-mediated gains in skeletal muscle mass even in individuals habitually consuming 'adequate' (i.e., >0.8 g kg⁻¹ day⁻¹) protein. Additionally, overfeeding energy with moderate to high-protein intake (15-25 % protein or 1.8-3.0 g kg⁻¹ day⁻¹) is associated with lean, but not fat mass accretion, when compared to overfeeding energy with low protein intake (5 % protein or ~0.68 g kg⁻¹ day⁻¹). Amino acids represent primary nutrient regulators of skeletal muscle anabolism, capable of enhancing lean mass accretion with resistance exercise and attenuating the loss of lean mass during periods of energy deficit, although factors such as protein dose, protein source, and timing of intake are likely important in mediating these effects.
Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways
International Nuclear Information System (INIS)
Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki
2007-01-01
Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway
Smad3 induces atrogin-1, inhibits mTOR and protein synthesis, and promotes muscle atrophy in vivo.
Goodman, Craig A; McNally, Rachel M; Hoffmann, F Michael; Hornberger, Troy A
2013-11-01
Myostatin, a member of the TGF superfamily, is sufficient to induce skeletal muscle atrophy. Myostatin-induced atrophy is associated with increases in E3-ligase atrogin-1 expression and protein degradation and decreases in Akt/mechanistic target of rapamycin (mTOR) signaling and protein synthesis. Myostatin signaling activates the transcription factor Smad3 (Small Mothers Against Decapentaplegic), which has been shown to be necessary for myostatin-induced atrogin-1 expression and atrophy; however, it is not known whether Smad3 is sufficient to induce these events or whether Smad3 simply plays a permissive role. Thus, the aim of this study was to address these questions with an in vivo model. To accomplish this goal, in vivo transfection of plasmid DNA was used to create transient transgenic mouse skeletal muscles, and our results show for the first time that Smad3 expression is sufficient to stimulate atrogin-1 promoter activity, inhibit Akt/mTOR signaling and protein synthesis, and induce muscle fiber atrophy. Moreover, we propose that Akt/mTOR signaling is inhibited by a Smad3-induced decrease in microRNA-29 (miR-29) expression and a subsequent increase in the translation of phosphatase and tensin homolog (PTEN) mRNA. Smad3 is also sufficient to inhibit peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) promoter activity and to increase FoxO (Forkhead Box Protein, Subclass O)-mediated signaling and the promoter activity of plasminogen activator inhibitor 1 (PAI-1). Combined, this study provides the first evidence that Smad3 is sufficient to regulate many of the events associated with myostatin-induced atrophy and therefore suggests that Smad3 signaling may be a viable target for therapies aimed at preventing myostatin-induced muscle atrophy.
Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P
2016-07-29
Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Nour Eissa
Full Text Available Many animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR. No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE in DSS-experimental murine colitis.Colitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh, β-actin (Actb, or β2-microglobulin (β2m showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp and eukaryotic translation elongation factor 2 (Eef2 were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.This study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.
Sha, H.; Yang, L.; Liu, M.; Xia, S.; Liu, Y.; Liu, F.; Kersten, A.H.; Qi, L.
2014-01-01
The physiological role of the spliced form of X-box–binding protein 1 (XBP1s), a key transcription factor of the endoplasmic reticulum (ER) stress response, in adipose tissue remains largely unknown. In this study, we show that overexpression of XBP1s promotes adiponectin multimerization in
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
Li, Gongyu; Yuan, Siming; Zheng, Shihui; Chen, Yuting; Zheng, Zhen; Liu, Yangzhong; Huang, Guangming
2017-12-01
Specific protein-metal interactions (PMIs) fulfill essential functions in cells and organic bodies, and activation of these functions in vivo are mostly modulated by the complex environmental factors, including pH value, small biomolecules, and salts. Specifically, the role of salts in promoting specific PMIs and their competition among various metals has remained untapped mainly due to the difficulty to distinguish nonspecific PMIs from specific PMIs by classic spectroscopic techniques. Herein, we report Hofmeister salts differentially promote the specific PMIs by combining nanoelectrospray ionization mass spectrometry and spectroscopic techniques (fluorescence measurement and circular dichroism). Furthermore, to explore the influence of salts in competitive binding between metalloproteins and various metals, we designed a series of competitive experiments and applied to a well-defined model system, the competitive binding of zinc (II) and arsenic (III) to holo-promyelocytic leukemia protein (PML). These experiments not only provided new insights at the molecular scale as complementary to previous NMR and spectroscopic results, but also deduced the relative binding ability between zinc finger proteins and metals at the molecular scale, which avoids the mass spectrometric titration-based determination of binding constants that is frequently affected and often degraded by variable solution conditions including salt contents. [Figure not available: see fulltext.
Lifescience Database Archive (English)
Full Text Available MPB2 Ubiquitin ligases WWP1 WWP1 NEDD4-like E3 ubiquitin-protein ligase WWP1 Atrophin-1-interacting pr...otein 5, WW domain-containing protein 1 9606 Homo sapiens Q9H0M0 11059 2OP7, 1ND7 11059 ...
Schlessinger, J
1994-02-01
SH2 and SH3 domains are small protein modules that mediate protein-protein interactions in signal transduction pathways that are activated by protein tyrosine kinases. SH2 domains bind to short phosphotyrosine-containing sequences in growth factor receptors and other phosphoproteins. SH3 domains bind to target proteins through sequences containing proline and hydrophobic amino acids. SH2 and SH3 domain containing proteins, such as Grb2 and phospholipase C gamma, utilize these modules in order to link receptor and cytoplasmic protein tyrosine kinases to the Ras signaling pathway and to phosphatidylinositol hydrolysis, respectively. The three-dimensional structures of several SH2 and SH3 domains have been determined by NMR and X-ray crystallography, and the molecular basis of their specificity is beginning to be unveiled.
International Nuclear Information System (INIS)
Tsuchiya, Takuma; Wang, Liyun; Yafune, Atsunori; Kimura, Masayuki; Ohishi, Takumi; Suzuki, Kazuhiko; Mitsumori, Kunitoshi; Shibutani, Makoto
2012-01-01
Cell cycle aberration was immunohistochemically examined in relation to preneoplastic liver cell foci expressing glutathione S-transferase placental form (GST-P) at early stages of tumor-promotion in rats with thioacetamide (TAA), a hepatocarcinogen facilitating liver cell regeneration. Immunoexpression of p16 Ink4a following exposure to other hepatocarcinogens/promoters and its DNA methylation status were also analyzed during early and late tumor-promotion stages. GST-P + liver cell foci increased cell proliferation and decreased apoptosis when compared with surrounding liver cells. In concordance with GST-P + foci, checkpoint proteins at G 1 /S (p21 Cip1 , p27 Kip1 and p16 Ink4a ) and G 2 /M (phospho-checkpoint kinase 1, Cdc25c and phospho-Wee1) were either up- or downregulated. Cellular distribution within GST-P + foci was either increased or decreased with proteins related to G 2 -M phase or DNA damage (topoisomerase IIα, phospho-histone H2AX, phospho-histone H3 and Cdc2). In particular, p16 Ink4a typically downregulated in GST-P + foci and regenerative nodules at early tumor-promotion stage with hepatocarcinogens facilitating liver cell regeneration and in neoplastic lesions at late tumor-promotion stage with hepatocarcinogens/promoters irrespective of regenerating potential. Hypermethylation at exon 2 of Cdkn2a was detected at both early- and late-stages. Thus, diverse disruptive expression of G 1 /S and G 2 /M proteins, which allows for clonal selection of GST-P + foci, results in the acquisition of multiple aberrant phenotypes to disrupt checkpoint function. Moreover, increased DNA-damage responses within GST-P + foci may be the signature of genetic alterations. Intraexonic hypermethylation may be responsible for p16 Ink4a -downregulation, which facilitates cell cycle progression in early preneoplastic lesions produced by repeated cell regeneration and late-stage neoplastic lesions irrespective of the carcinogenic mechanism.
Directory of Open Access Journals (Sweden)
Eleanna Stamatakou
Full Text Available Upon arrival at their synaptic targets, axons slow down their growth and extensively remodel before the assembly of presynaptic boutons. Wnt proteins are target-derived secreted factors that promote axonal remodelling and synaptic assembly. In the developing spinal cord, Wnts secreted by motor neurons promote axonal remodelling of NT-3 responsive dorsal root ganglia neurons. Axon remodelling induced by Wnts is characterised by growth cone pausing and enlargement, processes that depend on the re-organisation of microtubules. However, the contribution of the actin cytoskeleton has remained unexplored. Here, we demonstrate that Wnt3a regulates the actin cytoskeleton by rapidly inducing F-actin accumulation in growth cones from rodent DRG neurons through the scaffold protein Dishevelled-1 (Dvl1 and the serine-threonine kinase Gsk3β. Importantly, these changes in actin cytoskeleton occurs before enlargement of the growth cones is evident. Time-lapse imaging shows that Wnt3a increases lamellar protrusion and filopodia velocity. In addition, pharmacological inhibition of actin assembly demonstrates that Wnt3a increases actin dynamics. Through a yeast-two hybrid screen, we identified the actin-binding protein Eps8 as a direct interactor of Dvl1, a scaffold protein crucial for the Wnt signalling pathway. Gain of function of Eps8 mimics Wnt-mediated axon remodelling, whereas Eps8 silencing blocks the axon remodelling activity of Wnt3a. Importantly, blockade of the Dvl1-Eps8 interaction completely abolishes Wnt3a-mediated axonal remodelling. These findings demonstrate a novel role for Wnt-Dvl1 signalling through Eps8 in the regulation of axonal remodeling.
AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs
Exceptional Parent, 2011
2011-01-01
This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2007-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls
Directory of Open Access Journals (Sweden)
Maurilio Lara-Flores
2013-07-01
Full Text Available In this study, the effect as growth promoter of five lactic acid strains (Enterococcus faecium, E. durans, Leuconostoc sp., Streptococcus sp. I and Streptococcus sp. II, isolated from intestinal tract of Nile tilapia (Oreochromis niloticus, was evaluated. Eight isocaloric diets were formulated: one containing 40% of protein as positive control, and seven with 27% protein. Five diets with 27% protein were supplemented with one of the isolated lactic acid bacteria in a concentration of 2.5x10(6 cfu g-1 of diet. A commercial probiotic based on S. faecium and Lactobacillus acidophilus was added at the same concentration to one 27% protein diet as a comparative diet, and the last diet was not supplemented with bacteria (negative control. Tilapia fry (280 mg basal weight stocked in 15 L aquaria at a density of two per liter were fed for 12 weeks with experimental diets. Results showed that fry fed with native bacteria supplemented diets presented significantly higher growth and feeding performance than those fed with control diet. Treatment with Streptococcus sp. I isolated from the intestine of Tilapia produced the best growth and feeding efficiency, suggesting that this bacteria is an appropriate native growth promoter.
