WorldWideScience

Sample records for editor-in-chief mike golio

  1. Editor-in-Chief Editorial

    OpenAIRE

    Reyes Carmona DDS, MSD, PhD, Jessie

    2015-01-01

    The Editor-in-chief discussed briefly regarding the role of Research-Educational Model and academic publications in Dental Education. Moreover, the journal challenges and current issue topics are commented.

  2. Editor in Chief changes for Implementation Science

    Directory of Open Access Journals (Sweden)

    Eccles Martin P

    2012-08-01

    Full Text Available Abstract Implementation Science, like all journals, needs to continue to develop. There will always be changes we need to make as next steps in improving the Journal for readers and improving how it runs. However, we now have our first change in Editors in Chief. We are fortunate to have been able to recruit two experienced academics who are also experienced editors—Professor Michel Wensing and Dr Anne Sales. I hope you will join me in welcoming them and give them, and continue to give Implementation Science, your support.

  3. From the Editor-in-Chief: Scope Expansion and New Editor-in-Chief for 2014

    Directory of Open Access Journals (Sweden)

    Christopher J. Woolverton

    2013-09-01

    Full Text Available JMBE Editor-in-Chief Christopher Woolverton reflects on all that the Journal has accomplished in the last five years and announces two exciting changes for 2014 and beyond: an expansion of the Journal’s scope and a change in leadership.

  4. Preferred Formats for References | Editor-in-Chief | Ghana Journal ...

    African Journals Online (AJOL)

    Ghana Journal of Linguistics. Journal Home · ABOUT · Advanced Search · Current Issue · Archives · Journal Home > Vol 6, No 1 (2017) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Preferred Formats for References. Editor-in-Chief Editor-in-Chief. Abstract.

  5. Letter from the New Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Samuel C. Mok

    2016-01-01

    Full Text Available Dear authors, reviewers, and readers of Cancers, It gives me great pleasure to welcome you to the latest issue of Cancers, for which I now serve as Editor-in-Chief. First, thanks are due to my predecessor and the founding Editor-in-Chief, Dr. Robert Weiss. [...

  6. From the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Simeon Oka

    2011-01-01

    while under review by the Journal." At the end I have a pleasure to frankly appreciate to Professor Jan Erik Johnsson, from Technical University of Denmark, Lyngby, for his contribution, as member of the International Advisory Board from the very beginning, to the scientific scope and orientation of the Journal, and to the quality of the papers published in more than 15 years. I am sorry that his wish was not to be member of the International Advisory Board, since he was retired. In the name of Editorial Boards of the journal Thermal Science I wish to him many nice activities in his free time. Finally, I am happy that, following the wish of Prof. Arun Mujumdar, the world known scientist and member of our International Advisory Board, that I can pay your attention to the link: http://serve.me.nus.edu.sg/arun/E_books.htm, where you can download many interesting e-books, and review of the activity of the Minerals, Metals and Materials Technology Centre, of the Faculty of Engineering, National University of Singapore. April, 2011 Professor Simeon Oka, Ph. D. Editor-in-chief

  7. EDITORIAL: Incoming Editor-in-Chief

    Science.gov (United States)

    Lidström, Suzanne

    2012-04-01

    , in his hands, the expansion continued and the transition to electronic production took place. In 2005, an agreement was signed with IOP Publishing and the bustling production work of the in-house team moved abroad to Bristol, leaving just the Editor-in-Chief to man the ship at the Royal Swedish Academy of Sciences. In 2011, however, as Roger prepared to step down, submissions had reached astounding levels as is evident from figure 1: that year, almost 1500 manuscripts were received by Physica Scripta, now acknowledged to be amongst the fastest growing journals in IOP Publishing, when measured in these terms. The year on year increase stands at 20% and, once again, of the extensive range of topics covered, condensed matter physics had been identified as the subject area in most need of attention because the burden of reviewing had become too great for one editor to oversee alone. Thus, when I joined Physica Scripta in January of this year, securing new External Editors for this field was perceived to be the most urgent task. It is, therefore, with the greatest of pleasure that I am able to announce the arrival of two new editors for this section: Professors David Keen and Tapio Rantala. Physica Scripta statistics Figure 1. The annual submissions made to Physica Scripta in recent years have rocketed and the rejection rate (given as a percentage) has increased rapidly. The modest increase in the number of articles accepted (shaded in blue) reflects a deliberate policy to augment the scientific quality. Professor Rantala has been selected by the Finnish Physical Society to replace Professor Matti Manninen, who is stepping down as the Finnish representative on the journal's Editorial Board. Professor Rantala is a prominent theorist and has been engaged in active research in a number of fields. In his early work, he was interested in surface science and molecular physics, however his expertise is predominantly in the domain of solid or materials physics related to

  8. Foreword from the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Jon M. Truby

    2012-04-01

    Highness the Emir, Sheikh Hamad bin Khalifa Al Thani, for this vision. I am grateful to all of those involved in the production of this and future issues, and hope the demands of our readers are met. May the journal continue to be a success. Dr. Jon M. Truby Ph.D, Editor-in-Chief

  9. EDITORIAL: New Editor-in-Chief for Nanotechnology New Editor-in-Chief for Nanotechnology

    Science.gov (United States)

    Couzin, Nina

    2009-01-01

    Nanotechnology is proud to announce the appointment of Professor Mark Reed, Yale University, as the new Editor-in-Chief from January 2009. Mark Reed holds the Harold Hodgkinson Chair of Engineering and Applied Science at Yale University. He has made significant contributions in the areas of quantum dots, electronic transport in nanoscale and mesoscopic systems, artificially structured materials and devices, and molecular electronics. Professor Reed has been associated with the journal as an Editorial Board member for a number of years and we are delighted that he has agreed to take on the scientific leadership of the journal in its 20th year. We also take the opportunity to thank Professor Mark Welland, Cambridge University, for his work as Editor-in-Chief since 2001, and for presiding over the re-launch and remarkable growth of the journal since then. Nanotechnology is unique in that it was the first peer-reviewed journal in the area of nanoscience, the first issue appearing in 1990. Since then it has established a distinguished publication record and has become a leading journal covering all aspects of nanoscale science and technology, as well as specializing in in-depth, comprehensive articles not seen in letter format journals. Published weekly and featuring subject sections, the journal is truly multidisciplinary in nature and is an excellent medium to quickly deliver your research results to readers worldwide. Nanotechnology is proud to be offering some of the fastest publication times around (less than three months on average from receipt to online publication). We offer free online access to all published papers for 30 days, ensuring that anyone with access to the internet will be able to read your paper. We were also the first journal to give our authors the opportunity to communicate their research to a wider audience through nanotechweb.org and other IOP websites. See the journal's homepage at www.iop.org/Journals/nano for more details. We are looking

  10. EDITORIAL: Incoming Editor-in-Chief

    Science.gov (United States)

    Webb, Steve

    2006-01-01

    editor signals change and in turn this induces in some people expectation, hope of improvement and maybe radical revolution. Others cower and hope for stability, continuation of the same and as little outward sign of change as possible. So I should like to signal that I hope to satisfy both camps. The Editor-in-Chief is primarily a guardian of the journal and should change nothing that does not need changing. Maintaining a standard at the same level is a valuable achievement in itself. This is no different from taking on any other leadership role such as in a team or department. One has to lead by consensus and with respect for the position. Conversely there are things I would like to see improved (otherwise I should not have been hired) and I commit to attempting these but in a spirit of cooperation with the Board, the publisher (IOP), IPEM and the readership. Any other approach would be doomed anyway. So, what would I like to see changed? Dare I say anything too strongly upfront? Like Alun six years ago I would like there to be more debate via correspondence but this depends on the readers to do more writing along these lines. Personally I feel PMB, like many journals, has developed to the point where most readers sadly can understand only a small fraction of its contents. I have talked to older readers who said they regularly used to read all or half of the journal. Now many of us can manage only the papers in our specialty. Yet this is somewhat inevitable as medical physics has progressed from a fledgling science to the vast activity it is today, topics have become deeply complicated and we cannot and should not reverse the clock. To address this, I would like to see authors provide some form of `intelligible lay-scientific summary' of their paper as a condition of its publication. I think readers would then enjoy reading all, not just some, of these and maybe become attracted to other areas than the ones in which they currently work. I would like to see the

  11. Retirement of J. Gary Eden as Editor-in-Chief

    Science.gov (United States)

    Jagadish, Chennupati; Jelinkova, Helena; Fainman, Yeshaiahu; Dawson, Martin; Ermers, Ysabel

    2016-01-01

    After nine years of dedicated service as Editor-in-Chief of Progress in Quantum Electronics (PQE), J. Gary Eden has retired at the end of December 2015. During his term as the Editor-in-Chief, PQE has grown significantly in size and quality and he has given generously of his time in advising authors, referees, editors, and the journal staff. Gary is an exceptional scientist and a generous individual who has given so much to the community. He is always very positive in every situation, and has created positive environment and supported people with utmost enthusiasm.

  12. EDITORIAL: Outgoing Editor-in-Chief Outgoing Editor-in-Chief

    Science.gov (United States)

    Hauptmann, Peter

    2012-01-01

    I started in 2002 as Editor-in-Chief of a well established journal—MST (Measurement Science and Technology). It was a time when modern means of communication offered new opportunities for the scientific community—for all scientists and engineers whether at universities, in industry or at other institutions—to access better quality information in a shorter time. This development helped us to be more efficient in our daily scientific work and to anticipate new trends faster than before. A flood of information was created by different search engines. A few online journals or journals published in emerging countries with a similar profile to MST appeared on the market. MST had to provide new answers in response to these developments. In 2002 I postulated two requirements to the journal. Firstly, the publisher has to be up to date. My impression over the years has been that IOPP is excellently organized. That has made it easier for the board members and all our reviewers to concentrate on the scientific aspects of our input to the journal. During all my visits to Bristol or my contacts with the IOPP staff I always met very professional and enthusiastic staff members. They have not only supported and encouraged the ideas and initiatives of the Editorial Board members, but they have also worked hard on establishing one of the most effective journal operations in the field of measurement science and technology. Many authors are well aware of this. Thus I am able to declare that the first requirement for a successful journal has been met. Secondly, the scientific level has to be high and the journal should attract readers from all over the world. This task was the responsibility of the Editorial Board members and of myself. Our strategy was on the one hand to ensure continuity in MST but on the other hand to be open to new trends and developments. Examples of these new aspects of the journal are fields like micro- and nanometrology, measurement techniques for

  13. EDITORIAL: Greetings from the new Editor-in-Chief Greetings from the new Editor-in-Chief

    Science.gov (United States)

    Nielsch, Kornelius

    2012-01-01

    -review, with the aim to raise the quality of our content, three years later the number of published articles has remained stable at around 220 per year, whilst the number of downloads and citations to the journal has grown. In 2011, three topical issues have been published, on: (Nano)characterization of semiconductor materials and structures (Guest Editor: Alberta Bonanni, University of Linz, Austria) Flexible OLEDs and organic electronics (Guest Editors: Jang-Joo Kim, Min-Koo Han, Cambridge University, UK, and Yong-Young Noh, Seoul National University, Korea) From heterostructures to nanostructures: an 80th birthday tribute to Zhores Alferov (Guest Editor: Dieter Bimberg, Technische Universität Berlin, Germany) For the coming years, I will strongly support that the number of published topical issues will continue on the same level or slightly rise. SST has planned the publication of the following topical issues for 2012: Non-polar and semipolar nitride semiconductors (Guest Editors: Jung Han, Yale University, USA, and Michael Kneissl, Technische Universität Berlin, Germany) Topological insulators (Guest Editors: Alberto Morpurgo, Université de Genève, Switzerland and Björn Trauzettel, Universität Basel, Switzerland) Atomic layer deposition (Guest Editor: Marek Godlewski, Polish Academy of Sciences, Poland) 50th Anniversary of the laser diode (Guest Editors: Mike Adams, Univeristy of Essex, UK and Stephane Calvez, University of Strathclyde, UK) In addition to the traditional topics of SST, I as Editor-in-chief, strongly support and welcome the submission of manuscripts on organic semiconductors, topological insulators, semiconductor nanostructures for photovoltaic, solid-state lighting and energy harvesting, IC application beyond Moore's law and fundamental works on semiconductors based on abundant materials. I am extremely optimistic about the future of SST. I believe that we will raise the standards of acceptance while maintaining the short time from submission to

  14. EDITORIAL: Farewell from the outgoing Editor-in-Chief Farewell from the outgoing Editor-in-Chief

    Science.gov (United States)

    Rost, Jan Michael

    2011-01-01

    I am very pleased to announce that Professor Paul Corkum will be taking on the position of Editor-in-Chief at Journal of Physics B: Atomic, Molecular and Optical Physics (J. Phys. B) from the beginning of January 2011. During my term as Editor-in-Chief atomic, molecular and optical science has continued to change rapidly: we have seen ultracold physics widening its original emphasis on Bose-Einstein condensates to the entanglement of light and matter in the most general sense towards a science of information. At the same time attosecond science and interaction of matter with short x-ray pulses develops rapidly. I am very happy that J. Phys. B with Paul Corkum as Editor-in-Chief will play a central role in publishing exciting results from this field. I would like to thank the publishing team at J. Phys. B for their fantastic job, in particular for the quality of the refereeing system the team has been able to maintain while at the same time bringing down the publication times considerably. I thank them all for the help and support they have given me in the role of Editor-in-Chief and wish them the very best for the future. Last and certainly not least I would like to thank you, the authors, referees and readers, for the support of J. Phys. B.

  15. EDITORIAL: Incoming Editor-in-Chief Incoming Editor-in-Chief

    Science.gov (United States)

    Birch, David

    2012-01-01

    It is a pleasure and an honour for me to be taking over as Editor-in-Chief of Measurement Science and Technology. MST is well known across research communities worldwide as a leading journal in which to publish new techniques and instrumentation. It has gained this enviable position largely because of the excellent guidance of its Editorial Board and dedicated staff at Institute of Physics Publishing over many years. I want to highlight in particular the contribution of the outgoing Editor Peter Hauptmann, and other Editors before him, in making the journal truly international. We thank Peter immensely for all his hard work in leading the journal, having exceptionally served two terms, each of five years. I come into the post of Editor at a very interesting and challenging time for research. The global recession is leading to cuts in research funding in many countries, researchers and their outputs are coming under closer scrutiny than ever before, and more is being expected of them. Journals play a critical role in monitoring and maintaining research standards, but we should be careful not to assume that journal Impact Factor is the sole measure of research quality. Although expediency may sometimes demand it, Impact Factor, as practitioners know, is subject dependent. One of the great things about science and technology for me is its level playing field. The key point is still innovation no matter where the work is done or where it is published. MST has a long pedigree of being the natural home of the highest quality papers from leading researchers wishing to report novel instrumentation and techniques. 2013 will mark the 90th anniversary of MST and we look forward to celebrating in style its sustained success. I recall with pride the first paper I published in Journal of Physics E: Scientific Instruments (as MST was previously titled) back in 1977. The paper reported the design and application of an early fluorescence lifetime spectrometer that I had constructed

  16. Announcement: New Editor-in-Chief Robert C. Kennicutt

    Science.gov (United States)

    Abt, Helmut A.

    1999-05-01

    Effective 1999 July 1, all new manuscripts for Part 1 of The Astrophysical Journal and The Astrophysical Journal Supplement Series should be sent to Dr. Robert C. Kennicutt, Editor-in-Chief The Astrophysical Journal Steward Observatory University of Arizona Tucson, AZ 85721-0065 The other means of contact are telephone, (520) 621-5145 FAX, (520) 621-5153 and e-mail, apj@as.arizona.edu. For express packages please use the street address of 933 North Cherry Avenue. Dr. Kennicutt will be assisted by several of my loyal coworkers, who will move across the street. Manuscripts received before July 1 will be handled by the current editor until most of their problems have been resolved, at which point the remainder will be sent to Dr. Kennicutt's office. Manuscripts for the Letters should, as before, be sent directly to Dr. Alex Dalgarno at the Center for Astrophysics in Cambridge, MA. We are fortunate that a person with as much experience in research and proven good judgment as Dr. Kennicutt is willing to accept this difficult and time-consuming responsibility. He will be only the seventh Managing Editor or Editor-in-Chief that this Journal has had in its 104 years. Please give him the cooperation and help that you have given the current editor. It has been my privilege to work for 28 years with many of the best astrophysicists in the world and to publish their papers. This was done with the help of the AAS Publications Board and AAS officers, the efforts of Peter Boyce and Evan Owens who made the on-line edition of the Journal possible, three Associate Editors, a score of Scientific Editors, a hardworking staff of six in Tucson, up to 25 production controllers and manuscript editors at the University of Chicago Press, and the thousands of astronomers throughout the world who served as referees. The original masthead called this journal ``An International Review of Spectroscopy and Astronomical Physics.'' That subtitle is no longer appropriate because we do not publish

  17. Announcement: New Editor-In-Chief, Robert C. Kennicutt, Jr.

    Science.gov (United States)

    Abt, Helmut A.

    1999-06-01

    Effective 1999 July 1, all new manuscripts for Part 1 of The Astrophysical Journal and The Astrophysical Journal Supplement Series should be sent to Dr. Robert C. Kennicutt, Jr., Editor-in-Chief The Astrophysical Journal Steward Observatory University of Arizona Tucson, AZ 85721-0065 The other means of contact are telephone, (520) 621-5145 FAX, (520) 621-5153 and e-mail, apj@as.arizona.edu. For express packages please use the street address of 933 North Cherry Avenue. Dr. Kennicutt will be assisted by several of my loyal coworkers, who will move across the street. Manuscripts received before July 1 will be handled by the current editor until most of their problems have been resolved, at which point the remainder will be sent to Dr. Kennicutt's office. Manuscripts for the Letters should, as before, be sent directly to Dr. Alex Dalgarno at the Center for Astrophysics in Cambridge, MA. We are fortunate that a person with as much experience in research and proven good judgment as Dr. Kennicutt is willing to accept this difficult and time-consuming responsibility. He will be only the seventh Managing Editor or Editor-in-Chief that this Journal has had in its 104 years. Please give him the cooperation and help that you have given the current editor. It has been my privilege to work for 28 years with many of the best astrophysicists in the world and to publish their papers. This was done with the help of the AAS Publications Board and AAS officers, the efforts of Peter Boyce and Evan Owens who made the on-line edition of the Journal possible, three Associate Editors, a score of Scientific Editors, a hardworking staff of six in Tucson, up to 25 production controllers and manuscript editors at the University of Chicago Press, and the thousands of astronomers throughout the world who served as referees. The original masthead called this journal ``An International Review of Spectroscopy and Astronomical Physics.'' That subtitle is no longer appropriate because we do not

  18. Table of Contents | Editor-in-Chief | Ghana Journal of Linguistics

    African Journals Online (AJOL)

    Ghana Journal of Linguistics. Journal Home · ABOUT · Advanced Search · Current Issue · Archives · Journal Home > Vol 6, No 1 (2017) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Table of Contents. Editor-in-Chief Editor-in-Chief. Abstract. Table of Contents ...

  19. EDITORIAL: Greetings from the new Editor-in-Chief

    Science.gov (United States)

    Garcia, Ephrahim

    2008-02-01

    I am Professor Ephrahim Garcia, an Associate Professor at Sibley School of Mechanical and Aerospace Engineering at Cornell University in Ithaca, New York. I have been at Cornell University since 2002, spent four years as a Program Manager at the Defense Advanced Research Project Agency from 1998-2002, and before that seven years at the Department of Mechanical Engineering at Vanderbilt University in Nashville, Tennessee. I have served on the Editorial Advisory Board of Smart Materials and Structures (SMS) for the last six years. It is a humbling thing to be asked to take up the post of Editor-in-Chief in a field with so many talented researchers. I would like to say a heartfelt thanks to the members of the Editorial Board and IOP Publishing for their confidence in me. Most importantly, I would like to thank Professor Vijay Varadan of the University of Arkansas and Professor Richard Claus of Virginia Polytechnic Institute and State University for their efforts in launching the journal 16 years ago. They have been stewards, promoters and, especially Vijay, key to the operation and function of SMS for all these years, and our research community is indebted to them. Professors Varadan and Claus have dedicated their careers to the area of smart materials and structures and we are very grateful for their leadership, mentoring and contribution. SMS is a thriving journal offering papers on all technical areas concerned with smart materials, systems and structures from the micro- and nanoscale to the macroscale. The journal is undergoing some major changes, including the recent transferal of papers to IOP Publishing's peer-review management system. With this new system authors can expect fast publication times of around 4 or 5 months from submission, and excellent author service. In this world of ever changing technology, the Editorial Board and I aim to reduce the time to publication for researchers in this exciting area of science and engineering. I am in the process of

  20. EDITORIAL: A word from the new Editor-in-Chief A word from the new Editor-in-Chief

    Science.gov (United States)

    Mostowski, Jan

    2011-01-01

    TIn the autumn of 2010 I became the Editor-in Chief of European Journal of Physics (EJP). EJP is a place for teachers, instructors and professors to exchange their views on teaching physics at university level and share their experience. It is general opinion that no good research is possible without connection with good, high-quality teaching, at the university level in particular. Therefore excellence in physics teaching is important to the physics community. European Journal of Physics is proud of its contribution to achieving this goal. As Editor-in-Chief, I will continue to work to this general objective of the journal. We will publish articles on specific topics in physics, stressing originality of presentation and suitability for use in students'laboratories, lectures and physics teaching in general. We will also publish more pedagogical papers presenting the achievements of particular teaching methods. In addition, we will continue to publish special sections on particular areas of physics, as well as the annual special section on physics competitions. European Journal of Physics is in good shape. Due to the work of the previous editors and the publisher, the readership is high and growing steadily, and many excellent papers are being submitted and published. I hope that this positive trend for the journal will continue, and I will do my best to keep to this high standard. A few words about myself. I work in the Institute of Physics in Warsaw, Poland. My main research interests are in theoretical quantum optics and I have published about 80 research papers on this topic. For many years I was involved in teaching physics at university and in high school. I am a co-author of a textbook on physics for high-school students and of a problem book in quantum mechanics. For the last ten years, I have been involved in the International Physics Olympiad and over the last few years I have been a member of the Editorial Board of European Journal of Physics.

  1. EDITORIAL: Greetings from the new Editor-in-Chief

    Science.gov (United States)

    Bhattacharya, P.

    2004-04-01

    On 1 January, 2004, I assumed the position of Editor-in-Chief of Journal of Physics D: Applied Physics. I will start by saying that I will do my best to justify the confidence of the journal management and publishing staff in my abilities. I was fortunate to have been able to work, as an Editorial Board member, with my predecessor, the previous Editor-in-Chief, Professor Allister Ferguson. Allister has provided a high degree of intellectual stewardship for the journal in the last five years. He has made the job appear a worthy challenge for me. I therefore take this opportunity to thank Allister on behalf of the Editorial Board and publishing staff of the journal. Several other factors contributed to my decision to accept this position. The first is the group of people who actually go about the business of publishing. The Senior Publisher, Nicola Gulley (and her predecessor Sophy Le Masurier); the Managing Editor, Jill Membrey; the Publishing Administrators, Nina Blakesley and Sarah Towell; the Production Editor, Katie Gerrard and their office staff form an amazing group and have managed to make the operation of the journal incredibly efficient. An index of this is the speed with which incoming manuscripts are processed. The average time between the receipt of a manuscript and its web publication, if accepted, is 130 days. This is three to five times shorter than for most other journals. A factor that contributes to this success is a responsive pool of referees that the publishing staff have as a valuable resource. Ultimately, the standard bearers of any journal are the referees. Therefore, a grateful `thank you' is due from all of us at J. Phys. D to all our referees, who diligently perform this honourable task. The Associate Editors of the journal, Professors Lawler, Margaritondo and O'Grady, also provide immense scientific leadership. They help in defining new directions for the journal and in the publishing process. Last, but not least, a remarkable asset of

  2. EDITORIAL: Greetings from the new Editor-in-Chief Greetings from the new Editor-in-Chief

    Science.gov (United States)

    Gardner, Jason S.

    2012-01-01

    As I begin my tenure as Editor-in-Chief of Journal of Physics: Condensed Matter (JPCM), I look upon this opportunity as both an honour and a real challenge. The journal is in great shape thanks to the work of my predecessors, Marshall Stoneham and David Ferry. The journal's solid reputation is based largely on the work these gentlemen have done over the past decade. The other main reason for the success of JPCM is the amazing staff in Bristol; keep up the good work, please. When discussing the journal with scientists from all corners of the globe, one thing is always mentioned—JPCM is a very reliable journal with well-written, high-quality papers, and a fast but rigorous peer-review process that provides fair, detailed and constructive referee reports for the benefit of authors. This is due almost entirely to our great authors and referees; we rely on them every day—thank you. As the new Editor-in-Chief I hope to continue to improve still further the journal's status in condensed matter science. As mentioned above, our reputation is excellent, but the reality is that we live in a world of bibliometrics and rankings. Over the past few years JPCM has been repositioned as a journal at the forefront of condensed matter physics, and the impact of the journal should increase further as a result of continued emphasis on commissioning in cutting-edge areas identified by the Editorial Board and the journal team. In addition to regular papers, JPCM has a number of other content streams that authors and readers can benefit from. Fast track communications (FTCs) offer exceptionally fast publication for work of the highest impact and urgency. By their select nature, FTCs benefit from personal treatment by the Editorial Board and the average receipt-to-first-decision time is just 11 days (the average receipt-to-publication time is just 45 days). Topical reviews in JPCM make the journal one of the most authoritative sources of review content for condensed matter physics

  3. From the Editor-in-Chief: Changes to Enhance the Author Experience

    Directory of Open Access Journals (Sweden)

    Samantha Elliott

    2014-03-01

    Full Text Available JMBE Editor-in-Chief, Dr. Samantha Elliott, thanks past volunteers for their efforts and discusses several new author enhancements related to the recently expanded scope, including video tutorials, a self-assessment tool, and a thematic issue.

  4. Associate Professor Jan Brandts, editor-in-chief of Applications of Mathematics, is fifty

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal

    2018-01-01

    Roč. 63, č. 1 (2018), s. 1-5 ISSN 0862-7940 Institutional support: RVO:67985840 Keywords : editor-in-chief Subject RIV: BA - General Mathematics Impact factor: 0.618, year: 2016 http://articles.math.cas.cz/10.21136/AM.2018.0326-17/?type=F

  5. JOSPT's Board names Dr Haxby Abbott editor-in-chief elect.

    Science.gov (United States)

    Nyland, John A

    2015-04-01

    On behalf of JOSPT's Board of Directors, President John A. Nyland is pleased to announce that J. Haxby Abbott, DPT, PhD, FNZCP, has accepted the position of editor-in-chief for JOSPT. He succeeds Guy G. Simoneau, PT, PhD, ATC, who has served in this role since the January 2002 issue.

  6. EDITORIAL: A few words from the new Editor-in-Chief A few words from the new Editor-in-Chief

    Science.gov (United States)

    Margaritondo, Giorgio

    2011-04-01

    As I begin my mandate as Editor-in-Chief of Journal of Physics D: Applied Physics, I can look back with great pleasure at many years of service, as a member of the Editorial Board, to this outstanding instrument of scientific dissemination. Having witnessed the exceptional quantitative and qualitative growth of the journal, I must consider this appointment both an honour and a real challenge. The success of the journal is primarily based on three assets: the authors' talent of course, but also the illuminated leadership of my predecessors at the journal helm and the highly competent, dedicated and responsive staff. I would like to praise, in particular, the leadership of my immediate predecessor and good friend, Pallab Battacharya, the pilot of the years of major qualitative growth. Being Pallab's successor makes my new responsibility even more challenging! The IOP personnel is a key asset for the journal: in my rather broad experience in scientific publishing, I have never seen such a combination of professional experience, commitment and willingness to innovate—a traditional strength of JPD. Regrettably, I cannot acknowledge here all the women and men who contributed to the success of the journal; however, I would like to explicitly acknowledge the outstanding work of Sarah Quin over the past decade. In my new duty, I can fortunately count on her successor, Olivia Roche, whose excellent professional and managerial qualities we can already appreciate. How should we view the future of the journal? In my view, with reasonable optimism. Notwithstanding the tough competition, our journal has a solid reputation and increasing visibility. It has consistently belonged to the small elite group of top journals preferred by applied physics authors worldwide. My program as Editor-in-Chief is both simple and very testing: to continue to enhance this elite status. The challenge comes from a variety of factors: first, 'applied physics' is a continuously evolving notion, even

  7. New Editor-in-Chief for Journal of Physics A: Mathematical and Theoretical

    Science.gov (United States)

    Gillan, Rebecca

    2014-04-01

    We are delighted to announce that Professor Martin Evans of University of Edinburgh has been appointed as the new Editor-in-Chief of Journal of Physics A: Mathematical and Theoretical. Martin Evans has been Editor of the Statistical Physics section of the journal since 2009. Prior to this, he served as a Board Member for the journal. His areas of research include statistical mechanics of nonequilibrium systems, phase transitions and scaling regimes in nonequilibrium statistical physics, glassy dynamics, phase transitions and ordering in driven diffusive systems, mass transport models, condensation models, zero range processes and exclusion processes. We very much look forward to working with Martin to continue to improve the journal's quality and interest to the readership. We would like to thank our outgoing Editor-in-Chief, Professor Murray Batchelor. Murray has worked hard and provided excellent guidance in improving the quality of the journal and the service that the journal provides to authors, referees and readers. During the last five years, we have raised the quality threshold for acceptance in the journal and currently reject over 70% of submissions. As a result, papers published in Journal of Physics A: Mathematical and Theoretical are amongst the best in the field. We have also maintained and improved on our excellent receipt-to-first-decision times, which now average under 40 days for papers. With the help of Martin Evans and our distinguished Editorial Board, we will be working to further improve the quality of the journal whilst continuing to offer excellent services to our readers, authors and referees. We hope that you benefit from reading the journal. If you have any comments or questions, please do not hesitate to contact us at jphysa@iop.org. Rebecca Gillan Publisher

  8. New Editor-in-Chief for Journal of Physics D: Applied Physics New Editor-in-Chief for Journal of Physics D: Applied Physics

    Science.gov (United States)

    2011-04-01

    The Institute of Physics is delighted to announce that the new Editor-in-Chief for Journal of Physics D: Applied Physics will be Professor Giorgio Margaritondo of École Polytechnique Fédérale de Lausanne, Switzerland. Giorgio will, with the help of his world-class Editorial Board, maintain standards of scientific rigour whilst ensuring that research published is of the highest quality. 'I would like to praise, in particular, the leadership of my immediate predecessor and good friend, Pallab Battacharya, the pilot of the years of major qualitative growth.' said Professor Margaritondo. 'Being Pallab's successor makes my new responsibility even more challenging!' Professor Margaritondo received the Laurea Summa cum Laude from the University of Rome in 1969. He has been a full professor of Applied Physics at the EPFL since 1990. In 2001, he became Dean of the EPFL Faculty of Basic Sciences. In 2004, he was nominated Provost and he served until 2010, when he became Dean of Continuing Education. He previously worked at the Italian National Research Council, at Bell Laboratories and at the University of Wisconsin-Madison. His research activity concerns the physics of semiconductors and superconductors (electronic states, surfaces and interfaces) and of biological systems; his main experimental techniques are electron spectroscopy and spectromicroscopy, x-ray imaging and scanning near-field microscopy, including experiments with synchrotron light and with free electron lasers. Author of more than 650 scientific publications and 9 books, he was also coordinator in 1995-98 of the scientific division of the Elettra synchrotron in Trieste. In 1997-2003 he was coordinator of the European Commission Round Table on synchrotron radiation. He is the president of the Council of the European Commission Integrated Initiative on Synchrotron and Free Electron Laser Science (IA-SFS and then ELISA), the largest network in the world in this domain. He is Fellow of the American Physical

  9. It may be a wise decision from ‘Editor-in-Chief and Publisher of IJAV’

    Directory of Open Access Journals (Sweden)

    Murlimanju BV

    2011-03-01

    Full Text Available Dear Sir,I read your editorial article ‘New measures taken for a better IJAV’ [1] and it seems that you have taken a wise decision for following up of the journal. As Prof. Nayak opined [2], having a processing fee for publication may discourage many authors, but in order to maintain the publication expenditures, editorial office and handling of higher number of manuscripts, you might have taken these steps. Since IJAV is an open access electronic journal, getting subscription fees from the institutions and universities is not possible. The anatomical variants are commonly encountered in day to day practice and are submitted to the journals for publication. But this is not that often with the original communications and review articles. In view of this, it may be difficult to manage a journal like IJAV as it is the only journal exclusively [3] made for publishing anatomical variations and clinical anatomy case reports. Waiving the processing fee for the authors from poor countries and students is an encouragement from the editor. Regarding the decision to provide incentives for the peer reviewers, instead of providing the money; it may be more suitable to issue a certificate from the editorial board for reviewing the case. It may help to decrease the amount of processing charge paid by the author. It’s a good idea to restrict the number of authors since most of the other reputed journal editors have opined that the authorship criteria for the case report should be four or less than four.I am very happy that IJAV has published more than hundreds of case reports within a short span of years. The map overlay of web traffic of IJAV via Google Analytics [1], which is displayed in your article, is informative and I am proud that our country ‘India’ is on higher traffic [1]. It is obvious that the Editor-in-Chief and his team deserve a big salute [4] for the hard work and efforts in bringing out the third volume. Wish the journal a bright

  10. 'Knowledge for better health' revisited - the increasing significance of health research systems: a review by departing Editors-in-Chief.

    Science.gov (United States)

    Hanney, Stephen R; González-Block, Miguel A

    2017-10-02

    How can nations organise research investments to obtain the best bundle of knowledge and the maximum level of improved health, spread as equitably as possible? This question was the central focus of a major initiative from WHO led by Prof Tikki Pang, which resulted in a range of developments, including the publication of a conceptual framework for national health research systems - Knowledge for better health - in 2003, and in the founding of the journal Health Research Policy and Systems (HARPS). As Editors-in-Chief of the journal since 2006, we mark our retirement by tracking both the progress of the journal and the development of national health research systems. HARPS has maintained its focus on a range of central themes that are key components of a national health research system in any country. These include building capacity to conduct and use health research, identifying appropriate priorities, securing funds and allocating them accountably, producing scientifically valid research outputs, promoting the use of research in polices and practice in order to improve health, and monitoring and evaluating the health research system. Some of the themes covered in HARPS are now receiving increased attention and, for example, with the assessment of research impact and development of knowledge translation platforms, the journal has covered their progress throughout that expansion of interest. In addition, there is increasing recognition of new imperatives, including the importance of promoting gender equality in health research if benefits are to be maximised. In this Editorial, we outline some of the diverse and developing perspectives considered within each theme, as well as considering how they are held together by the growing desire to build effective health research systems in all countries.From 2003 until mid-June 2017, HARPS published 590 articles on the above and related themes, with authors being located in 76 countries. We present quantitative data tracing

  11. Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    M Yavuz COŞKUN

    2013-06-01

    Full Text Available Andrejs Geske (University of Latvia, Latvia B. N. Ghosh (Eastern Med. Univ. North Cyprus Bayram Ürekli (University of Selçuk, Türkiye Erdinç Didar (American University, Bulgaria Ercan Tatlıdil (University of Ege, Türkiye Erman Artun (University of Çukurova, Türkiye Hikmet Y. Celkan (University of Gaziantep, Türkiye Hüseyin Bağcı (METU, Türkiye Jean Crombois (American University, Bulgaria Kemal Silay (Indiana University, USA Lelio Iapadre (University of L'Aquila, Italy Michael Goldman (University of Minnesota, USA

  12. Janis Huston Audin, MSc, DVM,1950-2009. Dynamic editor-in-chief of the Journal of the American Veterinary Medical Association and strong One Health advocate dies

    Directory of Open Access Journals (Sweden)

    Bruce Kaplan, DVM

    2009-09-01

    Full Text Available Dr Janis H. Audin (MSc Illinois 1975, DVM Illinois 1979, a champion of progressive veterinary medical journalism and ‘One Health’ died on 22 April 2009 following a long, courageous and difficult battle with pancreatic cancer. The world has lost a truly significant One Health leader and advocate. Under her guidance, the Journal of the American Veterinary Medical Association (JAVMA implemented a ‘one-health wonders’ column that recognised and highlighted prominent One Health individuals among the medical and veterinary medical professions in the United States. The American Veterinary Medical Association (AVMA has lost a dedicated and gifted editor-in-chief.Dr Audin joined the editorial staff of the AVMA in 1985, as an assistant editor and was promoted to associate editor in 1989 and editor in 1994. She became the editor-in-chief of both the JAVMA and the American Journal of Veterinary Research in 1995. Prior to that, Dr Audin practised as an associate veterinarian in Calumet City, Illinois, for four years.During her tenure, Dr Audin was noted for implementing procedural and technological changes in the journal to reduce costs, improve timeliness of publications and promote readership interest and awareness. New features in the News section introduced under her leadership have made the journals more practical and public health-relevant. For instance, Dr Audin fostered the United States Department of Agriculture’s Food Safety and Inspection Service (USDA-FSIS ‘Inspection Insights’ - a public health-oriented food safety monthly column related to meat, poultry and egg products - from 1996 through 1998. She also increased international manuscript submissions.On 23 March 2009 AVMA Executive Vice President Dr W. Ron DeHaven named Dr Audin as editor-in-chief emeritus of the Publications Division. Wisely, it also meant that Dr Audin could continue contributing to the staff effort to ensure the high quality of the AVMA scientific journals

  13. Mighty Mike!

    Science.gov (United States)

    Apel, Laura

    2007-01-01

    This article profiles Mike Simmel, a member of the Harlem Wizards professional basketball team and a national spokesman for Epilepsy Awareness. Mike has been diagnosed with epilepsy when he was two-years-old. At age seven, his father gave him a basketball to see if working with the ball would help him overcome his motor skills issues. Mike first…

  14. Martin Gibbs (1922-2006): Pioneer of (14)C research, sugar metabolism & photosynthesis; vigilant Editor-in-Chief of Plant Physiology; sage Educator; and humanistic Mentor.

    Science.gov (United States)

    Black, Clanton C

    2008-01-01

    The very personal touch of Professor Martin Gibbs as a worldwide advocate for photosynthesis and plant physiology was lost with his death in July 2006. Widely known for his engaging humorous personality and his humanitarian lifestyle, Martin Gibbs excelled as a strong international science diplomat; like a personal science family patriarch encouraging science and plant scientists around the world. Immediately after World War II he was a pioneer at the Brookhaven National Laboratory in the use of (14)C to elucidate carbon flow in metabolism and particularly carbon pathways in photosynthesis. His leadership on carbon metabolism and photosynthesis extended for four decades of working in collaboration with a host of students and colleagues. In 1962, he was selected as the Editor-in-Chief of Plant Physiology. That appointment initiated 3 decades of strong directional influences by Gibbs on plant research and photosynthesis. Plant Physiology became and remains a premier source of new knowledge about the vital and primary roles of plants in earth's environmental history and the energetics of our green-blue planet. His leadership and charismatic humanitarian character became the quintessence of excellence worldwide. Martin Gibbs was in every sense the personification of a model mentor not only for scientists but also shown in devotion to family. Here we pay tribute and honor to an exemplary humanistic mentor, Martin Gibbs.

  15. From the Editor in Chief...

    Directory of Open Access Journals (Sweden)

    Cemil Ozturk

    2012-05-01

    Full Text Available We are pleased to present the May-2012 issue of the Journal of Social Studies Education Research (JSSER. We would like to start with giving information about the first International Symposium on Social Studies Education: New Trends and Issues in Citizenship and Democracy Education in a Changing World’. Association for Social Studies Educators has successfully completed the first symposium in corporation with Marmara University and Council of Europe in 20-22 April 2012 in İstanbul, Turkey. The first International Social Studies Symposium took place with 250 participants from 11 different countries: Turkey, Brazil, Canada, England, The USA, Germany, France, Italy, Malaysia, Azerbaijan, Greece and Kirgizstan. There were 151 full oral and 4 poster presentations presented by the participants. This event provided opportunities for participant to exchange ideas and learn about perceptions of citizenship and citizenship education in different countries

  16. [Interview with the editor-in-chief of Nature--a decade for psychiatrie disorders. Interview by Shinsuke Koike, Atsushi Nishida, Syudo Yamasaki and Shuntaro Ando].

    Science.gov (United States)

    Campbell, Philip

    2012-01-01

    Nature is the most frequently cited interdisciplinary science journal globally; however, it has recently begun publishing impressive reviews and special topics in the fields of mental health and psychiatric disorders. An editorial entitled, "A decade for psychiatric disorders" was published on the first page of the first 2010 issue of Nature. This editorial was a significantly symbolic publication; not only did it have an impressive title, but also consisted of precise and appropriate content in accordance with the present conditions and future perspectives of psychiatric disorders. This was of further significance as it was published on the first page of the first 2010 issue. In this report, we review an interview with the author of the editorial and the editor-in-chief of Nature, Dr. Philip Campbell. He explained to us the reason for Nature increasingly publishing articles in the fields of mental health and psychiatric disorders, and the reason for this editorial being published in this impressive space. He opined that, although the pathophysiology of psychiatric disorders has been gradually revealed through scientific progress in most research fields, a big gap remains between cancer and psychiatric disorders with regard to health policy and research conditions. The entire editorial team of Nature believed that they could contribute in some way to bridge this gap. He was of the opinion that the media should be apprised with appropriate information on psychiatric disorders by mental health researchers in order to dispel the stigma associated with these disorders and create awareness of the importance of mental health among the public. He drew our attention to the recent brilliant progress in neuroscience research and the future perspectives of mental health research; this trend was notably observed in recent articles in Nature. The concluding sentence in "A decade for psychiatric disorders" is, "Yet the exposure of many psychiatrists to contemporary biology is

  17. In memoriam: Janis Huston Audin, MSc, DVM, 1950-2009. Dynamic editor-in-chief of the Journal of the American Veterinary Medical Association and strong One Health advocate dies.

    Science.gov (United States)

    Kaplan, Bruce

    2009-01-01

    Dr Janis H. Audin (MSc Illinois 1975, DVM Illinois 1979), a champion of progressive veterinary medical journalism and 'One Health' died on 22 April 2009 following a long, courageous and difficult battle with pancreatic cancer. The world has lost a truly significant One Health leader and advocate. Under her guidance, the Journal of the American Veterinary Medical Association (JAVMA) implemented a 'one-health wonders' column that recognised and highlighted prominent One Health individuals among the medical and veterinary medical professions in the United States. The American Veterinary Medical Association (AVMA) has lost a dedicated and gifted editor-in-chief. Dr Audin joined the editorial staff of the AVMA in 1985, as an assistant editor and was promoted to associate editor in 1989 and editor in 1994. She became the editor-in-chief of both the JAVMA and the American Journal of Veterinary Research in 1995. Prior to that, Dr Audin practised as an associate veterinarian in Calumet City, Illinois, for four years. During her tenure, Dr Audin was noted for implementing procedural and technological changes in the journal to reduce costs, improve timeliness of publications and promote readership interest and awareness. New features in the News section introduced under her leadership have made the journals more practical and public health-relevant. For instance, Dr Audin fostered the United States Department of Agriculture's Food Safety and Inspection Service (USDA-FSIS) 'Inspection Insights' - a public health-oriented food safety monthly column related to meat, poultry and egg products - from 1996 through 1998. She also increased international manuscript submissions. On 23 March 2009 AVMA Executive Vice President Dr W. Ron DeHaven named Dr Audin as editor-in-chief emeritus of the Publications Division. Wisely, it also meant that Dr Audin could continue contributing to the staff effort to ensure the high quality of the AVMA scientific journals while the Association began a

  18. From the Editor-in-Chief

    African Journals Online (AJOL)

    cervical cancer screening and practice in low-resource countries with ... and testing for gynecological cancers explored in another study from the ... statistics. His article noted that majority are avoidable, thus necessitating training in modern methods of fetal surveillance and improved efficiency of our health delivery systems.

  19. Letter of Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Reza Bagheri

    2014-02-01

    Full Text Available Dear colleagues, Welcome to the fourth issue of the Journal of Cardio-Thoracic Medicine. We are grateful that with support and cooperation of our dear colleagues, the first year of JCTM publication passed successfully. We are expecting to promote the indexing of Journal of Cardio-Thoracic Medicine in the following year. In this issue, a valuable review article has been written by Dr.Corlateanu and colleagues, about the overlap syndrome between Asthma and Chronic Obstructive Pulmonary Disease. Due to the importance of these two conditions, I highly recommend you to read this article.  Moreover, same as the previous issues, several original articles and an interesting case report have been published. We appreciate the collaboration of our international colleagues from Turkey and Moldova in this issue. Again, I would like to thank all of our colleagues for submitting their valuable studies to Journal of Cardio-Thoracic Medicine.I hope you will find the articles interesting to read.

  20. From the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Ibrahim Baggili

    2014-12-01

    Full Text Available Welcome to JDFSL’s fourth and final issue for 2014!First, I would like to thank our editorial board, reviewers, and the JDFSL team for bringing this issue to life. It has been a big year for JDFSL as the journal continues to progress. I would like to highlight our critical achievements for 2014 before touching onthe papers that were accepted in this issue:    1. JDFSL has gone to a fully open access model without author payment through support from academic institutions.    2. JDFSL has formed and continues to form partnerships with various conferences that relate to cyber security and forensics.    3. JDFSL has improved its indexing and the editorial staff and publisher are pushing hard to get the journal indexed by as many reputable indexing servicesas possible.    4. JDFSL has revamped its Web site.    5. JDFSL welcomed new members to the editorial board    6. JDFSL’s Web site and various articles gained more visibility due to media backlinks.It is critical to note that these achievements would have not been possible without the support of the digital forensics community and all JDFSL stakeholders. I would like to thank each and every person that has been involved in pushing the boundaries of open access publishing in our domain, while maintaining rigor, quality and feasibility.

