The eukaryotic translation elongation factor eEF1A2 induces neoplastic properties and mediates tumorigenic effects of ZNF217 in precursor cells of human ovarian carcinomas

Energy Technology Data Exchange (ETDEWEB)

Sun, Yu; Wong, Nicholas; Guan, Yinghui; Salamanca, Clara M.; Cheng, Jung Chien; Lee, Jonathan M.; Gray, Joe W.; Auersperg, Nelly

2008-04-25

Ovarian epithelial carcinomas (OEC) frequently exhibit amplifications at the 20q13 locus which is the site of several oncogenes, including the eukaryotic elongation factor EEF1A2 and the transcription factor ZNF217. We reported previously that overexpressed ZNF217 induces neoplastic characteristics in precursor cells of OEC. Unexpectedly, ZNF217, which is a transcriptional repressor, enhanced expression of eEF1A2. In this study, array comparative genomic hybridization, single nucleotide polymorphism and Affymetrix analysis of ZNF217-overexpressing cell lines confirmed consistently increased expression of eEF1A2 but not of other oncogenes, and revealed early changes in EEF1A2 gene copy numbers and increased expression at crisis during immortalization. We defined the influence of eEF1A2 overexpression on immortalized ovarian surface epithelial cells, and investigated interrelationships between effects of ZNF217 and eEF1A2 on cellular phenotypes. Lentivirally induced eEF1A2 overexpression caused delayed crisis, apoptosis resistance and increases in serum-independence, saturation densities, and anchorage independence. siRNA to eEF1A2 reversed apoptosis resistance and reduced anchorage independence in eEF1A2-overexpressing lines. Remarkably, siRNA to eEF1A2 was equally efficient in inhibiting both anchorage independence and resistance to apoptosis conferred by ZNF217 overexpression. Our data define neoplastic properties that are caused by eEF1A2 in nontumorigenic ovarian cancer precursor cells, and suggest that eEF1A2 plays a role in mediating ZNF217-induced neoplastic progression.

Mammalian translation elongation factor eEF1A2: X-ray structure and new features of GDP/GTP exchange mechanism in higher eukaryotes.

Science.gov (United States)

Crepin, Thibaut; Shalak, Vyacheslav F; Yaremchuk, Anna D; Vlasenko, Dmytro O; McCarthy, Andrew; Negrutskii, Boris S; Tukalo, Michail A; El'skaya, Anna V

2014-11-10

Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon-anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the 'GTP'- and 'GDP'-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Prenatal low-dose methylmercury exposure impairs neurite outgrowth and synaptic protein expression and suppresses TrkA pathway activity and eEF1A1 expression in the rat cerebellum

Energy Technology Data Exchange (ETDEWEB)

Fujimura, Masatake, E-mail: fujimura@nimd.go.jp [Department of Basic Medical Sciences, National Institute for Minamata Disease, Kumamoto (Japan); Usuki, Fusako [Department of Clinical Medicine, National Institute for Minamata Disease, Kumamoto (Japan); Cheng, Jinping; Zhao, Wenchang [School of Environmental Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)

2016-05-01

Methylmercury (MeHg) is a highly neurotoxic environmental chemical that can cause developmental impairments. Human fetuses and neonates are particularly susceptible to MeHg toxicity; however, the mechanisms governing its effects in the developing brain are unclear. In the present study, we investigated the effects of prenatal and lactational MeHg exposure on the developing cerebellum in rats. We demonstrated that exposure to 5 ppm MeHg decreased postnatal expression of pre- and postsynaptic proteins, suggesting an impairment in synaptic development. MeHg exposure also reduced neurite outgrowth, as shown by a decrease in the expression of the neurite marker neurofilament H. These changes were not observed in rats exposed to 1 ppm MeHg. In order to define the underlying mechanism, we investigated the effects of MeHg exposure on the tropomyosin receptor kinase (Trk) A pathway, which plays important roles in neuronal differentiation and synapse formation. We demonstrated suppression of the TrkA pathway on gestation day 20 in rats exposed to 5 ppm MeHg. In addition, down-regulation of eukaryotic elongation factor 1A1 (eEF1A1) was observed on postnatal day 1. eEF1A1 knockdown in differentiating PC12 cells impaired neurite outgrowth and synaptic protein expression, similar to the results of MeHg exposure in the cerebellum. These results suggest that suppression of the TrkA pathway and subsequent decreases in eEF1A1 expression induced by prenatal exposure to MeHg may lead to reduced neurite outgrowth and synaptic protein expression in the developing cerebellum. - Highlights: • Prenatal exposure to MeHg decreased postnatal expression of synaptic proteins. • MeHg exposure also reduced neurite outgrowth postnatally. • Suppression of the TrkA pathway and eEF1A1 expression was induced by MeHg exposure. • eEF1A1 knockdown impaired neurite outgrowth and synaptic protein expression.

Prenatal low-dose methylmercury exposure impairs neurite outgrowth and synaptic protein expression and suppresses TrkA pathway activity and eEF1A1 expression in the rat cerebellum

International Nuclear Information System (INIS)

Fujimura, Masatake; Usuki, Fusako; Cheng, Jinping; Zhao, Wenchang

2016-01-01

Methylmercury (MeHg) is a highly neurotoxic environmental chemical that can cause developmental impairments. Human fetuses and neonates are particularly susceptible to MeHg toxicity; however, the mechanisms governing its effects in the developing brain are unclear. In the present study, we investigated the effects of prenatal and lactational MeHg exposure on the developing cerebellum in rats. We demonstrated that exposure to 5 ppm MeHg decreased postnatal expression of pre- and postsynaptic proteins, suggesting an impairment in synaptic development. MeHg exposure also reduced neurite outgrowth, as shown by a decrease in the expression of the neurite marker neurofilament H. These changes were not observed in rats exposed to 1 ppm MeHg. In order to define the underlying mechanism, we investigated the effects of MeHg exposure on the tropomyosin receptor kinase (Trk) A pathway, which plays important roles in neuronal differentiation and synapse formation. We demonstrated suppression of the TrkA pathway on gestation day 20 in rats exposed to 5 ppm MeHg. In addition, down-regulation of eukaryotic elongation factor 1A1 (eEF1A1) was observed on postnatal day 1. eEF1A1 knockdown in differentiating PC12 cells impaired neurite outgrowth and synaptic protein expression, similar to the results of MeHg exposure in the cerebellum. These results suggest that suppression of the TrkA pathway and subsequent decreases in eEF1A1 expression induced by prenatal exposure to MeHg may lead to reduced neurite outgrowth and synaptic protein expression in the developing cerebellum. - Highlights: • Prenatal exposure to MeHg decreased postnatal expression of synaptic proteins. • MeHg exposure also reduced neurite outgrowth postnatally. • Suppression of the TrkA pathway and eEF1A1 expression was induced by MeHg exposure. • eEF1A1 knockdown impaired neurite outgrowth and synaptic protein expression.

Isoforms of elongation factor eEF1A may be differently regulated at post-transcriptional level in breast cancer progression

Directory of Open Access Journals (Sweden)

Vislovukh A. A.

2013-01-01

Full Text Available Eukaryotic translation elongation factor 1A exists as two 98 % homologous isoforms: eEF1A1 (A1 and eEF1A2 (A2 which are tissue and development specific. Despite high homology in an open reading frame (ORF region, mRNAs coding for eEF1A1 and eEF1A2 are different in their untranslated regions (UTR, suggesting a possibility of their dissimilar post-transcriptional regulation. Aim. To analyze the existence of cis-acting motifs in the UTRs of EEF1A1/A2 mRNAs, to confirm the possibility of post-transcriptional control of eEF1A1 and eEF1A2 expression. Methods. An ensemble of bioinformatic methods was applied to predict regulatory motifs in the UTRs of EEF1A1/A2 mRNAs. Dual-luciferase reporter assay was employed to detect post-transcriptional regulation of eEF1A1/A2 expression. Results. Numerous regulatory motifs in the UTR of EEF1A1/A2 mRNAs were found bioinformatically. The experimental evidence was obtained for the existence of negative regulation of EEF1A1 and positive regulation of EEF1A2 mRNA in the model of breast cancer development. Conclusions. EEF1A1 and EEF1A2 mRNAs contain distinct motifs in the UTRs and are differently regulated in cancer suggesting the possibility of their control by different cellular signals.

Mapping the human translation elongation factor eEF1H complex using the yeast two-hybrid system

DEFF Research Database (Denmark)

Mansilla, Francisco; Friis, Irene; Jadidi, Mandana

2002-01-01

In eukaryotes, the eukaryotic translation elongation factor eEF1A responsible for transporting amino-acylated tRNA to the ribosome forms a higher-order complex, eEF1H, with its guanine-nucleotide-exchange factor eEF1B. In metazoans, eEF1B consists of three subunits: eEF1B alpha, eEF1B eta and eEF1B...... of in vitro experiments have been proposed for the macromolecular organization of the eEF1H complex. However, these models differ in various aspects. This might be due to the difficulties of handling, particularly the eEF1B beta and eEF1B gamma subunits in vitro. Here, the human eEF1H complex is for the first...... gamma:eEF1B beta, where the last was observed using a three-hybrid approach. Surprisingly, eEF1A2 showed no or only little affinity for the guanine-nucleotide-exchange factors. Truncated versions of the subunits of eEF1B were used to orientate these subunits within the resulting model. The model unit...

Using docking and alchemical free energy approach to determine the binding mechanism of eEF2K inhibitors and prioritizing the compound synthesis.

Science.gov (United States)

Wang, Qiantao; Edupuganti, Ramakrishna; Tavares, Clint D J; Dalby, Kevin N; Ren, Pengyu

2015-01-01

A-484954 is a known eEF2K inhibitor with submicromolar IC50 potency. However, the binding mechanism and the crystal structure of the kinase remains unknown. Here, we employ a homology eEF2K model, docking and alchemical free energy simulations to probe the binding mechanism of eEF2K, and in turn, guide the optimization of potential lead compounds. The inhibitor was docked into the ATP-binding site of a homology model first. Three different binding poses, hypothesis 1, 2, and 3, were obtained and subsequently applied to molecular dynamics (MD) based alchemical free energy simulations. The calculated relative binding free energy of the analogs of A-484954 using the binding pose of hypothesis 1 show a good correlation with the experimental IC50 values, yielding an r (2) coefficient of 0.96 after removing an outlier (compound 5). Calculations using another two poses show little correlation with experimental data, (r (2) of less than 0.5 with or without removing any outliers). Based on hypothesis 1, the calculated relative free energy suggests that bigger cyclic groups, at R1 e.g., cyclobutyl and cyclopentyl promote more favorable binding than smaller groups, such as cyclopropyl and hydrogen. Moreover, this study also demonstrates the ability of the alchemical free energy approach in combination with docking and homology modeling to prioritize compound synthesis. This can be an effective means of facilitating structure-based drug design when crystal structures are not available.

Cloning, sequencing, and transgenic expression of Podospora curvicolla and Sordaria macrospora eEF1A genes: relationship between cytosolic translation and longevity in filamentous fungi.

Science.gov (United States)

Gagny, B; Rossignol, M; Silar, P

1997-12-01

We have cloned and sequenced the gene encoding the translation elongation factor eEF1A from two filamentous fungi, Podospora curvicolla and Sordaria macrospora. These fungi are close relatives of Podospora anserina and also show senescence syndromes. Comparison of the sequences of the deduced proteins with that of P. anserina reveals that the three proteins differ in several positions. Replacement of the P. anserina gene by either of the two exogenous genes does not entail any modification in P. anserina physiology; the longevity of the fungus is not affected. No alteration of in vivo translational accuracy was detected; however, the exogenous proteins nonetheless promoted a modification of the resistance to the aminoglycoside antibiotic paromomycin. These data suggest that optimization of life span between these closely related fungi has likely not been performed during evolution through modifications of eEF1A activity, despite the fact that mutations in this factor can drastically affect longevity. Copyright 1997 Academic Press.

Structure of eEF3 and the mechanism of transfer RNA release from the E-site

DEFF Research Database (Denmark)

Andersen, Christian Brix Folsted; Becker, T.; Blau, M.

2006-01-01

Elongation factor eEF3 is an ATPase, which, in addition to the two canonical factors eEF1A and eEF2, serves an essential function in the translation cycle of fungi. eEF3 is required for the binding of the aatRNA-eEF1A-GTP ternary complex to the ribosomal A-site and has been suggested to facilitate...... the clearance of deacyl-tRNA from the E-site. Here, we present the crystal structure of eEF3 showing that it consists of an N-terminal HEAT repeat domain, followed by a four-helix bundle and two ABC-type ATPase domains with a chromo-domain inserted in ABC2. Moreover, we present the cryo-EM structure of the ATP......-bound form of eEF3 in complex with the post-translocational state 80S ribosome from yeast. eEF3 uses an entirely new factor binding site near the ribosomal E-site, with the chromodomain stabilizing the ribosomal L1 stalk in an open conformation, thus, allowing tRNA release....

Neurite outgrowth mediated by translation elongation factor eEF1A1: a target for antiplatelet agent cilostazol.

Directory of Open Access Journals (Sweden)

Kenji Hashimoto

Full Text Available Cilostazol, a type-3 phosphodiesterase (PDE3 inhibitor, has become widely used as an antiplatelet drug worldwide. A recent second Cilostazol Stroke Prevention Study demonstrated that cilostazol is superior to aspirin for prevention of stroke after an ischemic stroke. However, its precise mechanisms of action remain to be determined. Here, we report that cilostazol, but not the PDE3 inhibitors cilostamide and milrinone, significantly potentiated nerve growth factor (NGF-induced neurite outgrowth in PC12 cells. Furthermore, specific inhibitors for the endoplasmic reticulum protein inositol 1,4,5-triphosphate (IP(3 receptors and several common signaling pathways (PLC-γ, PI3K, Akt, p38 MAPK, and c-Jun N-terminal kinase (JNK, and the Ras/Raf/ERK/MAPK significantly blocked the potentiation of NGF-induced neurite outgrowth by cilostazol. Using a proteomics analysis, we identified that levels of eukaryotic translation elongation factor eEF1A1 protein were significantly increased by treatment with cilostazol, but not cilostamide, in PC12 cells. Moreover, the potentiating effects of cilostazol on NGF-induced neurite outgrowth were significantly antagonized by treatment with eEF1A1 RNAi, but not the negative control of eEF1A1. These findings suggest that eEF1A1 and several common cellular signaling pathways might play a role in the mechanism of cilostazol-induced neurite outgrowth. Therefore, agents that can increase the eEF1A1 protein may have therapeutic relevance in diverse conditions with altered neurite outgrowth.

Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.

Science.gov (United States)

Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li

2017-10-01

Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.

Mitochondrial Respiration Inhibitors Suppress Protein Translation and Hypoxic Signaling via the Hyperphosphorylation and Inactivation of Translation Initiation Factor eIF2α and Elongation Factor eEF2

Science.gov (United States)

Li, Jun; Mahdi, Fakhri; Du, Lin; Datta, Sandipan; Nagle, Dale G.; Zhou, Yu-Dong

2011-01-01

Over 20000 lipid extracts of plants and marine organisms were evaluated in a human breast tumor T47D cell-based reporter assay for hypoxia-inducible factor-1 (HIF-1) inhibitory activity. Bioassay-guided isolation and dereplication-based structure elucidation of an active extract from the Bael tree (Aegle marmelos) afforded two protolimonoids, skimmiarepin A (1) and skimmiarepin C (2). In T47D cells, 1 and 2 inhibited hypoxia-induced HIF-1 activation with IC50 values of 0.063 µM and 0.068 µM, respectively. Compounds 1 and 2 also suppressed hypoxic induction of the HIF-1 target genes GLUT-1 and VEGF. Mechanistic studies revealed that 1 and 2 inhibited HIF-1 activation by blocking the hypoxia-induced accumulation of HIF-1α protein. At the range of concentrations that inhibited HIF-1 activation, 1 and 2 suppressed cellular respiration by selectively inhibiting the mitochondrial electron transport chain at complex I (NADH dehydrogenase). Further investigation indicated that mitochondrial respiration inhibitors such as 1 and rotenone induced the rapid hyperphosphorylation and inhibition of translation initiation factor eIF2α and elongation factor eEF2. The inhibition of protein translation may account for the short-term exposure effects exerted by mitochondrial inhibitors on cellular signaling, while the suppression of cellular ATP production may contribute to the inhibitory effects following extended treatment periods. PMID:21875114

RESEARCH INVESTIGATIONS ON THE PROTEOME: 1. MECHANISMS OF REGULATING PROTEIN SYNTHESIS, AND 2. GLOBAL CHARACTERIZATION OF PROTEOMIC RESPONSES TO ARSENIC EXPOSURES

Science.gov (United States)

Eukaryotic Elongation Factor 2 (eEF2) mediates translocation in protein synthesis. eEF2 is modified by two post-translational modifications: the phosphorylation of Thr57 in the G domain and a unique conversion of His699 to diphthamide at the tip of domain IV. Diphthamide is the t...

A Ca2+-calmodulin-eEF2K-eEF2 signalling cascade, but not AMPK, contributes to the suppression of skeletal muscle protein synthesis during contractions

DEFF Research Database (Denmark)

Rose, Adam John; Alsted, Thomas Junker; Jensen, Thomas Elbenhardt

2009-01-01

Skeletal muscle protein synthesis rate decreases during contractions but the underlying regulatory mechanisms are poorly understood. It was hypothesised that there would be a coordinated regulation of eukaryotic elongation factor 2 (eEF2) and eukaryotic initiation factor 4E-binding protein 1 (4EBP1......) phosphorylation by signalling cascades downstream of rises in intracellular [Ca(2+)] and decreased energy charge via AMP activated protein kinase (AMPK) in contracting skeletal muscle. When fast-twitch skeletal muscles were contracted ex vivo using different protocols, the suppression of protein synthesis...... correlated more closely with changes in eEF2 rather than 4EBP1 phosphorylation. Using a combination of Ca(2+) release agents and ATPase inhibitors it was shown that the 60-70% suppression of fast-twitch skeletal muscle protein synthesis during contraction was equally distributed between Ca(2+) and energy...

Single excitation-emission fluorescence spectrum (EEF) for determination of cetane improver in diesel fuel.

Science.gov (United States)

Insausti, Matías; Fernández Band, Beatriz S

2015-04-05

A highly sensitive spectrofluorimetric method has been developed for the determination of 2-ethylhexyl nitrate in diesel fuel. Usually, this compound is used as an additive in order to improve cetane number. The analytical method consists in building the chemometric model as a first step. Then, it is possible to quantify the analyte with only recording a single excitation-emission fluorescence spectrum (EEF), whose data are introduced in the chemometric model above mentioned. Another important characteristic of this method is that the fuel sample was used without any pre-treatment for EEF. This work provides an interest improvement to fluorescence techniques using the rapid and easily applicable EEF approach to analyze such complex matrices. Exploding EEF was the key to a successful determination, obtaining a detection limit of 0.00434% (v/v) and a limit of quantification of 0.01446% (v/v). Copyright © 2015 Elsevier B.V. All rights reserved.

The utrophin A 5'-UTR drives cap-independent translation exclusively in skeletal muscles of transgenic mice and interacts with eEF1A2.

Science.gov (United States)

Miura, P; Coriati, A; Bélanger, G; De Repentigny, Y; Lee, J; Kothary, R; Holcik, M; Jasmin, B J

2010-04-01

The molecular mechanisms regulating expression of utrophin A are of therapeutic interest since upregulating its expression at the sarcolemma can compensate for the lack of dystrophin in animal models of Duchenne Muscular Dystrophy (DMD). The 5'-UTR of utrophin A has been previously shown to drive cap-independent internal ribosome entry site (IRES)-mediated translation in response to muscle regeneration and glucocorticoid treatment. To determine whether the utrophin A IRES displays tissue specific activity, we generated transgenic mice harboring control (CMV/betaGAL/CAT) or utrophin A 5'-UTR (CMV/betaGAL/UtrA/CAT) bicistronic reporter transgenes. Examination of multiple tissues from two CMV/betaGAL/UtrA/CAT lines revealed that the utrophin A 5'-UTR drives cap-independent translation of the reporter gene exclusively in skeletal muscles and no other examined tissues. This expression pattern suggested that skeletal muscle-specific factors are involved in IRES-mediated translation of utrophin A. We performed RNA-affinity chromatography experiments combined with mass spectrometry to identify trans-factors that bind the utrophin A 5'-UTR and identified eukaryotic elongation factor 1A2 (eEF1A2). UV-crosslinking experiments confirmed the specificity of this interaction. Regions of the utrophin A 5'-UTR that bound eEF1A2 also mediated cap-independent translation in C2C12 muscle cells. Cultured cells lacking eEF1A2 had reduced IRES activity compared with cells overexpressing eEF1A2. Together, these results suggest an important role for eEF1A2 in driving cap-independent translation of utrophin A in skeletal muscle. The trans-factors and signaling pathways driving skeletal-muscle specific IRES-mediated translation of utrophin A could provide unique targets for developing pharmacological-based DMD therapies.

Structural rationale for the cross-resistance of tumor cells bearing the A399V variant of elongation factor eEF1A1 to the structurally unrelated didemnin B, ternatin, nannocystin A and ansatrienin B

Science.gov (United States)

Sánchez-Murcia, Pedro A.; Cortés-Cabrera, Álvaro; Gago, Federico

2017-10-01

At least four classes of structurally distinct natural products with potent antiproliferative activities target the translation elongation factor eEF1A1, which is best known as the G-protein that delivers amino acyl transfer RNAs (aa-tRNAs) to ribosomes during mRNA translation. We present molecular models in atomic detail that provide a common structural basis for the high-affinity binding of didemnin B, ternatin, ansatrienin B and nannocystin A to eEF1A1, as well as a rationale based on molecular dynamics results that accounts for the deleterious effect of replacing alanine 399 with valine. The proposed binding site, at the interface between domains I and III, is eminently hydrophobic and exists only in the GTP-bound conformation. Drug binding at this site is expected to disrupt neither loading of aa-tRNAs nor GTP hydrolysis but would give rise to stabilization of this particular conformational state, in consonance with reported experimental findings. The experimental solution of the three-dimensional structure of mammalian eEF1A1 has proved elusive so far and the highly homologous eEF1A2 from rabbit muscle has been crystallized and solved only as a homodimer in a GDP-bound conformation. Interestingly, in this dimeric structure the large interdomain cavity where the drugs studied are proposed to bind is occupied by a mostly hydrophobic α-helix from domain I of the same monomer. Since binding of this α-helix and any of these drugs to domain III of eEF1A(1/2) is, therefore, mutually exclusive and involves two distinct protein conformations, one intriguing possibility that emerges from our study is that the potent antiproliferative effect of these natural products may arise not only from inhibition of protein synthesis, which is the current dogma, but also from interference with some other non-canonical functions. From this standpoint, this type of drugs could be considered antagonists of eEF1A1/2 oligomerization, a hypothesis that opens up novel areas of research.

Eukaryotic elongation factor 2 is a prognostic marker and its kinase a potential therapeutic target in HCC.

Science.gov (United States)

Pott, Leona L; Hagemann, Sascha; Reis, Henning; Lorenz, Kristina; Bracht, Thilo; Herold, Thomas; Skryabin, Boris V; Megger, Dominik A; Kälsch, Julia; Weber, Frank; Sitek, Barbara; Baba, Hideo A

2017-02-14

Hepatocellular carcinoma is a cancer with increasing incidence and largely refractory to current anticancer drugs. Since Sorafenib, a multikinase inhibitor has shown modest efficacy in advanced hepatocellular carcinoma additional treatments are highly needed. Protein phosphorylation via kinases is an important post-translational modification to regulate cell homeostasis including proliferation and apoptosis. Therefore kinases are valuable targets in cancer therapy. To this end we performed 2D differential gel electrophoresis and mass spectrometry analysis of phosphoprotein-enriched lysates of tumor and corresponding non-tumorous liver samples to detect differentially abundant phosphoproteins to screen for novel kinases as potential drug targets. We identified 34 differentially abundant proteins in phosphoprotein enriched lysates. Expression and distribution of the candidate protein eEF2 and its phosphorylated isoform was validated immunohistochemically on 78 hepatocellular carcinoma and non-tumorous tissue samples. Validation showed that total eEF2 and phosphorylated eEF2 at threonine 56 are prognostic markers for overall survival of HCC-patients. The activity of the regulating eEF2 kinase, compared between tumor and non-tumorous tissue lysates by in vitro kinase assays, is more than four times higher in tumor tissues. Functional analyzes regarding eEF2 kinase were performed in JHH5 cells with CRISPR/Cas9 mediated eEF2 kinase knock out. Proliferation and growth is decreased in eEF2 kinase knock out cells. eEF2 and phosphorylated eEF2 are prognostic markers for survival of hepatocellular carcinoma patients and the regulating eEF2 kinase is a potential drug target for tumor therapy.

Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

Science.gov (United States)

Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

2016-09-01

Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

eEF1A Controls ascospore differentiation through elevated accuracy, but controls longevity and fruiting body formation through another mechanism in Podospora anserina.

Science.gov (United States)

Silar, P; Lalucque, H; Haedens, V; Zickler, D; Picard, M

2001-01-01

Antisuppressor mutations in the eEF1A gene of Podospora anserina were previously shown to impair ascospore formation, to drastically increase life span, and to permit the development of the Crippled Growth degenerative process. Here, we show that eEF1A controls ascospore formation through accuracy level maintenance. Examination of antisuppressor mutant perithecia reveals two main cytological defects, mislocalization of spindle and nuclei and nuclear death. Antisuppression levels are shown to be highly dependent upon both the mutation site and the suppressor used, precluding any correlation between antisuppression efficiency and severity of the sporulation impairment. Nevertheless, severity of ascospore differentiation defect is correlated with resistance to paromomycin. We also show that eEF1A controls fruiting body formation and longevity through a mechanism(s) different from accuracy control. In vivo, GFP tagging of the protein in a way that partly retains its function confirmed earlier cytological observation; i.e., this factor is mainly diffuse within the cytosol, but may transiently accumulate within nuclei or in defined regions of the cytoplasm. These data emphasize the fact that the translation apparatus exerts a global regulatory control over cell physiology and that eEF1A is one of the key factors involved in this monitoring. PMID:11514440

Targeted silencing of elongation factor 2 kinase suppresses growth and sensitizes tumors to doxorubicin in an orthotopic model of breast cancer.

Directory of Open Access Journals (Sweden)

Ibrahim Tekedereli

Full Text Available Eukaryotic elongation factor 2 kinase (eEF-2K, through its phosphorylation of elongation factor 2 (eEF2, provides a mechanism by which cells can control the rate of the elongation phase of protein synthesis. The activity of eEF-2K is increased in rapidly proliferating malignant cells, is inhibited during mitosis, and may contribute to the promotion of autophagy in response to anti-cancer therapies. The purpose of this study was to examine the therapeutic potential of targeting eEF-2K in breast cancer tumors. Through the systemic administration of liposomal eEF-2K siRNA (twice a week, i.v. 150 µg/kg, the expression of eEF-2K was down-regulated in vivo in an orthotopic xenograft mouse model of a highly aggressive triple negative MDA-MB-231 tumor. This targeting resulted in a substantial decrease in eEF2 phosphorylation in the tumors, and led to the inhibition of tumor growth, the induction of apoptosis and the sensitization of tumors to the chemotherapy agent doxorubicin. eEF-2K down-modulation in vitro resulted in a decrease in the expression of c-Myc and cyclin D1 with a concomitant increase in the expression of p27(Kip1. A decrease in the basal activity of c-Src (phospho-Tyr-416, focal adhesion kinase (phospho-Tyr-397, and Akt (phospho-Ser-473 was also detected following eEF-2K down-regulation in MDA-MB-231 cells, as determined by Western blotting. Where tested, similar results were seen in ER-positive MCF-7 cells. These effects were also accompanied by a decrease in the observed invasive phenotype of the MDA-MB-231 cells. These data support the notion that the disruption of eEF-2K expression in breast cancer cells results in the down-regulation of signaling pathways affecting growth, survival and resistance and has potential as a therapeutic approach for the treatment of breast cancer.

[Identification and analysis of the proteins interacted with Prestin in cochlear outer hair cells of guinea pig].

Science.gov (United States)

Luo, X; Wang, J Y; Zhang, F L; Xia, Y

2018-01-07

Objective: To explore the regulation and mechanism of Prestin protein by identifying the proteins interacted with Prestin in cochlear outer hair cell(OHC) and analyzing their biological function. Methods: Co-immunoprecipitation combined mass spectrometry technology was used to isolate and identify the proteins interacted with Prestin protein of OHC, bioinformatics was used to construct Prestin protein interaction network. The proteins interacted with Prestin in OHC of guinea pig were determined by matching primary interaction mass spectrometry with protein interaction network, and annotated their functions. Results: The results of co-immunoprecipitation combined with mass spectrometry showed that 116 kinds of credible proteins could interact with Prestin. By constructing Prestin protein interaction network, matching the results of mass spectrometry and analyzing of sub-cellular localization, eight kinds of proteins were confirmed that they interacted with Prestin directly, namely EEF2, HSP90AB1, FN1, FLNA, EEF1A1, HSP90B1, ATP5A1, and ERH, respectively, which were mainly involved in the synthesis and transportation, transmembrane folding and localization, structural stability and signal transduction of Prestin protein. Conclusion: EEF2, HSP90AB1, FN1, FLNA, EEF1A1, HSP90B1, ATP5A1 and ERH provide molecular basis for sensory amplification function of OHCs by participating in biotransformation, transmembrane folding and localization, signal transduction and other biological processes of Prestin protein.