Lin, Fei-Xiang; Du, Shi-Xin; Liu, De-Zhong; Hu, Qin-Xiao; Yu, Guo-Yong; Wu, Chu-Cheng; Zheng, Gui-Zhou; Xie, Da; Li, Xue-Dong; Chang, Bo
2016-01-01
Naringin is an active compound extracted from Rhizoma Drynariae, and studies have revealed that naringin can promote proliferation and osteogenic differentiation of bone marrow stromal cells (BMSCs). In this study, we explored whether naringin could promote osteogenic differentiation of BMSCs by upregulating Foxc2 expression via the Indian hedgehog (IHH) signaling pathway. BMSCs were cultured in basal medium, basal medium with naringin, osteogenic induction medium, osteogenic induction medium with naringin and osteogenic induction medium with naringin in the presence of the IHH inhibitor cyclopamine (CPE). We examined cell proliferation by using a WST-8 assay, and differentiation by Alizarin Red S staining (for mineralization) and alkaline phosphatase (ALP) activity. In addition, we detected core-binding factor α1 (Cbfα1), osteocalcin (OCN), bone sialoprotein (BSP), peroxisome proliferation-activated receptor gamma 2 (PPARγ2) and Foxc2 expression by using RT-PCR. We also determined Foxc2 and IHH protein levels by western blotting. Naringin increased the mineralization of BMSCs, as shown by Alizarin red S assays, and induced ALP activity. In addition, naringin significantly increased the mRNA levels of Foxc2, Cbfα1, OCN, and BSP, while decreasing PPARγ2 mRNA levels. Furthermore, the IHH inhibitor CPE inhibited the osteogenesis-potentiating effects of naringin. Naringin increased Foxc2 and stimulated the activation of IHH, as evidenced by increased expression of proteins that were inhibited by CPE. Our findings indicate that naringin promotes osteogenic differentiation of BMSCs by up-regulating Foxc2 expression via the IHH signaling pathway.
Li, Jianing; Wang, Yu; Tang, Lihua; de Villiers, Willem JS; Cohen, Donald; Woodward, Jerold; Finkelman, Fred D; Eckhardt, Erik RM
2012-01-01
BACKGROUND The prevalence of peanut allergies is rising. Peanuts and many other allergen sources contain significant amounts of triglycerides, which affect absorption of antigens but have unknown effects on sensitization and anaphylaxis. We recently reported that dietary medium-chain triglycerides (MCT), which bypass mesenteric lymph and directly enter portal blood, reduce intestinal antigen absorption into blood compared to long-chain triglycerides (LCT), which stimulate mesenteric lymph flow and are absorbed in chylomicrons via mesenteric lymph. OBJECTIVE Test how dietary MCT affect food allergy. METHODS C3H/HeJ mice were fed peanut butter protein in MCT, LCT (peanut oil), or LCT plus an inhibitor of chylomicron formation (Pluronic L81; “PL81”). Peanut-specific antibodies in plasma, responses of the mice to antigen challenges, and intestinal epithelial cytokine expression were subsequently measured. RESULTS MCT suppressed antigen absorption into blood, but stimulated absorption into Peyer's patches. A single gavage of peanut protein with MCT as well as prolonged feeding in MCT-based diets caused spontaneous allergic sensitization. MCT-sensitized mice experienced IgG-dependent anaphylaxis upon systemic challenge and IgE-dependent anaphylaxis upon oral challenge. MCT feeding stimulated jejunal-epithelial TSLP, IL-25 and IL-33 expression compared to LCT, and promoted Th2 cytokine responses in splenocytes. Moreover, oral challenges of sensitized mice with antigen in MCT significantly aggravated anaphylaxis compared to challenges with LCT. Importantly, effects of MCT could be mimicked by adding PL81 to LCT, and in vitro assays indicated that chylomicrons prevent basophil activation. CONCLUSION Dietary MCT promote allergic sensitization and anaphylaxis by affecting antigen absorption and availability and by stimulating Th2 responses. PMID:23182172
Polycomb-like proteins link the PRC2 complex to CpG islands
Energy Technology Data Exchange (ETDEWEB)
Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin
2017-09-06
The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.
Health of issues of whey proteins: 2. Weight management
Schaafsma, G.
2006-01-01
The increasing prevalence in many countries of people with overweight and obesity is undoubtedly one of the biggest threats to public health. Dietary proteins, because of their positive effects on satiation/ satiety, may help to reduce energy intake and promote a healthy body composition with less
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
Alternative Splicing of CHEK2 and Codeletion with NF2 Promote Chromosomal Instability in Meningioma
Directory of Open Access Journals (Sweden)
Hong Wei Yang
2012-01-01
Full Text Available Mutations of the NF2 gene on chromosome 22q are thought to initiate tumorigenesis in nearly 50% of meningiomas, and 22q deletion is the earliest and most frequent large-scale chromosomal abnormality observed in these tumors. In aggressive meningiomas, 22q deletions are generally accompanied by the presence of large-scale segmental abnormalities involving other chromosomes, but the reasons for this association are unknown. We find that large-scale chromosomal alterations accumulate during meningioma progression primarily in tumors harboring 22q deletions, suggesting 22q-associated chromosomal instability. Here we show frequent codeletion of the DNA repair and tumor suppressor gene, CHEK2, in combination with NF2 on chromosome 22q in a majority of aggressive meningiomas. In addition, tumor-specific splicing of CHEK2 in meningioma leads to decreased functional Chk2 protein expression. We show that enforced Chk2 knockdown in meningioma cells decreases DNA repair. Furthermore, Chk2 depletion increases centrosome amplification, thereby promoting chromosomal instability. Taken together, these data indicate that alternative splicing and frequent codeletion of CHEK2 and NF2 contribute to the genomic instability and associated development of aggressive biologic behavior in meningiomas.
Yin, Fengqiong; Xu, Zhenhua; Wang, Zifeng; Yao, Hong; Shen, Zan; Yu, Fang; Tang, Yiping; Fu, Dengli; Lin, Sheng; Lu, Gang; Kung, Hsiang-Fu; Poon, Wai Sang; Huang, Yunchao; Lin, Marie Chia-Mi
2012-12-14
Chemokine CC-motif receptor-like 2 (CCRL2) is a 7-transmembrane G protein-coupled receptor which plays a key role in lung dendritic cell trafficking to peripheral lymph nodes. The function and expression of CCRL2 in cancer is not understood at present. Here we report that CCRL2 expression level is elevated in human glioma patient samples and cell lines. The magnitude of increase is positively associated with increasing tumor grade, with the highest level observed in grade IV glioblastoma. By gain-of-function and loss-of-function studies, we further showed that CCRL2 did not regulate the growth of human glioblatoma U87 and U373 cells. Importantly, we demonstrated that over-expression of CCRL2 significantly enhanced the migration rate and invasiveness of the glioblastoma cells. Taken together, these results suggest for the first time that elevated CCRL2 in glioma promotes cell migration and invasion. The potential roles of CCRL2 as a novel therapeutic target and biomarker warrant further investigations. Copyright © 2012 Elsevier Inc. All rights reserved.
The membrane protein LasM Promotes the Culturability of Legionella pneumophila in Water
Directory of Open Access Journals (Sweden)
Laam Li
2016-09-01
Full Text Available The water-borne pathogen Legionella pneumophila (Lp strongly expresses the lpg1659 gene in water. This gene encodes a hypothetical protein predicted to be a membrane protein using in silico analysis. While no conserved domains were identified in Lpg1659, similar proteins are found in many Legionella species and other aquatic bacteria. RT-qPCR showed that lpg1659 is positively regulated by the alternative sigma factor RpoS, which is essential for Lp to survive in water. These observations suggest an important role of this novel protein in the survival of Lp in water. Deletion of lpg1659 did not affect cell morphology, membrane integrity or tolerance to high temperature. Moreover, lpg1659 was dispensable for growth of Lp in rich medium, and during infection of the amoeba Acanthamoeba castellanii and of THP-1 human macrophages. However, deletion of lpg1659 resulted in an early loss of culturability in water, while over-expression of this gene promoted the culturability of Lp. Therefore, these results suggest that lpg1659 is required for Lp to maintain culturability, and possibly long-term survival, in water. Since the loss of culturability observed in the absence of Lpg1659 was complemented by the addition of trace metals into water, this membrane protein is likely a transporter for acquiring essential trace metal for maintaining culturability in water and potentially in other metal-deprived conditions. Given its role in the survival of Lp in water, Lpg1659 was named LasM for Legionella aquatic survival membrane protein.
Analysis of the promoters involved in enterocin AS-48 expression.
Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel
2014-01-01
The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Analysis of the promoters involved in enterocin AS-48 expression.
Directory of Open Access Journals (Sweden)
Rubén Cebrián
Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Yuan, Hui; Owsiany, Katherine; Sheeja, T.E.; Zhou, Xiangjun; Rodriguez, Caroline; Li, Yongxi; Welsch, Ralf; Chayut, Noam; Yang, Yong; Thannhauser, Theodore W.; Parthasarathy, Mandayam V.; Xu, Qiang; Deng, Xiuxin; Fei, Zhangjun; Schaffer, Ari; Katzir, Nurit; Burger, Joseph; Tadmor, Yaakov; Li, Li
2015-01-01
Carotenoids are crucial for plant growth and human health. The finding of ORANGE (OR) protein as a pivotal regulator of carotenogenesis offers a unique opportunity to comprehensively understand the regulatory mechanisms of carotenoid accumulation and develop crops with enhanced nutritional quality. Here, we demonstrated that alteration of a single amino acid in a wild-type OR greatly enhanced its ability to promote carotenoid accumulation. Whereas overexpression of OR from Arabidopsis (Arabidopsis thaliana; AtOR) or from the agronomically important crop sorghum (Sorghum bicolor; SbOR) increased carotenoid levels up to 2-fold, expression of AtORHis (R90H) or SbORHis (R104H) variants dramatically enhanced carotenoid accumulation by up to 7-fold in the Arabidopsis calli. Moreover, we found that AtORAla (R90A) functioned similarly to AtORHis to promote carotenoid overproduction. Neither AtOR nor AtORHis greatly affected carotenogenic gene expression. AtORHis exhibited similar interactions with phytoene synthase (PSY) as AtOR in posttranscriptionally regulating PSY protein abundance. AtORHis triggered biogenesis of membranous chromoplasts in the Arabidopsis calli, which shared structures similar to chromoplasts found in the curd of the orange cauliflower (Brassica oleracea) mutant. By contrast, AtOR did not cause plastid-type changes in comparison with the controls, but produced plastids containing larger and electron-dense plastoglobuli. The unique ability of AtORHis in mediating chromoplast biogenesis is responsible for its induced carotenoid overproduction. Our study demonstrates ORHis/Ala as powerful tools for carotenoid enrichment in plants, and provides insights into the mechanisms underlying ORHis-regulated carotenoid accumulation. PMID:26224804
DEFF Research Database (Denmark)
Norman, Anders; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes
2005-01-01
Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N-methyl-N'-......Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N......-cell biosensor which is not only able to detect minute levels of genotoxins but, due to its use of the green fluorescent protein, also a reporter system which should be applicable in high-throughput screening assays as well as a wide variety of in situ detection studies....