  1. From the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Simeon Oka

    2010-01-01

    Full Text Available The Editorial Board of the journal Thermal Science is continuing to pay great attention to the processes in internal combustion engines, both due to their environmental impact and ability to use renewable energy sources i. e. different types of biofuels. Concerning that motor vehicles contribute about 14% of the global CO2 emission, it is understandable that many research efforts are devoted to processes in internal combustion engines and use of biofuels. The number of submitted papers dealing with processes in internal combustion engines is growing from months to months, so in the journal Thermal Science also will published in 2011 one issue devoted to the same topics. Papers submitted are already in the reviewing process. Professor Dragoslava Stojiljkovi} and Professor Stojan Petrovi} as Guest editors, had again a difficult task to make appropriate choice of the papers, covering wide range of topics. I am very grateful to Guest editors for their extremely competent choice of the topics and papers. Reviewers of the papers made, also, tremendous contributions to the quality of the papers published. This time, also, as in No. 3, 2009, we asked experts in traffic engineering to give their contribution. They pointed out importance of the internal combustion engine energy efficiency, vehicle fleet operation management and logistic efficiency, and painted large scale picture of the environmental problems caused by large density traffic. We hope that this point of view will make new impulse for many new joint projects with the aim to investigate impact of the processes in internal combustion engines and logistic of motor fleet management, and organization of traffic flows, especially in large towns, on environment. Papers devoted to the thermal processes in internal combustion engines are grouped in Part one of this issue. Due to large number of papers accepted for publication, we have been forced to introduce Part two, in which are grouped selected papers dealing with problems in fluid dynamic and heat transfer of possible interest in design of the internal combustion engines.

  2. From the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Simeon Oka

    2010-01-01

    Full Text Available Dear readers of the journal Thermal Science This year we have for the first time a Supplement issue. There are many reasons for introducing Supplement issues besides the four regular issues in the Volume each year. This will be editorial policy in the next years. This year we have great increase of the number of submitted papers, and at the same time very interesting proposals of distinguished researchers to dedicate whole issue to the some modern and interesting scientific topics. The only solution is to have, one or more, Supplement issues in the year. Supplement issue to the Vol. 14, 2010, has several important characteristics. Supplement issue 2010, is devoted to the 50th anniversary of the Faculty of Mechanical Engineering, University of Kragujevac, Serbia. In the issue are presented the most important scientific and engineering results achieved in last several years by the Department of energy and process engineering of the Faculty. Some of the papers selected for this issue present also the results achieved in joint research of researchers of this Department and researches from other Universities in Serbia. To distinguish 50th anniversary of some research and education institution is the best opportunity to fulfil one of the main tasks of the journal Thermal Science, proposed even at the very beginning of the foundation of this journal, namely, to promote the best scientific results achieved in Serbia, and later also in the South-East European countries. If for education of the qualified researcher is necessary 10-15 years, for scientific institution to become mature, and to give recognized scientific results it is necessary to pass two or three in house made generations of the researchers. For this process about 50 years is necessary, and this is the reason why we accepted proposal of the Dean Professor Dr. Miroslav Babić, to devote one issue of the journal Thermal Science to the part of the scientific results achieved by the researcher affiliated at the Faculty of Mechanical Engineering in Kragujevac. Guest editor, Professor Dr. Milun Babić, had an extremely difficult job to make proper selection of papers, representing research results of his Department and Faculty of Mechanical Engineering, not only in fundamental and applied research, but also in practical applications. I am greatly thankful to him since he presented not only most interesting scientific results, but also cases of best practise realized on the basis of the research results. At the same time, in his introductory review paper he explain research policy in the field of thermal sciences, energy efficiency and use of renewable energy sources having the main aim to solve more important energy and environmental problems of the local community, as well as to introduce energy management, environmental management, and sustainable development. This is one of the main characteristics of the set of papers selected by Guest editor for this Supplement issue. Realization of the full chain – fundamental research, applied research development and demonstration (R&D&D is not too often, especially in developing countries. I hope, that paper selection that made for this issue by Guest editor Professor Dr. Milun Babić, in many cases evidently presents that it is possible, even with small funds available in Serbia.

  3. From the Editor-in-Chief

    Directory of Open Access Journals (Sweden)

    Simeon Oka

    2011-01-01

    Full Text Available In the year 2011 Editorial Board of the journal Thermal Science continues with the policy to prepare special issues, Supplements, devoted to the specific, actual scientific topics. Supple ments, issued besides four regular issues per year, have double role in publishing the journal Thermal Science: from one side Supplemental issues gives possibility to present to readers most interesting topics, and from the other side it is possible to publish greater number of papers, following permanent growing interest of the researchers to publish results of their investigations in our journal. Following those ideas, Editorial Board with greatest interest accepted proposal of the organizer of the Mini-symposium on Analytical Methods for Thermal Science, Professor Ji-Huan He and Shanghai Modern Textile Institute, to pre pare special issue with selected papers presented this Symposium. More over, to devote special issue of the journal Thermal Science, to analytical methods, seems to be very challenging, in this era of numerical models and commercial CFD software, used by every researcher, even at the beginning of the professional career. The beginners in investigations think that by numerical modelling it is possible to solve every physical problem, in thermal sciences, too. After wards, they realize that it is not the case, and that other scientific tools, experiments, and analytical methods can not be avoided, and even give better and more correct physical explanation of the processes. For those reasons, my personal opinion is that this issue of the journal Thermal Science is especially important, and will present new impulse for increasing quality of the journal. Papers presented at Symposium "Analytical Methods for Thermal Science", in the frame of the 3rd International Symposium on Nonlinear Dynamics, September 25-28, 2010, Shanghai, China, and selected for this special issue, convey a strong, reliable, efficient, and promising development of thermal science. Included herein is a collection of original refereed research papers by well-established researchers in the field of nonlinear science. We hope that these papers will prove to be a timely and valuable reference for researchers in this area. Analytical approach to thermal science is challenging and promising, and is playing an even more important role in optimal design of various thermal problems. Considering this fact, selection of the papers for this special issue has the aim to show illustrating approaches to various thermal problems by various methods including fractal geometry and fractional calculus, and the present special issue can be used as paradigms for many other applications. I am deeply grateful to the Guest editors, Professor Ji-Huan He (now with National Engineering Laboratory of Modern Silk, Soochow University, Suzhow, China and Professor Lianchun Zheng (Department of Mathematics and Mechanics, University of Science and Technology Beijing, Beijing, China, for excellent paper selection, the job which is at the same time highly professional and delicate. I am sure, that readers will obtain realistic insight in how to apply the methods presented in this special issue to various problems.

  4. Interview with Mike Shaughnessy

    Science.gov (United States)

    Rossman, Allan; Shaughnessy, Mike

    2013-01-01

    Mike Shaughnessy is Professor Emeritus of Mathematics and Statistics at Portland State University in Oregon. He served as co-chair for the Board for the Special Interest Group for Research in Mathematics Education of the American Educational Research Association from 2005-2007. A member of the Board of Directors of the National Council of Teachers…

  5. From the desk of the Editor-in-Chief

    Science.gov (United States)

    2014-10-01

    Launching a new journal is never an easy endeavor. With the publication of this issue of the Life Sciences in Space Research, our new Journal has gotten off to an excellent start with thirty scholarly articles published since its inception and a steady stream of submissions. At the 40th COSPAR assembly held at the picturesque campus of Moscow State University in early August, Elsevier sponsored an inaugural event to promote the launching of the journal, an event that was well attended if one were to use how fast the food platter disappeared as a yardstick. In addition, at the recent Radiation Research Society meeting in Las Vegas in the U.S., Elsevier had an exhibition booth (picture), which was visited by many of the NASA and ESA funded scientists attending the meeting.

  6. Editorial | Editor-in-Chief | Filosofia Theoretica: Journal of African ...

    African Journals Online (AJOL)

    Filosofia Theoretica: Journal of African Philosophy, Culture and Religions. Journal Home · ABOUT · Advanced Search · Current Issue · Archives · Journal Home > Vol 2, No 2 (2013) >. Log in or Register to get access to full text downloads.

  7. Introducing Theranostics Journal - From the Editor-in-Chief

    Science.gov (United States)

    Chen, Xiaoyuan (Shawn)

    2011-01-01

    Theranostics is a multidisciplinary journal that publishes innovative and original research papers reflecting the field of molecular imaging, molecular therapeutics, multifunctional nanoparticle platforms, image-guided therapy, and translational nanomedicine. A broad spectrum of biomedical research that can be applied to future theranostic applications is encouraged. PMID:21547150

  8. Introducing Theranostics Journal - From the Editor-in-Chief

    OpenAIRE

    Xiaoyuan Chen

    2011-01-01

    Theranostics is a multidisciplinary journal that publishes innovative and original research papers reflecting the field of molecular imaging, molecular therapeutics, multifunctional nanoparticle platforms, image-guided therapy, and translational nanomedicine. A broad spectrum of biomedical research that can be applied to future theranostic applications is encouraged.

  9. Guidelines for Contributors | Editor-in-Chief | Ghana Journal of ...

    African Journals Online (AJOL)

    PLEASE follow these guidelines closely when preparing your paper for submission. The editors reserve the right to reject inadequately prepared papers. All areas of linguistics are invited – the journal is not limited to articles on languages of or in Ghana or Africa.

  10. From the desk of the Editor-in-Chief

    Science.gov (United States)

    Hei, Tom K.

    2015-07-01

    Life Sciences in Space Research had a prominent presence at the International Congress of Radiation Research (ICRR) meeting held in Kyoto, Japan from May 25th-29th, with seven of the eleven editors attending the meeting. A journal booth was also put up at the pre-ICRR satellite meeting on Space Radiation and Heavy Ions in Therapy (SRHITS) held a few days earlier in Osaka. Since the inception of LSSR last year, the editors and publisher have promoted the journal at a number of major conferences including COSPAR 2014 in Moscow, the annual meeting of the Radiation Research Society and the NASA Space Radiation Investigators Meeting. These efforts have increased awareness of the journal among investigators in space life sciences and related fields. The number of monthly downloads of articles from the journal website averages 2000, a respectable number for a brand new journal.

  11. Greetings from the new Editor-in-Chief, Ronald Stambaugh Greetings from the new Editor-in-Chief, Ronald Stambaugh

    Science.gov (United States)

    Stambaugh, Ronald

    2012-04-01

    I am very pleased to join the outstanding leadership team for the journal Nuclear Fusion as Scientific Editor. The journal's high position in the field of fusion energy research derives in no small measure from the efforts of the IAEA team in Vienna, the production and marketing of IOP Publishing, the Board of Editors led by its chairman Mitsuru Kikuchi, the Associate Editor for Inertial Confinement Max Tabak and the outgoing Scientific Editor, Paul Thomas. During Paul's five year tenure submissions have grown by over 40%. The usage of the electronic journal has grown year by year with about 300 000 full text downloads of Nuclear Fusion articles in 2011, an impressive figure due in part to the launch of the full 50 year archive. High quality has been maintained while times for peer review and publishing have been reduced and the journal achieved some of the highest impact factors ever (as high as 4.27). The journal has contributed greatly to building the international scientific basis for fusion. I was privileged to serve from 2003 to 2010 as chairman of the Coordinating Committee for the International Tokamak Physics Activity (ITPA) which published in Nuclear Fusion the first ITER Physics Basis (1999) and its later update (2007). The scientific basis that has been developed to date for fusion has led to the construction of major facilities to demonstrate the production of power-plant relevant levels of fusion reactions. We look forward to the journal continuing to play a key role in the international effort toward fusion energy as these exciting major facilities and the various approaches to fusion continue to be developed. It is clear that Nuclear Fusion maintains its position in the field because of the perceived high quality of the submissions, the refereeing and the editorial processes, and the availability and utility of the online journal. The creation of the Nuclear Fusion Prize, led by the Board of Editors chairman Mitsuru Kikuchi, for the most outstanding paper published in the journal each year has furthered the submission and recognition of papers of the highest quality. The accomplishments of the journal's team over the last five years will be a tough act to follow but I look forward to working with this competent and dedicated group to continue the journal's high standards and ensure that Nuclear Fusion remains the journal of choice for authors and readers alike.

  12. EDITORIAL: Greetings from the new Editor-in-Chief Greetings from the new Editor-in-Chief

    Science.gov (United States)

    Corkum, Paul

    2011-01-01

    As a journal that reports advances in atomic, molecular and optical science (AMO), Journal of Physics B: Atomic, Molecular and Optical Physics (J. Phys. B) provides the AMO research community with three unique fora: topical reviews, tutorials and special issues. Developed under the leadership of editor Jan Michael Rost and his Editorial Board, these sections have cemented J. Phys. B's reputation as a major journal showcasing the AMO community's advances. For me, an AMO scientist, it is therefore a special pleasure to be entrusted with continuing the tradition of excellence established by Jan Michael and the Editorial Board. I intend to build on this foundation by ensuring that the journal makes full use of these tools. Topical reviews: a unique focus When J. Phys. B becomes the first journal you turn to for initial reviews about important emerging areas in your field, we as an Editorial Board will have succeeded. To us, a topical review is different from a traditional review—a topical review focuses on emerging sub-fields of AMO physics. Its function is to alert and educate our readers about emerging opportunities. Topical reviews can also serve a closely related function for readers: keeping us up-to-date with critical technologies that lie slightly outside our own fields, such as advances in free-electron lasers science, (which will surely affect our field). Our overall goal is to make your research more productive because of the topical reviews you read within the journal. Tutorials J. Phys. B tutorials are aimed at graduate students or researchers venturing into a new field. Just as in my own research group I encourage all graduate students to write their theses in a way that will be useful to both future graduate students and the larger community beyond my group, J. Phys. B has designed tutorials to fill this function on the journal scale. Thus, tutorial authors are able to write in greater depth than can be included in a paper in nature, science or in the regular pages of J. Phys. B. Often a professor and student will collaborate on a tutorial while the student is writing a thesis. Our challenge as an Editorial Board is to identify the most important topics and most talented authors for such tutorials. Special issues Authors find it uniquely appealing to publish in J. Phys. B special issues, because these issues feature a concentration of papers on a selected topic. This concentration draws attention to all papers in the special issue. However, a special issue never takes over the entire publication, and all J. Phys. B special issue articles are reviewed in the usual way. As an Editorial Board, we will look for emerging sub-fields which have reached a level of maturity that would benefit from a special issue. Suggestions from you, our colleagues As an AMO scientist, I myself am widely informed about my own speciality of attosecond science, but not necessarily up-to-date on emerging advances in other AMO specialities. The Editorial Board and I need your suggestions for special issues, for topical reviews, for tutorials, and for how we can improve J. Phys. B further still. So please email your suggestions, backed by your explanation of why the sub-field is important. Although we cannot guarantee that we will accept all suggestions, I do promise that the Editorial Board will seriously consider every one of them. J. Phys. B's publication process Producing a regular publication is an arduous process. It is the staff who carry out the day-to-day processes on which reliable production depends. They see that your paper is reviewed and published quickly. They are dedicated to serving your specialized needs. The editor's and the Board's role is to serve as a conduit: we help the staff understand the specialized needs of the science community and help the science community to understand the specialized nature of publishing. Looking ahead to my five years as editor, I hope they will be as successful as those of my predecessor, Jan Michael Rost. Jan Michael has steered the journal through the many changes that have occurred in scientific publishing in recent years. While every scientific journal searches for new ways to better-serve its readers, J. Phys. B has developed unique services that can make us scientists more productive. That is the highest accolade I can possibly give to Jan Michael as I begin to build on the strong foundation that he has put in place.

  13. Interview with Mike Parker Pearson

    Directory of Open Access Journals (Sweden)

    Thomas J. T. Williams

    2013-02-01

    Full Text Available Mike Parker Pearson is the Institute of Archaeology’s newly appointed Professor of British Later Prehistory. In this interview he reflects on his experience at the birth of post-processualism, current problems and opportunities in modern archaeology, and the subject for which he is best known: Stonehenge.

  14. Mike Garant Ameerika ühiskonna probleemidest

    Index Scriptorium Estoniae

    2000-01-01

    44. nädalal külastas inglise keele õppetooli dr Mike Garant Helsingi ülikoolist. Mike Garant käsitles oma loengutes multikulturaalse Ameerika ühiskonna probleeme (mobiilsus, identiteet, keel) : [täistekst

  15. An interview with Mike Levine.

    Science.gov (United States)

    Levine, Mike; Vicente, Catarina

    2015-10-15

    Mike Levine, director of the Lewis-Sigler Institute for Integrative Genomics at Princeton University, is a developmental biologist who has dedicated his career to understanding how gene expression is regulated during development. Some of his most significant research, such as the co-discovery of the homeobox genes and his work on even skipped stripe 2, was performed in Drosophila, but he has since branched out to Ciona intestinalis, which he is using as a model to understand how vertebrate features have evolved. We had a lively chat with Mike at this year's Society for Developmental Biology (SDB) meeting, where he was awarded the Edwin Grant Conklin Medal. © 2015. Published by The Company of Biologists Ltd.

  16. Mike Pentz showing visitors around CESAR

    CERN Multimedia

    CERN PhotoLab

    1964-01-01

    Mike Pentz, leader of the CESAR Group, shows visitors around the 2 MeV electron storage ring. Here they are in the vault of the injector (a 2 MV van de Graaff generator), next to the 2 beam lines, one leading to the ring, the other to the spectrometer.

  17. EDITORIAL: Editorial from the new Editor-in-Chief for 2014 Editorial from the new Editor-in-Chief for 2014

    Science.gov (United States)

    Graham, W. G.

    2014-02-01

    I am honoured to take on the leadership of Plasma Sources Science and Technology (PSST) as the successor to Professor Mark J Kushner, with whom I have had the pleasure to work on the journal for many years. Under Mark's insightful and energetic leadership over the last six years, PSST has cemented its position as the journal of choice within its subject area and is now one of the most successful journals in the field. In this first issue of 2014, I would like to reflect on some of the events and achievements of 2013. At the start of the year the PSST Editorial Board, recognizing the vital importance of atomic, molecular and optical (AMO) data to low-temperature plasma physics, agreed that PSST would accept papers reporting such new data, generated through both experiment and theory. Jonathan Tennyson joined the Editorial Board to represent this area. In March Anne Bourdon joined the Associate Editor team and has since then played a key part in the journal's review process alongside our other Editors. During the autumn, PSST moved to a new editorial management system. In December Deborah O'Connell was awarded the 2013 Hershkowitz Early Career Award and Review and joins the Editorial Board as of 2014. I would also like to thank Miles Turner for his work in leading the drafting of a guide on the details necessary in the reporting of the results of computer simulations; the main conclusions of this report have been incorporated into the journal policy. Overall 2013 has been another successful year for PSST; paper submissions were up by 8% on the previous year and there was the highest ever number of downloads of PSST papers in one year. Another noteworthy feature of 2013 was the continuing improvement in publication times while maintaining our high standards for acceptance and providing expert feedback coupled with encouragement particularly to younger researchers and groups. Largely as a result of the hard work of our referees and Associate Editors, the average time from receipt-to-first decision of a paper is only 50 days. In 2014 we will continue to support the low-temperature plasma physics community through the publication of special topical issues. Those already scheduled for next year are: Transport in B-fields in low temperature plasmas, Guest Editors: Rod Boswell and Igor D Kaganovich Spots and patterns on electrodes of gas discharges, Guest Editors: Mikhail S Benilov and Ulrich Kogelschatz Interaction of electromagnetic waves with low temperature plasmas, Guest Editors: Osamu Sakai and Shahid Rauf We will also launch a new feature: LabTalks, a way in which our authors can showcase their group's work and communicate their research published in PSST to a wider audience. Full details are on the PSST website. Along with the leadership team, made up of Associate Editors, Anne, Nick and Richard and the great PSST staff at Institute of Physics Publishing, led by Alice Malhador, I will strive to grow, improve and deliver a journal which reflects the excellent science from the low-temperature plasma community. We hope we can continue to count on your vital support as authors and referees.

  18. Autogrammid, oma aja märk / Mike Lawrence

    Index Scriptorium Estoniae

    Lawrence, Mike

    2004-01-01

    Autogrammide kogumisest, nende ehtsusest, sportlastele kuulunud esemete kollektsioneerimisest. Lisatud: Kollektsionääride maiuspalu. Autor Mike Lawrence on oksjonifirma Bonhams/Brooks konsultant, ajakirjanik

  19. Fact Sheet: Roles and Responsibilities of One EPA Web Editors-in-Chief (EICs)

    Science.gov (United States)

    Skills and abilities expected of EICs include project management, communication, leadership, and problem solving. The EIC is responsible to serve as the lead for their web topic, and coordinate content development and maintenance.

  20. [Constant Charles Delprat, editor-in-chief of the Dutch Journal of Medicine 1889-1896].

    Science.gov (United States)

    van 't Hof, S E

    2007-06-09

    Constant Charles Delprat (1854-1934) was a general practitioner and for many years a central figure in the Vereeniging Nederlandsch Tijdschrift voor Geneeskunde (Dutch Journal of Medicine Society). He was particularly interested in bacteriology and travelled to Berlin in 1890 to obtain tuberculin, which was said to cure tuberculosis patients, but he returned empty handed. He reported this experience in the Journal. One of his other interests was medical history. Today, he is mainly remembered for writing the history of the first 50 years of the Journal and of the Dutch medical periodicals prior to 1857, the year that the Dutch Journal of Medicine was first published.

  1. Mike"s Conker: a collaborative nonlinear knowledge elicitation repository for mobile HCI practitioners

    Science.gov (United States)

    Mohamedally, Dean; Edlich, Stefan; Zaphiris, Panayiotis; Petrie, Helen

    2005-03-01

    In the field of Human Computer Interaction (HCI), we use a variety of Knowledge Elicitation (KE) techniques to capture user cognitive issues e.g. via interviews, paper prototyping, card sorting, focus group debates and more. MIKE (Mobile Interactive Knowledge Elicitation) is an ongoing research direction to enhance the KE capabilities of HCI practitioners via mobile and electronic methods. MIKE tools are a suite of Mobile HCI software and hardware configurations for a variety of mobile platforms. With MIKE's CONKER we describe a Collaborative Non-linear Knowledge Elicitation Repository for HCI practitioners. Its intention is to provide a scalable infrastructure for supporting the management and collaborative retrieval of mobile based KE datasets. Some of its functional design requirements include HCI practitioner profiles management, managing experimental progress from dispersed mobile HCI teams, timetabling expenditures for time critical empirical capture and participant management, and enabling concurrent HCI specialists to compare elicited mobile data. Further expansion of the CONKER system will include incorporation of distributed psychometric analysis methods. CONKER is realized as a sourceforge-alike Web-Portal using state-of-the-art web-framework technologies. We describe several approaches to the capturing and management of HCI data and how CONKER makes this available to the HCI community.

  2. Modeling Spitsbergen fjords by hydrodynamic MIKE engine.

    Science.gov (United States)

    Kosecki, Szymon; Przyborska, Anna; Jakacki, Jaromir

    2013-04-01

    Two Svalbard's fjords - Hornsund (on the western side of the most southern part of Spitsbergen island) and Kongsfjorden (also on the western side of Spitsbergen island, but in the northern part) are quite different - the first one is "cold" and second one is "warm". It is obvious that both of them are under influence of West Spitsbergen Current (WSC), which curry out warm Atlantic water and cold East Spitsbergen Current detaches Hornsund. But there is also freshwater stored in Spitsbergen glaciers that have strong influence on local hydrology and physical fjord conditions. Both, local and shelf conditions have impact on state of the fjord and there is no answer which one is the most important in each fjord. Modeling could help to solve this problem - MIKE 3D model has been implemented for both fjords. Mesh-grid of the each fjord has been extended for covering shelf area. External forces like tides, velocities at the boundary and atmospheric forces together with sources of cold and dens fresh water in the fjords will give reliable representation of physical conditions in Hornsund and Kongsfjorden. Calculations of balances between cold fresh water and warm and salt will provide additional information that could help to answer the main question of the GAME (Growing of the Arctic Marine Ecosystem) project - what is the reaction of physically controlled Arctic marine ecosystem to temperature rise.

  3. Kriis kui võimalus / Mike Seymour ; interv. Kristo Kiviorg

    Index Scriptorium Estoniae

    Seymour, Mike

    2008-01-01

    Riskijuhtimise ja kriisikommunikatsiooni spetsialist Mike Seymouri sõnul on infoühiskonna areng pannud ettevõtted olukorda, kus nad peavad olema iga hetk valmis sattuma enda suhtes vaenulikult meelestatud avalikkuse tähelepanu alla. Vt. samas: Urve Vilk. Eesti ettevõtete valmisolek kriisikommunikatsiooniks on madal

  4. Words of the Editor-in-Chief — Academic discussion is an effective measure to promote scientific development

    Directory of Open Access Journals (Sweden)

    Zeng-Zhao Feng

    2017-07-01

    Full Text Available Van Loon et al.'s paper “The response of stromatolites to seismic shocks: Tomboliths from the Palaeoproterozoic Chaibasa Formation, E India” with a new term “tomboliths” and original viewpoints should be published, but some contents need to be discussed. Shanmugam's paper “The response of stromatolites to seismic shocks: Tomboliths from the Palaeoproterozoic Chaibasa Formation, E India: Discussion and liquefaction basics” pointed out some queries and problems about Van Loon et al.'s paper. It is an academic discussion paper and should be published as well. However, some main problems, such as the new term “tomboliths” and its origin of seismic shocks, “whether stromatolites or tomboliths are soft-sediment deformation structures or not”, etc., also need to be discussed. Academic discussion is an effective measure to promote scientific development. The more thorough academic discussions are carried out regarding academic problems, the more scientific facts and truths will become clear. All participants in this discussion are contributors. It is active to carry out the policy of “A hundred flowers blossom and a hundred schools of thought contend” by our Journal of Palaeogeography.

  5. Mike Davis, guérilla dans les sciences sociales.

    Directory of Open Access Journals (Sweden)

    Yveline Lévy-Piarroux

    2009-03-01

    Full Text Available « La plaine est morne et morte ― et la ville la mange. » Emile Verhaeren, « La plaine » in Les villes tentaculaires Le titre anglais de l’ouvrage de Mike Davis et Daniel B. Monk est Evil Paradises: Dreamworlds of Neoliberalism (2007. Les traducteurs ont conservé l’oxymore de la première formulation. Les « mondes de rêve » sont devenus « les villes hallucinées », allusion croisée à deux recueils de poésie d’Émile Verhaeren, Les campagnes hallucinées (1893 ...

  6. Reduction of Waste Water in Erhai Lake Based on MIKE21 Hydrodynamic and Water Quality Model

    OpenAIRE

    Changjun Zhu; Qinag Liang; Feng Yan; Wenlong Hao

    2013-01-01

    In order to study the ecological water environment in Erhai Lake, different monitoring sections were set to research the change of hydrodynamics and water quality. According to the measured data, MIKE21 Ecolab, the water quality simulation software developed by DHI, is applied to simulate the water quality in Erhai Lake. The hydrodynamics model coupled with water quality is established by MIKE21FM software to simulate the current situation of Erhai Lake. Then through the comparison with the m...

  7. Validating Stormwater system simulations in Edmonton Using MIKE URBAN

    Science.gov (United States)

    Gaafar, M.

    2016-12-01

    Many municipalities use chloramination to disinfect drinking water so as to avert the production of the disinfection by-products (DBPs) that result from conventional chlorination processes and the consequential public health risks. However, the long-lasting monochloramine disinfectant (NH2Cl) can pose a significant risk to the environment. As, it can be introduced into stormwater sewers and thus freshwater sources. This study was intended to investigate decay of NH2Cl in stormwater networks starting by building a stormwater model and validating its hydraulic and hydrologic computations, and then modelling water quality in the storm sewers. The presented work here is only the first stage of this study. The 30th Avenue basin in Edmonton was chosen as a case study, because it has various land-use types including commercial, industrial, residential and parks. The City of Edmonton has already built a MIKE-URBAN stormwater model for modelling floods. However, this model was built to the trunk level where only the main drainage features were presented. Also, this model was not calibrated and known to consistently compute pipe flows higher than the observed values; not to the benefit of studying water quality. So the first goal was to complete modelling and updating the real stormwater network. Then, available GIS Data was used to calculate different catchment properties such as slope, length and imperviousness. To calibrate and validate this model, data of two temporary pipe flow monitoring stations was used along with records of two other permanent stations available for eight consecutive summer seasons. The effect of various hydrological parameters on model results was investigated. It was found that model results were affected by the ratio of impervious areas. The catchment length was tested, however calculated, because it is approximate representation of the catchment shape. Surface roughness coefficients were calibrated using. Consequently, computed flows at the two

  8. A Micro-Frame Analysis of the On-Camera/On-Mike Paralinguistic Behavior of Three Presidential Candidates.

    Science.gov (United States)

    Carey, John Thomas

    This study examined the paralinguistic behavior of three presidential candidates in on-camera and on-mike speeches made during their campaigns. Using tape recordings, a detailed micronotation was made of candidates' paralinguistic patterns, both while speaking on-camera and on-mike and while speaking under circumstances that were not for a mass…

  9. Puudega inimesed tahavad tööd teha / Mike Buckley

    Index Scriptorium Estoniae

    Buckley, Mike

    2003-01-01

    PHARE nõuniku Mike Buckley hinnangul kipuvad toetuste- ja pensionisüsteemid eeldama, et puudega inimesed ei ole suutelised töötama, samas näitavad küsitlused, et kolmandik neist sooviks töötada

  10. The ‘Bravo Mike Syndrome’: Private Security Culture and Racial Profiling in South Africa

    NARCIS (Netherlands)

    Diphoorn, T.G.

    2017-01-01

    This article analyses how issues of race influence the occupational culture of the armed response sector, a particular part of the private security industry, in Durban, South Africa. In addition to analysing the racial hierarchy of the industry, this article examines the ‘Bravo Mike Syndrome' –

  11. The ‘Bravo Mike Syndrome' : Private security culture and racial profiling in South Africa

    NARCIS (Netherlands)

    Diphoorn, T.

    2017-01-01

    This article analyses how issues of race influence the occupational culture of the armed response sector, a particular part of the private security industry, in Durban, South Africa. In addition to analysing the racial hierarchy of the industry, this article examines the ‘Bravo Mike Syndrome' –

  12. Comments on Mike Rose's Essay "Rethinking Remedial Education and the Academic-Vocational Divide"

    Science.gov (United States)

    Goldrick-Rab, Sara

    2012-01-01

    The struggle over whether all students have a right to a high-quality, affordable college education, or whether it is a privilege they must "earn" through high test scores and parental savings for tuition, plays out daily in the so-called "remedial" or "developmental" classes. This article presents the author's comments on Mike Rose's essay…

  13. Development of a GPU-accelerated MIKE 21 Solver for Water Wave Dynamics

    DEFF Research Database (Denmark)

    Aackermann, Peter Edward; Pedersen, Peter Juhler Dinesen; Engsig-Karup, Allan Peter

    2013-01-01

    With encouragement by the company DHI are the aim of this B.Sc. thesis1 to investigate, whether if it is possible to accelerate the simulation speed of DHIs commercial product MIKE 21 HD, by formulating a parallel solution scheme and implementing it to be executed on a CUDA-enabled GPU (massive...

  14. Simulating Wind Driven Waves in the Strait of Hormuz using MIKE21 (Simulasi Gelombang Angin di Selat Hormuz Menggunakan MIKE21

    Directory of Open Access Journals (Sweden)

    Faeghe Eslami Mehdiabadi

    2015-03-01

    Full Text Available Daerah pesisir di bumi adalah salah satu zona paling dinamis yang dipengaruhi oleh berbagai parameter seperti gelombang, arus, dan badai. Untuk mengelola serta mengkontrol zona tersebut adalah penting untuk mempelajari hidrodinamika daerah. Penelitian ini menggunakan MIKE 21/3 coupled Model FM untuk melihat gelombang (wind driven waves di sekitar Pulau Larak di Selat Hormuz. Untuk mensimulasikan pola gelombang di wilayah tersebut digunakan irregular triangular grid.  Pola arus di sekitar pulau dipelajari untuk jangka waktu satu tahun. Ditemukan bahwa gelombang yang ditimbulkan karena arus di sekitar pantai utara pulau relatif lemah. Terlihat pula bahwa gelombang yang ada di daerah tersebut terutama ke arah timur laut. Tinggi gelombang rata-rata di surfzone adalah sekitar 0,5 m., Dengan kecepatan arus sekitar 0,2 m.s-1. Mengingat angin menang dan arah gelombang, disimpulkan bahwa pantai utara Pulau Larak tempat yang cocok untuk konstruksi pelabuhan dan kegiatan memancing. Kata kunci: gelombang, arus, MIKE, Pulau Larak Coastal areas on earth are among the most dynamic zones which affected by different parameters such as waves, currents, and storms. To manage and control such a zone it is essential to study the hydrodynamic of the area. MIKE 21/3 Coupled Model FM was used to investigate the wind driven waves around Larak Island located in the Strait of Hormuz. To simulate the pattern of the wave in the area irregular triangular grid was applied. The pattern of current around the Island was studied for a one year period of simulation. It was found that the current induced wave break around the Northern coast of the Island is relatively weak. It was also observed that the prevailed wave in the area is mainly toward the Northeast. The averaged wave height in the surfzone is about 0.5 m., with the current velocity of about 0.2 m.s-1. Considering the prevailed wind and wave direction, it was concluded that the northern coasts of the Larak Island are

  15. Mike Leigh' abordi-draama võitis Veneetsias Kuldlõvi / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2004-01-01

    Veneetsia 61. filmifestivali võitjad : Kuldlõvi sai inglase Mike Leigh "Vera Drake" (nimiosa eest ka parima naisnäitleja Coppa Volpi Imelda Stauntonile), Hõbelõvi läks hispaanlase Alejandro Amenabari filmile "Merele" (siit ka parima meesnäitleja au Javier Bardemile), režii eriauhinna sai Kim Ki-duk Lõuna-Koreast filmiga "Tühi maja" ("Bin jip")

  16. MIKE SHE: Software for integrated surface water/ground water modeling

    Science.gov (United States)

    Chunmiao Zheng,; Hughes, Joseph D.

    2008-01-01

    MIKE SHE: Software for Integrated Surface Water/Ground Water Modeling - Hughes - 2008 - Groundwater - Wiley Online Library // Modernizr.load('http://content.readcube.com.ezproxy.library.wisc.edu/wiley/epdf_linker.js'); // // // var gs_channels = 'default'; // var googletag = googletag || {}; googletag.cmd = googletag.cmd || []; ( function () { var gads = document.createElement ( 'script' ) , node = document.getElementsByTagName ( 'script' ) [ 0 ] ; gads.async = true; gads.src = document.location.protocol + '//www.googletagservices.com/tag/js/gpt.js'; node.parentNode.insertBefore ( gads , node ); }) (); // Consideration of surface water and ground water interactions is becoming more important owing to complex water resource problems that require balancing water use and environmental concerns. Modeling of ground water is increasingly being done from an integrated hydrologic system perspective. MIKE SHE is a software tool developed specifically to simulate fully coupled surface water and ground water flow and transport processes. MIKE SHE includes a number of modules to simulate climatic processes, overland flow, channel flow, and saturated-unsaturated ground water flow. Development of Système Hydrologique Européen (SHE) began in 1977 as a collaborative research project by the Institute of Hydrology in the United Kingdom, SOGREAH in France, and the Danish Hydraulic Institute in Denmark (Graham and Butts 2006). The Danish Hydraulic Institute (now called DHI Water and Environment) is the developer of the commercial version of SHE (MIKE SHE); more information regarding the software can be found on the company’s Web site at http://www.dhigroup.com.

  17. Marine mammal subspecies in the age of genetics: Introductory remarks from the Associate Editor and Editor-in-Chief of Marine Mammal Science

    Science.gov (United States)

    Michael K. Schwartz; Daryl J. Boness

    2017-01-01

    Almost every conservation genetics and evolutionary biology textbook has a section questioning: "What is a species or subspecies?" It has been one of the most discussed, nearly unanswerable questions in all of biology. At issue is how to logically divide a variable that is generally continuous, with some occasional discrete breaks. Answering this question is...

  18. Mike Lynch

    DEFF Research Database (Denmark)

    Irwin, Alan; Horst, Maja

    In ’Science as a vacation’, Michael Lynch argues that ’STS might aim for something other than the serious job of doing business’. In so doing, he makes a strong case for an STS that does not aim to be useful but instead does ‘its own job’. In our presentation, we will explore some of the challenges...... associated with this position and especially its relationship to STS traditions of policy relevance and engagement. What does it mean for STS to do its job? Or rather, what does it mean for us to do our jobs? Taking inspiration both from Lynch’s published work and the different ways he has performed his STS...

  19. "That was Heaven". Hadrian's Villa as "fabulous" Heaven in Angels in America by Mike Nichols

    Directory of Open Access Journals (Sweden)

    Mauro Giori

    2011-07-01

    Full Text Available Angels in America is still Tony Kushner’s major achievement. In adapting it for television, Mike Nichols accurately respected the political agenda of the author (democratic, hebrew and homosexual, who also wrote the screenplay. The choice of Hadrian’s Villa (instead of a San Francisco devastated by the earthquake of 1906 as a background for the scenes which take place in the Paradise can be understood as coherent with Kushner’s ideological perspective, as well as with his original camp aesthetics.

  20. MIKE's PET: A participant-based experiment tracking tool for HCI practitioners using mobile devices

    Science.gov (United States)

    Mohamedally, Dean; Edlich, Stefan; Klaus, Enrico; Zaphiris, Panayiotis

    2006-02-01

    Knowledge Elicitation (KE) methods are an integral part of Human Computer Interaction (HCI) practices. They are a key aspect to the synthesis of psychology empirical methods with requirements engineering, User Centred Design (UCD) and user evaluations. Examples of these methods include prototyping, focus groups, interviews, surveys and direct video observation. The MIKE project (Mobile Interactive Knowledge Elicitation) at the Centre for HCI Design, City University London, UK provides mobile cyberscience capabilities for HCI practitioners conducting such research while at stakeholder locations. This paper reports on the design and development of a new MIKE based tool, named PET, a Participant-based Experiment Tracking tool for HCI practitioners using Java-based (J2ME) mobile devices. PET integrates its user tracking techniques with the development of the second generation implementation of the CONKER (COllaborative Non-linear Knowledge Elicitation Repository) Web Service. We thus report further on CONKER v2.0's new capabilities developed to enable tighter collaboration and empirical data management between HCI practitioners, considering their UCD needs. The visualisation, tracking and recording of HCI participant-based datasets via PET is explored with close connectivity with the CONKER v2.0 Web Service, in order to provide mobile-web cyberscience for remote and local HCI practitioners.

  1. Storm Surge Modelling of Super Typhoon Haiyan Event in Tacloban City, Leyte using MIKE 21 Model

    Science.gov (United States)

    Prelligera, Flor Angel; Caro, Carl Vincent; Ladiero, Christine; Mahar Francisco Lagmay, Alfredo; Lapidez, John Phillip; Malano, Vicente; Agaton, Rojelee; Santiago, Joy; Suarez, John Kenneth

    2014-05-01

    Super Typhoon Haiyan hit the Philippines on 08 November 2013 causing massive destruction to the central part of the country. Arguably the strongest tropical cyclone to make landfall in recorded history, Haiyan caused 6,201 deaths and damages amounting to PhP 36,690,882,497.27 (USD 824,390,091.77). The typhoon also brought about destructive storm surges reaching up to 7 meters in height. A better understanding of storm surge is essential to the development of mechanisms to mitigate the effects of similar events. Thus, a computer simulation of Haiyan with the resulting wave heights and storm surge levels was made using MIKE 21 model -- a software used for many different coastal and marine engineering projects worldwide. Simulations were made using the Hydrodynamic Flexible Mesh (HD FM) model coupled with the Spectral Wave (SW) model of the software. This coupled approach allows accurate calculations of both surge water levels and wave crest heights for overtopping of coastal structures. The maximum mesh flexibility of MIKE 21 allows mesh refinement for the coastal areas of Tacloban City within coarser mesh elements resulting to higher grid accuracy. Input parameters for the simulations of the coastline of Tacloban City, a densely populated coastal community heaviest hit by the storm surges of Haiyan, were obtained from the Philippine Atmospheric, Geophysical, and Astronomical Services Administration (PAGASA) and Japan Meteorological Agency (JMA). Atmospheric conditions such as wind and pressure values were input to a set of regional and local hydrodynamic and spectral wave models. Simulation results were compared with available tidal gauge records and the comparison showed good correlation. Coastal regional inundation maps were then created from the results of the storm surge simulations. These maps or its equivalent should be used to develop and further improve disaster risk management plans for future surge events. These plans include, but are not limited to

  2. On the probability distribution of stock returns in the Mike-Farmer model

    Science.gov (United States)

    Gu, G.-F.; Zhou, W.-X.

    2009-02-01

    Recently, Mike and Farmer have constructed a very powerful and realistic behavioral model to mimick the dynamic process of stock price formation based on the empirical regularities of order placement and cancelation in a purely order-driven market, which can successfully reproduce the whole distribution of returns, not only the well-known power-law tails, together with several other important stylized facts. There are three key ingredients in the Mike-Farmer (MF) model: the long memory of order signs characterized by the Hurst index Hs, the distribution of relative order prices x in reference to the same best price described by a Student distribution (or Tsallis’ q-Gaussian), and the dynamics of order cancelation. They showed that different values of the Hurst index Hs and the freedom degree αx of the Student distribution can always produce power-law tails in the return distribution fr(r) with different tail exponent αr. In this paper, we study the origin of the power-law tails of the return distribution fr(r) in the MF model, based on extensive simulations with different combinations of the left part L(x) for x 0 of fx(x). We find that power-law tails appear only when L(x) has a power-law tail, no matter R(x) has a power-law tail or not. In addition, we find that the distributions of returns in the MF model at different timescales can be well modeled by the Student distributions, whose tail exponents are close to the well-known cubic law and increase with the timescale.

  3. Bi-criteria evaluation of the MIKE SHE model for a forested watershed on the South Carolina coastal plain

    Science.gov (United States)

    Z. Dai; C. Li; C. Trettin; G. Sun; D. Amatya; H. Li

    2010-01-01

    Hydrological models are important tools for effective management, conservation and restoration of forested wetlands. The objective of this study was to test a distributed hydrological model, MIKE SHE, by using bi-criteria (i.e., two measurable variables, streamflow and water table depth) to describe the hydrological processes in a forested watershed that is...

  4. Briti väliskomisjoni esimehe sõnul polnud neil Lissaboni leppe referendum vajalik / Mike Gapes ; intervjueerinud Evelyn Kaldoja

    Index Scriptorium Estoniae

    Gapes, Mike

    2009-01-01

    Briti alamkoja väliskomisjoni leiboristist juht Mike Gapes vastab küsimustele, mis puudutavad brittide võimalust hääletada Lissaboni leppe üle, Schengenist ja eurotsoonist välja jäämist ning lisasõdurite saatmist Afganistani

  5. Multi-site calibration, validation, and sensitivity analysis of the MIKE SHE Model for a large watershed in northern China

    Science.gov (United States)

    S. Wang; Z. Zhang; G. Sun; P. Strauss; J. Guo; Y. Tang; A. Yao

    2012-01-01

    Model calibration is essential for hydrologic modeling of large watersheds in a heterogeneous mountain environment. Little guidance is available for model calibration protocols for distributed models that aim at capturing the spatial variability of hydrologic processes. This study used the physically-based distributed hydrologic model, MIKE SHE, to contrast a lumped...

  6. Hydrological simulation of Sperchios River basin in Central Greece using the MIKE SHE model and geographic information systems

    Science.gov (United States)

    Paparrizos, Spyridon; Maris, Fotios

    2017-05-01

    The MIKE SHE model is able to simulate the entire stream flow which includes direct and basic flow. Many models either do not simulate or use simplistic methods to determine the basic flow. The MIKE SHE model takes into account many hydrological data. Since this study was directed towards the simulation of surface runoff and infiltration into saturated and unsaturated zone, the MIKE SHE is an appropriate model for reliable conclusions. In the current research, the MIKE SHE model was used to simulate runoff in the area of Sperchios River basin. Meteorological data from eight rainfall stations within the Sperchios River basin were used as inputs. Vegetation as well as geological data was used to perform the calibration and validation of the physical processes of the model. Additionally, ArcGIS program was used. The results indicated that the model was able to simulate the surface runoff satisfactorily, representing all the hydrological data adequately. Some minor differentiations appeared which can be eliminated with the appropriate adjustments that can be decided by the researcher's experience.

  7. Looming Over the Nation, Uneasy with the Folks: Locating Mike de Leon in Philippine Cinema

    Directory of Open Access Journals (Sweden)

    Patrick F. Campos

    2006-12-01

    Full Text Available The article draws on filmic, popular, and scholarly references in order to trace how Mike de Leon and his films have been regarded, since his landmark entrance into Philippine cinema as director, up to the present. Specifically, it locates De Leon within the subtly shifting discourse of nationalist film scholarship and historicizing, and discusses how he and his films are written about, identified, associated or networked with other filmmakers and films, or utilized in discourses about the Philippines, Philippine cinema, or Philippine culture.The article locates De Leon as (1 an insider of Philippine cinema history, (2 an outsider of the commercial film industry, and (3 a hero of the mythic Golden Age of the National Cinema. It also maps out his filmography within the nationalist agenda; appraises what filmmakers, commentators, and scholars have articulated about his films; and analyzes the thematic and stylistic trajectories of his later works. Finally, it discusses how De Leon is being written into today’s discourse of Philippine cinema.