Applying physical input-output tables of energy to estimate the energy ecological footprint (EEF) of Galicia (NW Spain)

International Nuclear Information System (INIS)

Carballo Penela, Adolfo; Sebastian Villasante, Carlos

2008-01-01

Nowadays, the achievement of sustainable development constitutes an important constraint in the design of energy policies, being necessary the development of reliable indicators to obtain helpful information about the use of energy resources. The ecological footprint (EF) provides a referential framework for the analysis of human demand for bioproductivity, including energy issues. In this article, the theoretical bases of the footprint analysis are described by applying input-output tables of energy to estimate the Galician energy ecological footprint (EEF). It is concluded that the location of highly polluting industries in Galicia makes the Galician EEF quite higher than more developed regions of Spain. The relevance of the outer component of the Galician EEF is also studied. First, available information seems to indicate that the energy incorporated to the trading of manufactured goods would notably increase the Galician consumption of energy. On the other hand, the inclusion of electricity trade in the EEF analysis, including an adjustment, following the same philosophy as with manufactured goods is proposed. This adjustment would substantially reduce the Galician EEF, as the exported electricity widely exceeds the imported one

Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis

Science.gov (United States)

González-Terán, Bárbara; Cortés, José R.; Manieri, Elisa; Matesanz, Nuria; Verdugo, ρngeles; Rodríguez, María E.; González-Rodríguez, ρgueda; Valverde, ρngela; Martín, Pilar; Davis, Roger J.; Sabio, Guadalupe

2012-01-01

Bacterial LPS (endotoxin) has been implicated in the pathogenesis of acute liver disease through its induction of the proinflammatory cytokine TNF-α. TNF-α is a key determinant of the outcome in a well-established mouse model of acute liver failure during septic shock. One possible mechanism for regulating TNF-α expression is through the control of protein elongation during translation, which would allow rapid cell adaptation to physiological changes. However, the regulation of translational elongation is poorly understood. We found that expression of p38γ/δ MAPK proteins is required for the elongation of nascent TNF-α protein in macrophages. The MKK3/6-p38γ/δ pathway mediated an inhibitory phosphorylation of eukaryotic elongation factor 2 (eEF2) kinase, which in turn promoted eEF2 activation (dephosphorylation) and subsequent TNF-α elongation. These results identify a new signaling pathway that regulates TNF-α production in LPS-induced liver damage and suggest potential cell-specific therapeutic targets for liver diseases in which TNF-α production is involved. PMID:23202732

Identification of a hypothetical membrane protein interactor of ...

Indian Academy of Sciences (India)

Unknown

characterized earlier through co-precipitation studies us- ing antibodies against this conserved carboxyl-terminal region (Rich and Steitz 1987). Protein P0 is also involved at the eEF2 elongation factor-binding domain, as demon- strated in yeast (Justice et al 1999). The P0 protein, and not P1 and P2 proteins, is essential for ...

Isolation of Flavonoids from Deguelia duckeana and Their Effect on Cellular Viability, AMPK, eEF2, eIF2 and eIF4E

Directory of Open Access Journals (Sweden)

Lorena M. C. Cursino

2016-02-01

Full Text Available Preparations of Deguelia duckeana, known in Brazil as timbó, are used by indigenous people to kill fish. Reinvestigation of its extracts resulted in the isolation and identification of 11 known flavonoids identified as 3,5,4’-trimethoxy-4-prenylstilbene (1, 4-methoxyderricidine (2, lonchocarpine (3, 4-hydroxylonchocarpine (4, 4-methoxylonchocarpine (5, 5-hydroxy-4’,7-dimethoxy-6-prenylflavanone (6, 4’-hydroxyisolonchocarpine (7, 4’-methoxyisolonchocarpine (8, 3’,4’,7-trimethoxyflavone (9, 3’,4’-methylenedioxy-7-methoxyflavone (10, and 2,2-dimethyl-chromone-5,4’-hydroxy-5’-methoxyflavone (11. Except for 1, 3, and 4 all of these flavonoids have been described for the first time in D. duckeana and the flavanone 6 for the first time in nature. Compounds 2, 3, 4, 7, 9, and 10 were studied for their potential to induce cell death in neuronal SK-N-SH cells. Only the chalcone 4 and the flavanone 7 significantly induced lactate dehydrogenase (LDH release, which was accompanied by activation of caspase-3 and impairment of energy homeostasis in the MTT assay and may explain the killing effect on fish. Interestingly, the flavone 10 reduced cell metabolism in the MTT assay without inducing cytotoxicity in the LDH assay. Furthermore, the flavonoids 2, 3, 4, 7, and 10 induced phosphorylation of the AMP-activated protein kinase (AMPK and the eukaryotic elongation factor 2 (eEF2. The initiation factor eIF4E was dephosphorylated in the presence of these compounds. The initiation factor eIF2alpha was not affected. Further studies are needed to elucidate the importance of the observed effects on protein synthesis and potential therapeutic perspectives.

The life and death of translation elongation factor 2

DEFF Research Database (Denmark)

Jørgensen, Rene; Merrill, A.R.; Andersen, Gregers Rom

2006-01-01

The eukaryotic elongation factor 2 (eEF2) occupies an essential role in protein synthesis where it catalyses the translocation of the two tRNAs and the mRNA after peptidyl transfer on the 80S ribosome. Recent crystal structures of eEF2 and the cryo-EM reconstruction of its 80S complex now provide...... diphthamide residue, which is ADP-ribosylated by diphtheria toxin from Corynebacterium diphtheriae and exotoxin A from Pseudomonas aeruginosa....

Medulloblastoma outcome is adversely associated with overexpression of EEF1D, RPL30, and RPS20 on the long arm of chromosome 8

International Nuclear Information System (INIS)

De Bortoli, Massimiliano; Man, Tsz-Kwong; Rao, Pulivarthi H; Kim, John YH; Castellino, Robert C; Lu, Xin-Yan; Deyo, Jeffrey; Sturla, Lisa Marie; Adesina, Adekunle M; Perlaky, Laszlo; Pomeroy, Scott L; Lau, Ching C

2006-01-01

Medulloblastoma is the most common malignant brain tumor of childhood. Improvements in clinical outcome require a better understanding of the genetic alterations to identify clinically significant biological factors and to stratify patients accordingly. In the present study, we applied cytogenetic characterization to guide the identification of biologically significant genes from gene expression microarray profiles of medulloblastoma. We analyzed 71 primary medulloblastomas for chromosomal copy number aberrations (CNAs) using comparative genomic hybridization (CGH). Among 64 tumors that we previously analyzed by gene expression microarrays, 27 were included in our CGH series. We analyzed clinical outcome with respect to CNAs and microarray results. We filtered microarray data using specific CNAs to detect differentially expressed candidate genes associated with survival. The most frequent lesions detected in our series involved chromosome 17; loss of 16q, 10q, or 8p; and gain of 7q or 2p. Recurrent amplifications at 2p23-p24, 2q14, 7q34, and 12p13 were also observed. Gain of 8q is associated with worse overall survival (p = 0.0141), which is not entirely attributable to MYC amplification or overexpression. By applying CGH results to gene expression analysis of medulloblastoma, we identified three 8q-mapped genes that are associated with overall survival in the larger group of 64 patients (p < 0.05): eukaryotic translation elongation factor 1D (EEF1D), ribosomal protein L30 (RPL30), and ribosomal protein S20 (RPS20). The complementary use of CGH and expression profiles can facilitate the identification of clinically significant candidate genes involved in medulloblastoma growth. We demonstrate that gain of 8q and expression levels of three 8q-mapped candidate genes (EEF1D, RPL30, RPS20) are associated with adverse outcome in medulloblastoma

Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2

DEFF Research Database (Denmark)

VanderKuur, J; Allevato, G; Billestrup, Nils

1995-01-01

. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...

Differentially expressed proteins among normal cervix, cervical intraepithelial neoplasia and cervical squamous cell carcinoma.

Science.gov (United States)

Zhao, Q; He, Y; Wang, X-L; Zhang, Y-X; Wu, Y-M

2015-08-01

To explore the differentially expressed proteins in normal cervix, cervical intraepithelial neoplasia (CIN) and cervical squamous cell carcinoma (CSCC) tissues by differential proteomics technique. Cervical tissues (including normal cervix, CIN and CSCC) were collected in Department of Gynecologic Oncology of Beijing Obstetrics and Gynecology Hospital. Two-dimensional fluorescence difference in gel electrophoresis (2-D DIGE) and DeCyder software were used to detect the differentially expressed proteins. Matrix-assisted laser desorption/ionization-time-of-flight tandem mass spectrometry (MALDI-TOF/TOF MS) was used to identify the differentially expressed proteins. Western blot (WB) and immunohistochemistry (IHC) were performed to validate the expressions of selected proteins among normal cervix, CIN and CSCC. 2-D DIGE images with high resolution and good repeatability were obtained. Forty-six differentially expressed proteins (27 up-regulated and 19 down-regulated) were differentially expressed among the normal cervix, CIN and CSCC. 26 proteins were successfully identified by MALDI-TOF/TOF MS. S100A9 (S100 calcium-binding protein A9) was the most significantly up-regulated protein. Eukaryotic elongation factor 1-alpha-1 (eEF1A1) was the most significantly down-regulated protein. Pyruvate kinase isozymes M2 (PKM2) was both up-regulated and down-regulated. The results of WB showed that with the increase in the severity of cervical lesions, the expression of S100A9 protein was significantly increased among the three groups (P = 0.010). The expression of eEF1A1 was reduced but without significant difference (P = 0.861). The expression of PKM2 was significantly reduced (P = 0.000). IHC showed that protein S100A9 was mainly expressed in the cytoplasm, and its positive expression rate was 20.0 % in normal cervix, 70.0 % in CIN and 100.0 % in CSCC, with a significant difference among them (P = 0.006). eEF1A1 was mainly expressed in the cell plasma, and its

Class I and II Small Heat Shock Proteins Together with HSP101 Protect Protein Translation Factors during Heat Stress.

Science.gov (United States)

McLoughlin, Fionn; Basha, Eman; Fowler, Mary E; Kim, Minsoo; Bordowitz, Juliana; Katiyar-Agarwal, Surekha; Vierling, Elizabeth

2016-10-01

The ubiquitous small heat shock proteins (sHSPs) are well documented to act in vitro as molecular chaperones to prevent the irreversible aggregation of heat-sensitive proteins. However, the in vivo activities of sHSPs remain unclear. To investigate the two most abundant classes of plant cytosolic sHSPs (class I [CI] and class II [CII]), RNA interference (RNAi) and overexpression lines were created in Arabidopsis (Arabidopsis thaliana) and shown to have reduced and enhanced tolerance, respectively, to extreme heat stress. Affinity purification of CI and CII sHSPs from heat-stressed seedlings recovered eukaryotic translation elongation factor (eEF) 1B (α-, β-, and γ-subunits) and eukaryotic translation initiation factor 4A (three isoforms), although the association with CI sHSPs was stronger and additional proteins involved in translation were recovered with CI sHSPs. eEF1B subunits became partially insoluble during heat stress and, in the CI and CII RNAi lines, showed reduced recovery to the soluble cell fraction after heat stress, which was also dependent on HSP101. Furthermore, after heat stress, CI sHSPs showed increased retention in the insoluble fraction in the CII RNAi line and vice versa. Immunolocalization revealed that both CI and CII sHSPs were present in cytosolic foci, some of which colocalized with HSP101 and with eEF1Bγ and eEF1Bβ. Thus, CI and CII sHSPs have both unique and overlapping functions and act either directly or indirectly to protect specific translation factors in cytosolic stress granules. © 2016 American Society of Plant Biologists. All Rights Reserved.

Epigenetic repression of regulator of G-protein signaling 2 promotes androgen-independent prostate cancer cell growth.

Science.gov (United States)

Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping

2012-04-01

G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.

Elongation factor 1 alpha1 and genes associated with Usher syndromes are downstream targets of GBX2.

Directory of Open Access Journals (Sweden)

David A Roeseler

Full Text Available Gbx2 encodes a DNA-binding transcription factor that plays pivotal roles during embryogenesis. Gain-and loss-of-function studies in several vertebrate species have demonstrated a requirement for Gbx2 in development of the anterior hindbrain, spinal cord, inner ear, heart, and neural crest cells. However, the target genes through which GBX2 exerts its effects remain obscure. Using chromatin immunoprecipitation coupled with direct sequencing (ChIP-Seq analysis in a human prostate cancer cell line, we identified cis-regulatory elements bound by GBX2 to provide insight into its direct downstream targets. The analysis revealed more than 286 highly significant candidate target genes, falling into various functional groups, of which 51% are expressed in the nervous system. Several of the top candidate genes include EEF1A1, ROBO1, PLXNA4, SLIT3, NRP1, and NOTCH2, as well as genes associated with the Usher syndrome, PCDH15 and USH2A, and are plausible candidates contributing to the developmental defects in Gbx2(-/- mice. We show through gel shift analyses that sequences within the promoter or introns of EEF1A1, ROBO1, PCDH15, USH2A and NOTCH2, are directly bound by GBX2. Consistent with these in vitro results, analyses of Gbx2(-/- embryos indicate that Gbx2 function is required for migration of Robo1-expressing neural crest cells out of the hindbrain. Furthermore, we show that GBX2 activates transcriptional activity through the promoter of EEF1A1, suggesting that GBX2 could also regulate gene expression indirectly via EEF1A. Taken together, our studies show that GBX2 plays a dynamic role in development and diseases.

Activation of mitochondrial promoter PH-binding protein in a radio-resistant Chinese hamster cell strain associated with Bcl-2

International Nuclear Information System (INIS)

Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya

2006-01-01

The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

A novel multiple-stage antimalarial agent that inhibits protein synthesis

Science.gov (United States)

Baragaña, Beatriz; Hallyburton, Irene; Lee, Marcus C. S.; Norcross, Neil R.; Grimaldi, Raffaella; Otto, Thomas D.; Proto, William R.; Blagborough, Andrew M.; Meister, Stephan; Wirjanata, Grennady; Ruecker, Andrea; Upton, Leanna M.; Abraham, Tara S.; Almeida, Mariana J.; Pradhan, Anupam; Porzelle, Achim; Martínez, María Santos; Bolscher, Judith M.; Woodland, Andrew; Norval, Suzanne; Zuccotto, Fabio; Thomas, John; Simeons, Frederick; Stojanovski, Laste; Osuna-Cabello, Maria; Brock, Paddy M.; Churcher, Tom S.; Sala, Katarzyna A.; Zakutansky, Sara E.; Jiménez-Díaz, María Belén; Sanz, Laura Maria; Riley, Jennifer; Basak, Rajshekhar; Campbell, Michael; Avery, Vicky M.; Sauerwein, Robert W.; Dechering, Koen J.; Noviyanti, Rintis; Campo, Brice; Frearson, Julie A.; Angulo-Barturen, Iñigo; Ferrer-Bazaga, Santiago; Gamo, Francisco Javier; Wyatt, Paul G.; Leroy, Didier; Siegl, Peter; Delves, Michael J.; Kyle, Dennis E.; Wittlin, Sergio; Marfurt, Jutta; Price, Ric N.; Sinden, Robert E.; Winzeler, Elizabeth A.; Charman, Susan A.; Bebrevska, Lidiya; Gray, David W.; Campbell, Simon; Fairlamb, Alan H.; Willis, Paul A.; Rayner, Julian C.; Fidock, David A.; Read, Kevin D.; Gilbert, Ian H.

2015-06-01

There is an urgent need for new drugs to treat malaria, with broad therapeutic potential and novel modes of action, to widen the scope of treatment and to overcome emerging drug resistance. Here we describe the discovery of DDD107498, a compound with a potent and novel spectrum of antimalarial activity against multiple life-cycle stages of the Plasmodium parasite, with good pharmacokinetic properties and an acceptable safety profile. DDD107498 demonstrates potential to address a variety of clinical needs, including single-dose treatment, transmission blocking and chemoprotection. DDD107498 was developed from a screening programme against blood-stage malaria parasites; its molecular target has been identified as translation elongation factor 2 (eEF2), which is responsible for the GTP-dependent translocation of the ribosome along messenger RNA, and is essential for protein synthesis. This discovery of eEF2 as a viable antimalarial drug target opens up new possibilities for drug discovery.

Functional analysis of bipartite begomovirus coat protein promoter sequences

International Nuclear Information System (INIS)

Lacatus, Gabriela; Sunter, Garry

2008-01-01

We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

Directory of Open Access Journals (Sweden)

Nobuko Matsushita

Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

TALE factors poise promoters for activation by Hox proteins.

Science.gov (United States)

Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G

2014-01-27

Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.

Actividades del grupo EEF en el contexto de la red europea TMR "Polarimetría radar: Teoría y aplicaciones"

OpenAIRE

Fabregas Canovas, Francisco Javier; López Martínez, Carlos; Broquetas Ibars, Antoni

2000-01-01

The activity of the EEF group in the TMR European Project Radar Polarimetry: Theory and Applications will be presented in this paper. We have developed new polarimetric-interferometric retrieval algorithms and enhancement techniques. These methods will be showed briefly in the next points. Peer Reviewed

RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.

Science.gov (United States)

Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin

2016-04-22

Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.

The double bromodomain protein Brd2 promotes B cell expansion and mitogenesis.

Science.gov (United States)

Belkina, Anna C; Blanton, Wanda P; Nikolajczyk, Barbara S; Denis, Gerald V

2014-03-01

Bromodomain-containing transcriptional regulators represent new epigenetic targets in different hematologic malignancies. However, bromodomain-mediated mechanisms that couple histone acetylation to transcription in lymphopoiesis and govern mature lymphocyte mitogenesis are poorly understood. Brd2, a transcriptional coregulator that contains dual bromodomains and an extraterminal domain (the BET family), couples chromatin to cell-cycle progression. We reported previously the first functional characterization of a BET protein as an effector of mammalian mitogenic signal transduction: Eμ-Brd2 Tg mice develop "activated B cell" diffuse large B cell lymphoma. No other animal models exist for genetic or lentiviral expression of BET proteins, hampering testing of novel anti-BET anticancer drugs, such as JQ1. We transduced HSCs with Brd2 lentivirus and reconstituted recipient mice to test the hypothesis that Brd2 regulates hematopoiesis in BM and mitogenesis in the periphery. Forced expression of Brd2 provides an expansion advantage to the donor-derived B cell compartment in BM and increases mature B cell mitogenic responsiveness in vitro. Brd2 binds the cyclin A promoter in B cells, shown by ChIP, and increases cyclin A mRNA and protein levels, and S-phase progression in vitro in mitogen-stimulated primary B cells, but not T cells, reinforcing results from Eμ-Brd2 mice. The small molecule BET inhibitor JQ1 reduces B cell mitogenesis, consistent with the interpretation that BET inhibitors are antiproliferative. Brd2-specific knockdown experiments show that Brd2 is also required for hematopoiesis. We conclude that Brd2 plays a critical, independent role in regulation of mitogenic response genes, particularly cyclin A, in B cells.

Promoters and proteins from Clostridium thermocellum and uses thereof

Science.gov (United States)

Wu, J. H. David; Newcomb, Michael

2012-11-13

The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.

Leucine stimulates protein synthesis in skeletal muscle of neonatal pigs by enhancing mTORC1 activation.

Science.gov (United States)

Suryawan, Agus; Jeyapalan, Asumthia S; Orellana, Renan A; Wilson, Fiona A; Nguyen, Hanh V; Davis, Teresa A

2008-10-01

Skeletal muscle in the neonate grows at a rapid rate due in part to an enhanced sensitivity to the postprandial rise in amino acids, particularly leucine. To elucidate the molecular mechanism by which leucine stimulates protein synthesis in neonatal muscle, overnight-fasted 7-day-old piglets were treated with rapamycin [an inhibitor of mammalian target of rapamycin (mTOR) complex (mTORC)1] for 1 h and then infused with leucine for 1 h. Fractional rates of protein synthesis and activation of signaling components that lead to mRNA translation were determined in skeletal muscle. Rapamycin completely blocked leucine-induced muscle protein synthesis. Rapamycin markedly reduced raptor-mTOR association, an indicator of mTORC1 activation. Rapamycin blocked the leucine-induced phosphorylation of mTOR, S6 kinase 1 (S6K1), and eukaryotic initiation factor (eIF)4E-binding protein-1 (4E-BP1) and formation of the eIF4E.eIF4G complex and increased eIF4E.4E-BP1 complex abundance. Rapamycin had no effect on the association of mTOR with rictor, a crucial component for mTORC2 activation, or G protein beta-subunit-like protein (GbetaL), a component of mTORC1 and mTORC2. Neither leucine nor rapamycin affected the phosphorylation of AMP-activated protein kinase (AMPK), PKB, or tuberous sclerosis complex (TSC)2, signaling components that reside upstream of mTOR. Eukaryotic elongation factor (eEF)2 phosphorylation was not affected by leucine or rapamycin, although current dogma indicates that eEF2 phosphorylation is mTOR dependent. Together, these in vivo data suggest that leucine stimulates muscle protein synthesis in neonates by enhancing mTORC1 activation and its downstream effectors.

The CytR repressor antagonizes cyclic AMP-cyclic AMP receptor protein activation of the deoCp2 promoter of Escherichia coli K-12

DEFF Research Database (Denmark)

Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E

1990-01-01

We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...

Epithelial membrane protein-2 promotes endometrial tumor formation through activation of FAK and Src.

Directory of Open Access Journals (Sweden)

Maoyong Fu

Full Text Available Endometrial cancer is the most common gynecologic malignancy diagnosed among women in developed countries. One recent biomarker strongly associated with disease progression and survival is epithelial membrane protein-2 (EMP2, a tetraspan protein known to associate with and modify surface expression of certain integrin isoforms. In this study, we show using a xenograft model system that EMP2 expression is necessary for efficient endometrial tumor formation, and we have started to characterize the mechanism by which EMP2 contributes to this malignant phenotype. In endometrial cancer cells, the focal adhesion kinase (FAK/Src pathway appears to regulate migration as measured through wound healing assays. Manipulation of EMP2 levels in endometrial cancer cells regulates the phosphorylation of FAK and Src, and promotes their distribution into lipid raft domains. Notably, cells with low levels of EMP2 fail to migrate and poorly form tumors in vivo. These findings reveal the pivotal role of EMP2 in endometrial cancer carcinogenesis, and suggest that the association of elevated EMP2 levels with endometrial cancer prognosis may be causally linked to its effect on integrin-mediated signaling.

Protein Hydrolysates as Promoters of Non-Haem Iron Absorption

Science.gov (United States)

Li, Yanan; Jiang, Han; Huang, Guangrong

2017-01-01

Iron (Fe) is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements. PMID:28617327

Protein Hydrolysates as Promoters of Non-Haem Iron Absorption

Directory of Open Access Journals (Sweden)

Yanan Li

2017-06-01

Full Text Available Iron (Fe is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements.

Heat shock-induced accumulation of translation elongation and termination factors precedes assembly of stress granules in S. cerevisiae.

Directory of Open Access Journals (Sweden)

Tomas Grousl

Full Text Available In response to severe environmental stresses eukaryotic cells shut down translation and accumulate components of the translational machinery in stress granules (SGs. Since they contain mainly mRNA, translation initiation factors and 40S ribosomal subunits, they have been referred to as dominant accumulations of stalled translation preinitiation complexes. Here we present evidence that the robust heat shock-induced SGs of S. cerevisiae also contain translation elongation factors eEF3 (Yef3p and eEF1Bγ2 (Tef4p as well as translation termination factors eRF1 (Sup45p and eRF3 (Sup35p. Despite the presence of the yeast prion protein Sup35 in heat shock-induced SGs, we found out that its prion-like domain is not involved in the SGs assembly. Factors eEF3, eEF1Bγ2 and eRF1 were accumulated and co-localized with Dcp2 foci even upon a milder heat shock at 42°C independently of P-bodies scaffolding proteins. We also show that eEF3 accumulations at 42°C determine sites of the genuine SGs assembly at 46°C. We suggest that identification of translation elongation and termination factors in SGs might help to understand the mechanism of the eIF2α factor phosphorylation-independent repression of translation and SGs assembly.

Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria.

Science.gov (United States)

Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe

2014-03-28

Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.

Fluoxetine induces autophagic cell death via eEF2K-AMPK-mTOR-ULK complex axis in triple negative breast cancer.

Science.gov (United States)

Sun, Dejuan; Zhu, Lingjuan; Zhao, Yuqian; Jiang, Yingnan; Chen, Lixia; Yu, Yang; Ouyang, Liang

2018-04-01

Triple negative breast cancer (TNBC) is a complex and intrinsically aggressive tumour with poor prognosis, and the discovery of targeted small-molecule drugs for TNBC treatment still remains in its infancy. In this study, we aimed to discover a small-molecule agent for TNBC treatment and illuminate its potential mechanisms. Cell viability was detected by using methylthiazoltetrazolium (MTT) assay. Electron microscopy, GFP-LC3 transfection, monodansylcadaverine staining and apoptosis assay were performed to determine Fluoxetine-induced autophagy and apoptosis. Western blotting and siRNA transfection were carried out to investigate the mechanisms of Fluoxetine-induced autophagy. iTRAQ-based proteomics analysis was used to explore the underlying mechanisms. We have demonstrated that Fluoxetine had remarkable anti-proliferative activities and induced autophagic cell death in MDA-MB-231 and MDA-MB-436 cells. The mechanism for Fluoxetine-induced autophagic cell death was associated with inhibition of eEF2K and activation of AMPK-mTOR-ULK complex axis. Further iTRAQ-based proteomics and network analyses revealed that Fluoxetine-induced mechanism was involved in BIRC6, BNIP1, SNAP29 and Bif-1. These results demonstrate that Fluoxetine induces apoptosis and autophagic cell death in TNBC, which will hold a promise for the future TNBC therapy. © 2017 John Wiley & Sons Ltd.

Eukaryotic translation initiator protein 1A isoform, CCS-3, enhances the transcriptional repression of p21CIP1 by proto-oncogene FBI-1 (Pokemon/ZBTB7A).

Science.gov (United States)

Choi, Won-Il; Kim, Youngsoo; Kim, Yuri; Yu, Mi-young; Park, Jungeun; Lee, Choong-Eun; Jeon, Bu-Nam; Koh, Dong-In; Hur, Man-Wook

2009-01-01

FBI-1, a member of the POK (POZ and Kruppel) family of transcription factors, plays a role in differentiation, oncogenesis, and adipogenesis. eEF1A is a eukaryotic translation elongation factor involved in several cellular processes including embryogenesis, oncogenic transformation, cell proliferation, and cytoskeletal organization. CCS-3, a potential cervical cancer suppressor, is an isoform of eEF1A. We found that eEF1A forms a complex with FBI-1 by co-immunoprecipitation, SDS-PAGE, and MALDI-TOF Mass analysis of the immunoprecipitate. GST fusion protein pull-downs showed that FBI-1 directly interacts with eEF1A and CCS-3 via the zinc finger and POZ-domain of FBI-1. FBI-1 co-localizes with either eEF1A or CCS-3 at the nuclear periplasm. CCS-3 enhances transcriptional repression of the p21CIP1 gene (hereafter referred to as p21) by FBI-1. The POZ-domain of FBI-1 interacts with the co-repressors, SMRT and BCoR. We found that CCS-3 also interacts with the co-repressors independently. The molecular interaction between the co-repressors and CCS-3 at the POZ-domain of FBI-1 appears to enhance FBI-1 mediated transcriptional repression. Our data suggest that CCS-3 may be important in cell differentiation, tumorigenesis, and oncogenesis by interacting with the proto-oncogene FBI-1 and transcriptional co-repressors. Copyright 2009 S. Karger AG, Basel.

A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

Directory of Open Access Journals (Sweden)

Gao Chen

2012-02-01

Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.

Receptor-interacting Protein 140 Overexpression Promotes Neuro-2a Neuronal Differentiation by ERK1/2 Signaling

Directory of Open Access Journals (Sweden)

Xiao Feng

2015-01-01

Full Text Available Background: Abnormal neuronal differentiation plays an important role in central nervous system (CNS development abnormalities such as Down syndrome (DS, a disorder that results directly from overexpression of genes in trisomic cells. Receptor-interacting protein 140 (RIP140 is significantly upregulated in DS brains, suggesting its involvement in DS CNS development abnormalities. However, the role of RIP140 in neuronal differentiation is still not clear. The current study aimed to investigate the effect of RIP140 overexpression on the differentiation of neuro-2a (N2a neuroblastoma cells, in vitro. Methods: Stably RIP140-overexpressing N2a (N2a-RIP140 cells were used as a neurodevelopmental model, and were constructed by lipofection and overexpression validated by real-time polymerase chain reaction and Western blot. Retinoic acid (RA was used to stimulate N2a differentiation. Combining the expression of Tuj1 at the mRNA and protein levels, the percentage of cells baring neurites, and the number of neurites per cell body was semi-quantified to determine the effect of RIP140 on differentiation of N2a cells. Furthermore, western blot and the ERK1/2 inhibitor U0126 were used to identify the specific signaling pathway by which RIP140 induces differentiation of N2a cells. Statistical significance of the differences between groups was determined by one-way analysis of variance followed by the Dunnett test. Results: Compared to untransfected N2a cells RIPl40 expression in N2a-RIP140 cells was remarkably upregulated at both the mRNA and protein levels. N2a-RIP140 cells had a significantly increased percentage of cells baring neurites, and numbers of neurites per cell, as compared to N2a cells, in the absence and presence of RA (P < 0.05. In addition, Tuj1, a neuronal biomarker, was strongly upregulated in N2a-RIP140 cells (P < 0.05 and phosphorylated ERK1/2 (p-ERK1/2 levels in N2a-RIP140 cells were dramatically increased, while differentiation was

Deficiency of thioredoxin binding protein-2 (TBP-2 enhances TGF-β signaling and promotes epithelial to mesenchymal transition.