Pan, Hsin Chuan; Lee, Soonchul; Ting, Kang; Shen, Jia; Wang, Chenchao; Nguyen, Alan; Berthiaume, Emily A; Zara, Janette N; Turner, A Simon; Seim, Howard B; Kwak, Jin Hee; Zhang, Xinli; Soo, Chia
2017-07-01
Multiple case reports using recombinant human bone morphogenetic protein-2 (rhBMP-2) have reported complications. However, the local adverse effects of rhBMP-2 application are not well documented. In this report we show that, in addition to promoting lumbar spinal fusion through potent osteogenic effects, rhBMP-2 augmentation promotes local cyst-like osteolytic formations in sheep trabecular bones that have undergone anterior lumbar interbody fusion. Three months after operation, conventional computed tomography showed that the trabecular bones of the rhBMP-2 application groups could fuse, whereas no fusion was observed in the control group. Micro-computed tomography analysis revealed that the core implant area's bone volume fraction and bone mineral density increased proportionately with rhBMP-2 dose. Multiple cyst-like bone voids were observed in peri-implant areas when using rhBMP-2 applications, and these sites showed significant bone mineral density decreases in relation to the unaffected regions. Biomechanically, these areas decreased in strength by 32% in comparison with noncystic areas. Histologically, rhBMP-2-affected void sites had an increased amount of fatty marrow, thinner trabecular bones, and significantly more adiponectin- and cathepsin K-positive cells. Despite promoting successful fusion, rhBMP-2 use in clinical applications may result in local adverse structural alterations and compromised biomechanical changes to the bone. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Yuan, Wei; Zheng, Jun; Qian, Jinyu; Zhou, Xiaoxiao; Wang, Minghui; Wang, Xiuhui
2017-07-01
To observe the effect of stromal vascular fraction cells (SVFs) from rat fat tissue combined with sustained release of recombinant human bone morphogenetic protein-2 (rhBMP-2) in promoting the lumbar fusion in rat model. SVFs were harvested from subcutaneous fat of bilateral inguinal region of 4-month-old rat through the collagenase I digestion. The sustained release carrier was prepared via covalent bond of the rhBMP-2 and β-tricalcium phosphate (β-TCP) by the biominetic apatite coating process. The sustained release effect was measured by BCA method. Thirty-two rats were selected to establish the posterolateral lumbar fusion model and were divided into 4 groups, 8 rats each group. The decalcified bone matrix (DBX) scaffold+PBS, DBX scaffold+rhBMP-2/β-TCP sustained release carrier, DBX scaffold+SVFs, and DBX scaffold+rhBMP-2/β-TCP sustained release carrier+SVFs were implanted in groups A, B, C, and D respectively. X-ray films, manual spine palpation, and high-resolution micro-CT were used to evaluate spinal fusion at 8 weeks after operation; bone mineral density (BMD) and bone volume fraction were analyzed; the new bone formation was evaluated by HE staining and Masson's trichrome staining, osteocalcin (OCN) was detected by immunohistochemical staining. The cumulative release amount of rhBMP-2 was about 40% at 2 weeks, indicating sustained release effect of rhBMP-2; while the control group was almost released within 2 weeks. At 8 weeks, the combination of manual spine palpation, X-ray, and micro-CT evaluation showed that group D had the strongest bone formation (100%, 8/8), followed by group B (75%, 6/8), group C (37.5%, 3/8), and group A (12.5%, 1/8). Micro-CT analysis showed BMD and bone volume fraction were significantly higher in group D than groups A, B, and C ( P cells with bone matrix deposition, and an active osteogenic process similar to the mineralization of long bones in group D. The bone formation of group B was weaker than that of group D, and
Anti-Diabetic Effects of CTB-APSL Fusion Protein in Type 2 Diabetic Mice
Directory of Open Access Journals (Sweden)
Yunlong Liu
2014-03-01
Full Text Available To determine whether cholera toxin B subunit and active peptide from shark liver (CTB-APSL fusion protein plays a role in treatment of type 2 diabetic mice, the CTB-APSL gene was cloned and expressed in silkworm (Bombyx mori baculovirus expression vector system (BEVS, then the fusion protein was orally administrated at a dose of 100 mg/kg for five weeks in diabetic mice. The results demonstrated that the oral administration of CTB-APSL fusion protein can effectively reduce the levels of both fasting blood glucose (FBG and glycosylated hemoglobin (GHb, promote insulin secretion and improve insulin resistance, significantly improve lipid metabolism, reduce triglycerides (TG, total cholesterol (TC and low density lipoprotein (LDL levels and increase high density lipoprotein (HDL levels, as well as effectively improve the inflammatory response of type 2 diabetic mice through the reduction of the levels of inflammatory cytokines tumor necrosis factor-α (TNF-α and interleukin-6 (IL-6. Histopathology shows that the fusion protein can significantly repair damaged pancreatic tissue in type 2 diabetic mice, significantly improve hepatic steatosis and hepatic cell cloudy swelling, reduce the content of lipid droplets in type 2 diabetic mice, effectively inhibit renal interstitial inflammatory cells invasion and improve renal tubular epithelial cell nucleus pyknosis, thus providing an experimental basis for the development of a new type of oral therapy for type 2 diabetes.
P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.
Loll-Krippleber, Raphael; Brown, Grant W
2017-09-15
mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.
Gotoh, Saki; Negishi, Masahiko
2015-09-22
Statin therapy is known to increase blood glucose levels in humans. Statins utilize pregnane X receptor (PXR) and serum/glucocorticoid regulated kinase 2 (SGK2) to activate phosphoenolpyruvate carboxykinase 1 (PEPCK1) and glucose-6-phosphatase (G6Pase) genes, thereby increasing glucose production in human liver cells. Here, the novel statin/PXR/SGK2-mediated signaling pathway has now been characterized for hepatic gluconeogenesis. Statin-activated PXR scaffolds the protein phosphatase 2C (PP2C) and SGK2 to stimulate PP2C to dephosphorylate SGK2 at threonine 193. Non-phosphorylated SGK2 co-activates PXR-mediated trans-activation of promoters of gluconeogenic genes in human liver cells, thereby enhancing gluconeogenesis. This gluconeogenic statin-PXR-SGK2 signal is not present in mice, in which statin treatment suppresses hepatic gluconeogenesis. These findings provide the basis for statin-associated side effects such as an increased risk for Type 2 diabetes.
Jayaraman, Sathishkumar; Das, Partha Pratim; Saini, Prakash Chandra; Roy, Barun; Chatterjee, Paresh Nath
2017-08-01
The intestinal gut health is one of the primary determinants of broiler growth and performance. Among the various enteric diseases, necrotic enteritis (NE) is an enterotoxemic disease caused by Clostridium perfringens, which can result in severe economic losses in poultry farming. Antibiotics like bacitracin methylene disalicylate (BMD) and avilamycin (AVL) are commonly used antibiotic growth promoters (AGP) in poultry feed to control necrotic enteritis in birds. Bacillus subtilis PB6 was reported to prevent necrotic enteritis and improve performance in birds. This paper investigated the influence of Bacillus subtilis PB6 in improving the performance of broiler birds in comparison with BMD and avilamycin. A 35 day trial was conducted with 240 day-old commercial broiler chicks (VenCobb 400), which were divided into four treatment groups, where each treatment group was composed of 6 replicates each containing 10 birds, for a total of 60 birds per treatment. The treatment groups included a negative control (no AGP), Bacillus subtilis PB6, BMD, and avilamycin. The parameters analyzed included body weight, feed conversion ratio (FCR), mortality, villus histomorphometry, and European efficiency factor (EEF). Bacillus subtilis PB6 significantly (P < 0.05) improved body weight and FCR (8 points) compared to the control. The group supplemented with B. subtilis PB6 or BMD had higher (P < 0.05) body weight compared to all other treatment groups. The supplementation of B. subtilis PB6 significantly improved the villus height (P < 0.05) compared to control and other AGP groups. The EEF was found to be the highest in the B. subtilis PB6 supplemented group at 35th day as compared to other treatment groups. The combined data from this study indicate that supplementation of B. subtilis PB6 improves overall performance of broilers compared to BMD and avilamycin, and can be used as potential AGP replacement in poultry farming. © 2017 Poultry Science Association Inc.
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Directory of Open Access Journals (Sweden)
Kawe Martin
2009-01-01
Full Text Available Abstract Background Overexpression of proteins in Escherichia coli is considered routine today, at least when the protein is soluble and not otherwise toxic for the host. We report here that the massive overproduction of even such "benign" proteins can cause surprisingly efficient promoter deletions in the expression plasmid, leading to the growth of only non-producers, when expression is not well repressed in the newly transformed bacterial cell. Because deletion is so facile, it might impact on high-throughput protein production, e.g. for structural genomics, where not every expression parameter will be monitored. Results We studied the high-level expression of several robust non-toxic proteins using a T5 promoter under lac operator control. Full induction leads to no significant growth retardation. We compared expression from almost identical plasmids with or without the lacI gene together in strains expressing different levels of LacI. Any combination without net overexpression of LacI led to an efficient promoter deletion in the plasmid, although the number of growing colonies and even the plasmid size – all antibiotic-resistant non-producers – was almost normal, and thus the problem not immediately recognizable. However, by assuring sufficient repression during the initial establishment phase of the plasmid, deletion was completely prevented. Conclusion The deletions in the insufficiently repressed system are caused entirely by the burden of high-level translation. Since the E. coli Dps protein, known to protect DNA against stress in the stationary phase, is accumulated in the deletion mutants, the mutation may have taken place during a transient stationary phase. The cause of the deletion is thus distinct from the well known interference of high-level transcription with plasmid replication. The deletion can be entirely prevented by overexpressing LacI, a useful precaution even without any signs of stress caused by the protein.
Lifescience Database Archive (English)
Full Text Available MPA1 TLR signaling molecules MAVS IPS1, KIAA1271, VISA VISA_(gene) Mitochondrial antiviral-signaling pr...otein CARD adapter inducing interferon beta, Interferon beta promoter stimulator protein... 1, Putative NF-kappa-B-activating protein 031N, Virus-induced-signaling adapter 9606 Homo sapiens Q7Z434 57506 2VGQ 57506 ...
Cook, Peter C; Owen, Heather; Deaton, Aimée M; Borger, Jessica G; Brown, Sheila L; Clouaire, Thomas; Jones, Gareth-Rhys; Jones, Lucy H; Lundie, Rachel J; Marley, Angela K; Morrison, Vicky L; Phythian-Adams, Alexander T; Wachter, Elisabeth; Webb, Lauren M; Sutherland, Tara E; Thomas, Graham D; Grainger, John R; Selfridge, Jim; McKenzie, Andrew N J; Allen, Judith E; Fagerholm, Susanna C; Maizels, Rick M; Ivens, Alasdair C; Bird, Adrian; MacDonald, Andrew S
2015-04-24
Dendritic cells (DCs) direct CD4(+) T-cell differentiation into diverse helper (Th) subsets that are required for protection against varied infections. However, the mechanisms used by DCs to promote Th2 responses, which are important both for immunity to helminth infection and in allergic disease, are currently poorly understood. We demonstrate a key role for the protein methyl-CpG-binding domain-2 (Mbd2), which links DNA methylation to repressive chromatin structure, in regulating expression of a range of genes that are associated with optimal DC activation and function. In the absence of Mbd2, DCs display reduced phenotypic activation and a markedly impaired capacity to initiate Th2 immunity against helminths or allergens. These data identify an epigenetic mechanism that is central to the activation of CD4(+) T-cell responses by DCs, particularly in Th2 settings, and reveal methyl-CpG-binding proteins and the genes under their control as possible therapeutic targets for type-2 inflammation.
Rodrigues, A.; Adamo, M.; Crozet, P.; Margalha, L.; Confraria, A.; Martinho, C.; Elias, A.; Rabissi, A.; Lumbreras, V.; Gonzalez-Guzman, M.; Antoni, R.; Rodriguez, P. L.; Baena-Gonzalez, E.
2013-01-01
Plant survival under environmental stress requires the integration of multiple signaling pathways into a coordinated response, but the molecular mechanisms underlying this integration are poorly understood. Stress-derived energy deprivation activates the Snf1-related protein kinases1 (SnRK1s), triggering a vast transcriptional and metabolic reprogramming that restores homeostasis and promotes tolerance to adverse conditions. Here, we show that two clade A type 2C protein phosphatases (PP2Cs),...