  8. An editorial approach: Mike Nelson’s corridors and The Deliverance and The Patience

    Directory of Open Access Journals (Sweden)

    Helen Hughes

    2015-06-01

    Full Text Available This essay contrasts the contemporary British artist Mike Nelson’s approach to constructing his large, multi-room installations with his approach to editing the numerous artist books that he has produced since 2000. This comparison reveals several compositional symmetries between the two, namely pertaining to narrative non-linearity and meta-fictionality. The logic of montage is shown to similarly underscore both the books and the installations. This essay argues that the corridors connecting the different rooms of Nelson’s installations function in a similar way to the logic of montage: they play an integral role as the support that binds the structure of the installation (its multiple rooms together as a whole. This essay argues that the corridor is the primary viewing framework of the installation for the viewer, and that this vantage point is significant because the necessarily partial vision of the installation from the space of the corridor demonstrates the logic of installation art more broadly. I conclude by mapping the key compositional elements of Nelson’s artist books onto his installations, taking the 2001 work The Deliverance and The Patience as a case study, to show that the books do not exemplify the artwork as with traditional exhibition catalogues, but rather parallel it. That is, a structural continuity is established between these two facets of his work.

  9. Storm Surge Risk Assessment of Tacloban, Leyte Using MIKE 21 Model Simulation of Typhoon Haiyan

    Science.gov (United States)

    Prelligera, F. A.; Ladiero, C.; Caro, C. V.; Lagmay, A. M. F. A.; Lapidez, J. P. B.; Suarez, J. K. B.; Santiago, J. T.; Agaton, R.

    2014-12-01

    Rehabilitation efforts for the destruction of Typhoon Haiyan which ravaged the central part of the Philippines may take up to 10 years and will cost PhP 250 billion (USD 5.7 billion). To prevent extensive damages and extreme cost for rehabilitation, thorough risk assessment along with systematic infrastructure plans, evacuation plans, and land use planning of the areas must be done. The study conducted a qualitative risk assessment for the city of Tacloban, one of the severely affected areas by the storm surges brought about by the typhoon. Its coastal areas are at high risk to storm surge due to: its location relative to the typhoon track; low elevation topography; dense population; and progressive economic activities. The risk assessment model proposed by the United Nations (1991) was used, where the risk index is defined by the hazard index multiplied by its vulnerability index. The risk index was evaluated into a five-point scale: very high, high, medium, low, very low. The storm surge hazard index of the study area was derived from the simulation results of Typhoon Haiyan event using MIKE 21 - a versatile software used for coastal modelling. Simulations were made using the coupled approach of Hydrodynamic Flexible Mesh (HD FM) and Spectral Wave (SW) models. This approach takes into account both surge water levels and wave crest heights for overtopping of coastal structures. The vulnerability index was determined from population, built environment, and critical service centers. The resulting risk index map will be beneficial to the on-going rehabilitation efforts in the study area.

  10. Ecosystem approach to water resources management using the MIKE 11 modeling system in the Strymonas River and Lake Kerkini.

    Science.gov (United States)

    Doulgeris, Charalampos; Georgiou, Pantazis; Papadimos, Dimitris; Papamichail, Dimitris

    2012-02-01

    The ability to apply an ecosystem approach to the Strymonas River catchment was investigated using the MIKE 11 modeling system for the simulation of surface water. The Strymonas River catchment is shared mainly between Bulgaria and Greece. The river feeds the artificial Lake Kerkini, a significant wetland ecosystem, and further downstream it outflows to the Gulf of Strymonikos, whose estuary ecosystem is very important for fisheries, biodiversity and tourism. MIKE 11-NAM was used for the simulation of rainfall-runoff process in the Strymonas River catchment and MIKE 11-HD was used to simulate the unsteady flow of the Strymonas River and to apply management rules based on the water level of Lake Kerkini. Two water level management scenarios were investigated. The first scenario referred to the mean daily-observed water level of Lake Kerkini between 1986 and 2006, and the second scenario represented adjustments necessary to fulfill the lake's ecosystem requirements. Under the current water level management practices (Scenario 1), the Strymonas River-Lake Kerkini system has enough water to fulfill its Irrigation Water Requirements (IWR) in normal and wet years while a slight deficit is appeared in dry years; however, both Lake Kerkini and the Strymonas River estuary ecosystems are subject to pressures, since reduction of the forest area has been recorded. Applying the ecosystem approach (Scenario 2), the protection of the riparian forest of Lake Kerkini is achieved while in normal and wet years the IWR are fulfilled and the deficit of the IWR is increased in dry years. Compared to Scenario 1, the pressure of the Strymonas River estuary ecosystem is slightly increased. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Simulation of the water balance of boreal watersheds of northeastern British Columbia, Canada using MIKE SHE, an integrated hydrological model

    Science.gov (United States)

    Abadzadesahraei, S.; Déry, S.; Rex, J. F.

    2016-12-01

    Northeastern British Columbia (BC) is undergoing rapid development for oil and gas extraction, largely depending on subsurface hydraulic fracturing (fracking), which relies on available freshwater. Even though this industrial activity has made substantial contributions to regional and provincial economies, it is important to ensure that sufficient and sustainable water supplies are available for all those dependent on the resource, including ecological systems. Further, BC statistics predict that the northeastern region's population will increase by 30% over the next 25 years, thereby amplifying the demands of domestic and industrial water usage. Hence, given the increasing demands for surface water in the complex wetlands of northeastern BC, obtaining accurate long-term water balance information is of vital importance. Thus, this study aims to simulate the 1979-2014 water balance at two boreal watersheds using the MIKE SHE model. More specifically, this research intends to quantify the historical, and regional, water budgets and their associated hydrological processes at two boreal watersheds—the Coles Lake and Tsea Lake watersheds—in northeastern BC. The development of coupled groundwater and surface water model of these watersheds are discussed. The model setup, calibration process, and results are presented, focusing on the water balance of boreal watersheds. Hydrological components within these watersheds are quantified through a combination of intensive fieldwork, observational data, analysis and numerical modeling. The output from the model provides important information for decision makers to manage water resources in northeastern BC. Keywords: Northeastern BC; boreal watershed; water balance; MIKE SHE hydrological model.

  12. River Flow Prediction for Future Climate Using Long Series of Multi-Site Synthetic Data and MIKE SHE Model

    Directory of Open Access Journals (Sweden)

    Kuchar Leszek

    2017-01-01

    Full Text Available A new simulation of daily flow for Kaczawa River, south-west Poland for extra long series of generated meteorological data (comparing to previous research and selected climate change scenarios are presented. The Representative Concentration Pathways (RCPs scenarios vs. SRES are introduced for simulations. The flow simulation in the river catchment is made using MIKE SHE hydrological model while the multisite data are generated by spatial weather generator SWGEN. Simulations are done for 2040 and 2060 while the simulations for the year 2000 are used as a background. The large number of new simulated series determined by the lead time, three climate change scenarios (RCP2.6 RCP4.5 and RCP6.0, and number of generated years (1000 for each case is equal to 7000 for a single station. Finally, Pdf function for flow is presented as well probability of exceedance of maximum flow.

  13. INTERVIEW OF THE EDITOR-IN-CHIEF OF THE JOURNAL “COMPARATIVE POLITICS”, PROFESSOR ALEXEI D. VOSKRESSENSKI’S WITH ANDRANIK MIGRANYAN, DIRECTOR OF THE INSTITUTE FOR DEMOCRACY AND COOPERATION (N.Y., USA

    Directory of Open Access Journals (Sweden)

    A. M. Migranian

    2012-01-01

    Full Text Available Abstract: Institute for democracy and cooperation is the first non-profit nonstate organization, set up to become a link between American think tanks and research centers, civil society institutions, universities and Russian intellectual and research centers and political and societal organizations. The IDC director Andranik Migranyan tells about the project of fundamental international research Democracy in the Russian mirror on the basis of the IDC and its significance for the world intellectual community and for Russia, about the project’s American comanager and co-editor Adam Przeworski, on the participants’ selection criteria. Project discussions were held in New York and in Moscow at MGIMO faculty of politics. A. Migranyan evaluates the results of work, the project workshops in Moscow and New York and makes tentative plans for joint follow-up research.

  14. Review of the monograph “Corruption: nature, revelation, interaction” / editor-in-chief Academician of the Russian Academy of Sciences T. Ya. Khabrieva. Мoscow: “Yurisprudentsiya” Publishers, 2014, 688 p.

    Directory of Open Access Journals (Sweden)

    Sergey F. Milyukov

    2016-03-01

    Full Text Available The review presents the authorsrsquo opinion of the monograph ldquoCorruption nature revelation interactionrdquo editorinchief Academician of the Russian Academy of Sciences T. Ya. Khabrieva. Selected chapters and paragraphs are reviewed and analyzed. The authors note both positive and negative sides of the monograph. The concept of corruption as a social phenomenon is discussed as well as the need to implement international norms in national legislation the legal framework for combating corruption in Russia the activities of the various institutions to fight against corruption combating corruption in state and municipal service ways of overcoming the corruption potential of legal acts impact of corruption on business and methods of combating corruption abroad. The team of authors including a large number of wellknown scientists and politicians S. B. Ivanov S. B. Naryshkin S. V. Stepashin Yu. A. Tikhomirov A. V. Fedorov T. Ya. Khabrieva etc. view corruption as a social phenomenon highlight the issues of international cooperation on corruption issues give a detailed review of legislation including international on combating corruption and name individual institutions to counteract this dangerous phenomenon. Special chapters are devoted to corruption in the system of state and municipal service and corruption in the business sector. Detailed attention in a separate chapter is given to the institution of anticorruption expertise. nbsp

  15. An Englishman in Romania: An Imagological Reading of Mike Ormsby’s Never Mind the Balkans, Here’s Romania

    Directory of Open Access Journals (Sweden)

    Gabriela-Iuliana COLIPCĂ-CIOBANU

    2014-12-01

    Full Text Available Connecting back with an already well-established tradition of scholarly explorations of images of Romanianness, as emerging from (nonfictional representations of cross-cultural, Anglo-Romanian encounters, the present paper focuses on one of the most recent textual productions foregrounding an English traveller’s gaze on his Romanian hosts, namely Mike Ormsby’s collection of short stories Never Mind the Balkans, Here’s Romania (2008. Applying an imagological grid to it, the paper aims at providing evidence in defence of the idea that, at least after 1989, the English observers’ attitudes towards and, implicitly, textual mirroring of Romania have undergone significant changes. In doing that, it reflects upon the ‘game’ of auto- and hetero-images at the heart of the narrative discourse as meant to point to both an awareness of cultural differences and the need to overcome cultural biases in one’s mind with a view to successful intercultural communication in the context of globalisation-driven societal transformations.

  16. Multi-site calibration, validation, and sensitivity analysis of the MIKE SHE Model for a large watershed in northern China

    Directory of Open Access Journals (Sweden)

    S. Wang

    2012-12-01

    Full Text Available Model calibration is essential for hydrologic modeling of large watersheds in a heterogeneous mountain environment. Little guidance is available for model calibration protocols for distributed models that aim at capturing the spatial variability of hydrologic processes. This study used the physically-based distributed hydrologic model, MIKE SHE, to contrast a lumped calibration protocol that used streamflow measured at one single watershed outlet to a multi-site calibration method which employed streamflow measurements at three stations within the large Chaohe River basin in northern China. Simulation results showed that the single-site calibrated model was able to sufficiently simulate the hydrographs for two of the three stations (Nash-Sutcliffe coefficient of 0.65–0.75, and correlation coefficient 0.81–0.87 during the testing period, but the model performed poorly for the third station (Nash-Sutcliffe coefficient only 0.44. Sensitivity analysis suggested that streamflow of upstream area of the watershed was dominated by slow groundwater, whilst streamflow of middle- and down- stream areas by relatively quick interflow. Therefore, a multi-site calibration protocol was deemed necessary. Due to the potential errors and uncertainties with respect to the representation of spatial variability, performance measures from the multi-site calibration protocol slightly decreased for two of the three stations, whereas it was improved greatly for the third station. We concluded that multi-site calibration protocol reached a compromise in term of model performance for the three stations, reasonably representing the hydrographs of all three stations with Nash-Sutcliffe coefficient ranging from 0.59–072. The multi-site calibration protocol applied in the analysis generally has advantages to the single site calibration protocol.

  17. Mike van Graan

    African Journals Online (AJOL)

    NWUuser

    2013-07-12

    Jul 12, 2013 ... It states further that the 2012 FIFA World Cup showed, through the integration of the creative and cultural industries that, if correctly harnessed, they "can engender social cohesion, enhance nation building and contribute to economic growth and development".5 These two goals are not ignoble goals; social ...

  18. Hydrological and hydrogeological effects of an open repository in Forsmark. Final MIKE SHE flow modelling results for the Environmental Impact Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Maartensson, Erik; Gustafsson, Lars-Goeran (DHI Sverige AB (Sweden))

    2010-07-15

    This report presents methodology and modelling results concerning a deep-rock repository for spent nuclear fuel in Forsmark. Specifically, the modelling tools MIKE SHE, MIKE 11 and MOUSE are used to quantify the groundwater inflow to the repository and associated hydrological and hydrogeological effects during the construction and operation phases. The modelling results presented in the report provide input to the Environmental Impact Assessment (EIA) that will be part of a permit application according to the Environmental Code. Based on an existing MIKE SHE model for Forsmark, the first step of the modelling process was to implement an updated hydrogeological model of the bedrock and to increase the vertical and horizontal extents of the model domain. Other model updates involve the vegetation classification, and implementation of SFR (final repository for short-lived radioactive waste) and the subsurface drainage system at the nearby nuclear power plant. The updated model was calibrated using measured data on groundwater levels in the Quaternary deposits and the bedrock, water levels in lakes, and stream discharges. The calibrated model was then used for simulation of undisturbed conditions (i.e. without the repository) as a reference for modelling results obtained for disturbed conditions (with the repository). The modelling results for undisturbed conditions that are presented in the report closely resemble those of the final MIKE SHE site descriptive modelling (SDM-Site Forsmark). The repository layout was implemented as pipe links (segments) in the modelling tool MOUSE, and the implemented layout was used for the modelling of disturbed conditions. The study uses an updated and verified MIKE SHE-MOUSE coupling routine that is specifically adapted for calculation of groundwater inflow to grouted rock tunnels. The vertical shafts of the repository are implemented in the form of MIKE SHE grid cells with atmospheric pressure. Modelling results for disturbed

  19. Video clip editing and duration of the shot: analysis of the editing in ‘I Took a Pill in Ibiza’ (Mike Posner

    Directory of Open Access Journals (Sweden)

    José Patricio Pérez Rufí

    2017-11-01

    Full Text Available Music videos are an audiovisual format that is created by the music industry for a performer’s public image and commercial purposes. This research aims to describe common practices in production and editing of current music videos regarding one particular aspect: the duration of the shot according to its frame. We carried out a textual analysis of Mike Posner’s video clip I took a Pill in Ibiza (Jon Jon Augustavo, 2016. In this case, the most frequent shots in the video clip are close shots, and the average duration is around two seconds. The average length of the shots creates a scale of durations which is equivalent to the scale of the size of the frames.

  20. Analyzing the hydrological impact of afforestation and tree species in two catchments with contrasting soil properties using the spatially distributed model MIKE SHE SWET

    DEFF Research Database (Denmark)

    Sonnenborg, Torben Obel; Christiansen, Jesper Riis; Pang, Bo

    2017-01-01

    afforestation or forest conversion impacts the water resource at the catchment scale. We hypothesize that the groundwater formation and streamflow is increased when water consuming conifers are replaced with the less consumptive broadleaf tree species. To test this a distributed hydrological model...... (conifer/broadleaf) and agricultural crops (grass, maize, wheat and barley) in different areal combinations. Initially, the SWET component was calibrated against plot scale field data from two forest sites to obtain vegetation parameter estimates for conifers and broadleaves. Subsequently, the catchment...... models were run for 10 years with predefined land use scenarios. MIKE SHE SWET simulated canopy interception and throughfall for conifers and broadleaf forests satisfactorily. The catchment simulations showed that replacing current conifer forests with broadleaves, resulted in a significant increase...

  1. Results from a full coupling of the HIRHAM regional climate model and the MIKE SHE hydrological model for a Danish catchment

    Science.gov (United States)

    Larsen, M. A. D.; Refsgaard, J. C.; Drews, M.; Butts, M. B.; Jensen, K. H.; Christensen, J. H.; Christensen, O. B.

    2014-03-01

    In recent years research on the coupling of existing regional climate models and hydrology/land surface models has emerged. A major challenge in this emerging research field is the computational interaction between the models. In this study we present results from a full two-way coupling of the HIRHAM regional climate model over a 4000 km x 2800 km domain in 11 km resolution and the combined MIKE SHE-SWET hydrology and land surface models over the 2500 km2 Skjern river catchment. A total of 26 one-year runs were performed to assess the influence of the data transfer interval (DTI) between the two models and the internal HIRHAM model variability of ten variables. In general, the coupled model simulations exhibit less accurate performance than the uncoupled simulations which is to be expected as both models prior to this study have been individually refined or calibrated to reproduce observations. Four of six output variables from HIRHAM, precipitation, relative humidity, wind speed and air temperature, showed statistically significant improvements in RMSE with a reduced DTI as evaluated in the range of 12-120 min. For these four variables the perturbation induced HIRHAM variability was shown to correspond to 47% of the RMSE improvement when using a DTI of 120 min compared to a DTI of 12 min and the variability resulted in large ranges in simulated precipitation. Also, the DTI was shown to substantially affect computation time. The MIKE SHE energy flux and discharge output variables experienced little impact from the DTI.

  2. Effects of Land Use and Climate Change on Groundwater and Ecosystems at the Middle Reaches of the Tarim River Using the MIKE SHE Integrated Hydrological Model

    Directory of Open Access Journals (Sweden)

    Patrick Keilholz

    2015-06-01

    Full Text Available The Tarim basin is a unique ecosystem. The water from the Tarim River supports both wildlife and humans. To analyze the effects of both land use and climate changes on groundwater, a research site was established at Yingibazar, which is a river oasis along the middle section of the Tarim River. A hydrological survey was performed to assess the general water cycle in this area with special emphasis on groundwater replenishment as well as the impact of agricultural irrigation on the riparian natural vegetation with respect to salt transport and depth of groundwater. Although high-resolution input data is scarce for this region, simulation of water cycle processes was performed using the hydrological model MIKE SHE (DHI. The results of the calibrated model show that natural flooding is the major contributor to groundwater recharge. There is also a close interaction between irrigated agricultural areas and the adjacent natural vegetation for groundwater levels and salinity up to 300 m away from the fields. Furthermore, the source of water used for irrigation (i.e., river and/or groundwater has a high impact on groundwater levels and salt transportation efficiency. The ongoing expansion of agricultural areas is rapidly destroying natural vegetation, floodplains, and their natural flow paths. Our results show that more unstable annual Tarim floods will occur in the future under the background of climate change. Therefore, integrated hydrological simulations were also performed for 2050 and 2100 using MIKE SHE. The results confirm that after the glaciers melt in the Tian Shan Mountains, serious aquifer depletion and environmental degradation will occur in the area, causing great difficulties for the local people.

  3. Somebody's Gotta Do It: Through His Foundation, Television Producer and Host Mike Rowe Is Working to Change the Perception of Middle-Skills Jobs and Fill Them at the Same Time

    Science.gov (United States)

    Rowe, Mike

    2015-01-01

    Mike Rowe wants high school students to rethink that $140,000 art history degree. The creator, executive producer, and host of CNN's Somebody's Gotta Do It and former host of TV's Dirty Jobs has long been passionate about promoting vocational, aka middle-skills, professions. Over the past decade, Rowe has given countless public and private…

  4. Effects on surface hydrology and near-surface hydrogeology of an open repository in Laxemar Results of modelling with MIKE SHE

    Energy Technology Data Exchange (ETDEWEB)

    Maartensson, Erik; Gustafsson, Lars-Goeran (DHI Sverige AB, Goeteborg (Sweden)); Bosson, Emma (Swedish Nuclear Fuel and Waste Management Co., Stockholm (Sweden))

    2009-10-15

    This report presents the methodology and the results from the modelling of an open repository for spent nuclear fuel in Laxemar. Specifically, the present work analyses the hydrological effects of the planned repository during the construction and operational phases when it is open, i.e. air-filled, and hence may cause a disturbance of the hydrological conditions in the surroundings. The numerical modelling is based on the SDM-Site Laxemar MIKE SHE model. The modelling was divided into three steps. The first step was to update the SDM-Site Laxemar model with a new hydrogeological bedrock model. The other main updates were an increase of the depth of the MIKE SHE model domain, enhanced vertical computational resolution and that the drainage of the Aespoe Hard Rock Laboratory was included in the model. The resulting model was used to simulate undisturbed natural conditions. The next step was to describe the open repository conditions, using Laxemar layout D2, by implementing the access tunnel, the repository tunnels and shafts in the model, and to simulate the consequences for the surface hydrology caused by an open repository under different conditions. The final step was a sensitivity analysis that aimed to investigate the sensitivity of the modelled effects of the open repository to the hydrogeological properties of the bedrock and the Quaternary deposits, the sediments under the sea, and changes in boundary conditions. The model covers an area of 34 km2. The groundwater divides were assumed to coincide with the surface water divides; thus, a no-flow boundary condition was used at the horizontal boundaries, except in the Quaternary deposit layers towards the sea where a time-varying boundary condition describing the sea-level in the area was used. In the bedrock layers, however, a no-flow boundary condition was applied. Also the bottom boundary was described as a no-flow boundary. The transient top boundary condition was based on meteorological data gathered at

  5. Numerical Limitations of 1D Hydraulic Models Using MIKE11 or HEC-RAS software – Case study of Baraolt River, Romania

    Science.gov (United States)

    Andrei, Armas; Robert, Beilicci; Erika, Beilicci

    2017-10-01

    MIKE 11 is an advanced hydroinformatic tool, a professional engineering software package for simulation of one-dimensional flows in estuaries, rivers, irrigation systems, channels and other water bodies. MIKE 11 is a 1-dimensional river model. It was developed by DHI Water · Environment · Health, Denmark. The basic computational procedure of HEC-RAS for steady flow is based on the solution of the one-dimensional energy equation. Energy losses are evaluated by friction and contraction / expansion. The momentum equation may be used in situations where the water surface profile is rapidly varied. These situations include hydraulic jumps, hydraulics of bridges, and evaluating profiles at river confluences. For unsteady flow, HEC-RAS solves the full, dynamic, 1-D Saint Venant Equation using an implicit, finite difference method. The unsteady flow equation solver was adapted from Dr. Robert L. Barkau’s UNET package. Fluid motion is controlled by the basic principles of conservation of mass, energy and momentum, which form the basis of fluid mechanics and hydraulic engineering. Complex flow situations must be solved using empirical approximations and numerical models, which are based on derivations of the basic principles (backwater equation, Navier-Stokes equation etc.). All numerical models are required to make some form of approximation to solve these principles, and consequently all have their limitations. The study of hydraulics and fluid mechanics is founded on the three basic principles of conservation of mass, energy and momentum. Real-life situations are frequently too complex to solve without the aid of numerical models. There is a tendency among some engineers to discard the basic principles taught at university and blindly assume that the results produced by the model are correct. Regardless of the complexity of models and despite the claims of their developers, all numerical models are required to make approximations. These may be related to geometric

  6. ANALYSIS OF EROSION AND SEDIMENTATION PATTERNS USING SOFTWARE OF MIKE 21 HDFM-MT IN THE KAPUAS MURUNG RIVER MOUTH CENTRAL KALIMANTAN PROVINCE

    Directory of Open Access Journals (Sweden)

    Franto Novico

    2017-07-01

    Full Text Available The public transportation system along the Kapuas River, Central Kalimantan are highly depend on water transportation. Natural condition gives high distribution to the smoothness of the vessel traffic along the Kapuas Murung River. The local government has planned to build specific port for stock pile at the Batanjung which would face with natural phenomena of sedimentation and erosion at a river mouth. Erosion and sedimentation could be predicted not only by field observing but it is also needed hypotheses using software analysis. Hydrodynamics and transport sediment models by Mike 21 HDFM-MT software will be applied to describe the position of sedimentations and erosions at a river mouth. Model is assumed by two different river conditions, wet and dry seasons. Based on two types of conditions the model would also describe the river flow and sediment transport at spring and neap periods. Tidal fluctuations and a river current as field observation data would be verified with the result of model simulations. Based on field observation and simulation results could be known the verification of tidal has an 89.74% correlation while the river current correlation has 43.6%. Moreover, based on the simulation the sediment patterns in flood period have a larger area than ebb period. Furthermore, the erosion patterns dominantly occur during wet and dry season within ebb period. Water depths and sediment patterns should be considered by the vessels that will use the navigation channel at a river mouth.

  7. Analysis of efficiency of pollution reduction measures in rural basin using MIKE Basin model. Case study: Olšava River Basin

    Directory of Open Access Journals (Sweden)

    Kaiglová Jana

    2014-03-01

    Full Text Available This paper presents the results of testing the applicability of the MIKE Basin model for simulating the efficiency of scenarios for reducing water pollution. The model has been tested on the Olšava River Basin (520 km2 which is a typical rural region with a heterogeneous mix of pollution sources with variable topography and land use. The study proved that the model can be calibrated successfully using even the limited amount of data typically available in rural basins. The scenarios of pollution reduction were based on implementation and intensification of municipal wastewater treatment and conversion of arable land on fields under the risk of soil erosion to permanent grassland. The application of simulation results of these scenarios with proposed measures proved decreasing concentrations in downstream monitoring stations. Due to the practical applicability of proposed measures, these could lead to fulfilment of the water pollution limits required by the Czech and EU legislation. However, there are factors of uncertainty that are discussed that may delay or limit the effect of adopted measures in small rural basins.

  8. African Journal of Physiotherapy and Rehabilitation Sciences: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Arinola O. Sanya Editor In Chief College of Medicine, University of Ibadan Editor in Chief Department of Physiotherapy, College of Medicine University of Ibadan Ibadan Nigeria Phone: +234-8023278607. Email: arinsanya@yahoo.com ...

  9. Maailma hüperinflatsioonid / Mike Hewitt

    Index Scriptorium Estoniae

    Hewitt, Mike

    2007-01-01

    Ilmunud ka: Molodjozh Estonii : Zolotoi Vestnik 18. dets. lk. 4-5. Kuigi majandusteadlased ei ole tunnustanud ühtegi kindlat hüperinflatsiooni, on majanduses teatud tunnused, mis viitavad hüperinflatsioonile. Loetelu riikidest, mis on kogenud hüperinflatsiooni ja/või oma valuuta välja vahetanud

  10. Quo Vadis, kaubandushiid Hyperlex? / Mike Franz Wahl

    Index Scriptorium Estoniae

    Wahl, Mike Franz, 1966-

    2007-01-01

    Juhtimiskaasuste võistluse "Juhtimisaju 2007" raames tuli osalejatel lahendada juhtum seoses ettevõtete liitumisega. Vt. samas näited võistlustöödest: Vanaviisi ei saa, uutmoodi ei taha...; Inimesed, rääkige!. Juhtimisaju 2007 parimad võistkonnad

  11. Green Chemistry: An Introductory Text (Mike Lancaster)

    Science.gov (United States)

    Rosan, Alan M.

    2003-10-01

    With the unrealistic and irreconcilable choice of either technical or environmental performance still dominating the consumer view, the need for green teaching, green thinking, and green practice is paramount. Replete with extensive and varied examples, detailed analyses, and critical comparisons, this text is an important contribution to the training of future chemists and chemical engineers who will need to work together to plan and conduct syntheses requiring atom economy, energy efficiency, waste minimization, safe reactor design and operation all linked by an overarching environmental ethic. If these laudable goals are ever attained it will be as a consequence of the insightful knowledge and forthright teachings of texts like this one.

  12. Editorial: Cybersecurity

    National Research Council Canada - National Science Library

    Chris McPhee; Dan Craigen

    2016-01-01

    Keywords: cybersecurity, new domains, literature reviews, intrusion, machine learning, malware, multisided platforms, open source, licensing From the Editor-in-Chief Welcome to the February 2016 issue...

  13. Ife Journal of Science: Editorial Policies

    African Journals Online (AJOL)

    Editor-in-Chief (Biological Sciences): Dr. I.O. Adewale Editor-in-Chief (Physical Sciences): Prof. A. O. Ogunfowokan. Associate Editors. Dr. A. O. Shittu - Microbiology Prof. T. O. Obilade - Mathematics Prof. G. A. O. Arawomo - Zoology Prof. J. O. Ajayi - Geology Prof. A. P. Akinola - Mathematics Prof. H. C. Illoh - Botany Prof.

  14. International Journal of Agriculture and Rural Development: Editorial ...

    African Journals Online (AJOL)

    Editorial Board. Editor-in Chief - Prof. C.C. Asiabaka. Deputy Editor-in-Chief - Dr. E.U. Onweremadu. Associate Editors. - Prof. B.O. Esonu. - Prof. (Mrs.) N.N. Oti. - Dr. M.A.C.A. Odii. Assistant Editors. - Dr. I.J. Ogoke. - Dr. M.N. Opara ...

  15. Nigerian Journal of Parasitology: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof Sammy O. H. Sam-Wobo Editor-in-Chief University of Agriculture. Editor-in-Chief/Web Manager Department of Pure and Applied Zoology Room A206 College of Biosciences Federal University of Agriculture PMB 2240, Abeokuta, Nigeria. Alternative email: sammywobo@gmail.com. Phone: + ...

  16. Nigerian Journal of Nutritional Sciences: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. Folake Samuel Editor-in-Chief, Nigerian Journal of Nutritional Sciences Department of Human Nutrition Faculty of Public Health University of Ibadan Nigeria njns2013@gmail.com. Editor-in-Chief - NJNS. Department of Human Nutrition. Faculty of Public Health. University of Ibadan. Nigeria.

  17. Directory of Polish Officials: A Reference Aid

    Science.gov (United States)

    1989-04-01

    Chlopska Droga (PZPR weekly) Editor in Chief. Swirgon, Waldemar; PZPR Deputy Editor in Chief. Dvennik Baltycki (PZPR daily; Gdansk...Chlopska Droga 127 Christian Social Union 123 Cicchanow Voivodship ■•■ .59 Citizens’ Militia ...’. -■• 29 Coal and

  18. Journal of Research in Forestry, Wildlife and Environment: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. P.O. Egwumah Editor-in-chief. Department of Wildlife and Range Management The Editor in-chief, Journal of Research in Forestry, Wildlife and Environment Department of Forestry Wildlife and Range Management University of Agriculture Makurdi P. M. B. 2373 Makurdi Benue State, Nigeria. Phone: + ...

  19. Chasing Great Paths of Helmut “Oxidative Stress” Sies

    DEFF Research Database (Denmark)

    Majima, H.; Indo, H.; Nakanishi, I.

    2016-01-01

    Prof. Dr. Helmut Sies is a pioneer of “Oxidative Stress”, and has published over 18 papers with the name of “Oxidative Stress” in the title. He has been Editor-in-Chief of the journal “Archives of Biochemistry and Biophysics” for many years, and is a former Editor-in-Chief of the journal “Free...

  20. Nigerian Journal of Basic and Applied Sciences: Contact - Sokoto

    African Journals Online (AJOL)

    Principal Contact. Prof. Yusuf Saidu Editor-in-Chief Usmanu Danfodiyo University Editor-in Chief Nigerian Journal of Basic and Applied Sciences Faculty of Science Usmanu Danfodiyo University P.M.B. 2346 Sokoto Nigeria Phone: +234 803 422 7001. Email: njbas@udusok.edu.ng ...

  1. Nigerian Journal of Animal Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Professor A. A. Odunsi Editor-in-Chief. c/o Editorial Office, ASAN National Secretariat, No. 27, Acme Road, Agidingbi, Ikeja, Lagos. Alternative email address: yodunsi@yahoo.com. Email: njas2011@gmail.com. Support Contact. Dr Demo Kalla J. Usman (Deputy Editor-in-Chief)

  2. Modeling of sediment transport along Mangalore coast using mike 21

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, K.S.; Dwarakish, G.S.; Jayakumar, S.

    The objective of the present study is to understand the sediment transport along Mangalore Coast and to quantify the sediment transport rates. The data used in the present study includes Wave, Wind, Tide, Naval Hydrographic Chart (Bathymetry Chart...

  3. The Elementary Private School Recognition Program: Mike Mulligan's View.

    Science.gov (United States)

    Lodish, Richard

    1986-01-01

    Describes the goals, the selection criteria, and the selection process of the Elementary Private School Recognition Program. Includes a listing, by states, of the 60 private elementary schools selected for 1985-86 recognition. (IW)

  4. Mike O’Callaghan Federal Medical Center Campus Environmental Assessment

    Science.gov (United States)

    2012-03-01

    block veneer to improve appearance. The structure was not designed to accommodate the type and level of current use and had an expected operational...Command- IM/IT  Dental 3rd Floor  Nursing Units (with access to 2nd Floor Surgery and 1st Floor ED)  Comprehensive In-Patient OB Services...r v i c e - E x c e l l e n c e Critical Adjacencies 2nd Floor 10 N Command IM/IT Dental Vacated VA Surgery/Pre-Op Clinics

  5. A Conversation with Jennifer Buffett: The Power of Philanthropy to Transform Cultures

    Directory of Open Access Journals (Sweden)

    Riane Eisler

    2015-12-01

    Full Text Available IJPS Editor-in-Chief Riane Eisler talks with Jennifer Buffett, co-president of the NoVo Foundation, about her ideas, her life, and the role of philanthropy in the cultural transformation toward partnership.

  6. Effect of Sida acuta and Corchorus olitorius mucilages on the physicochemical properties of maize and sorghum starches

    Directory of Open Access Journals (Sweden)

    Funmilola Yetunde Oladipo

    2011-05-01

    Full Text Available Sorry, this article has been withdrawn of Orbital journal because its content was previously published in another scientific journal! Dr. Adilson Beatriz Editor-in-Chief of the Orbital – The Electronic Journal of Chemistry

  7. Retraction - Request that it is necessary to retract paper: Thermal and electrical energy yield analysis of a directly water cooled photovoltaic module DOI:10.2298/TSCI130118144M

    National Research Council Canada - National Science Library

    Editorial

    2016-01-01

    Prof. Dr. Simeon Oka, Editor-in-chief of the journal THERMAL SCIENCE request that it is necessary to retract paper Thermal and electrical energy yield analysis of a directly water cooled photovoltaic module DOI...

  8. Journal of Religion and Human Relations: Contact

    African Journals Online (AJOL)

    Principal Contact. Rev. Dr. Enoch Patrick Nmah Editor-in-Chief Nnamdi Azikiwe University, Awka Department of Religion and Human Relations P.M.B. 5025. Unizik Awka Nigeria Phone: 08033500348. Email: frches@yahoo.com ...

  9. Journal of Meteorology and Climate Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. K.O Ogunjobi Editor-in-Chief Federal University of Technology, Akure (FUTA) Department of Meteorology Federal University of Technology Akure, Ondo State Nigeria Phone: +234-7031145866. Email: jobik2000@yahoo.com ...

  10. African Journal of Paediatric Surgery: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr Aba Francis Uba Editor-in-Chief Paediatric Surgery Unit Department of Surgery Jos University Teaching Hospital P.M.B. 2076 Jos Plateau State Nigeria Phone: (234) 080371 54469. Email: afranu@yahoo.com ...

  11. Biomedical Sensors of Ionizing Radiation

    OpenAIRE

    Pani, S; Speller, R; Royle, G; Olivo, A

    2010-01-01

    Sensors Technology Series Editor-in-Chief's Preface vii Preface ix 1 Biomedical Sensors: Temperature Sensor ... G. Kim Prisk 4 Biomedical Sensors of Ionizing Radiation 129 Robert Speller, Alessandro Olivo, Silvia Pani, and Gary Royle 5 ...

  12. Benin Journal of Postgraduate Medicine: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. C. Azodo Editor-In-Chief University of Benin Teaching Hospital Department of Periodontics PMB 1111. Benin City Edo State Nigeria Phone: 08034051699. Email: bjpmbjpm@yahoo.com ...

  13. Sokoto Journal of Veterinary Sciences: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. B. M. Agaie Editor-in-Chief Usmanu Danfodiyo University. Faculty of Veterinary Medicine, UDUS City Campus. P. M. B. 2346. Sokoto- Nigeria. Phone: +2348035073563. Email: agaie1992@gmail.com ...

  14. Dear authors: We do read your cover letters

    Science.gov (United States)

    This is an editorial written as Editor-in-Chief (EIC) for the Journal of the American Oil Chemists’ Society (JAOCS) describing the importance of writing a cover letter for the submission of manuscripts to JAOCS....

  15. African Journal for Physical Activity and Health Sciences: Editorial ...

    African Journals Online (AJOL)

    AJPHES) is a refereed journal published quarterly (March, June, September and December) by LAM Publications Limited. The Editor-in-Chief and the Editorial Committee serve as reviewing board in conjunction with appointed reviewers ...

  16. Sobering thoughts at seventy on trivia and serendipity.

    Science.gov (United States)

    Wheatley, Denys

    2010-10-01

    The Editor-in-Chief reflects on a life in biological sciences that has been rewarding through the sheer diversity of interesting phenomenon he has researched, and recalls how holistic thinking had sadly been replaced by rampant reductionism.

  17. Highland Medical Research Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Professor Emmanuel I Agaba Editor-in-Chief Department of Medicine. Department of Medicine. Jos University Teaching Hospital. PMB 2076. Jos, Nigeria. Phone: +2348037001392. Fax: +243 073454172. Email: highmedresj@gmail.com ...

  18. Animal Production Research Advances: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr I Charles Okoli Editor-in-Chief Federal University of Technology Department of Animal Science and Technology PMB 1526 Owerri Nigeria Phone: +2348056647100. Email: dr_charleso@yahoo.com ...

  19. Journal of Biomedical Investigation: Submissions

    African Journals Online (AJOL)

    Editor-in-chief Journal of Biomedical Investigation, Department of Pharmacology and Therapeutics, Faculty of Medicine College of Health Sciences Nnamdi Azikiwe University, Nnewi Campus PMB 5001 Nnewi ... Vertical rules should be avoided.

  20. PUBLISHER'S ANNOUNCEMENT: Refereeing standards

    Science.gov (United States)

    Bender, C.; Scriven, N.

    2004-08-01

    On 1 January 2004 I will be assuming the position of Editor-in-Chief of Journal of Physics A: Mathematical and General (J. Phys. A). I am flattered at the confidence expressed in my ability to carry out this challenging job and I will try hard to justify this confidence. The previous Editor-in-Chief, Ed Corrigan, has worked tirelessly for the last five years and has done an excellent job for the journal. Everyone at the journal is profoundly grateful for his leadership and for his achievements. Before accepting the position of Editor-in-Chief, I visited the office of J. Phys. A to examine the organization and to assess its strengths and weaknesses. This office is located at the Institute of Physics Publishing (IOPP) headquarters in Bristol. J. Phys. A has been expanding rapidly and now publishes at the rate of nearly 1000 articles (or about 14,000 pages) per year. The entire operation of the journal is conducted in a very small space---about 15 square metres! Working in this space are six highly intelligent, talented, hard working, and dedicated people: Neil Scriven, Publisher; Mike Williams, Publishing Editor; Rose Gray and Sarah Nadin, Publishing Administrators; Laura Smith and Steve Richards, Production Editors. In this small space every day about eight submitted manuscripts are downloaded from the computer or received in the post. These papers are then processed and catalogued, referees are selected, and the papers are sent out for evaluation. In this small space the referees' reports are received, publication decisions are made, and accepted articles are then published quickly by IOPP. The whole operation is amazingly efficient. Indeed, one of the great strengths of J. Phys. A is the speed at which papers are processed. The average time between the receipt of a manuscript and an editorial decision is under sixty days. (Many distinguished journals take three to five times this amount of time.) This speed of publication is an extremely strong enticement for

  1. Utprøving av metodikker for modellering av overvann i et urbant område ved bruk av ArcGIS, MIKE21 og MIKE FLOOD

    OpenAIRE

    Johansen, Jarle Andre; Moldekleiv, Hans Jakob Saxe

    2016-01-01

    I de siste århundrene har det blitt registrert forandringer i klimasystemet. Det er sannsynlig at dette er en konsekvens av menneskers forbruk av fossilt brennstoff. Klimaendringene vises i en høynet middeltemperatur for store deler av jordkloden. I Norge blir klimaendringene synlige i form av at det har blitt mer nedbør og at nedbørshendelsene har blitt mer intense. Denne tendensen blir av de fleste forskere framskrevet til å vedvare. Samtidig med klimautviklingen har samfunnet blitt forandr...

  2. Fundamentals of computational intelligence neural networks, fuzzy systems, and evolutionary computation

    CERN Document Server

    Keller, James M; Fogel, David B

    2016-01-01

    This book covers the three fundamental topics that form the basis of computational intelligence: neural networks, fuzzy systems, and evolutionary computation. The text focuses on inspiration, design, theory, and practical aspects of implementing procedures to solve real-world problems. While other books in the three fields that comprise computational intelligence are written by specialists in one discipline, this book is co-written by current former Editor-in-Chief of IEEE Transactions on Neural Networks and Learning Systems, a former Editor-in-Chief of IEEE Transactions on Fuzzy Systems, and the founding Editor-in-Chief of IEEE Transactions on Evolutionary Computation. The coverage across the three topics is both uniform and consistent in style and notation. Discusses single-layer and multilayer neural networks, radial-basi function networks, and recurrent neural networks Covers fuzzy set theory, fuzzy relations, fuzzy logic interference, fuzzy clustering and classification, fuzzy measures and fuzz...

  3. Acta stomatologica Croatica and PubMed Central.

    Science.gov (United States)

    Brkić, Hrvoje

    2016-06-01

    April 15 2016 marked the 50th anniversary of continuous publishing of the journal Acta stomatologica Croatica (ASCRO). The celebration was held in the great hall of the Croatian Medical Association, with numerous guests from the biomedical field. The history of the journal was presented by Goran Knežević (editor-in-chief 1996-2006) and Hrvoje Brkić (current editor-in-chief), who presented all the current information on the electronical editing and its current indexation. Only a few days later, the Editorial Office received the information that ASCRO has been included in PubMed Central since volume 48, an impulse for the members of the Editorial Board and the Editor-in-Chief to make ASCRO better and more cited.

  4. Tectonics

    Science.gov (United States)

    John Dewey will complete his term as editor-in-chief of Tectonics at the end of 1984. Clark Burchfiel's term as North American Editor will also end. Tectonics is published jointly with the European Geophysical Society. This newest of AGU's journals has already established itself as an important journal bridging the concerns of geophysics and geology.James A. Van Allen, president of AGU, has appointed a committee to recommend candidates for both editor-in-chief and North American editor for the 1985-1987 term.

  5. Imagining the Future University

    DEFF Research Database (Denmark)

    Bengtsen, Søren Smedegaard; Barnett, Ronald

    'Imagining the Future University' is a special issue in the journal Philosophy and Theory in Higher Education, published by Peter Lang. Editor in Chief of the journal is John Petrovic, University of Alabama. The speciale issue is edited by Søren Bengtsen and Ronald Barnett.......'Imagining the Future University' is a special issue in the journal Philosophy and Theory in Higher Education, published by Peter Lang. Editor in Chief of the journal is John Petrovic, University of Alabama. The speciale issue is edited by Søren Bengtsen and Ronald Barnett....

  6. Canadian Journal of Kidney Health and Disease: a unique launch of a unique journal.

    Science.gov (United States)

    Levin, Adeera; Clase, Catherine M; Sood, Manish M; Dicks, Elizabeth; Fortin, Marie-Chantal; Hartwig, Sunny; Holden, Rachel; Lafrance, Jean-Philippe; Molzahn, Anita; Rosenblum, Norman; Samuel, Susan; Soroka, Steven

    2014-01-01

    Usually inaugural editorials are written by the Editor-in-Chief to describe the scope and vision for the journal to potential authors and readers. This editorial is written by the Editor-in-Chief, the Deputy Editors and the Associate Editors collaboratively as a clear signal that this is a unique and different journal. We will build this journal on a set of principles which are fundamental to improving the outcomes of patients with kidney disease. To that end, we aim to be supportive, to collaborate, to integrate multiple perspectives and to be open to possibilities.

  7. Mike Mignola's B.P.R.D.: Hollow Earth and Other Stories

    National Research Council Canada - National Science Library

    2003-01-01

    .... The first tale, "Hollow Earth," is action-packed but still driven by characters. In it, Abe recruits Roger and Johann, a soul without a body, to rescue former teammate Liz Sherman from a spooky Nazi junkyard at the center of the earth, as Hellboy has show-stealing flashbacks to his first meetings with Abe and Liz that present their former mentor in...

  8. Wave hindcast experiments in the Indian Ocean using MIKE 21 SW ...

    Indian Academy of Sciences (India)

    derived ocean wave period using genetic algorithm; IEEE. Geosci. Rem. Sens. Lett. 8 354–358. IOC 2003 Centenary Edition of the GEBCO Digital Atlas, published on CD-ROM on behalf of the Intergovern- mental Oceanographic Commission and the International. Hydrographic Centre, Organization as part of the General.

  9. Wave hindcast experiments in the Indian Ocean using MIKE 21 SW ...

    Indian Academy of Sciences (India)

    Wave prediction and hindcast studies are important in ocean engineering, coastal infrastructure development and management. In view of sparse and infrequent in-situ observations, model derived hindcast wave data can be used for the assessment of wave climate in offshore and coastal areas. In the present study, MIKE ...

  10. MIKE-SHE integrated groundwater and surface water model used to ...

    African Journals Online (AJOL)

    The DRIFT-ARID tool is used in this study to define environmental water requirements (EWR) for non-perennial river flow systems in South Africa to facilitate ecosystembased management of water resources as required by the National Water Act (Act No. 36 of 1998). Fifty years of distributed daily climate data (1950 to 2000) ...

  11. Compelling Memory: 9/11 and the Work of Mourning in Mike Binder's Reign over Me

    NARCIS (Netherlands)

    Peeren, E.

    2016-01-01

    This article contends that the American commemoration of 9/11 has been dominantly conducted in a compelling, spectacularized manner. The obligation to remember is accompanied by an expectation that this memory will be put on display in the form of emotional expression and/or memory objects.