Directory of Open Access Journals (Sweden)

So Masaki

Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.

Multi-protein delivery by nanodiamonds promotes bone formation.

Science.gov (United States)

Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D

2013-11-01

Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.

RPL13A and EEF1A1 Are Suitable Reference Genes for qPCR during Adipocyte Differentiation of Vascular Stromal Cells from Patients with Different BMI and HOMA-IR.

Science.gov (United States)

Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa

2016-01-01

Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR.

Heat-induced accumulation of protein synthesis elongation factor 1A indicates an important role in heat tolerance in potato

Science.gov (United States)

Heat stress substantially reduces crop productivity worldwide, and will become more severe due to global warming. Identification of proteins involved in heat stress response may help develop varieties for heat tolerance. Eukaryotic elongation factor 1A (eEF1A) is a cytosolic, multifunctional protei...

Rift Valley fever virus NSs protein promotes post-transcriptional downregulation of protein kinase PKR and inhibits eIF2alpha phosphorylation.

Science.gov (United States)

Ikegami, Tetsuro; Narayanan, Krishna; Won, Sungyong; Kamitani, Wataru; Peters, C J; Makino, Shinji

2009-02-01

Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD) or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR)-mediated eukaryotic initiation factor (eIF)2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.

Health issues of whey proteins: 3. gut health promotion

NARCIS (Netherlands)

Gertjan Schaafsma

2007-01-01

This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protein, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.

Overexpression of human virus surface glycoprotein precursors induces cytosolic unfolded protein response in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Sasnauskas Kęstutis

2011-05-01

Full Text Available Abstract Background The expression of human virus surface proteins, as well as other mammalian glycoproteins, is much more efficient in cells of higher eukaryotes rather than yeasts. The limitations to high-level expression of active viral surface glycoproteins in yeast are not well understood. To identify possible bottlenecks we performed a detailed study on overexpression of recombinant mumps hemagglutinin-neuraminidase (MuHN and measles hemagglutinin (MeH in yeast Saccharomyces cerevisiae, combining the analysis of recombinant proteins with a proteomic approach. Results Overexpressed recombinant MuHN and MeH proteins were present in large aggregates, were inactive and totally insoluble under native conditions. Moreover, the majority of recombinant protein was found in immature form of non-glycosylated precursors. Fractionation of yeast lysates revealed that the core of viral surface protein aggregates consists of MuHN or MeH disulfide-linked multimers involving eukaryotic translation elongation factor 1A (eEF1A and is closely associated with small heat shock proteins (sHsps that can be removed only under denaturing conditions. Complexes of large Hsps seem to be bound to aggregate core peripherally as they can be easily removed at high salt concentrations. Proteomic analysis revealed that the accumulation of unglycosylated viral protein precursors results in specific cytosolic unfolded protein response (UPR-Cyto in yeast cells, characterized by different action and regulation of small Hsps versus large chaperones of Hsp70, Hsp90 and Hsp110 families. In contrast to most environmental stresses, in the response to synthesis of recombinant MuHN and MeH, only the large Hsps were upregulated whereas sHsps were not. Interestingly, the amount of eEF1A was also increased during this stress response. Conclusions Inefficient translocation of MuHN and MeH precursors through ER membrane is a bottleneck for high-level expression in yeast. Overexpression of

Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.

Science.gov (United States)

Kalveram, Birte; Ikegami, Tetsuro

2013-04-01

Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells.

Growth-promoting effect on iron-sulfur proteins on axenic cultures of Entamoeba dispar

Directory of Open Access Journals (Sweden)

Khalifa S.A.M.

2006-03-01

Full Text Available A growth-promoting factor (GPF that promotes the growth of Entamoeba dispar under axenic culture conditions was found in fractions of mitochondria (Mt, hydrogenosomes (Hg and chloroplasts (Cp obtained from cells of six different protozoan, mammalian and plant species. We were able to extract the GPF from the Cp-rich leaf cells of a plant (spiderwort: Commelina communis L. in an acetone-soluble fraction as a complex of chlorophyll with low molecular weight proteins (molecular weight [MW] approximately 4,600. We also found that on treatment with 0.6 % complexes of 2-mercapthoethanol (2ME, complexes of chlorophyll-a with iron-sulphur (Fe-S proteins (e.g., ferredoxins [Fd] from spinach and Clostridium pasteurianum and noncomplex rubredoxin (Rd from C. pasteurianum have a growth-promoting effect on E. dispar. These findings suggest that E. dispar may lack a sufficient quantity of some essential components of Fe-S proteins, such as Fe-S center.

Cartilage Acidic Protein 2 a hyperthermostable, high affinity calcium-binding protein.

Science.gov (United States)

Anjos, Liliana; Gomes, Ana S; Melo, Eduardo P; Canário, Adelino V; Power, Deborah M

2013-03-01

Cartilage Acidic Protein 2 (CRTAC2) is a novel protein present from prokaryotes to vertebrates with abundant expression in the teleost fish pituitary gland and an isoform of CRTAC1, a chondrocyte marker in humans. The two proteins are non-integrins containing N-terminal integrin-like Ca(2+)-binding motifs and their structure and function remain to be assigned. Structural studies of recombinant sea bream (sb)CRTAC2 revealed it is composed of 8.8% α-helix, 33.4% β-sheet and 57.8% unordered protein. sbCRTAC2 bound Ca(2+) with high affinity (K(d)=1.46nM) and favourable Gibbs free energy (∆G=-12.4kcal/mol). The stoichiometry for Ca(2+) bound to sbCRTAC2 at saturation indicated six Ca(2+) ligand-binding sites exist per protein molecule. No conformational change in sbCRTAC2 occurred in the presence of Ca(2+). Fluorescence emission revealed that the tertiary structure of the protein is hyperthermostable between 25°C and 95°C and the fully unfolded state is only induced by chemical denaturing (4M GndCl). sbCRTAC has a widespread tissue distribution and is present as high molecular weight aggregates, although strong reducing conditions promote formation of the monomer. sbCRTAC2 promotes epithelial cell outgrowth in vitro suggesting it may share functional homology with mammalian CRTAC1, recently implicated in cell-cell and cell-matrix interactions. Copyright © 2012 Elsevier B.V. All rights reserved.

Synaptogyrin-2 Promotes Replication of a Novel Tick-borne Bunyavirus through Interacting with Viral Nonstructural Protein NSs*

Science.gov (United States)

Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J.; Xing, Zheng

2016-01-01

Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. PMID:27226560

A high-throughput screening assay for eukaryotic elongation factor 2 kinase inhibitors

Directory of Open Access Journals (Sweden)

Ting Xiao

2016-10-01

Full Text Available Eukaryotic elongation factor 2 kinase (eEF2K inhibitors may aid in the development of new therapeutic agents to combat cancer. Purified human eEF2K was obtained from an Escherichia coli expression system and a luminescence-based high-throughput screening (HTS assay was developed using MH-1 peptide as the substrate. The luminescent readouts correlated with the amount of adenosine triphosphate remaining in the kinase reaction. This method was applied to a large-scale screening campaign against a diverse compound library and subsequent confirmation studies. Nine initial hits showing inhibitory activities on eEF2K were identified from 56,000 synthetic compounds during the HTS campaign, of which, five were chosen to test their effects in cancer cell lines.

A non-catalytic N-terminal domain negatively influences the nucleotide exchange activity of translation elongation factor 1Bα.

Science.gov (United States)

Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V

2016-02-01

Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.

Rift Valley fever virus NSs protein promotes post-transcriptional downregulation of protein kinase PKR and inhibits eIF2alpha phosphorylation.

Directory of Open Access Journals (Sweden)

Tetsuro Ikegami

2009-02-01

Full Text Available Rift Valley fever virus (RVFV (genus Phlebovirus, family Bunyaviridae is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR-mediated eukaryotic initiation factor (eIF2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.

Health issues of whey proteins: 3. Gut health promotion

NARCIS (Netherlands)

Schaafsma, G.

2007-01-01

This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protei, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.

Characterization of a Lactococcus lactis promoter for heterologous protein production

Directory of Open Access Journals (Sweden)

Christian E. Ogaugwu

2018-03-01

Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.

Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

DEFF Research Database (Denmark)

Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

2003-01-01

To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

Synaptogyrin-2 Promotes Replication of a Novel Tick-borne Bunyavirus through Interacting with Viral Nonstructural Protein NSs.

Science.gov (United States)

Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J; Xing, Zheng

2016-07-29

Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Eight Essential Foods in Iranian Traditional Medicine and their Role in Health Promotion and Well-being.

Science.gov (United States)

Zeinalian, Mehrdad; Eshaghi, Mehdi; Hadian, Mahdi; Naji, Homayoun; Marandi, Sayed Mohammad Masoud; Asgary, Sedigheh

2017-01-01

Eight essential foods (EEF) described in Iranian traditional medicine (ITM) have a determinant role to balance human temperament insuring health and well-being. EEF included oral, imaginary, auditory, visual, olfactory, touch, sexual, and familiarity food. Oral foods should be halal, compatible with individual temper, consumed up twice a day, and compatible with different seasons and geographic conditions. Imaginary food consists of the individual thought content which is directly related to mental and physical fitness. It helps to balance temperament if be free of negative thoughts such as suspicion and distrust to others. Auditory food includes all sounds surrounding us, some of which are sedative and help to balance temperaments, such as natural sounds, and spiritual and beautiful words. Visual food includes everything in the range of human vision which is impressive on his/her thought. Natural beautiful scenes have almost a warm temper and help to balance human temperament. Olfactory food includes odors which stimulate the smell. Touch food includes all materials in direct contact with body skin, like clothes, which have a determinant role in temper moderation in the case of being natural. Sexual food complies with the human need to express his/her love and/or is loved, so its fulfillment could prevent human mal-temperament. Familiarity food can be provided by companion with friends and family members and has a significant role to insure well-being. Given the comprehensiveness of EEF in ITM which covers all human health-related aspects, we can insure health and well-being among our population by promoting and public educating of these principles.

Interplay between chaperones and protein disorder promotes the evolution of protein networks.

Directory of Open Access Journals (Sweden)

Sebastian Pechmann

2014-06-01

Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the

Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

Science.gov (United States)

Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

2008-10-01

The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

High-level extracellular protein production in Bacillus subtilis using an optimized dual-promoter expression system.

Science.gov (United States)

Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing

2017-02-20

We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.

Anti-citrullinated protein antibodies promote apoptosis of mature human Saos-2 osteoblasts via cell-surface binding to citrullinated heat shock protein 60.

Science.gov (United States)

Lu, Ming-Chi; Yu, Chia-Li; Yu, Hui-Chun; Huang, Hsien-Bin; Koo, Malcolm; Lai, Ning-Sheng

2016-01-01

We hypothesized that anti-citrullinated protein antibodies (ACPAs) react with osteoblast surface citrullinated proteins and affect cell function, leading to joint damage in patients with rheumatoid arthritis (RA). First, we purified ACPAs by cyclic citrullinated peptide (CCP)-conjugated affinity column chromatography. The cognate antigens of ACPAs on Saos-2 cells, a sarcoma osteogenic cell line generated from human osteoblasts, were probed by ACPAs, and the reactive bands were analyzed using proteomic analyses. We found that ACPAs bind to Saos-2 cell membrane, and several protein candidates, including HSP60, were identified. We then cloned and purified recombinant heat shock protein 60 (HSP60) and citrullinated HSP60 (citHSP60) and investigated the effect of ACPAs on Saos-2 cell. We confirmed that HSP60 obtained from Saos-2 cell membrane were citrullinated and reacted with ACPAs, which induces Saos-2 cells apoptosis via binding to surface-expressed citHSP60 through Toll-like receptor 4 signaling. ACPAs promoted interleukin (IL)-6 and IL-8 expression in Saos-2 cells. Finally, sera from patients with RA and healthy controls were examined for their titers of anti-HSP60 and anti-citHSP60 antibodies using an enzyme-linked immunosorbent assay. The radiographic change in patients with RA was evaluated using the Genant-modified Sharp scoring system. Patients with RA showed higher sera titers of anti-citHSP60, but not anti-HSP60, antibodies when compared with controls. In addition, the anti-citHSP60 level was positively associated with increased joint damage in patients with RA. In conclusion, Saos-2 cell apoptosis was mediated by ACPAs via binding to cell surface-expressed citHSP60 and the titer of anti-citHSP60 in patients with RA positively associated with joint damage. Copyright © 2015 Elsevier GmbH. All rights reserved.

Combination of the Endogenous lhcsr1 Promoter and Codon Usage Optimization Boosts Protein Expression in the Moss Physcomitrella patens

Directory of Open Access Journals (Sweden)

Manuel Hiss

2017-10-01

Full Text Available The moss Physcomitrella patens is used both as an evo-devo model and biotechnological production system for metabolites and pharmaceuticals. Strong in vivo expression of genes of interest is important for production of recombinant proteins, e.g., selectable markers, fluorescent proteins, or enzymes. In this regard, the choice of the promoter sequence as well as codon usage optimization are two important inside factors to consider in order to obtain optimum protein accumulation level. To reliably quantify fluorescence, we transfected protoplasts with promoter:GFP fusion constructs and measured fluorescence intensity of living protoplasts in a plate reader system. We used the red fluorescent protein mCherry under 2x 35S promoter control as second reporter to normalize for different transfection efficiencies. We derived a novel endogenous promoter and compared deletion variants with exogenous promoters. We used different codon-adapted green fluorescent protein (GFP genes to evaluate the influence of promoter choice and codon optimization on protein accumulation in P. patens, and show that the promoter of the gene of P. patens chlorophyll a/b binding protein lhcsr1 drives expression of GFP in protoplasts significantly (more than twofold better than the commonly used 2x 35S promoter or the rice actin1 promoter. We identified a shortened 677 bp version of the lhcsr1 promoter that retains full activity in protoplasts. The codon optimized GFP yields significantly (more than twofold stronger fluorescence signals and thus demonstrates that adjusting codon usage in P. patens can increase expression strength. In combination, new promotor and codon optimized GFP conveyed sixfold increased fluorescence signal.

Mammalian amyloidogenic proteins promote prion nucleation in yeast.

Science.gov (United States)

Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

2018-03-02

Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor

International Nuclear Information System (INIS)

Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank

2006-01-01

Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology

Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

Science.gov (United States)

Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

2005-03-01

Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

The Level of Autoantibodies Targeting Eukaryote Translation Elongation Factor 1 α1 and Ubiquitin-Conjugating Enzyme 2L3 in Nondiabetic Young Adults

Directory of Open Access Journals (Sweden)

Eunhee G. Kim

2016-01-01

Full Text Available BackgroundThe prevalence of novel type 1 diabetes mellitus (T1DM antibodies targeting eukaryote translation elongation factor 1 alpha 1 autoantibody (EEF1A1-AAb and ubiquitin-conjugating enzyme 2L3 autoantibody (UBE2L3-AAb has been shown to be negatively correlated with age in T1DM subjects. Therefore, we aimed to investigate whether age affects the levels of these two antibodies in nondiabetic subjects.MethodsEEF1A1-AAb and UBE2L3-AAb levels in nondiabetic control subjects (n=150 and T1DM subjects (n=101 in various ranges of age (18 to 69 years were measured using an enzyme-linked immunosorbent assay. The cutoff point for the presence of each autoantibody was determined based on control subjects using the formula: [mean absorbance+3×standard deviation].ResultsIn nondiabetic subjects, there were no significant correlations between age and EEF1A1-AAb and UBE2L3-AAb levels. However, there was wide variation in EEF1A1-AAb and UBE2L3-AAb levels among control subjects <40 years old; the prevalence of both EEF1A1-AAb and UBE2L3-AAb in these subjects was 4.4%. When using cutoff points determined from the control subjects <40 years old, the prevalence of both autoantibodies in T1DM subjects was decreased (EEFA1-AAb, 15.8% to 8.9%; UBE2L3-AAb, 10.9% to 7.9% when compared to the prevalence using the cutoff derived from the totals for control subjects.ConclusionThere was no association between age and EEF1A1-AAb or UBE2L3-AAb levels in nondiabetic subjects. However, the wide variation in EEF1A1-AAb and UBE2L3-AAb levels apparent among the control subjects <40 years old should be taken into consideration when determining the cutoff reference range for the diagnosis of T1DM.

Heterozygous Null Bone Morphogenetic Protein Receptor Type 2 Mutations Promote SRC Kinase-dependent Caveolar Trafficking Defects and Endothelial Dysfunction in Pulmonary Arterial Hypertension*

Science.gov (United States)

Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.

2015-01-01

Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245

Phosphorylation of stress protein pp80 is related to promotion of transformation

International Nuclear Information System (INIS)

Smith, B.M.; Gindhart, T.D.; Hirano, K.; Colburn, N.H.

1986-01-01

The JB6 mouse epidermal cell system is an in vitro model of late stage promotion, and includes cell lines sensitive (P+) or resistant (P-) to phorbol ester-induced anchorage independent transformation, and transformed (T/sub x/) lines. Certain promoter-induced changes in phosphoproteins, identified by gel electrophoresis, are unique to cells of one phenotype, and occur only with specific promoters. An 80Kd protein is inversely correlated with phenotype: P- cells have a constitutively higher level (p 35 S-methionine. pp80 shares properties with the 80Kd heat stress protein: molecular weight relative abundance, and isoelectric point (4.5). Pharmacological analogs of calcium, the lanthanides, promote transformation of JB6 cells, but have no effect on phosphorylation of the 80Kd protein. If pp80 is on the promotion pathway, it is limited to a specific subset of transformation promoters

HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

Energy Technology Data Exchange (ETDEWEB)

Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)

2016-04-15

Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

International Nuclear Information System (INIS)

Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi

2016-01-01

Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

Antioxidant Activity of Flaxseed (Linum usitatissimum L. shell and Analysis of Its Polyphenol Contents by LC-MS/MS

Directory of Open Access Journals (Sweden)

Hatica Han

2018-07-01

Full Text Available Flaxseed (Linum usitatissimum L. is important source of oil and protein for industrial, pharmaceutical, and nutritional applications. In order to estimate the effects of lyophilized aqueous extract of flaxseed shell (AEF and evaporated ethanolic extract of flaxseed shell (EEF, we studied their DPPH, ABTS, DMPD and O 2 •- scavenging effects. Total antioxidant activity by ferric thiocyanate method, Fe 3+, Cu 2+ and [Fe 3+-(TPTZ 2] 3+ reducing ability, and Fe 2+ chelating activity. Also, α-tocopherol, BHA, trolox, and BHT were used as positive controls. The results clearly AEF and EEF demonstrated effective antioxidant activity. The quantity of p-hydroxybenzoic, vanillin, p-coumaric acid, ascorbic acid, ferulic acid, and ellagic acid were investigated by LC-MS/MS. The present study will introduce a novelty for further studies on the antioxidant effects of AEF and EEF.

The G-protein coupled chemoattractant receptor FPR2 promotes malignant phenotype of human colon cancer cells

Science.gov (United States)

Xiang, Yi; Yao, Xiaohong; Chen, Keqiang; Wang, Xiafei; Zhou, Jiamin; Gong, Wanghua; Yoshimura, Teizo; Huang, Jiaqiang; Wang, Rongquan; Wu, Yuzhang; Shi, Guochao; Bian, Xiuwu; Wang, Jiming

2016-01-01

The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human colon is unclear. Our investigation revealed that a considerable number of human colon cancer cell lines expressed FPR2 and its ligands promoted cell migration and proliferation. Human colon cancer cell lines expressing high levels of FPR2 also formed more rapidly growing tumors in immunocompromised mice as compared with cell lines expressing lower levels of FPR2. Knocking down of FPR2 from colon cancer cell lines highly expressing FPR2 reduced their tumorigenicity. Clinically, FPR2 is more highly expressed in progressive colon cancer, associated with poorer patient prognosis. These results suggest that FPR2 can be high-jacked by colon cancer cells for their growth advantage, thus becoming a potential target for therapeutic development. PMID:27904774

Eight essential foods in Iranian traditional medicine and their role in health promotion and well-being

Directory of Open Access Journals (Sweden)

Mehrdad Zeinalian

2017-01-01

Full Text Available Eight essential foods (EEF described in Iranian traditional medicine (ITM have a determinant role to balance human temperament insuring health and well-being. EEF included oral, imaginary, auditory, visual, olfactory, touch, sexual, and familiarity food. Oral foods should be halal, compatible with individual temper, consumed up twice a day, and compatible with different seasons and geographic conditions. Imaginary food consists of the individual thought content which is directly related to mental and physical fitness. It helps to balance temperament if be free of negative thoughts such as suspicion and distrust to others. Auditory food includes all sounds surrounding us, some of which are sedative and help to balance temperaments, such as natural sounds, and spiritual and beautiful words. Visual food includes everything in the range of human vision which is impressive on his/her thought. Natural beautiful scenes have almost a warm temper and help to balance human temperament. Olfactory food includes odors which stimulate the smell. Touch food includes all materials in direct contact with body skin, like clothes, which have a determinant role in temper moderation in the case of being natural. Sexual food complies with the human need to express his/her love and/or is loved, so its fulfillment could prevent human mal-temperament. Familiarity food can be provided by companion with friends and family members and has a significant role to insure well-being. Given the comprehensiveness of EEF in ITM which covers all human health-related aspects, we can insure health and well-being among our population by promoting and public educating of these principles.

Interaction of the anaphase-promoting complex/cyclosome and proteasome protein complexes with multiubiquitin chain-binding proteins

DEFF Research Database (Denmark)

Seeger, Michael; Hartmann-Petersen, Rasmus; Wilkinson, Caroline R M

2003-01-01

Fission yeast Rhp23 and Pus1 represent two families of multiubiquitin chain-binding proteins that associate with the proteasome. We show that both proteins bind to different regions of the proteasome subunit Mts4. The binding site for Pus1 was mapped to a cluster of repetitive sequences also found...... in the proteasome subunit SpRpn2 and the anaphase-promoting complex/cyclosome (APC/C) subunit Cut4. The putative role of Pus1 as a factor involved in allocation of ubiquitinylated substrates for the proteasome is discussed....

Adenovirus E4 open reading frame 4-induced dephosphorylation inhibits E1A activation of the E2 promoter and E2F-1-mediated transactivation independently of the retinoblastoma tumor suppressor protein

DEFF Research Database (Denmark)

Mannervik, M; Fan, S; Ström, A C

1999-01-01

of the viral E4 open reading frame 4 (E4-ORF4) protein. This effect does not to require the retinoblastoma protein that previously has been shown to regulate E2F activity. The inhibitory activity of E4-ORF4 appears to be specific because E4-ORF4 had little effect on, for example, E4-ORF6/7 transactivation......Previous studies have shown that the cell cycle-regulated E2F transcription factor is subjected to both positive and negative control by phosphorylation. Here we show that in transient transfection experiments, adenovirus E1A activation of the viral E2 promoter is abrogated by coexpression...... of the E2 promoter. We further show that the repressive effect of E4-ORF4 on E2 transcription works mainly through the E2F DNA-binding sites in the E2 promoter. In agreement with this, we find that E4-ORF4 inhibits E2F-1/DP-1-mediated transactivation. We also show that E4-ORF4 inhibits E2 mRNA expression...

The secreted protein ANGPTL2 promotes metastasis of osteosarcoma cells through integrin α5β1, p38 MAPK, and matrix metalloproteinases.

Science.gov (United States)

Odagiri, Haruki; Kadomatsu, Tsuyoshi; Endo, Motoyoshi; Masuda, Tetsuro; Morioka, Masaki Suimye; Fukuhara, Shigetomo; Miyamoto, Takeshi; Kobayashi, Eisuke; Miyata, Keishi; Aoi, Jun; Horiguchi, Haruki; Nishimura, Naotaka; Terada, Kazutoyo; Yakushiji, Toshitake; Manabe, Ichiro; Mochizuki, Naoki; Mizuta, Hiroshi; Oike, Yuichi

2014-01-21

The tumor microenvironment can enhance the invasive capacity of tumor cells. We showed that expression of angiopoietin-like protein 2 (ANGPTL2) in osteosarcoma (OS) cell lines increased and the methylation of its promoter decreased with time when grown as xenografts in mice compared with culture. Compared with cells grown in normal culture conditions, the expression of genes encoding DNA demethylation-related enzymes increased in tumor cells implanted into mice or grown in hypoxic, serum-starved culture conditions. ANGPTL2 expression in OS cell lines correlated with increased tumor metastasis and decreased animal survival by promoting tumor cell intravasation mediated by the integrin α5β1, p38 mitogen-activated protein kinase, and matrix metalloproteinases. The tolloid-like 1 (TLL1) protease cleaved ANGPTL2 into fragments in vitro that did not enhance tumor progression when overexpressed in xenografts. Expression of TLL1 was weak in OS patient tumors, suggesting that ANGPTL2 may not be efficiently cleaved upon secretion from OS cells. These findings demonstrate that preventing ANGPTL2 signaling stimulated by the tumor microenvironment could inhibit tumor cell migration and metastasis.

miR-367 regulation of DOC-2/DAB2 interactive protein promotes proliferation, migration and invasion of osteosarcoma cells.

Science.gov (United States)

Cai, Wei; Jiang, Haitao; Yu, Yifan; Xu, Yong; Zuo, Wenshan; Wang, Shouguo; Su, Zhen

2017-11-01

Recently, miR-367 is reported to exert either oncogenic or tumor suppressive effects in human malignancies. Recent study reports that miR-367 is up-regulated in OS tissues and cell lines, and abrogates adriamycin-induced apoptosis. The clinical significance of miR-367 and its function in OS need further investigation. In our study, miR-367 expression in OS was markedly elevated compared with corresponding non-tumor tissues. High miR-367 expression was associated with malignant clinical features and poor prognosis of OS patients. In accordance, the levels of miR-367 were dramatically up-regulated in OS cells. Loss of miR-367 expression in Saos-2 cells obviously inhibited the proliferation, migration and invasion of cancer cells in vitro. Meanwhile, miR-367 restoration promoted these malignant behaviors of MG-63 cells. Mechanistically, miR-367 negatively regulated DOC-2/DAB2 interactive protein (DAB2IP) abundance in OS cells. Hereby, DAB2IP was recognized as a direct target gene of miR-367 in OS. DAB2IP mRNA level was down-regulated and inversely correlated with miR-367 expression in OS specimens. DAB2IP overexpression prohibited proliferation, migration and invasion in Saos-2 cells, while DAB2IP knockdown showed promoting effects on proliferation, migration and invasion of MG-63 cells. Furthermore, the role of miR-367 might be mediated by DAB2IP-regulated phosphorylation of ERK and AKT in OS cells. To conclude, miR-367 may function as a biomarker for prediction of prognosis and a target for OS therapy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor

Directory of Open Access Journals (Sweden)

Rian de Laat

2015-03-01

Full Text Available Sequential proteolytic cleavages of amyloid-β protein precursor (AβPP by β-secretase and γ-secretase generate amyloid β (Aβ peptides, which are thought to contribute to Alzheimer's disease (AD. Much of this processing occurs in endosomes following endocytosis of AβPP from the plasma membrane. However, this pathogenic mode of processing AβPP may occur in competition with lysosomal degradation of AβPP, a common fate of membrane proteins trafficking through the endosomal system. Following up on published reports that LINGO-1 binds and promotes the amyloidogenic processing of AβPP we have examined the consequences of LINGO-1/AβPP interactions. We report that LINGO-1 and its paralogs, LINGO-2 and LINGO-3, decrease processing of AβPP in the amyloidogenic pathway by promoting lysosomal degradation of AβPP. We also report that LINGO-1 levels are reduced in AD brain, representing a possible pathogenic mechanism stimulating the generation of Aβ peptides in AD.

A C-reactive protein promoter polymorphism is associated with type 2 diabetes mellitus in Pima Indians

DEFF Research Database (Denmark)

Wolford, Johanna K; Gruber, Jonathan D; Ossowski, Victoria M

2003-01-01

of diabetes, independent of adiposity. Because CRP is located on 1q21, we considered it a potential positional candidate gene for T2DM. We therefore evaluated CRP and the nearby serum amyloid P-component, APCS, which is structurally similar to CRP, as candidate diabetes susceptibility genes. Approximately 10......Linkage analysis has identified a susceptibility locus for type 2 diabetes mellitus (T2DM) on chromosome 1q21-q23 in several populations. Results from recent prospective studies indicate that increased levels of C-reactive protein (CRP), a marker of immune system activation, are predictive...... disequilibrium clusters. We genotyped representative SNPs in approximately 1300 Pima samples and found a single variant in the CRP promoter (SNP 133552) that was associated with T2DM (P=0.014), as well as a common haplotype (CGCG) that was associated with both T2DM (P=0.029) and corrected insulin response...

A photo-responsive F-box protein FOF2 regulates floral initiation by promoting FLC expression in Arabidopsis.