Huang, Qiuyue; Qin, Shanshan; Yuan, Xiaoning; Zhang, Liang; Ji, Juanli; Liu, Xuewen; Ma, Wenjing; Zhang, Yunfei; Liu, Pengfei; Sun, Zhiting; Zhang, Jingxuan; Liu, Ying
2017-07-01
We have shown that a novel STAT3 inhibitor arctigenin (Atn) induces significant cytotoxicity in triple-negative breast cancer (TNBC) cells. This study further delineated molecular mechanisms where by Atn triggered cytotoxicity in TNBC cells. We found Atn can also inhibit metastasis in TNBC cells through cancerous inhibitor of protein phosphatase 2A (CIP2A) pathway. CIP2A is an endogenous inhibitor of protein phosphatase 2A (PP2A), which can increase the migration and invasion of various cancer cells. PP2A is a tumor suppressor, which is functionally defective in various cancers. Atn-induced metastasis inhibition was associated with reactivation of PP2A, downregulation of CIP2A and Akt phosphorylation. Silencing CIP2A enhanced Atn-induced metastasis inhibition and apoptosis in TNBCs. Furthermore, ectopic expression of CIP2A or inhibition of PP2A in TNBC cells abolished the effects of Atn. In conclusion, we found that enhancement of PP2A activity by inhibition of CIP2A, at least in part, promotes the anti-metastasis effect induced by Atn. Our findings disclose the novel therapeutic mechanism of this targeted agent, and suggest the therapeutic potential and feasibility of developing PP2A enhancers as a novel anticancer strategy.
Zhuang, Fengfeng; Nguyen, Manuel P; Shuler, Charles; Liu, Yi-Hsin
2009-04-03
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent transactivation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and heat shock factors may play a contributing role.
The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis
Glazer, Andrew; Wilkinson, Alex; Backer, Chelsea B.; Lapan, Sylvain; Gutzman, Jennifer H.; Cheeseman, Iain M.; Reddien, Peter W.
2009-01-01
Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and that utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian S. mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates. PMID:19852954
Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D
2014-10-01
Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Sanz, Ricardo L; Ferraro, Gino B; Girouard, Marie-Pier; Fournier, Alyson E
2017-08-11
IgLONs are members of the immunoglobulin superfamily of cell adhesion proteins implicated in the process of neuronal outgrowth, cell adhesion and subdomain target recognition. IgLONs form homophilic and heterophilic complexes on the cell surface that repress or promote growth depending on the neuronal population, the developmental stage and surface repertoire of IgLON family members. In the present study, we identified a metalloproteinase-dependent mechanism necessary to promote growth in embryonic dorsal root ganglion cells (DRGs). Treatment of embryonic DRG neurons with pan-metalloproteinase inhibitors, tissue inhibitor of metalloproteinase-3, or an inhibitor of ADAM Metallopeptidase Domain 10 (ADAM10) reduces outgrowth from DRG neurons indicating that metalloproteinase activity is important for outgrowth. The IgLON family members Neurotrimin (NTM) and Limbic System-Associated Membrane Protein (LSAMP) were identified as ADAM10 substrates that are shed from the cell surface of DRG neurons. Overexpression of LSAMP and NTM suppresses outgrowth from DRG neurons. Furthermore, LSAMP loss of function decreases the outgrowth sensitivity to an ADAM10 inhibitor. Together our findings support a role for ADAM-dependent shedding of cell surface LSAMP in promoting outgrowth from DRG neurons.
Directory of Open Access Journals (Sweden)
Xiu-Yun Li
2018-05-01
Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.
mTORC2 Promotes Tumorigenesis via Lipid Synthesis.
Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N
2017-12-11
Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.
Facility for generating crew waste water product for ECLSS testing
Buitekant, Alan; Roberts, Barry C.
1990-01-01
An End-use Equipment Facility (EEF) has been constructed which is used to simulate water interfaces between the Space Station Freedom Environmental Control and Life Support Systems (ECLSS) and man systems. The EEF is used to generate waste water to be treated by ECLSS water recovery systems. The EEF will also be used to close the water recovery loop by allowing test subjects to use recovered hygiene and potable water during several phases of testing. This paper describes the design and basic operation of the EEF.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer
DEFF Research Database (Denmark)
Caldeira, José Roberto F; Prando, Erika C; Quevedo, Francisco C
2006-01-01
prognosis, and metastasis. Differential CpG island methylation in the promoter region of the CDH1 gene might be an alternative way for the loss of expression and function of E-cadherin, leading to loss of tissue integrity, an essential step in tumor progression. METHODS: The aim of our study was to assess...... not statistically significant, the levels of E-cadherin expression tended to diminish with the CDH1 promoter region methylation. In the group of 71 ductal cancinomas, most of the cases of showing CDH1 hypermethylation also presented reduced levels of expression of ER and PgR proteins, and a possible association......BACKGROUND: The E-cadherin gene (CDH1) maps, at chromosome 16q22.1, a region often associated with loss of heterozygosity (LOH) in human breast cancer. LOH at this site is thought to lead to loss of function of this tumor suppressor gene and was correlated with decreased disease-free survival, poor...
Lifescience Database Archive (English)
Full Text Available MPB2 Ubiquitin ligases SMURF1 KIAA1625 SMURF1 E3 ubiquitin-protein ligase SMURF1 SM...AD ubiquitination regulatory factor 1, SMAD-specific E3 ubiquitin-protein ligase 1 9606 Homo sapiens Q9HCE7 57154 2LB1, 2LAZ, 2LB0, 3PYC 57154 Q9HCE7 ...
Directory of Open Access Journals (Sweden)
Kristi M Porter
Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.
TRF2 recruits RTEL1 to telomeres in S phase to promote t-loop unwinding.
Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John H J; Boulton, Simon J
2015-02-19
The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to prevent catastrophic t-loop processing by structure-specific nucleases. We show that the TRF2-RTEL1 interaction is mediated by a metal-coordinating C4C4 motif in RTEL1, which is compromised by the Hoyeraal-Hreidarsson syndrome (HHS) mutation, RTEL1(R1264H). Conversely, we define a TRF2(I124D) substitution mutation within the TRFH domain of TRF2, which eliminates RTEL1 binding and phenocopies the RTEL1(R1264H) mutation, giving rise to aberrant t-loop excision, telomere length heterogeneity, and loss of the telomere as a circle. These results implicate TRF2 in the recruitment of RTEL1 to facilitate t-loop disassembly at telomeres in S phase. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
International Nuclear Information System (INIS)
Sasaki, Kentaro; Kim, Myung-Hee; Imai, Ryozo
2007-01-01
Bacterial cold shock proteins (CSPs) are RNA chaperones that unwind RNA secondary structures. Arabidopsis COLD SHOCK DOMAIN PROTEIN2 (AtCSP2) contains a domain that is shared with bacterial CSPs. Here we showed that AtCSP2 binds to RNA and unwinds nucleic acid duplex. Heterologous expression of AtCSP2 complemented cold sensitivity of an Escherichia coli csp quadruple mutant, indicating that AtCSP2 function as a RNA chaperone in E. coli. AtCSP2 mRNA and protein levels increased during cold acclimation, but the protein accumulation was most prominent after 10 days of cold treatment. AtCSP2 promoter::GUS transgenic plants revealed that AtCSP2 is expressed only in root and shoot apical regions during vegetative growth but is expressed in reproductive organs such as pollens, ovules and embryos. These data indicated that AtCSP2 is involved in developmental processes as well as cold adaptation. Localization of AtCSP2::GFP in nucleolus and cytoplasm suggested different nuclear and cytosolic RNA targets
The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4α
International Nuclear Information System (INIS)
Klapper, Maja; Boehme, Mike; Nitz, Inke; Doering, Frank
2007-01-01
The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4α (HNF-4α), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4α binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4α by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4α, that are both candidate genes for diabetes type 2, may be a powerful approach
The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4{alpha}
Energy Technology Data Exchange (ETDEWEB)
Klapper, Maja [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Boehme, Mike [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Nitz, Inke [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Doering, Frank [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany)
2007-04-27
The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4{alpha} binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4{alpha} by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4{alpha}, that are both candidate genes for diabetes type 2, may be a powerful approach.
OsNF-YC2 and OsNF-YC4 proteins inhibit flowering under long-day conditions in rice
Kim, SoonKap
2015-11-05
OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response through the modulation of three flowering-time genes ( Ehd1, Hd3a , and RFT1 ) in rice. Plant NUCLEAR FACTOR Y (NF-Y) transcription factors control numerous developmental processes by forming heterotrimeric complexes, but little is known about their roles in flowering in rice. In this study, it is shown that some subunits of OsNF-YB and OsNF-YC interact with each other, and among them, OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response of rice. Protein interaction studies showed that the physical interactions occurred between the three OsNF-YC proteins (OsNF-YC2, OsNF-YC4 and OsNF-YC6) and three OsNF-YB proteins (OsNF-YB8, OsNF-YB10 and OsNF-YB11). Repression and overexpression of the OsNF-YC2 and OsNF-YC4 genes revealed that they act as inhibitors of flowering only under long-day (LD) conditions. Overexpression of OsNF-YC6, however, promoted flowering only under LD conditions, suggesting it could function as a flowering promoter. These phenotypes correlated with the changes in the expression of three rice flowering-time genes [Early heading date 1 (Ehd1), Heading date 3a (Hd3a) and RICE FLOWERING LOCUS T1 (RFT1)]. The diurnal and tissue-specific expression patterns of the subsets of OsNF-YB and OsNF-YC genes were similar to those of CCT domain encoding genes such as OsCO3, Heading date 1 (Hd1) and Ghd7. We propose that OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response by interacting directly with OsNF-YB8, OsNF-YB10 or OsNF-YB11 proteins in rice.
Babault, Nicolas; Païzis, Christos; Deley, Gaëlle; Guérin-Deremaux, Laetitia; Saniez, Marie-Hélène; Lefranc-Millot, Catherine; Allaert, François A
2015-01-01
The effects of protein supplementation on muscle thickness and strength seem largely dependent on its composition. The current study aimed at comparing the impact of an oral supplementation with vegetable Pea protein (NUTRALYS®) vs. Whey protein and Placebo on biceps brachii muscle thickness and strength after a 12-week resistance training program. One hundred and sixty one males, aged 18 to 35 years were enrolled in the study and underwent 12 weeks of resistance training on upper limb muscles. According to randomization, they were included in the Pea protein (n = 53), Whey protein (n = 54) or Placebo (n = 54) group. All had to take 25 g of the proteins or placebo twice a day during the 12-week training period. Tests were performed on biceps muscles at inclusion (D0), mid (D42) and post training (D84). Muscle thickness was evaluated using ultrasonography, and strength was measured on an isokinetic dynamometer. Results showed a significant time effect for biceps brachii muscle thickness (P Pea, Whey and Placebo, respectively; P Pea group as compared to Placebo whereas there was no difference between Whey and the two other conditions. Muscle strength also increased with time with no statistical difference between groups. In addition to an appropriate training, the supplementation with pea protein promoted a greater increase of muscle thickness as compared to Placebo and especially for people starting or returning to a muscular strengthening. Since no difference was obtained between the two protein groups, vegetable pea proteins could be used as an alternative to Whey-based dietary products. The present trial has been registered at ClinicalTrials.gov (NCT02128516).
Dual reporter transgene driven by 2.3Col1a1 promoter is active in differentiated osteoblasts
Marijanovic, Inga; Jiang, Xi; Kronenberg, Mark S.; Stover, Mary Louise; Erceg, Ivana; Lichtler, Alexander C.; Rowe, David W.