  12. The Trailwatcher: A Collection of Colonel Mike Malone’s Writings

    Science.gov (United States)

    1982-06-21

    nwts SO t COllld tape all the r~rson-to-pc t t dat • nnd ranscribed it, nd analy it. it took five years.) Vietn event int t the nst a in p...that heart this iJli>act statements to gecko lizards, they vhat might happen to our ’re perceptive. they’ reform 󈨑, those ethics coining up

  13. MIKE-SHE integrated groundwater and surface water model used to ...

    African Journals Online (AJOL)

    2016-07-03

    Jul 3, 2016 ... 8Environmental and Water Quality Consultant, PO Box 16018, Panorama, 7506, South Africa. 9Geography ..... software. Temporal analysis is often done with standard spreadsheet software. GIS software allows modellers to spa- tially correlate different types of data (e.g. mapped surface geology with ...

  14. Reinventing the Formal Definition of Limit: The Case of Amy and Mike

    Science.gov (United States)

    Swinyard, Craig

    2011-01-01

    Relatively little is known about how students come to reason coherently about the formal definition of limit. While some have conjectured how students might think about limits formally, there is insufficient empirical evidence of students making sense of the conventional [superscript epsilon]-[delta] definition. This paper provides a detailed…

  15. Impact of uncertainty description on assimilating hydraulic head in the MIKE SHE distributed hydrological model

    DEFF Research Database (Denmark)

    Zhang, Donghua; Madsen, Henrik; Ridler, Marc E.

    2015-01-01

    The ensemble Kalman filter (EnKF) is a popular data assimilation (DA) technique that has been extensively used in environmental sciences for combining complementary information from model predictions and observations. One of the major challenges in EnKF applications is the description of model...... uncertainty. In most hydrological EnKF applications, an ad hoc model uncertainty is defined with the aim of avoiding a collapse of the filter. The present work provides a systematic assessment of model uncertainty in DA applications based on combinations of forcing, model parameters, and state uncertainties...

  16. Academic Training Lecture | LHC Operation: Past and Future by Mike Lamont | 10-12 September

    CERN Multimedia

    2013-01-01

    After a successful first running period, LHC is now well into a two year shutdown for extensive consolidation. A pedagogical overview of the machine, its operating principles, its systems and underlying accelerator physics is presented. Performance past and future is discussed.   These lectures will be presented in three parts: LHC Operation: Past and Future (1/3): Tuesday 10 September 2013 from 11:00 to 12:00 at CERN (222-R-001 - Filtration Plant) LHC Operation: Past and Future (2/3): Wednesday 11 September from 11:00 to 12:00 at CERN (222-R-001 - Filtration Plant) LHC Operation: Past and Future (3/3): Thursday 12 September from 11:00 to 12:00 at CERN (222-R-001 - Filtration Plant) Click here to view the event details on Indico.

  17. Securities Market Journal: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Those who wish to have their articles published are hereby requested to forward them to the Editor-in-Chief. Manuscripts are considered on the clear understanding that they are not being submitted to any other publishers. Only articles related to capital market issues are acceptable. They may be ...

  18. Collaboration between SSMJ and its readers

    African Journals Online (AJOL)

    All of us in the healthcare professions throughout the world can learn much from each other. This has been demonstrated so well by the collaboration between the editors, authors, medical experts and readers of the South Sudan Medical Journal. The Editor-in-Chief recently sent out a request for photographs and received a ...

  19. Ghana Journal of Linguistics - Vol 6, No 1 (2017)

    African Journals Online (AJOL)

    The Editors welcome reports on research in progress and brief notices of research findings, as well as news of general interest to linguists. The Editors also welcome books from authors and publishers for review in the Ghana Journal of Linguistics. They may be sent to Dr. Ọbádélé Kambon, Editor-in-Chief, Ghana Journal of ...

  20. From the editor's desk

    Indian Academy of Sciences (India)

    I put on record my gratitude to the Indian Academy of Sciences for giving me the opportunity to serve the journal as Associate Editor and Editor-in-Chief, and appreciation to the colleagues in the editorial office, Gracy,. Navya and Prakash, who made the task look so much simpler. Please accept my good wishes for the new ...

  1. EDITORIAL NEWS Thank you, Prof Mollentze

    African Journals Online (AJOL)

    As outgoing Editor-in-Chief I would like to thank all my fellow. Editorial Board members for your loyal support and hard work of the past three years. Due to your commitment and toil behind the scenes the journal not only survived but thrived! On behalf of the Editorial Board I also wish to express our sincere gratitude towards ...

  2. Zimbabwe Journal of Educational Research: Editorial Policies

    African Journals Online (AJOL)

    Aknowledgement of 2013 Reviewers. The Editor-in-Chief and the Editorial Board of the Zimbabwe Journal of Educational Research would like to express their sincere gratitude to the colleagues below who gave their precious time to review articles herein and those which appeared in Volumes 25, Numbers 1 & 2, 2013.

  3. Mihaly Csikszentmihalyi

    DEFF Research Database (Denmark)

    Knoop, Hans Henrik

    2017-01-01

    Knoop, H. H. (in press). Mihaly Csikszentmihaly. In B. J. Carducci (Editor-in-Chief) & A. Di Fabio, D. H. Saklofske, & C. Stough (Vol. Eds.), The Wiley-Blackwell encyclopedia of personality and individual differences: Vol. III. Personality processes and individual differences. Hoboken, NJ: John...

  4. Journal of Medical Laboratory Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Francis Useh Editor. National Open University of Nigeria. 14/16 Ahmadu Bello Way. Victoria. Lagos. Nigeria. Additional Contact: Prof. Okoronkwo (Editor-in-Chief): okoronkwo@gmail.com. Phone: +2348035925974. Email: francisuse@yahoo.co.uk ...

  5. EDITOR'S NOTE: THE HEROS OF NIJOTECH THE HEROS OF ...

    African Journals Online (AJOL)

    eobe

    In this issue, I on behalf of the Editor-in-Chief, Engr. Prof. J. C. Agunwamba, the Dean of Engineering Engr. Prof. O. U. Oparaku and other Associate Editors wish to express our gratitude to these unique and devoted people. We owe the success recorded so far in the quality of our papers to them. Apart from providing timely ...

  6. EDITORIAL: An overview of the African Journal of AIDS Research ...

    African Journals Online (AJOL)

    In 2013 there was a considerable backlog of manuscripts and the journal needed a change in leadership to build on the work of Dr Kelly. I (Alan Whiteside) was invited to become the editor-in-chief and take the journal into HEARD. Due to the need to get AJAR back on track, Gavin George, Tim Quinlan and Kaymarlin ...

  7. RNAi-mediated inhibition of Raf-1 leads to decreased angiogenesis and tumor growth in gastric cancer.

    Science.gov (United States)

    2009-09-01

    This article has been retracted at the request of the Editor-in-Chief. Reason: The Editors have determined that the article is a duplication of the authors' article in Cancer Biology & Therapy (2005) 4:113-117. This is in violation of the journal's policy against dual publication. For more information on this policy see: www.landesbioscience.com/journals/cbt/guidelines/#plagiarism.

  8. Book Reviews | Bernard | African Zoology

    African Journals Online (AJOL)

    . Abstract. Book Review 1. Book Title: The Physiology of Reproduction. Book Authors: Editors-in-Chief: E. Knobil, & J.D. Kneill. Raven Press, 1988. 2633 pages. Book Review 2. Book Title: Long-term Studies in Ecology: Approaches and ...

  9. Nigerian School Library Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. DF Elaturoti Editor-in-Chief Abadina Media Resource Centre, University of Ibadan, Nigeria Abadina Media Resource Centre, University of Ibadan, Nigeria Phone: +2348033893853. Email: davidelaturoti@yahoo.com. Support Contact. KA Aramide Email: kolaakinjide@gmail.com. ISSN: 0331-8214.

  10. Journal of the Ghana Institution of Engineers: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. Mohammed Salifu Editor-in-Chief Kwame Nkrumah University of Science and. Department of Civil Engineering Faculty of Civil and Geomatic Engineering College of Engineering Kwame Nkrumah University of Science and Technology (KNUST) University Post Office Kumasi, GHANA Phone: 00 233 51 ...

  11. South African Journal of Animal Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof V Muchenje Editor-in-Chief University of Fort Hare. University of Fort Hare. Faculty of Science and Agriculture. P. Bag X 1314, Alice, 5700, South Africa. Alternative email: vmuchenje@hotmail.com. Phone: +27 40 602 2059. Fax: +27 86 628 2967. Email: vmuchenje@ufh.ac.za ...

  12. A Conversation with Brie Mathers: Learning To Value Our Bodies and Our Selves.

    Directory of Open Access Journals (Sweden)

    Riane Eisler

    2016-06-01

    Full Text Available IJPS Editor-in-Chief Riane Eisler interviews Brie Mathers, director of the organization Love the Skin You're In, about her work to change how girls and women see themselves in the cultural transformation to a healthier, more equitable partnership society.

  13. Global Journal of Humanities: Submissions

    African Journals Online (AJOL)

    Articles should be sent to the Editor-In-Chief and Managing Editor. An assessment fee of N1000 (One Thousand Naira) or (US$10) should accompany all articles submitted. Articles not accompanied by the assessment fee shall not be processed. If you want to send your article through the internet please use Microsoft word ...

  14. Materials Best Paper Award 2013

    OpenAIRE

    Ophelia Han; Maryam Tabrizian

    2013-01-01

    Materials is instituting an annual award to recognize the outstanding papers in the area of materials science and engineering published in Materials. We are pleased to announce the first “Materials Best Paper Award” for 2013. Nominations were selected by the Section Editor-in-Chiefs and Editorial Board members of Materials from all papers published in 2009.

  15. African Crop Science Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. J.S. Tenywa Editor-in-Chief Faculty of Agriculture. Makerere University PO Box 7062 Kampala Uganda. Alternative email address: acsj@caes.mak.ac.ug. Email: acss@caes.mak.ac.ug. Support Contact. Editor Email: johntenywa@gmail.com. ISSN: 2072-6589. AJOL African Journals Online. HOW TO ...

  16. Nigerian Journal of Parasitology: Editorial Policies

    African Journals Online (AJOL)

    Elizabeth U. Amuta Department of Biological Sciences University of Agriculture Makurdi, Nigeria bettyamuta@gmail.com. Publishing and Circulation Office for soft and hard volumes. Editor-in-Chief/Web Manager Department of Pure and Applied Zoology Room A206 College of Biosciences Federal University of Agriculture

  17. Nigeria Agricultural Journal: Editorial Policies

    African Journals Online (AJOL)

    Michael Okpara University of Agriculture, Umudike, P.M.B. 7267, Umuahia, Abia State, Nigeria. jambanasor@yahoo.co.uk, editor.asnjournal@gmail.com. Deputy Editor-In-Chief - Prof. M.D. Alagbejo Ahmadu Bello University, Zaria. Associate Editors - Prof. M.O. Adedire University of Agriculture, Abeokuta Ogun State, Nigeria

  18. Annals of African Surgery: Submissions

    African Journals Online (AJOL)

    All manuscripts dealing with experimental results in animals must include a statement that the study has been approved by an animal utilization study committee. The Editor in Chief may further investigate that statement. Information about the management of postoperative pain for both animal and human subjects must be ...

  19. In Memoriam: Emerita Professor Mary Esther Kropp Dakubu | Osam ...

    African Journals Online (AJOL)

    2016-11-17

    From 2011 to 2016, she was the Editor-In-Chief of the Ghana Journal of Linguistics. She also co-edited the six volume series Studies in the Languages of the Volta Basin published by the Department of Linguistics, University of Ghana. Prof. Mary Esther Kropp Dakubu passed away on November 17, 2016, in Boston, MA, ...

  20. African Anthropologist: Submissions

    African Journals Online (AJOL)

    Authors should not submit their manuscripts to other journals while The African Anthropologist is considering them for publication. Manuscripts should be sent to Paul Nchoji Nkwi, Editor in Chief, B.P. 1862, Yaounde, Cameroon. All correspondence related to subscription, advertising, change of address, and any other ...

  1. Introduction to Pathogenic Protozoa

    Science.gov (United States)

    2011-06-01

    Chicago: ASCP Press; 1991. 4. Orihel TC, Ash, LR. Atlas of Human Parasitology . 4th ed. Chicago: ASCP Press; 1997. 5. Pethitory JC, Ardoin F, Ash LR, et...classification of human parasites. Manual of Clinical Microbiology, 9th edition, Volume 2, section X Parasitology , chapter 132, editor in chief PR Murray

  2. Editorial for the IEEE Transactions on Power Electronics, January 2009

    DEFF Research Database (Denmark)

    Blaabjerg, Frede

    2009-01-01

    I am entering the fourth year as the Editor in Chief of the IEEE TRANSACTIONS ON POWER ELECTRONICS. A position like this becomes more and more important for the technical field as publishing in a peer-reviewed highly ranked journal has influence on the industrial and academic career. It is a way...

  3. South African Journal of Higher Education: Submissions

    African Journals Online (AJOL)

    Please monitor the website to see the status of the article as it may need amendments. Correspondence. All correspondence and enquiries should be directed to: The Editor-in-Chief. South African Journal of Higher Education. Faculty of Education. Stellenbosch University. Private Bag X1. Matieland. 7602. Republic of South ...

  4. Nigerian Journal of Natural Products and Medicine: Contact

    African Journals Online (AJOL)

    Principal Contact. J. M.Agbedahunsi Ph.D. Editor in Chief Drug Research and Production Unit, Faculty of Pharmacy Faculty of Pharmacy, Obafemi Awolowo University, Ile-Ife, NIGERIA. Phone: +2348034093594. Fax: +234 36 231 733. Email: jagbedah@oauife.edu.ng ...

  5. Study of antioxidant enzymes, lipid peroxidation, lipid

    African Journals Online (AJOL)

    MJP

    immunologic factor in coronary artery disease in East. Azarbijan”. Sofola O.A. Editor-in-Chief, International Journal of Medicine and Biomedical Research. Department of Physiology, College of Medicine, University of Lagos, Nigeria. editor@ijmbr.com. The Editors and Publisher of the International Journal of Medicine and ...

  6. Zoologist (The): Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. A.B. Odaibo Editor-in-Chief University of Ibadan, Ibadan. Nigeria. Hydrobiology & Fisheries Unit, Department of Zoology, University of Ibadan, Ibadan. Oyo State. Nigeria. West Africa. Alternative Email Address: adebakar19@yahoo.com. Phone: +234-(0)- 803-049-74. Fax: +234-02-8103043

  7. Profile Interview: Dr Lucinda Manda-Taylor

    African Journals Online (AJOL)

    From the foregoing, I believe that my education and professional experience provides me with the requisite expertise, training, motivation, and leadership skills to take on any new challenge, including my new role as editor-in- chief of the Malawi Medical Journal (MMJ). TK: How do you plan on taking up the challenge of this.

  8. Editorial

    Indian Academy of Sciences (India)

    Come 2015, there will be some changes in the Journal of Genetics. Given the stabilization of the journal, and a steadily increasing number of submissions and acceptances, we will be publishing four issues a year, starting 2015. We will also have a change of Editor-in-Chief, and it is my great pleasure to introduce and ...

  9. Abia State University Medical Students' Association Journal ...

    African Journals Online (AJOL)

    Advertisement Rate per issue. SUBSCRIPTION Nigeria: Personal N 500 per issue. Institutional N 600 per issue. Outside Aba- Add 30% extra for postage. Correspondence should be addressed to: The Editor-in-Chief ABSUMSAJ School of Clinical Medicine Abia State University Teaching Hospital, Aba Abia State.

  10. South African Journal of Higher Education: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof Yusef Waghid Editor-in-Chief South African Journal of Higher Educatio. South African Journal of Higher Education Faculty of Education Stellenbosch University. Private Bag X1 Matieland 7602. Phone: +27 (021) 8082419. Fax: +27 (021) 8082283. Email: yw@sun.ac.za ...

  11. African Journal of Educational Studies in Mathematics and Sciences ...

    African Journals Online (AJOL)

    Principal Contact. Prof Jophus Anamuah-Mensah Editor-in-Chief University of Education, Winneba. Faculty of Science Education, University of Education, Winneba, P. O. Box 25, Winneba, Ghana. Phone: +233 24 4323186. Fax: +233 432 22361. Email: jophusam@gmail.com ...

  12. AJFAND Guest Editorial

    African Journals Online (AJOL)

    KenBu

    the world food science and technology community. Some highlights for Africa include: • Dr Ruth Oniang'o, Editor-in-Chief of AJFAND, has assumed the role of Chair of the Executive Council of the International Academy of Food Science and. Technology (IAFoST), previously held by Prof Delia Rodriguez-Amaya of. Brazil;.

  13. Back to School: The Quality of Citizenship Education in Harare - An ...

    African Journals Online (AJOL)

    Book Review. Back to School: The Quality of Citizenship Education in Harare - An Evaluation of the Implementation of the Citizenship Curriculum at Primary School by Oswell Namasasu. Scholar's Press (2013); ISBN: 978-3-639-70132-6; pp. 303. Reviewed by Professor F. Zindi (Editor-in-Chief, ZJER). “The ideas displayed ...

  14. Global Approaches to Extension Practice: A Journal of Agricultural ...

    African Journals Online (AJOL)

    Accepted articles become the copyright of GAEP, but authors should note that they will be held responsible in case they violate the copyright of others. 7. Authors of accepted articles shall be required to pay a publication fee. All correspondence to: Dr Edna C. Matthews-Njoku (Editor-in-Chief) Department of Agricultural ...

  15. EDITORIAL

    African Journals Online (AJOL)

    user

    2014-01-01

    Jan 1, 2014 ... of this project, the Editor-in-Chief of EJHS became member of the Council of Science Editors. The project [AJPP] also helped EJHS partner with the prestigious Annals of Internal Medicine published by. American College of Physicians from which EJHS it gained a great deal. In 2009, the Ethiopian Journal.

  16. Editorial Prof Lundgren's significant contribution to SAJAA and its ...

    African Journals Online (AJOL)

    Prof Chris Lundgren was the Editor-in-Chief of the Southern. African Journal of Anaesthesia and Analgesia (SAJAA) for a remarkable 14 years from 2001-2015. Under her excellent guidance, the journal has developed and grown to the point that the Academy of Science for South Africa's (ASSAf) review of scholarly ...

  17. Nigeria Agricultural Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. J.A. Mbanasor Editor in Chief Head of Department, Agribusiness and Management College of Agribusiness and Financial Management Michael Okpara University of Agriculture Office of the Head of Department. Agribusiness and Management. College of Agribusiness and Financial Management.

  18. Zede Journal: Editorial Policies

    African Journals Online (AJOL)

    Dr. Daniel Kitaw, Editor-in-Chief. Dr. Frehiwot Woldehanna, Secretary. Dr. Abubeker Yimam, Member. Dr. Hiyaw Terefe, Member. Dr. Daniel Fikreselassie, Member. Dr. Yosief Birru, Member. Publisher. AAU Printing Press. Addis Ababa University. P.O.Box 1178. Addis Ababa. Ethiopia ...

  19. Nnamdi Azikiwe University Journal of International Law and ...

    African Journals Online (AJOL)

    Principal Contact. Dr. Ikenga K.E. Oraegbunam Editor-in-chief. Nnamdi Azikiwe University. Department of International Law and Jurisprudence, Faculty of Law, Nnamdi Azikiwe University, P.M.B. 5025, Awka, Anambra State, Nigeria. Alternate E-Mail: ikengaken@gmail.com. Phone: +2348034711211

  20. Ghana Mining Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Professor Daniel Mireku-Gyimah Editor-in-Chief University of Mines & Technology Ghana Mining Journal University of Mines & Technology P. O. BOX 237 Tarkwa Ghana Phone: +233 362 20280/20324. Fax: +233 362 20306. Email: dm.gyimah@umat.edu.gh ...

  1. SoMHiL and OJPAS™: “like a rolling stone”

    Directory of Open Access Journals (Sweden)

    Shyamanta Das

    2017-01-01

    Full Text Available The Society of Mental Health in LAMIC (SoMHiL and Academia Dysphrenia come together to run the Open Journal of Psychiatry & Allied Sciences (OJPAS™. The Editor-in-Chief is going to change from the upcoming issue.

  2. SINET: Ethiopian Journal of Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Gezahegn Yirgu Editor-in-Chief Addis Ababa University Addis Ababa University College of Natural Sciences Arat Kilo Campus P.O.Box 1176 Addis Ababa Ethiopia Phone: 251 111 239462. Fax: 251 111 239462. Email: gezahegnyirgu@yahoo.com ...

  3. Are we ready to move forward?

    Science.gov (United States)

    Bill Block

    2012-01-01

    In this issue, I feature an invited paper by Michael Morrison titled ''The Habitat Sampling and Analysis Paradigm has Limited Value in Animal Conservation: a Prequel.'' As many of you know, Dr. Morrison was a former Editor-in-Chief for Journal of Wildlife Management and established himself as one of the leaders in the field of wildlife-habitat...

  4. African Journal of Endocrinology and Metabolism: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. G.O. Ajayi Editor-in-Chief University of Lagos Department of Obstetrics & Gynaecology, College of Medicine, University of Lagos, P.M.B. 12003, Idi-Araba Lagos Nigeria Phone: 234-1-8507681. Fax: 234-1-17404387. Email: goajayi@yahoo.com ...

  5. Bioprinting in Regenerative Medicine

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2016-02-01

    Full Text Available Prof. Turksen is a very well known scientist in the stem cell biology field and he is also internationally known for his fundamental studies on claudin-6. In addition to his research activity he is editor for the Stem Cell Biology and Regenerative Medicine series (Humana Press and editor-in-chief of Stem Cell Reviews and Reports.....

  6. Interview with Mikhail Gulyukin - Director of All-Russian research Institute of experimental Veterinary Medicine named after Y. R. Kovalenko, academician of the Russian Academy of Sciences

    OpenAIRE

    GULYUKIN M.I.

    2016-01-01

    Interview with Mikhail Gulyukin director of All-Russian Research Institute of Experimental Veterinary Medicine named after Y.R. Kovalenko, Academician of the Russian Academy of Sciences. Interview taken on August 18, 2016 by Editor-in-Chief of RJOAS.

  7. Nigeria Journal of Pure and Applied Physics: Contact

    African Journals Online (AJOL)

    Principal Contact. Professor A. M. Arogunjo Editor-in-Chief Department of Physics Federal University of Technology, Akure. Alternative email addresses: amarogunjo@futa.edu.ng; njpap@futa.edu.ng. Phone: +234 34 241305. Email: phy@futa.edu.ng ...

  8. Once a physicist: Philip Earis

    Science.gov (United States)

    2017-06-01

    Philip Earis is editor-in-chief of Joule, a new sustainable-energy journal. He recently returned to the UK after three years living in India, where he founded “Project Light” - an organization bringing solar power to off-grid communities

  9. Journal of the Ghana Institution of Engineers: Submissions

    African Journals Online (AJOL)

    Submission Three (3) original printouts of the paper should be submitted to the address below. An electronic copy in MS Word, MS Excel format shall be required after the final revision. The Editor-in-Chief Journal of the Ghana Institution of Engineers Engineers Center 13 Continental Road, Roman Ridge, P. O. Box AN 7042

  10. THE AFRICAN ASSOCIATION FOR LEXICOGRAPHY

    African Journals Online (AJOL)

    Riette Ruthven

    In 1992, a feasibility study was done to determine the need for a Southern Afri- can Institute for Lexicography. The idea for such an Institute originated at the. Board of Control of the Woordeboek van die Afrikaanse Taal (WAT). The then. Editor-in-Chief of the Bureau of the WAT, Dr D.J. van Schalkwyk, requested Dr. M. Alberts ...

  11. Pharmacy preparations : Back in the limelight? Pharmacists make up your mind!

    NARCIS (Netherlands)

    Crommelin, Daan J A|info:eu-repo/dai/nl/074578804; Bouwman-Boer, Yvonne

    2016-01-01

    In this contribution to the theme issue recognizing prof. Florence's achievements as editor -in-chief of the Int. J. Pharmaceutics, we analyze the future of pharmacy preparations (also known as extemporaneous preparations or compounded products). Pharmacy preparations, long considered as an

  12. Nigerian Journal of Animal Production: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. Olajide A.ADEYEMI Editor-in-Chief (NJAP) Department of Animal Production and Health Federal University of Agriulture. Department of Animal Production and Health. Federal University of Agriulture. PMB 2040, Aeokuta. Ogun State. Nigeria. Alternative Email: adeyemioa@funaab.edu.ng.

  13. Introduction to the Clinical Forum: Reading Comprehension Is Not a Single Ability.

    Science.gov (United States)

    Gray, Shelley

    2017-04-20

    In this introduction to the clinical forum on reading comprehension, the Editor-in-Chief of Language, Speech, and Hearing Services in Schools provides data on our national reading comprehension problem, resources for increasing our understanding of reading comprehension, and a call to action for speech-language pathologists to work with educational teams to address poor reading comprehension in school-age children.

  14. Science, Technology and Arts Research Journal: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Manuscripts Submission Manuscript must be submitted with a covering letter from the author of correspondence to the Editor in Chief by e-mail. After the successful submission of manuscript the corresponding author will be acknowledged within 72 hours. Any quarry regarding the preparation ...

  15. Abia State University Medical Students' Association Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Ivuoma Okoroafor Editor-in-Chief School of Clinical Medicine, Abia State c/o School of Clinical Medicine Abia State University Teaching Hospital, Aba Abia State. PMB 7004. Phone: +234-07066896553. Email: absumsajournal@yahoo.com ...

  16. The Muslim Brotherhood in America: Orthodox and Active

    Science.gov (United States)

    2012-05-17

    especially America. By 1952, he led the society’s propaganda department as editor-in-chief of the weekly, Al Ikhwan al- Muslimin. In 1954, a MB...houses as tall or taller than a Muslim’s building; are forbidden to display wine or pork; are forbidden to ring church bells or display crosses; are

  17. FUTY Journal of the Environment: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. A. A. Adebayo Editor-in-Chief Federal University of Technology SES, Federal University of Technology PMB 2076, Yola Nigeria Phone: +2348034370211. Email: bayobel@gmail.com. Support Contact. Dr. T. O. Idowu (Editor/Editorial Board Secretary) Phone: +2348034269273

  18. Acta Theologica: Editorial Policies

    African Journals Online (AJOL)

    Redaksie/Editorial Staff. Prof. J-A van den Berg (Hoof redakteur/Editor in chief). Dr. L. Hoffman (Executive editor/Uitvoerende redakteur). Rev. M. Laubshcer. Dr J.K. Pali. Prof W.J. Schoeman. Prof. S.D. Snyman. Prof D.F. Tolmie. Dr H.C. van der Westhuizen. Prof. R. Venter ...

  19. Author Details

    African Journals Online (AJOL)

    Editor-in-Chief, The. Vol 2, No 2 (2013) - Articles Editorial Abstract PDF. ISSN: 2408-5987. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL · News. OTHER RESOURCES.

  20. Ergonomics SA: Submissions

    African Journals Online (AJOL)

    Manuscript submissions. Authors should submit their full papers (using the abovementioned template) as an attachment via email to the journal email address j.mcdougall@ru.ac.za. All submitted papers should be sent in .doc or .rtf formats. No other formats will be accepted. Editor. Editor-in-Chief: Ergonomics SA

  1. African Journal of Food, Agriculture, Nutrition and Development ...

    African Journals Online (AJOL)

    Principal Contact. Prof. Ruth K. Oniang'o, PhD. Editor-in-Chief Jomo Kenyatta University of Agriculture. 9 Planets Apartments S#6. Kabarnet Gardens, Kabarnet Rd. P.O. Box 29086-00625 Nairobi, Kenya Phone: +254 (0) 722 406955. Email: oniango@iconnect.co.ke ...

  2. Bridging Scholarship and Practice: 20 Years of the Public International Law and Policy Group

    NARCIS (Netherlands)

    Fraser, J.A.; Mc Gonigle, B.N.

    2017-01-01

    When the Editor-in-Chief of the Utrecht Journal of International and European Law (UJIEL) approached us with the possibility of guest editing a special issue related to public international law and policy, we felt the timing could not have been better. As academics at Utrecht University with the

  3. Health Sciences in Iran; Past and Present

    Directory of Open Access Journals (Sweden)

    Dehghani R.* PhD

    2014-08-01

    Full Text Available As this is the first issue of the International Archives of Health Sciences, a scholarly journal of Kashan University of medical Sciences, we start with an editorial of Dr. Rouhullah Dehghani, the editor-in-chief, to explain the aims and views of the editorial board members and the scope of the journal.

  4. AFRREV LALIGENS: An International Journal of Language ...

    African Journals Online (AJOL)

    Principal Contact. Prof. Clement O. O. Kolawole Editor in Chief Professor, Language Education, Curriculum & Instruction Department of Teacher Education Faculty of Education, University of Ibadan, Nigeria. P. O. Box 1150. Awka, Anambra State. Nigeria. Email: kocycool54@yahoo.com ...

  5. Problem-based learning

    NARCIS (Netherlands)

    Loyens, Sofie; Kirschner, Paul A.; Paas, Fred

    2010-01-01

    Loyens, S. M. M., Kirschner, P. A., & Paas, F. (2011). Problem-based learning. In S. Graham (Editor-in-Chief), A. Bus, S. Major, & L. Swanson (Associate Editors), APA educational psychology handbook: Vol. 3. Application to learning and teaching (pp. 403-425). Washington, DC: American Psychological

  6. Nigerian School Library Journal: Editorial Policies

    African Journals Online (AJOL)

    Peer Review Process. The reviewer is requested to evaluate each manuscript on the basis of its content as well as its relevance to library and information science including school media. On initial receipt of articles, the Editor-in Chief reads through each article to establish a prima facie quality of the article and relevance to ...

  7. General editorial on publication ethics

    Indian Academy of Sciences (India)

    We join our readers and contributors in continuing to hope that the vigilance and care exercised by our referees and editors will minimize this problem. R. RAMASWAMY. AMITABH JOSHI. Editor of Publications. Editor-in-Chief. Journal of Genetics. N. MUKUNDA. Previous Editor of Publications. Indian Academy of Sciences.

  8. SA Journal of Radiology: Editorial Policies

    African Journals Online (AJOL)

    Editorial Board. Editor-in-chief. Ian Duncan Guest editor. S. Beningfield Production editor. Julia Casciola Editorial board. Coert de Vries Leonie Scholtz Darius Tsatsi Savvas Andronikou Peter Corr Alan Scher Steve Beningfield Malan van Rensburg Mala Modi. ISSN: 2078-6778. AJOL African Journals Online. HOW TO USE ...

  9. Nigeria Journal of Business Administration: Submissions

    African Journals Online (AJOL)

    Author Guidelines. 1. Those who wish to have their articles published in the Nigeria Journal of Business Administration are hereby requested to forward them to the Editor-in-Chief at the address given at the bottom of this page. 2. Heads of Department of offering doctoral degree programmes in Business Administration or ...

  10. Editorial

    African Journals Online (AJOL)

    inception, and as past Chairman of the South African Society for Clinical Psychology. Editor-in-Chief of the Indo-. Pacific Journal of Phenomenology since 2003, he is also on the editorial panels of two other online journals. Professor. Stones's research interests are in the areas of identity, attitudes and attitude change, ...

  11. GUIDELINES FOR CONTRIBUTORS PLEASE follow these ...

    African Journals Online (AJOL)

    USER

    Editor-in-Chief, via our website at gjl.laghana.org. Authors should be sure to keep hard and soft copies for their own future reference. Articles should not exceed 10,000 words in length. They should be written in a text format or a recent version of Word (.docx format is preferred). PDF format is not acceptable. TITLE PAGE: ...

  12. A Conversation with Sally Coxe: A Primate Partnership Culture

    Directory of Open Access Journals (Sweden)

    Riane Eisler

    2017-10-01

    Full Text Available IJPS Editor-in-Chief Riane Eisler talks with Sally Coxe, founding director of the Bonobo Conservation Initiative (BCI, dedicated to protecting these uniquely peaceful primates who share more than 98 percent of our human species’ genes and are on the brink of extinction, as well as protecting their rainforest home.

  13. Journal of Tropical Microbiology and Biotechnology: Editorial Policies

    African Journals Online (AJOL)

    Editor in Chief. Dr. Hamadi Iddi Boga, Kenya. E-mail: hamadiboga@yahoo.com or hboga@fsc.jkuat.ac.ke. Editorial Board. Prof. J.H.P Kahindi. Dr. M. Younan, Germany. Dr. I. Virgin, Sweden. Dr. M.G. Yates, United Kingdom. Dr. Emmanuel De Souza, Brazil. Dr. Gunnel Dalhammar, Sweden. Dr. Claude Sabeta, Zimbabwe.

  14. The Tshivend√a–English T√halusamaipfi/Dictionary as a Product ...

    African Journals Online (AJOL)

    rbr

    was also clearly defined, making provision for: (a) a Chairperson appointed by the Minister;. (b) an Editor-in-chief […]; (c) a person appointed by the Minister who, at the request of the Minister, has been nominated by a language body for the language concerned referred to in […] the Pan South African Language Board Act, ...

  15. Contributions by Jans Wesseling, Jan van Schilfgaarde, and Herman Bouwer to effective and responsible water management in agriculture

    NARCIS (Netherlands)

    Raats, P.A.C.; Feddes, R.A.

    2006-01-01

    The first three, successive Editors-in-Chief of Agricultural Water Management, Jans Wesseling, Jan van Schilfgaarde, and Herman Bouwer, were of Dutch origin, received their early training immediately after World War II, and started their careers in the early 1950s: Jans in The Netherlands and Jan

  16. Merger as a Remedy in Higher Education Desegregation. Geier v. University of Tennessee.

    Science.gov (United States)

    Shimeall, Kent M.

    1980-01-01

    The propriety of a district court's decision favoring the merger of a predominantly White state university and a predominantly Black state university, to desegregate them, is discussed. Alternatives and the role of Black institutions are considered. (Journal availability: Editor-in-Chief, College of Law, University of Toledo, Toledo, OH, $3.00.)…

  17. Nigerian Journal of Biotechnology: Editorial Policies

    African Journals Online (AJOL)

    Department of Crop Protection, College of Plant Science and Crop Production, Federal University of Agriculture, Abeokuta, Ogun State. Nigeria. EDITORIAL OFFICE II Department of Biochemistry, Faculty of Life Sciences, Ahmadu Bello Univesity, Zaria, Kaduna State. Nigeria. Editor-in-Chief Professor Akinola R. Popoola,

  18. Journal of East African Natural History: Submissions

    African Journals Online (AJOL)

    2017-11-01

    Nov 1, 2017 ... Author Guidelines. Submission: manuscripts should be submitted as a Word document in an email attachment, to the Editor-in-Chief, Journal of East African Natural History at office@naturekenya.org. The manuscript should be accompanied by a covering letter from the author, or in the case of multiple ...

  19. Is Julian Assange an International Version of Daniel Ellsberg and WikiLeaks the Modern Equivalent of the Pentagon Papers?

    Science.gov (United States)

    Freivogel, William H.

    2011-01-01

    History has placed the stamp of approval on the publication of the Pentagon Papers, the top-secret history of the Vietnam War. If WikiLeaks editor-in-chief Julian Assange is another Daniel Ellsberg, then it is possible the website's disclosures will be viewed over time as similarly in the public interest. A classroom discussion on the release of…

  20. Reflections Lederberg and the 'Cellularity' of Bacteria

    Indian Academy of Sciences (India)

    Srimath

    world, mainly via a blog called “Small Things Considered”. He has authored several influential textbooks and reference works. He suc- ceeded Joshua Lederberg as Editor-in-Chief of the Encyclopedia of Microbiology. He also authored a book, In the Company of Mushrooms, which deals with his avocation, wild mushrooms.

  1. East and Central African Journal of Surgery: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Ignatius Kakande Editor-in-Chief Association of Surgeons of East Africa. East and Central African Journal of Surgery. P.O. Box 7051. Kampala. Uganda. Alternative email: igkakande@gmail.com. Phone: +256 772 501 745. Email: ecajs@gmail.com ...

  2. International Journal of Development and Management Review ...

    African Journals Online (AJOL)

    References should follow the APA style. A non-refundable assessment fee of One Thousand Naira (N1,000.00) in Bank draft (or its equivalent in US Dollar) drawn in any branch of Union Bank Nigeria Plc. In Owerri or cash payable to Editor-in-chief (Dr. E.B.J. Iheriohanma) should be included. INJODEMAR is expected to ...

  3. Lagos Journal of Library and Information Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Adebambo Oduwole (Ph.D) Editor-in-Chief Lagos State University Library, Ojo, Lagos Lagos Journal of Library and Information Science. University of Lagos Library, Akoka-Yaba, Lagos Nigeria. Alternative Email: nlalagos@outlook.com. Email: bambose26@yahoo.com ...

  4. Research Review of the Institute of African Studies: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. M.E. Kropp Dakubu Editor-in-Chief University of Ghana. Research Review. Institute of African Studies. P.O.Box LG73 Legon, Ghana. Phone: 211-24-4764006. Fax: 233-21-500512. Email: medakubu@ug.edu.gh. Support Contact. Dr Stephen Acheampong Phone: 211-24-4979233

  5. Emerging Perspectives on Editorial Ethics: An Interview with Chris Higgins

    Science.gov (United States)

    Jackson, Liz

    2017-01-01

    Chris Higgins took on the roles of Editor of "Educational Theory," and Editor-in-Chief of the "Philosophy of Education Yearbook" published by the Philosophy of Education Society, in 2013, after having been an Associate Editor and Book Review Editor for "Educational Theory" for six years. Higgins worked closely with…

  6. Nigerian Journal of Animal Production: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Manuscripts: All manuscripts and correspondence concerning the Journal should be sent to the Editor-in-Chief, Dr. O.O. Oduguwa, Department of Animal Nutrition, University of Agriculture, P.M.B. 2240, Abeokuta, Ogun State, Nigeria. E-mail: oduguwa@unaab.edu.ng. Manuscripts are invited from an over ...

  7. Retraction Notice to ;Fabrication, electromagnetic characteristics of microwave absorbers containing Li0.35Zn0.3Fe2.35O4 micro-belts, nickel-coated carbon fibers; [J. Magn. Magn. Mater. 345 (2013) 249-254

    Science.gov (United States)

    Zhao, Bin; Wang, Qilei; Zhang, Cunrui

    2017-08-01

    This article has been retracted: please see Elsevier Policy on Article Withdrawal This article has been retracted at the request of the Editor-in-Chief. The authors have plagiarized part of a paper that had already appeared in Ceram. Int., 39 (2013) 2317-2322,

  8. Pan African Medical Journal: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr Raoul Kamadjeu Editor-in-Chief The Pan African Medical Journal Phone: +254 714 606 223. Email: raoul.kamadjeu@gmail.com. Support Contact. Editor Email: editor@panafrican-med-journal.com. ISSN: 1937-8688. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...

  9. African Health Sciences: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr James Tumwine Editor-in-Chief. Makerere University Medical School P. O. Box 7072 Kampala Uganda. Phone: 256-41-530020/1. Email: kabaleimc@gmail.com. Support Contact. Pauline Salamula Email: paulinesalamula@gmail.com. ISSN: 1680-6905. AJOL African Journals Online. HOW TO USE ...

  10. Large-scale organizational change: an executive's guide

    National Research Council Canada - National Science Library

    Laszlo, Christopher; Laugel, Jean-François

    2000-01-01

    ... for managers who sail into the teeth of complexity and paradox." -Perry Pascarella, former editor-in-chief, Industry Week "Large-Scale Organizational Change opens new and promising avenues for leaders of large organizations. It shows how ecological sustainability itself changes the relationship between business and the outside world....

  11. Nigerian Journal of Chemical Research: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Manuscript Requirements: The original and two other copies of the manuscript, type double-spaced, on A4 paper size should be submitted complete with tables and figures to the Editor-in- Chief. The content of the article should be organized in sections to include: Title: should be short, specific and ...

  12. JPRS Report, Soviet Union, Peoples of Asia and Africa, No. 6, November-December 1987

    Science.gov (United States)

    1988-06-07

    Contemporary Chinese Poetry 5 104 Shestakova I.V. The Energy Policies of Japan .... 4 115 Shitov V.N. Problems of the Democratization of Inter- national...Questions of Economic History. Anthology. Editor-in-chief A.M. Petrov 5 183 Beylis V.A. Epic Literature of the Peoples of Africa below the Sahara. Ye.S

  13. The influence of administrative leadership: an interview with Dr Karen S. Hill.

    Science.gov (United States)

    Hill, Karen S; Adams, Jeffrey M

    2015-01-01

    This department highlights nursing leaders who have demonstrated a commitment to patient care leadership and innovation in practice, policy, research, education, and theory. This interview profiles Karen Hill, DNP, RN, NEA-BC, FACHE, FAAN, chief operating officer and chief nursing officer of Baptist Health in Lexington, Kentucky, and editor-in-chief of the Journal of Nursing Administration.

  14. Comments on the nonpharmaceutical interventions in New York City and Chicago during the 1918 flu pandemic

    OpenAIRE

    Barry, John M

    2007-01-01

    Abstract This commentary was originally published in CIDRAP News and it is here reported almost verbatim to allow divulgation through open access. The Editorial summarizes John Barry's concerns about the value of accurate historical reporting and its implications in public policy determination. This short abstract was written by the Editor-in-Chief of the Journal of Translational Medicine to introduce the Editorial.

  15. Journal of the Obafemi Awolowo University Medical Student's ...

    African Journals Online (AJOL)

    Manuscripts should be sent electronically to the Editor-in-Chief, IFEMED Journal club at ifemedjc@yahoo.com, ifemedjc@gmail.com or by post to the editorial office ... 1. title page with full title of paper 10 words maximum , author's full name, postal and electronic addresses, degrees , department and institutional affiliations

  16. Journal of Applied Science and Technology: Contact

    African Journals Online (AJOL)

    Principal Contact. Nana (Prof) Ayensu Gyeabour I Editor-in-Chief. Journal of Applied Science and Technology (JAST), Graduate School of Nuclear & Allied Sciences, University of Ghana, Atomic Campus, P.O. Box AE 1, Atomic, Accra, Ghana. Phone: +233-244-772255. Email: jastpublication@gmail.com ...

  17. Retracted: FLT3: beyond good and evil.

    Science.gov (United States)

    Lagunas-Rangel, Francisco Alejandro; Cortes-Penagos, Carlos; Viveros-Sandoval, Martha Eva

    2016-07-29

    The above article, published online on 29 July 2016 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the Journal Editor in Chief, Journal Production Manager, and John Wiley & Sons, Ltd. The retraction has been agreed due to 48% similar significant between this article and an article published in Nature Reviews Cancer journal. Copyright © 2016 John Wiley & Sons, Ltd.

  18. From the Field: Speech Therapy Outcome Measures--Interview with Dr. Pam Enderby

    Science.gov (United States)

    Montgomery, Judy K.

    2015-01-01

    This article is an interview with Dr. Pam Enderby--a speech language therapist and professor at the Institute of General Practice and Primary Care at the University of Sheffield, Community Sciences Centre, Northern General Hospital, in the United Kingdom--conducted by Judy Montgomery, Editor in Chief, of "Communication Disorders…

  19. Tropical Journal of Medical Research: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. J.C Orakwe Editor-in-Chief Nnamdi Azikiwe University Teaching Hospital Tropical Journal of Medical Research, C/o Department of Surgery, Nnamdi Azikiwe University Teaching Hospital P.M.B 5025. Nnewi, Nigeria. Email: jayceeorakwe@yahoo.com ...

  20. A History of the Emerging Infectious Diseases Journal

    Centers for Disease Control (CDC) Podcasts

    2015-03-17

    EID Editor-in-Chief, Dr. D. Peter Drotman and Dr. James Hughes discuss the history of the Emerging Infectious Diseases journal.  Created: 3/17/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 3/17/2015.

  1. Nigerian Journal of Technological Research: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. OOA Fasanya Editor-in-Chief Federal University of Technology, Minna, Niger State, Nigeria Journal Office, Federal University of Technology, P.M.B. 65, Minna, Niger State, Nigeria Phone: +234 81313 45053. Email: njtrfutminna@gmail.com ...

  2. Journal of Applied Chemistry and Agricultural Research: Editorial ...

    African Journals Online (AJOL)

    Peer Review Process. Each paper is initially sent to two reviewers (subject specialists) and where there are divergent views a copy is sent to a third reviewer and from these reviews the Editor-in-Chief takes final decision about the papers. Publication Frequency. One volume published annually. Editorial Team. EDITORIAL ...

  3. Agricultural and Food Science Journal of Ghana: Editorial Policies

    African Journals Online (AJOL)

    Editorial Board. Dr. Joseph Nketia Berchie - Editor-in-Chief; Dr. Moses Branford Mochiah - Editor; Dr. (Mrs.) Adelaide Agyeman - Editor; Dr. (Mrs.) Marian D. Quain - Editor; Mrs. Lawrencia D. Acheampong - Secretary; Dr. Joseph Manu Aduening - Editor; Dr. Haruna Braimah - Editor; Mr. Ralph Bam - Editor; Mr. Albert Aubyn - ...

  4. Hyperhidrosis and botulinum toxin: expanding horizons.

    Science.gov (United States)

    Heymann, Warren R

    2008-08-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  5. Tumor necrosis factor inhibitor-induced pustular psoriasis?

    Science.gov (United States)

    Heymann, Warren R

    2007-02-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  6. Dengue fever.

    Science.gov (United States)

    Heymann, Warren R

    2009-02-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  7. Antipsoriatic biologic agents for the treatment of atopic dermatitis.

    Science.gov (United States)

    Heymann, Warren R

    2007-05-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  8. The human papillomavirus vaccine.

    Science.gov (United States)

    Heymann, Warren R

    2008-06-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  9. Epidermal growth factor receptor inhibitors and hair.

    Science.gov (United States)

    Heymann, Warren R

    2008-04-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  10. The human genome: Mutating from science fiction to reality.