Science.gov (United States)

He, Reqing; Li, Xinmei; Zhong, Ming; Yan, Jindong; Ji, Ronghuan; Li, Xu; Wang, Qin; Wu, Dan; Sun, Mengsi; Tang, Dongying; Lin, Jianzhong; Li, Hongyu; Liu, Bin; Liu, Hongtao; Liu, Xuanming; Zhao, Xiaoying; Lin, Chentao

2017-09-01

Floral initiation is regulated by various genetic pathways in response to light, temperature, hormones and developmental status; however, the molecular mechanisms underlying the interactions between different genetic pathways are not fully understood. Here, we show that the photoresponsive gene FOF2 (F-box of flowering 2) negatively regulates flowering. FOF2 encodes a putative F-box protein that interacts specifically with ASK14, and its overexpression results in later flowering under both long-day and short-day photoperiods. Conversely, transgenic plants expressing the F-box domain deletion mutant of FOF2 (FOF2ΔF), or double loss of function mutant of FOF2 and FOL1 (FOF2-LIKE 1) present early flowering phenotypes. The late flowering phenotype of the FOF2 overexpression lines is suppressed by the flc-3 loss-of-function mutation. Furthermore, FOF2 mRNA expression is regulated by autonomous pathway gene FCA, and the repressive effect of FOF2 in flowering can be overcome by vernalization. Interestingly, FOF2 expression is regulated by light. The protein level of FOF2 accumulates in response to light, whereas it is degraded under dark conditions via the 26S proteasome pathway. Our findings suggest a possible mechanistic link between light conditions and the autonomous floral promotion pathway in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Identification of an ovine atadenovirus gene whose product activates the viral E2 promoter: possible involvement of E2F-1

International Nuclear Information System (INIS)

Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter

2004-01-01

Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth

Microchidia protein 2, MORC2, downregulates the cytoskeleton adapter protein, ArgBP2, via histone methylation in gastric cancer cells

Energy Technology Data Exchange (ETDEWEB)

Tong, Yuxin; Li, Yan [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Gu, Hui [Department of Key Laboratory of Health Ministry for Congenital Malformation Shengjing Hospital, China Medical University, Shenyang, Liaoning 110004 (China); Wang, Chunyu [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Liu, Funan [Department of Surgical Oncology, The First Hospital of China Medical University, Shenyang, Liaoning 110001 (China); Shao, Yangguang; Li, Jiabin; Cao, Liu [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China); Li, Feng, E-mail: fli@mail.cmu.edu.cn [Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang, Liaoning 110122 (China)

2015-11-27

ArgBP2 is an adapter protein that plays an important role in actin-dependent processes such as cell adhesion and migration. However, its function and regulation mechanisms in gastric cancer have not yet been investigated. Here, we showed the low expression of ArgBP2 mRNA level in gastric tumor samples and its repressive function in the proliferation, migration, and invasion of gastric cancer cells. Then, we cloned and identified ArgBP2 promoter and verified that MORC2 bound to the promoter. Moreover, we demonstrated that MORC2 enhanced the recruitment of EZH2, which promoted the tri-methylation of H3K27, leading to the transcriptional repression of ArgBP2. Our results might thus contribute to understanding the molecular mechanisms of ArgBP2 regulation and suggesting ArgBP2 as a potential therapeutic target for gastric cancer. - Highlights: • ArgBP2 inhibits proliferation, migration, and invasion of gastric cancer cells. • Identification of ArgBP2 promoter and its transcription factor MORC2. • EZH2 is required in MORC2 down-regulating ArgBP2 via histone methylation.

Microchidia protein 2, MORC2, downregulates the cytoskeleton adapter protein, ArgBP2, via histone methylation in gastric cancer cells

International Nuclear Information System (INIS)

Tong, Yuxin; Li, Yan; Gu, Hui; Wang, Chunyu; Liu, Funan; Shao, Yangguang; Li, Jiabin; Cao, Liu; Li, Feng

2015-01-01

ArgBP2 is an adapter protein that plays an important role in actin-dependent processes such as cell adhesion and migration. However, its function and regulation mechanisms in gastric cancer have not yet been investigated. Here, we showed the low expression of ArgBP2 mRNA level in gastric tumor samples and its repressive function in the proliferation, migration, and invasion of gastric cancer cells. Then, we cloned and identified ArgBP2 promoter and verified that MORC2 bound to the promoter. Moreover, we demonstrated that MORC2 enhanced the recruitment of EZH2, which promoted the tri-methylation of H3K27, leading to the transcriptional repression of ArgBP2. Our results might thus contribute to understanding the molecular mechanisms of ArgBP2 regulation and suggesting ArgBP2 as a potential therapeutic target for gastric cancer. - Highlights: • ArgBP2 inhibits proliferation, migration, and invasion of gastric cancer cells. • Identification of ArgBP2 promoter and its transcription factor MORC2. • EZH2 is required in MORC2 down-regulating ArgBP2 via histone methylation.

[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

Science.gov (United States)

Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

2016-11-23

Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

Recombination-stable multimeric green fluorescent protein for characterization of weak promoter outputs in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen

2015-01-01

a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...

Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

International Nuclear Information System (INIS)

Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

1988-01-01

The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress

Directory of Open Access Journals (Sweden)

Ou Shulin

2017-01-01

Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.

A mucus adhesion promoting protein, MapA, mediates the adhesion of Lactobacillus reuteri to Caco-2 human intestinal epithelial cells.

Science.gov (United States)

Miyoshi, Yukihiro; Okada, Sanae; Uchimura, Tai; Satoh, Eiichi

2006-07-01

Lactobacillus reuteri is one of the dominant lactobacilli found in the gastrointestinal tract of various animals. A surface protein of L. reuteri 104R, mucus adhesion promoting protein (MapA), is considered to be an adhesion factor of this strain. We investigated the relation between MapA and adhesion of L. reuteri to human intestinal (Caco-2) cells. Quantitative analysis of the adhesion of L. reuteri strains to Caco-2 cells showed that various L. reuteri strains bind not only to mucus but also to intestinal epithelial cells. In addition, purified MapA bound to Caco-2 cells, and this binding inhibited the adhesion of L. reuteri in a concentration-dependent manner. Based on these observations, the adhesion of L. reuteri appears due to the binding of MapA to receptor-like molecules on Caco-2 cells. Further, far-western analysis indicated the existence of multiple receptor-like molecules in Caco-2 cells.

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Science.gov (United States)

Fauteux, François; Strömvik, Martina V

2009-01-01

Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Directory of Open Access Journals (Sweden)

Fauteux François

2009-10-01

Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer.

Science.gov (United States)

Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu

2016-03-08

The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.

HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells

DEFF Research Database (Denmark)

Olsen, Jørgen; Laustsen, Lotte; Troelsen, J

1994-01-01

The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....

H2A/K pseudogene mutation may promote cell proliferation

Energy Technology Data Exchange (ETDEWEB)

Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)

2016-05-15

Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.

Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

International Nuclear Information System (INIS)

Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

2012-01-01

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.

Science.gov (United States)

Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels

2015-05-12

Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.

Rab11-family of interacting protein 2 associates with chlamydial inclusions through its Rab-binding domain and promotes bacterial multiplication.

Science.gov (United States)

Leiva, Natalia; Capmany, Anahí; Damiani, María Teresa

2013-01-01

Chlamydia trachomatis, an obligate intracellular pathogen, survives within host cells in a special compartment named 'inclusion' and takes advantage of host vesicular transport pathways for its growth and replication. Rab GTPases are key regulatory proteins of intracellular trafficking. Several Rabs, among them Rab11 and Rab14, are implicated in chlamydial development. FIP2, a member of the Rab11-Family of Interacting Proteins, presents at the C-terminus a Rab-binding domain that interacts with both Rab11 and Rab14. In this study, we determined and characterized the recruitment of endogenous and GFP-tagged FIP2 to the chlamydial inclusions. The recruitment of FIP2 is specific since other members of the Rab11-Family of Interacting Proteins do not associate with the chlamydial inclusions. The Rab-binding domain of FIP2 is essential for its association. Our results indicate that FIP2 binds to Rab11 at the chlamydial inclusion membrane through its Rab-binding domain. The presence of FIP2 at the chlamydial inclusion favours the recruitment of Rab14. Furthermore, our results show that FIP2 promotes inclusion development and bacterial replication. In agreement, the silencing of FIP2 decreases the bacterial progeny. C. trachomatis likely recruits FIP2 to hijack host intracellular trafficking to redirect vesicles full of nutrients towards the inclusion. © 2012 Blackwell Publishing Ltd.

E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

Directory of Open Access Journals (Sweden)

Yueting Zheng

2016-01-01

Full Text Available Interferons (IFNs are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC and TERT-immortalized normal human diploid fibroblasts (HDF-TERT. IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib, a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection.

An Alphavirus E2 Membrane-Proximal Domain Promotes Envelope Protein Lateral Interactions and Virus Budding

Directory of Open Access Journals (Sweden)

Emily A. Byrd

2017-11-01

Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.

Soy protein isolate inhibits hepatic tumor promotion in mice fed a high-fat liquid diet.

Science.gov (United States)

Mercer, Kelly E; Pulliam, Casey F; Pedersen, Kim B; Hennings, Leah; Ronis, Martin Jj

2017-03-01

Alcoholic and nonalcoholic fatty liver diseases are risk factors for development of hepatocellular carcinoma, but the underlying mechanisms are poorly understood. On the other hand, ingestion of soy-containing diets may oppose the development of certain cancers. We previously reported that replacing casein with a soy protein isolate reduced tumor promotion in the livers of mice with alcoholic liver disease after feeding a high fat ethanol liquid diet following initiation with diethylnitrosamine. Feeding soy protein isolate inhibited processes that may contribute to tumor promotion including inflammation, sphingolipid signaling, and Wnt/β-catenin signaling. We have extended these studies to characterize liver tumor promotion in a model of nonalcoholic fatty liver disease produced by chronic feeding of high-fat liquid diets in the absence of ethanol. Mice treated with diethylnitrosamine on postnatal day 14 were fed a high-fat liquid diet made with casein or SPI as the sole protein source for 16 weeks in adulthood. Relative to mice fed normal chow, a high fat/casein diet led to increased tumor promotion, hepatocyte proliferation, steatosis, and inflammation. Replacing casein with soy protein isolate counteracted these effects. The high fat diets also resulted in a general increase in transcripts for Wnt/β-catenin pathway components, which may be an important mechanism, whereby hepatic tumorigenesis is promoted. However, soy protein isolate did not block Wnt signaling in this nonalcoholic fatty liver disease model. We conclude that replacing casein with soy protein isolate blocks development of steatosis, inflammation, and tumor promotion in diethylnitrosamine-treated mice fed high fat diets. Impact statement The impact of dietary components on cancer is a topic of great interest for both the general public and the scientific community. Liver cancer is currently the second leading form of cancer deaths worldwide. Our study has addressed the effect of the protein

Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

Science.gov (United States)

Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

2016-10-01

E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

Science.gov (United States)

Jin, Han; Zhang, Kai; Qiao, Chunyan; Yuan, Anliang; Li, Daowei; Zhao, Liang; Shi, Ce; Xu, Xiaowei; Ni, Shilei; Zheng, Changyu; Liu, Xiaohua; Yang, Bai; Sun, Hongchen

2014-01-01

Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2) gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI–al nanocomposites efficiently deliver the BMP-2 gene to bone marrow mesenchymal stem cells and that BMP-2 gene-engineered cell sheet is an effective way for promoting bone regeneration. PMID:24855355

Interaction of an IHF-like protein with the Rhizobium etli nifA promoter.

Science.gov (United States)

Benhassine, Traki; Fauvart, Maarten; Vanderleyden, Jos; Michiels, Jan

2007-06-01

The nifA gene fulfills an essential role in the regulation of nitrogen fixation genes in Rhizobium etli. Transcription analysis of the nifA gene, assessed using promoter deletions, indicated an oxygen-independent expression, threefold higher during symbiosis as compared with free-living conditions. Electrophoretic mobility shift assays using those nifA promoter deletion fragments, which were actively transcribed, demonstrated the specific interaction with R. etli cellular protein(s) resulting in the formation of two DNA-protein complexes. An interacting protein was purified by liquid chromatography on Heparin Sepharose and Mono S columns. The purified 12 kDa R. etli protein cross-reacted with antibodies directed against Escherichia coli integration host factor (IHF). Furthermore, purified E. coli IHF was able to specifically bind to the R. etli nifA promoter region. These results point to an as yet undisclosed function of IHF in the regulation of R. etli nifA expression.

HCV core protein-induced down-regulation of microRNA-152 promoted aberrant proliferation by regulating Wnt1 in HepG2 cells.

Directory of Open Access Journals (Sweden)

Shifeng Huang

Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell

Promoter characterization and genomic organization of the human X11β gene APBA2.

LENUS (Irish Health Repository)

Hao, Yan

2012-02-15

Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

High-level intracellular expression of heterologous proteins in Brevibacillus choshinensis SP3 under the control of a xylose inducible promoter

Directory of Open Access Journals (Sweden)

D’Urzo Nunzia

2013-02-01

Full Text Available Abstract Background In past years research has focused on the development of alternative Gram positive bacterial expression systems to produce industrially relevant proteins. Brevibacillus choshinensis is an easy to handle non-sporulating bacterium, lacking extracellular proteases, that has been already shown to provide a high level of recombinant protein expression. One major drawback, limiting the applicability of the Brevibacillus expression system, is the absence of expression vectors based on inducible promoters. Here we used the PxylA inducible promoter, commonly employed in other Bacillae expression systems, in Brevibacillus. Results Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA. The GFP expression yields were more than 25 fold higher than those reported for B. megaterium carrying the same vector. All the tested proteins show significant increment in their expression levels (2-10 folds than those obtained using the available plasmids based on the P2 constitutive promoter. Conclusion Combining the components of two different commercially available Gram positive expression systems, such as Brevibacillus (from Takara Bio and B. megaterium (from Mobitec, we demonstrate that vectors based on the B. megaterium PxylA xylose inducible promoter can be successfully used to induce high level of intracellular expression of heterologous proteins in Brevibacillus.

Disruption of genes encoding eIF4E binding proteins-1 and -2 does not alter basal or sepsis-induced changes in skeletal muscle protein synthesis in male or female mice.

Science.gov (United States)

Steiner, Jennifer L; Pruznak, Anne M; Deiter, Gina; Navaratnarajah, Maithili; Kutzler, Lydia; Kimball, Scot R; Lang, Charles H

2014-01-01

Sepsis decreases skeletal muscle protein synthesis in part by impairing mTOR activity and the subsequent phosphorylation of 4E-BP1 and S6K1 thereby controlling translation initiation; however, the relative importance of changes in these two downstream substrates is unknown. The role of 4E-BP1 (and -BP2) in regulating muscle protein synthesis was assessed in wild-type (WT) and 4E-BP1/BP2 double knockout (DKO) male mice under basal conditions and in response to sepsis. At 12 months of age, body weight, lean body mass and energy expenditure did not differ between WT and DKO mice. Moreover, in vivo rates of protein synthesis in gastrocnemius, heart and liver did not differ between DKO and WT mice. Sepsis decreased skeletal muscle protein synthesis and S6K1 phosphorylation in WT and DKO male mice to a similar extent. Sepsis only decreased 4E-BP1 phosphorylation in WT mice as no 4E-BP1/BP2 protein was detected in muscle from DKO mice. Sepsis decreased the binding of eIF4G to eIF4E in WT mice; however, eIF4E•eIF4G binding was not altered in DKO mice under either basal or septic conditions. A comparable sepsis-induced increase in eIF4B phosphorylation was seen in both WT and DKO mice. eEF2 phosphorylation was similarly increased in muscle from WT septic mice and both control and septic DKO mice, compared to WT control values. The sepsis-induced increase in muscle MuRF1 and atrogin-1 (markers of proteolysis) as well as TNFα and IL-6 (inflammatory cytokines) mRNA was greater in DKO than WT mice. The sepsis-induced decrease in myocardial and hepatic protein synthesis did not differ between WT and DKO mice. These data suggest overall basal protein balance and synthesis is maintained in muscle of mice lacking both 4E-BP1/BP2 and that sepsis-induced changes in mTOR signaling may be mediated by a down-stream mechanism independent of 4E-BP1 phosphorylation and eIF4E•eIF4G binding.

Kinetics of the interactions between yeast elongation factors 1A and 1Balpha, guanine nucleotides, and aminoacyl-tRNA

DEFF Research Database (Denmark)

Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne

2007-01-01

of guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7...

Prefoldin Promotes Proteasomal Degradation of Cytosolic Proteins with Missense Mutations by Maintaining Substrate Solubility.

Directory of Open Access Journals (Sweden)

Sophie A Comyn

2016-07-01

Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.

FANCG promotes formation of a newly identified protein complex containing BRCA2, FANCD2 and XRCC3.

Science.gov (United States)

Wilson, J B; Yamamoto, K; Marriott, A S; Hussain, S; Sung, P; Hoatlin, M E; Mathew, C G; Takata, M; Thompson, L H; Kupfer, G M; Jones, N J

2008-06-12

Fanconi anemia (FA) is a human disorder characterized by cancer susceptibility and cellular sensitivity to DNA crosslinks and other damages. Thirteen complementation groups and genes are identified, including BRCA2, which is defective in the FA-D1 group. Eight of the FA proteins, including FANCG, participate in a nuclear core complex that is required for the monoubiquitylation of FANCD2 and FANCI. FANCD2, like FANCD1/BRCA2, is not part of the core complex, and we previously showed direct BRCA2-FANCD2 interaction using yeast two-hybrid analysis. We now show in human and hamster cells that expression of FANCG protein, but not the other core complex proteins, is required for co-precipitation of BRCA2 and FANCD2. We also show that phosphorylation of FANCG serine 7 is required for its co-precipitation with BRCA2, XRCC3 and FANCD2, as well as the direct interaction of BRCA2-FANCD2. These results argue that FANCG has a role independent of the FA core complex, and we propose that phosphorylation of serine 7 is the signalling event required for forming a discrete complex comprising FANCD1/BRCA2-FANCD2-FANCG-XRCC3 (D1-D2-G-X3). Cells that fail to express either phospho-Ser7-FANCG, or full length BRCA2 protein, lack the interactions amongst the four component proteins. A role for D1-D2-G-X3 in homologous recombination repair (HRR) is supported by our finding that FANCG and the RAD51-paralog XRCC3 are epistatic for sensitivity to DNA crosslinking compounds in DT40 chicken cells. Our findings further define the intricate interface between FANC and HRR proteins in maintaining chromosome stability.

GADD34 Function in Protein Trafficking Promotes Adaptation to Hyperosmotic Stress in Human Corneal Cells

Directory of Open Access Journals (Sweden)

Dawid Krokowski

2017-12-01

Full Text Available Summary: GADD34, a stress-induced regulatory subunit of the phosphatase PP1, is known to function in hyperosmotic stress through its well-known role in the integrated stress response (ISR pathway. Adaptation to hyperosmotic stress is important for the health of corneal epithelial cells exposed to changes in extracellular osmolarity, with maladaptation leading to dry eye syndrome. This adaptation includes induction of SNAT2, an endoplasmic reticulum (ER-Golgi-processed protein, which helps to reverse the stress-induced loss of cell volume and promote homeostasis through amino acid uptake. Here, we show that GADD34 promotes the processing of proteins synthesized on the ER during hyperosmotic stress independent of its action in the ISR. We show that GADD34/PP1 phosphatase activity reverses hyperosmotic-stress-induced Golgi fragmentation and is important for cis- to trans-Golgi trafficking of SNAT2, thereby promoting SNAT2 plasma membrane localization and function. These results suggest that GADD34 is a protective molecule for ocular diseases such as dry eye syndrome. : Here, Krokowski et al. show that GADD34/PP1 protects the microtubule network, prevents Golgi fragmentation, and preserves protein trafficking independent of its action in the integrated stress response (ISR. In osmoadaptation, GADD34 facilitates trans-Golgi-mediated processing of the endoplasmic reticulum (ER-synthesized amino acid transporter SNAT2, which in turn increases amino acid uptake. Keywords: SNAT2, GADD34, hyperosmotic stress, amino acid transport, Golgi fragmentation, ISR

CNPY2 inhibits MYLIP-mediated AR protein degradation in prostate cancer cells.

Science.gov (United States)

Ito, Saya; Ueno, Akihisa; Ueda, Takashi; Nakagawa, Hideo; Taniguchi, Hidefumi; Kayukawa, Naruhiro; Fujihara-Iwata, Atsuko; Hongo, Fumiya; Okihara, Koji; Ukimura, Osamu

2018-04-03

The androgen receptor (AR) is a ligand-dependent transcription factor that promotes prostate cancer (PC) cell growth through control of target gene expression. This report suggests that Canopy FGF signaling regulator 2 (CNPY2) controls AR protein levels in PC cells. We found that AR was ubiquitinated by an E3 ubiquitin ligase, myosin regulatory light chain interacting protein (MYLIP) and then degraded through the ubiquitin-proteasome pathway. CNPY2 decreased the ubiquitination activity of MYLIP by inhibition of interaction between MYLIP and UBE2D1, an E2 ubiquitin ligase. CNPY2 up-regulated gene expression of AR target genes such as KLK3 gene which encodes the prostate specific antigen (PSA) and promoted cell growth of PC cells. The cell growth inhibition by CNPY2 knockdown was rescued by AR overexpression. Furthermore, positive correlation of expression levels between CNPY2 and AR/AR target genes was observed in tissue samples from human prostate cancer patients. Together, these results suggested that CNPY2 promoted cell growth of PC cells by inhibition of AR protein degradation through MYLIP-mediated AR ubiquitination.

Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

Directory of Open Access Journals (Sweden)

Thrush Anthony

2010-01-01

Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

Understanding the molecular basis of plant growth promotional effect of Pseudomonas fluorescens on rice through protein profiling.

Science.gov (United States)

Kandasamy, Saveetha; Loganathan, Karthiba; Muthuraj, Raveendran; Duraisamy, Saravanakumar; Seetharaman, Suresh; Thiruvengadam, Raguchander; Ponnusamy, Balasubramanian; Ramasamy, Samiyappan

2009-12-24

Plant Growth Promoting Rhizobacteria (PGPR), Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.

Flavodiiron Proteins Promote Fast and Transient O2 Photoreduction in Chlamydomonas.

Science.gov (United States)

Chaux, Frédéric; Burlacot, Adrien; Mekhalfi, Malika; Auroy, Pascaline; Blangy, Stéphanie; Richaud, Pierre; Peltier, Gilles

2017-07-01

During oxygenic photosynthesis, the reducing power generated by light energy conversion is mainly used to reduce carbon dioxide. In bacteria and archae, flavodiiron (Flv) proteins catalyze O 2 or NO reduction, thus protecting cells against oxidative or nitrosative stress. These proteins are found in cyanobacteria, mosses, and microalgae, but have been lost in angiosperms. Here, we used chlorophyll fluorescence and oxygen exchange measurement using [ 18 O]-labeled O 2 and a membrane inlet mass spectrometer to characterize Chlamydomonas reinhardtii flvB insertion mutants devoid of both FlvB and FlvA proteins. We show that Flv proteins are involved in a photo-dependent electron flow to oxygen, which drives most of the photosynthetic electron flow during the induction of photosynthesis. As a consequence, the chlorophyll fluorescence patterns are strongly affected in flvB mutants during a light transient, showing a lower PSII operating yield and a slower nonphotochemical quenching induction. Photoautotrophic growth of flvB mutants was indistinguishable from the wild type under constant light, but severely impaired under fluctuating light due to PSI photo damage. Remarkably, net photosynthesis of flv mutants was higher than in the wild type during the initial hour of a fluctuating light regime, but this advantage vanished under long-term exposure, and turned into PSI photo damage, thus explaining the marked growth retardation observed in these conditions. We conclude that the C. reinhardtii Flv participates in a Mehler-like reduction of O 2 , which drives a large part of the photosynthetic electron flow during a light transient and is thus critical for growth under fluctuating light regimes. © 2017 American Society of Plant Biologists. All Rights Reserved.

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

Pharmacological activation of aldehyde dehydrogenase 2 promotes osteoblast differentiation via bone morphogenetic protein-2 and induces bone anabolic effect

Energy Technology Data Exchange (ETDEWEB)

Mittal, Monika; Pal, Subhashis; China, Shyamsundar Pal; Porwal, Konica [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India); Dev, Kapil [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Shrivastava, Richa [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Raju, Kanumuri Siva Rama; Rashid, Mamunur [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Trivedi, Arun Kumar; Sanyal, Sabyasachi [Biochemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Wahajuddin, Muhammad [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Bhaduria, Smrati [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Rakesh [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chattopadhyay, Naibedya, E-mail: n_chattopadhyay@cdri.res.in [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India)

2017-02-01

Aldehyde dehydrogenases (ALDHs) are a family of enzymes involved in detoxifying aldehydes. Previously, we reported that an ALDH inhibitor, disulfiram caused bone loss in rats and among ALDHs, osteoblast expressed only ALDH2. Loss-of-function mutation in ALDH2 gene is reported to cause bone loss in humans which suggested its importance in skeletal homeostasis. We thus studied whether activating ALDH2 by N-(1, 3-benzodioxol-5-ylmethyl)-2, 6-dichlorobenzamide (alda-1) had osteogenic effect. We found that alda-1 increased and acetaldehyde decreased the differentiation of rat primary osteoblasts and expressions of ALDH2 and bone morphogenetic protein-2 (BMP-2). Silencing ALDH2 in osteoblasts abolished the alda-1 effects. Further, alda-1 attenuated the acetaldehyde-induced lipid-peroxidation and oxidative stress. BMP-2 is essential for bone regeneration and alda-1 increased its expression in osteoblasts. We then showed that alda-1 (40 mg/kg dose) augmented bone regeneration at the fracture site with concomitant increase in BMP-2 protein compared with control. The osteogenic dose (40 mg/kg) of alda-1 attained a bone marrow concentration that was stimulatory for osteoblast differentiation, suggesting that the tissue concentration of alda-1 matched its pharmacologic effect. In addition, alda-1 promoted modeling-directed bone growth and peak bone mass achievement, and increased bone mass in adult rats which reiterated its osteogenic effect. In osteopenic ovariectomized (OVX) rats, alda-1 reversed trabecular osteopenia with attendant increase in serum osteogenic marker (procollagen type I N-terminal peptide) and decrease in oxidative stress. Alda-1 has no effect on liver and kidney function. We conclude that activating ALDH2 by alda-1 had an osteoanabolic effect involving increased osteoblastic BMP-2 production and decreased OVX-induced oxidative stress. - Highlights: • Alda-1 induced osteoblast differentiation that involved upregulation of ALDH2 and BMP-2 • Alda-1

Hepatitis C virus E2 protein promotes human hepatoma cell proliferation through the MAPK/ERK signaling pathway via cellular receptors

International Nuclear Information System (INIS)

Zhao Lanjuan; Wang Lu; Ren Hao; Cao Jie; Li Li; Ke Jinshan; Qi Zhongtian

2005-01-01

Dysregulation of mitogen-activated protein kinase (MAPK) signaling pathways by various viruses has been shown to be responsible for viral pathogenicity. The molecular mechanism by which hepatitis C virus (HCV) infection caused human liver diseases has been investigated on the basis of abnormal intracellular signal events. Current data are very limited involved in transmembrane signal transduction triggered by HCV E2 protein. Here we explored regulation of the MAPK/extracellular signal-regulated kinase (MAPK/ERK) signaling pathway by E2 expressed in Chinese hamster oval cells. In human hepatoma Huh-7 cells, E2 specifically activated the MAPK/ERK pathway including downstream transcription factor ATF-2 and greatly promoted cell proliferation. CD81 and low density lipoprotein receptor (LDLR) on the cell surface mediated binding of E2 to Huh-7 cells. The MAPK/ERK activation and cell proliferation driven by E2 were suppressed by blockage of CD81 as well as LDLR. Furthermore, pretreatment with an upstream kinase MEK1/2 inhibitor U0126 also impaired the MAPK/ERK activation and cell proliferation induced by E2. Our results suggest that the MAPK/ERK signaling pathway triggered by HCV E2 via its receptors maintains survival and growth of target cells

Promoting resuscitation of viable but nonculturable cells of Vibrio harveyi by a resuscitation-promoting factor-like protein YeaZ.

Science.gov (United States)

Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X

2017-02-01

To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4  CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5  CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.

Understanding the molecular basis of plant growth promotional effect of Pseudomonas fluorescens on rice through protein profiling

Directory of Open Access Journals (Sweden)

Thiruvengadam Raguchander

2009-12-01

Full Text Available Abstract Background Plant Growth Promoting Rhizobacteria (PGPR, Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Results Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Conclusion Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.

The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

Directory of Open Access Journals (Sweden)

Rafael Estrada-Avilés

Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

The C. elegans SoxC protein SEM-2 opposes differentiation factors to promote a proliferative blast cell fate in the postembryonic mesoderm

Science.gov (United States)

Tian, Chenxi; Shi, Herong; Colledge, Clark; Stern, Michael; Waterston, Robert; Liu, Jun

2011-01-01

The proper development of multicellular organisms requires precise regulation and coordination of cell fate specification, cell proliferation and differentiation. Abnormal regulation and coordination of these processes could lead to disease, including cancer. We have examined the function of the sole C. elegans SoxC protein, SEM-2, in the M lineage, which produces the postembryonic mesoderm. We found that SEM-2/SoxC is both necessary and sufficient to promote a proliferating blast cell fate, the sex myoblast fate, over a differentiated striated bodywall muscle fate. A number of factors control the specific expression of sem-2 in the sex myoblast precursors and their descendants. This includes direct control of sem-2 expression by a Hox-PBC complex. The crucial nature of the HOX/PBC factors in directly enhancing expression of this proliferative factor in the C. elegans M lineage suggests a possible more general link between Hox-PBC factors and SoxC proteins in regulating cell proliferation. PMID:21307099

GSTT2 promoter polymorphisms and colorectal cancer risk

Directory of Open Access Journals (Sweden)

Ahn Sun-A

2007-01-01

Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

Overexpression of MIP2, a novel WD-repeat protein, promotes proliferation of H9c2 cells

International Nuclear Information System (INIS)

Wei, Xing; Song, Lan; Jiang, Lei; Wang, Guiliang; Luo, Xinjing; Zhang, Bin; Xiao, Xianzhong

2010-01-01

WD40 repeat proteins have a wide range of diverse biological functions including signal transduction, cell cycle regulation, RNA splicing, and transcription. Myocardial ischemic preconditioning up-regulated protein 2 (MIP2) is a novel member of the WD40 repeat proteins superfamily that contains five WD40 repeats. Little is known about its biological role, and the purpose of this study was to determine the role of MIP2 in regulating cellular proliferation. Transfection and constitutive expression of MIP2 in the rat cardiomyoblast cell line H9c2 results in enhanced growth of those cells as measured by cell number and is proportional to the amount of MIP2 expressed. Overexpression of MIP2 results in a shorter cell cycle, as measured by flow cytometry. Collectively, these data suggest that MIP2 may participate in the progression of cell proliferation in H9c2 cells.