2003-01-01
AIM: As quantitative and spatial analyses of promoter reporter constructs are not easily performed in intact bone, we designed a reporter gene specific to bone, which could be analyzed both visually and quantitatively by using chloramphenicol acetyltransferase (CAT) and a cyan version of green fluorescent protein (GFPcyan), driven by a 2.3-kb fragment of the rat collagen promoter (Col2.3). METHODS: The construct Col2.3CATiresGFPcyan was used for generating transgenic mice. Quantitative measurement of promoter activity was performed by CAT analysis of different tissues derived from transgenic animals; localization was performed by visualized GFP in frozen bone sections. To assess transgene expression during in vitro differentiation, marrow stromal cell and neonatal calvarial osteoblast cultures were analyzed for CAT and GFP activity. RESULTS: In mice, CAT activity was detected in the calvaria, long bone, teeth, and tendon, whereas histology showed that GFP expression was limited to osteoblasts and osteocytes. In cell culture, increased activity of CAT correlated with increased differentiation, and GFP activity was restricted to mineralized nodules. CONCLUSION: The concept of a dual reporter allows a simultaneous visual and quantitative analysis of transgene activity in bone.
Zhuang, Fengfeng; Nguyen, Manuel P.; Shuler, Charles; Liu, Yi-Hsin
2009-01-01
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent trans-activation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and Heat shock factors may play a contributing role. PMID:19338779
LRRK2 mediated Rab8a phosphorylation promotes lipid storage.
Yu, Miao; Arshad, Muhammad; Wang, Wenmin; Zhao, Dongyu; Xu, Li; Zhou, Linkang
2018-02-27
Several mutations in leucine rich repeat kinase 2 (LRRK2) gene have been associated with pathogenesis of Parkinson's disease (PD), a neurodegenerative disorder marked by resting tremors, and rigidity, leading to Postural instability. It has been revealed that mutations that lead to an increase of kinase activity of LRRK2 protein are significantly associated with PD pathogenesis. Recent studies have shown that some Rab GTPases, especially Rab8, serve as substrates of LRRK2 and undergo phosphorylation in its switch II domain upon interaction. Current study was performed in order to find out the effects of the phosphorylation of Rab8 and its mutants on lipid metabolism and lipid droplets growth. The phosphorylation status of Rab8a was checked by phos-tag gel. Point mutant construct were generated to investigate the function of Rab8a. 3T3L1 cells were transfected with indicated plasmids and the lipid droplets were stained with Bodipy. Fluorescent microscopy experiments were performed to examine the sizes of lipid droplets. The interactions between Rab8a and Optineurin were determined by immunoprecipitation and western blot. Our assays demonstrated that Rab8a was phosphorylated by mutated LRRK2 that exhibits high kinase activity. Phosphorylation of Rab8a on amino acid residue T72 promoted the formation of large lipid droplets. T72D mutant of Rab8a had higher activity to promote the formation of large lipid droplets compared with wild type Rab8a, with increase in average diameter of lipid droplets from 2.10 μm to 2.46 μm. Moreover, phosphorylation of Rab8a weakened the interaction with its effector Optineurin. Y1699C mutated LRRK2 was able to phosphorylate Rab8a and phosphorylation of Rab8a on site 72 plays important role in the fusion and enlargement of lipid droplets. Taken together, our study suggests an indirect relationship between enhanced lipid storage capacity and PD pathogenesis.
Nano titanium dioxide photocatalytic protein tyrosine nitration: A potential hazard of TiO2 on skin
International Nuclear Information System (INIS)
Lu, Naihao; Zhu Zhening; Zhao Xuqi; Tao Ran; Yang Xiangliang; Gao Zhonghong
2008-01-01
Protein tyrosine nitration is a prevalent post-translational modification which occurs as a result of oxidative and nitrative stress, it may be directly involved in the onset and/or progression of diseases. Considering the existence of nano titanium dioxide (TiO 2 ) in environment and sunscreen products along with the high content of nitrite in sweat, the UV-exposed skin may be a significant target for the photosensitized damage. In this paper, tyrosine nitration of bovine serum albumin (BSA) was initiated in the UV-irradiated reaction mixture containing 0.2-3.0 mg/ml of three commercially nano TiO 2 products and 0.25-1.0 mM NO 2 - . It was found that anatase TiO 2 and Degussa P25 TiO 2 showed prominent photocatalytic activity on promoting the formation of protein tyrosine nitration, and the optimum condition for the reaction was around physiological pH. Meanwhile, the photocatalytic effect of rutile on protein tyrosine nitration was subtle. The potential physiological significance of nano TiO 2 -photocatalytic protein nitration was also demonstrated in mouse skin homogenate. Although the relationship between photocatalytic protein tyrosine nitration and chronic cutaneous diseases needs further study, the toxicity of nano TiO 2 to the skin disease should be paid more attention in the production and utilization process
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Plasma response to electron energy filter in large volume plasma device
International Nuclear Information System (INIS)
Sanyasi, A. K.; Awasthi, L. M.; Mattoo, S. K.; Srivastava, P. K.; Singh, S. K.; Singh, R.; Kaw, P. K.
2013-01-01
An electron energy filter (EEF) is embedded in the Large Volume Plasma Device plasma for carrying out studies on excitation of plasma turbulence by a gradient in electron temperature (ETG) described in the paper of Mattoo et al. [S. K. Mattoo et al., Phys. Rev. Lett. 108, 255007 (2012)]. In this paper, we report results on the response of the plasma to the EEF. It is shown that inhomogeneity in the magnetic field of the EEF switches on several physical phenomena resulting in plasma regions with different characteristics, including a plasma region free from energetic electrons, suitable for the study of ETG turbulence. Specifically, we report that localized structures of plasma density, potential, electron temperature, and plasma turbulence are excited in the EEF plasma. It is shown that structures of electron temperature and potential are created due to energy dependence of the electron transport in the filter region. On the other hand, although structure of plasma density has origin in the particle transport but two distinct steps of the density structure emerge from dominance of collisionality in the source-EEF region and of the Bohm diffusion in the EEF-target region. It is argued and experimental evidence is provided for existence of drift like flute Rayleigh-Taylor in the EEF plasma
Directory of Open Access Journals (Sweden)
Jianqing Chen
Full Text Available Human growth hormone (hGH is a peptide hormone secreted by eosinophils of the human anterior pituitary, and a regulatory factor for a variety of metabolic pathways. A 30-kD protein from the pupa stage of silkworm was detected by Western blotting and confirmed by immunoprecipitation based on its ability to bind to anti-hGH antibody. This protein, named BmhGH-like protein, was purified from fresh silkworm pupas through low-temperature homogenization, filtration, and centrifugation to remove large impurity particles. The supernatants were precipitated, resuspended, and passed through a molecular sieve. Further purification by affinity chromatography and two-dimensional electrophoresis resulted in pure protein for analysis by MS MALDI-TOF-MS analysis. An alignment with predicted proteins indicated that BmhGH-like protein consisted of two lipoproteins, which we named hGH-L1 and hGH-L2. These proteins belong to the β-trefoil superfamily, with β domains similar to the spatial structure of hGH. Assays with K562 cells demonstrated that these proteins could promote cell division in vitro. To further validate the growth-promoting effects, hGH-L2 was cloned from pupa cDNA to create recombinant silkworm baculovirus vBmNPV-hGH-L2, which was used to infect silkworm BmN cells at low titer. Flow cytometric analysis demonstrated that the protein shortened the G0/G1 phase of the cells, and enabled the cells to rapidly traverse the G1/S phase transition point to enter S phase and promote cell division. Discovery of hGH-like protein in silkworm will once again arouse people's interest in the potential medicinal value of silkworm and establish the basis for the development of new hormone drugs.
Cho, Kyoung-in; Haney, Victoria; Yoon, Dosuk; Hao, Yin; Ferreira, Paulo A
2015-12-21
Morphological disintegration of neurons is coupled invariably to neural death. In particular, disruption of outer segments of photoreceptor neurons triggers photoreceptor death regardless of the pathological stressors. We show that Ranbp2(-/-)::Tg-Ranbp2(CLDm-HA) mice with mutations in SUMO-binding motif (SBM) of cyclophilin-like domain (CLD) of Ran-binding protein 2 (Ranbp2) expressed in a null Ranbp2 background lack untoward effects in photoreceptors in the absence of light-stress. However, compared to wild type photoreceptors, light-stress elicits profound disintegration of outer segments of Ranbp2(-/-)::Tg-Ranbp2(CLDm-HA) with paradoxical age-dependent resistance of photoreceptors to death and genotype-independent activation of caspases. Ranbp2(-/-)::Tg-Ranbp2(CLDm-HA) exhibit photoreceptor death-independent changes in ubiquitin-proteasome system (UPS), but death-dependent increase of ubiquitin carrier protein 9(ubc9) levels. Hence, insidious functional impairment of SBM of Ranbp2's CLD promotes neuroprotection and uncoupling of photoreceptor degeneration and death against phototoxicity. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra
2013-01-01
Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this
Directory of Open Access Journals (Sweden)
Kazi Md Kamrul Huda
Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible
Kristie, T M; Roizman, B
1986-01-01
Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...
Genes that cooperate with tumor promoters in transformation
International Nuclear Information System (INIS)
Colburn, N.H.; Smith, B.M.
1988-01-01
Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation
Directory of Open Access Journals (Sweden)
Lydia Chang
Full Text Available Ubiquilin proteins facilitate delivery of ubiquitinated proteins to the proteasome for degradation. Interest in the proteins has been heightened by the discovery that gene mutations in UBQLN2 cause dominant inheritance of amyotrophic lateral sclerosis (ALS. However, the mechanisms by which the mutations cause ALS are not known. Here we report on the underlying defect of ubiquilin-2 proteins containing ALS-linked mutations in affecting proteasome-mediated degradation. We found that overexpression of ubiquilin-2 proteins containing any one of five different ALS mutations slow degradation of Myc, a prototypic proteasome substrate. Examination of coprecipitating proteins indicated that the mutant proteins are generally capable of binding polyubiquitinated proteins, but defective in binding the proteasome. GST-pulldown studies revealed that many of the mutants bind weaker to the S5a subunit of the proteasome, compared with wild type (WT ubiquilin-2 protein. The results suggest the mutant proteins are unable to deliver their captured cargo to the proteasome for degradation, which presumably leads to toxicity. Quantification of cell death is consistent with this idea. Measurement of protein turnover further indicated the mutant proteins have longer half-lives than WT ubiquilin-2. Our studies provide novel insight into the mechanism by which ALS-linked mutations in UBQLN2 interfere with protein degradation.
Impaired PRC2 activity promotes transcriptional instability and favors breast tumorigenesis.
Wassef, Michel; Rodilla, Veronica; Teissandier, Aurélie; Zeitouni, Bruno; Gruel, Nadege; Sadacca, Benjamin; Irondelle, Marie; Charruel, Margaux; Ducos, Bertrand; Michaud, Audrey; Caron, Matthieu; Marangoni, Elisabetta; Chavrier, Philippe; Le Tourneau, Christophe; Kamal, Maud; Pasmant, Eric; Vidaud, Michel; Servant, Nicolas; Reyal, Fabien; Meseure, Dider; Vincent-Salomon, Anne; Fre, Silvia; Margueron, Raphaël
2015-12-15
Alterations of chromatin modifiers are frequent in cancer, but their functional consequences often remain unclear. Focusing on the Polycomb protein EZH2 that deposits the H3K27me3 (trimethylation of Lys27 of histone H3) mark, we showed that its high expression in solid tumors is a consequence, not a cause, of tumorigenesis. In mouse and human models, EZH2 is dispensable for prostate cancer development and restrains breast tumorigenesis. High EZH2 expression in tumors results from a tight coupling to proliferation to ensure H3K27me3 homeostasis. However, this process malfunctions in breast cancer. Low EZH2 expression relative to proliferation and mutations in Polycomb genes actually indicate poor prognosis and occur in metastases. We show that while altered EZH2 activity consistently modulates a subset of its target genes, it promotes a wider transcriptional instability. Importantly, transcriptional changes that are consequences of EZH2 loss are predominantly irreversible. Our study provides an unexpected understanding of EZH2's contribution to solid tumors with important therapeutic implications. © 2015 Wassef et al.; Published by Cold Spring Harbor Laboratory Press.
Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua
2017-07-18
N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.
Mishra, Ratnesh Chandra; Grover, Anil
2014-11-01
In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Li, Zhi [Department of Human Anatomy and Histoembryology, College of Basic Medical Sciences, Jilin University (China); Li, Youjun, E-mail: liyoujunn@126.com [Department of Human Anatomy and Histoembryology, College of Basic Medical Sciences, Jilin University (China); Wang, Nan; Yang, Lifeng; Zhao, Wei; Zeng, Xiandong [Central Hospital Affiliated to Shenyang Medical College (China)
2016-03-18
miR-130b was significantly up-regulated in osteosarcoma (OS) cells. Naked cuticle homolog 2 (NKD2) inhibited tumor growth and metastasis in OS by suppressing Wnt signaling. We used three miRNA target analysis tools to identify potential targets of miR-130b, and found that NKD2 is a potential target of miR-130b. Based on these findings, we hypothesize that miR-130b might target NKD2 and regulate the Wnt signaling to promote OS growth. We detected the expression of miR-130b and NKD2 mRNA and protein by quantitative Real-Time PCR (qRT-PCR) and western blot assays, respectively, and found up-regulation of miR-130b and down-regulation of NKD2 mRNA and protein exist in OS cell lines. MTT and flow cytometry assays showed that miR-130b inhibitors inhibit proliferation and promote apoptosis in OS cells. Furthermore, we showed that NKD2 is a direct target of miR-130b, and miR-130b regulated proliferation and apoptosis of OS cells by targeting NKD2. We further investigated whether miR-130b and NKD2 regulate OS cell proliferation and apoptosis by inhibiting Wnt signaling, and the results confirmed our speculation that miR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis of OS cells. These findings will offer new clues for OS development and progression, and novel potential therapeutic targets for OS. - Highlights: • miR-130b is up-regulated and NKD2 is down-regulated in osteosarcoma cell lines. • Down-regulation of miR-130b inhibits proliferation of osteosarcoma cells. • Down-regulation of miR-130b promotes apoptosis of osteosarcoma cells. • miR-130b directly targets NKD2. • NKD2 regulates OS cell proliferation and apoptosis by inhibiting the Wnt signaling.
International Nuclear Information System (INIS)
Li, Zhi; Li, Youjun; Wang, Nan; Yang, Lifeng; Zhao, Wei; Zeng, Xiandong
2016-01-01
miR-130b was significantly up-regulated in osteosarcoma (OS) cells. Naked cuticle homolog 2 (NKD2) inhibited tumor growth and metastasis in OS by suppressing Wnt signaling. We used three miRNA target analysis tools to identify potential targets of miR-130b, and found that NKD2 is a potential target of miR-130b. Based on these findings, we hypothesize that miR-130b might target NKD2 and regulate the Wnt signaling to promote OS growth. We detected the expression of miR-130b and NKD2 mRNA and protein by quantitative Real-Time PCR (qRT-PCR) and western blot assays, respectively, and found up-regulation of miR-130b and down-regulation of NKD2 mRNA and protein exist in OS cell lines. MTT and flow cytometry assays showed that miR-130b inhibitors inhibit proliferation and promote apoptosis in OS cells. Furthermore, we showed that NKD2 is a direct target of miR-130b, and miR-130b regulated proliferation and apoptosis of OS cells by targeting NKD2. We further investigated whether miR-130b and NKD2 regulate OS cell proliferation and apoptosis by inhibiting Wnt signaling, and the results confirmed our speculation that miR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis of OS cells. These findings will offer new clues for OS development and progression, and novel potential therapeutic targets for OS. - Highlights: • miR-130b is up-regulated and NKD2 is down-regulated in osteosarcoma cell lines. • Down-regulation of miR-130b inhibits proliferation of osteosarcoma cells. • Down-regulation of miR-130b promotes apoptosis of osteosarcoma cells. • miR-130b directly targets NKD2. • NKD2 regulates OS cell proliferation and apoptosis by inhibiting the Wnt signaling.
Parsa, Kishore V. L.; Kain, Vasundhara; Behera, Soma; Suraj, Sashidhara Kaimal; Babu, Phanithi Prakash; Kar, Anand; Panda, Sunanda; Zhu, Yi-jun; Jia, Yuzhi; Thimmapaya, Bayar; Reddy, Janardan K.; Misra, Parimal
2013-01-01
PRIP-Interacting protein with methyl transferase domain (PIMT) serves as a molecular bridge between CREB-binding protein (CBP)/ E1A binding protein p300 (Ep300) -anchored histone acetyl transferase and the Mediator complex sub-unit1 (Med1) and modulates nuclear receptor transcription. Here, we report that ERK2 phosphorylates PIMT at Ser298 and enhances its ability to activate PEPCK promoter. We observed that PIMT is recruited to PEPCK promoter and adenoviral-mediated over-expression of PIMT in rat primary hepatocytes up-regulated expression of gluconeogenic genes including PEPCK. Reporter experiments with phosphomimetic PIMT mutant (PIMTS298D) suggested that conformational change may play an important role in PIMT-dependent PEPCK promoter activity. Overexpression of PIMT and Med1 together augmented hepatic glucose output in an additive manner. Importantly, expression of gluconeogenic genes and hepatic glucose output were suppressed in isolated liver specific PIMT knockout mouse hepatocytes. Furthermore, consistent with reporter experiments, PIMTS298D but not PIMTS298A augmented hepatic glucose output via up-regulating the expression of gluconeogenic genes. Pharmacological blockade of MAPK/ERK pathway using U0126, abolished PIMT/Med1-dependent gluconeogenic program leading to reduced hepatic glucose output. Further, systemic administration of T4 hormone to rats activated ERK1/2 resulting in enhanced PIMT ser298 phosphorylation. Phosphorylation of PIMT led to its increased binding to the PEPCK promoter, increased PEPCK expression and induction of gluconeogenesis in liver. Thus, ERK2-mediated phosphorylation of PIMT at Ser298 is essential in hepatic gluconeogenesis, demonstrating an important role of PIMT in the pathogenesis of hyperglycemia. PMID:24358311
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Transport proteins promoting Escherichia coli pathogenesis
Tang, Fengyi; Saier, Milton H.
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185
Transport proteins promoting Escherichia coli pathogenesis.
Tang, Fengyi; Saier, Milton H
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Lee, C A; Silva, M; Siber, A M; Kelly, A J; Galyov, E; McCormick, B A
2000-10-24
In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal epithelial cells, bacterial internalization is not required for the signaling mechanisms that induce PMN movement. Here, we sought to determine which S. typhimurium factors and intestinal epithelial signaling pathways elicit the production of PMN chemoattractants by enterocytes. Our results suggest that S. typhimurium activates a protein kinase C-dependent signal transduction pathway that orchestrates transepithelial PMN movement. We show that the type III effector protein, SipA, is not only necessary but is sufficient to induce this proinflammatory response in epithelial cells. Our results force us to reconsider the long-held view that Salmonella effector proteins must be directly delivered into host cells from bacterial cells.
Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins
Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki
2010-01-01
Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683
Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D
2017-03-02
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.
Guilbert, Solenn M; Lambert, Herman; Rodrigue, Marc-Antoine; Fuchs, Margit; Landry, Jacques; Lavoie, Josée N
2018-02-05
BCL2-associated athanogene (BAG)-3 is viewed as a platform that would physically and functionally link distinct classes of molecular chaperones of the heat shock protein (HSP) family for the stabilization and clearance of damaged proteins. In this study, we show that HSPB8, a member of the small heat shock protein subfamily, cooperates with BAG3 to coordinate the sequestration of harmful proteins and the cellular adaptive response upon proteasome inhibition. Silencing of HSPB8, like depletion of BAG3, inhibited targeting of ubiquitinated proteins to the juxtanuclear aggresome, a mammalian system of spatial quality control. However, aggresome targeting was restored in BAG3-depleted cells by a mutant BAG3 defective in HSPB8 binding, uncoupling HSPB8 function from its binding to BAG3. Depletion of HSPB8 impaired formation of ubiquitinated microaggregates in an early phase and interfered with accurate modifications of the stress sensor p62/sequestosome (SQSTM)-1. This impairment correlated with decreased coupling of BAG3 to p62/SQSTM1 in response to stress, hindering Kelch-like ECH-associated protein (KEAP)-1 sequestration and stabilization of nuclear factor E2-related factor (Nrf)-2, an important arm of the antioxidant defense. Notably, the myopathy-associated mutation of BAG3 (P209L), which lies within the HSPB8-binding motif, deregulated the association between BAG3 and p62/SQSTM1 and the KEAP1-Nrf2 signaling axis. Together, our findings support a so-far-unrecognized role for the HSPB8-BAG3 connection in mounting of an efficient stress response, which may be involved in BAG3-related human diseases.-Guilbert, S. M., Lambert, H., Rodrigue, M.-A., Fuchs, M., Landry, J., Lavoie, J. N. HSPB8 and BAG3 cooperate to promote spatial sequestration of ubiquitinated proteins and coordinate the cellular adaptive response to proteasome insufficiency.
Levy-Apter, Einat; Finkelshtein, Eynat; Vemulapalli, Vidyasiri; Li, Shawn S-C; Bedford, Mark T; Elson, Ari
2014-12-26
The non-receptor isoform of protein-tyrosine phosphatase ϵ (cyt-PTPe) supports adhesion of bone-resorbing osteoclasts by activating Src downstream of integrins. Loss of cyt-PTPe reduces Src activity in osteoclasts, reduces resorption of mineralized matrix both in vivo and in cell culture, and induces mild osteopetrosis in young female PTPe KO mice. Activation of Src by cyt-PTPe is dependent upon this phosphatase undergoing phosphorylation at its C-terminal Tyr-638 by partially active Src. To understand how cyt-PTPe activates Src, we screened 73 Src homology 2 (SH2) domains for binding to Tyr(P)-638 of cyt-PTPe. The SH2 domain of GRB2 bound Tyr(P)-638 of cyt-PTPe most prominently, whereas the Src SH2 domain did not bind at all, suggesting that GRB2 may link PTPe with downstream molecules. Further studies indicated that GRB2 is required for activation of Src by cyt-PTPe in osteoclast-like cells (OCLs) in culture. Overexpression of GRB2 in OCLs increased activating phosphorylation of Src at Tyr-416 and of cyt-PTPe at Tyr-638; opposite results were obtained when GRB2 expression was reduced by shRNA or by gene inactivation. Phosphorylation of cyt-PTPe at Tyr-683 and its association with GRB2 are integrin-driven processes in OCLs, and cyt-PTPe undergoes autodephosphorylation at Tyr-683, thus limiting Src activation by integrins. Reduced GRB2 expression also reduced the ability of bone marrow precursors to differentiate into OCLs and reduced the fraction of OCLs in which podosomal adhesion structures assume organization typical of active, resorbing cells. We conclude that GRB2 physically links cyt-PTPe with Src and enables cyt-PTPe to activate Src downstream of activated integrins in OCLs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Aryan, Homayon; Boynton, Richard J.; Walker, Simon N.