    Science.gov (United States)

    Heymann, Warren R

    2008-01-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  11. Streptococcal vulvovaginitis.

    Science.gov (United States)

    Heymann, Warren R

    2009-07-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided hear as a special service to readers of the Journal of the American Academy of Dermatology.

  12. Liposuction in men.

    Science.gov (United States)

    Heymann, Warren R

    2006-08-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  13. Imiquimod use in the treatment of lentigo maligna.

    Science.gov (United States)

    Junkins-Hopkins, Jacqueline M

    2009-11-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Jacqueline M. Junkins-Hopkins, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  14. Immunomodulatory therapy of cutaneous T-cell lymphoma: a multimodality approach in advanced disease.

    Science.gov (United States)

    Junkins-Hopkins, Jacqueline M

    2009-12-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Jacqueline M. Junkins-Hopkins, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  15. Scurvy in children.

    Science.gov (United States)

    Heymann, Warren R

    2007-08-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  16. Psoriasis: the heart of the matter.

    Science.gov (United States)

    Heymann, Warren R

    2008-03-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  17. Screening for melanoma.

    Science.gov (United States)

    Heymann, Warren R

    2007-01-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  18. Peutz-Jeghers syndrome.

    Science.gov (United States)

    Heymann, Warren R

    2007-09-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  19. Outcomes research in dermatology.

    Science.gov (United States)

    Heymann, Warren R

    2008-02-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  20. Treatment of cutaneous T-cell lymphoma: focus on vorinostat.

    Science.gov (United States)

    Heymann, Warren R

    2008-10-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  1. Eosinophilic dermatoses.

    Science.gov (United States)

    Heymann, Warren R

    2006-07-01

    Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  2. Journal of Aquatic Sciences: Editorial Policies

    African Journals Online (AJOL)

    Editorial Board. Dr. O. A. Davies - Dept. of Fisheries and Aquatic Environment, RSUST (Editor-in-Chief). Prof. A. A. Olatunde (FAAS) - Dept. of Biol. Sc., University of Abuja, Nigeria (Editor). Prof. A. I. Hart - Dept. Animal and Environmental Biology, UNIPORT, Nigeria (Editor). Dr. J. F. N. Abowei - Dept. of Biol. Sc., Niger Delta ...

  3. African Journal of Physiotherapy and Rehabilitation Sciences ...

    African Journals Online (AJOL)

    Author Guidelines. Manuscripts should be submitted electronically to ajparsibadan@yahoo.co.uk. Alternatively, three hard copies and an MS Word copy of the manuscript on compact disc should be sent to: The Editor-in-Chief, AJPARS c/o Department of Physiotherapy, College of Medicine University of Ibadan PMB 5017 ...

  4. Hydrological and hydro-geological effects on wetlands and forest areas from the repository at Forsmark. Results from modelling with MIKE SHE; Hydrologiska och hydrogeologiska effekter paa vaatmarker och skogsomraaden av slutfoervarsanlaeggningen i Forsmark. Resultat fraan modellering med MIKE SHE

    Energy Technology Data Exchange (ETDEWEB)

    Maartensson, Erik; Gustafsson, Lars-Goeran; Gustafsson, Ann-Marie; Aneljung, Maria; Sabel, Ulrika (DHI Sverige AB, Goeteborg (Sweden))

    2010-06-15

    This report provides background material for investigations and associated impact assessments concerning water operations in terms of withdrawal of groundwater from the final repository for spent nuclear fuel at Forsmark. The report presents detailed modelling results in the form of supplementary sensitivity analyses and detailed hydrological and hydrogeological analyses of specific nature objects in Forsmark. The sensitivity analyses aim to investigate the sensitivity of the modelling results to i) the meteorological conditions, ii) impervious surfaces and iii) the model description of the present SFR (final repository for short-lived radioactive waste). A number of simulation cases aim to study cumulative effects of groundwater withdrawal from an extended SFR. The simulations are evaluated with respect to the groundwater table drawdown and head changes in the bedrock. The report analyses the hydrogeological and hydrological conditions for a number of selected wetland objects and forest objects. The selection of objects aims to cover different types of valuable nature objects at different geographical locations in relation to the influence area of the groundwater table drawdown. The analysis comprises groundwater levels at all nature objects, whereas wetlands with particularly high nature values have been studied in detail with respect to surface water levels, the need for water supply and object-specific water balances. These studies have been performed for different meteorological conditions in the form of a type (2006) and a statistically normal, dry and wet year, respectively, with a return period of 100 years for the dry- and wet years. All simulations for disturbed conditions with a fully open repository are done with a hydraulic conductivity of K{sub inj} = 10-7 or 10-8 m/s in the grouted zone. The results show that time-dependent precipitation and snow melt have large influence on the temporal variations of the depth to the groundwater table for undisturbed conditions. Precipitation and snow melt also have large influence on the drawdown of the groundwater table due to the groundwater withdrawal from the repository. For a normal year, based on precipitation data from the reference normal period 1961-1990, the annual average size of the influence area is 1.15 km2 for a grouting level of K{sub inj} = 10-7 m/s. Compared to the normal year, the size of the influence area is 17% larger during a dry year and 19% smaller during a wet year. The groundwater table drawdown also varies during individual years. For the type year 2006, the size of the influence area is approximately three times larger in November than in May. Implementation of the present SFR underground facility in the modelling tool MOUSE yields a groundwater inflow to SFR of 6.7 L/s, compared to a measured inflow of some 6 L/s. According to model calculations, the groundwater withdrawal from SFR causes groundwater table drawdown in an area with a size of 0.17 km2. The influence area is concentrated to the SFR pier and areas with vertical fracture zones in the rock, located north and northeast of Lake Bolundsfjaerden. The head change in the bedrock at the level 50 m b s l reaches the model boundary in the northeast. An extension of the SFR facility is planned. According to the modelling results, the extension will only yield small additional groundwater table drawdown and head changes in the bedrock. For the wetland objects, even a relatively small drawdown of the groundwater table may cause vegetation changes and ultimately overgrowth. The forests are not as sensitive to a drawdown of the groundwater table. According to the model calculations, the groundwater withdrawal from the repository yields a groundwater table drawdown that exceeds 0.1 m as an annual average for a normal year in one fifth the studied wetland objects and in half of the forest objects. The fraction of objects with a groundwater table drawdown is higher during a dry year and lower during a wet year. The surface-water depth in the studied wetland objects ranges from a few centimetres to half a metre. It is judged that a number of wetland objects may require water supply in order to maintain an undisturbed water level during groundwater withdrawal from the repository. According to the modelling results, the water-supply requirements are largest during spring and autumn. In one of the wetland objects, the water requirement is 3 L/s as an annual average for the type year 2006. Object-specific water balances and particle tracking calculations show that the inflow to the wetland objects mainly takes place through the Quaternary deposits. This is in accordance with the conceptual model, according to which there is a shallow groundwater flow system with many local recharge and discharge areas. The groundwater withdrawal from the repository implies that the water balance is changed for some of the studied wetland objects.

  5. Operation IVY, Pacific Proving Grounds, November 1952. Project 11.5. Radiobiological Studies at Eniwetok before and after Mike Shot

    Science.gov (United States)

    1953-06-01

    8 0.3 2 Urchin and 0 0.2 2 4 4 4 1 0.3 0.02 3 sand dollar Cucumber 0 0.02 0.1 2 0.08 0.08 0.3 1 0.6 0.5 Crustacean 0 0.04 0.03 0.5 0.08 2 0.6 1...is to locality. Compari- son with 1949 findings at Eniwetok shows mutual tendencies toward high activities in samples of hydroids, sponges...Terns are not scavengers and do not eat refuse. The food of the shore birds is composed mostly of insects and small crustaceans found on the beaches

  6. Retraction: Mohamaden W, Wang H, Guan H, Li J. Effect of potassium oxalate on liver function and kidney tissue of dogs (beagles. Arch biol sci. 2013;65(4:1363-70. DOI: 10.2298/ABS1304363M

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Effect of potassium oxalate on liver function and kidney tissue of dogs (beagles, published in the Archives of Biological Sciences in 2013, Vol. 65, Issue 4. The Editor-in-Chief has been informed that this paper is a duplicate of an earlier paper: Mohamaden W, Wang H, Guan H, Meng X, Li J. Effect of potassium oxalate injection on serum and kidney tissue of beagle dogs. Life Sci J. 2013;10(2:1537-42. This claim is correct and the results have already been presented in the article published earlier. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize for this error. Link to the retracted article 10.2298/ABS1304363M

  7. Feasibility of abdominoplasty with Cesarean section [Retraction

    Directory of Open Access Journals (Sweden)

    Thabet WN

    2013-01-01

    Full Text Available The Editor-in-Chief and Publisher of the International Journal of Women’s Health have been alerted by Dr Nadine Sherif, the corresponding author, to unacceptable levels of duplication with a previously published paper: Ali A, Essam A. Abdominoplasty Combined with Cesarean Delivery: Evaluation of the Practice. Aesthetic Plastic Surgery. 2011;35(1:80–86.It is worth noting that this paper was peer-reviewed by two peer-reviewers and the Editor-in-Chief of the International Journal of Women’s Health before publication. The paper concerned is: Thabet WN, Hossny AS, Sherif NA. Feasibility of abdominoplasty with Cesarean section. International Journal of Women’s Health. 2012;4:115–121.

  8. Article Withdrawal: "Perceptions of the use of complementary therapy and Siddha medicine among rural patients with HIV/AIDS: a case study from India" by Maria Costanza Torri.

    Science.gov (United States)

    2014-01-01

    The above article from the International Journal of Health Planning and Management, published online in Wiley Online Library on July 4th 2012, has been withdrawn by agreement between the author, the journal Editor-in-Chief and John Wiley & Sons Ltd. The withdrawal has been agreed owing to an error at the publishers and subsequent dual publication in the journal. The journal Editor-in-Chief and John Wiley & Sons Ltd. would like to emphasise that there is no suggestion of a breach of publication ethics by Dr Torri. REFERENCE Torri MC. 2012. Perceptions of the use of complementary therapy and Siddha medicine among rural patients with HIV/AIDS: a case study from India. Int J Health Plann Mgmt. doi: 10.1002/hpm.2242. Copyright © 2013 John Wiley & Sons, Ltd.

  9. A standard format for reporting atomic positions in measured or calculated surface structures: The CIF file

    Science.gov (United States)

    Marks, Laurence D.

    2010-06-01

    In his editorial in this issue, the editor-in-chief emphasizes the editorial policy that any paper which involves a crystallographic structure (whether experimentally measured or theoretically calculated) must also include a complete listing of all the atomic positions within the crystal structure, either as supporting information or directly within the paper itself. He also strongly recommends that the complete crystallographic data set be included as supporting information. At the request of the editor-in-chief, I outline here the reasons why this is scientifically desirable. Furthermore, I propose here that the Surface Science community adopt the same standard format for reporting these as is already widely used in bulk crystallography publications, namely the inclusion of a Crystallographic Information Format file (or CIF file) as supporting information. Finally, I describe the details of this specific file format, with illustrative examples.

  10. Writing scientific manuscripts: most common mistakes

    OpenAIRE

    Faber, Jorge

    2017-01-01

    ABSTRACT I have had the privilege of serving as editor-in-chief for 11 years of two scientific journals: The Dental Press Journal of Orthodontics and the Journal of the World Federation of Orthodontists. I had the opportunity to read and correct thousands of manuscripts. This experience was greatly enriching, because reading a text professionally completely differs from the perspective of readers in general. The routine practice of correcting manuscripts has made me realize that some errors r...

  11. RETRACTED: Facies analysis and depositional environments of the Oligocene–Miocene Asmari Formation, Zagros Basin, Iran

    OpenAIRE

    Sahraeyan, Mohammad; Bahrami, Mohammad; Arzaghi, Solmaz

    2014-01-01

    This article has been retracted: please see Elsevier Policy on Article Withdrawal (http://www.elsevier.com/locate/withdrawalpolicy). This article has been retracted at the request of the Editor-in-Chief. The article duplicates significant parts of three other articles without proper citations (Allahkarampour Dill, M., Seyrafian, A., Vaziri-Moghaddam, H., 2010. The Asmari Formation, north of the Gascharan (Dill anticline), southwest Iran: facies analysis, depositional environments and se...

  12. ETHICAL ASPECTS AND DILEMMAS OF PREPARING, WRITING AND PUBLISHING OF THE SCIENTIFIC PAPERS IN THE BIOMEDICAL JOURNALS

    OpenAIRE

    Masic, Izet

    2012-01-01

    Introduction: In this paper author discussed about preparing and submitting manuscripts - scientific, research, professional papers, reviews and case reports. Author described it from the Editor?s perspective, and specially talked about ethical aspects of authorship, conflict of interest, copyright, plagiarism and duplicate publication from the point of view of his experiences as Editor-in-Chief of several biomedical journals and Chief of Task Force of European Federation of Medical Informati...

  13. Preface

    OpenAIRE

    Editors

    2007-01-01

    We continue the Academia-Industry Symposium with this issue. Jerome P. Kassirer , Distinguished Professor at Tufts University School of Medicine, Editor-in-Chief Emeritus, New England Journal of Medicine, writes an editorial: 'Extent And Implications Of The Academia-Industry Connection' (p1-6). Joel Lexchin , Professor in the School of Health Policy and Management at York University, writes another editorial: 'Of Money And Trust In Biomedical Care' (p7-10).MSM Editors, Ajai R. Singh and Shaku...

  14. Wall Layers

    Science.gov (United States)

    1992-01-14

    Sydney, Australia. December 6, 1990. Lumley, J. L. A dynamical-systems-theory approach to the wall region. Environmental Engineering Laboratory, CSIRO...Nonlinear Science. Holmes, P. Editor in Chief, Nonlinear Scinece Today. Holmes, P. Reviewer for Physica D, J. Sound Vib., J. Phys., Q. Appl. Math, Phys...Spring, 1994; Organizing committee member. Holmes, P. Editorial Board Member: Archive for Rational Mechanics and Analysis; Journal of Nonlinear Scinece

  15. Molecules Best Paper Award 2012

    Directory of Open Access Journals (Sweden)

    Derek J. McPhee

    2012-02-01

    Full Text Available Molecules starts to institute the “Best Paper” award to recognize these outstanding papers in the area of natural products, medicinal chemistry and molecular diversity published in Molecules. We are pleased to announce the first “Molecules Best Paper Award” for 2012. Nominations were selected by the editor-in-chief and selected editorial board members from all the papers published in 2008. [...

  16. Molecules Best Paper Award 2013

    Directory of Open Access Journals (Sweden)

    Derek J. McPhee

    2013-02-01

    Full Text Available Molecules has started to institute a "Best Paper" award to recognize the most outstanding papers in the area of natural products, medicinal chemistry and molecular diversity published in Molecules. We are pleased to announce the second "Molecules Best Paper Award" for 2013. Candidates were chosen by the Editor-in-Chief and selected editorial board members from among all the papers published in 2009.

  17. Molecules Best Paper Award 2014

    Directory of Open Access Journals (Sweden)

    Derek J. McPhee

    2014-01-01

    Full Text Available Molecules instituted some years ago a “Best Paper” award to recognize the most outstanding papers in the area of natural products, medicinal chemistry and molecular diversity published each year in Molecules. We are pleased to announce the third “Molecules Best Paper Award” for 2014. The winners were chosen by the Editor-in-Chief and selected editorial board members from among all the papers published in 2010. Reviews and research papers were evaluated separately.

  18. Nigerian Journal of Orthopaedics and Trauma: Editorial Policies

    African Journals Online (AJOL)

    Editorial Team. Chairman Editorial Committee W. Yinusa Editor-in-Chief L.O.A. Thanni Founding Editor A.U. Ekere 2002 - 2005 Editors C. Nwadiaro S.O. Giwa C.E. Eze G.T. Adebule Assistant Editors M.O. Ogirima A.U. Katchy Editorial Advisers O.O. Onuba N.D. Ukaegbu J.T. da Rocha-Afodu ...

  19. The Mystery of Pacita Todtod: Filipino American Actress, Singer, Journalist, and Community Leader in the 1940s

    OpenAIRE

    Jamero, Melissa Jeanne

    2015-01-01

    Pacita Todtod (married name Bobadilla) was a Filipino American actress and singer, as well as community leader and editor-in-chief of the Philippines Mail, a Filipino American newspaper. Through Todtod’s performances and written works, we can observe the complex power dynamics of race and gender in the colonial context of American paternalism in the Philippines during World War II, and in the local politics of Filipino American migrant communities in Northern California. Todtod advocated for ...

  20. Retracted Article : Corruption And Economic Growth: A Survey Of ...

    African Journals Online (AJOL)

    This article was retracted by the journal Editor-in-Chief at the request of the authors (as of February 2013). http://dx.doi.org/10.4314/jorind.v6i1.42402 · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use ...

  1. WJG sets an example of internationalization for other Chinese academic journals.

    Science.gov (United States)

    Zu, Guang-An

    2010-06-14

    Supported by the "Special Fund for Key Academic Journals" of the National Natural Science Foundation of China, World Journal of Gastroenterology (WJG) has become a high-impact international clinical medical journal due to the great efforts of Professor Lian-Sheng Ma, Editor-in-Chief, and his team over several years. Now, WJG has successfully achieved a high degree of internationalization and sets a good example for other Chinese academic journals.

  2. I'm back

    Science.gov (United States)

    Bill Block

    2012-01-01

    As some of you might know, I am the new Editor-In-Chief for the Journal of Wildlife Management. Just to get acquainted, here are a few tidbits about me. I am the Program Manager for the Wildlife and Terrestrial Ecosystems Science Program with Rocky Mountain Research Station of the U.S. Forest Service. I consider myself a generalist having worked on reptiles, amphibians...

  3. Cricket’s Contribution to India’s National Solidification

    Science.gov (United States)

    2009-03-01

    entire writing process. Finally, to my editor-in-chief, best friend, Punjabi music dance partner, and loving wife Lisa, thank you for being my...of cricket’s solidification effects. The annual Ranji tournament served two key roles. First, it provided a yearly cricket ritual at the local... healing those wounds. It’s a lesson to politicians that Iraqis can be one. We are all supporting our team; none of us was saying this player is a

  4. Editorial: Latest methods and advances in biotechnology.

    Science.gov (United States)

    Lee, Sang Yup; Jungbauer, Alois

    2014-01-01

    The latest "Biotech Methods and Advances" special issue of Biotechnology Journal continues the BTJ tradition of featuring the latest breakthroughs in biotechnology. The special issue is edited by our Editors-in-Chief, Prof. Sang Yup Lee and Prof. Alois Jungbauer and covers a wide array of topics in biotechnology, including the perennial favorite workhorses of the biotech industry, Chinese hamster ovary (CHO) cell and Escherichia coli. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Historie a vývoj Playboy Enterprises, Inc.

    OpenAIRE

    Truhlářová, Linda

    2010-01-01

    Diploma thesis "The History and Development of Playboy Enterprises, Inc." deals with a rise of Playboy Enterprises, Inc. It considers creation of men's magazines since 19.century, creation of Playboy magazine and describes a personality of its editor-in-chief Hugh Hefner. Diploma thesis follows development of Playboy magazine every decade since 1950's and records every important dates and projects of publishing house. It deals also with another business of Playboy Enterprises, Inc., which con...

  6. Road Materials and Pavement Design, Volume 17(3)

    CSIR Research Space (South Africa)

    De Beer, Morris

    2016-03-01

    Full Text Available Andrew Charles COLLOP - De Montfort University, Leicester, UK William G. BUTTLAR - University of Missouri, Urbana-Champaign, USA Editor-in-Chief at Large Jorge B. Sousa - Consulpav, Oeiras, Portugal Associate Editors Morris de Beer - CSIR Built..., Stockholm, Sweden Mihai O. Marasteanu - University of Minnesota, Minneapolis, USA Manfred N. Partl - EMPA, Dübendorf, Switzerland Gabriele Tebaldi - University of Parma, Italy Michael P. Wistuba - Technische Universität Braunschweig, Germany ...

  7. Road Materials and Pavement Design volume 17(4).

    CSIR Research Space (South Africa)

    De Beer, Morris

    2016-03-01

    Full Text Available Andrew Charles COLLOP - De Montfort University, Leicester, UK William G. BUTTLAR - University of Missouri, Urbana-Champaign, USA Editor-in-Chief at Large Jorge B. Sousa - Consulpav, Oeiras, Portugal Associate Editors Morris de Beer - CSIR Built..., Stockholm, Sweden Mihai O. Marasteanu - University of Minnesota, Minneapolis, USA Manfred N. Partl - EMPA, Dübendorf, Switzerland Gabriele Tebaldi - University of Parma, Italy Michael P. Wistuba - Technische Universität Braunschweig, Germany ...

  8. Road Materials and Pavement Design volume 17(2)

    CSIR Research Space (South Africa)

    De Beer, Morris

    2016-03-01

    Full Text Available Andrew Charles COLLOP - De Montfort University, Leicester, UK William G. BUTTLAR - University of Missouri, Urbana-Champaign, USA Editor-in-Chief at Large Jorge B. Sousa - Consulpav, Oeiras, Portugal Associate Editors Morris de Beer - CSIR Built..., Stockholm, Sweden Mihai O. Marasteanu - University of Minnesota, Minneapolis, USA Manfred N. Partl - EMPA, Dübendorf, Switzerland Gabriele Tebaldi - University of Parma, Italy Michael P. Wistuba - Technische Universität Braunschweig, Germany ...

  9. Road Materials and Pavement Design Volume 17(1)

    CSIR Research Space (South Africa)

    De Beer, Morris

    2016-03-01

    Full Text Available Andrew Charles COLLOP - De Montfort University, Leicester, UK William G. BUTTLAR - University of Missouri, Urbana-Champaign, USA Editor-in-Chief at Large Jorge B. Sousa - Consulpav, Oeiras, Portugal Associate Editors Morris de Beer - CSIR Built..., Stockholm, Sweden Mihai O. Marasteanu - University of Minnesota, Minneapolis, USA Manfred N. Partl - EMPA, Dübendorf, Switzerland Gabriele Tebaldi - University of Parma, Italy Michael P. Wistuba - Technische Universität Braunschweig, Germany ...

  10. WITHDRAWN: MicroRNA-505 modulates cancer proliferation and migration in human non-small cell lung cancer through inverse regulation of FZD4.

    Science.gov (United States)

    Li, Hong; Yang, Tian; Ning, Qian; Shang, Dong; Yao, Yan; Sun, Zhongmin

    2017-03-31

    This article has been withdrawn at the request of the Editor-in-Chief. Following peer-review and acceptance of the above referenced paper for publication in Lung Cancer, the Editor-in-Chief was contacted by the Editor-in-Chief of the journal, Gene Therapy, with information that the manuscript had simultaneously been submitted to both Lung Cancer and Gene Therapy. A referee selected to review the manuscript for Gene Therapy was also contacted by the Editor-in-Chief of the journal, Respiratory Research, with a request to review the same manuscript for that journal. The three journals ascertained that the manuscript had been simultaneously submitted to all three journals. In addition, as part of their investigation of potential simultaneous submission, the Editors of Lung Cancer compared the manuscript submitted to Gene Therapy with that accepted for publication in Lung Cancer, and this has raised concerns related to the data presented in the paper. The paper accepted for publication in Lung Cancer examines A549 and H810 cells. The paper submitted to Gene Therapy examines A549 and H510A cells. However, the data presented in both papers, including the figures, are identical. The Editors of Lung Cancer have asked the authors for an explanation, but the corresponding author has not responded. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at https://www.elsevier.com/about/our-business/policies/article-withdrawal. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  11. An unusual case of spontaneous Mycobacterium chelonae corneal ulcer in a healthy middle-aged adult [Retraction

    Directory of Open Access Journals (Sweden)

    Bhandari V

    2017-07-01

    Full Text Available Bhandari V, Sriganesh R, Relekar K. An unusual case of spontanous Mycobacterium chelonae corneal ulcer in a healthy middle-aged adult. Int Med Case Rep J. 2016;9:121–124. The Editor-in-Chief and Publisher have retracted this paper because of duplicate publication in Case Reports in Ophthalmological Medicine on June 20, 2015. The retraction relates to this paper

  12. RETRACTED: A novel technique of multi-track percutaneous balloon mitral commissurotomy (PBMC

    Directory of Open Access Journals (Sweden)

    Sherif A. Sakr

    2012-07-01

    This paper has been retracted upon mutual agreement between the publisher and the Editor-in-Chief of EJCDT when it was discovered that this article had also been submitted and published in the International Heart Journal http://dx.doi.org/10.1536/ihj.54.196. The authors did not give clarification for the action, therefore the paper was retracted following international publishing practices.

  13. Retraction notice to “A novel technique of multi-track percutaneous balloon mitral commissurotomy (PBMC” [Egypt. J. Chest Dis. Tuberc. 61/3 (2013 223–228

    Directory of Open Access Journals (Sweden)

    Sherif A. Sakr

    2015-01-01

    This paper has been retracted upon mutual agreement between the publisher and the Editor-in-Chief of EJCDT when it was discovered that this article had also been submitted and published in the International Heart Journal http://dx.doi.org/10.1536/ihj.54.196. The authors did not give clarification for the action; therefore the paper was retracted following international publishing practices.

  14. Substance abuse and rehabilitation: responding to the global burden of diseases attributable to substance abuse

    OpenAIRE

    Li-Tzy Wu

    2010-01-01

    Li-Tzy Wu*Department of Psychiatry and Behavioral Sciences, Duke University School of Medicine, Duke University Medical Center, Durham, NC, USA *Li-Tzy Wu is the Editor-in-Chief of Substance Abuse and RehabilitationAbstract: Alcohol, tobacco, and illegal drug use are pervasive throughout the world. Substance use problems are among the major contributors to the global disease burden, which includes disability and mortality. The benefits of treatment far outweigh the economic costs. Despite the...

  15. Retracted

    Science.gov (United States)

    Zhu, Yongjian; Luan, Zhu; Yang, Qingguo; Li, Dashan; Lu, Wei; Liu, Liren

    2007-04-01

    This article has been retracted at the request of the Editor-in-Chief and Author. Please see Elsevier Policy on Article Withdrawal (http://www.elsevier.com/locate/withdrawalpolicy). Reason: A significant error in calculation was discovered after repeating the VC programming presented in the paperE In the previous programming, the authors neglected to include a term in the reliability function formula due to a spelling mistake, which will lead to a completely different result.

  16. Essay: reflections on Physical Review Letters.

    Science.gov (United States)

    Lazarus, David

    2008-08-01

    During my tenure as APS Editor-in-Chief Physical Review Letters changed from a journal whose authors were mostly from the U.S. to one whose authors were mostly from abroad. I encouraged authors to publicize their work even before their papers were accepted for publication. And I sought to raise the quality of the papers that were published even higher than before.

  17. Comments on the nonpharmaceutical interventions in New York City and Chicago during the 1918 flu pandemic

    Directory of Open Access Journals (Sweden)

    Barry John M

    2007-12-01

    Full Text Available Abstract This commentary was originally published in CIDRAP News and it is here reported almost verbatim to allow divulgation through open access. The Editorial summarizes John Barry's concerns about the value of accurate historical reporting and its implications in public policy determination. This short abstract was written by the Editor-in-Chief of the Journal of Translational Medicine to introduce the Editorial.

  18. Retracted: Post-stroke epilepsy in Polish paediatric patients.

    Science.gov (United States)

    Kopyta, Ilona; Sarecka-Hujar, Beata

    2015-08-01

    The above article, published online on 5 October 2013 in Wiley Online Library Early View (http://onlinelibrary.wiley.com/), has been retracted by agreement between the authors, the journal Editor in Chief, Dr Peter Baxter, and John Wiley & Sons Ltd. The retraction has been agreed due to several errors in the statistics. These errors make interpretation of the data difficult and the validity of the conclusions questionable. © 2013 Mac Keith Press.

  19. Defining and Measuring Chronic Conditions

    Centers for Disease Control (CDC) Podcasts

    2013-05-20

    This podcast is an interview with Dr. Anand Parekh, U.S. Department of Health and Human Services Deputy Assistant Secretary for Health, and Dr. Samuel Posner, Preventing Chronic Disease Editor in Chief, about the definition and burden of multiple chronic conditions in the United States.  Created: 5/20/2013 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/20/2013.

  20. International Journal of Environmental Research and Public Health Best Paper Award 2015

    OpenAIRE

    Tchounwou, Paul B.; Joyce Zhou

    2015-01-01

    International Journal of Environmental Research and Public Health started to institute an annual award in 2013 to recognize outstanding papers related to environmental health sciences and public health that meet the aims, scope and high standards of this journal. We are pleased to announce the third “International Journal of Environmental Research and Public Health Best Paper Awards” for 2015. Nominations were solicited from the Editor-in-Chief and Editorial Board members, with all papers pu...

  1. International Journal of Environmental Research and Public Health Best Paper Award 2014

    OpenAIRE

    Tchounwou, Paul B.; Joyce Zhou

    2014-01-01

    International Journal of Environmental Research and Public Health started to institute an annual award in 2013 to recognize outstanding papers related to environmental health sciences and public health that meet the aims, scope and high standards of this journal. We are pleased to announce the second “International Journal of Environmental Research and Public Health Best Paper Award” for 2014. Nominations were solicited from the Editor-in-Chief and Editorial Board members, with all papers pub...

  2. Lipodermatosclerosis.

    Science.gov (United States)

    Heymann, Warren R

    2009-06-01

    Based on the dialogue "Lipodermatosclerosis" between Jeffrey E. Petersen, MD, and Gary Brauner, MD. Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  3. Carcinoma of the tongue.

    Science.gov (United States)

    Heymann, Warren R

    2009-05-01

    Based on the dialogue "The tongue" between Janellen Smith, MD, and Gary Brauner, MD. Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  4. Head lice treatments: Searching for the path of least resistance.

    Science.gov (United States)

    Heymann, Warren R

    2009-08-01

    Based on the dialogue "Head lice" between Drs Kimberly D. Morel and Stephen Stone. Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided here as a special service to readers of the Journal of the American Academy of Dermatology.

  5. International Journal of Business, Economics and Management Works (ISSN: 2410-3500)

    OpenAIRE

    Dr. Sajjad Nazir

    2015-01-01

    Editor-In-Chief: Dr. Sajjad Nazir, Hohai University, Nanjing China, Assistant Professor, NFC Institute of Engineering & Fertilizer Research, Faisalabad, Pakistan, Email: , Mobile: +86-18502552540   ISSN: 2410-3500 (Online) Int.j.bus.econ.manag.works ZDB-Number: 28123256 OCLC-Number: 904187517 International journal of Business, Economics and Management works aims to give its contribution in state-of-the art research busines...

  6. Editorial

    Science.gov (United States)

    Dimitrijevic, M. S.; Popovic, L. C.

    The present issue of SERBIAN ASTRONOMICAL JOURNAL is the last one edited by the two of us. We resigned not because we were tired of our service to the astronomical community but due to the old tradition of the Belgrade Astronomical Observatory that its Director is automatically the Editor-in-Chief of its publications. We therefore gladly give the opportunity to the new Director, in charge since July 1st. 2002, to organize the publishing activity according to his conceptions. One of us (M.S.D.) was appointed Editor on January 1st. 1984 (from No. 135), becoming the Editor-in-Chief in 1987 (from No. 137). The other one (L.C.P.) is the Editor since 1994 (from No. 150). During this period the Bulletin de l'Observatoire Astronomique de Belgrade merged with the Publications of the Department of Astronomy, changing its name into Bulletin Astronomique de Belgrade from No. 145 in 1992, to finally become Serbian Astronomical Journal in 1998, from No. 157. Accordingly, of a "Bulletin" we made a "Journal". For example, in the period 1971-1984 (Nos. 125-134) in Bull. Obs. Astron. Belgrade, practically only the associates of the Belgade Observatory published their papers, save for a few individuals from the Belgrade University. We found within this period the name of one sole foreign astronomer - from the USSR - namely V. A. Fomin, among the authors. In the period 1985-2002 in the Serbian Astronomical Journal published their communications not only astronomers from Yugoslavia but also from Belgium, China, France, Italy, Moldova, Romania, Russia, Spain, Ukraine, USA. Our authors from outside of Yugoslavia are: J. P. Anosova C. Beuyninx Cristina Blaga Paul A. Blaga Veronique Bommier N. M. Bronnikov Alberto Celino Pierre Cugnon D. R. Davis Henry Debehogne Veronique Dehant P. Farinella Alex Gaina R. I. Gumerov R. S. Izmailov V. B. Kapkov F. F. Khalikhevich S. A. Kilioner Tatiana R. Kirian N. G. Litkevich Evencio G. Mediavilla O. Mihai Andrea Milani Vasile Mioc Jose A. Munoz Viktor V

  7. Lithuania’s Literary Periodicals: to Go Digital or Get Printed? (From the point of view of their antagonists

    Directory of Open Access Journals (Sweden)

    Asta Urbanaviciute

    2016-12-01

    Full Text Available The aim of this article is to analyse the possibilities (and intentions of Lithuania’s literary periodicals to start publishing them only in a digital version. An assumption is made that network society, affected by fast consumption trends, is more likely to choose digital magazines and newspapers, therefore literary publications are also challenged to reconsider their publishing strategies. There are several very important reasons (small circulation, possibility to survive only with the help of support funds are included why literary periodicals should think about the possibility to abandon traditional print editions, leaving only a digital version. The attitude of editors of literary publications to possible (or necessary typological changes could be summarized in a few sentences: the biggest problem – getting (not earning! more money. The rest is all right. In order to find out what editors of popular periodicals think about these issues the author of this paper interviewed three editors-in-chief. Why popular publications are marched with literary ones? Because they have to survive knowing that they will not get any financial support from anywhere. There was another reason for inquiring the editor-in-chief of delfi.lt, the biggest Lithuanian news portal, about this matter: delfi.lt would like to co-operate with literary publications. Opinion of the deputy editor-in-chief of internet daily bernardinai.lt which publishes many texts on literary subjects was also sought out. What is their opinion?

  8. Ten Years of Simulation in Healthcare: A Thematic Analysis of Editorials.

    Science.gov (United States)

    Nestel, Debra

    2017-10-01

    In this commentary, I review 38 articles published as editorials in Simulation in Healthcare from inception to April 2016. Of the 27 authors, there was a predominance of medical doctors (63%), male authors (67%), and work originating in the United States (86%). The founding Editor-in-Chief Dr David Gaba contributed to half of the editorials. Using inductive thematic analysis, the following five themes were identified: "embedding" simulation, simulation responding to clinical practice, educational considerations for simulation, research practices, and communicating leadership and scholarship about the community. After thematic analysis, the theoretical notion of communities of practice was used to make further meaning of the themes. This theorizing process reveals that editorial content aligns with the features of an evolving community of practice. The editorials seem to have responded to and shaped contemporary simulation practices. The editorial is a powerful forum in which to frame issues relevant to the healthcare simulation community. As the founding Editor-in-Chief, Gaba has made an extraordinary contribution to the Society for Simulation in Healthcare, in these editorials and the broader healthcare simulation community. Under the leadership of the Editor-in-Chief, Dr Mark Scerbo, I am confident that the editorial voice will continue in the true spirit of scholarship.

  9. Cardiology in the young : where we have been. Where we are. Where we are going.

    Science.gov (United States)

    Jacobs, Jeffrey P

    2014-12-01

    Cardiology in the Young is devoted to cardiovascular issues affecting the young, and older patients with congenital heart disease, or with other cardiac diseases acquired during childhood. The journal serves the interests of all professionals concerned with these topics. By design, the journal is international and multidisciplinary in its approach, and members of the editorial board take an active role in its mission, helping to make it an indispensable reference for paediatric and congenital cardiac care. All aspects of paediatric and congenital cardiac care are covered within the journal. The content includes original articles, brief reports, editorials, reviews, and papers devoted to continuing professional development. High-quality colour figures are published on a regular basis, and without charge to the authors. Regular supplements are published containing the abstracts of the annual meetings of the Association for European Paediatric and Congenital Cardiology, along with other occasional supplements. These supplements are supplied free to subscribers. The vision of Cardiology in the Young is to use print and electronic media to improve paediatric and congenital cardiac care. The mission of Cardiology in the Young is to be a premier global journal for paediatric and congenital cardiac care - an essential journal that spans the domains of patient care, research, education, and advocacy, and also spans geographical, temporal, and subspeciality boundaries. Cardiology in the Young was officially launched in December, 1990. The late Lucio Parenzan was Editor-in-Chief from 1990 through Volume 4, Number 1, January 1994. Professor Robert Anderson and Giancarlo Crupi then shared the Editor-in-Chief position until the end of 1995. Then, from 1995 through 2007, Professor Robert Anderson served as the sole Editor-in-Chief of Cardiology in the Young . Edward Baker, MD, FRCP, FRCPCH, served as Editor-in-Chief of Cardiology in the Young from 2007 to 2013. In January, 2014

  10. Society News: RAS Awards 2012; Prof. Andy Fabian; Prof. John C Brown; Prof. Andrew Fazakerley; Dr. Mike Irwin; Joss Bland-Hawthorn

    Science.gov (United States)

    2012-02-01

    Each year the RAS recognizes outstanding achievement in astronomy and geophysics by the award of medals and prizes. Candidates are nominated by Fellows and the awards made by a committee of Fellows, ensuring that these scientists have earned the respect and admiration of their peers in the research community.

  11. Waste assimilative capacity of coastal waters along Mumbai mega city, west coast of India using MIKE-21 and WASP simulation models.

    Digital Repository Service at National Institute of Oceanography (India)

    Renjith, V.; Vethamony, P.; Zainudin, Z.; VinodKumar, K.

    Coastal waters are the ultimate receivers of the organic waste materials generated by upstream cities and towns. This waste can cause dissolved oxygen depletion due to increased oxygen demand, affecting the natural ability of water bodies...

  12. Results from a full coupling of the HIRHAM regional climate model and the MIKE SHE hydrological model for a Danish catchment

    DEFF Research Database (Denmark)

    Larsen, Morten Andreas Dahl; Refsgaard, J.C.; Drews, Martin

    2014-01-01

    A major challenge in the emerging research field of coupling of existing regional climate models (RCMs) and hydrology/land-surface models is the computational interaction between the models. Here we present results from a full two-way coupling of the HIRHAM RCM over a 4000 km × 2800 km domain at 11...

  13. Running Head: Feasibility of Blood Management. Feasibility Study of a Blood Management Program in the Mike O’Callaghan Federal Hospital

    Science.gov (United States)

    2009-06-02

    beneficiaries (99th Medical Group, 2007). The MOFH averages as many as 2,000 outpatient visits a day and performs as many as 30 inpatient and...dental residents, general surgery residents, and certified registered nurse anesthetists. The MOFH initiated a Family Medicine Residency program in...the most experience in the field. A comprehensive program includes techniques to conserve and manage blood in the preoperative setting

  14. 78 FR 76814 - In the Matter of: Mohammed Soroush Mahalaty, a/k/a Mohammad Soroush,a/k/a Mike Soroush, 18...

    Science.gov (United States)

    2013-12-19

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE... was convicted of violating IEEPA by unlawfully, willfully, and knowingly exporting, selling, and..., or ordering, buying, receiving, using, selling, delivering, storing, disposing of, forwarding...

  15. Dust Destruction in the Supernova Remnant N49: Additional WiFeS Integral Field data AnalysisRachel Quigley, Rachael Huxford, Parviz Ghavamian, Mike Dopita

    Science.gov (United States)

    Quigley, Rachel; Ghavamian, Parviz

    2018-01-01

    Abstract:The supernova remnant N49, located in the Large Magellanic Cloud (LMC), is widely researched because of its relatively young age and its location near a dense, dusty molecular cloud in the interstellar medium (ISM). N49 has entered into its radiative phase more quickly than to be expected for the age of this remnant. As a consequence, N49 is showing signs that the diffuse hot interior is starting to cool and recombine. Using existing integral field spectra of SNR N49, different Fe emission lines and other spectral lines were extracted via python tools, following a similar approach to Dopita et al. (2016). At optical wavelengths, the dependence of [OIII]5007/4363 ratio on shock velocity is evident. This diagnostic is important because the [OIII]-emitting zone in low-velocity shocks of the cooling post-shock gas is hot. As the shock velocity increases, the temperature indicated by the [OIII] parameter falls. The dependence of Fe depletion lines on shock velocity is rather weak. Using [FeIII]:[OIII] diagnostic, the properties of dust destruction and production of dust in the SNR can be determined. Using this method, line ratios for other emission lines can be compared to the MAPPINGS predictions of Allen et al. (2008) to study the range of shock speeds present in the supernova remnant, where radiative shocks are driven into interstellar gas.

  16. Juhtimise juhiseid 11/9-järgsesse maailma : ettevaatusabinõud ja strateegia ebajärjekindluse ajastul / Ralph W Shrader, Mike McConnell

    Index Scriptorium Estoniae

    Shrader, Ralph W

    2002-01-01

    Ettevõtete juhtide kohustuste hulka kuulub turvalisuse tagamine ja riskide juhtimine. See hõlmab töötajate ohutuse tagamist, firma põhitegevuse ning süsteemide kaitset. Diagrammid. Lisa: Juhend sõjamängude mõistmiseks: vahend haavatuse/töökatkestuste hindamiseks

  17. EDITORIAL

    Directory of Open Access Journals (Sweden)

    2007-12-01

    Full Text Available This issue of the Journal of the Serbian Chemical Society was chosen by the members of the Presidency of the Society and of the Editorial Board from Serbia to mark the retirement of Dragutin M. Dražić as Editor-in-Chief of the Journal.Dragutin Dražić succeeded Slobodan V. Ribnikar, who was Editor-in-Chief for 10 years, among others in the 77-year old history of the Journal and who introduced many improvements in editing and editing policy, including editing in English since 1985.Dragutin Dražić was Editor-in Chief for more than 20 years. In addition to his immense impact as a scientist and university teacher to the field of Electrochemistry and Physical Chemistry and to the understanding of the importance of chemistry and of the natural science in general (see J. Serb. Chem Soc., 66 (2001 731, his great effort in the editing of the Journal resulted in its pivotal position in the world of scientific journals in Serbia. With no intention to repeat Dragutin Dražić’s great contribution to the development of contemporary chemical minds in the former Yugoslavia, and lately in Serbia (see J. Serb. Chem. Soc., 72 (2007 1, we simply say: THANK YOU! Saying this, we are aware that we express the gratitude of the chemistry community not only in Serbia, but also worldwide, where the name Dragutin Dražić is recognized.The papers in this issue were prepared by the authors from Serbia who aided Dragutin Dražić, JSCS Honorary Editor, in his editing efforts, by submitting theirs manuscripts, through sub-editing and revision of the submitted manuscripts, or some other way, to establish a journal with the reputation which Journal of the Serbian Chemical Society holds today on the international scene.

  18. The Application of Clinical Genetics

    Directory of Open Access Journals (Sweden)

    Maurer MH

    2012-02-01

    Full Text Available Martin H MaurerDepartment of Physiology and Pathophysiology, University of Heidelberg, Heidelberg, Germany; Mariaberg Hospital for Child and Adolescent Psychiatry, Gammertingen, GermanyIn 2012, The Application of Clinical Genetics enters its fifth year of publication. The journal has had a change of Editor-in-Chief: Dr David H Tegay stepped down and I was appointed to serve as the new Editor-in-Chief. As his successor, I thank Dr Tegay for his great work for the journal. I hope I can continue his successful editorial contributions. Moreover, I thank the many reviewers for their sustained support of the journal.The Application of Clinical Genetics is dedicated to open access publishing – as all Dove Press journals are. This means that authors will be charged for the publication process, but the acceptance of a manuscript is based solely on its scientific quality. This is what I will be responsible for as Editor-in-Chief. The team at Dove Press is a constant help with all administrative duties concerning peer reviewal, and I want to express my thanks for their prompt and reliable help. The field of clinical genetics is facing new challenges with the broad availability of large-scale screening methods for gene mutations, such as high-throughput sequencing and biochips. This means that ethical issues regarding the handling of genetic information must be addressed, both for the individual and for society.1–3 For example, sequencing of cell-free, fetal nucleic acids in the maternal blood to locate fetal aneuploidy, especially trisomy 21, may become broadly available soon, with even faster results than conventional methods such as amniocentesis.

  19. Retraction: Sleep Organisation in Depression and Schizophrenia: Index of Endogenous Periodicity of Sleep as a State Marker

    Directory of Open Access Journals (Sweden)

    Mirko Spiroski

    2014-06-01

    Full Text Available The article published by Ilankovic et al., 2013 [1] has been retracted by Editor-in-Chief because corresponding author published the similar paper in Psychiatria Danubina in 2014 [2]. An internal investigation has raised sufficient evidence of the originality in the first paper [1] and self plagiarism in the second paper [2]; as such, we retract this article from the literature on request by corresponding author and in accordance with guidelines and best editorial practices from the Committee on Publication Ethics. We apologize to our audience about this unfortunate situation.

  20. Writing scientific manuscripts: most common mistakes

    Directory of Open Access Journals (Sweden)

    Jorge Faber

    Full Text Available ABSTRACT I have had the privilege of serving as editor-in-chief for 11 years of two scientific journals: The Dental Press Journal of Orthodontics and the Journal of the World Federation of Orthodontists. I had the opportunity to read and correct thousands of manuscripts. This experience was greatly enriching, because reading a text professionally completely differs from the perspective of readers in general. The routine practice of correcting manuscripts has made me realize that some errors recur frequently. To help authors to improve their manuscripts before submission, these problems are discussed here in the order that they appear in conventional manuscript sections.

  1. Editorial Team, Volume: 1, Issue: 1, March 2016

    OpenAIRE

    Yılmaz, Recep

    2016-01-01

    Executive EditorMeliha Nurdan Taşkıran, Ondokuz Mayis University, Turkey Editor-in-ChiefRecep Yılmaz, Ondokuz Mayis University, Turkey Associate EditorsOnur Bekiroğlu, Ondokuz Mayis University, TurkeyÖmer Çakın, Ondokuz Mayis University, TurkeyÖzlem Akgüç Çetinkaya, Ondokuz Mayis University, TurkeyBeste Nigâr Erdem, Ondokuz Mayis University, TurkeyMevlüde Nur Erdem, Ondokuz Mayis University, TurkeySinan Kaya, Ondokuz Mayis University, TurkeyAhmet Oktan, Ondokuz Mayis University, Turkey Assist...