Knotted vs. unknotted proteins: evidence of knot-promoting loops.

Directory of Open Access Journals (Sweden)

Raffaello Potestio

Full Text Available Knotted proteins, because of their ability to fold reversibly in the same topologically entangled conformation, are the object of an increasing number of experimental and theoretical studies. The aim of the present investigation is to assess, on the basis of presently available structural data, the extent to which knotted proteins are isolated instances in sequence or structure space, and to use comparative schemes to understand whether specific protein segments can be associated to the occurrence of a knot in the native state. A significant sequence homology is found among a sizeable group of knotted and unknotted proteins. In this family, knotted members occupy a primary sub-branch of the phylogenetic tree and differ from unknotted ones only by additional loop segments. These "knot-promoting" loops, whose virtual bridging eliminates the knot, are found in various types of knotted proteins. Valuable insight into how knots form, or are encoded, in proteins could be obtained by targeting these regions in future computational studies or excision experiments.

β-Hydroxy-β-Methylbutyrate (HMB) Promotes Neurite Outgrowth in Neuro2a Cells.

Science.gov (United States)

Salto, Rafael; Vílchez, Jose D; Girón, María D; Cabrera, Elena; Campos, Nefertiti; Manzano, Manuel; Rueda, Ricardo; López-Pedrosa, Jose M

2015-01-01

β-Hydroxy-β-methylbutyrate (HMB) has been shown to enhance cell survival, differentiation and protein turnover in muscle, mainly activating phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinases/ extracellular-signal-regulated kinases (MAPK/ERK) signaling pathways. Since these two pathways are related to neuronal survival and differentiation, in this study, we have investigated the neurotrophic effects of HMB in mouse neuroblastoma Neuro2a cells. In Neuro2a cells, HMB promotes differentiation to neurites independent from any effects on proliferation. These effects are mediated by activation of both the PI3K/Akt and the extracellular-signal-regulated kinases (ERK1/2) signaling as demonstrated by the use of specific inhibitors of these two pathways. As myocyte-enhancer factor 2 (MEF2) family of transcription factors are involved in neuronal survival and plasticity, the transcriptional activity and protein levels of MEF2 were also evaluated. HMB promoted MEF2-dependent transcriptional activity mediated by the activation of Akt and ERK1/2 pathways. Furthermore, HMB increases the expression of brain glucose transporters 1 (GLUT1) and 3 (GLUT3), and mTOR phosphorylation, which translates in a higher protein synthesis in Neuro2a cells. Furthermore, Torin1 and rapamycin effects on MEF2 transcriptional activity and HMB-dependent neurite outgrowth support that HMB acts through mTORC2. Together, these findings provide clear evidence to support an important role of HMB in neurite outgrowth.

Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

Directory of Open Access Journals (Sweden)

Jin H

2014-05-01

Full Text Available Han Jin,1 Kai Zhang,2 Chunyan Qiao,1 Anliang Yuan,1 Daowei Li,1 Liang Zhao,1 Ce Shi,1 Xiaowei Xu,1 Shilei Ni,1 Changyu Zheng,3 Xiaohua Liu,4 Bai Yang,2 Hongchen Sun11Department of Pathology, School of Stomatology, Jilin University, Changchun, People’s Republic of China; 2State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun, People’s Republic of China; 3Molecular Physiology and Therapeutics Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD, USA; 4Department of Biomedical Sciences, Texas A&M University Baylor College of Dentistry, Dallas, TX, USAAbstract: Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2 gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al nanocomposites plus human BMP-2 complementary(cDNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI�

Thioredoxin Txnl1/TRP32 Is a Redox-active Cofactor of the 26 S Proteasome

DEFF Research Database (Denmark)

Andersen, Katrine M; Klausen, Louise Kjær; Prag, Søren

2009-01-01

in the cytoplasm and nucleus. Txnl1 has thioredoxin activity with a redox potential of about -250 mV. Mutant Txnl1 with one active site cysteine replaced by serine formed disulfide bonds to eEF1A1, a substrate-recruiting factor of the 26S proteasome. eEF1A1 is therefore a likely physiological substrate....... In response to knock-down of Txnl1, ubiquitin-protein conjugates were moderately stabilised. Hence, Txnl1 is the first example of a direct connection between protein reduction and proteolysis, two major intracellular protein quality control mechanisms....

Protein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation.

LENUS (Irish Health Repository)

McEneaney, Victoria

2010-01-01

Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.

The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition.

Science.gov (United States)

Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud

2016-04-01

The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.

Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.

Science.gov (United States)

Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S

2014-12-01

Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.

Aquaporin 2 promotes cell migration and epithelial morphogenesis.

Science.gov (United States)

Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny

2012-09-01

The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

Science.gov (United States)

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Pumpkin eIF5A isoforms interact with components of the translational machinery in the cucurbit sieve tube system.

Science.gov (United States)

Ma, Yi; Miura, Eriko; Ham, Byung-Kook; Cheng, Hao-Wen; Lee, Young-Jin; Lucas, William J

2010-11-01

In yeast, eIF5A, in combination with eEF2, functions at the translation step, during the protein elongation cycle. This result is of significance with respect to functioning of the enucleate sieve tube system, as eIF5A was recently detected in Cucurbita maxima (pumpkin) phloem sap. In the present study, we further characterized four CmeIF5A isoforms, encoding three proteins, all of which were present in the phloem sap. Although hypusination of CmeIF5A was not necessary for entry into the sieve elements, this unique post-translational modification was necessary for RNA binding. The two enzymes required for hypusination were detected in pumpkin phloem sap, where presumably this modification takes place. A combination of gel-filtration chromatography and protein overlay assays demonstrated that, as in yeast, CmeIF5A interacts with phloem proteins, like eEF2, known to be involved in protein synthesis. These findings are discussed in terms of a potential role for eIF5A in regulating protein synthesis within the enucleate sieve tube system of the angiosperms. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

Promoter- and cell-specific epigenetic regulation of CD44, Cyclin D2, GLIPR1 and PTEN by Methyl-CpG binding proteins and histone modifications

International Nuclear Information System (INIS)

Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi

2010-01-01

The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile

Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the CALB2 promoter.

Science.gov (United States)

Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat

2018-04-27

The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments

Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

Directory of Open Access Journals (Sweden)

Rachel M. Woodfint

2017-01-01

Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

The retinoid X receptor response element in the human aldehyde dehydrogenase 2 promoter is antagonized by the chicken ovalbumin upstream promoter family of orphan receptors

NARCIS (Netherlands)

Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D

2000-01-01

Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift

TPA-inducible proteins may account for sensitivity to promotion of transformation

International Nuclear Information System (INIS)

Hirano, K.; Smith, B.; Colburn, N.H.

1986-01-01

The preneoplastic JB6 mouse epidermal cell system includes cell lines sensitive (P + ) or resistant (P - ) to tumor promoter induced neoplastic transformation. The authors investigated whether a difference in TPA-inducible proteins may explain this differential sensitivity. The synthesis of a 39 Kd cytoplasmic protein (Major Excreted Protein) was TPA-inducible, but to a similar extent in both P + and P - cells. TPA stimulated phosphorylation but not synthesis of the previously described stress protein pp80 in both P + and P - cells from 1 to 5 hr after treatment. Pulse labelling of P + and P - cells with 35 S-methionine revealed a TPA dependent P + specific transient increase in the synthesis of 58Kd protein. Induction was observed at 1 hr, and returned to basal levels by 4 hr and 20 hr, in nuclear and cytoplasmic fractions, respectively. This protein is not phosphorylated in response to TPA treatment. P + cells differ from P - cells in one or more genes that specify sensitivity to promotion of transformation, designated pro genes. Antibodies to three peptides representing the pro-1 open reading frame were used in immunoprecipitation and Western blotting to isolate the pro-1 gene product. A 43 Kd protein was immunologically responsive to the pro-1 peptide antibodies, and showed an increased signal 40 min after TPA treatment. Since the predicted molecular weight of a pro-1 gene product is only 7 Kd, the possibility of a modification of the protein by poly(ADP-ribosylation) or glycosylation is being investigated

Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function

Energy Technology Data Exchange (ETDEWEB)

Sangsuwan, Jiraporn [Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn [Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand)

2015-09-01

The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function.

Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function

International Nuclear Information System (INIS)

Sangsuwan, Jiraporn; Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn

2015-01-01

The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function

Mycobacterium tuberculosis UvrD1 and UvrA proteins suppress DNA strand exchange promoted by cognate and noncognate RecA proteins.

Science.gov (United States)

Singh, Pawan; Patil, K Neelakanteshwar; Khanduja, Jasbeer Singh; Kumar, P Sanjay; Williams, Alan; Rossi, Franca; Rizzi, Menico; Davis, Elaine O; Muniyappa, K

2010-06-15

DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.

SH2 domain-containing protein tyrosine phosphatase 2 and focal adhesion kinase protein interactions regulate pulmonary endothelium barrier function.

Science.gov (United States)

Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O

2015-06-01

Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients

MRG15 activates the cdc2 promoter via histone acetylation in human cells

International Nuclear Information System (INIS)

Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.

2011-01-01

Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

MRG15 activates the cdc2 promoter via histone acetylation in human cells

Energy Technology Data Exchange (ETDEWEB)

Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)

2011-07-01

Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

Functional characterization of JMJD2A, a histone deacetylase- and retinoblastoma-binding protein.

Science.gov (United States)

Gray, Steven G; Iglesias, Antonio H; Lizcano, Fernando; Villanueva, Raul; Camelo, Sandra; Jingu, Hisaka; Teh, Bin T; Koibuchi, Noriyuki; Chin, William W; Kokkotou, Efi; Dangond, Fernando

2005-08-05

To effectively direct targeted repression, the class I histone deacetylases (HDACs) associate with many important regulatory proteins. In this paper we describe the molecular characterization of a member of the Jumonji domain 2 (JMJD2) family of proteins, and demonstrate its binding to both class I HDACs and the retinoblastoma protein (pRb). JMJD2 proteins are characterized by the presence of two leukemia-associated protein/plant homeodomain (LAP/PHD) zinc fingers, one JmjN, one JmjC (containing an internal retinoblastoma-binding protein 2 (RBBP2)-like sequence), and two Tudor domains. The first member of this group, JMJD2A, is widely expressed in human tissues and cell lines, and high endogenous expression of JMJD2A mRNA was found in several cell types, including human T-cell lymphotropic virus 1 (HTLV-1)-infected cell lines. JMJD2A and JMJD2B exhibit cell type-specific responses to the HDAC inhibitor trichostatin A. We show that the JMJD2A protein associates in vivo with pRb and class I HDACs, and mediates repression of E2F-regulated promoters. In HTLV-1 virus-infected cells, we find that JMJD2A binds to the viral Tax protein. Antibodies to JMJD2A recognize the native protein but also a half-sized protein fragment, the latter up-regulated in THP-1 cells during the G(2)/M phase of the cell cycle. The ability of JMJD2A to associate with pRb and HDACs and potentiate pRb-mediated repression of E2F-regulated promoters implies an important role for this protein in cell proliferation and oncogenesis.

The C. elegans Spalt-like protein SEM-4 functions through the SoxC transcription factor SEM-2 to promote a proliferative blast cell fate in the postembryonic mesoderm.

Science.gov (United States)

Shen, Qinfang; Shi, Herong; Tian, Chenxi; Ghai, Vikas; Liu, Jun

2017-09-01

Proper development of a multicellular organism relies on well-coordinated regulation of cell fate specification, cell proliferation and cell differentiation. The C. elegans postembryonic mesoderm provides a useful system for uncovering factors involved in these processes and for further dissecting their regulatory relationships. The single Spalt-like zinc finger containing protein SEM-4/SALL is known to be involved in specifying the proliferative sex myoblast (SM) fate. We have found that SEM-4/SALL is sufficient to promote the SM fate and that it does so in a cell autonomous manner. We further showed that SEM-4/SALL acts through the SoxC transcription factor SEM-2 to promote the SM fate. SEM-2 is known to promote the SM fate by inhibiting the expression of two BWM-specifying transcription factors. In light of recent findings in mammals showing that Sall4, one of the mammalian homologs of SEM-4, contributes to pluripotency regulation by inhibiting differentiation, our work suggests that the function of SEM-4/SALL proteins in regulating pluripotency versus differentiation appears to be evolutionarily conserved. Copyright © 2017 Elsevier Inc. All rights reserved.

Depression of leukocyte protein synthesis, immune function and growth performance induced by high environmental temperature in broiler chickens

Science.gov (United States)

Kamel, Nancy N.; Ahmed, Ayman M. H.; Mehaisen, Gamal M. K.; Mashaly, Magdi M.; Abass, Ahmed O.

2017-09-01

In tropical and semitropical regions, raising broiler chickens out of their thermal comfort zone can cause an added economic loss in the poultry industry. The cause for the deleterious effects on immunity and growth performance of broilers under high environmental temperatures is still poorly understood. Therefore, the aim of the current investigation was to evaluate the effect of heat stress on leukocytes protein synthesis and immune function as a possible direct cause of low performance in broiler chickens under such condition. In this study, 300 one-day-old male broiler chicks (Cobb500™) were randomly assigned into 2 groups with 5 replicates of 30 chicks each. From 21 to 42 days of age, one group was exposed to non-stressed condition at 24 °C and 50% relative humidity (control group), while the other group was exposed to heat stress at 35 °C and 50% relative humidity (HS group). At 42 days of age, blood samples were collected from each group to evaluate stress indicators, immune function, and leukocytes protein synthesis. Production performance was also recorded. Noteworthy, protein synthesis in leukocytes was significantly ( P < 0.05) inhibited in HS group by 38% compared to control group. In contrast, the phosphorylation level on threonine 56 site (Thr56) of eukaryotic elongation factor (eEF2), which indicates the suppression of protein translation process through altering the protein elongation phase, was significantly threefold higher in HS group than in control ( P < 0.05). In addition, an increase in stress indicators was markedly ( P < 0.05) presented in the HS birds by twofold increase in heterophil/lymphocyte (H/L) ratio and threefold increase in plasma corticosterone level compared to control. Furthermore, the immune function was significantly ( P < 0.05) suppressed in HS birds than control (0.99 vs. 1.88 mg/mL plasma IgG, 89.2 vs. 148.0 μg/mL plasma IgM, 4.80 vs. 7.20 antibody titer against SRBC, and 1.38 vs. 3.39 stimulation index of lymphocyte

HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.

Science.gov (United States)

Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael

2016-06-01

Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. Copyright © 2016 Elsevier Inc. All rights reserved.

Promoter methylation and expression of MGMT and the DNA mismatch repair genes MLH1, MSH2, MSH6 and PMS2 in paired primary and recurrent glioblastomas.

Science.gov (United States)

Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C

2011-08-01

Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

2012-01-13

Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

International Nuclear Information System (INIS)

Yang, Zhihong; Zhang, Yuxia; Wang, Li

2012-01-01

Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

TIM-family proteins promote infection of multiple enveloped viruses through virion-associated phosphatidylserine.

Directory of Open Access Journals (Sweden)

Stephanie Jemielity

2013-03-01

Full Text Available Human T-cell Immunoglobulin and Mucin-domain containing proteins (TIM1, 3, and 4 specifically bind phosphatidylserine (PS. TIM1 has been proposed to serve as a cellular receptor for hepatitis A virus and Ebola virus and as an entry factor for dengue virus. Here we show that TIM1 promotes infection of retroviruses and virus-like particles (VLPs pseudotyped with a range of viral entry proteins, in particular those from the filovirus, flavivirus, New World arenavirus and alphavirus families. TIM1 also robustly enhanced the infection of replication-competent viruses from the same families, including dengue, Tacaribe, Sindbis and Ross River viruses. All interactions between TIM1 and pseudoviruses or VLPs were PS-mediated, as demonstrated with liposome blocking and TIM1 mutagenesis experiments. In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1. Finally, the blocking of PS receptors on macrophages inhibited the entry of Ebola VLPs, suggesting that PS receptors can contribute to infection in physiologically relevant cells. Notably, infection mediated by the entry proteins of Lassa fever virus, influenza A virus and SARS coronavirus was largely unaffected by TIM1 expression. Taken together our data show that TIM1 and related PS-binding proteins promote infection of diverse families of enveloped viruses, and may therefore be useful targets for broad-spectrum antiviral therapies.

ETS1 mediates MEK1/2-dependent overexpression of cancerous inhibitor of protein phosphatase 2A (CIP2A in human cancer cells.

Directory of Open Access Journals (Sweden)

Anchit Khanna

2011-03-01

Full Text Available EGFR-MEK-ERK signaling pathway has an established role in promoting malignant growth and disease progression in human cancers. Therefore identification of transcriptional targets mediating the oncogenic effects of the EGFR-MEK-ERK pathway would be highly relevant. Cancerous inhibitor of protein phosphatase 2A (CIP2A is a recently characterized human oncoprotein. CIP2A promotes malignant cell growth and is over expressed at high frequency (40-80% in most of the human cancer types. However, the mechanisms inducing its expression in cancer still remain largely unexplored. Here we present systematic analysis of contribution of potential gene regulatory mechanisms for high CIP2A expression in cancer. Our data shows that evolutionary conserved CpG islands at the proximal CIP2A promoter are not methylated both in normal and cancer cells. Furthermore, sequencing of the active CIP2A promoter region from altogether seven normal and malignant cell types did not reveal any sequence alterations that would increase CIP2A expression specifically in cancer cells. However, treatment of cancer cells with various signaling pathway inhibitors revealed that CIP2A mRNA expression was sensitive to inhibition of EGFR activity as well as inhibition or activation of MEK-ERK pathway. Moreover, MEK1/2-specific siRNAs decreased CIP2A protein expression. Series of CIP2A promoter-luciferase constructs were created to identify proximal -27 to -107 promoter region responsible for MEK-dependent stimulation of CIP2A expression. Additional mutagenesis and chromatin immunoprecipitation experiments revealed ETS1 as the transcription factor mediating stimulation of CIP2A expression through EGFR-MEK pathway. Thus, ETS1 is probably mediating high CIP2A expression in human cancers with increased EGFR-MEK1/2-ERK pathway activity. These results also suggest that in addition to its established role in invasion and angiogenesis, ETS1 may support malignant cellular growth via regulation of

Reduced MeCP2 expression is frequent in autism frontal cortex and correlates with aberrant MECP2 promoter methylation.

Science.gov (United States)

Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M

2006-01-01

Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.

Highly active promoters and native secretion signals for protein production during extremely low growth rates in Aspergillus niger.

Science.gov (United States)

Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera

2016-08-20

The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.

Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

Science.gov (United States)

Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

2016-09-01

Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

Promoter- and cell-specific epigenetic regulation of CD44, Cyclin D2, GLIPR1 and PTEN by Methyl-CpG binding proteins and histone modifications

Directory of Open Access Journals (Sweden)

Schwarzenbach Heidi

2010-06-01

Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one

Translation of both 5'TOP and non-TOP host mRNAs continues into the late phase of Baculovirus infection

NARCIS (Netherlands)

Oers, van M.M.; Doitsidou, M.; Thomas, A.A.M.; Maagd, de R.A.; Vlak, J.M.

2003-01-01

Complete cDNA sequences were obtained for ribosomal protein (rp) L15 and eukaryotic initiation factor eIF2 from the lepidopteran insect Spodoptera frugiperda, and for elongation factor eEF2 from S. exigua. The presence of a 5' terminal oligopyrimidine (TOP) tract classified the lepidopteran rpL15

Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

Science.gov (United States)

Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela

2014-01-01

Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

Directory of Open Access Journals (Sweden)

Inga Hinrichsen

Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer.

Science.gov (United States)

Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing

2017-03-01

Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in

Increased protein-energy intake promotes anabolism in critically ill infants with viral bronchiolitis: a double‑blind randomised controlled trial

Science.gov (United States)

de Betue, Carlijn T; van Waardenburg, Dick A; Deutz, Nicolaas E; van Eijk, Hans M; van Goudoever, Johannes B; Luiking, Yvette C; Zimmermann, Luc J; Joosten, Koen F

2011-01-01

Objective The preservation of nutritional status and growth is an important aim in critically ill infants, but difficult to achieve due to the metabolic stress response and inadequate nutritional intake, leading to negative protein balance. This study investigated whether increasing protein and energy intakes can promote anabolism. The primary outcome was whole body protein balance, and the secondary outcome was first pass splanchnic phenylalanine extraction (SPEPhe). Design This was a double-blind randomised controlled trial. Infants (n=18) admitted to the paediatric intensive care unit with respiratory failure due to viral bronchiolitis were randomised to continuous enteral feeding with protein and energy enriched formula (PE-formula) (n=8; 3.1±0.3 g protein/kg/24 h, 119±25 kcal/kg/24 h) or standard formula (S-formula) (n=10; 1.7±0.2 g protein/kg/24 h, 84±15 kcal/kg/24 h; equivalent to recommended intakes for healthy infants <6 months). A combined intravenous-enteral phenylalanine stable isotope protocol was used on day 5 after admission to determine whole body protein metabolism and SPEPhe. Results Protein balance was significantly higher with PE-formula than with S-formula (PE-formula: 0.73±0.5 vs S-formula: 0.02±0.6 g/kg/24 h) resulting from significantly increased protein synthesis (PE-formula: 9.6±4.4, S-formula: 5.2±2.3 g/kg/24 h), despite significantly increased protein breakdown (PE-formula: 8.9±4.3, S-formula: 5.2±2.6 g/kg/24 h). SPEPhe was not statistically different between the two groups (PE-formula: 39.8±18.3%, S-formula: 52.4±13.6%). Conclusions Increasing protein and energy intakes promotes protein anabolism in critically ill infants in the first days after admission. Since this is an important target of nutritional support, increased protein and energy intakes should be preferred above standard intakes in these infants. Dutch Trial Register number: NTR 515. PMID:21673183

OsLOL1, a C2C2-type zinc finger protein, interacts with OsbZIP58 to promote seed germination through the modulation of gibberellin biosynthesis in Oryza sativa.

Science.gov (United States)

Wu, Jiahe; Zhu, Chuanfeng; Pang, Jinhuan; Zhang, Xiangrong; Yang, Chunlin; Xia, Guixian; Tian, Yingchuan; He, Chaozu

2014-12-01

Seed germination is a key developmental process in the plant life cycle that is influenced by various environmental cues and phytohormones through gene expression and a series of metabolism pathways. In the present study, we investigated a C2C2-type finger protein, OsLOL1, which promotes gibberellin (GA) biosynthesis and affects seed germination in Oryza sativa (rice). We used OsLOL1 antisense and sense transgenic lines to explore OsLOL1 functions. Seed germination timing in antisense plants was restored to wild type when exogenous GA3 was applied. The reduced expression of the GA biosynthesis gene OsKO2 and the accumulation of ent-kaurene were observed during germination in antisense plants. Based on yeast two-hybrid and firefly luciferase complementation analyses, OsLOL1 interacted with the basic leucine zipper protein OsbZIP58. The results from electrophoretic mobility shift and dual-luciferase reporter assays showed that OsbZIP58 binds the G-box cis-element of the OsKO2 promoter and activates LUC reporter gene expression, and that interaction between OsLOL1 and OsbZIP58 activates OsKO2 gene expression. In addition, OsLOL1 decreased SOD1 gene expression and accelerated programmed cell death (PCD) in the aleurone layer of rice grains. These findings demonstrate that the interaction between OsLOL1 and OsbZIP58 influences GA biosynthesis through the activation of OsKO2 via OsbZIP58, thereby stimulating aleurone PCD and seed germination. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Understanding the Fate of Applied Nitrogen in Pine Plantations of the Southeastern United States Using 15N Enriched Fertilizers

Directory of Open Access Journals (Sweden)

Jay E. Raymond

2016-11-01

Full Text Available This study was conducted to determine the efficacy of using enhanced efficiency fertilizer (EEFs products compared to urea to improve fertilizer nitrogen use efficiency (FNUE in forest plantations. All fertilizer treatments were labeled with 15N (0.5 atom percent and applied to 100 m2 circular plots at 12 loblolly pine stands (Pinus taeda L. across the southeastern United States. Total fertilizer N recovery for fertilizer treatments was determined by sampling all primary ecosystem components and using a mass balance calculation. Significantly more fertilizer N was recovered for all EEFs compared to urea, but there were generally no differences among EEFs. The total fertilizer N ecosystem recovery ranged from 81.9% to 84.2% for EEFs compared to 65.2% for urea. The largest amount of fertilizer N recovered for all treatments was in the loblolly pine trees (EEFs: 38.5%–49.9%, urea: 34.8% and soil (EEFs: 30.6%–38.8%, urea: 28.4%. This research indicates that a greater ecosystem fertilizer N recovery for EEFs compared to urea in southeastern pine plantations can potentially lead to increased FNUE in these systems.

Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

Directory of Open Access Journals (Sweden)

Deepti Jain

Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

Phorbol ester tumor promoter induced the synthesis of two major cytoplasmic proteins: identity with two proteins induced under heat-shocked and glucose-starved conditions

International Nuclear Information System (INIS)

Zhang, H.; Chen, K.Y.; Liu, A.Y.C.

1987-01-01

The regulation of specific protein synthesis by the phorbol ester tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), was evaluated using the L-8 and C-2 myoblast and the 3T3-L1 fibroblast cell cultures. TPA increased, by 2-4 fold, the synthesis rates of two cytoplasmic proteins with apparent molecular weights of 89,000 and 74,000 as determined by SDS-polyacrylamide gel electrophoresis and autoradiography. The concentration of TPA and the time of incubation needed to elicit this induction was determined to be 10 μg/ml and 20 hrs, respectively. Increasing the concentration of TPA to 100, 200, and 500 ng/ml did not result in a greater magnitude of induction. The possibility that these two TPA-induced proteins may be identical to proteins with similar molecular weights induced under heat-shocked or glucose-starved conditions was evaluated by 1-D and 2-D gel electrophoresis and autoradiography. Results provided evidence that the TPA-induced 89,000- and 74,000-dalton proteins were identical to hsp 89 and hsp 74, 2 out of a set of 8-9 proteins induced under heat shocked conditions. Furthermore, they are identical to two of the set of glucose-regulated proteins induced under a glucose-starved condition

Endoplasmic reticulum proteins SDF2 and SDF2L1 act as components of the BiP chaperone cycle to prevent protein aggregation.

Science.gov (United States)

Fujimori, Tsutomu; Suno, Ryoji; Iemura, Shun-Ichiro; Natsume, Tohru; Wada, Ikuo; Hosokawa, Nobuko

2017-08-01

The folding of newly synthesized proteins in the endoplasmic reticulum (ER) is assisted by ER-resident chaperone proteins. BiP (immunoglobulin heavy-chain-binding protein), a member of the HSP70 family, plays a central role in protein quality control. The chaperone function of BiP is regulated by its intrinsic ATPase activity, which is stimulated by ER-resident proteins of the HSP40/DnaJ family, including ERdj3. Here, we report that two closely related proteins, SDF2 and SDF2L1, regulate the BiP chaperone cycle. Both are ER-resident, but SDF2 is constitutively expressed, whereas SDF2L1 expression is induced by ER stress. Both luminal proteins formed a stable complex with ERdj3 and potently inhibited the aggregation of different types of misfolded ER cargo. These proteins associated with non-native proteins, thus promoting the BiP-substrate interaction cycle. A dominant-negative ERdj3 mutant that inhibits the interaction between ERdj3 and BiP prevented the dissociation of misfolded cargo from the ERdj3-SDF2L1 complex. Our findings indicate that SDF2 and SDF2L1 associate with ERdj3 and act as components in the BiP chaperone cycle to prevent the aggregation of misfolded proteins, partly explaining the broad folding capabilities of the ER under various physiological conditions. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

International Nuclear Information System (INIS)

Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

1987-01-01

The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

Science.gov (United States)

Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

2016-05-17

Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Modulation of Epstein–Barr Virus Nuclear Antigen 2-dependent transcription by protein arginine methyltransferase 5

International Nuclear Information System (INIS)

Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih; Zhao, Bo; Kieff, Elliott; Peng, Chih-Wen

2013-01-01

Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection

Modulation of Epstein–Barr Virus Nuclear Antigen 2-dependent transcription by protein arginine methyltransferase 5

Energy Technology Data Exchange (ETDEWEB)

Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China); Zhao, Bo; Kieff, Elliott [Department of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, 181 Longwood Ave., Boston 02115, MA (United States); Peng, Chih-Wen, E-mail: pengcw@mail.tcu.edu.tw [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China)

2013-01-18

Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection.

Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

Directory of Open Access Journals (Sweden)

Zhang Hua

2006-08-01

Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

Quantitative Non-canonical Amino Acid Tagging (QuaNCAT) Proteomics Identifies Distinct Patterns of Protein Synthesis Rapidly Induced by Hypertrophic Agents in Cardiomyocytes, Revealing New Aspects of Metabolic Remodeling*

Science.gov (United States)

Liu, Rui; Kenney, Justin W.; Manousopoulou, Antigoni; Johnston, Harvey E.; Kamei, Makoto; Woelk, Christopher H.; Xie, Jianling; Schwarzer, Michael; Proud, Christopher G.