2013-02-01
A correlation between solar wind velocity (VSW) and energetic electron fluxes (EEF) at the geosynchronous orbit was first identified more than 30 years ago. However, recent studies have shown that the relation between VSW and EEF is considerably more complex than was previously suggested. The application of process identification technique to the evolution of electron fluxes in the range 1.8 - 3.5 MeV has also revealed peculiarities in the relation between VSW and EEF at the geosynchronous orbit. It has been revealed that for a constant solar wind density, EEF increase with VSW until a saturation velocity is reached. Beyond the saturation velocity, an increase in VSW is statistically not accompanied with EEF enhancement. The present study is devoted to the investigation of saturation velocity and its dependency upon solar wind density using the reverse arrangement test. In general, the results indicate that saturation velocity increases as solar wind density decreases. This implies that solar wind density plays an important role in defining the relationship between VSW and EEF at the geosynchronous orbit.
Li, Wanxia; Tao, Shaoyu; Wu, Qinghua; Wu, Tao; Tao, Ran; Fan, Jun
2017-12-01
Myocardial cell injury and cardiac myocyte apoptosis are associated with sepsis. Glutamine (Gln) has been reported to repair myocardial cell injury. The aim of this study was to explore the role of Gln on cardiac myocytes in a cecal ligation and puncture (CLP) model of sepsis in Wistar rats. Following induction of sepsis in a CLP rat model, viral encoding heat shock protein 90 (Hsp90) gene and Hsp90dsDNA were designed to express and knockdown Hsp90, respectively. Rat cardiac tissues were examined histologically, and apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling staining. The expression of B-cell lymphoma-2 (Bcl-2), Bcl-2-associated X protein, Hsp90, p53 upregulated modulator of apoptosis, and p53 was measured by western blotting and real-time polymerase chain reaction. Caspase-3, caspase-8, and caspase-9 were detected by enzyme-linked immunosorbent assay. Rat cardiac myocyte damage induced by CLP was reduced by Gln treatment and Hsp90 overexpression, and these changes were reversed by Hsp90 knockdown. Bcl-2 expression, Bcl-2-associated X protein, p53, p53 upregulated modulator of apoptosis, caspase-8, caspase-9, and caspase-3 activities were significantly upregulated in the CLP model, which were reduced by Gln treatment and Hsp90 overexpression. Gln reduced apoptosis of cardiac myocytes in a rat model of sepsis, by promoting Hsp90 expression. Further studies are needed to determine the possible therapeutic action of Gln in sepsis in human tissue. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Manuel D Díaz-Muñoz
Full Text Available Post-transcriptional mRNA regulation by RNA binding proteins (RBPs associated with AU-rich elements (AREs present in the 3' untranslated region (3'UTR of specific mRNAs modulates transcript stability and translation in eukaryotic cells. Here we have functionally characterised the importance of the AREs present within the Bcl2 3'UTR in order to maintain Bcl2 expression. Gene targeting deletion of 300 nucleotides of the Bcl2 3'UTR rich in AREs diminishes Bcl2 mRNA stability and protein levels in primary B cells, decreasing cell lifespan. Generation of chimeric mice indicates that Bcl2-ARE∆/∆ B cells have an intrinsic competitive disadvantage compared to wild type cells. Biochemical assays and predictions using a bioinformatics approach show that several RBPs bind to the Bcl2 AREs, including AUF1 and HuR proteins. Altogether, association of RBPs to Bcl2 AREs contributes to Bcl2 protein expression by stabilizing Bcl2 mRNA and promotes B cell maintenance.
Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice.
Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum
2016-01-01
The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
UO{sub 2}{sup 2+}/protein complexation sites screening
Energy Technology Data Exchange (ETDEWEB)
Guilbaud, P.; Pible, O
2004-07-01
Uranium(VI) is likely to make strong coordination with some proteins in the plasma and in targeted cells. In the frame of a nuclear toxicology program, a biochemical strategy has been developed to identify these targets in complex biological media. The present work focuses on an approach based on the screening of 3D protein structures in order to identify proteins able to bind UO{sub 2}{sup 2+} and the corresponding complexation sites in these proteins. Our preliminary results show that indeed a few proteins display a high affinity to uranyl salt. The site of interaction may be mapped using molecular modeling, providing coherent results with the biochemical data. (authors)
Chen, Buxin; Dores, Michael R.; Grimsey, Neil; Canto, Isabel; Barker, Breann L.; Trejo, JoAnn
2011-01-01
Signaling by protease-activated receptor-1 (PAR1), a G protein-coupled receptor (GPCR) for thrombin, is regulated by desensitization and internalization. PAR1 desensitization is mediated by β-arrestins, like most classic GPCRs. In contrast, internalization of PAR1 occurs through a clathrin- and dynamin-dependent pathway independent of β-arrestins. PAR1 displays two modes of internalization. Constitutive internalization of unactivated PAR1 is mediated by the clathrin adaptor protein complex-2 (AP-2), where the μ2-adaptin subunit binds directly to a tyrosine-based motif localized within the receptor C-tail domain. However, AP-2 depletion only partially inhibits agonist-induced internalization of PAR1, suggesting a function for other clathrin adaptors in this process. Here, we now report that AP-2 and epsin-1 are both critical mediators of agonist-stimulated PAR1 internalization. We show that ubiquitination of PAR1 and the ubiquitin-interacting motifs of epsin-1 are required for epsin-1-dependent internalization of activated PAR1. In addition, activation of PAR1 promotes epsin-1 de-ubiquitination, which may increase its endocytic adaptor activity to facilitate receptor internalization. AP-2 also regulates activated PAR1 internalization via recognition of distal C-tail phosphorylation sites rather than the canonical tyrosine-based motif. Thus, AP-2 and epsin-1 are both required to promote efficient internalization of activated PAR1 and recognize discrete receptor sorting signals. This study defines a new pathway for internalization of mammalian GPCRs. PMID:21965661
Zheng, Yanhua; Yang, Weiwei; Xia, Yan; Hawke, David; Liu, David X.; Lu, Zhimin
2011-01-01
Protein tyrosine phosphatase (PTP)-PEST is a critical regulator of cell adhesion and migration. However, the mechanism by which PTP-PEST is regulated in response to oncogenic signaling to dephosphorylate its substrates remains unclear. Here, we demonstrate that activated Ras induces extracellular signal-regulated kinase 1 and 2-dependent phosphorylation of PTP-PEST at S571, which recruits PIN1 to bind to PTP-PEST. Isomerization of the phosphorylated PTP-PEST by PIN1 increases the interaction between PTP-PEST and FAK, which leads to the dephosphorylation of FAK Y397 and the promotion of migration, invasion, and metastasis of v-H-Ras-transformed cells. These findings uncover an important mechanism for the regulation of PTP-PEST in activated Ras-induced tumor progression. PMID:21876001
Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair.
Nakanishi, Koji; Yang, Yun-Gui; Pierce, Andrew J; Taniguchi, Toshiyasu; Digweed, Martin; D'Andrea, Alan D; Wang, Zhao-Qi; Jasin, Maria
2005-01-25
Fanconi anemia (FA) is a recessive disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. Cells from FA patients are hypersensitive to agents that produce DNA crosslinks and, after treatment with these agents, have pronounced chromosome breakage and other cytogenetic abnormalities. Eight FANC genes have been cloned, and the encoded proteins interact in a common cellular pathway. DNA-damaging agents activate the monoubiquitination of FANCD2, resulting in its targeting to nuclear foci that also contain BRCA1 and BRCA2/FANCD1, proteins involved in homology-directed DNA repair. Given the interaction of the FANC proteins with BRCA1 and BRCA2, we tested whether cells from FA patients (groups A, G, and D2) and mouse Fanca-/- cells with a targeted mutation are impaired for this repair pathway. We find that both the upstream (FANCA and FANCG) and downstream (FANCD2) FA pathway components promote homology-directed repair of chromosomal double-strand breaks (DSBs). The FANCD2 monoubiquitination site is critical for normal levels of repair, whereas the ATM phosphorylation site is not. The defect in these cells, however, is mild, differentiating them from BRCA1 and BRCA2 mutant cells. Surprisingly, we provide evidence that these proteins, like BRCA1 but unlike BRCA2, promote a second DSB repair pathway involving homology, i.e., single-strand annealing. These results suggest an early role for the FANC proteins in homologous DSB repair pathway choice.