  2. Director of IMCS - National Prize Laureate of Moldova

    Directory of Open Access Journals (Sweden)

    Editorial board of the "Computer Science Journal of Moldova"

    2012-02-01

    Full Text Available Director of the Institute of Mathematics and Computer Science, Vice Editor-in-Chief of CSJM, and our colleague, D.Hab. Svetlana Cojocaru, in 2011 became the National Prize Laureate of Moldova. In accordance with Government decision, this distinction is given for ``outstanding achievements whose results have substantially enriched science, culture and art, had a considerable contribution to promoting a positive image of the country in the international arena, a significant impact on the development of socio-economic, scientific and technical progress, national and world culture.''

  3. Harnessing Green IT Principles and Practices

    CERN Document Server

    Murugesan, San

    2012-01-01

    “Ultimately, this is a remarkable book, a practical testimonial, and a comprehensive bibliography rolled into one. It is a single, bright sword cut across the various murky green IT topics. And if my mistakes and lessons learned through the green IT journey are any indication, this book will be used every day by folks interested in greening IT.”— Simon Y. Liu, Ph.D. & Ed.D., Editor-in-Chief, IT Professional Magazine, IEEE Computer Society, Director, U.S. National Agricultural Library This book presents a holistic perspective onGreen IT by discussing its vario

  4. Osterbrock Prize Lecture: The Coming to Be of the Biographical Encyclopedia of Astronomers

    Science.gov (United States)

    Hockey, Thomas A.

    2017-01-01

    The four-volume Biographical Encyclopedia of Astronomers (and cosmologists), second edition, is one of a kind: There is no discipline-specific counterpart in the physical or biological sciences. The BEA is the work of 430 authors, translators, and editors who produced biographies of approximately 1,800 persons, from the beginning of history to the beginning of the era of Big Science. How did this happen? The Editor-in-chief will give a “behind the pages” view of the construction of this first-look, first-reached-from-the-shelf reference work.

  5. Merger offers IS managers flexibility & less stressful integrating, downsizing, & outsourcing. Interview by Bill Childs.

    Science.gov (United States)

    Montgomery, R; Carpenter, S

    1994-02-01

    A merger between two multi-million dollar IS firms in July 1993 created a company with $315 million in sales and a sharp focus on healthcare. National Healthtech Corp., parent firm of MRI, brought the focus to the deal. And Dallas-based Affiliated Computer Services, a data services provider to financial, commercial and healthcare organizations, brought telecommunications and outsourcing expertise. Bill Childs, editor-in-chief, recently spoke with the two firms' principals--Richard A. Montgomery, CEO of National Healthtech Corp., and Steve Carpenter, senior VP of ACS and COO of NHC. Excerpts from their conversation follow.

  6. Molecules Best Paper Award 2015

    Directory of Open Access Journals (Sweden)

    Derek J. McPhee

    2015-01-01

    Full Text Available Molecules instituted some years ago a “Best Paper” award to recognize the most outstanding papers in the area of organic synthesis, natural products, medicinal chemistry and molecular diversity published each year in Molecules. We are pleased to announce the third “Molecules Best Paper Award” for 2015. The winners were chosen by the Editor-in-Chief and selected editorial board members from among all the papers published in 2011. Reviews and research papers were evaluated separately. We are pleased to announce that the following eight papers have won the Molecules Best Paper Award for 2015:[...

  7. Nursing in the Trump era.

    Science.gov (United States)

    Moore, Alison

    2017-01-11

    Do nurses in the US know what to expect from President Trump? The predominant mood at the moment is one of uncertainty, according to editor-in-chief of the American Journal of Nursing Shawn Kennedy. While presidential candidate Trump had a lot to say about health care, it is far from clear what President Trump will do. One reason for this is that he has been inconsistent in his views. He was pro-choice in 1999, for example, and antiabortion afterwards. Another reason is that the reality of politics may limit his power.

  8. Exercise — Exploring Mutuality and Discordance(s Between Sport and Public Health

    Directory of Open Access Journals (Sweden)

    Eling D. de Bruin

    2013-01-01

    Full Text Available Sports is a peer-reviewed scientific journal that revolves around the interdisciplinary area of exercise sciences applied in sport and public health. The intention of Sports is to link several scientific disciplines in an integrated fashion in order to address critical issues related to exercise science, sports and public health. As the first Editor-in-Chief of Sports, I would like to share a few comments about this interdisciplinary field of research by discussing the mutuality and discordances between exercise as it is applied in sports and public health.

  9. Surface enhanced raman spectroscopy analytical, biophysical and life science applications

    CERN Document Server

    Schlücker, Sebastian

    2013-01-01

    Covering everything from the basic theoretical and practical knowledge to new exciting developments in the field with a focus on analytical and life science applications, this monograph shows how to apply surface-enhanced Raman scattering (SERS) for solving real world problems. From the contents: * Theory and practice of SERS * Analytical applications * SERS combined with other analytical techniques * Biophysical applications * Life science applications including various microscopies Aimed at analytical, surface and medicinal chemists, spectroscopists, biophysicists and materials scientists. Includes a Foreword by the renowned Raman spectroscopist Professor Wolfgang Kiefer, the former Editor-in-Chief of the Journal of Raman Spectroscopy.

  10. Gas-charged sediments on the inner continental shelf off western India

    Digital Repository Service at National Institute of Oceanography (India)

    Karisiddaiah, S.M.; Veerayya, M.; Vora, K.H.; Wagle, B.G.

    in the improvement of the manuscript. We are extremely thankful to Professor D.A. McManus, Editor-in-Chief, for his valuable suggestions. References Bhattacharya, S.N., Chakraborti, S.K., Chandra, K., Gupta, M.C. and Mathur, M., 1974. Gaseous hydrocarbons... of Mexico. Geo- Mar. Lett., 10: 200-208. Carlson, P.R., Golan-Bac, M., Karl, H.A. and Kvenvolden, K.A., 1985. Seismic and geochemical evidence for shallow gas in sediments on Navarin continental margin, Bering Sea. Am. Assoc. Pet. Geol. Bull., 69: 422...

  11. Editorial

    DEFF Research Database (Denmark)

    Blaabjerg, Frede

    2008-01-01

    Two years have now passed since I took over from Prof. Dan van Wyk as Editor in Chief of IEEE Transactions on Power Electronics. In this period major changes have been implemented as modern journal publications are moving more to all digital publishing. When I took over we introduced Manuscript......, identify critical delays, track old information etc. Also the Editorial Office is now receiving the final paper all digital without ordinary mail submission which is really making life easier. We hope in the future to be able only to use Manuscript Central in the complete paper process flow....

  12. Road Materials and Pavement Design, 30 May 2017

    CSIR Research Space (South Africa)

    De Beer, Morris

    2017-01-01

    Full Text Available stream_source_info De Beer_18928_2017.pdf.txt stream_content_type text/plain stream_size 995 Content-Encoding UTF-8 stream_name De Beer_18928_2017.pdf.txt Content-Type text/plain; charset=UTF-8 Road Materials... and Pavement Design Vol. 18, Issue 1 2017 http://www.tandfonline.com/toc/trmp20/18/1?nav=tocList Editorial board EDITORS-IN-CHIEF Hervé Di Benedetto - University of Lyon / ENTPE, Vaulx-en-Velin, France Andrew Charles Collop - De Montfort University...

  13. International Journal of Environmental Research and Public Health Best Paper Award 2015

    Directory of Open Access Journals (Sweden)

    Paul B. Tchounwou

    2015-01-01

    Full Text Available International Journal of Environmental Research and Public Health started to institute an annual award in 2013 to recognize outstanding papers related to environmental health sciences and public health that meet the aims, scope and high standards of this journal. We are pleased to announce the third “International Journal of Environmental Research and Public Health Best Paper Awards” for 2015. Nominations were solicited from the Editor-in-Chief and Editorial Board members, with all papers published in 2011 eligible for consideration. The following nine papers were selected for recognition awards:[...

  14. Transparency and translation of science in a modern world

    DEFF Research Database (Denmark)

    Grandjean, Philippe; Ozonoff, David

    2013-01-01

    The co-Editors-in-Chief of Environmental Health respond to an unusual initiative taken by editors of 14 toxicology journals to influence pending decisions by the European Commission to establish a framework for regulating chemicals that pose a hazard to normal function of the endocrine system...... the safety of particular industrial products. The transparency provided by Environmental Health includes open access and open peer review, with reader access to reviews, including the identity of reviewers and their statements on possible conflicts of interest. However, the editors of the 14 toxicology...

  15. New Year, New Name and New Milestones Scope — Journal of Circulating Biomarkers

    Directory of Open Access Journals (Sweden)

    Shidong Jia

    2014-04-01

    Full Text Available This editorial article introduces a renaming of journal Exosomes and Microvesicles (EXMV to the Journal of Circulating Biomarkers with a new editorial scope, mission and our approach for the upcoming year in relation to engaging at the international level, the translational art of the study of exosomes and microvesicles, and the interface between exosomes and microvesicles, circulating tumor cells, cell-free circulating DNA and circulating protein markers in precision medicine and drug development. There is a slight change in the members of the Editors in Chief, Editorial Board and extending collaborations to international societies, such as the American Society for Exosomes and Microvesicles (ASEMV.

  16. Writing scientific manuscripts: most common mistakes.

    Science.gov (United States)

    Faber, Jorge

    2017-01-01

    I have had the privilege of serving as editor-in-chief for 11 years of two scientific journals: The Dental Press Journal of Orthodontics and the Journal of the World Federation of Orthodontists. I had the opportunity to read and correct thousands of manuscripts. This experience was greatly enriching, because reading a text professionally completely differs from the perspective of readers in general. The routine practice of correcting manuscripts has made me realize that some errors recur frequently. To help authors to improve their manuscripts before submission, these problems are discussed here in the order that they appear in conventional manuscript sections.

  17. International journal of molecular science best paper award 2013.

    Science.gov (United States)

    Han, Ophelia

    2013-02-22

    Since 2012, International Journal of Molecular Science has instituted an annual award to recognize outstanding papers in the area of chemistry, molecular physics and molecular biology that meet the aims, scope and high standards of this journal [1]. We are pleased to announce the second "International Journal of Molecular Science Best Paper Award" for 2013. Nominations were made by the Section Editor-in-Chiefs of International Journal of Molecular Science, with all papers published in 2009 eligible for consideration. The awards are issued for reviews and articles separately.

  18. RETRACTED: Geology and petrogenesis of Neoproterozoic migmatitic rock association, Hafafit Region, Eastern Desert, Egypt: Implications for syntectonic anatectic migmatites

    Science.gov (United States)

    El Bahariya, Gaafar

    2009-12-01

    This article has been retracted at the request of the Editor-in-Chief and Author. Please see Elsevier Policy on Article Withdrawal ( http://www.elsevier.com/locate/withdrawalpolicy). Reason: This article was essentially a duplication of a paper that had already appeared in Egypt. J. Geol., 52 (2008) 25-54. The author would like to apologize for a misunderstanding on his part that led him to believe that the publication of the paper in a local journal and Lithos, without prior agreement with both journals and clear notification, did not represent duplicate publication.

  19. Welcome to Metals––a New Open Access Journal for a Growing Scientific Community

    Directory of Open Access Journals (Sweden)

    Hugo F. López

    2011-02-01

    Full Text Available As I assume the role of Editor-in-Chief of this new journal, I look forward to serving in contributing to the advance of science and engineering in the field of metallic materials. This formidable task is made possible thanks to the excellent support of the Publisher and of the Editorial Staff of MDPI, as well as to a highly qualified Editorial Board. Hence, it is with pleasure that I accept this challenge, and I look forward to work with all of you in expanding the field of metals through journal contributions of current importance and of great interest to the scientific community. [...

  20. WITHDRAWN: Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy.

    Science.gov (United States)

    Zhang, Peiyong; Liu, Xiaochen; Huang, Guotao; Bai, Caiyan; Zhang, Zhenling; Li, Hongjun

    2017-12-09

    This article has been retracted at the request of the authors. The Editor in Chief has agreed to retract this article and the publisher supports the decision. The authors have indicated that their initial results were not reproducible when conducted by their colleagues. They indicated that the levels of autophagy were significantly different in the MI/R mice model in the respective results. The authors of this article would like to apologize to all affected parties. The full Elsevier Policy on Article Withdrawal can be found at https://www.elsevier.com/about/our-business/policies/article-withdrawal. Copyright © 2017.

  1. Retraction Note to: Potential Start Codon Targeted (SCoT) and Interretrotransposon Amplified Polymorphism (IRAP) Markers for Evaluation of Genetic Diversity and Conservation of Wild Pistacia Species Population.

    Science.gov (United States)

    Sorkheh, Karim; Amirbakhtiar, Nazanin; Ercisli, Sezai

    2017-11-10

    "This article has been retracted by the Publisher in agreement with the Editor-in-Chief, because it contains portions of writings on the same topic already published and without sufficient attribution to these earlier works being given. The principal authors of the paper acknowledged that text from background sources was mistakenly used in this article without proper reference to the original source. Upon investigation carried out according to the Committee on Publication Ethics guidelines, it has been found that the authors have duplicated or rephrased parts from other articles of which the main sources.

  2. Mirko Alilović: Herzegovina on Maps and Plans

    Directory of Open Access Journals (Sweden)

    Božo Skoko

    2015-06-01

    Full Text Available The monograph Herzegovina on Maps and Plans was published in Velika Gorica in 2015. It is a large format book (22 × 33 cm, hardcover, containing 268 pages and more than 130 illustrations, mostly maps. Its author is Mirko Alilović, graduate engineer of geodesy, the publisher is NI-AL d.o.o., co-publisher is Ljubuški municipality, editor in chief Prof. Dr. Božo Skoko, reviewer and proof-reader Prof. Dr. Miljenko Lapaine. The book's ISBN is 978-953-58473-0-4 and it is written in Croatian.

  3. The complete guide to high-end audio

    CERN Document Server

    Harley, Robert

    2015-01-01

    An updated edition of what many consider the "bible of high-end audio"   In this newly revised and updated fifth edition, Robert Harley, editor in chief of the Absolute Sound magazine, tells you everything you need to know about buying and enjoying high-quality hi-fi. With this book, discover how to get the best sound for your money, how to identify the weak links in your system and upgrade where it will do the most good, how to set up and tweak your system for maximum performance, and how to become a more perceptive and appreciative listener. Just a few of the secrets you will learn cover hi

  4. Recensão crítica: Personal development 10-10-10 : a life-transforming idea

    OpenAIRE

    Sousa, Ivo Dias de

    2014-01-01

    Recensão crítica à obra de Suzi Welch, "10-10-10: A Life-Transforming Idea” “10-10-10: A Life-Transforming Idea” is a short book by Suzi Welch that describes a simple and highly effective notion. The book gives us strategies to make decisions quickly and well in all areas of our life like work, business decisions, parenting, love and friendship. It´s author, Suzy Welch was an editor-in-chief of the Harvard Business Review. Besides being an author, she is also a television commentator, ...

  5. Looking Forward (Editorial)

    OpenAIRE

    Denise Koufogiannakis

    2009-01-01

    This issue marks the start of EBLIP’s fourthyear of publication. I am excited to begin my new role as Editor-in-Chief at a time when the journal is functioning well and the Editorial Team has a sufficient amount of experience to confidently manage the publishing process, but is young enough to be open to new ideas and make changes without too much angst. Mostly, I hope that the journal can quickly respond to the needs of our readers, authors, and everyone who works to make the journal a succe...

  6. Essay: Samuel Abraham Goudsmit (1902 1978)

    Science.gov (United States)

    Bederson, Benjamin

    2008-07-01

    When Sam Goudsmit was 23, he and George Uhlenbeck hypothesized that the electron had spin. Sam was a well-known atomic physicist working at the University of Michigan when World War II began. During the war he first worked on radar at the MIT Radiation Lab, and then in the waning days of the war in Europe he led a mission to determine how far the Nazis had gotten in developing an atomic bomb. After chairing the Physics Department at Brookhaven, in 1950 APS named Goudsmit Managing Editor of Physical Review and Reviews of Modern Physics; in 1966 he was named Editor-in-Chief. He founded Physical Review Letters in 1958.

  7. Army Communicator. Voice of the Signal Regiment. Volume 33, Number 2, Spring 2008

    Science.gov (United States)

    2008-01-01

    www.amazon.com/gp/richpub/ syltguides/fullview/6PMKABCX1QEX/ If you don’t think you have the time for profes- sional reading, then you don’t. As George Orwell ...Editor-in-Chief/Graphic Designer Janet A. McElmurray EDITORIAL STAFF 0805802 By Order of the Secretary of the Army: GEORGE W. CASEY JR. General, United...differences as the deadly rift between Sunni and Shia Muslim factions raged out of control. In response, President George W. Bush and his military advisors

  8. A Bibliography of the Personal Software Process (PSP) and the Team Software Process (TSP)

    Science.gov (United States)

    2009-10-01

    IEEE Computer Society Press, 1996. http://www.computer.org/portal/web/csdl/doi/10.1109/CSEE.1996.491362 El Emam, K.; Shostak, B .; & Madhavji, N... Marciniak Editor-in-Chief, New York, NY: John Wiley & Sons, 1994, 851-860. Humphrey, Watts S. ―Reflections on a Software Life,‖ In the Beginning...Adoption with PSP/TSP— TCAIM.‖ Proceedings of the TSP Symposium (September 2008). http://www.sei.cmu.edu/tspsymposium/ Nichols, B . & Willett, Alan

  9. Retraction: 'Dose-dependent dual effect of HTLV-1 tax oncoprotein on p53-dependent nucleotide excision repair in human T-cells' by Yana Schavinsky-Khrapunsky, Esther Priel and Mordechai Aboud.

    Science.gov (United States)

    2017-06-15

    The above article, published online on 4 October 2007 in Wiley Online Library (wileyonlinelibrary.com), and in Volume 122, pp. 305-316, has been retracted by agreement between the journal Editor in Chief, Professor Peter Lichter, and John Wiley & Sons Ltd. The retraction has been agreed as the bands in Figs 1, 2, 5 and 6 appear to have been manipulated. Schavinsky-Khrapunsky, Y., Priel, E. and Aboud, M. (2008), Dose-dependent dual effect of HTLV-1 tax oncoprotein on p53-dependent nucleotide excision repair in human T-cells. Int. J. Cancer, 122: 305-316. doi:10.1002/ijc.23091. © 2017 UICC.

  10. Retracted: Effects of dietary supplementation with a probiotic (Enterococcus faecium DSM 7134) on growth performance, nutrient digestibility, and gut health status in weaning pigs.

    Science.gov (United States)

    Lan, R X; Kim, I H

    2017-04-12

    The above article from the Journal of the Science of Food and Agriculture, published online on 12 April 2017 in Wiley Online Library (http://wileyonlinelibrary.com) has been withdrawn by agreement betweeen the authors, the Journal Editors-in-Chief Mark Shepherd and Ardrew Waterhouse and John Wiley & Sons Ltd., on behalf of the Society of Chemical Industry. The withdrawal has been agreed due the incorrect identification of the strain used in the article, which is Enterococcus faecium SLB 120 and not Enterococcus faecicum DSM 7134 as previously stated. This article is protected by copyright. All rights reserved.

  11. Retraction: Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation. J. Diao, Y. D. Ma, and M. S. Hasson.

    Science.gov (United States)

    2012-06-01

    The following article from Proteins: Structure, Function, and Bioinformatics, "Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation," by Jiasheng Diao, Yunglin D. Ma, and Miriam S. Hasson, published online on 21 October 2010 in Wiley Online Library (onlinelibrary.wiley.com), has been retracted by agreement between the journal Editor in Chief, Bertrand Garcia-Moreno, and Wiley Periodicals. The retraction has been agreed because it was established by internal investigation performed by Purdue University that the authors of this article are not the owners of the data and have no right to publication. Copyright © 2009 Wiley-Liss, Inc.

  12. Retraction statement: Advances in the physiological and pathological implications of cholesterol.

    Science.gov (United States)

    2015-08-01

    The above article, published online on 28 February 2013 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, William Foster, and John Wiley and Sons Ltd. The retraction has been agreed due to the publication of a similar paper by the same authors (with the exclusion of P Mardones) in Frontiers in Bioscience in January 2014. The authors believed that they had taken the necessary steps to withdraw their paper from Frontiers in Bioscience before they submitted to Biological Reviews in June 2012. © 2015 Cambridge Philosophical Society.

  13. Loss of Dcc in the spinal cord is sufficient to cause a deficit in lateralized motor control and the switch to a hopping gait.

    Science.gov (United States)

    Peng, Jimmy; Ferent, Julien; Li, Qingyu; Liu, Mingwei; da Silva, Ronan Vinicius; Zeilhofer, Hanns Ulrich; Kania, Artur; Zhang, Ying; Charron, Frédéric

    2017-07-10

    Editorial Notice: Jimmy Peng, Julien Ferent, Qingyu Li, Mingwei Liu, Ronan Vinicius da Silva, Hanns Ulrich Zeilhofer, Artur Kania, Ying Zhang and Frederic Charron. Accepted manuscript online: 10 JUL 2017 | DOI: 10.1002/dvdy.24549. The above article, published as an Accepted Article online on July 10, 2017, in Wiley Online Library (wileyonlinelibrary.com), has been temporarily withdrawn by agreement between the authors, the journal Editor in Chief, Parker B. Antin, and Wiley Periodicals, Inc. The temporary withdrawal has been agreed due to a delay in publication of an article which is referenced in the above manuscript. This article is protected by copyright. All rights reserved. © 2017 Wiley Periodicals, Inc.

  14. Retraction statement: Manuka honey vs. hydrogel - a prospective, open label, multicentre, randomised controlled trial to compare desloughing efficacy and healing outcomes in venous ulcers.

    Science.gov (United States)

    2015-09-01

    The following article from Journal of Clinical Nursing, 'Manuka honey vs. hydrogel - a prospective, open label, multicentre, randomised controlled trial to compare desloughing efficacy and healing outcomes in venous ulcers' by Georgina Gethin and Seamus Cowman published online on 25 August 2008 in Wiley Online Library (wileyonlinelibrary.com) and in Volume 18, pp. 466-474, has been retracted by agreement between the journal Editor-in-Chief, the authors and John Wiley & Sons, Ltd. The retraction has been agreed due to errors in the data analysis which affect the article's findings. © 2014 John Wiley & Sons Ltd.

  15. Retracted: Bacteria diversity overview and endoglucanase assessment from Himalayan Tapovan geothermal spring.

    Science.gov (United States)

    Sahoo, Jitendra Kumar; Navani, Naveen Kumar; Pathania, Ranjana

    2015-08-25

    The above article from the Journal of Basic Microbiology, published online on 25 August 2015 in Wiley Online Library as Early View (http://onlinelibrary.wiley.com/doi/10.1002/jobm.201500135/pdf), has been retracted by agreement between Naveen Kumar Navani and Ranjana Pathania, the Editor-in-Chief and Wiley-VCH GmbH & Co. KGaA. The retraction has been agreed because the article has been submitted and approved for publication by Jitendra Kumar Sahoo without consent in any form by the named co-authors Naveen Kumar Navani and Ranjana Pathania. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Retraction: Genistein protects genioglossus myocyte against hypoxia-induced injury through PI3K-Akt and ERK MAPK pathways.

    Science.gov (United States)

    2012-05-01

    RETRACTION: The following article from Journal of Cellular Biochemistry, Genistein protects genioglossus myocyte against hypoxia-induced injury through PI3K-Akt and ERK MAPK pathways by Wanghui Ding and Yuehua Liu, posted online on May 19, 2011 in Wiley Online Library (onlinelibrary.wiley.com), has been retracted by agreement between the authors, the journal Editor in Chief, Dr. Gary S. Stein and Wiley-Liss, Inc. The retraction has been made as authorization to publish was not granted by one of the funding bodies. Copyright © 2012 Wiley Periodicals, Inc.

  17. In Memoriam: Joshua Lederberg

    Centers for Disease Control (CDC) Podcasts

    2008-05-29

    In this podcast, Dr. Peter Drotman, Editor-In-Chief of the Emerging Infectious Disease journal speaks with Dr. Jim Hughes, about an article in the June 2008 issue of Emerging Infectious Diseases. They discuss Dr. Joshua Lederberg, globally recognized scientist, educator, national and Presidential scientific advisor, and Nobel Laureate who recently died at the age of 82. Dr Lederberg's early work in bacterial genetics virtually established the discipline of molecular biology, earning him a Nobel Prize in Physiology or Medicine in 1958 when he was only 33 years old.  Created: 5/29/2008 by Emerging Infectious Diseases.   Date Released: 5/29/2008.

  18. JCB content automatically deposited in PubMed Central (PMC)

    Science.gov (United States)

    Hill, Emma

    2007-01-01

    The Journal of Cell Biology has helped define the field of cell biology. Since its establishment in 1955 by some of the founders of the discipline, the journal has attracted exciting, high quality science from leaders in the field. This is thanks in large part to a committed and active Editorial Board, selected as some of the most respected and thoughtful cell biologists throughout the world. It was therefore an honor, four months ago, to take the position of Executive Editor and work alongside current Editor-in-Chief Ira Mellman.

  19. En el aire, una novela de “Fabián Vidal”

    OpenAIRE

    González García, Juana María

    2007-01-01

    In the begining of XX Century, Spanish reading situation will change because of the appearance of brief literature collections. Those were coverted into a very profitable product. Enrique Fajardo, more known as “Fabián Vidal”, was a journalist and writer born in Granada in 1883 and dead exiled in Mexico in 1948 approximately. Editor in chief in La Correspondencia de España and director of La Voz, his work doesn’t limit to periodistic activity, but he developed literature creation. This is the...

  20. Retraction: Radenović L, Selaković V. Kainate-induced oxidative stress and neurotoxicity in the rat brain, Arch Biol Sci, 2005, 57(4:259-266, DOI: 10.2298/ABS0504259R

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Kainate-induced oxidative stress and neurotoxicity in the rat brain, published in the Archives of Biological Sciences in 2005, Vol. 57, Issue 4. The Editor-in-Chief has been informed that this paper plagiarizes an earlier paper: Radenović L, Jovanović M, Vasiljević I, Selaković V. Superoxide production and the activity of MnSOD in rat brain after intrahippocampal kainate-induced seizure. Neurosci Res Comm, 2004, 34(2:92-103. This claim is correct and almost the entire paper is a verbatim copy of the earlier one. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize to the readers of the journal that it took so many years to notice this error and to retract the paper. We request readers of the journal to directly get in touch with the editorial office and the editors of the journal for similar cases in the future, so that they can be handled promptly. Link to the retracted article 10.2298/ABS0504259R

  1. Psychoanalytic lexicography: notes from two "harmless drudges".

    Science.gov (United States)

    Samberg, Eslee; Auchincloss, Elizabeth L

    2010-12-01

    The co-Editors in Chief of the American Psychoanalytic Association's new edition of Psychoanalytic Terms and Concepts (previously edited by Moore and Fine and last revised in 1990) recount their lexicographical adventures. Editing a dictionary at the turn of the twenty-first century is a daunting, some might say foolhardy, undertaking. The most obvious challenge faced by the editors was the growing pluralism within psychoanalysis. However, a more fundamental challenge was that the object of psychoanalytic study, the mind and its processes, can be known only by putting words to our observations, inferences, and interpretations. Psychoanalytic thinkers, starting with Freud, have wrestled with this challenge in ways that define the history of psychoanalysis itself. Long gone are the days when Freud could commend the "correctness" of Sterba's lexicographical efforts. Today postmodern critics, at the opposite extreme, argue that terms and concepts are best understood as "verbal gestures" in the "language-game" of psychoanalysis. Some go so far as to assert that dictionary-writing is obsolete. The co-Editors in Chief of Psychoanalytic Terms and Concepts have not succumbed to such nihilistic views, but have instead struggled to establish a reasonable stance within contemporary debates over the nature of psychoanalytic language.

  2. History of science content analysis of Chinese science textbooks from the perspective of acculturation

    Science.gov (United States)

    Ma, Yongjun; Wan, Yanlan

    2017-08-01

    Based on previous international studies, a content analysis scheme has been designed and used from the perspective of culture to study the history of science (HOS) in science textbooks. Nineteen sets of Chinese science textbooks have been analyzed. It has been found that there are noticeable changes in the quantity, content, layout, presentation, and writing intention of the HOS sections in textbooks from different time periods. What's more, the textbooks aim at presenting the scientific culture and aim to help students understand it better. However, the cultural associations of the HOS in textbooks is insufficient and significant differences exist among textbooks of different subjects. In order to explore the reasons why the presentation of HOS in various subjects is different, we made a specific comparison of curriculum standards of two subjects with great differences and interviewed the editors-in-chief of two textbooks. Results show that one of the most important reasons for the different writings of the HOS in textbooks is that different subject curriculum standards attach greater importance to the HOS. In addition, the attention to the HOS by editors-in-chief, the tradition of studying the HOS within the history of the discipline, and the reference textbooks in compiling textbooks are all important influence factors. Some suggestions for future textbooks compilation are given at the end.

  3. Publisher's Announcement

    Science.gov (United States)

    Scriven, Neil

    2003-12-01

    We are delighted to announce that the new Editor-in-Chief of Journal of Physics A: Mathematical and General for 2004 will be Professor Carl M Bender of Washington University, St. Louis. Carl will, with the help of his world class editorial board, maintain standards of scientific rigour whilst ensuring that research published is of the highest importance. Carl attained his first degree in physics at Cornell University before studying for his PhD at Harvard. He later worked at The Institute for Advanced Study in Princeton and at MIT before assuming his current position at Washington University, St Louis. He has been a visiting professor at Technion, Haifa, and Imperial College, London and a scientific consultant for Los Alamos National Laboratory. His main expertise is in using classical applied mathematics to solve a broad range of problems in high-energy theoretical physics and mathematical physics. Since the publication of his book Advanced Mathematical Methods for Scientists and Engineers, written with Steven Orszag, he has been regarded as an expert on the subject of asymptotic analysis and perturbative methods. `Carl publishes his own internationally-important research in the journal and has been an invaluable, energetic member of the Editorial Board for some time' said Professor Ed Corrigan, Carl's predecessor as Editor, `he will be an excellent Editor-in-Chief'. Our grateful thanks and best wishes go to Professor Corrigan who has done a magnificent job for the journal during his five-year tenure.

  4. Retraction: Hazani A, Ibrahim M, Shehata A, El-Gaaly G, Daoud M, Fouad D, Rizwana H, Moubayed N. Ecotoxicity of Ag-nanoparticles on two microalgae, Chlorella vulgaris and Dunaliella tertiolecta. Arch Biol Sci. 2013;65(4:1447-1457. DOI: 10.2298/ABS1304447H

    Directory of Open Access Journals (Sweden)

    Editorial

    2016-01-01

    Full Text Available This is a notice of retraction of the article: Ecotoxicity of Ag-nanoparticles on two microalgae, Chlorella vulgaris and Dunaliella tertiolecta, published in the Archives of Biological Sciences in 2013, Vol. 65, Issue 4. The Editor-in-Chief has been informed that this paper is a duplicate of an earlier paper: Hazani A, Ibrahim M, Arif I, Shehata A, EL-Gaaly G, Daoud M, Fouad D, Rizwana H, Moubayed N. Ecotoxicity of Ag-Nanoparticles to Microalgae. J Pure Appl Microbiol. 2013;7(Spl. Ed.: 233-241. This claim is correct and the entire paper is a verbatim copy of the earlier one. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize to the readers of the journal that it took so many years to notice this error and to retract the paper. We request readers of the journal to directly get in touch with the editorial office and the editors of the journal for similar cases in the future, so that they can be handled promptly. Link to the retracted article 10.2298/ABS1304447H

  5. Sexual behaviors among men who have sex with men: a quantitative cross sectional study in Kathmandu Valley, Nepal [Expression of concern

    Directory of Open Access Journals (Sweden)

    Mishra SR

    2013-07-01

    Full Text Available Mishra SR, Khanal V. HIV/AIDS – Research and Palliative Care. 2013:5 81–88.Following the publication of this article, the Editor-in-Chief and Publisher were alerted to concerns over terminology used, errors in the reference list, and unacceptable levels of similar text with a previously published paper: Deuba K, et al. Risk of HIV infection among men having sex with men in Kathmandu Valley, Nepal. Asia-Pacific Journal of Public Health. DOI: http://dx.doi.org/10.1177/1010539512441491.The authors were contacted in relation to these concerns and provided timely, adequate answers to all issues raised. The authors admit and apologize for two major mistakes: the missing reference of Deuba et al; and the errors in the reference list. All other concerns were adequately answered.In light of these, the Editor-in-Chief and Publisher are issuing this Expression of Concern to make readers aware of these points.Read the original article

  6. Retraction

    Directory of Open Access Journals (Sweden)

    Singhai R

    2012-03-01

    Full Text Available The Editor-in-Chief and Publisher of Breast Cancer: Targets and Therapy have been alerted to unacceptable levels of duplication with previously published papers. All four papers were submitted by Dr Rajeev Singhai.It is worth noting that all papers were peer-reviewed by a minimum of two peer-reviewers and the Editor-in-Chief of Breast Cancer: Targets and Therapy before publication. The papers concerned are:Patil VW, Tayade MB, Pingale SA, et al. The p53 breast cancer tissue biomarker in Indian women. Breast Cancer: Targets and Therapy. 2011;3:71–78.Singhai R, Patil AV, Patil VW. Cancer biomarker HER-2/neu in breast cancer in Indian women. Breast Cancer: Targets and Therapy. 2011;3:21–26.Patil AV, Bhamre RS, Singhai R, Tayade MB, Patil VW. Estrogen receptor (ER and progesterone receptor (PgR in breast cancer of Indian women. Breast Cancer: Targets and Therapy. 2011;3:27–33.Patil VW, Singhai R, Patil AV, Gurav PD. Triple-negative (ER, PgR, HER-2/neu breast cancer in Indian women. Breast Cancer: Targets and Therapy. 2011;3:9–19.

  7. Retraction: Radenović L, Selaković V. Mitochondrial superoxide production and MnSOD activity following exposure to an agonist and antagonists of ionotropic receptors in rat brain, Arch Biol Sci. 2005; 57(1:1-10, DOI:10.2298/ABS0501001R

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Mitochondrial superoxide production and MnSOD activity following exposure to an agonist and antagonists of ionotropic glutamate receptors in rat brain, published in the Archives of Biological Sciences in 2005, Vol. 57, Issue 1. The Editor-in-Chief has been informed that this paper plagiarizes an earlier paper: Radenović L, Selaković V, Kartelija G, Todorović N, Nedeljković M. Differential effects of NMDA and AMPA/kainate receptor antagonists on superoxide production and MnSOD activity in rat brain following intrahippocampal injection. Brain Res Bull, 2004, 64(1:85-93. This claim is correct and almost the entire paper is a verbatim copy of the earlier one. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize to the readers of the journal that it took so many years to notice this error and to retract the paper. We request readers of the journal to directly get in touch with the editorial office and the editors of the journal for similar cases in the future, so that they can be handled promptly. Link to the retracted article 10.2298/ABS0501001R

  8. Retraction: Radenović L, Selaković V, Janać B, Todorović D. Effect of glutamate antagonists effect on nitric oxide production in rat brain following intrahippocampal injection, Arch Biol Sci. 2007;59(1:29-36, DOI: 10.2298/ABS0701029R

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Effect of glutamate antagonists effect on nitric oxide production in rat brain following intrahippocampal injection, published in the Archives of Biological Sciences in 2007, Vol. 59, Issue 1. The Editor-in-Chief has been informed that this paper plagiarizes an earlier paper: Radenovic L, Selakovic V. Differential effects of NMDA and AMPA/kainate receptor antagonists on nitric oxide production in rat brain following intrahippocampal injection. Brain Res Bull. 2005;67(1-2:133-41. The results presented in the article that is being retracted overlap with the results presented in the original article without appropriate justification, permission or crossreferencing. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize to the readers of the journal that it took so many years to notice this error and to retract the paper. We request readers of the journal to directly get in touch with the editorial office and the editors of the journal for similar cases in the future, so that they can be handled promptly. Link to the retracted article 10.2298/ABS0701029R

  9. Retraction: Popović T, Balaž J, Stanković S.: A method for the rapid detection and identification of halo blight pathogen on common bean. Arch biol sci. 2014; 66(4:1393-1400. DOI: 10.2298/ABS1404393P

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: A method for the rapid detection and identification of halo blight pathogen on common bean, published in the Archives of Biological Sciences in 2014, Vol. 66, Issue 4. The Editor-in-Chief has been informed that the results presented in Fig 1. in this article have already been presented in Fig 3. in the article: Balaž J, Popović T, Vasić M, Nikolić Z. Elaboration of methods for detection of Pseudomonas savastanoi pv. phaseolicola on bean seeds. Pesticidi i fitomedicina. 2008; 23(2:81-8. DOI: 10.2298/PIF0802081B; and the results presented in Fig 2. have already been presented in Fig 4. in the article: Popović T, Milovanović P, Aleksić G, Gavrilović V, Starović M, Vasić M, Balaž J. Application of semi-selective mediums in routine diagnostic testing of Pseudomonas savastanoi pv. phaseolicola on common bean seeds. Sci Agric. 2012;69(4:265-70. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. Link to the retracted article 10.2298/ABS1404393P

  10. Disaster Health Management: A Primer for Students and Practitioners Fitzgerald Gerry Tarrant Mike Aitken Peter et al Disaster Health Management: A Primer for Students and Practitioners 352pp £39.99 Routledge 9781138911185 1138911186 [Formula: see text].

    Science.gov (United States)

    2017-02-10

    This comprehensive textbook addresses the history of disaster management, terminology, concepts, principles and trends. While the book refers mainly to Australian policies and guidelines, international examples are offered too.

  11. PUBLISHER'S ANNOUNCEMENT: Editorial developments

    Science.gov (United States)

    2009-01-01

    We are delighted to announce that from January 2009, Professor Murray T Batchelor of the Australian National University, Canberra will be the new Editor-in-Chief of Journal of Physics A: Mathematical and Theoretical. Murray Batchelor has been Editor of the Mathematical Physics section of the journal since 2007. Prior to this, he served as a Board Member and an Advisory Panel member for the journal. His primary area of research is the statistical mechanics of exactly solved models. He holds a joint appointment in mathematics and physics and has held visiting positions at the Universities of Leiden, Amsterdam, Oxford and Tokyo. We very much look forward to working with Murray to continue to improve the journal's quality and interest to the readership. We would like to thank our outgoing Editor-in-Chief, Professor Carl M Bender. Carl has done a magnificent job as Editor-in-Chief and has worked tirelessly to improve the journal over the last five years. Carl has been instrumental in designing and implementing strategies that have enhanced the quality of papers published and service provided by Journal of Physics A: Mathematical and Theoretical. Notably, under his tenure, we have introduced the Fast Track Communications (FTC) section to the journal. This section provides a venue for outstanding short papers that report new and timely developments in mathematical and theoretical physics and offers accelerated publication and high visibility for our authors. During the last five years, we have raised the quality threshold for acceptance in the journal and now reject over 60% of submissions. As a result, papers published in Journal of Physics A: Mathematical and Theoretical are amongst the best in the field. We have also maintained and improved on our excellent receipt-to-first-decision times, which now average less than 50 days for papers. We have recently announced another innovation; the Journal of Physics A Best Paper Prize. These prizes will honour excellent papers

  12. Editorial

    Directory of Open Access Journals (Sweden)

    B. Rossaro

    2015-08-01

    Full Text Available The Journal of Entomological and Acarological Research (JEAR, formerly the Bollettino di Zoologia Agraria e di Bachicoltura of the Institute of Entomology of the University of Milan, was founded in 1928 by Remo Grandori (1928-1955. Prof. Grandori became the first Director of the journal, followed by his wife Luigia Grandori (1956-1957, Minos Martelli (1958-1985 and Luciano Süss (1986-2011. In 2012, the Editor, the Department of Agri-food Systems Protection (DiPSA - University of Milan, come to the decision to move from the paper version to the online open access version of JEAR, with the aim to reach all researchers in the field with a restyled editorial, and with Giuseppe Carlo Lozzia as Editor in Chief (2012-2014. Thanks to the contributions of prestigious scientists and young researchers from all over the world, the Journal published many papers, which were downloaded in numerous countries across the world. Recently, the new Editor, the Department of Food Environmental and Nutritional Sciences - University of Milan, named me as Editor-in-Chief and I happily accepted the invitation with the objective to give new energy to the JEAR through the publication of more and more research papers of recognized scientific quality. The Journal will maintain its actual structure with four subject areas steered by internationally recognized Section Editors, who are now supported by a new and larger Editorial Board. The JEAR publishes papers on systematics, geographical speciation and evolution, aquatic and terrestrial entomology, ecological system dynamics, phenology and modelling for integrated pest control, agricultural and stored product pests, urban veterinary and forensic entomology, plant insect interaction and ecosystems, biological control and agro-ecology, and all other subjects related to the four subject areas. I hope the journal will continue to receive the attention of the researchers, in particular our younger colleagues in whose hands is

  13. A Personal Perspective: My Four Encounters with John Kendrew.

    Science.gov (United States)

    Wassarman, Paul M

    2017-08-18

    By celebrating the 100th anniversary of John Kendrew's birth in 1917, the Journal of Molecular Biology recognizes his seminal contributions to science in general and structural biology in particular. John was first to use X-ray diffraction to solve the 3-dimensional structure of a protein, sperm-whale myoglobin, worthy of a Nobel Prize in Chemistry in 1962. John was the Founder and first Editor-in-Chief of the Journal of Molecular Biology, Deputy Chairman of the Laboratory of Molecular Biology and Head of its Division of Structural Studies, a Founder of the European Molecular Biology Organization, first Director-General of the European Molecular Biology Laboratory, and 33rd President of St. John's College, Oxford. In this personal perspective I relate how I came to know John as his postdoctoral fellow at the Laboratory of Molecular Biology in 1967 and as his biographer 45 years later. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Interview with Di Gao PhD

    Directory of Open Access Journals (Sweden)

    Di Gao

    2016-04-01

    Full Text Available Di Gao is currently a scientist in the Quality Control department of AstraZeneca. She is responsible for technology transfer, stability programs and supporting regulatory submission. She has a BSc and PhD degree in chemistry and interned with Genentech in 2012. After completing her Ph.D. from University of Michigan in June 2013, she joined the R&D department of the United States Pharmacopeia (USP to support USP monograph modernization and since June 2014 she has been working in her current position at AstraZeneca. Recently, she won a prestigious award from Women in Bio (WIB. WIB is an organization of professionals committed to promoting careers, leadership and entrepreneurship for women in the life sciences. This interview was conducted by Roland J.W. Meesters PhD, Editor-in-Chief of Journal of Applied Bioanalysis.

  15. RETRACTED: Menselijke vrijheid en het Christelijk geloof

    Directory of Open Access Journals (Sweden)

    Jasper Doomen

    2012-05-01

    *This article has been retracted at the request of the Editor-in-Chief. Reason: ‘The article has been retracted to straighten the academic record. It has come to light that this article has significant overlap with an article that had already appeared in Informción Filosófica, Volume 1 (2004, num. 2, pp. 251–265, entitled ‘De onverenigbaarheid van menselijke vrijheid met het christelijk geloof’. Apologies are offered to readers of the journal that this was not detected during the submission process’. The full-text of the original article (2004 is here: https://openaccess.leidenuniv.nl/handle/1887/17816

  16. Academic Debate: Publications Which Promote Political Agendas Have no Place in Scientific and Medical Journals, and Academics Should Refrain from Publishing in Such Journals

    Directory of Open Access Journals (Sweden)

    Shimon Glick

    2015-01-01

    Full Text Available This paper presents the full debate held on October 1, 2014, which focused on the following resolution: “Publications which promote political agendas have no place in scientific and medical journals, and academics should refrain from publishing in such journals.” The debate moderator was Professor Shimon Glick. Taking the pro stance was Professor A. Mark Clarfield; the con stance was held by Professor Rael D. Strous. Following the first part of the debate, Dr Richard Horton, Editor-in-Chief of The Lancet, gave his thoughts on the topic. This was followed by the opportunity for rebuttal by Professors Clarfield and Strous. The debate was summarized and closed by Professor Glick. This paper provides a slightly edited text of the debate, for ease of reading.

  17. Interview with Xiaoli Wang PhD winner of CACA 2016 Young Investigator Award

    Directory of Open Access Journals (Sweden)

    Xiaoli Wang

    2016-07-01

    Full Text Available Xiaoli Wang is currently an R&D Senior Scientist in Agilent’s HPLC instrument R&D group at Agilent Technologies, Waldbronn, Germany. Prior to this, he was an R&D manager in Agilent’s CrossLab Group in the US focusing on development of novel chromatographic columns. He has a B.S. degree in Chemistry from Peking University, Beijing China and a PhD. degree in Analytical Chemistry from the University of Minnesota in 2006. He started his industrial career in the pharmaceutical industry at AstraZeneca for four years before joining Agilent Technologies in 2010. Recently, he won the prestigious 2016 Young Investigator Award from Chinese American Chromatography Association (CACA. This interview was conducted by Roland J.W. Meesters PhD, Editor-in-Chief of Journal of Applied Bioanalysis.