2016-01-01

properties, so this finding indicates it may be involved in metabolic remodeling and also serve as a novel candidate biomarker. Levels of translation factor eEF1 also increased during TAC, likely contributing to faster cell mass accumulation. Interestingly those two candidates were not up-regulated in pregnancy or exercise induced CH, indicating PKM2 and eEF1 were pathological CH specific markers. We anticipate that the methodologies described here will be valuable for other researchers studying protein synthesis in primary cells. PMID:27512079

Isolation of a novel promoter for efficient protein expression by Aspergillus oryzae in solid-state culture.

Science.gov (United States)

Bando, Hiroki; Hisada, Hiromoto; Ishida, Hiroki; Hata, Yoji; Katakura, Yoshio; Kondo, Akihiko

2011-11-01

A novel promoter from a hemolysin-like protein encoding the gene, hlyA, was characterized for protein overexpression in Aspergillus oryzae grown in solid-state culture. Using endo-1,4-β-glucanase from A. oryzae (CelA) as the reporter, promoter activity was found to be higher than that of the α-amylase (amyA) and manganese superoxide dismutase (sodM) genes not only in wheat bran solid-state culture but also in liquid culture. Expression of the A. oryzae endoglucanase CelB and two heterologous endoglucanases (TrEglI and TrEglIII from Trichoderma reesei) under the control of the hlyA promoter were also found to be stronger than under the control of the amyA promoter in A. oryzae grown in wheat bran solid-state culture, suggesting that the hlyA promoter may be useful for the overproduction of other proteins as well. In wheat bran solid-state culture, the productivity of the hlyA promoter in terms of protein produced was high when the cultivation temperature was 30°C or 37°C, when the water content was 0.6 or 0.8 ml/g wheat bran, and from 48 to 72 h after inoculation. Because A. oryzae sporulated actively under these conditions and because hemolysin has been reported to play a role in fungal fruiting body formation, high-level expression of hlyA may be related to sporulation.

Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

International Nuclear Information System (INIS)

Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

2005-01-01

Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

Carcinoma associated fibroblasts (CAFs) promote breast cancer motility by suppressing mammalian Diaphanous-related formin-2 (mDia2).

Science.gov (United States)

Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M

2018-01-01

The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.

Transition of Plasmodium sporozoites into liver stage-like forms is regulated by the RNA binding protein Pumilio

KAUST Repository

Gomes-Santos, Carina S. S.

2011-05-19

Many eukaryotic developmental and cell fate decisions that are effected post-transcriptionally involve RNA binding proteins as regulators of translation of key mRNAs. In malaria parasites (Plasmodium spp.), the development of round, non-motile and replicating exo-erythrocytic liver stage forms from slender, motile and cell-cycle arrested sporozoites is believed to depend on environmental changes experienced during the transmission of the parasite from the mosquito vector to the vertebrate host. Here we identify a Plasmodium member of the RNA binding protein family PUF as a key regulator of this transformation. In the absence of Pumilio-2 (Puf2) sporozoites initiate EEF development inside mosquito salivary glands independently of the normal transmission-associated environmental cues. Puf2- sporozoites exhibit genome-wide transcriptional changes that result in loss of gliding motility, cell traversal ability and reduction in infectivity, and, moreover, trigger metamorphosis typical of early Plasmodium intra-hepatic development. These data demonstrate that Puf2 is a key player in regulating sporozoite developmental control, and imply that transformation of salivary gland-resident sporozoites into liver stage-like parasites is regulated by a post-transcriptional mechanism. 2011 Gomes-Santos et al.

Inhibition of SNW1 association with spliceosomal proteins promotes apoptosis in breast cancer cells

International Nuclear Information System (INIS)

Sato, Naoki; Maeda, Masao; Sugiyama, Mai; Ito, Satoko; Hyodo, Toshinori; Masuda, Akio; Tsunoda, Nobuyuki; Kokuryo, Toshio; Hamaguchi, Michinari; Nagino, Masato; Senga, Takeshi

2015-01-01

RNA splicing is a fundamental process for protein synthesis. Recent studies have reported that drugs that inhibit splicing have cytotoxic effects on various tumor cell lines. In this report, we demonstrate that depletion of SNW1, a component of the spliceosome, induces apoptosis in breast cancer cells. Proteomics and biochemical analyses revealed that SNW1 directly associates with other spliceosome components, including EFTUD2 (Snu114) and SNRNP200 (Brr2). The SKIP region of SNW1 interacted with the N-terminus of EFTUD2 as well as two independent regions in the C-terminus of SNRNP200. Similar to SNW1 depletion, knockdown of EFTUD2 increased the numbers of apoptotic cells. Furthermore, we demonstrate that exogenous expression of either the SKIP region of SNW1 or the N-terminus region of EFTUD2 significantly promoted cellular apoptosis. Our results suggest that the inhibition of SNW1 or its associating proteins may be a novel therapeutic strategy for cancer treatment

Tropomyosin Promotes Lamellipodial Persistence by Collaborating with Arp2/3 at the Leading Edge.

Science.gov (United States)

Brayford, Simon; Bryce, Nicole S; Schevzov, Galina; Haynes, Elizabeth M; Bear, James E; Hardeman, Edna C; Gunning, Peter W

2016-05-23

At the leading edge of migrating cells, protrusion of the lamellipodium is driven by Arp2/3-mediated polymerization of actin filaments [1]. This dense, branched actin network is promoted and stabilized by cortactin [2, 3]. In order to drive filament turnover, Arp2/3 networks are remodeled by proteins such as GMF, which blocks the actin-Arp2/3 interaction [4, 5], and coronin 1B, which acts by directing SSH1L to the lamellipodium where it activates the actin-severing protein cofilin [6, 7]. It has been shown in vitro that cofilin-mediated severing of Arp2/3 actin networks results in the generation of new pointed ends to which the actin-stabilizing protein tropomyosin (Tpm) can bind [8]. The presence of Tpm in lamellipodia, however, is disputed in the literature [9-19]. Here, we report that the Tpm isoforms 1.8/9 are enriched in the lamellipodium of fibroblasts as detected with a novel isoform-specific monoclonal antibody. RNAi-mediated silencing of Tpm1.8/9 led to an increase of Arp2/3 accumulation at the cell periphery and a decrease in the persistence of lamellipodia and cell motility, a phenotype consistent with cortactin- and coronin 1B-deficient cells [2, 7]. In the absence of coronin 1B or cofilin, Tpm1.8/9 protein levels are reduced while, conversely, inhibition of Arp2/3 with CK666 leads to an increase in Tpm1.8/9 protein. These findings establish a novel regulatory mechanism within the lamellipodium whereby Tpm collaborates with Arp2/3 to promote lamellipodial-based cell migration. Copyright © 2016 Elsevier Ltd. All rights reserved.

The 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide is a DnaK-like protein

DEFF Research Database (Denmark)

Birkelund, Svend; Lundemose, AG; Christiansen, Gunna

1990-01-01

,980-base-pair open reading frame revealed 94% homology with a 75-kilodalton protein from C. trachomatis serovar D and 57% homology with the DnaK proteins of E. coli and of Bacillus megaterium, while amino acid homology with human heat shock protein 70 (hsp70) was 42%. The promoter region was identified......The gene coding for the 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide has been cloned in Escherichia coli, and the nucleotide sequence has been determined. The cloned DNA fragment contained the coding region as well as the putative promoter. The deduced amino acid sequence of the 1...... by computer search and by primer extension of mRNA synthesized in recombinant E. coli. The promoter region which differed from the putative promoter region in serovar D was shown to be a mixed promoter type in which the -10 region showed a regular TATA box configuration while the -35 region showed high...

Complex folding and misfolding effects of deer-specific amino acid substitutions in the β2-α2 loop of murine prion protein

Science.gov (United States)

Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.

2015-10-01

The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.

Phosphatase control of 4E-BP1 phosphorylation state is central for glycolytic regulation of retinal protein synthesis.

Science.gov (United States)

Gardner, Thomas W; Abcouwer, Steven F; Losiewicz, Mandy K; Fort, Patrice E

2015-09-15

Control of protein synthesis in insulin-responsive tissues has been well characterized, but relatively little is known about how this process is regulated in nervous tissues. The retina exhibits a relatively high protein synthesis rate, coinciding with high basal Akt and metabolic activities, with the majority of retinal ATP being derived from aerobic glycolysis. We examined the dependency of retinal protein synthesis on the Akt-mTOR signaling and glycolysis using ex vivo rat retinas. Akt inhibitors significantly reduced retinal protein synthesis but did not affect glycolytic lactate production. Surprisingly, the glycolytic inhibitor 2-deoxyglucose (2-DG) markedly inhibited Akt1 and Akt3 activities, as well as protein synthesis. The effects of 2-DG, and 2-fluorodeoxyglucose (2-FDG) on retinal protein synthesis correlated with inhibition of lactate production and diminished ATP content, with all these effects reversed by provision of d-mannose. 2-DG treatment was not associated with increased AMPK, eEF2, or eIF2α phosphorylation; instead, it caused rapid dephosphorylation of 4E-BP1. 2-DG reduced total mTOR activity by 25%, but surprisingly, it did not reduce mTORC1 activity, as indicated by unaltered raptor-associated mTOR autophosphorylation and ribosomal protein S6 phosphorylation. Dephosphorylation of 4E-BP1 was largely prevented by inhibition of PP1/PP2A phosphatases with okadaic acid and calyculin A, and inhibition of PPM1 phosphatases with cadmium. Thus, inhibition of retinal glycolysis diminished Akt and protein synthesis coinciding with accelerated dephosphorylation of 4E-BP1 independently of mTORC1. These results demonstrate a novel mechanism regulating protein synthesis in the retina involving an mTORC1-independent and phosphatase-dependent regulation of 4E-BP1. Copyright © 2015 the American Physiological Society.

Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene

International Nuclear Information System (INIS)

Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo

2006-01-01

In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains

2'-5'-Oligoadenylate Synthetase-Like Protein Inhibits Respiratory Syncytial Virus Replication and Is Targeted by the Viral Nonstructural Protein 1.

Science.gov (United States)

Dhar, Jayeeta; Cuevas, Rolando A; Goswami, Ramansu; Zhu, Jianzhong; Sarkar, Saumendra N; Barik, Sailen

2015-10-01

2'-5'-Oligoadenylate synthetase-like protein (OASL) is an interferon-inducible antiviral protein. Here we describe differential inhibitory activities of human OASL and the two mouse OASL homologs against respiratory syncytial virus (RSV) replication. Interestingly, nonstructural protein 1 (NS1) of RSV promoted proteasome-dependent degradation of specific OASL isoforms. We conclude that OASL acts as a cellular antiviral protein and that RSV NS1 suppresses this function to evade cellular innate immunity and allow virus growth. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.

Directory of Open Access Journals (Sweden)

Xiaoming Wang

Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.

HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

Energy Technology Data Exchange (ETDEWEB)

Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com

2015-10-23

This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases

HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

International Nuclear Information System (INIS)

Tan, Yongsheng; Li, Yan

2015-01-01

This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1

Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

KAUST Repository

Alam, Tanvir

2014-10-02

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

FANCD2 Maintains Fork Stability in BRCA1/2-Deficient Tumors and Promotes Alternative End-Joining DNA Repair

Directory of Open Access Journals (Sweden)

Zeina Kais

2016-06-01

Full Text Available BRCA1/2 proteins function in homologous recombination (HR-mediated DNA repair and cooperate with Fanconi anemia (FA proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork.

Nickel and low CO2-controlled motility in Chlamydomonas through complementation of a paralyzed flagella mutant with chemically regulated promoters

Directory of Open Access Journals (Sweden)

Rosenbaum Joel L

2011-01-01

Full Text Available Abstract Background Chlamydomonas reinhardtii is a model system for the biology of unicellular green algae. Chemically regulated promoters, such as the nickel-inducible CYC6 or the low CO2-inducible CAH1 promoter, may prove useful for expressing, at precise times during its cell cycle, proteins with relevant biological functions, or complementing mutants in genes encoding such proteins. To this date, this has not been reported for the above promoters. Results We fused the CYC6 and CAH1 promoters to an HA-tagged RSP3 gene, encoding a protein of the flagellar radial spoke complex. The constructs were used for chemically regulated complementation of the pf14 mutant, carrying an ochre mutation in the RSP3 gene. 7 to 8% of the transformants showed cells with restored motility after induction with nickel or transfer to low CO2 conditions, but not in non-inducing conditions. Maximum complementation (5% motile cells was reached with very different kinetics (5-6 hours for CAH1, 48 hours for CYC6. The two inducible promoters drive much lower levels of RSP3 protein expression than the constitutive PSAD promoter, which shows almost complete rescue of motility. Conclusions To our knowledge, this is the first example of the use of the CYC6 or CAH1 promoters to perform a chemically regulated complementation of a Chlamydomonas mutant. Based on our data, the CYC6 and CAH1 promoters should be capable of fully complementing mutants in genes whose products exert their biological activity at low concentrations.

HAL-2 promotes homologous pairing during Caenorhabditis elegans meiosis by antagonizing inhibitory effects of synaptonemal complex precursors.

Science.gov (United States)

Zhang, Weibin; Miley, Natasha; Zastrow, Michael S; MacQueen, Amy J; Sato, Aya; Nabeshima, Kentaro; Martinez-Perez, Enrique; Mlynarczyk-Evans, Susanna; Carlton, Peter M; Villeneuve, Anne M

2012-01-01

During meiosis, chromosomes align with their homologous pairing partners and stabilize this alignment through assembly of the synaptonemal complex (SC). Since the SC assembles cooperatively yet is indifferent to homology, pairing and SC assembly must be tightly coordinated. We identify HAL-2 as a key mediator in this coordination, showing that HAL-2 promotes pairing largely by preventing detrimental effects of SC precursors (SYP proteins). hal-2 mutants fail to establish pairing and lack multiple markers of chromosome movement mediated by pairing centers (PCs), chromosome sites that link chromosomes to cytoplasmic microtubules through nuclear envelope-spanning complexes. Moreover, SYP proteins load inappropriately along individual unpaired chromosomes in hal-2 mutants, and markers of PC-dependent movement and function are restored in hal-2; syp double mutants. These and other data indicate that SYP proteins can impede pairing and that HAL-2 promotes pairing predominantly but not exclusively by counteracting this inhibition, thereby enabling activation and regulation of PC function. HAL-2 concentrates in the germ cell nucleoplasm and colocalizes with SYP proteins in nuclear aggregates when SC assembly is prevented. We propose that HAL-2 functions to shepherd SYP proteins prior to licensing of SC assembly, preventing untimely interactions between SC precursors and chromosomes and allowing sufficient accumulation of precursors for rapid cooperative assembly upon homology verification.

A single cysteine post-translational oxidation suffices to compromise globular proteins kinetic stability and promote amyloid formation

Directory of Open Access Journals (Sweden)

Patrizia Marinelli

2018-04-01

Full Text Available Oxidatively modified forms of proteins accumulate during aging. Oxidized protein conformers might act as intermediates in the formation of amyloids in age-related disorders. However, it is not known whether this amyloidogenic conversion requires an extensive protein oxidative damage or it can be promoted just by a discrete, localized post-translational modification of certain residues. Here, we demonstrate that the irreversible oxidation of a single free Cys suffices to severely perturb the folding energy landscape of a stable globular protein, compromise its kinetic stability, and lead to the formation of amyloids under physiological conditions. Experiments and simulations converge to indicate that this specific oxidation-promoted protein aggregation requires only local unfolding. Indeed, a large scale analysis indicates that many cellular proteins are at risk of undergoing this kind of deleterious transition; explaining how oxidative stress can impact cell proteostasis and subsequently lead to the onset of pathological states. Keywords: Protein oxidation, Protein misfolding, Protein aggregation, Oxidative stress, Post-translational modification

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

NARCIS (Netherlands)

Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

Direct inhibition of RNAse T2 expression by the HTLV-1 viral protein Tax.

Science.gov (United States)

Polakowski, Nicholas; Han, Hongjin; Lemasson, Isabelle

2011-08-01

Adult T-cell leukemia (ATL) is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1) infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP) assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development.

Direct Inhibition of RNAse T2 Expression by the HTLV-1 Viral Protein Tax

Directory of Open Access Journals (Sweden)

Isabelle Lemasson

2011-08-01

Full Text Available Adult T-cell leukemia (ATL is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1 infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development.

Isolation and characterization of an atypical LEA protein coding cDNA and its promoter from drought-tolerant plant Prosopis juliflora.

Science.gov (United States)

George, Suja; Usha, B; Parida, Ajay

2009-05-01

Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. Despite the wealth of information on abiotic stress and stress tolerance in plants, many aspects still remain unclear. Prosopis juliflora is a hardy plant reported to be tolerant to drought, salinity, extremes of soil pH, and heavy metal stress. In this paper, we report the isolation and characterization of the complementary DNA clone for an atypical late embryogenesis abundant (LEA) protein (Pj LEA3) and its putative promoter sequence from P. juliflora. Unlike typical LEA proteins, rich in glycine, Pj LEA3 has alanine as the most abundant amino acid followed by serine and shows an average negative hydropathy. Pj LEA3 is significantly different from other LEA proteins in the NCBI database and shows high similarity to indole-3 acetic-acid-induced protein ARG2 from Vigna radiata. Northern analysis for Pj LEA3 in P. juliflora leaves under 90 mM H2O2 stress revealed up-regulation of transcript at 24 and 48 h. A 1.5-kb fragment upstream the 5' UTR of this gene (putative promoter) was isolated and analyzed in silico. The possible reasons for changes in gene expression during stress in relation to the host plant's stress tolerance mechanisms are discussed.

Identification and function of leucine-rich repeat flightless-I-interacting protein 2 (LRRFIP2 in Litopenaeus vannamei.

Directory of Open Access Journals (Sweden)

Shuang Zhang

Full Text Available Leucine-rich repeat flightless-I-interacting protein 2 (LRRFIP2 is a myeloid differentiation factor 88-interacting protein with a positive regulatory function in toll-like receptor signaling. In this study, seven LRRFIP2 protein variants (LvLRRFIP2A-G were identified in Litopenaeus vannamei. All the seven LvLRRFIP2 protein variants encode proteins with a DUF2051 domain. LvLRRFIP2s were upregulated in hemocytes after challenged with lipopolysaccharide, poly I:C, CpG-ODN2006, Vibrio parahaemolyticus, Staphylococcus aureus, and white spot syndrome virus (WSSV. Dual-luciferase reporter assays in Drosophila Schneider 2 cells revealed that LvLRRFIP2 activates the promoters of Drosophila and shrimp AMP genes. The knockdown of LvLRRFIP2 by RNA interference resulted in higher cumulative mortality of L. vannamei upon V. parahaemolyticus but not S. aureus and WSSV infections. The expression of L. vannamei AMP genes were reduced by dsLvLRRFIP2 interference. These results indicate that LvLRRFIP2 has an important function in antibacterials via the regulation of AMP gene expression.

Multiple timescale analysis and factor analysis of energy ecological footprint growth in China 1953-2006

International Nuclear Information System (INIS)

Chen Chengzhong; Lin Zhenshan

2008-01-01

Scientific analysis of energy consumption and its influencing factors is of great importance for energy strategy and policy planning. The energy consumption in China 1953-2006 is estimated by applying the energy ecological footprint (EEF) method, and the fluctuation periods of annual China's per capita EEF (EEF cpc ) growth rate are analyzed with the empirical mode decomposition (EMD) method in this paper. EEF intensity is analyzed to depict energy efficiency in China. The main timescales of the 37 factors that affect the annual growth rate of EEF cpc are also discussed based on EMD and factor analysis methods. Results show three obvious undulation cycles of the annual growth rate of EEF cpc , i.e., 4.6, 14.4 and 34.2 years over the last 53 years. The analysis findings from the common synthesized factors of IMF1, IMF2 and IMF3 timescales of the 37 factors suggest that China's energy policy-makers should attach more importance to stabilizing economic growth, optimizing industrial structure, regulating domestic petroleum exploitation and improving transportation efficiency

Translation elongation factor 1A facilitates the assembly of the tombusvirus replicase and stimulates minus-strand synthesis.

OpenAIRE

Zhenghe Li; Judit Pogany; Steven Tupman; Anthony M Esposito; Terri Goss Kinzy; Peter D Nagy

2010-01-01

Replication of plus-strand RNA viruses depends on host factors that are recruited into viral replicase complexes. Previous studies showed that eukaryotic translation elongation factor (eEF1A) is one of the resident host proteins in the highly purified tombusvirus replicase complex. Using a random library of eEF1A mutants, we identified one mutant that decreased and three mutants that increased Tomato bushy stunt virus (TBSV) replication in a yeast model host. Additional in vitro assays with w...

Functional promoter variant in zinc finger protein 202 predicts severe atherosclerosis and ischemic heart disease

DEFF Research Database (Denmark)

Frikke-Schmidt, R.; Nordestgaard, Børge; Grande, Peer

2008-01-01

Objectives This study was designed to test the hypotheses that single nucleotide polymorphisms ( SNPs), in zinc finger protein 202 ( ZNF202), predict severe atherosclerosis and ischemic heart disease ( IHD). Background ZNF202 is a transcriptional repressor controlling promoter elements in genes...... involved in vascular maintenance and lipid metabolism. Methods We first determined genotype association for 9 ZNF202 SNPs with severe atherosclerosis ( ankle brachial index >0.7 vs. ...,998 controls. Finally, we determined whether g. -660A>G altered transcriptional activity of the ZNF202 promoter in vitro. Results Cross-sectionally, ZNF202 g. -660 GG versus AA homozygosity predicted an odds ratio for severe atherosclerosis of 2.01 ( 95% confidence interval [CI]: 1.34 to 3.01). Prospectively...

Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

Science.gov (United States)

Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

2015-04-01

The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter

Directory of Open Access Journals (Sweden)

Zhentao Yang

2017-05-01

Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

Protein kinase A antagonist inhibits β-catenin nuclear translocation, c-Myc and COX-2 expression and tumor promotion in ApcMin/+ mice

Directory of Open Access Journals (Sweden)

Brudvik Kristoffer W

2011-12-01

Full Text Available Abstract Background The adenomatous polyposis coli (APC protein is part of the destruction complex controlling proteosomal degradation of β-catenin and limiting its nuclear translocation, which is thought to play a gate-keeping role in colorectal cancer. The destruction complex is inhibited by Wnt-Frz and prostaglandin E2 (PGE2 - PI-3 kinase pathways. Recent reports show that PGE2-induced phosphorylation of β-catenin by protein kinase A (PKA increases nuclear translocation indicating two mechanisms of action of PGE2 on β-catenin homeostasis. Findings Treatment of ApcMin/+ mice that spontaneously develop intestinal adenomas with a PKA antagonist (Rp-8-Br-cAMPS selectively targeting only the latter pathway reduced tumor load, but not the number of adenomas. Immunohistochemical characterization of intestines from treated and control animals revealed that expression of β-catenin, β-catenin nuclear translocation and expression of the β-catenin target genes c-Myc and COX-2 were significantly down-regulated upon Rp-8-Br-cAMPS treatment. Parallel experiments in a human colon cancer cell line (HCT116 revealed that Rp-8-Br-cAMPS blocked PGE2-induced β-catenin phosphorylation and c-Myc upregulation. Conclusion Based on our findings we suggest that PGE2 act through PKA to promote β-catenin nuclear translocation and tumor development in ApcMin/+ mice in vivo, indicating that the direct regulatory effect of PKA on β-catenin nuclear translocation is operative in intestinal cancer.

Regulation of oxidative enzyme activity and eukaryotic elongation factor 2 in human skeletal muscle: influence of gender and exercise

DEFF Research Database (Denmark)

Roepstorff, Carsten; Schjerling, P.; Vistisen, Bodil

2005-01-01

AIM: To investigate gender-related differences in the responses of oxidative enzymes and eukaryotic elongation factor-2 (eEF2) to exercise. METHODS: The influence of exercise (90 min, 60%VO(2peak)) on citrate synthase (CS) and beta-hydroxyacyl-CoA dehydrogenase (HAD) activity and mRNA content...... expression and phosphorylation were unaffected by training status (NS). CONCLUSION: Basal transcriptional, translational, and/or post-translational control of CS and HAD seems to be gender-dependent. Also, gender differences in translation and/or post-translational protein modification of CS occur during...... not differ between females and males (NS). In females only, CS activity was enhanced (P differ between UT and ET but, nevertheless, CS activity was 56% higher in ET than in UT volunteers (P

Differentiation and injury-repair signals modulate the interaction of E2F and pRB proteins with novel target genes in keratinocytes.

Science.gov (United States)

Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina

2006-08-01

E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.

NSs protein of rift valley fever virus promotes posttranslational downregulation of the TFIIH subunit p62.

Science.gov (United States)

Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro

2011-07-01

Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus.

The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)

2012-11-02

Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.

Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia

International Nuclear Information System (INIS)

El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.

2009-01-01

Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.

Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum.

Science.gov (United States)

Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan

2016-03-10

Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a

Androgen signaling promotes translation of TMEFF2 in prostate cancer cells via phosphorylation of the α subunit of the translation initiation factor 2.

Directory of Open Access Journals (Sweden)

Ryan F Overcash

Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.

Glucose stimulates protein synthesis in skeletal muscle of neonatal pigs through an AMPK- and mTOR-independent process.

Science.gov (United States)

Jeyapalan, Asumthia S; Orellana, Renan A; Suryawan, Agus; O'Connor, Pamela M J; Nguyen, Hanh V; Escobar, Jeffery; Frank, Jason W; Davis, Teresa A

2007-08-01

Skeletal muscle protein synthesis is elevated in neonates in part due to an enhanced response to the rise in insulin and amino acids after eating. In vitro studies suggest that glucose plays a role in protein synthesis regulation. To determine whether glucose, independently of insulin and amino acids, is involved in the postprandial rise in skeletal muscle protein synthesis, pancreatic-substrate clamps were performed in neonatal pigs. Insulin secretion was inhibited with somatostatin and insulin was infused to reproduce fasting or fed levels, while glucose and amino acids were clamped at fasting or fed levels. Fractional protein synthesis rates and translational control mechanisms were examined. Raising glucose alone increased protein synthesis in fast-twitch glycolytic muscles but not in other tissues. The response in muscle was associated with increased phosphorylation of protein kinase B (PKB) and enhanced formation of the active eIF4E.eIF4G complex but no change in phosphorylation of AMP-activated protein kinase (AMPK), tuberous sclerosis complex 2 (TSC2), mammalian target of rapamycin (mTOR), 4E-binding protein-1 (4E-BP1), ribosomal protein S6 kinase (S6K1), or eukaryotic elongation factor 2 (eEF2). Raising glucose, insulin, and amino acids increased protein synthesis in most tissues. The response in muscle was associated with phosphorylation of PKB, mTOR, S6K1, and 4E-BP1 and enhanced eIF4E.eIF4G formation. The results suggest that the postprandial rise in glucose, independently of insulin and amino acids, stimulates protein synthesis in neonates, and this response is specific to fast-twitch glycolytic muscle and occurs by AMPK- and mTOR-independent pathways.

Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance

Directory of Open Access Journals (Sweden)

Xiaofei Jiang

2017-05-01

Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.

Nuclear localization of lymphocyte-specific protein tyrosine kinase (Lck) and its role in regulating LIM domain only 2 (Lmo2) gene

Energy Technology Data Exchange (ETDEWEB)

Venkitachalam, Srividya; Chueh, Fu-Yu [Department of Microbiology and Immunology, H. M. Bligh Cancer Research Laboratories, Chicago Medical School, Rosalind Franklin University of Medicine and Science, North Chicago, IL 60064 (United States); Yu, Chao-Lan, E-mail: chaolan.yu@rosalindfranklin.edu [Department of Microbiology and Immunology, H. M. Bligh Cancer Research Laboratories, Chicago Medical School, Rosalind Franklin University of Medicine and Science, North Chicago, IL 60064 (United States)

2012-01-20

Highlights: Black-Right-Pointing-Pointer Lmo2 expression is elevated in Lck-transformed cells. Black-Right-Pointing-Pointer Both endogenous and exogenous Lck localize in the nucleus. Black-Right-Pointing-Pointer Nuclear Lck is active in Lck-transformed cells. Black-Right-Pointing-Pointer Lck binds to the promoter region of Lmo2 gene in vivo. Black-Right-Pointing-Pointer In contrast to JAK2, Lck does not increase histone H3 phosphorylation on Tyr 41. -- Abstract: LIM domain only protein 2 (Lmo2) is a transcription factor that plays a critical role in the development of T-acute lymphoblastic leukemia (T-ALL). A previous report established a link between Lmo2 expression and the nuclear presence of oncogenic Janus kinase 2 (JAK2), a non-receptor protein tyrosine kinase. The oncogenic JAK2 kinase phosphorylates histone H3 on Tyr 41 that leads to the relief of Lmo2 promoter repression and subsequent gene expression. Similar to JAK2, constitutive activation of lymphocyte-specific protein tyrosine kinase (Lck) has been implicated in lymphoid malignancies. However, it is not known whether oncogenic Lck regulates Lmo2 expression through a similar mechanism. We show here that Lmo2 expression is significantly elevated in T cell leukemia LSTRA overexpressing active Lck kinase and in HEK 293 cells expressing oncogenic Y505FLck kinase. Nuclear localization of active Lck kinase was confirmed in both Lck-transformed cells by subcellular fractionation and immunofluorescence microscopy. More importantly, in contrast to oncogenic JAK2, oncogenic Lck kinase does not result in significant increase in histone H3 phosphorylation on Tyr 41. Instead, chromatin immunoprecipitation experiment shows that oncogenic Y505FLck kinase binds to the Lmo2 promoter in vivo. This result raises the possibility that oncogenic Lck may activate Lmo2 promoter through direct interaction.