Yan, Jing; Liu, Chuan; Jiang, Jing-Yi; Liu, Hans; Li, Chao; Li, Xin-Yu; Yuan, Ye; Zong, Zhi-Hong; Wang, Hua-Qin
2017-10-01
Bcl-2 associated athanogene 3 (BAG3) contains a modular structure, through which BAG3 interacts with a wide range of proteins, thereby affording its capacity to regulate multifaceted biological processes. BAG3 is often highly expressed and functions as a pro-survival factor in many cancers. However, the oncogenic potential of BAG3 remains not fully understood. The cell cycle regulator, S-phase kinase associated protein 2 (Skp2) is increased in various cancers and plays an important role in tumorigenesis. The current study demonstrated that BAG3 promoted proliferation of ovarian cancer cells via upregulation of Skp2. BAG3 stabilized Skp2 mRNA via its 3'-untranslated region (UTR). The current study demonstrated that BAG3 interacted with Skp2 mRNA. In addition, miR-21-5p suppressed Skp2 expression, which was compromised by forced BAG3 expression. These results indicated that at least some oncogenic functions of BAG3 were mediated through posttranscriptional regulation of Skp2 via antagonizing suppressive action of miR-21-5p in ovarian cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Lin, Hung-Chih; Su, Shih-Li; Lu, Chia-Yang; Lin, Ai-Hsuan; Lin, Wan-Chun; Liu, Chin-San; Yang, Ya-Chen; Wang, Hsiu-Miao; Lii, Chong-Kuei; Chen, Haw-Wen
2017-03-01
Andrographolide, the main bioactive component of the medicinal plant Andrographis paniculata, has been shown to possess potent anti-inflammatory activity. Endothelin 1 (ET-1), a potent vasoconstrictor peptide produced by vascular endothelial cells, displays proinflammatory property. Hypoxia-inducible factor 1α (HIF-1α), the regulatory member of the transcription factor heterodimer HIF-1α/β, is one of the most important molecules that responds to hypoxia. Changes in cellular HIF-1α protein level are the result of altered gene transcription and protein stability, with the latter being dependent on prolyl hydroxylases (PHDs). In this study, inhibition of pro-inflammatory ET-1 expression and changes of HIF-1α gene transcription and protein stability under hypoxia by andrographolide in EA.hy926 endothelial-like cells were investigated. Hypoxic conditions were created using the hypoxia-mimetic agent CoCl 2. We found that hypoxia stimulated the production of reactive oxygen species (ROS), the expression of HIF-1α mRNA and protein, and the expression and secretion of ET-1. These effects, however, were attenuated by co-exposure to andrographolide, bilirubin, and RuCO. Silencing Nrf2 and heme oxygenase 1 (HO-1) reversed the inhibitory effects of andrographolide on hypxoia-induced HIF-1α mRNA and protein expression. Moreover, andrographolide increased the expression of prolyl hydroxylases (PHD) 2/3, which hydroxylate HIF-1α and promotes HIF-1α proteasome degradation, with an increase in HIF-1α hydroxylation was noted under hypoxia. Inhibition of p38 MAPK abrogated the hypoxia-induced increases in HIF-1α mRNA and protein expression as well as ET-1 mRNA expression and secretion. Taken together, these results suggest that andrographolide suppresses hypoxia-induced pro-inflammatory ET-1 expression by activating Nrf2/HO-1, inhibiting p38 MAPK signaling, and promoting PHD2/3 expression. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 918-930, 2017. © 2016 Wiley
Kim, Yoon; Song, Ji-Hye; Park, Seon-U; Jeong, You-Seung; Kim, Soo-Hwan
2017-02-01
Brassinosteroids (BRs) are plant polyhydroxy-steroids that play important roles in plant growth and development via extensive signal integration through direct interactions between regulatory components of different signaling pathways. Recent studies have shown that diverse helix-loop-helix/basic helix-loop-helix (HLH/bHLH) family proteins are actively involved in control of BR signaling pathways and interact with other signaling pathways. In this study, we show that ATBS1-INTERACTING FACTOR 2 (AIF2), a nuclear-localized atypical bHLH transcription factor, specifically interacts with BRASSINOSTEROID-INSENSITIVE 2 (BIN2) among other BR signaling molecules. Overexpression of AIF2 down-regulated transcript expression of growth-promoting genes, thus resulting in retardation of growth. AIF2 renders plants hyposensitive to BR-induced root growth inhibition, but shows little effects on BR-promoted hypocotyl elongation. Notably, AIF2 was dephosphorylated by BR, and the dephosphorylated AIF2 was subject to proteasome-mediated degradation. AIF2 degradation was greatly induced by BR and ABA, but relatively slightly by other hormones such as auxin, gibberellin, cytokinin and ethylene. Moreover, AIF2 transcription was significantly suppressed by a BRI1/BZR1-mediated BR signaling pathway through a direct binding of BRASSINAZOLE RESISTANT 1 (BZR1) to the BR response element (BRRE) region of the AIF2 promoter. In conclusion, our study suggests that BIN2-driven AIF2 phosphorylation could augment the BIN2/AIF2-mediated negative circuit of BR signaling pathways, and the BR-induced transcriptional repression and protein degradation negatively regulate AIF2 transcription factor, reinforcing the BZR1/BES1-mediated positive BR signaling pathway. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Zheng, Xuqin [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China); Sun, Tao [Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Nanjing, Jiangsu Province 210002 (China); Wang, Xiaodong, E-mail: xdwang666@hotmail.com [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China)
2013-07-05
Highlights: •TC, a CB2R specific agonist, stimulates SIRT1 activity by PKA/CREB pathway. •TC promotes PGC-1α transcriptional activity by increasing its deacetylation. •TC increases the expression of genes linked to FAO and promotes the rate of FAO. •The effects of TC in FAO are dependent on CB2R. •Suggesting CB2R as a target to treat diseases with lipid dysregulation. -- Abstract: Abnormal fatty acid oxidation has been associated with obesity and type 2 diabetes. At the transcriptional level, peroxisome proliferator-activated receptor-gamma coactivator 1α (PGC-1α) has been reported to strongly increase the ability of hormone nuclear receptors PPARα and ERRα to drive transcription of fatty acid oxidation enzymes. In this study, we report that a specific agonist of the type 2 cannabinoid receptor (CB2R) can lead to fatty acid oxidation through the PGC-1α pathway. We have found that CB2R is expressed in differentiated C2C12 myotubes, and that use of the specific agonist trans-caryophyllene (TC) stimulates sirtuin 1 (SIRT1) deacetylase activity by increasing the phosphorylation of cAMP response element-binding protein (CREB), thus leading to increased levels of PGC-1α deacetylation. This use of TC treatment increases the expression of genes linked to the fatty acid oxidation pathway in a SIRT1/PGC-1α-dependent mechanism and also drastically accelerates the rate of complete fatty acid oxidation in C2C12 myotubes, neither of which occur when CB2R mRNA is knocked down using siRNA. These results reveal that activation of CB2R by a selective agonist promotes lipid oxidation through a signaling/transcriptional pathway. Our findings imply that pharmacological manipulation of CB2R may provide therapeutic possibilities to treat metabolic diseases associated with lipid dysregulation.
Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong
2015-01-01
The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799
Energy Technology Data Exchange (ETDEWEB)
Lin, Chen-Si [Department of Biological Science and Technology, National Chiao-Tung University, Hsin-Chu, Taiwan (China); School of Veterinary Medicine, National Taiwan University, Taipei, Taiwan (China); He, Pei-Juin; Hsu, Wei-Tung [Department of Biological Science and Technology, National Chiao-Tung University, Hsin-Chu, Taiwan (China); Wu, Ming-Shiang [Department of Internal Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Wu, Chang-Jer [Department of Food Science, National Taiwan Ocean University, Keelung, Taiwan (China); Shen, Hsiao-Wei [Institute of Molecular Medicine and Bioengineering, National Chiao-Tung University, Hsin-Chu, Taiwan (China); Hwang, Chia-Hsiang [Yung-Shin Pharmaceutical Industry Co., Ltd., Tachia, Taichung, Taiwan (China); Lai, Yiu-Kay [Department of Life Science, Institute of Biotechnology, National Tsing Hua University, Hsin-Chu, Taiwan (China); Tsai, Nu-Man [School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung, Taiwan (China); Liao, Kuang-Wen, E-mail: kitchhen@yahoo.com.tw [Institute of Molecular Medicine and Bioengineering, National Chiao-Tung University, Hsin-Chu, Taiwan (China)
2010-06-25
Helicobacter pylori is a potent carcinogen associated with gastric cancer malignancy. Recently, H. pylori Heat shock protein 60 (HpHSP60) has been reported to promote cancer development by inducing chronic inflammation and promoting tumor cell migration. This study demonstrates a role for HpHSP60 in angiogenesis, a necessary precursor to tumor growth. We showed that HpHSP60 enhanced cell migration and tube formation, but not cell proliferation, in human umbilical vein endothelial cells (HUVECs). HpHSP60 also indirectly promoted HUVEC proliferation when HUVECs were co-cultured with supernatants collected from HpHSP60-treated AGS or THP-1 cells. The angiogenic array showed that HpHSP60 dramatically induced THP-1 cells and HUVECs to produce the chemotactic factors IL-8 and GRO. Inhibition of CXCR2, the receptor for IL-8 and GRO, or downstream PLC{beta}2/Ca2+-mediated signaling, significantly abolished HpHSP60-induced tube formation. In contrast, suppression of MAP K or PI3 K signaling did not affect HpHSP60-mediated tubulogenesis. These data suggest that HpHSP60 enhances angiogenesis via CXCR2/PLC{beta}2/Ca2+ signal transduction in endothelial cells.
International Nuclear Information System (INIS)
Lin, Chen-Si; He, Pei-Juin; Hsu, Wei-Tung; Wu, Ming-Shiang; Wu, Chang-Jer; Shen, Hsiao-Wei; Hwang, Chia-Hsiang; Lai, Yiu-Kay; Tsai, Nu-Man; Liao, Kuang-Wen
2010-01-01
Helicobacter pylori is a potent carcinogen associated with gastric cancer malignancy. Recently, H. pylori Heat shock protein 60 (HpHSP60) has been reported to promote cancer development by inducing chronic inflammation and promoting tumor cell migration. This study demonstrates a role for HpHSP60 in angiogenesis, a necessary precursor to tumor growth. We showed that HpHSP60 enhanced cell migration and tube formation, but not cell proliferation, in human umbilical vein endothelial cells (HUVECs). HpHSP60 also indirectly promoted HUVEC proliferation when HUVECs were co-cultured with supernatants collected from HpHSP60-treated AGS or THP-1 cells. The angiogenic array showed that HpHSP60 dramatically induced THP-1 cells and HUVECs to produce the chemotactic factors IL-8 and GRO. Inhibition of CXCR2, the receptor for IL-8 and GRO, or downstream PLCβ2/Ca2+-mediated signaling, significantly abolished HpHSP60-induced tube formation. In contrast, suppression of MAP K or PI3 K signaling did not affect HpHSP60-mediated tubulogenesis. These data suggest that HpHSP60 enhances angiogenesis via CXCR2/PLCβ2/Ca2+ signal transduction in endothelial cells.
Directory of Open Access Journals (Sweden)
Hongying Zhang
2017-07-01
Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.
Delivery of bone morphogenetic protein-2 and substance P using graphene oxide for bone regeneration
Directory of Open Access Journals (Sweden)
La WG
2014-05-01
Full Text Available Wan-Geun La,1 Min Jin,1 Saibom Park,1,2 Hee-Hun Yoon,1 Gun-Jae Jeong,1 Suk Ho Bhang,1 Hoyoung Park,1,2 Kookheon Char,1,2 Byung-Soo Kim1,31School of Chemical and Biological Engineering, Seoul National University, Seoul, Republic of Korea; 2The National Creative Research Initiative Center for Intelligent Hybrids, Seoul National University, Seoul, Republic of Korea; 3Institute of Bioengineering, Institute of Chemical Processes, Engineering Research Institute, Seoul National University, Seoul, Republic of KoreaAbstract: In this study, we demonstrate that graphene oxide (GO can be used for the delivery of bone morphogenetic protein-2 (BMP-2 and substance P (SP, and that this delivery promotes bone formation on titanium (Ti implants that are coated with GO. GO coating on Ti substrate enabled a sustained release of BMP-2. BMP-2 delivery using GO-coated Ti exhibited a higher alkaline phosphatase activity in bone-forming cells in vitro compared with bare Ti. SP, which is known to recruit mesenchymal stem cells (MSCs, was co-delivered using Ti or GO-coated Ti to further promote bone formation. SP induced the migration of MSCs in vitro. The dual delivery of BMP-2 and SP using GO-coated Ti showed the greatest new bone formation on Ti implanted in the mouse calvaria compared with other groups. This approach may be useful to improve osteointegration of Ti in dental or orthopedic implants.Keywords: bone morphogenetic protein-2, bone regeneration, graphene oxides, stem cell recruitment, substance P
Duan, Chaojun; Li, Minghua; Rui, Liangyou
2004-10-15
Leptin regulates energy homeostasis primarily by binding and activating its long form receptor (LRb). Deficiency of either leptin or LRb causes morbid obesity. Leptin stimulates LRb-associated JAK2, thus initiating multiple pathways including the Stat3 and phosphatidylinositol (PI) 3-kinase pathways that mediate leptin biological actions. Here we report that SH2-B, a JAK2-interacting protein, promotes activation of the PI 3-kinase pathway by recruiting insulin receptor substrate 1 (IRS1) and IRS2 in response to leptin. SH2-B directly bound, via its PH and SH2 domain, to both IRS1 and IRS2 both in vitro and in intact cells and mediated formation of a JAK2/SH2-B/IRS1 or IRS2 tertiary complex. Consequently, SH2-B dramatically enhanced leptin-stimulated tyrosine phosphorylation of IRS1 and IRS2 in HEK293 cells stably expressing LRb, thus promoting association of IRS1 and IRS2 with the p85 regulatory subunit of PI 3-kinase and phosphorylation and activation of Akt. SH2-B mutants with lower affinity for IRS1 and IRS2 exhibited reduced ability to promote association of JAK2 with IRS1, tyrosine phosphorylation of IRS1, and association of IRS1 with p85 in response to leptin. Moreover, deletion of the SH2-B gene impaired leptin-stimulated tyrosine phosphorylation of endogenous IRS1 in mouse embryonic fibroblasts (MEF), which was reversed by reintroduction of SH2-B. Similarly, SH2-B promoted growth hormone-stimulated tyrosine phosphorylation of IRS1 in both HEK293 and MEF cells. Our data suggest that SH2-B is a novel mediator of the PI 3-kinase pathway in response to leptin or other hormones and cytokines that activate JAK2.