  18. Disruption of human papillomavirus 16 E6 gene by clustered regularly interspaced short palindromic repeat/Cas system in human cervical cancer cells [Retraction

    Directory of Open Access Journals (Sweden)

    Yu L

    2017-06-01

    Full Text Available Yu L, Wang XL, Zhu D, et al. Disruption of human papillomavirus 16 E6 gene by clustered regularly interspaced short palindromic repeat/Cas system in human cervical cancer cells. OncoTargets and Therapy. 2015;8:37–44 was published subsequent to Hu Z, Yu L, Zhu D, et al. Disruption of HPV16-E7 by CRISPR/Cas system induces apoptosis and growth inhibition in HPV16 positive human cervical cancer cells. BioMed Research International. 2014 (2014, Article ID 612823.When comparing the above papers it becomes apparent that they have an unacceptably high degree of similarity and re-use. Accordingly, the Editor-in-Chief and Publisher have issued this Notice of Retraction.This retraction relates toThis retraction also relates to  

  19. CERN Action on Open Access : Open Meeting on Changing the Publishing Model

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    Leader of the discussion: Chief Scientific Officer Jos Engelen, CERN. Particle physicists are again contributing to change by Director-General Robert Aymar, CERN. A general presentation of the CERN policy and visions. Improving the impact of your research by Former Editor-in-Chief Alex Bradshaw, New Journal of Physics. Springer Open Choice by Chief executive officer Derk Haank, Springer. The JHEP experience by Scientific director Hector Rubinstein, JHEP. The impact of the J series, existing and coming journals: JHEP JCAP JSTAT JINST. National libraries ensuring long-term archiving of digital information speaker to be decided. Debate The Director-General is calling all CERN editors and authors to a meeting to contribute to the discussion on the direction that CERN should take in its experimentation with new publishing models. The current subscription-funded publishing model for journal articles (where access to a particular journal is granted upon payment of a subscription, often arranged by the institutional ...

  20. Treatment strategies according to genotype for chronic hepatitis B in children.

    Science.gov (United States)

    Man Cho, Seung; Choe, Byung-Ho

    2016-09-01

    This review article was requested by editor-in-chief of this journal as 'pediatric CHB treatment' for the upcoming special issue. The main objective of chronic hepatitis B (CHB) treatment is diminishing the risk of complications related to chronic liver disease. In Asia, there are already some reports about hepatocellular carcinoma (HCC) in hepatitis B virus (HBV) infected children. The key points of treatment in children with CHB infections are selection of which patients to treat and conformation of the optimal therapy time that would reduce viral resistance. The choice of therapy is determined by the district (Western/Eastern), HBV genotype, medical accessibility, and economic state of the country. Newly developed nucleos(t)ide analogues (NAs) are potent in children with CHB. However, to improve therapeutic efficacy, physicians are recommended to follow treatment guidelines and determine the specific genotype in the CHB patient. In this article, the treatment of pediatric CHB is reviewed according to differences in genotype.

  1. Inaugural Letter for the International Journal of Financial Studies (IJFS

    Directory of Open Access Journals (Sweden)

    Nicholas Apergis

    2013-01-01

    Full Text Available The honor of becoming the Editor-in-Chief of the International Journal of Financial Studies becomes immediately muted by the intensity of the task ahead. I am pleased and flattered to follow in the footsteps of previous editors and to continue to define international financial research. My ambition as well as the IJFS’s ambition is the journal to become a more recognized top tier journal, acclaimed for defining new direction in financial research. Achieving this goal will require persistence of purpose, time and patience. History will judge whether within the next few years IJFS will emerge as an important financial journal publishing research, which will redirect and redefine research in financial issues.

  2. Mammalian target of rapamycin inhibitors for treatment in tuberous sclerosis

    Directory of Open Access Journals (Sweden)

    Won Seop Kim

    2013-06-01

    Full Text Available Korean J Pediatr 2011;54:241-5. <a href='http://dx.doi.org/10.3345/kjp.2011.54.6.241'>http://dx.doi.org/10.3345/kjp.2011.54.6.241</a>. PMID: 21949518 [PubMed] <div style="border-top:1px solid #0092C8"></div> The following article<sup>1</sup> is being retracted as a part of the manuscript was plagiarized. Yeong-Ho Rha, MD, PhD Editor-in-Chief, Korean J Pediatr 1.Kim WS. Mammalian target of rapamycin inhibitors for treatment in tuberous sclerosis. Korean J Pediatr 2011;54:241-5.

  3. John F. Dewey—Tectonics Editor

    Science.gov (United States)

    Richman, Barbara T.

    ‘I want the journal to acquire a reputation for very rapid, fair, and accurate reviewing,’ asserted John F. Dewey, editor-in-chief of AGU's newest journal, Tectonics. Dewey said that he will rule the bimonthly, which will begin publication in February, ‘with a bit of a rod of iron’ to ensure that Tectonics is ‘where only original and important papers are published.’‘I'm going to be very strict with reviewers,’ Dewey explained in his quick British clip. ‘If the review does not come back to me within 10 days to 2 weeks, I'll review the paper myself. I'm also going to have a system whereby, if a paper needs major surgery after being refereed, it will be rejected. Papers will have to be in virtually publishable condition before they are first submitted,’ he said.

  4. Retraction: 'Effect of blonanserin on cognitive function in antipsychotic-naïve first-episode schizophrenia'.

    Science.gov (United States)

    Tenjin, Tomomi; Miyamoto, Seiya; Miyake, Nobumi; Ogino, Shin; Kitajima, Rei; Ojima, Kazuaki; Arai, Jun; Teramoto, Haruki; Tsukahara, Sachiko; Ito, Yukie; Tadokoro, Masanori; Anai, Kiriko; Funamoto, Yasuyuki; Kaneda, Yasuhiro; Sumiyoshi, Tomiki; Yamaguchi, Noboru

    2017-05-01

    The above article from Human Psychopharmacology, first published on 25 January 2012 in Wiley OnlineLibrary (onlinelibrary.wiley.com), and in Volume 90, pp. 90-100, has been retracted by agreement between the authors, the journal Editor in Chief, David Baldwin, and John Wiley & Sons Ltd. The retraction has been agreed following an investigation by the St Marianna University Ethics Committee which determined that the paper was not as originally designed and approved. Tenjin, T., Miyamoto, S., Miyake, N., Ogino, S., Kitajima, R., Ojima, K., … Yamaguchi, N. (2012). Effect of blonanserin on cognitive function in antipsychotic-naïve first-episode schizophrenia. Hum. Psychopharmacol Clin Exp, 27, 90-100. https://doi.org/10.1002/hup.1276. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Preface to special issue of selected papers from Theoretical, Experimental, and Computational Mechanics (TECM)

    DEFF Research Database (Denmark)

    Jabbari, Masoud; Sarlak Chivaee, Hamid; Hattel, Jesper Henri

    2017-01-01

    We are pleased to introduce this special issue of the Applied Mathematical Modelling journal with highlights from theTheoretical, Experimental, and Computational Mechanics Symposium (TECM-2015). This special issue consists of four rigorouslyselected papers originally presented at TECM-2015...... various fields and application. The symposium did an excellent job of outlining the current landscape of computational mechanics and its capabilities in solving complex industrial problems in the process industries, and we agree with the editor-in-chief of the journal that it is certainly worthwhile......, and were subjected to the rigorous APM review process. We wish to thank the authors for their hard work in turning the original conference papers into top quality full journal articles. We also wish to thank our international reviewers who kindly agreed to review the articles to ensure that the quality...

  6. Academic Debate: Publications Which Promote Political Agendas Have no Place in Scientific and Medical Journals, and Academics Should Refrain from Publishing in Such Journals.

    Science.gov (United States)

    Glick, Shimon; Clarfield, A Mark; Strous, Rael D; Horton, Richard

    2015-01-01

    This paper presents the full debate held on October 1, 2014, which focused on the following resolution: "Publications which promote political agendas have no place in scientific and medical journals, and academics should refrain from publishing in such journals." The debate moderator was Professor Shimon Glick. Taking the pro stance was Professor A. Mark Clarfield; the con stance was held by Professor Rael D. Strous. Following the first part of the debate, Dr Richard Horton, Editor-in-Chief of The Lancet, gave his thoughts on the topic. This was followed by the opportunity for rebuttal by Professors Clarfield and Strous. The debate was summarized and closed by Professor Glick. This paper provides a slightly edited text of the debate, for ease of reading.

  7. Allergy - Committed to Progress in Allergy and Immunology.

    Science.gov (United States)

    Simon, Hans-Uwe; Bieber, Thomas

    2018-01-13

    After more than 8 years, our terms as Co-Editors-in-Chief have now reached an end. We are thankful for having had the privilege to serve the community in this position. We think that we have reached our original goal of increasing the overall quality of the journal (1). The science which is reported every month in Allergy is of high quality and wide interest, largely contributing to the development of the fields of Allergy and Immunology. The impact of the journal is high, as reflected by its present impact factor of 7.36. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  8. The voice of American botanists: the founding and establishment of the American Journal of Botany, "American botany," and the Great War (1906-1935).

    Science.gov (United States)

    Smocovitis, Vassiliki Betty

    2014-03-01

    This paper examines the crucial early history of the American Journal of Botany from the years following the founding of the Botanical Society of America in 1906 to the termination of the agreement for publication with the Brooklyn Botanic Garden in 1935. It examines the efforts of individuals like F. C. Newcombe, who did the most to raise support for the journal and became the first Editor-in-Chief, in the context of the growing numbers of professional botanists and plant scientists who were actively engaged in research requiring appropriate publication venues and in the process of forming an independent identity as "American botanists." It also examines the launching of the journal in the context of the Great War in Europe and the transition from German botany to American botany in the second decade of the 20th century.

  9. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Lin FO

    2016-10-01

    Full Text Available The Editor-in-Chief and Publisher of OncoTargets and Therapy have been alerted to unacceptable levels of duplication with another published paper: Zhang D, Ni Z, Xu X, and Xiao J. MiR-32 Functions as a Tumor Suppressor and Directly Targets EZH2 in Human Oral Squamous Cell Carcinoma. Medical Science Monitor. 20:2527–2535, 2014.Accordingly, we retract Lin FO, Yao LJ, Xiao J, Liu DF, and Ni ZY. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma. OncoTargets and Therapy. 2014;7:1583–1591.This Retraction relates to 

  10. miR-32 functions as a tumor suppressor and directly targets SOX9 in human non–small cell lung cancer [Retraction

    Directory of Open Access Journals (Sweden)

    Zhu D

    2016-10-01

    Full Text Available The Editor-in-Chief and Publisher of OncoTargets and Therapy have been alerted to unacceptable levels of duplication with another published paper: Zhu D, Chen H, Yang X, Chen W, Wang L, Xu J and Yu L. Decreased microRNA-224 and its clinical significance in non-small cell lung cancer patients. Diagnostic Pathology. 9;198:2014.Accordingly, we retract Zhu D, Chen H, Yang X, Chen W, Wang L, Xu J, Yu L. miR-32 functions as a tumor suppressor and directly targets SOX9 in human non–small cell lung cancer. OncoTargets and Therapy. 2015;8:1773–1783. This Retraction relates to 

  11. RETRACTED ARTICLE: Typhoon disasters and adaptive governance in Guangdong, China.

    Science.gov (United States)

    2014-03-01

    The peer-review process for the above article was found to have been compromised and inappropriately influenced by the first author, Yongdeng Lei. As a result the findings and conclusions of these articles cannot be relied upon. The Editor-in-Chief was misled in believing that she had accepted the article based upon a favorable review. The article is retracted based upon violation of the integrity of the peer review process.The first author and the publisher wish to retract this paper to preserve the integrity of material published in the journal. The publisher acknowledges that the integrity of the peer review process should have been subject to more rigorous verification to ensure the reviews provided were genuine and impartial. The publisher apologizes for any inconvenience rendered to the readers of the journal and wishes to assure the reader that measures have been taken to ensure that the peer review process is comprehensively checked to avoid a similar error occurring.

  12. Symmetry – An International and Interdisciplinary Scientific Open Access Journal

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin

    2009-06-01

    Full Text Available As the publisher of MDPI journals, I am pleased to launch Symmetry (ISSN 2073-8994, an international and interdisciplinary open access scientific journal. Twenty years ago, a journal entitled Symmetry – An Interdisciplinary and International Journal was launched by VCH Publishers, Inc. in New York, with Professor Istvan Hargittai as Editor-in-Chief. I submitted a paper which was processed by Professor Sven J. Cyvin from The University of Trondheim – The Norwegian Institute of Technology. The paper was accepted and scheduled for publication in the printed issue 4 of volume 1, 1990. I still keep a copy of the galley proofs. However, the publication of this journal was terminated after just the release of the first issue of volume 1, and this paper was finally published elsewhere [1]. [...

  13. Participation and power

    DEFF Research Database (Denmark)

    We would like to welcome you to a series of dialogues within the framework of action research (AR) and participatory research (PR), which will be focused on the relationship between participation and power. The basic question in this anthology is ‘What are the possibilities and barriers to partic......We would like to welcome you to a series of dialogues within the framework of action research (AR) and participatory research (PR), which will be focused on the relationship between participation and power. The basic question in this anthology is ‘What are the possibilities and barriers...... to participation conceptualised as various degrees of codetermination in organisations and in research processes?’ The anthology is part of a follow-up on an initiative taken in 2010 by Professor Werner Fricke, editor-in-chief of the International Journal of Action Research for many years. His vision was to create...

  14. Weaving a Tapestry from Threads Spun by Geneticists: The Series Perspectives on Genetics, 1987-2008.

    Science.gov (United States)

    Dove, William F

    2016-07-01

    The Perspectives column was initiated in 1987 when Jan Drake, Editor-in-Chief of GENETICS, invited Jim Crow and William Dove to serve as coeditors of "Anecdotal, Historical, and Critical Commentaries." As the series evolved over 21 years, under the guidance of Crow and Dove, the input of stories told by geneticists from many countries created a panorama of 20th-century genetics. Three recurrent themes are visible: how geneticists have created the science (as solitary investigators, in pairs, or in cooperative groups); how geneticists work hard, but find ways to have fun; and how public and private institutions have sustained the science of genetics, particularly in the United States. This article ends by considering how the Perspectives series and other communication formats can carry forward the core science of genetics from the 20th into the 21st century. Copyright © 2016 by the Genetics Society of America.

  15. The cortical mouse: a piece of forgotten history in noninvasive brain–computer interfaces.

    Science.gov (United States)

    Principe, Jose C

    2013-07-01

    Early research on brain-computer interfaces (BCIs) was fueled by the study of event-related potentials (ERPs) by Farwell and Donchin, who are rightly credited for laying important groundwork for the BCI field. However, many other researchers have made substantial contributions that have escaped the radar screen of the current BCI community. For example, in the late 1980s, I worked with a brilliant multidisciplinary research group in electrical engineering at the University of Florida, Gainesville, headed by Dr. Donald Childers. Childers should be well known to long-time members of the IEEE Engineering in Medicine and Biology Society since he was the editor-in-chief of IEEE Transactions on Biomedical Engineering in the 1970s and the recipient of one of the most prestigious society awards, the William J. Morlock Award, in 1973.

  16. Academic Debate: Publications Which Promote Political Agendas Have no Place in Scientific and Medical Journals, and Academics Should Refrain from Publishing in Such Journals

    Science.gov (United States)

    Glick, Shimon; Clarfield, A. Mark; Strous, Rael D.; Horton, Richard

    2015-01-01

    This paper presents the full debate held on October 1, 2014, which focused on the following resolution: “Publications which promote political agendas have no place in scientific and medical journals, and academics should refrain from publishing in such journals.” The debate moderator was Professor Shimon Glick. Taking the pro stance was Professor A. Mark Clarfield; the con stance was held by Professor Rael D. Strous. Following the first part of the debate, Dr Richard Horton, Editor-in-Chief of The Lancet, gave his thoughts on the topic. This was followed by the opportunity for rebuttal by Professors Clarfield and Strous. The debate was summarized and closed by Professor Glick. This paper provides a slightly edited text of the debate, for ease of reading. PMID:25717385

  17. Retraction Statement: "Overexpression of miR-708 and its targets in the childhood common precursor B-cell ALL" by Xue Li, MMed, Dong Li, PhD, Yong Zhuang, MMed, Qing Shi, BSc, Wei Wei, MMed, and Xiuli Ju, MD, PhD.

    Science.gov (United States)

    2017-05-01

    The above article, published online 23 August 2013 in Pediatric Blood and Cancer, Volume 60, Issue 12, December 2013, Pages 2060-2067, has been retracted by agreement among the authors, the journal's Editor-in-Chief, Peter E. Newburger, M.D., and Wiley Periodicals, Inc. The decision to retract was agreed upon following notification that the paper substantially duplicates a prior study already published in Chinese https://www.ncbi.nlm.nih.gov/pubmed/23611221. The authors were not aware that publication in another language would constitute a duplicate publication and, upon being informed of this fact, have agreed to withdraw the paper from Pediatric Blood and Cancer. Reference Li X, Li D, Zhuang Y, Shi Q, Wei W and Ju X. Overexpression of miR-708 and its targets in the childhood common precursor B-cell ALL. Pediatr Blood Cancer. 2013; 60: 2060-2067. doi:10.1002/pbc.24583. © 2017 Wiley Periodicals, Inc.

  18. Economic History in Times of Transition

    DEFF Research Database (Denmark)

    Reckendrees, Alfred

    2017-01-01

    This issue coincides with my retirement as one of the (co-)editors of the Scandinavian Economic History Review. It has been a great pleasure and a real privilege to work for this journal over the last six years, and I am grateful that Jari Ojala, editor-in-chief since 2015, invited me to reflect...... upon the development of the Journal since 2011. After a few acknowledgements, I present a brief survey of strategic ideas that guided the editors and of some achievements of the last six years. Then I take the opportunity to indicate how in my view academic journals in our fields may become even more...... interesting (the short answer is ‘red’ – relevance, engagement, debate). And finally, I introduce to the articles appearing in this number of the Journal. A journal is teamwork. Many people, from the authors who submit their papers to the publisher’s copyeditors, contribute to the success of a journal. Most...

  19. Geospatial health

    DEFF Research Database (Denmark)

    Utzinger, Jürg; Rinaldi, Laura; Malone, John B.

    2011-01-01

    Geospatial Health is an international, peer-reviewed scientific journal produced by the Global Network for Geospatial Health (GnosisGIS). This network was founded in 2000 and the inaugural issue of its official journal was published in November 2006 with the aim to cover all aspects of geographical...... information system (GIS) applications, remote sensing and other spatial analytic tools focusing on human and veterinary health. The University of Naples Federico II is the publisher, producing two issues per year, both as hard copy and an open-access online version. The journal is referenced in major...... databases, including CABI, ISI Web of Knowledge and PubMed. In 2008, it was assigned its first impact factor (1.47), which has now reached 1.71. Geospatial Health is managed by an editor-in-chief and two associate editors, supported by five regional editors and a 23-member strong editorial board...

  20. Retracted: Aetiology and clinical profile of children with 46, XY differences of sex development at an Indian referral centre.

    Science.gov (United States)

    Chauhan, V; Dada, R; Jain, V

    2017-11-01

    Retraction: 'Aetiology and clinical profile of children with 46, XY differences of sex development at an Indian referral centre' by Vasundhera Chauhan, Rima Dada, Vandana Jain The above article, published online on 8 August 2016 in Wiley Online Library (http://wileyonlinelibrary.com), has been retracted by agreement between the authors, the Journal Editors-in-Chief, Wolf-Bernhard Schill and Ralf Henkel, and Blackwell Verlag GmbH. The retraction has been agreed as the result of an unresolved dispute between the first author and a colleague research fellow due to the inclusion of data from patients who were simultaneously enrolled in two studies being conducted separately by the two parties. Reference Chauhan, V., Dada, R. and Jain, V. (2016), Aetiology and clinical profile of children with 46, XY differences of sex development at an Indian referral centre. Andrologia. doi:10.1111/and.12663. © 2016 Blackwell Verlag GmbH.

  1. Corrigendum: Batos B, Orlović S, Miletić Z, Rakonjac Lj, Miljković D.: Population variability and comparative analysis of macroelement concentrations in pedunculate oak (Quercus robur L. leaves and surrounding soils. Arch biol sci. 2014;66(4: 1345-55, DOI: 10.2298/ABS1404345B

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available The Editor-in-Chief has been informed that the results in Table 1 and in Table 2 presented in the article: Population variability and comparative analysis of macroelement concentrations in pedunculate oak (Quercus robur L. Leaves and surrounding soils published in the Archives of Biological Sciences in 2014, Vol. 66, Issue 4 partially overlap with the results in Tables 1, 2, 3a and 3b, published in the article Batos B, Miletić Z, Orlović S, Miljković D. Variability of nutritive macroelements in pedunculate oak (Quercus robur L. leaves in Serbia. Genetika. 2010;42(3:435-53, DOI: 10.2298/GENSR1003435B without proper cross-referencing. This claim is correct and we are reporting this overlap in order to provide appropriate cross-referencing to the earlier work. Link to the corrected article 10.2298/ABS1404345B

  2. Weaving a Tapestry from Threads Spun by Geneticists: The Series Perspectives on Genetics, 1987–2008

    Science.gov (United States)

    Dove, William F.

    2016-01-01

    The Perspectives column was initiated in 1987 when Jan Drake, Editor-in-Chief of GENETICS, invited Jim Crow and William Dove to serve as coeditors of “Anecdotal, Historical, and Critical Commentaries.” As the series evolved over 21 years, under the guidance of Crow and Dove, the input of stories told by geneticists from many countries created a panorama of 20th-century genetics. Three recurrent themes are visible: how geneticists have created the science (as solitary investigators, in pairs, or in cooperative groups); how geneticists work hard, but find ways to have fun; and how public and private institutions have sustained the science of genetics, particularly in the United States. This article ends by considering how the Perspectives series and other communication formats can carry forward the core science of genetics from the 20th into the 21st century. PMID:27384024

  3. Retraction: 'Genotyping of CYP2C19 polymorphisms and its clinical validation in the ethnic Arab population', by T. Tayeb, Dana H. Bakheet, Khaled Zaza, Salma M. Wakil and Nduna Dzimiri.

    Science.gov (United States)

    2016-03-01

    The above article from the Journal of Pharmacy and Pharmacology, published online on 14 February 2015 in Wiley Online Library (wileyonlinelibrary.com), and in Volume 67, pp. 972-979, has been retracted by agreement between the authors, the journal Editor-in-Chief, Professor David Jones, and John Wiley & Sons Ltd. The retraction has been agreed following an investigation by the Research Advisory Council at King Faisal Specialist Hospital and Research Centre, because the manuscript (including all of its content and authorship) was published without obtaining clearance from the Office of Research Affairs. Reference Tayeb HT et al. Genotyping of CYP2C19 polymorphisms and its clinical validation in the ethnic Arab population. © 2016 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology.

  4. Retraction: 'rhBNP therapy can improve clinical outcomes and reduce in-hospital mortality compared with dobutamine in heart failure patients: a meta-analysis' by Ming-Yi Lv, Shu-Ling Deng and Xiao-Feng Long.

    Science.gov (United States)

    2016-05-01

    The above article, published online on 28(th) November 2015 in Wiley Online Library (http://onlinelibrary.wiley.com/doi/10.1111/bcp.12788/full), and in volume 81, pp. 174-185, has been retracted by agreement between the authors, the journal Editor in Chief, Professor A Cohen, and John Wiley & Sons Limited. The retraction has been agreed owing to evidence indicating that the peer review of this paper was compromised. The authors were unaware of the actions of the third party responsible for compromising the peer review. Reference Lv M-Y, Deng S-L, Long X-F. rhBNP therapy can improve clinical outcomes and reduce in-hospital mortality compared with dobutamine in heart failure patients: a meta-analysis. Br J Clin Pharmacol 2016; 81: 174-85. doi:10.1111/bcp.12788. © 2016 The British Pharmacological Society.

  5. Retraction: 'Genistein mediated histone acetylation and demethylation activates tumor suppressor genes in prostate cancer cells' by Nobuyuki Kikuno, Hiroaki Shiina, Shinji Urakami, Ken Kawamoto, Hiroshi Hirata, Yuichiro Tanaka, Shahana Majid, Mikio Igawa and Rajvir Dahiya.

    Science.gov (United States)

    2017-10-01

    The above article, published online on 22 April 2008 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, Prof. Peter Lichter, and John Wiley & Sons Ltd. The retraction has been agreed due to errors identified in Figs, 3, 4, and 5. The concerns about these figures cannot be resolved because the original data can no longer be retrieved. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M and Dahiya R. (2008), Genistein mediated histone acetylation and demethylation activates tumor suppressor genes in prostate cancer cells. Int J Cancer, 123:552-560. DOI: 10.1002/ijc.23590. © 2017 UICC.

  6. Retracted: Micro-computed tomography evaluation of apical transportation and centring ability of Reciproc and WaveOne systems in severely curved root canals.

    Science.gov (United States)

    de Meireles, D A; de Brito, T C C A; Marques, A A F; Garrido, A D B; Garcia, L F R; Sponchiado, E C

    2015-08-01

    The following article from International Endodontic Journal, 'Micro-computed tomography evaluation of apical transportation and centring ability of Reciproc and WaveOne systems in severely curved root canals' by D. A. de Meireles, T. C. C. A. de Brito, A. A. F. Marques, A. D. B. Garrido, L. F. R. Garcia & E. C. Sponchiado Jr, published online on 5 February 2015 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, Prof. Paul Dummer, and John Wiley & Sons Ltd. The retraction has been agreed due to the use of techniques for crucial measurements in canal shaping and a lack of clarity regarding the measuring methodology. The use of inadequate measuring methodologies makes the findings of the paper invalid. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  7. Retraction: "Activated K-Ras and INK4a/Arf Deficiency Promote Aggressiveness of Pancreatic Cancer by Induction of EMT Consistent With Cancer Stem Cell Phenotype" by Wang et al.

    Science.gov (United States)

    2016-10-01

    The above article, published online on November 23, 2012 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figure 4B and C to be inappropriately manipulated and re-labeled. Literature Cited Wang Z, Ali S, Banerjee S, Bao B, Li Y, Azmi AS, Korc M, Sarkar FH. 2013. Activated K-Ras and INK4a/Arf deficiency promote aggressiveness of pancreatic cancer by induction of EMT consistent with cancer stem cell phenotype. J Cell Physiol 228:556-562; doi: 10.1002/jcp.24162. © 2016 Wiley Periodicals, Inc.

  8. Retracted: Impact of Type 2 diabetes prevention programmes based on risk identification and lifestyle intervention intensity strategies: a cost-effectiveness analysis.

    Science.gov (United States)

    2016-08-01

    The following article, published online on 17 November 2015 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, Richard Holt and John Wiley & Sons Ltd. The retraction has been agreed due the fact the authors have made Wiley aware that there was an error in the way the diabetes prevention intervention effect was implemented in this version of the model. The underlying model is not affected by this error. However, the magnitude of the cost savings and health benefits are substantially lower than stated. Reference 1 Breeze R, Thomas C, Squires H, Brennan A, Greaves C, Diggle PJ, Brunner E, Tabak A, Preston L, Chilcott J. Impact of Type 2 diabetes prevention programmes based on risk identification and lifestyle intervention intensity strategies: a cost-effectiveness analysis. Diabet Med 2015; doi: 10.1111/dme.12981. © 2015 Diabetes UK.

  9. Retraction: "Down-regulation of uPA and uPAR by 3,3'-diindolylmethane contributes to the inhibition of cell growth and migration of breast cancer cells" by Ahmad et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on August 19, 2009 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the third author and the corresponding author that found Figure 5C to be inappropriately re-used and re-labeled. REFERENCE Ahmad A, Kong D, Wang Z, Sarkar SH, Banerjee S, Sarkar FH. 2009. Down-regulation of uPA and uPAR by 3,3'-diindolylmethane contributes to the inhibition of cell growth and migration of breast cancer cells. J Cell Biochem 108:916-925; doi: 10.1002/jcb.22323. © 2016 Wiley Periodicals, Inc.

  10. Retraction: "Oral Polypodium leucomotos increases the anti-inflammatory and melanogenic responses of the skin to different modalities of sun exposures: a pilot study" by Calzavara-Pinton PG, Rossi MT, Zanca A, Arisi M, Gonzalez S, and Venturini M.

    Science.gov (United States)

    2016-09-01

    The above article, published online on November 6, 2015 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, Thomas M. Ruenger, MD PhD and John Wiley & Sons Ltd. The retraction has been agreed as the clinical trial reported in this manuscript was not approved by the local Ethics Committee. Reference Calzavara-Pinton PG, Rossi MT, Zanca A, Arisi M, Gonzalez S, Venturini M. Oral Polypodium leucomotos increases the anti-inflammatory and melanogenic responses of the skin to different modalities of sun exposures: a pilot study. Photodermatol Photoimmunol Photomed 2016; 32: 22-27. doi: 10.1111/phpp.12209. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Retraction statement: 'Species distributions shift downward across western North America' by M.A. Harsch and J. Hille Ris Lambers.

    Science.gov (United States)

    2015-03-01

    The above article, published online on 18 August 2014 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, Dr Melanie Harsch and Associate Professor Janneke Hille Ris Lambers, journal Editor-in-Chief, Professor Stephen Long, and John Wiley & Sons Ltd. The retraction has been agreed for the following reasons: a coding error affected the results and therefore invalidated the broadscale conclusions presented in the article. The article presented broad-scale patterns of species distribution shifts in response to recent climate change. Unfortunately, it has since been found that one approach used to account for sampling bias, the null model approach, was affected by the coding error. Following the identification of the coding error, we are therefore retracting the article. We thank Drs Adam Wolf and William Anderegg for bringing this issue to our attention.

  12. Retracted: Spontaneous rectus sheath haematoma associated with rivaroxaban treatment.

    Science.gov (United States)

    Tas Tuna, A; Palabiyik, O; Beyaz, S G

    2015-08-01

    http://onlinelibrary.wiley.com/doi/10.1111/jcpt.12228/pdf The above article, published online on 10 November 2014 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, A. Li Wan Po, and John Wiley & Sons Ltd. The retraction has been agreed because, unknown to the authors, another group published a similar study based on the same material in the Indian Journal of Pharmacology: Kocayigit I, Can Y, Sahinkus S, et al. Spontaneous rectus sheath haematoma during rivaroxaban therapy. Indian Journal of Pharmacology. 2014;46(3):339-340. doi:10.4103/0253-7613.132193. © 2014 John Wiley & Sons Ltd.

  13. Retraction statement: In Bangladesh, overweight individuals have fewer symptoms of depression than nonoverweight individuals.

    Science.gov (United States)

    2015-12-01

    The above article, published online on 1 October 2009 in Wiley Online Library (wileyonlinelibrary.com), and in volume 18, pp. 1143-1145, has been retracted by agreement between the authors, the journal Editors-in-Chief, Eric Ravussin and Donna Ryan, the Obesity Society and Wiley Periodicals, Inc. Although there is no implication that the data collection was carried out unethically, the retraction has been agreed to because the subsequent data analysis was conducted without the required approval of the university ethics board while the published paper incorrectly stated that Norwegian ethical approval had been obtained. Asghar, S., Magnusson, A., Khan, A., Ali, K. and Hussain, A. In Bangladesh, overweight individuals have fewer symptoms of depression than nonoverweight individuals. Obesity 2010;18:1143-1145. doi: 10.1038/oby.2009.332. © 2015 The Obesity Society.

  14. Retracted: Umbelliferone reverses depression-like behavior in chronic unpredictable mild stress-induced mice via RIP140/NF-κB pathway.

    Science.gov (United States)

    Chunhua, Ma; Lingdong, Kong; Hongyan, Long; Zhangqiang, Ma

    2016-10-05

    The above article from IUBMB Life, published online on October 5th, 2016 in Wiley Online Library (http://wileyonlinelibrary.com), has been retracted by agreement between the authors, the Journal Editors-in-Chief, Dr. Angelo Azzi and Dr. William Whelan, and Wiley Periodicals, Inc. The retraction has been agreed because the article was submitted and approved for publication by Chunhua Ma and Long Hongyan without consent in any form by the named Corresponding Author, Kong Lingdong. Chunhua, M., Lingdong, K., Hongyan, L. and Zhangqiang, M. (2016), Umbelliferone reverses depression-like behavior in chronic unpredictable mild stress-induced mice via RIP140/NF-κB pathway. IUBMB Life. doi:10.1002/iub.1570 © 2017 IUBMB Life, 69(9):767-767, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  15. Retraction: 'Alendronate and vitamin D2 for prevention of hip fracture in Parkinson's disease: A randomized controlled trial,' by Sato, Y., Iwamoto, J., Kanoko, T., and Satoh, K.

    Science.gov (United States)

    2016-07-01

    The above article, published online on 14 March 2006 in Wiley Online Library (wileyonlinelibrary.com), and in Volume 21, Issue 7, Pages 924-929, has been retracted by agreement between the authors, the Editor-in-Chief, Jose A. Obeso, and Wiley Periodicals, Inc. The retraction has been agreed due to an acknowledgement from the authors that the co-authors did not participate in study design, data collection, data analysis, interpretation of data and drafting the manuscript. Thus all co-authors are honorary. Reference Sato, Y., Iwamoto, J., Kanoko, T., and Satoh, K. (2006) Alendronate and vitamin D2 for prevention of hip fracture in Parkinson's disease: A randomized controlled trial. Mov Disord. doi: 10.1002/mds.20825. © 2016 International Parkinson and Movement Disorder Society.

  16. Retraction: "Identification of Novel Biomarkers for Pancreatic Cancer Using Integrated Transcriptomics With Functional Pathways Analysis" by Zhang, X., Tong, P., Chen, J., Pei, Z., Zhang, X., Chen, W., Xu, J. and Wang, J.

    Science.gov (United States)

    2017-11-01

    The above article from the Journal of Cellular Physiology, published online on 10 March 2016 in Wiley Online Library as Early View (http://onlinelibrary.wiley.com/enhanced/doi/10.1002/jcp.25353/), has been retracted by agreement between Gary Stein, the journal's Editor-in-Chief, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation at the University of Texas, MD Anderson Cancer Center, which confirmed that the article was submitted and approved for publication by Dr. Jin Wang without acknowledgement of NIH funding received or the consent and authorship of Dr. Ann Killary and Dr. Subrata Sen, with whom the manuscript was originally drafted. © 2016 Wiley Periodicals, Inc.

  17. Retraction: The effect of anticoagulant choice on collection of cord blood.

    Science.gov (United States)

    2014-09-01

    "The effect of anticoagulant choice on collection of cord blood" by M. Badowski, C. Shultz and D.T. Harris. Transfusion. First published online: June 12, 2014. The above article, published online on June 12, 2014 on Wiley Online Library (wileyonlinelibrary.com), has been withdrawn for legal reasons by agreement between the authors, the journal Editor in Chief, Paul M. Ness, MD, the AABB, and Wiley Periodicals, Inc. The withdrawal has been agreed due to violation of a research agreement between the Cord Blood Registry, which commissioned the article, and the authors. Badowski M, Shultz C and Harris DT. The effect of anticoagulant choice on collection of cord blood. Transfusion. 2014. doi: 10.1111/trf.12744. First published online: 12 JUN 2014. © 2014 AABB.

  18. Retraction: "Concurrent inhibition of NF-κB, cyclooxygenase-2, and epidermal growth factor receptor leads to greater anti-tumor activity in pancreatic cancer" by Ali et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on March 8, 2010 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figures 2A, 4, 6A, and 6C to be inappropriately manipulated. REFERENCE Ali S, Banerjee S, Schaffert JM, El-Rayes BF, Philip PA, Sarkar FH. 2010. Concurrent inhibition of NF-κB, cyclooxygenase-2, and epidermal growth factor receptor leads to greater anti-tumor activity in pancreatic cancer. J Cell Biochem 110:171-181; doi: 10.1002/jcb.22523. © 2016 Wiley Periodicals, Inc.

  19. Retraction: "Inactivation of Ink4a/Arf Leads to Deregulated Expression of miRNAs in K-Ras Transgenic Mouse Model of Pancreatic Cancer" by Ali et al.

    Science.gov (United States)

    2016-10-01

    The above article, published online on June 21, 2012 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figure 5A to be inappropriately manipulated. Literature Cited Ali S, Banerjee S, Logna F, Bao B, Philip PA, Korc M, Sarkar FH. 2012. Inactivation of Ink4a/Arf leads to deregulated expression of miRNAs in K-Ras transgenic mouse model of pancreatic cancer. J Cell Physiol 227:3373-3380; doi: 10.1002/jcp.24036. © 2016 Wiley Periodicals, Inc.

  20. Retraction: "Down-regulation of Notch-1 and Jagged-1 inhibits prostate cancer cell growth, migration and invasion, and induces apoptosis via inactivation of Akt, mTOR, and NF-κB signaling pathways" by Wang et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on January 5, 2010 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figure 5A to be inappropriately manipulated. REFERENCE Wang Z, Li Y, Banerjee S, Kong D, Ahmad A, Nogueira V, Hay N, Sarkar FH. 2010. Down-regulation of Notch-1 and Jagged-1 inhibits prostate cancer cell growth, migration and invasion, and induces apoptosis via inactivation of Akt, mTOR, and NF-κB signaling pathways. J Cell Biochem 109:726-736; doi: 10.1002/jcb.22451. © 2016 Wiley Periodicals, Inc.

  1. Retraction: "Down-regulation of Notch-1 is associated with Akt and FoxM1 in inducing cell growth inhibition and apoptosis in prostate cancer cells" by Wang et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on July 23, 2010 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figures 1B and 3A to be inappropriately manipulated. REFERENCE Wang Z, Li Y, Ahmad A, Banerjee S, Azmi AS, Kong D, Wojewoda C, Miele L, Sarkar FH. 2011. Down-regulation of Notch-1 is associated with Akt and FoxM1 in inducing cell growth inhibition and apoptosis in prostate cancer cells. J Cell Biochem 112:78-88; doi: 10.1002/jcb.22770. © 2016 Wiley Periodicals, Inc.

  2. Retracted: Postoperative pain after irrigation with Vibringe versus a conventional needle: a randomized controlled trial.

    Science.gov (United States)

    Bilgili, D; Yilmaz, S; Dumani, A; Yoldas, O

    2016-08-01

    The following article from International Endodontic Journal, 'Postoperative pain after irrigation with Vibringe versus a conventional needle: a randomized controlled trial' by D. Bilgili, S. Yilmaz, A. Dumani & O. Yoldas, published online on 29 February 2016 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the Journal Editor in Chief, Prof. Paul Dummer, and John Wiley & Sons Ltd. The retraction has been agreed because the corresponding author did not contact the first author who carried out the work before alterations to the article were made prior to submission. This damages the integrity of the work and there are additional concerns over the number of patients and the accuracy of the results and conclusions. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  3. Retracted: Evaluation of the incidence of microcracks caused by Mtwo and ProTaper NEXT rotary file systems versus the Self Adjusting File: A scanning electron microscopic study.

    Science.gov (United States)

    Saha, S G; Vijaywargiya, N; Dubey, S; Saxena, D; Kala, S

    2015-11-24

    The following article from International Endodontic Journal, 'Evaluation of the incidence of microcracks caused by Mtwo and ProTaper NEXT rotary file systems versus the Self Adjusting File: a scanning electron microscopic study' by S. G. Saha, N. Vijaywargiya, S. Dubey, D. Saxena & S. Kala, published online on 24 November 2015 in Wiley Online Library (wileyonlinelibrary. com), has been retracted by agreement between the authors, the journal Editor in Chief, Prof. Paul Dummer, and John Wiley & Sons Ltd. The retraction has been agreed due to the consideration that the SEM methodology used by the authors has the potential to cause cracks and is thus is not suitable for the evaluation of micro-cracks in roots. This article is protected by copyright. All rights reserved.

  4. This article has been retracted and is available online only: Religion, culture and male involvement in the use of family planning: evidence from Enugu and Katsina States of Nigeria.

    Science.gov (United States)

    Robinson, Jane J A

    2011-09-01

    The following article from the International Nursing Review, 'Religion, culture and male involvement in the use of family planning: evidence from Enugu and Katsina States of Nigeria', by C. Ujuju, J. Anyanti, S.B. Adebayo, F. Muhammad, O. Oluigbo and A. Gofwan, published online on 6 September 2010 on Wiley Online Library (http://wileyonlinelibrary.com) has been retracted by agreement between the authors, the journal Editor in Chief, Jane J.A. Robinson and Blackwell Publishing Ltd. The retraction has been agreed as not all copyright permissions had been cleared. Jane J.A Robinson Editor International Nursing Review. © 2010 The Authors. International Nursing Review © 2010 International Council of Nurses.

  5. Retraction: 'Beneficial Effect of Intermittent Cyclical Etidronate Therapy in Hemiplegic Patients Following an Acute Stroke' by Y. Sato, T. Asoh, M. Kaji and K. Oizumi.

    Science.gov (United States)

    2016-10-01

    The above article, published online on 1 December 2000 in Wiley Online Library (wileyonlinelibrary.com), and in Volume 15, Issue 12, pages 2487-2494, has been retracted by agreement between the authors, the Journal Editor in Chief, Juliet Compston, and Wiley Periodicals, Inc. The retraction has been agreed due to concerns about the underlying data to which the authors have given no satisfactory response. Dr Sato acknowledges that his co-authors are named as such for honorary reasons and are not responsible for the content of the manuscript. Reference Sato, Y., Asoh, T., Kaji, M. and Oizumi, K. (2000) Beneficial Effect of Intermittent Cyclical Etidronate Therapy in Hemiplegic Patients Following an Acute Stroke. J Bone Miner Res, 15:2487-2494. doi: 10.1359/jbmr.2000.15.12.2487. © 2016 American Society for Bone and Mineral Research.

  6. Retraction: "Over-expression of FoxM1 leads to epithelial-mesenchymal transition and cancer stem cell phenotype in pancreatic cancer cells" by Bao et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on April 18, 2011 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the second author that found Figures 1C and 4C to be inappropriately re-used and re-labeled. REFERENCE Bao B, Wang Z, Ali S, Kong D, Banerjee S, Ahmad A, Li Y, Azmi AS, Miele L, Sarkar FH. 2011. Over-expression of FoxM1 leads to epithelial-mesenchymal transition and cancer stem cell phenotype in pancreatic cancer cells. J Cell Biochem 112:2296-2306; doi: 10.1002/jcb.23150. © 2016 Wiley Periodicals, Inc.

  7. Retraction statement: LA sprouts randomized controlled nutrition, cooking and gardening program reduces obesity and metabolic risk in Latino youth.

    Science.gov (United States)

    2015-12-01

    The above article, published online on 9 May 2015 in Wiley Online Library (wileyonlinelibrary.com), and in Volume 23, pp. 1244-1251, has been retracted by agreement between the authors, the journal Editors-in-Chief, Eric Ravussin and Donna Ryan, the Obesity Society, and Wiley Periodicals, Inc. The retraction has been agreed to because the statistical analysis was not correct given the cluster-randomized design, and the wrong degrees of freedom were used. The conclusion that the original paper drew about having demonstrated treatment efficacy was not supported in the corrected analysis. Gatto, N. M., Martinez, L. C., Spruijt-Metz, D. and Davis, J. N. LA Sprouts randomized controlled nutrition and gardening program reduces obesity and metabolic risk in Latino youth. Obesity 2015;23:1244-1251. doi: 10.1002/oby.21077. © 2015 The Obesity Society.

  8. Retraction: Characterization of cellulolytic activities of newly isolated Thelephora sowerbyi from North-Western Himalayas on different lignocellulosic substrates.

    Science.gov (United States)

    Sharma, Deepika; Goel, Gunjan; Bansal, Saurabh; Mahajan, Rishi; Sharma, B M; Chauhan, Rajinder Singh

    2016-12-01

    Characterization of cellulolytic activities of newly isolated Thelephora sowerbyi from North-Western Himalayas on different lignocellulosic substrate J. Basic Microbiol. 2015, 55, 1-11 - DOI: 10.1002/jobm.201500107 The above article from the Journal of Basic Microbiology, published online on 08 June 2015 in Wiley Online Library as Early View (http://onlinelibrary.wiley.com/doi/10.1002/jobm.201500107/pdf), has been retracted by agreement between the authors, the Editor-in-Chief and Wiley-VCH GmbH & Co. KGaA. The retraction has been agreed because the microorganism studied in the described experiments has been identified as the fungus Cotylidia pannosa (Gene Accession No. KT008117) instead of Thelephora sowerbyi. The culture has been identified on the basis of the sequence of the amplified ITS region of the microorganism which was submitted by the authors to the NCBI database. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Retracted: Modern Concepts for Caries Tissue Removal.

    Science.gov (United States)

    Schwendicke, Falk

    2016-02-15

    "Modern Concepts for Caries Tissue Removal", by Falk Schwendicke The above article, published online on 15 February 2016 in Wiley Online Library (http://onlinelibrary.wiley.com/doi/10.llll/jerd.12201), has been retracted by agreement between the author, Dr. Falk Schwendicke, the journal Editor-in-Chief, Dr. Harald O. Heymann, Associate Editor, Dr. Edward Swift and Wiley Periodicals, Inc. The retraction has been agreed as the article was published in advance of other companion work which should have had precedence. The article pages have been replaced by the Retraction Statement and the article condensed accordingly. Schwendicke, F. Swift, EJ. Modern concepts for caries tissue removal. Dent J Esthet Rest 2016; 28:1; DOI: 10.1111/jerd.12201. © 2016 Wiley Periodicals, Inc.

  10. Retraction statement: Modern Concepts for Caries Tissue Removal.

    Science.gov (United States)

    2016-01-01

    "Modern Concepts for Caries Tissue Removal", by Falk Schwendicke The above article, published online on 15 February 2016 in Wiley Online Library (http://onlinelibrary.wiley.com/doi/10.llll/jerd.12201), has been retracted by agreement between the author, Dr. Falk Schwendicke, the journal Editor-in-Chief, Dr. Harald O. Heymann, Associate Editor, Dr. Edward Swift and Wiley Periodicals, Inc. The retraction has been agreed as the article was published in advance of other companion work which should have had precedence. The article pages have been replaced by the Retraction Statement and the article condensed accordingly. Schwendicke, F. Swift, EJ. Modern concepts for caries tissue removal. Dent J Esthet Rest 2016; 28:1; DOI: 10.1111/jerd.12201. © 2016 Wiley Periodicals, Inc.