MECP2 promoter methylation and X chromosome inactivation in autism.

Science.gov (United States)

Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

2008-06-01

Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

Directory of Open Access Journals (Sweden)

Luisina De Tullio

2017-10-01

Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

Penta- and octa-bromodiphenyl ethers promote proinflammatory protein expression in human bronchial epithelial cells in vitro.

Science.gov (United States)

Koike, Eiko; Yanagisawa, Rie; Takigami, Hidetaka; Takano, Hirohisa

2014-03-01

Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in consumer products. Humans can be exposed to PBDEs mainly through the inhalation of air or dust. Thus, PBDEs can affect respiratory and immune systems. In the present study, we investigated whether PBDEs stimulate bronchial epithelial cells. We examined commercial penta-BDE (DE-71), octa-BDE (DE-79), and deca-BDE (DE-83R). Human bronchial epithelial cells (BEAS-2B) were exposed to each PBDE for 24h. Subsequently, the expression of intercellular adhesion molecule-1 (ICAM-1) and proinflammatory cytokines were investigated. DE-71 and DE-79, but not DE-83R, significantly increased the expression of ICAM-1, interleukin-6 (IL-6), and IL-8 in BEAS-2B. Because these remarkable effects were observed with DE-71, we further investigated the underlying intracellular mechanisms. DE-71 promoted epidermal growth factor receptor (EGFR) phosphorylation. Inhibitors of EGFR-selective tyrosine kinase and p38 mitogen-activated protein kinase effectively blocked the increase of IL-6 and IL-8. Furthermore, antagonists of thyroid hormone receptor and aryl hydrocarbon receptor significantly suppressed the increase in IL-6 and/or IL-8 production. In conclusion, penta- and octa-BDE, but not deca-BDE, might promote the expression of proinflammatory proteins in bronchial epithelial cells possibly by activating protein kinases and/or stimulating nuclear receptors related to subsequent activation of transcriptional factors. Copyright © 2013 Elsevier Ltd. All rights reserved.

Performance of large electron energy filter in large volume plasma device

International Nuclear Information System (INIS)

Singh, S. K.; Srivastava, P. K.; Awasthi, L. M.; Mattoo, S. K.; Sanyasi, A. K.; Kaw, P. K.; Singh, R.

2014-01-01

This paper describes an in-house designed large Electron Energy Filter (EEF) utilized in the Large Volume Plasma Device (LVPD) [S. K. Mattoo, V. P. Anita, L. M. Awasthi, and G. Ravi, Rev. Sci. Instrum. 72, 3864 (2001)] to secure objectives of (a) removing the presence of remnant primary ionizing energetic electrons and the non-thermal electrons, (b) introducing a radial gradient in plasma electron temperature without greatly affecting the radial profile of plasma density, and (c) providing a control on the scale length of gradient in electron temperature. A set of 19 independent coils of EEF make a variable aspect ratio, rectangular solenoid producing a magnetic field (B x ) of 100 G along its axis and transverse to the ambient axial field (B z ∼ 6.2 G) of LVPD, when all its coils are used. Outside the EEF, magnetic field reduces rapidly to 1 G at a distance of 20 cm from the center of the solenoid on either side of target and source plasma. The EEF divides LVPD plasma into three distinct regions of source, EEF and target plasma. We report that the target plasma (n e ∼ 2 × 10 11  cm −3 and T e ∼ 2 eV) has no detectable energetic electrons and the radial gradients in its electron temperature can be established with scale length between 50 and 600 cm by controlling EEF magnetic field. Our observations reveal that the role of the EEF magnetic field is manifested by the energy dependence of transverse electron transport and enhanced transport caused by the plasma turbulence in the EEF plasma

The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex

International Nuclear Information System (INIS)

Nakagawa, Koji; Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie; Asaka, Masahiro; Takeda, Hiroshi; Kobayashi, Masanobu

2012-01-01

Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.

A synthetic arabinose-inducible promoter confers high levels of recombinant protein expression in hyperthermophilic archaeon Sulfolobus islandicus

DEFF Research Database (Denmark)

Peng, Nan; Deng, Ling; Mei, Yuxia

2012-01-01

Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...

Forkhead Box Protein C2 Promotes Epithelial-Mesenchymal Transition, Migration and Invasion in Cisplatin-Resistant Human Ovarian Cancer Cell Line (SKOV3/CDDP

Directory of Open Access Journals (Sweden)

Chanjuan Li

2016-08-01

Full Text Available Background/Aims: Forkhead Box Protein C2 (FOXC2 has been reported to be overexpressed in a variety of human cancers. However, it is unclear whether FOXC2 regulates epithelial-mesenchymal transition (EMT in CDDP-resistant ovarian cancer cells. The aim of this study is to investigate the effects of FOXC2 on EMT and invasive characteristics of CDDP-resistant ovarian cancer cells and the underlying molecular mechanism. Methods: MTT, Western blot, scratch wound healing, matrigel transwell invasion, attachment and detachment assays were performed to detect half maximal inhibitory concentration (IC50 of CDDP, expression of EMT-related proteins and invasive characteristics in CDDP-resistant ovarian cancer cell line (SKOV3/CDDP and its parental cell line (SKOV3. Small hairpin RNA (shRNA was used to knockdown FOXC2 and analyze the effect of FOXC2 knockdown on EMT and invasive characteristics of SKOV3/CDDP cells. Also, the effect of FOXC2 upregulation on EMT and invasive characteristics of SKOV3 cells was analyzed. Furthermore, the molecular mechanism underlying FOXC2-regulating EMT in ovarian cancer cells was determined. Results: Compared with parental SKOV3 cell line, SKOV3/CDDP showed higher IC50 of CDDP (43.26μM (PConclusions: Taken together, these data demonstrate that FOXC2 may be a promoter of EMT phenotype in CDDP-resistant ovarian cancer cells and a potential therapeutic target for the treatment of advanced ovarian cancer.

Matrilin-2, an extracellular adaptor protein, is needed for the regeneration of muscle, nerve and other tissues

Directory of Open Access Journals (Sweden)

Éva Korpos

2015-01-01

Full Text Available The extracellular matrix (ECM performs essential functions in the differentiation, maintenance and remodeling of tissues during development and regeneration, and it undergoes dynamic changes during remodeling concomitant to alterations in the cell-ECM interactions. Here we discuss recent data addressing the critical role of the widely expressed ECM protein, matrilin-2 (Matn2 in the timely onset of differentiation and regeneration processes in myogenic, neural and other tissues and in tumorigenesis. As a multiadhesion adaptor protein, it interacts with other ECM proteins and integrins. Matn2 promotes neurite outgrowth, Schwann cell migration, neuromuscular junction formation, skeletal muscle and liver regeneration and skin wound healing. Matn2 deposition by myoblasts is crucial for the timely induction of the global switch toward terminal myogenic differentiation during muscle regeneration by affecting transforming growth factor beta/bone morphogenetic protein 7/Smad and other signal transduction pathways. Depending on the type of tissue and the pathomechanism, Matn2 can also promote or suppress tumor growth.

Enteral β-hydroxy-β-methylbutyrate supplementation increases protein synthesis in skeletal muscle of neonatal pigs

Science.gov (United States)

Kao, Michelle; Columbus, Daniel A.; Suryawan, Agus; Steinhoff-Wagner, Julia; Hernandez-Garcia, Adriana; Nguyen, Hanh V.; Fiorotto, Marta L.

2016-01-01

Many low-birth weight infants are at risk for poor growth due to an inability to achieve adequate protein intake. Administration of the amino acid leucine stimulates protein synthesis in skeletal muscle of neonates. To determine the effects of enteral supplementation of the leucine metabolite β-hydroxy-β-methylbutyrate (HMB) on protein synthesis and the regulation of translation initiation and degradation pathways, overnight-fasted neonatal pigs were studied immediately (F) or fed one of five diets for 24 h: low-protein (LP), high-protein (HP), or LP diet supplemented with 4 (HMB4), 40 (HMB40), or 80 (HMB80) μmol HMB·kg body wt−1·day−1. Cell replication was assessed from nuclear incorporation of BrdU in the longissimus dorsi (LD) muscle and jejunum crypt cells. Protein synthesis rates in LD, gastrocnemius, rhomboideus, and diaphragm muscles, lung, and brain were greater in HMB80 and HP and in brain were greater in HMB40 compared with LP and F groups. Formation of the eIF4E·eIF4G complex and S6K1 and 4E-BP1 phosphorylation in LD, gastrocnemius, and rhomboideus muscles were greater in HMB80 and HP than in LP and F groups. Phosphorylation of eIF2α and eEF2 and expression of SNAT2, LAT1, MuRF1, atrogin-1, and LC3-II were unchanged. Numbers of BrdU-positive myonuclei in the LD were greater in HMB80 and HP than in the LP and F groups; there were no differences in jejunum. The results suggest that enteral supplementation with HMB increases skeletal muscle protein anabolism in neonates by stimulation of protein synthesis and satellite cell proliferation. PMID:27143558

Centrosomal protein 55 activates NF-?B signalling and promotes pancreatic cancer cells aggressiveness

OpenAIRE

Peng, Tao; Zhou, Wei; Guo, Feng; Wu, He-shui; Wang, Chun-you; Wang, Li; Yang, Zhi-yong

2017-01-01

Centrosomal protein 55 (CEP55) is a microtubule-bundling protein that participants in cell mitosis. It is overexpressed in several solid tumours and promotes the growth and invasion of cancer cells. However, the role of CEP55 in pancreatic cancer (PANC) remains unclear. Herein, upregulated expression of CEP55 (associated with poor prognosis) was detected in PANC using quantitative real-time reverse transcription PCR, western blotting, and immunohistochemistry. Cell migration, colony formation...

G protein-coupled receptor kinase-2 (GRK-2) regulates serotonin metabolism through the monoamine oxidase AMX-2 in Caenorhabditis elegans.

Science.gov (United States)

Wang, Jianjun; Luo, Jiansong; Aryal, Dipendra K; Wetsel, William C; Nass, Richard; Benovic, Jeffrey L

2017-04-07

G protein-coupled receptors (GPCRs) regulate many animal behaviors. GPCR signaling is mediated by agonist-promoted interactions of GPCRs with heterotrimeric G proteins, GPCR kinases (GRKs), and arrestins. To further elucidate the role of GRKs in regulating GPCR-mediated behaviors, we utilized the genetic model system Caenorhabditis elegans Our studies demonstrate that grk-2 loss-of-function strains are egg laying-defective and contain low levels of serotonin (5-HT) and high levels of the 5-HT metabolite 5-hydroxyindole acetic acid (5-HIAA). The egg laying defect could be rescued by the expression of wild type but not by catalytically inactive grk-2 or by the selective expression of grk-2 in hermaphrodite-specific neurons. The addition of 5-HT or inhibition of 5-HT metabolism also rescued the egg laying defect. Furthermore, we demonstrate that AMX-2 is the primary monoamine oxidase that metabolizes 5-HT in C. elegans , and we also found that grk-2 loss-of-function strains have abnormally high levels of AMX-2 compared with wild-type nematodes. Interestingly, GRK-2 was also found to interact with and promote the phosphorylation of AMX-2. Additional studies reveal that 5-HIAA functions to inhibit egg laying in a manner dependent on the 5-HT receptor SER-1 and the G protein GOA-1. These results demonstrate that GRK-2 modulates 5-HT metabolism by regulating AMX-2 function and that 5-HIAA may function in the SER-1 signaling pathway. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Breast regression protein-39 (BRP-39) promotes dendritic cell maturation in vitro and enhances Th2 inflammation in murine model of asthma.

Science.gov (United States)

Xu, Qian; Chai, Shou-jie; Qian, Ying-ying; Zhang, Min; Wang, Kai

2012-12-01

To determine the roles of breast regression protein-39 (BRP-39) in regulating dendritic cell maturation and in pathology of acute asthma. Mouse bone marrow-derived dendritic cells (BMDCs) were prepared, and infected with adenovirus over-expressing BRP-39. Ovalbumin (OVA)-induced murine model of acute asthma was made in female BALB/c mice by sensitizing and challenging with chicken OVA and Imject Alum. The transfected BMDCs were adoptively transferred into OVA-treated mice via intravenous injection. Airway hyperresponsiveness (AHR), inflammation and pulmonary histopathology were characterized. The expression of BRP-39 mRNA and protein was significantly increased in lung tissues of OVA-treated mice. The BMDCs infected with adenovirus BRP-39 exhibited greater maturation and higher activity in vitro. Adoptive transfer of the cells into OVA-treated mice significantly augmented OVA-induced AHR and eosinophilic inflammation. Meanwhile, BRP-39 further enhanced the production of OVA-induced Th2 cytokines IL-4, IL-5 and IL-13, but significantly attenuated OVA-induced IFN-γ production in bronchoalveolar lavage fluid. In OVA-induced murine model of acute asthma, BRP-39 is over-expressed in lung tissue and augments Th2 inflammatory response and AHR. BRP-39 promotes dendritic cell maturation in vitro. Therefore, BRP-39 may be a potential therapeutic target of asthma.

p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.

Science.gov (United States)

Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo

2005-04-10

The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.

Recombinant human bone morphogenetic protein-2 released from polyurethane-based scaffolds promotes early osteogenic differentiation of human mesenchymal stem cells

International Nuclear Information System (INIS)

Kim, Jinku; Hollinger, Jeffrey O

2012-01-01

The purposes of this study were to determine the pharmacokinetics of recombinant human bone morphogenetic protein-2 (rhBMP-2) from a polyurethane (PUR)-based porous scaffold and to determine the biological responses of human mesenchymal stem cells (hMSCs) to the rhBMP-2 released from those scaffolds. The rhBMP-2 was incorporated into the PUR three-dimensional (3D) porous scaffolds and release profiles were determined using enzyme-linked immunosorbent assay. The bioactivity of the rhBMP-2 containing releasates was determined using hMSCs and compared with exogenous rhBMP-2. Release of rhBMP-2 from PUR-based systems was bi-phasic and characterized by an initial burst followed by a sustained release for up to 21 days. Expression of alkaline phosphatase activity by hMSCs treated with the rhBMP-2 releasates was significantly greater than the cells alone (control) throughout the time periods. Furthermore, after 14 days of culture, the hMSCs cultured with rhBMP-2 releasate had a greater amount of mineralization compared to exogenous rhBMP-2. Overall, the rhBMP-2 release from the PUR-based scaffolds was sustained for 21 days and the releasates appeared to be bioactive and promoted earlier osteogenic differentiation and mineralization of hMSCs than the exogenous rhBMP-2. (paper)

SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK

Energy Technology Data Exchange (ETDEWEB)

Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States

2017-10-24

The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.

E2F1 promote the aggressiveness of human colorectal cancer by activating the ribonucleotide reductase small subunit M2

Energy Technology Data Exchange (ETDEWEB)

Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)

2015-08-21

As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and

The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.

Science.gov (United States)

Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique

2014-06-01

Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

BH3-only protein Bim inhibits activity of antiapoptotic members of Bcl-2 family when expressed in yeast.

Science.gov (United States)

Juhásová, Barbora; Mentel, Marek; Bhatia-Kiššová, Ingrid; Zeman, Igor; Kolarov, Jordan; Forte, Michael; Polčic, Peter

2011-09-02

Proteins of the Bcl-2 family regulate programmed cell death in mammals by promoting the release of cytochrome c from mitochondria in response to various proapoptotic stimuli. The mechanism by which BH3-only members of the family activate multidomain proapoptotic proteins Bax and Bak to form a pore in mitochondrial membranes remains under dispute. We report that cell death promoting activity of BH3-only protein Bim can be reconstituted in yeast when both Bax and antiapoptotic protein Bcl-X(L) are present, suggesting that Bim likely activates Bax indirectly by inhibiting antiapoptotic proteins. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Tailoring Escherichia coli for the L-rhamnose PBAD promoter-based production of membrane and secretory proteins

NARCIS (Netherlands)

Hjelm, Anna; Karyolaimos, Alexandros; Zhang, Zhe; Rujas, Edurne; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

Membrane and secretory protein production in Escherichia coli requires precisely controlled production rates to avoid the deleterious saturation of their biogenesis pathways. Based on this requirement, the E. coli L-rhamnose PBAD promoter (PrhaBAD) is often used for membrane and secretory protein

Cross-talk between amyloidogenic proteins in type-2 diabetes and Parkinson’s disease

OpenAIRE

Horvath, Istvan; Wittung-Stafshede, Pernilla

2016-01-01

Protein assembly into ordered so-called amyloid fibers is a process that promotes several neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). Also type-2 diabetes (T2D) is a disease involving amyloid formation, although it occurs in the pancreas. Since the protein that forms amyloids in PD, α-synuclein (aS), is also expressed in the pancreas, we investigated whether it could affect aggregation of the peptide involved in T2D, and vice versa. Using in vitro methods an...

Ursodeoxycholic acid reduces protein levels and nucleation-promoting activity in human gallbladder bile

NARCIS (Netherlands)

van Erpecum, K. J.; Portincasa, P.; Eckhardt, E.; Go, P. M.; vanBerge-Henegouwen, G. P.; Groen, A. K.

1996-01-01

Background & Aims: Ursodeoxycholic acid prevents gallstone formation in selected patients. The aim of this study was to examine whether decreased concentration and nucleation-promoting activity of various proteins contribute to this beneficial effect. Methods: Gallbladder bile of 13 patients with

Interaction of hepatocyte nuclear factors in transcriptional regulation of tissue specific hormonal expression of human multidrug resistance-associated protein 2 (abcc2)

International Nuclear Information System (INIS)

Qadri, Ishtiaq; Hu, L.-J.; Iwahashi, Mieko; Al-Zuabi, Subhi; Quattrochi, Linda C.; Simon, Francis R.

2009-01-01

Multidrug resistance-associated protein 2 (MRP2) (ABCC2) is an ATP-binding cassette membrane protein located primarily on apical surface of hepatocytes that mediates transport of conjugated xenobiotics and endogenous compounds into bile. MRP2 is highly expressed in hepatocytes, and at lower levels in small intestines, stomach and kidney. Previous reports have characterized mammalian MRP2 promoters, but none have established the molecular mechanism(s) involved in liver enriched expression. This study aims to investigate the mechanism of hepatic MRP2 regulation. A 2130 bp of MRP2 promoter was cloned from PAC-1 clone P108G1-7, to identify putative liver specific/hormone responsive functional DNA binding sites. Using deletion analysis, site specific mutagenesis and co-transfection studies, liver specific expression was determined. MRP2 promoter-LUC constructs were highly expressed in liver cell lines compared to non-liver cells. The region extending from - 3 to+ 458 bp of MRP2 promoter starting from AUG contained the potential binding sites for CAAATT box enhancer binding protein (C/EBP), hepatocytes nuclear factor 1, 3 and 4 (HNF1, HNF3, and HNF4. Only HNF1 and HNF4 co-transfection with MRP2 luciferase increased expression. Site specific mutational analysis of HNF1 binding site indicated an important role for HNF1α. HNF4α induction of MRP2 was independent of HNF1 binding site. C/EBP, HNF3, and HNF6 inhibited HNF1α while HNF4α induced MRP2 luciferase expression and glucocorticoids stimulated MRP2 expression. This study emphasizes the complex regulation of MRP2 with HNF1α and HNF4α playing a central role. The coordinated regulation of xenobiotic transporters and oxidative conjugation may determine the adaptive responses to cellular detoxification processes

DPL-1 DP, LIN-35 Rb and EFL-1 E2F act with the MCD-1 zinc-finger protein to promote programmed cell death in Caenorhabditis elegans.

Science.gov (United States)

Reddien, Peter W; Andersen, Erik C; Huang, Michael C; Horvitz, H Robert

2007-04-01

The genes egl-1, ced-9, ced-4, and ced-3 play major roles in programmed cell death in Caenorhabditis elegans. To identify genes that have more subtle activities, we sought mutations that confer strong cell-death defects in a genetically sensitized mutant background. Specifically, we screened for mutations that enhance the cell-death defects caused by a partial loss-of-function allele of the ced-3 caspase gene. We identified mutations in two genes not previously known to affect cell death, dpl-1 and mcd-1 (modifier of cell death). dpl-1 encodes the C. elegans homolog of DP, the human E2F-heterodimerization partner. By testing genes known to interact with dpl-1, we identified roles in cell death for four additional genes: efl-1 E2F, lin-35 Rb, lin-37 Mip40, and lin-52 dLin52. mcd-1 encodes a novel protein that contains one zinc finger and that is synthetically required with lin-35 Rb for animal viability. dpl-1 and mcd-1 act with efl-1 E2F and lin-35 Rb to promote programmed cell death and do so by regulating the killing process rather than by affecting the decision between survival and death. We propose that the DPL-1 DP, MCD-1 zinc finger, EFL-1 E2F, LIN-35 Rb, LIN-37 Mip40, and LIN-52 dLin52 proteins act together in transcriptional regulation to promote programmed cell death.

Adiponectin promotes hyaluronan synthesis along with increases in hyaluronan synthase 2 transcripts through an AMP-activated protein kinase/peroxisome proliferator-activated receptor-α-dependent pathway in human dermal fibroblasts

International Nuclear Information System (INIS)

Yamane, Takumi; Kobayashi-Hattori, Kazuo; Oishi, Yuichi

2011-01-01

Highlights: ► Adiponectin promotes hyaluronan synthesis along with an increase in HAS2 transcripts. ► Adiponectin also increases the phosphorylation of AMPK. ► A pharmacological activator of AMPK increases mRNA levels of PPARα and HAS2. ► Adiponectin-induced HAS2 mRNA expression is blocked by a PPARα antagonist. ► Adiponectin promotes hyaluronan synthesis via an AMPK/PPARα-dependent pathway. -- Abstract: Although adipocytokines affect the functions of skin, little information is available on the effect of adiponectin on the skin. In this study, we investigated the effect of adiponectin on hyaluronan synthesis and its regulatory mechanisms in human dermal fibroblasts. Adiponectin promoted hyaluronan synthesis along with an increase in the mRNA levels of hyaluronan synthase 2 (HAS2), which plays a primary role in hyaluronan synthesis. Adiponectin also increased the phosphorylation of AMP-activated protein kinase (AMPK). A pharmacological activator of AMPK, 5-aminoimidazole-4-carboxamide-1β-ribofuranoside (AICAR), increased mRNA levels of peroxisome proliferator-activated receptor-α (PPARα), which enhances the expression of HAS2 mRNA. In addition, AICAR increased the mRNA levels of HAS2. Adiponectin-induced HAS2 mRNA expression was blocked by GW6471, a PPARα antagonist, in a concentration-dependent manner. These results show that adiponectin promotes hyaluronan synthesis along with increases in HAS2 transcripts through an AMPK/PPARα-dependent pathway in human dermal fibroblasts. Thus, our study suggests that adiponectin may be beneficial for retaining moisture in the skin, anti-inflammatory activity, and the treatment of a variety of cutaneous diseases.

IN-MACA-MCC: Integrated Multiple Attractor Cellular Automata with Modified Clonal Classifier for Human Protein Coding and Promoter Prediction

Directory of Open Access Journals (Sweden)

Kiran Sree Pokkuluri

2014-01-01

Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.

Endoplasmic Reticulum Stress Induced Synthesis of a Novel Viral Factor Mediates Efficient Replication of Genotype-1 Hepatitis E Virus.

Directory of Open Access Journals (Sweden)

Vidya P Nair

2016-04-01

Full Text Available Hepatitis E virus (HEV causes acute hepatitis in many parts of the world including Asia, Africa and Latin America. Though self-limiting in normal individuals, it results in ~30% mortality in infected pregnant women. It has also been reported to cause acute and chronic hepatitis in organ transplant patients. Of the seven viral genotypes, genotype-1 virus infects humans and is a major public health concern in South Asian countries. Sporadic cases of genotype-3 and 4 infection in human and animals such as pigs, deer, mongeese have been reported primarily from industrialized countries. Genotype-5, 6 and 7 viruses are known to infect animals such as wild boar and camel, respectively. Genotype-3 and 4 viruses have been successfully propagated in the laboratory in mammalian cell culture. However, genotype-1 virus replicates poorly in mammalian cell culture and no other efficient model exists to study its life cycle. Here, we report that endoplasmic reticulum (ER stress promotes genotype-1 HEV replication by inducing cap-independent, internal initiation mediated translation of a novel viral protein (named ORF4. Importantly, ORF4 expression and stimulatory effect of ER stress inducers on viral replication is specific to genotype-1. ORF4 protein sequence is mostly conserved among genotype-1 HEV isolates and ORF4 specific antibodies were detected in genotype-1 HEV patient serum. ORF4 interacted with multiple viral and host proteins and assembled a protein complex consisting of viral helicase, RNA dependent RNA polymerase (RdRp, X, host eEF1α1 (eukaryotic elongation factor 1 isoform-1 and tubulinβ. In association with eEF1α1, ORF4 stimulated viral RdRp activity. Furthermore, human hepatoma cells that stably express ORF4 or engineered proteasome resistant ORF4 mutant genome permitted enhanced viral replication. These findings reveal a positive role of ER stress in promoting genotype-1 HEV replication and pave the way towards development of an efficient

The LIM-only protein FHL2 attenuates lung inflammation during bleomycin-induced fibrosis.

Directory of Open Access Journals (Sweden)

Abdulaleem Alnajar

Full Text Available Fibrogenesis is usually initiated when regenerative processes have failed and/or chronic inflammation occurs. It is characterised by the activation of tissue fibroblasts and dysregulated synthesis of extracellular matrix proteins. FHL2 (four-and-a-half LIM domain protein 2 is a scaffolding protein that interacts with numerous cellular proteins, regulating signalling cascades and gene transcription. It is involved in tissue remodelling and tumour progression. Recent data suggest that FHL2 might support fibrogenesis by maintaining the transcriptional expression of alpha smooth muscle actin and the excessive synthesis and assembly of matrix proteins in activated fibroblasts. Here, we present evidence that FHL2 does not promote bleomycin-induced lung fibrosis, but rather suppresses this process by attenuating lung inflammation. Loss of FHL2 results in increased expression of the pro-inflammatory matrix protein tenascin C and downregulation of the macrophage activating C-type lectin receptor DC-SIGN. Consequently, FHL2 knockout mice developed a severe and long-lasting lung pathology following bleomycin administration due to enhanced expression of tenascin C and impaired activation of inflammation-resolving macrophages.

G1/S-regulated E2F-containing protein complexes bind to the mouse thymidine kinase gene promoter

DEFF Research Database (Denmark)

Dou, Q P; Zhao, S; Levin, A H

1994-01-01

report that MT2 includes an E2F-like binding site (GTTCGCGGGCAAA), as shown by the following evidence. (i) MT2 bound specifically to an affinity-purified fusion human E2F protein. (ii) Both MT2 and an authentic E2F site (TTTCGCGCGCTTT) bound specifically to similar or identical nuclear protein complexes...... complexes were also investigated. Studies using specific antibodies revealed that p107, a retinoblastoma-like protein, was present in both E2F-G0/G1 and E2F.S, whereas cyclin E.cyclin A.cdk2 were only present in E2F.S complex(es). These data suggest that removal of the p107-containing E2F.G0/G1 complex...

Promoter polymorphisms in two overlapping 6p25 genes implicate mitochondrial proteins in cognitive deficit in schizophrenia.

LENUS (Irish Health Repository)

Jablensky, A

2011-10-04

In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.

Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation.

Science.gov (United States)

De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C

2017-10-17

Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

NSA2, a novel nucleolus protein regulates cell proliferation and cell cycle

International Nuclear Information System (INIS)

Zhang, Heyu; Ma, Xi; Shi, Taiping; Song, Quansheng; Zhao, Hongshan; Ma, Dalong

2010-01-01

NSA2 (Nop seven-associated 2) was previously identified in a high throughput screen of novel human genes associated with cell proliferation, and the NSA2 protein is evolutionarily conserved across different species. In this study, we revealed that NSA2 is broadly expressed in human tissues and cultured cell lines, and located in the nucleolus of the cell. Both of the putative nuclear localization signals (NLSs) of NSA2, also overlapped with nucleolar localization signals (NoLSs), are capable of directing nucleolar accumulation. Moreover, over-expression of the NSA2 protein promoted cell growth in different cell lines and regulated the G1/S transition in the cell cycle. SiRNA silencing of the NSA2 transcript attenuated the cell growth and dramatically blocked the cell cycle in G1/S transition. Our results demonstrated that NSA2 is a nucleolar protein involved in cell proliferation and cell cycle regulation.

The miR-599 promotes non-small cell lung cancer cell invasion via SATB2

International Nuclear Information System (INIS)

Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran

2017-01-01

MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.

An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein

International Nuclear Information System (INIS)

Janaki Ramaiah, M.; Parnaik, Veena K.

2006-01-01

Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif

Fragile X Proteins FMRP and FXR2P Control Synaptic GluA1 Expression and Neuronal Maturation via Distinct Mechanisms

Directory of Open Access Journals (Sweden)

Weixiang Guo

2015-06-01

Full Text Available Fragile X mental retardation protein (FMRP and its autosomal paralog FXR2P are selective neuronal RNA-binding proteins, and mice that lack either protein exhibit cognitive deficits. Although double-mutant mice display more severe learning deficits than single mutants, the molecular mechanism behind this remains unknown. In the present study, we discovered that FXR2P (also known as FXR2 is important for neuronal dendritic development. FMRP and FXR2P additively promote the maturation of new neurons by regulating a common target, the AMPA receptor GluA1, but they do so via distinct mechanisms: FXR2P binds and stabilizes GluA1 mRNA and enhances subsequent protein expression, whereas FMRP promotes GluA1 membrane delivery. Our findings unveil important roles for FXR2P and GluA1 in neuronal development, uncover a regulatory mechanism of GluA1, and reveal a functional convergence between fragile X proteins in neuronal development.

TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding

OpenAIRE

Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John?H.J.; Boulton, Simon?J.

2015-01-01

Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to?prevent catastrophic t-loop processing by structure-specific nucleases. We show that ...

Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

Science.gov (United States)

Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

2014-12-01

Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.

The LIKE system, a novel protein expression toolbox for Bacillus subtilis based on the liaI promoter

Science.gov (United States)

2012-01-01

Background Bacillus subtilis is a very important Gram-positive model organism of high biotechnological relevance, which is widely used as a host for the production of both secreted and cytoplasmic proteins. We developed a novel and efficient expression system, based on the liaI promoter (PliaI) from B. subtilis, which is under control of the LiaRS antibiotic-inducible two-component system. In the absence of a stimulus, this promoter is kept tightly inactive. Upon induction by cell wall antibiotics, it shows an over 100-fold increase in activity within 10 min. Results Based on these traits of PliaI, we developed a novel LiaRS-controlled gene expression system for B. subtilis (the “LIKE" system). Two expression vectors, the integrative pLIKE-int and the replicative pLIKE-rep, were constructed. To enhance the performance of the PliaI-derived system, site-directed mutagenesis was employed to optimize the ribosome binding site and alter its spacing to the initiation codon used for the translational fusion. The impact of these genetic modifications on protein production yield was measured using GFP as a model protein. Moreover, a number of tailored B. subtilis expression strains containing different markerless chromosomal deletions of the liaIH region were constructed to circumvent undesired protein production, enhance the positive autoregulation of the LiaRS system and thereby increase target gene expression strength from the PliaI promoter. Conclusions The LIKE protein expression system is a novel protein expression system, which offers a number of advantages over existing systems. Its major advantages are (i) a tightly switched-off promoter during exponential growth in the absence of a stimulus, (ii) a concentration-dependent activation of PliaI in the presence of suitable inducers, (iii) a very fast but transient response with a very high dynamic range of over 100-fold (up to 1,000-fold) induction, (iv) a choice from a range of well-defined, commercially available

NSs Protein of Rift Valley Fever Virus Promotes Posttranslational Downregulation of the TFIIH Subunit p62▿

Science.gov (United States)

Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro

2011-01-01

Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus. PMID:21543505

Overexpression Analysis of emv2 gene coding for Late Embryogenesis Abundant Protein from Vigna radiata (Wilczek

Directory of Open Access Journals (Sweden)

Rajesh S.

2008-10-01

Full Text Available Late embryogenesis abundant (LEA proteins are speculated to protect against water stress deficit in plants. An over expression system for mungbean late embryogenesis abundant protein, emv2 was constructed in a pET29a vector, designated pET-emv2 which is responsible for higher expression under the transcriptional/translational control of T7/lac promoter incorporated in the Escherichia coli BL21 (DE3.Induction protocol was optimized for pET recombinants harboring the target gene. Overexpressed EMV2 protein was purified to homogeneity and the protein profile monitored by SDS-PAGE.

Early Involvement of Death-Associated Protein Kinase Promoter Hypermethylation in the Carcinogenesis of Barrett's Esophageal Adenocarcinoma and Its Association with Clinical Progression

Directory of Open Access Journals (Sweden)

Doerthe Kuester

2007-03-01

Full Text Available Esophageal Barrett's adenocarcinoma (BA develops through a multistage process, which is associated with the transcriptional silencing of tumor-suppressor genes by promoter CpG island hypermethylation. In this study, we explored the promoter hypermethylation and protein expression of proapoptotic deathassociated protein kinase (DAPK during the multistep Barrett's carcinogenesis cascade. Early BA and paired samples of premalignant lesions of 61 patients were analyzed by methylation-specific polymerase chain reaction and immunohistochemistry. For the association of clinicopathological markers and protein expression, an immunohistochemical tissue microarray analysis of 66 additional BAs of advanced tumor stages was performed. Hypermethylation of DAPK promoter was detected in 20% of normal mucosa, 50% of Barrett's metaplasia, 53% of dysplasia, and 60% of adenocarcinomas, and resulted in a marked decrease in DAPK protein expression (P < .01. The loss of DAPK protein was significantly associated with advanced depth of tumor invasion and advanced tumor stages (P < .001. Moreover, the severity of reflux esophagitis correlated significantly with the hypermethylation rate of the DAPK promoter (P < .003. Thus, we consider DAPK inactivation by promoter hypermethylation as an early event in Barrett's carcinogenesis and suggest that a decreased protein expression of DAPK likely plays a role in the development and progression of BA.

Control of autogenous activation of Herbaspirillum seropedicae nifA promoter by the IHF protein.

Science.gov (United States)

Wassem, Roseli; Pedrosa, Fábio O; Yates, Marshall G; Rego, Fabiane G M; Chubatsu, Leda S; Rigo, Liu U; Souza, Emanuel M

2002-07-02

Analysis of the expression of the Herbaspirillum seropedicae nifA promoter in Escherichia coli and Herbaspirillum seropedicae, showed that nifA expression is primarily dependent on NtrC but also required NifA for maximal expression under nitrogen-fixing conditions. Deletion of the IHF (integration host factor)-binding site produced a promoter with two-fold higher activity than the native promoter in the H. seropedicae wild-type strain but not in a nifA strain, indicating that IHF controls NifA auto-activation. IHF is apparently required to prevent overexpression of the NifA protein via auto-activation under nitrogen-fixing conditions in H. seropedicae.

The stress protein BAG3 stabilizes Mcl-1 protein and promotes survival of cancer cells and resistance to antagonist ABT-737.

Science.gov (United States)

Boiani, Mariana; Daniel, Cristina; Liu, Xueyuan; Hogarty, Michael D; Marnett, Lawrence J

2013-03-08

Members of the Bcl-2 family of proteins are important inhibitors of apoptosis in human cancer and are targets for novel anticancer agents such as the Bcl-2 antagonists, ABT-263 (Navitoclax), and its analog ABT-737. Unlike Bcl-2, Mcl-1 is not antagonized by ABT-263 or ABT-737 and is considered to be a major factor in resistance. Also, Mcl-1 exhibits differential regulation when compared with other Bcl-2 family members and is a target for anticancer drug discovery. Here, we demonstrate that BAG3, an Hsp70 co-chaperone, protects Mcl-1 from proteasomal degradation, thereby promoting its antiapoptotic activity. Using neuroblastoma cell lines, with a defined Bcl-2 family dependence, we found that BAG3 expression correlated with Mcl-1 dependence and ABT-737 resistance. RNA silencing of BAG3 led to a marked reduction in Mcl-1 protein levels and overcame ABT-737 resistance in Mcl-1-dependent cells. In ABT-737-resistant cells, Mcl-1 co-immunoprecipitated with BAG3, and loss of Mcl-1 after BAG3 silencing was prevented by proteasome inhibition. BAG3 and Mcl-1 were co-expressed in a panel of diverse cancer cell lines resistant to ABT-737. Silencing BAG3 reduced Mcl-1 protein levels and overcame ABT-737 resistance in several of the cell lines, including triple-negative breast cancer (MDA-MB231) and androgen receptor-negative prostate cancer (PC3) cells. These studies identify BAG3-mediated Mcl-1 stabilization as a potential target for cancer drug discovery.

The Stress Protein BAG3 Stabilizes Mcl-1 Protein and Promotes Survival of Cancer Cells and Resistance to Antagonist ABT-737*

Science.gov (United States)

Boiani, Mariana; Daniel, Cristina; Liu, Xueyuan; Hogarty, Michael D.; Marnett, Lawrence J.

2013-01-01

Members of the Bcl-2 family of proteins are important inhibitors of apoptosis in human cancer and are targets for novel anticancer agents such as the Bcl-2 antagonists, ABT-263 (Navitoclax), and its analog ABT-737. Unlike Bcl-2, Mcl-1 is not antagonized by ABT-263 or ABT-737 and is considered to be a major factor in resistance. Also, Mcl-1 exhibits differential regulation when compared with other Bcl-2 family members and is a target for anticancer drug discovery. Here, we demonstrate that BAG3, an Hsp70 co-chaperone, protects Mcl-1 from proteasomal degradation, thereby promoting its antiapoptotic activity. Using neuroblastoma cell lines, with a defined Bcl-2 family dependence, we found that BAG3 expression correlated with Mcl-1 dependence and ABT-737 resistance. RNA silencing of BAG3 led to a marked reduction in Mcl-1 protein levels and overcame ABT-737 resistance in Mcl-1-dependent cells. In ABT-737-resistant cells, Mcl-1 co-immunoprecipitated with BAG3, and loss of Mcl-1 after BAG3 silencing was prevented by proteasome inhibition. BAG3 and Mcl-1 were co-expressed in a panel of diverse cancer cell lines resistant to ABT-737. Silencing BAG3 reduced Mcl-1 protein levels and overcame ABT-737 resistance in several of the cell lines, including triple-negative breast cancer (MDA-MB231) and androgen receptor-negative prostate cancer (PC3) cells. These studies identify BAG3-mediated Mcl-1 stabilization as a potential target for cancer drug discovery. PMID:23341456

An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.

Science.gov (United States)

Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B

2017-03-01

Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.

The moderate essential amino acid restriction entailed by low-protein vegan diets may promote vascular health by stimulating FGF21 secretion.

Science.gov (United States)

McCarty, Mark F

2016-02-12

The serum total and LDL cholesterol levels of long-term vegans tend to be very low. The characteristically low ratio of saturated to unsaturated fat in vegan diets, and the absence of cholesterol in such diets, clearly contribute to this effect. But there is reason to suspect that the quantity and composition of dietary protein also play a role in this regard. Vegan diets of moderate protein intake tend to be relatively low in certain essential amino acids, and as a result may increase hepatic activity of the kinase GCN2, which functions as a gauge of amino acid status. GCN2 activation boosts the liver's production of fibroblast growth factor 21 (FGF21), a factor which favorably affects serum lipids and metabolic syndrome. The ability of FGF21 to decrease LDL cholesterol has now been traced to at least two mechanisms: a suppression of hepatocyte expression of sterol response element-binding protein-2 (SREBP-2), which in turn leads to a reduction in cholesterol synthesis; and up-regulated expression of hepatocyte LDL receptors, reflecting inhibition of a mechanism that promotes proteasomal degradation of these receptors. In mice, the vascular benefits of FGF21 are also mediated by favorable effects on adipocyte function - most notably, increased adipocyte secretion of adiponectin, which directly exerts anti-inflammatory effects on the vasculature which complement the concurrent reduction in LDL particles in preventing or reversing atherosclerosis. If, as has been proposed, plant proteins preferentially stimulate glucagon secretion owing to their amino acid composition, this would represent an additional mechanism whereby plant protein promotes FGF21 activity, as glucagon acts on the liver to boost transcription of the FGF21 gene.

Kinetics of activation of the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein.

Science.gov (United States)

Hoggett, J G; Brierley, I

1992-11-01

The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid.

The Role of Protein Elongation Factor eEF1A2 in Breast Cancer

Science.gov (United States)

2006-09-01

apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al

Vitamin K2 promotes mesenchymal stem cell differentiation by inhibiting miR‑133a expression.

Science.gov (United States)

Zhang, Yuelei; Weng, Shiyang; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, Youshui

2017-05-01

Vitamin K2 has been demonstrated to promote the osteogenic differentiation of mesenchymal stem cells; however, the mechanisms underlying this effect remain unclear. As microRNA (miR)‑133a has been identified as a negative regulator of osteogenic differentiation, the present study hypothesized that vitamin K2 promoted osteogenesis by inhibiting miR‑133a. Using human bone marrow stromal cells (hBMSCs) overexpressing miR‑133a, or a control, the expression levels of osteogenesis‑associated proteins, including runt‑related transcription factor 2, alkaline phosphatase and osteocalcin, were analyzed. miR‑133a significantly suppressed the osteogenic differentiation of hBMSCs. To determine the effect of vitamin K2 on miR‑133a expression and osteogenesis, hBMSCs were treated with vitamin K2. Vitamin K2 inhibited miR‑133a expression, which was accompanied by enhanced osteogenic differentiation. Furthermore, the expression levels of vitamin K epoxide reductase complex subunit 1, the key protein in γ‑carboxylation, were downregulated by miR‑133a overexpression and upregulated by vitamin K2 treatment, indicating a positive feedback on γ‑carboxylation. The results of the present study suggested that vitamin K2 targets miR‑133a to regulate osteogenesis.

Three Pseudomonas putida FNR Family Proteins with Different Sensitivities to O2.

Science.gov (United States)

Ibrahim, Susan A; Crack, Jason C; Rolfe, Matthew D; Borrero-de Acuña, José Manuel; Thomson, Andrew J; Le Brun, Nick E; Schobert, Max; Stapleton, Melanie R; Green, Jeffrey

2015-07-03

The Escherichia coli fumarate-nitrate reduction regulator (FNR) protein is the paradigm for bacterial O2-sensing transcription factors. However, unlike E. coli, some bacterial species possess multiple FNR proteins that presumably have evolved to fulfill distinct roles. Here, three FNR proteins (ANR, PP_3233, and PP_3287) from a single bacterial species, Pseudomonas putida KT2440, have been analyzed. Under anaerobic conditions, all three proteins had spectral properties resembling those of [4Fe-4S] proteins. The reactivity of the ANR [4Fe-4S] cluster with O2 was similar to that of E. coli FNR, and during conversion to the apo-protein, via a [2Fe-2S] intermediate, cluster sulfur was retained. Like ANR, reconstituted PP_3233 and PP_3287 were converted to [2Fe-2S] forms when exposed to O2, but their [4Fe-4S] clusters reacted more slowly. Transcription from an FNR-dependent promoter with a consensus FNR-binding site in P. putida and E. coli strains expressing only one FNR protein was consistent with the in vitro responses to O2. Taken together, the experimental results suggest that the local environments of the iron-sulfur clusters in the different P. putida FNR proteins influence their reactivity with O2, such that ANR resembles E. coli FNR and is highly responsive to low concentrations of O2, whereas PP_3233 and PP_3287 have evolved to be less sensitive to O2. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Influenza B virus M2 protein can functionally replace its influenza A virus counterpart in promoting virus replication

International Nuclear Information System (INIS)

Wanitchang, Asawin; Wongthida, Phonphimon; Jongkaewwattana, Anan

2016-01-01

The M2 protein (AM2 and BM2) of influenza A and B viruses function as a proton channel essential for viral replication. They also carry a cytoplasmic tail whose functions are not fully delineated. It is currently unknown whether these proteins could be replaced functionally in a viral context. Here, we generated single-cycle influenza A viruses (scIAV-ΔHA) carrying various M2-2A-mCherry constructs in the segment 4 (HA) and evaluated their growth in complementing cells. Intriguingly, the scIAV-ΔHA carrying AM2 and that bearing BM2 grew comparably well in MDCK-HA cells. Furthermore, while the virus carrying chimeric B-AM2 in which the BM2 transmembrane fused with the AM2 cytoplasmic tail produced robust infection, the one bearing the AM2 transmembrane fused with the BM2 cytoplasmic tail (A-BM2) exhibited severely impaired growth. Altogether, we demonstrate that AM2 and BM2 are functionally interchangeable and underscore the role of compatibility between transmembrane and cytoplasmic tail of the M2 protein. -- Highlights: •Flu A M2 protein (AM2) can be functionally replaced by that of Flu B (BM2). •Both AM2 and BM2 with extended cytoplasmic tail are functional. •Compatibility between the ion channel and the cytoplasmic tail is critical for M2 function. •M2 with higher ion channel activity may augment influenza virus replication.

Influenza B virus M2 protein can functionally replace its influenza A virus counterpart in promoting virus replication

Energy Technology Data Exchange (ETDEWEB)

Wanitchang, Asawin; Wongthida, Phonphimon; Jongkaewwattana, Anan, E-mail: anan.jon@biotec.or.th

2016-11-15

The M2 protein (AM2 and BM2) of influenza A and B viruses function as a proton channel essential for viral replication. They also carry a cytoplasmic tail whose functions are not fully delineated. It is currently unknown whether these proteins could be replaced functionally in a viral context. Here, we generated single-cycle influenza A viruses (scIAV-ΔHA) carrying various M2-2A-mCherry constructs in the segment 4 (HA) and evaluated their growth in complementing cells. Intriguingly, the scIAV-ΔHA carrying AM2 and that bearing BM2 grew comparably well in MDCK-HA cells. Furthermore, while the virus carrying chimeric B-AM2 in which the BM2 transmembrane fused with the AM2 cytoplasmic tail produced robust infection, the one bearing the AM2 transmembrane fused with the BM2 cytoplasmic tail (A-BM2) exhibited severely impaired growth. Altogether, we demonstrate that AM2 and BM2 are functionally interchangeable and underscore the role of compatibility between transmembrane and cytoplasmic tail of the M2 protein. -- Highlights: •Flu A M2 protein (AM2) can be functionally replaced by that of Flu B (BM2). •Both AM2 and BM2 with extended cytoplasmic tail are functional. •Compatibility between the ion channel and the cytoplasmic tail is critical for M2 function. •M2 with higher ion channel activity may augment influenza virus replication.

NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function

International Nuclear Information System (INIS)

Zhao Guohua; Shi Lingfang; Qiu Daoming; Hu Hong; Kao, Peter N.

2005-01-01

NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthesy, J. Biol. Chem. 269 (1994) 20691-20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2

Construction and use of a Cupriavidus necator H16 soluble hydrogenase promoter (PSH fusion to gfp (green fluorescent protein

Directory of Open Access Journals (Sweden)

Bat-Erdene Jugder

2016-07-01

Full Text Available Hydrogenases are metalloenzymes that reversibly catalyse the oxidation or production of molecular hydrogen (H2. Amongst a number of promising candidates for application in the oxidation of H2 is a soluble [Ni–Fe] uptake hydrogenase (SH produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for functional SH synthesis, was investigated by developing a green fluorescent protein (GFP reporter system to characterise PSH promoter activity using several gene cloning approaches. A PSH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the PSH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator H16. The fusion construct allowed for the design of a simple screening assay to evaluate PSH activity. Furthermore, the constructed reporter system can serve as a model to develop a rapid fluorescent based reporter for subsequent small-scale process optimisation experiments for SH expression.

Human recombinant cementum attachment protein (hrPTPLa/CAP) promotes hydroxyapatite crystal formation in vitro and bone healing in vivo.

Science.gov (United States)

Montoya, Gonzalo; Arenas, Jesús; Romo, Enrique; Zeichner-David, Margarita; Alvarez, Marco; Narayanan, A Sampath; Velázquez, Ulises; Mercado, Gabriela; Arzate, Higinio

2014-12-01

Cementum extracellular matrix is similar to other mineralized tissues; however, this unique tissue contains molecules only present in cementum. A cDNA of these molecules, cementum attachment protein (hrPTPLa/CAP) was cloned and expressed in a prokaryotic system. This molecule is an alternative splicing of protein tyrosine phosphatase-like A (PTPLa). In this study, we wanted to determine the structural and functional characteristics of this protein. Our results indicate that hrPTPLa/CAP contains a 43.2% α-helix, 8.9% β-sheet, 2% β-turn and 45.9% random coil secondary structure. Dynamic light scattering shows that this molecule has a size distribution of 4.8 nm and aggregates as an estimated mass of 137 kDa species. AFM characterization and FE-SEM studies indicate that this protein self-assembles into nanospheres with sizes ranging from 7.0 to 27 nm in diameter. Functional studies demonstrate that hrPTPLa/CAP promotes hydroxyapatite crystal nucleation: EDS analysis revealed that hrPTPLa/CAP-induced crystals had a 1.59 ± 0.06 Ca/P ratio. Further confirmation with MicroRaman spectrometry and TEM confirm the presence of hydroxyapatite. In vivo studies using critical-size defects in rat cranium showed that hrPTPLa/CAP promoted 73% ± 2.19% and 87% ± 1.97% new bone formation at 4 and 8 weeks respectively. Although originally identified in cementum, PTPLa/CAP is very effective at inducing bone repair and healing and therefore this novel molecule has a great potential to be used for mineralized tissue bioengineering and tissue regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.

Ubiquitin Ligase RNF138 Promotes Episodic Ataxia Type 2-Associated Aberrant Degradation of Human Cav2.1 (P/Q-Type) Calcium Channels.

Science.gov (United States)

Fu, Ssu-Ju; Jeng, Chung-Jiuan; Ma, Chia-Hao; Peng, Yi-Jheng; Lee, Chi-Ming; Fang, Ya-Ching; Lee, Yi-Ching; Tang, Sung-Chun; Hu, Meng-Chun; Tang, Chih-Yung

2017-03-01

Voltage-gated Ca V 2.1 channels comprise a pore-forming α 1A subunit with auxiliary α 2 δ and β subunits. Ca V 2.1 channels play an essential role in regulating synaptic signaling. Mutations in the human gene encoding the Ca V 2.1 subunit are associated with the cerebellar disease episodic ataxia type 2 (EA2). Several EA2-causing mutants exhibit impaired protein stability and exert dominant-negative suppression of Ca V 2.1 wild-type (WT) protein expression via aberrant proteasomal degradation. Here, we set out to delineate the protein degradation mechanism of human Ca V 2.1 subunit by identifying RNF138, an E3 ubiquitin ligase, as a novel Ca V 2.1-binding partner. In neurons, RNF138 and Ca V 2.1 coexist in the same protein complex and display notable subcellular colocalization at presynaptic and postsynaptic regions. Overexpression of RNF138 promotes polyubiquitination and accelerates protein turnover of Ca V 2.1. Disrupting endogenous RNF138 function with a mutant (RNF138-H36E) or shRNA infection significantly upregulates the Ca V 2.1 protein level and enhances Ca V 2.1 protein stability. Disrupting endogenous RNF138 function also effectively rescues the defective protein expression of EA2 mutants, as well as fully reversing EA2 mutant-induced excessive proteasomal degradation of Ca V 2.1 WT subunits. RNF138-H36E coexpression only partially restores the dominant-negative effect of EA2 mutants on Ca V 2.1 WT functional expression, which can be attributed to defective membrane trafficking of Ca V 2.1 WT in the presence of EA2 mutants. We propose that RNF138 plays a critical role in the homeostatic regulation of Ca V 2.1 protein level and functional expression and that RNF138 serves as the primary E3 ubiquitin ligase promoting EA2-associated aberrant degradation of human Ca V 2.1 subunits. SIGNIFICANCE STATEMENT Loss-of-function mutations in the human Ca V 2.1 subunit are linked to episodic ataxia type 2 (EA2), a dominantly inherited disease characterized by

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

The regulation of protein synthesis and translation factors by CD3 and CD28 in human primary T lymphocytes

Directory of Open Access Journals (Sweden)

Proud Christopher G

2002-05-01

Full Text Available Abstract Background Activation of human resting T lymphocytes results in an immediate increase in protein synthesis. The increase in protein synthesis after 16–24 h has been linked to the increased protein levels of translation initiation factors. However, the regulation of protein synthesis during the early onset of T cell activation has not been studied in great detail. We studied the regulation of protein synthesis after 1 h of activation using αCD3 antibody to stimulate the T cell receptor and αCD28 antibody to provide the co-stimulus. Results Activation of the T cells with both antibodies led to a sustained increase in the rate of protein synthesis. The activities and/or phosphorylation states of several translation factors were studied during the first hour of stimulation with αCD3 and αCD28 to explore the mechanism underlying the activation of protein synthesis. The initial increase in protein synthesis was accompanied by activation of the guanine nucleotide exchange factor, eukaryotic initiation factor (eIF 2B, and of p70 S6 kinase and by dephosphorylation of eukaryotic elongation factor (eEF 2. Similar signal transduction pathways, as assessed using signal transduction inhibitors, are involved in the regulation of protein synthesis, eIF2B activity and p70 S6 kinase activity. A new finding was that the p38 MAPK α/β pathway was involved in the regulation of overall protein synthesis in primary T cells. Unexpectedly, no changes were detected in the phosphorylation state of the cap-binding protein eIF4E and the eIF4E-binding protein 4E-BP1, or the formation of the cap-binding complex eIF4F. Conclusions Both eIF2B and p70 S6 kinase play important roles in the regulation of protein synthesis during the early onset of T cell activation.

Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

Science.gov (United States)

Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

2014-06-10

The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion

Science.gov (United States)

Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.

2016-01-01

Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041

SmgGDS is a transient nucleolar protein that protects cells from nucleolar stress and promotes the cell cycle by regulating DREAM complex gene expression.

Science.gov (United States)

Gonyo, P; Bergom, C; Brandt, A C; Tsaih, S-W; Sun, Y; Bigley, T M; Lorimer, E L; Terhune, S S; Rui, H; Flister, M J; Long, R M; Williams, C L

2017-12-14

The chaperone protein and guanine nucleotide exchange factor SmgGDS (RAP1GDS1) is a key promoter of cancer cell proliferation and tumorigenesis. SmgGDS undergoes nucleocytoplasmic shuttling, suggesting that it has both cytoplasmic and nuclear functions that promote cancer. Previous studies indicate that SmgGDS binds cytoplasmic small GTPases and promotes their trafficking to the plasma membrane. In contrast, little is known about the functions of SmgGDS in the nucleus, or how these nuclear functions might benefit cancer cells. Here we show unique nuclear localization and regulation of gene transcription pathways by SmgGDS. Strikingly, SmgGDS depletion significantly reduces expression of over 600 gene products that are targets of the DREAM complex, which is a transcription factor complex that regulates expression of proteins controlling the cell cycle. The cell cycle regulators E2F1, MYC, MYBL2 (B-Myb) and FOXM1 are among the DREAM targets that are diminished by SmgGDS depletion. E2F1 is well known to promote G1 cell cycle progression, and the loss of E2F1 in SmgGDS-depleted cells provides an explanation for previous reports that SmgGDS depletion characteristically causes a G1 cell cycle arrest. We show that SmgGDS localizes in nucleoli, and that RNAi-mediated depletion of SmgGDS in cancer cells disrupts nucleolar morphology, signifying nucleolar stress. We show that nucleolar SmgGDS interacts with the RNA polymerase I transcription factor upstream binding factor (UBF). The RNAi-mediated depletion of UBF diminishes nucleolar localization of SmgGDS and promotes proteasome-mediated degradation of SmgGDS, indicating that nucleolar sequestration of SmgGDS by UBF stabilizes SmgGDS protein. The ability of SmgGDS to interact with UBF and localize in the nucleolus is diminished by expressing DiRas1 or DiRas2, which are small GTPases that bind SmgGDS and act as tumor suppressors. Taken together, our results support a novel nuclear role for SmgGDS in protecting malignant

Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp

Directory of Open Access Journals (Sweden)

Fei Mo

2014-09-01

Full Text Available Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus under various conditions (sex, age, water temperature, and drug treatments, seven reference genes, including beta actin (ACTB, beta-2 microglobulin (B2M, embryonic elongation factor-1 alpha (EEF1A, glyceraldehyde phosphate dehydrogenase (GAPDH, alpha tubulin (TUBA, ribosomal protein l8 (RPL8 and glucose-6-phosphate dehydrogenase (G6PDH, were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species.

The C. elegans DSB-2 protein reveals a regulatory network that controls competence for meiotic DSB formation and promotes crossover assurance.

Directory of Open Access Journals (Sweden)

Simona Rosu

Full Text Available For most organisms, chromosome segregation during meiosis relies on deliberate induction of DNA double-strand breaks (DSBs and repair of a subset of these DSBs as inter-homolog crossovers (COs. However, timing and levels of DSB formation must be tightly controlled to avoid jeopardizing genome integrity. Here we identify the DSB-2 protein, which is required for efficient DSB formation during C. elegans meiosis but is dispensable for later steps of meiotic recombination. DSB-2 localizes to chromatin during the time of DSB formation, and its disappearance coincides with a decline in RAD-51 foci marking early recombination intermediates and precedes appearance of COSA-1 foci marking CO-designated sites. These and other data suggest that DSB-2 and its paralog DSB-1 promote competence for DSB formation. Further, immunofluorescence analyses of wild-type gonads and various meiotic mutants reveal that association of DSB-2 with chromatin is coordinated with multiple distinct aspects of the meiotic program, including the phosphorylation state of nuclear envelope protein SUN-1 and dependence on RAD-50 to load the RAD-51 recombinase at DSB sites. Moreover, association of DSB-2 with chromatin is prolonged in mutants impaired for either DSB formation or formation of downstream CO intermediates. These and other data suggest that association of DSB-2 with chromatin is an indicator of competence for DSB formation, and that cells respond to a deficit of CO-competent recombination intermediates by prolonging the DSB-competent state. In the context of this model, we propose that formation of sufficient CO-competent intermediates engages a negative feedback response that leads to cessation of DSB formation as part of a major coordinated transition in meiotic prophase progression. The proposed negative feedback regulation of DSB formation simultaneously (1 ensures that sufficient DSBs are made to guarantee CO formation and (2 prevents excessive DSB levels that could

FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression

Science.gov (United States)

Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin

2018-01-01

E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722

Shoc2/Sur8 protein regulates neurite outgrowth.