  11. Retracted: Worst Pattern Of Invasion and occult cervical metastases for oral squamous carcinoma.

    Science.gov (United States)

    Velosa, Claudia; Shi, Qiuying; Stevens, Todd M; Chiosea, Simion I; Purgina, Bibiana; Carroll, William; Rosenthal, Eben; Morlandt, Anthony; Loree, Thom; Brandwein-Weber, Margaret S

    2017-03-28

    The above article, published online in Wiley Online Library as the Version of Record on March 28, 2017 (doi 10.1002/hed.24754), has been retracted by agreement between the Editor-in-Chief, Ehab Y. Hanna, and Wiley Periodicals, Inc. The retraction has been agreed owing to a dispute as to authorship and inclusion of some data in the analysis. Velosa, C., Shi, Q., Stevens, T. M., Chiosea, S. I., Purgina, B., Carroll, W., Rosenthal, E., Morlandt, A., Loree, T. and Brandwein-Weber, M. S. (2017), Worst pattern of invasion and occult cervical metastases for oral squamous carcinoma. Head Neck. doi:10.1002/hed.24754. © 2017 Wiley Periodicals, Inc.

  12. The degree of extramural spread of T3 rectal cancer: a plea to the UICC and AJCC.

    Science.gov (United States)

    Zinicola, R; Pedrazzi, G; Haboubi, N; Nicholls, R J

    2017-03-01

    The above article, published online on 15 July 2016 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor-in-Chief, Neil Mortensen, and John Wiley & Sons Limited. After acceptance the authors were made aware of a contribution to a prior publication of the UICC, TNM Supplement: A commentary on uniform use, 4th Edition, ed. C. Wittekind (Wiley, 2012), p. 195, which renders the central argument of their article invalid. They have therefore asked for it to be withdrawn. A modified version of the paper was published in the January 2017 issue (volume 19; issue 1) with the title "The degree of extramural spread of T3 rectal cancer: an appeal to the American Joint Committee on Cancer". Colorectal Disease © 2016 The Association of Coloproctology of Great Britain and Ireland.

  13. Retracted: 'Ergothioneine represses inflammation and dysfunction in human endothelial cells exposed to oxidized low-density lipoprotein' by Lunna Saing, Yu-Chi Wei and Chih-Jen Tseng.

    Science.gov (United States)

    2016-07-01

    The above article from Clinical and Experimental Pharmacology and Physiology, published as an Accepted Article online on 10 February 2015 in Wiley Online Library (http://wileyonlinelibrary.com), has been retracted by agreement between the authors, the Journal Editor-in-Chief, Jun-Ping Liu, and John Wiley & Sons Australia, Ltd. The retraction has been agreed as the article was submitted without agreement of all co-authors. Saing L, Wei Y-C, Tseng C-J. Ergothioneine represses inflammation and dysfunction in human endothelial cells exposed to oxidized low-density lipoprotein. Clin Exp Pharmacol Physiol 2015; DOI: 10.1111/1440-1681.12374. © 2016 John Wiley & Sons Australia, Ltd.

  14. Retracted: Differential expression of microRNAs in myometrium and leiomyomas and regulation by ovarian steroids.

    Science.gov (United States)

    2015-10-01

    The above article, published online on 20 December 2007 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Professor L Popescu and John Wiley and Sons Ltd. The retraction has been requested by the University of Florida, Office of Research, in response to their investigation which concluded fabrication of data in Figures 2, 3 and 4. Reference Pan Q, Luo X, Chegini N. Retracted: differential expression of microRNAs in myometrium and leiomyomas and regulation by ovarian steroids. J Cell Mol Med 12: 227-240. Doi: 10.1111/j.1582-4934.2007.00207.x. Copyright © 2015 Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  15. Biochemia Medica has started using the CrossCheck plagiarism detection software powered by iThenticate

    Science.gov (United States)

    Šupak-Smolčić, Vesna; Šimundić, Ana-Maria

    2013-01-01

    In February 2013, Biochemia Medica has joined CrossRef, which enabled us to implement CrossCheck plagiarism detection service. Therefore, all manuscript submitted to Biochemia Medica are now first assigned to Research integrity editor (RIE), before sending the manuscript for peer-review. RIE submits the text to CrossCheck analysis and is responsible for reviewing the results of the text similarity analysis. Based on the CrossCheck analysis results, RIE subsequently provides a recommendation to the Editor-in-chief (EIC) on whether the manuscript should be forwarded to peer-review, corrected for suspected parts prior to peer-review or immediately rejected. Final decision on the manuscript is, however, with the EIC. We hope that our new policy and manuscript processing algorithm will help us to further increase the overall quality of our Journal. PMID:23894858

  16. Design for Restoration: beyond the survey

    Directory of Open Access Journals (Sweden)

    Giovanni Carbonara

    2015-01-01

    Full Text Available  This new issue, that we can define special, marks an important change for DISEGNARECON (its transfer from the University of Bologna to the University of L’Aquila facing the topic of the Design for the Restoration in a way that is special too. Treated in fact - beside the outgoing editor in chief, Roberto Mingucci - by Mario Centofanti, who now assumes the responsibility for the magazine, and Giovanni Carbonara, which is definitely authoritative reference in the field. Sharing a strong interest for communicating the Restoration Project, they intended to indicate the substantial union of methods and objectives between the disciplines of architectural survey and of restoration, which makes the meaning of an aggregation now also institutionally formalized and particularly significant for the project on the existing architecture. 

  17. Reality Construction of News Release on Local Television

    Directory of Open Access Journals (Sweden)

    Noneng Sumiaty

    2015-07-01

    Full Text Available The research generally aims to know the reality of journalists and television media in local television news. This is a descriptive study through a qualitative approach. Techniques of data collection are done through observation, in-depth interviews with key informants (key person, which is leading people in the editorial, the coordinator of the coverage, presenter of news, finance and human resource development and master of ceremony room ATV Sukabumi. The survey results revealed that to serve a local television news  required reporting from journalists. Before the news broadcast gets edit of journalists, the coordinator of the coverage and the editor in chief as the elaboration of filtering journalist and chief editor of coverage as the owner of a local television media. So that, a local television news broadcast can not avoid the subjective element of the journalists and media owners who are part of the construction.

  18. From the Guest Editor: Caring Democracy

    Directory of Open Access Journals (Sweden)

    Riane Eisler

    2017-03-01

    Full Text Available The Interdisciplinary Journal of Partnership Studies was launched in the fall of 2014, and as Editor in Chief, I am happy to report that since our launch we have had more than 10,000 downloads of articles by readers all over the world. I also want to take this opportunity to welcome our new Managing Editor, Heidi Bruce, and to thank her for being part of the wonderful team producing this journal, which, among others, includes Liz Fine Weinfurter, Marty Lewis-Hunstiger, Teddie Potter, Peg Lonnquist, and Virajita Singh of the University of Minnesota. I am honored to be the Guest Editor for our first themed issue on Caring Democracy, a subject that is especially timely at this historic juncture, and to have so many distinguished contributors to it. Here is a brief outline of its contents.

  19. Daniel Landis: Award for Distinguished Contributions to the International Advancement of Psychology.

    Science.gov (United States)

    2012-11-01

    Presents a short biography of one of the co-recipients of the American Psychological Association's Award for Distinguished Contributions to the International Advancement of Psychology. One of the 2012 winners is Daniel Landis for his unparalleled contribution to the field of intercultural research in a distinguished academic career spanning almost half a century. Landis has shaped the field of intercultural research through scholarship of the highest order, reflected in his publications on cross-cultural training and research, the measurement of equal opportunity climate, individual-differences research and methodology, evaluation of social programs, development of theory in social psychology, and cross-cultural aspects of human sexuality. He is the founding editor-in-chief of the International Journal of Intercultural Relations and has edited three editions of the Handbook of Intercultural Training (1983, 1996, 2004). Landis' Award citation and a selected bibliography are also presented. PsycINFO Database Record (c) 2012 APA, all rights reserved.

  20. PUBLISHER'S ANNOUNCEMENT: Editorial developments Editorial developments

    Science.gov (United States)

    2010-01-01

    I am delighted to inform you that from January 2010 Professor Alfred K Louis of the University of Saarland, Germany, will be the new Editor-in-Chief of Inverse Problems. Alfred joins us with a wealth of experience and a great deal of respect from the community. He has served the journal in a number of ways as an Editorial Board member, outstanding reviewer and author. We very much look forward to working with him to continue to publish the highest quality articles in the field and build on our extremely successful special section and topical review programmes. Whilst welcoming Alfred to the position, we are also keen to thank our outgoing Editor-in-Chief, Professor Bill Symes, for the fabulous job that he has done over the past five years. Under Bill's direction, Inverse Problems has gone from strength to strength. In fact, in the last year we have taken the step of moving from six to 12 issues a year, reflecting the increased number of high-quality papers submitted to the journal. During the last five years we have published a wide range of fantastic special sections and topical reviews, including a celebration of the journal's 25th year (issue 12 2009), in which Bill played a pivotal role. We are very much looking forward to 2010 and will be celebrating our 25th birthday further with a selection of highlighted articles chosen from the past 25 years. We hope that you will continue to enjoy reading the journal. If you have any feedback, comments or questions, please do not hesitate to contact us at ip@iop.org. Zoë Crossman Publisher

  1. RETRACTED: Rift-related active fault-system and a direction of maximum horizontal stress in the Cairo-Suez district, northeastern Egypt: A new approach from EMR-Technique and Cerescope data

    Science.gov (United States)

    Hagag, Wael; Obermeyer, Hennes

    2016-09-01

    This article has been retracted: please see Elsevier Policy on Article Withdrawal (https://www.elsevier.com/about/our-business/policies/article-withdrawal). This article has been retracted at the request of Editor-in-Chief Read Mapeo in agreement with Editor-in-Chief Damien Delvaux. The authors have plagiarized part of the following papers. The introduction and methodology sections of the paper are similar and in places slightly modified versions of the abstract, introduction and sections 2.4.2.1 and 2.4.2.2 of the PhD Thesis of Michael Krumbholz (2010) https://ediss.uni-goettingen.de/handle/11858/00-1735-0000-0006-B2EB-A. Text from the sections of introduction, methodology and "EMR-measurements in the Cairo-Suez district" is found also in the paper "Detection of active faults using EMR-Technique and Cerescope at Landau area in central Upper Rhine Graben, SW Germany" that was published by the authors in the Journal of Applied Geophysics 124 (2016) 117-129 http://dx.doi.org/10.1016/j.jappgeo.2015.11.019. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process.

  2. Retraction: Radenović L. Effect of 7-nitroindazole on superoxide production and MnSOD activity in the rat brain following kainate-induced neurotoxicity. Arch biol sci, 2008, 60(1:25-32. DOI: 10.2298/ABS0801025R

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Effect of 7-nitroindazole on superoxide production and MnSOD activity in the rat brain following kainate-induced neurotoxicity, published in the Archives of Biological Sciences in 2008, Vol. 60, Issue 1. The Editor-in-Chief has been informed that this paper plagiarizes an earlier paper: Radenovic L, Selakovic V, Kartelija G, Todorovic N, Nedeljkovic M. Differential effects of NMDA and AMPA/kainate receptor antagonists on superoxide production and MnSOD activity in rat brain following intrahippocampal injection. Brain Res Bull, 2004, 64(1:85-93. The results in the article being retracted were presented as findings obtained from novel research. Inspection of the results has revealed that they were part of research already presented in the original article without appropriate justification or cross-referencing. The Editor-in-Chief considered publishing a notice of redundancy specifying the elements published previously. However, since the original article had already been autoplagiarized by the same corresponding author in the same journal (retraction DOI:10.2298/ABS150318026E, the article is being retracted in accordance with the publishing ethics of the Archives of Biological Sciences in order to preserve the integrity of scientific research. We apologize to the journal's readers that it took so long to notice this error and instigate retraction of the paper. We request our readers to contact the editorial office and editors of the journal directly should similar cases occur in the future, so that the necessary action can be taken more promptly. Link to the retracted article 10.2298/ABS0801025R

  3. GSE moves to a new system of submission

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Abstract Since October 10, 2005 the management of manuscripts submitted to GSE has moved to a new electronic system: Management Manuscript System or MMS. This system offers different services, which facilitate submission of manuscripts and contribute to their efficient and rapid processing. It is accessible at: http://www.edpsciences.org/gse. With this system, we expect to process your manuscripts quickly and efficiently. In the editorial board, two new scientific editors: Hélène Hayes (INRA, Jouy-en-Josas, France and Philippe Baret (Université catholique de Louvain, Belgium have taken over from Francis Minvielle, after six years of active and successful participation as Scientific Editor. H. Hayes will address manuscripts in molecular biology, while P. Baret will deal with those in quantitative genetics. Didier Boichard (INRA, Jouy-en-Josas, France will act as Editor-in-Chief. The journal thanks Michel Georges for his continuous help, as former Editor-in-Chief, to improve the quality and the international audience of GSE. For the fourth consecutive year, the impact factor of GSE is in progression (1.65 in 2004. Most of the articles published in GSE have focused on original research in quantitative and molecular genetics of farm and experimental animals, as well as related species. Since the number of submissions has markedly increased over the last two years, GSE has slightly modified its scope by restricting it to domesticated and experimental species and leaving articles on wild species to more specialised journals. The expected outcome is that GSE will specialize on papers with a strong methodological dimension to help understand, maintain and exploit animal genetic variability.

  4. Under-representation of women on dental journal editorial boards.

    Science.gov (United States)

    Ioannidou, Effie; Rosania, Amy

    2015-01-01

    Each journal's editorial and advisory board plays a critical role in resolving gender bias in the peer-review and publication process. Thus, this study aimed to quantify women's participation in editorial and advisory boards of major dental journals. Gender data on editorial and advisory boards were extracted from major dental journals, which were then categorized by journal specialty focus. The gender of the editor-in-chief and associate editor-in-chief was noted to assess the effect of journal leadership on women's participation in journal boards. For comparison purposes, data were also obtained regarding the percentage of women faculty for each dental specialty. Overall, in the major 69 dental journals, 14.8% of editorial board members were women. An one-way ANOVA analysis revealed statistically significant gender differences between journal specialty categories (p = 0.003) with some dental specialties' journals demonstrating a relatively high participation of women as editorial board members. There was a significant positive correlation for various dental specialties between women's representation in editorial and advisory boards and women in similar dental academic specialties (p = 0.02, r2 = 0.55). Furthermore, there was a positive correlation between the presence of women in journal editorial leadership and the percentage of women serving as advisory board members (p = 0.03). Our results confirmed that the under-representation of women on dental journal editorial boards was significantly different between dental science specialties. When there were more women in journal editorial leadership positions, there was a higher participation of women as editorial and advisory board members. Journals should increase the numbers of women on editorial boards in order to secure diversity, improve publication quality and recognize women's contribution to dental science.

  5. Editorial

    Science.gov (United States)

    2007-11-01

    This is my last issue of Plasma Sources Science and Technology in my role as Editor-in-Chief. I would like to take this opportunity to describe the origins of what has been for me a 17-year adventure. Maureen Clarke, then responsible for commissioning new journals at IOP, first conceived of a journal devoted to low-temperature plasmas. She contacted me, and, I imagine, others in the plasma community, with a set of questions about this possible new journal. Although I've lost that letter, I still have a copy of my e-mail response to her from 2 July 1990, from which the following extracts are taken: Dear Ms. Clarke, Thank you for an opportunity to comment on your new journal—Plasma Sources and Plasma Processing. I believe that there is a currently a place for a journal which is concerned with plasma source design and characteristics related to plasma processing and that this need is likely to continue for at least 10 years or more. [ . . . ] Right now there is considerable interest in the plasma processing community on the relative advantages of ECR and other microwave sources versus 13 MHz systems and a variety of different types of both sources have been invented and more seem to be coming along each day. Helicon sources are also starting to be interesting. [ . . . ] My view is that plasma processing includes all aspects of processes which employ charged particle plasmas in manufacturing processes. This runs from ion implantation out of very low pressure (Science and Technology (PSST), and chose the original cover design (shown here). coverPSST I agreed to be Editor-in-Chief of PSST on the condition that I be responsible for choosing the referees. This differed from the policy of most other IOP journals, for which IOP staff made those decisions. I believed, and still believe, that the best way to build the journal and maintain its quality is to choose the best authorities in the field to be referees. This served to familiarize these scientists with PSST

  6. Editorial

    Science.gov (United States)

    Maret, Georg; Reiter, Günter

    2005-01-01

    The European Physical Journal E Soft Matter (EPJE Soft Matter), launched on January 1, 2000, is now entering into its sixth year of existence. Despite the problems any new journal has to deal with, we see that EPJE Soft Matter is a success journal which achieved the goal to generate and strengthen links between physicists, chemists, engineers and also biologists interested in “Soft Matter". Why is EPJE Soft Matter needed and what is special with EPJE Soft Matter? Right from the start, EPJE Soft Matter aimed at providing a meeting place for the various communities involved in the rapidly growing field of “Soft Condensed Matter" science; a “melting pot" for ideas coming from physics, chemistry, materials science and also from biology. Besides regular publications the journal provides also a forum for discussion of controversial ideas (Perspectives, Commentaries, Focus Points, ...). The basic idea of publishing discussions is to draw the attention of all communities involved in “Soft Matter" science to fundamental current problems of common interest. The central philosophy of EPJE Soft Matter is thus to stimulate discussion amongst the community and to become a key tool for advancing soft matter science. EPJE Soft Matter is a journal made by scientists for scientists. Along these lines, the Editors-in-Chief welcome suggestions from colleagues for new concepts and novel ways of publishing scientific information and original results. How is EPJE Soft Matter performing? Being aware of the risk of addressing, in parallel, separate communities without sufficient mutual interaction, particular attention is paid to attracting contributions from traditionally linked fields like chemistry and physics in the case of polymers at interfaces. It appears that such a mix is well appreciated by the community as the impact factor of the journal is steadily growing (from 1.61 in 2001 to 2.45 in 2003). While publications from physics-related areas of Soft Matter are well

  7. Announcement: New Editor-In Robert C. Kennicutt

    Science.gov (United States)

    Abt, Helmut A.

    1999-06-01

    Effective 1999 July 1, all new manuscripts for Part 1 of The Astrophysical Journal and The Astrophysical Journal Supplement Series should be sent to Dr. Robert C. Kennicutt, Editor-in-Chief The Astrophysical Journal Steward Observatory University of Arizona Tucson, AZ 85721-0065 The other means of contact are telephone, (520) 621-5145 FAX, (520) 621-5153 and e-mail, apj@as.arizona.edu. For express packages please use the street address of 933 North Cherry Avenue. Dr. Kennicutt will be assisted by several of my loyal coworkers, who will move across the street. Manuscripts received before July 1 will be handled by the current editor until most of their problems have been resolved, at which point the remainder will be sent to Dr. Kennicutt's office. Manuscripts for the Letters should, as before, be sent directly to Dr. Alex Dalgarno at the Center for Astrophysics in Cambridge, MA. We are fortunate that a person with as much experience in research and proven good judgment as Dr. Kennicutt is willing to accept this difficult and time-consuming responsibility. He will be only the seventh Managing Editor or Editor-in-Chief that this Journal has had in its 104 years. Please give him the cooperation and help that you have given the current editor. It has been my privilege to work for 28 years with many of the best astrophysicists in the world and to publish their papers. This was done with the help of the AAS Publications Board and AAS officers, the efforts of Peter Boyce and Evan Owens who made the on-line edition of the Journal possible, three Associate Editors, a score of Scientific Editors, a hardworking staff of six in Tucson, up to 25 production controllers and manuscript editors at the University of Chicago Press, and the thousands of astronomers throughout the world who served as referees. The original masthead called this journal ``An International Review of Spectroscopy and Astronomical Physics.'' That subtitle is no longer appropriate because we do not publish

  8. Starting a New Chapter

    Directory of Open Access Journals (Sweden)

    Loza-Murguia Manuel G.

    2011-08-01

    Full Text Available In this new stage we want to improve the magazine to make it useful for readers, on the one hand we intend to maintain their accreditation project of the contents of the magazine and on the other hand, the boost in indexing websites popularity, who raise the visibility and therefore coverage to authors and readers who have honored us with their support and we receive frequent visits. Obviously all the works received will remain subject to internal assessment and peer review as usual. Your acceptance will be based on significance, originality and validity of the material presented. The journal is indexed by the time DIALNET. The half-yearly, from 2012 we intend to be a leader in information that is intended to finding solutions to the problems latent, on the other side seeks to raise awareness among professionals and researchers that the publication is a prerequisite to in order to will be clear what is being done as has research in the region. The Journal of the Selva Andina Research Society is a journal founded no more than two years, having failed to publish any number of this enormous amount of material in all this time. We are currently under evaluation by the SciELO Project, Bolivia and have the confidence to be meeting all the criteria that are required to be visible on the website of international prestige. We want to be a reference publication in the journal Public areas both in the international literature (particularly in Latin America and in Bolivia. As Director and Editor in Chief continued in front of it, I thank the Board of the Supreme Council on Science and Biotechnology Research Society Selva Andina renewed confidence in me during these early years, all the items they want be published should be sent to infoselvandina@gmail.com or boliviamanloza@yahoo.com. Following the usual guidelines and rules are expressed in the publication. There is an Editorial Board comprised of leading national and international professional experts who

  9. Retraction.

    Science.gov (United States)

    2016-12-01

    This article corrects: Retracted: Three BUB1 and BUBR1/MAD3-related spindle assembly checkpoint proteins are required for accurate mitosis in Arabidopsis. New Phytologist 205: 202-215. Article first published online: 29 September 2014. This article has been retracted at the request of: Editor-in-Chief and Author 'Three BUB1 and BUBR1/MAD3-related spindle assembly checkpoint proteins are required for accurate mitosis in Arabidopsis', by Paganelli L, Caillaud M-C, Quentin M, Damiani I, Govetto B, Lecomte P, Karpov, PA, Abad P, Chabouté M-E and Favery B. The above article, first published online on Wiley Online Library (wileyonlinelibrary.com), and in New Phytologist 205: 202-215, has been retracted by agreement between the authors, the journal Editor-in-Chief, Alistair Hetherington, and John Wiley & Sons Ltd. Since publication of the above article, it has been brought to our attention that errors occurred in the construction of Figs 1 and 2(a); some components were inappropriately edited and duplicated, including the duplication and editing of images that first appeared in Caillaud et al. (2009), which were used by the authors as a basic template. Consequently, the integrity of the yeast two-hybrid experiments reported in the article is undermined, and, with agreement of all parties, the decision has been made to retract this article. We apologize for any inconvenience the publication of this work may have caused our readers. References Caillaud MC, Paganelli L, Lecomte P, Deslandes L, Quentin M, Pecrix Y, Le Bris M, Marfaing N, Abad P, Favery B. 2009. Spindle assembly checkpoint protein dynamics reveal conserved and unsuspected roles in plant cell division. PLoS One 4: e6757. Paganelli L, Caillaud M-C, Quentin M, Damiani I, Govetto B, Lecomte P, Karpov PA, Abad P, Chabouté M-E, Favery B. 2015. Three BUB1 and BUBR1/MAD3-related spindle assembly checkpoint proteins are required for accurate mitosis in Arabidopsis. New Phytologist 205: 202-215. © 2016 The Authors

  10. Involvement of NF-κB and HSP70 signaling pathways in the apoptosis of MDA-MB-231 cells induced by a prenylated xanthone compound, α-mangostin, from Cratoxylum arborescens [Retraction

    Directory of Open Access Journals (Sweden)

    Ibrahim MY

    2017-05-01

    Full Text Available Ibrahim MY, Hashim NM, Mohan S, et al. Involvement of NF-κB and HSP70 signaling pathways in the apoptosis of MDA-MB-231 cells induced by a prenylated xanthone compound, α-mangostin, from Cratoxylum arborescens. Drug Design, Development and Therapy. 2014;8:2193–2211 was published subsequent to Ibrahim MY, Hashim NM, Mohan S, et al. α-Mangostin from Cratoxylum arborescens demonstrates apoptogenesis in MCF-7 with regulation of NF-κB and Hsp70 protein modulation in vitro, and tumor reduction in vivo. Drug Design, Development and Therapy. 2014;8:1629–1647.When comparing the papers it becomes apparent that they have an unacceptably high degree of similarity and re-use. Further, there is no clear scientific distinction between the cell lines and the results in both. Accordingly, the Editor-in-Chief and Publisher have issued this Notice of Retraction.This retraction relates to this paperThis retraction relates to this Corrigendum

  11. Characterization of Materials, 2 Volume Set

    Science.gov (United States)

    Kaufmann, Elton N.

    2003-01-01

    Characterization of Materials (formerly Methods in Materials Research) provides comprehensive up-to-date coverage of materials characterization techniques including computational and theoretical methods as well as crystallography, mechanical testing, thermal analysis, optical imaging and spectroscopy, and more. Editor-in-Chief, Elton Kaufmann, Ph.D. is Associate Director of the Strategic Planning Group at the Argonne National Laboratory and has published approximately 100 technical papers in refereed journals and books. Dr. Kaufmann has assembled leading experts from academia, government, and industry to provide: A comprehensive up-to-date collection of methods used in the characterization of materials Articles on various methods from standard to cutting edge Periodic online updates to keep pace with latest developments A user-friendly format that is easy and simple to search and navigate Characterization of Materials is a collection of characterization methods that is widely applicable in the wide and diverse field of materials research irrespective of discipline or ultimate application and with which researchers, engineers, and educators must have familiarity. Methods covered include: General Vacuum Techniques X-Ray Powder Diffraction High Strain Rate Testing Deep Level Transient Spectroscopy Cyclic Voltammetry Extended X-Ray Absorption Fine Structure Low Energy Electron Diffraction Thermogravimetric Analysis Magnetometry Transmission Electron Microscopy Ultraviolet Photoelectron Spectroscopy This reference work is also available as a convenient online edition. For information regarding the online edition, please visit: www.mrw.interscience.wiley.com/com

  12. Peer-review process in journals dealing with chemistry and related subjects published in Serbia

    Directory of Open Access Journals (Sweden)

    Dekanski Aleksandar

    2016-01-01

    Full Text Available A survey was conducted among editors of journals publishing in the field of chemistry, chemical technology and related topics in Serbia, aiming to collect information on their experience, problems and difficulties during peer-review process. Editors from 22 journals out of 27 which regularly published during 2015 replied. General data on journals were collected from responses obtained from editors-in-chief, whereas all editors (including sub-editors and section editors participated in a questionnaire concerning peer-review procedure. Additionally, they were asked to evaluate quality of reports and attitude of reviewers, discuss present situation and suggest measures to improve peer-review process. Greatest problems encountered by editors in peer-review process can be summarized as follows: low rate of acceptance to review, low quality of reports, sometimes due to reviewer’s bias or his/her inability to properly understand review process. A method used to search for reviewers does not substantially influence quality of reports. Editors agree that introduction of On-Line process and creation of precise instructions for reviewers, education of potential reviewers, as well as social, public and professional recognition and appreciation of reviewers’ work, are the most important measures to improve quality of peer-review process and, consecutively, quality of published articles and journals.

  13. Appropriate Roles for the Subscriber, Publisher, Editor, Author, and Reviewer in the Archives of Plastic Surgery

    Directory of Open Access Journals (Sweden)

    Kun Hwang

    2013-11-01

    Full Text Available Authors, editors and reviewers, publishers, and subscribers all play their role in scientific journals. These 5 stakeholders are essential to journals. In this paper, firstly, I briefly summarize the role of each journal stakeholder and their respective goals. Secondly, the status of each participant in the Archives of Plastic Surgery is described. Finally, I propose an appropriate role and plan for each of them. Specific roles and responsibilities include the following: subscribers should welcome and submit the critiques of published papers in letters to the editor. Publishers should trust editors and provide them with adequate financial support for ongoing quality improvement of the journal. The editor-in-chief should be given a sufficient period of time-several years-to build up journal quality and train the incoming editor. The editors, including section editors, are also responsible for increasing the author pool. One editor might be designated a 'devil's referee', that is, a kind of devil's advocate with the responsibility of examining the originality of the manuscript, taking a skeptical view of the manuscript, and looking for holes in the methods and results of reported experiments. Authors' responsibilities include submitting manuscripts with scientific integrity and being ready to take responsibility for their articles even long after publication. Finally, reviewers' responsibilities include identifying similar articles not cited. Reviewers are also welcome to write a discussion on the article they review.

  14. Science journal editors' views on publication ethics: results of an international survey.

    Science.gov (United States)

    Wager, E; Fiack, S; Graf, C; Robinson, A; Rowlands, I

    2009-06-01

    Breaches of publication ethics such as plagiarism, data fabrication and redundant publication are recognised as forms of research misconduct that can undermine the scientific literature. We surveyed journal editors to determine their views about a range of publication ethics issues. Questionnaire sent to 524 editors-in-chief of Wiley-Blackwell science journals asking about the severity and frequency of 16 ethical issues at their journals, their confidence in handling such issues, and their awareness and use of guidelines. Responses were obtained from 231 editors (44%), of whom 48% edited healthcare journals. The general level of concern about the 16 issues was low, with mean severity scores of 20% of the editors stated that 12 of the 16 items never occurred at their journal. However, 13%-47% did not know the frequency of the problems. Awareness and use of guidelines was generally low. Most editors were unaware of all except other journals' instructions. Most editors of science journals seem not very concerned about publication ethics and believe that misconduct occurs only rarely in their journals. Many editors are unfamiliar with available guidelines but would welcome more guidance or training.

  15. RETRACTION: Heritage Management Of Temple Tanks In An Urban Scenario: A Case Study Of Thirupporur, a Traditional Town In the State of Tamilnadu, India, by Kubilay Kaptan

    Directory of Open Access Journals (Sweden)

    Kubilay Kaptan

    2017-07-01

    Full Text Available The Editor-in-Chief retracts this paper in accordance with recommendations of the Committee on Publication Ethics – COPE, after finding evidence of plagiarism. The retraction note is applicable to the following article: “Heritage management of temple tanks in an urban scenario - a case study of Thirupporur, a traditional town in the state of Tamilnadu, India”, https://doi.org/10.6092/issn.1973-9494/4188 published online and in the print version of the Journal Conservation Science in Cultural Heritage, N.13 – 2013. The article plagiarized is the following: R. Vedamuthu and D. Jayanthi, “Heritage Management of Temple Tanks in an Urban Scenario - A Case Study of Thirupporur, a Traditional Town in the State of Tamilnadu, India” in “Studies on Historical Heritage” in the Proceedings of the International Symposium, Antalya, Turkey, September 17-21, 2007 http://www.tamir.yildiz.edu.tr/images/images/SHH07-2%20Ch3,%204.pdf.pdfReaders are strongly encouraged to refer to this article instead of the retracted item. We apologize to readers and to the authors of the previously published paper for this very serious oversight.

  16. Editors’ Perspectives on Enhancing Manuscript Quality and Editorial Decisions Through Peer Review and Reviewer Development

    Science.gov (United States)

    Janke, Kristin K.; Traynor, Andrew P.

    2017-01-01

    Objectives. To identify peer reviewer and peer review characteristics that enhance manuscript quality and editorial decisions, and to identify valuable elements of peer reviewer training programs. Methods. A three-school, 15-year review of pharmacy practice and pharmacy administration faculty’s publications was conducted to identify high-publication volume journals for inclusion. Editors-in-chief identified all editors managing manuscripts for participation. A three-round modified Delphi process was used. Rounds advanced from open-ended questions regarding actions and attributes of good reviewers to consensus-seeking and clarifying questions related to quality, importance, value, and priority. Results. Nineteen editors representing eight pharmacy journals participated. Three characteristics of reviews were rated required or helpful in enhancing manuscript quality by all respondents: includes a critical analysis of the manuscript (88% required, 12% helpful), includes feedback that contains both strengths and areas of improvement (53% required, 47% helpful), and speaks to the manuscript’s utility in the literature (41% required, 59% helpful). Hands-on experience with review activities (88%) and exposure to good and bad reviews (88%) were identified as very valuable to peer reviewer development. Conclusion. Reviewers, individuals involved in faculty development, and journals should work to assist new reviewers in defining focused areas of expertise, building knowledge in these areas, and developing critical analysis skills. PMID:28630514

  17. Essential Features for a Scholarly Journal Content Management and Peer Review Software

    Directory of Open Access Journals (Sweden)

    Fatima Sheikh Shoaie

    2010-03-01

    Full Text Available   The present study investigates the software used in scientific journals for content management and peer review, in order to identify the essential features. These softwares are analyzed and presented in tabular format. A questionnaire was prepared and submitted to a panel composed of 15 referees, editor in chief, software designers and researchers. The essential features for a software managing the review process were divided into three groups with populations of 10-15, 5-10 and 0-5 respectively. The majority of peer review process software features, in view of panelists, fell into a group of features with a population of 10-15. Finally it should be said that the features represented by the first group must be taken into account when designing or purchasing a peer review software. The second tier features (with population of 5-10 are recommended given journal's status and capabilities. The third tier features were altogether discounted due to low population

  18. Formation of soot from polycyclic aromatic hydrocarbons as well as fullerenes and carbon nanotubes in the combustion of hydrocarbon

    Science.gov (United States)

    Mansurov, Z. A.

    2011-01-01

    The eightieth anniversary of Academician, Lenin Prize Winner Rem Ivanovich Soloukhin is an important event for the scientific association of investigators of combustion and detonation processes. R. I. Soloukhin has developed original gasdynamic laser systems based on the selective thermal excitation and mixing in a supersonic flow: efficient high-power gas-flow lasers of convective type with electric excitation and chemical lasers initiated by an electron beam. He proposed methods of measuring the rapidly changing pressure, density, temperature, and other parameters of processes occurring in shock waves. Deputy Editor-in-Chief of the Journal "Fizika Goreniya Vzryva," Professor at Novosibirsk University R. I. Soloukhin trained a Pleiad of Doctors and Candidates of Sciences. His fundamental investigations form the basis for the development of new directions in the physics of combustion and explosion. In the present article, recent works on soot formation in the combustion of hydrocarbons are reviewed. The phenomenology, kinetics, and mechanism of soot formation, the influence of different factors on the formation of polycyclic aromatic hydrocarbons, fullerenes, carbon nanotubes, and soot, low-temperature cold-flame soot formation, the combustion in an electric field, and the paramagnetism of soot particles were considered from the environmental standpoint.

  19. Self-monitoring of blood glucose in noninsulin-using type 2 diabetic patients: right answer, but wrong question: self-monitoring of blood glucose can be clinically valuable for noninsulin users.

    Science.gov (United States)

    Polonsky, William H; Fisher, Lawrence

    2013-01-01

    Given the importance of glycemic control in the development of diabetes complications, the plethora of tools now available to monitor the day-to-day trends in glycemia is remarkable. In this regard, self-monitoring of blood glucose (SMBG) has been considered a key component of patient management. Arguably, there remains almost universal agreement that SMBG should be available to all diabetic patients regardless of current treatment strategy. However, recently there have been reports that have challenged the current paradigm that all patients should use SMBG and concluded that SMBG for type 2 diabetic patients not on insulin may not be beneficial on glycemic control and must be weighed against the expense and inconvenience. In the counterpoint narrative following the contribution by Malanda et al., Drs. Polonsky and Fisher provide a compelling argument suggesting that while it is evident that implementing SMBG in unstructured ways without training patients and clinicians is likely to be a waste of resources, there are effective and powerful ways to use structured SMBG in insulin-naïve type 2 diabetic patients. -William T. Cefalu, MD Editor in Chief, Diabetes Care.

  20. Self-monitoring of blood glucose in noninsulin-using type 2 diabetic patients: it is time to face the evidence.

    Science.gov (United States)

    Malanda, Uriëll L; Bot, Sandra D; Nijpels, G

    2013-01-01

    Given the importance of glycemic control in the development of diabetes complications, the plethora of tools now available to monitor the day-to-day trends in glycemia is remarkable. In this regard, self-monitoring of blood glucose (SMBG) has been considered a key component of patient management. Arguably, there remains almost universal agreement that SMBG should be available to all diabetic patients regardless of current treatment strategy. However, recently there have been reports that have challenged the current paradigm that all patients should use SMBG and concluded that SMBG for type 2 diabetic patients not on insulin may not be beneficial on glycemic control and must be weighed against the expense and inconvenience. In this two-part point-counterpoint narrative, Malanda et al. and Polonsky and Fisher take opposing views on the utility of SMBG to be valuable for individuals with type 2 diabetes not using insulin. In the narrative below, Malanda et al. suggest that the evidence for potentially beneficial SMBG-induced effects on glycemic control, hypoglycemic periods, and potential harms in type 2 diabetic patients who are not treated with insulin does not justify the use of SMBG. Moreover, the use of SMBG is associated with huge costs, which should be better redirected to effective strategies to improve health for this category of patients. -William T. Cefalu, MD Editor in Chief, Diabetes Care.

  1. Interview with Daan Frenkel, Boltzmann Medallist 2016 : Simulating soft matter through the lens of statistical mechanics.

    Science.gov (United States)

    Frenkel, Daan; Louët, Sabine

    2016-06-01

    Daan Frenkel has been awarded the most important prize in the field of statistical mechanics, the 2016 Boltzmann Medal, named after the Austrian physicist and philosopher Ludwig Boltzmann. The award recognises Frenkel's seminal contributions to the statistical-mechanical understanding of the kinetics, self-assembly and phase behaviour of soft matter. The honour recognises Frenkel's highly creative large-scale simulations of soft matter capable of explaining the self-assembly of complex macromolecular systems, colloidal and biomolecular systems. Frenkel is Professor of Theoretical Chemistry at the University of Cambridge, UK and has been Editor in Chief of EPJE between 2010 and 2014. The award will be given to both Frenkel and his French colleague Yves Pomeau, during the StatPhys Conference on 20th July 2016 in Lyon, France. In this interview with Sabine Louët, Frenkel gives his views on statistical physics, which has become more relevant than ever for interdisciplinary research. He also offers some pearls of wisdom for the next generation Statistical Mechanics experts.

  2. Retracted: Multilevel Predictors of Math Classroom Climate: A Comparison Study of Student and Teacher Perceptions.

    Science.gov (United States)

    Wang, Ming-Te; Eccles, Jacquelynne S

    2016-09-01

    The above article, published online on June 23, 2014 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor-in-Chief, Nancy Guerra, and Wiley Periodicals, Inc. The retraction has been agreed upon following the discovery that this article contained inaccurate data. It came to the author's attention that the names of some of the items reported in the Measures section of the paper could not be correct because such items did not exist in the surveys. The authors tried to identify exactly which items had been used in the data analyses but they could not establish without some doubt exactly which items had actually been used. Reference Wang, M.-T. and Eccles, J. S. (2014), Multilevel Predictors of Math Classroom Climate: A Comparison Study of Student and Teacher Perceptions. Journal of Research on Adolescence. doi: 10.1111/jora.12153. © 2014 The Authors. Journal of Research on Adolescence © 2014 Society for Research on Adolescence.

  3. Automatic program development a tribute to Robert Paige

    CERN Document Server

    Danvy, Olivier; Mairson, Harry; Pettorossi, Alberto

    2008-01-01

    This work, a tribute to renowned researcher Robert Paige, is a collection of revised papers published in his honor in the Higher-Order and Symbolic Computation Journal in 2003 and 2005.Among them there are two key papers: a retrospective view of his research lines, and a proposal for future studies in the area of the automatic program derivation.The book also includes some papers by members of the IFIP Working Group 2.1 of which Bob was an active member.All of the papers are related to the research interests of Dr Paige, who died in 1999, and, in particular, to the transformational development of programs and their algorithmic derivation from formal specifications.His colleagues, who include Olivier Danvy of the University of Aarhus in Denmark, and Alberto Pettorossi of the University of Rome 'Tor Vergata' in Italy, believe the book provides a renewed stimulus for continuing and deepening Dr Paige's research vision.Prof. Olivier Danvy is editor in chief of the Higher Order for Symbolic Computation journal.

  4. Documents: banaliteit gevierd in een modernistisch tijdschrift

    Directory of Open Access Journals (Sweden)

    Eva van den Boogaard

    2012-12-01

    Full Text Available This article studies the French avant-garde magazine Documents (1929-1931, which was founded by four French intellectuals: Jean Babelon, Georges Bataille, Pierre d'Espezel and Georges Wildenstein. Soon, Bataille became the editor in chief, whereas d'Espezel and Babelon withdrew. The magazine focused on (primitive art, philosophy and ethnography. Documents reacted to André Breton's surrealism, which Bataille and cooperatives considered too idealistic and naive. They promoted a more materialistic philosophy, called bas matérialisme. A focal point was the formlessness of reality: scientists and philosophers should not try to capture the world in rational and static texts. Documents turned against intellectualism, but did so, paradoxically, in highly intellectual texts. Thus, the magazine's form and content partly contradicted each other. On the other hand, the illustrations in the magazine correspond in interesting ways to Bataille's philosophy. It is this interaction between the form and intellectual content of the magazine that is the focus of this article.

  5. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  6. Editorial Note

    Science.gov (United States)

    van der Meer, F.; Ommen Kloeke, E.

    2015-07-01

    With this editorial note we would like to update you on the performance of the International Journal of Applied Earth Observation and Geoinformation (JAG) and inform you about changes that have been made to the composition of the editorial team. Our Journal publishes original papers that apply earth observation data for the management of natural resources and the environment. Environmental issues include biodiversity, land degradation, industrial pollution and natural hazards such as earthquakes, floods and landslides. As such the scope is broad and ranges from conceptual and more fundamental work on earth observation and geospatial sciences to the more problem-solving type of work. When I took over the role of Editor-in-Chief in 2012, I together with the Publisher set myself the mission to position JAG in the top-3 of the remote sensing and GIS journals. To do so we strived at attracting high quality and high impact papers to the journal and to reduce the review turnover time to make JAG a more attractive medium for publications. What has been achieved? Have we reached our ambitions? We can say that: The submissions have increased over the years with over 23% for the last 12 months. Naturally not all may lead to more papers, but at least a portion of the additional submissions should lead to a growth in journal content and quality.

  7. Quality of health news disseminated in the print media in developing countries: a case study in Iran

    Directory of Open Access Journals (Sweden)

    Ashorkhani Mahnaz

    2012-08-01

    Full Text Available Abstract Background Mass media play an important role in keeping people up-to-date with the latest health news. This study aims at investigating the quality of health news disseminated in the print media, its course of production and factors affecting its quality. Methods In the quantitative section of the study, 410 health-related news items, published during a six-month span in the Iranian public press, underwent content analysis. In the qualitative section, focus group discussions were held with journalists, editors-in-chief and news gatekeepers. Results The quantitative phase showed that 18% of the news articles were not fit for dissemination in public. The qualitative phase illustrated that multiple factors at various levels affect the quality of news, namely poor knowledge, inadequate motivations and context-related barriers. Conclusions The quality of health news reporting is not desirable. Educational interventions need to be carried out to raise awareness among researchers and journalists. Also, certain steps should be taken to increase motivations and strengthen infrastructures, including designing guidelines and monitoring news.

  8. Do you see what I see ? memoirs of a blind biker

    CERN Document Server

    Targ, Russell

    2010-01-01

    Now in paperback, the droll memoir by a world-class physicist that includes recollections of his involvement with pioneering laser research, encounters with many of the most recognizable literary, cultural, and entertainment figures of the 20th century, and his role in teaching ESP techniques to the CIA--a real-life X-Files saga. Russll Targ is a Zelig-like character. His story is an idiosyncratic journey through the highways and byways of American intellectual, scientific, and cultural life in 20th century. His father (the long-time editor-in-chief at Putnam) acquired The Godfather on the basis of an outline scribbled on the back of a napkin. His mother was the first press agent of the fan dancer Sally Rand. His step-mother is the legendary literary agent Rosalind Targ. He was married for thirty years to the sister of the infamous chess master Bobby Fischer. He briefly dated Henny Youngman's cousin. He attended college with Alan Alda's wife, Arlene. He was part of Ayn Rand's study group in the 1950s--along...

  9. Barriers of Health News Producers’ Empowerment: A Qualitative Study in Iran

    Directory of Open Access Journals (Sweden)

    Mahnaz Ashoorkhani

    2014-12-01

    Full Text Available Background: Studies show that raising news producers’ knowledge and skills are influential and necessary for promoting the quality of health news. This study aimed to investigate the barriers to implementing empowerment programs for news producers and to identify their respective solutions. Methods: In this qualitative content analysis the opinion of 14 journalists, one translator, 10 editors or editors-in-chief of health news agencies were gathered through 12 in-depth interviews and 4 focus group discussions. Purposive sampling was done and interviews continued up to the point of saturation. Data were analyzed with Open Code software. Results: The barriers to the implementation of empowerment programs were identified as: a individual factors, b deficiency of certain facilitators, and c organizational and macro policymakings. Various solutions were suggested for the barriers respectively. Conclusion: The implementation of empowerment programs for news producers requires a system approach toward its determinant factors. This will be more likely if measures at other concerned levels are also taken. Creating incentives on behalf of the news-producing organizations can also contribute to this end and create a suitable context for news producers. Training and empowerment alone will not be sufficient.

  10. Do probiotic preparations for humans really have efficacy?

    Directory of Open Access Journals (Sweden)

    Marika Mikelsaar

    2011-12-01

    Full Text Available Microbial ecology studies have provided convincing evidence for the crosstalk between members of the autochthonous microbiota and the host immune system. The tight interrelationship between microbiota and host mucosal cells are mediated by microbial metabolites that are responsible for bacterial cell-to-cell communication by quorum-sensing mechanisms and also through the activation of eukaryotic cells following secretion of host defensins and modulation of cytokine expression profiles. All these host functions can be positively influenced by probiotic bacteria of human origin. However, few requirements for evaluating these strains for use in humans have been set according to their composition and metabolic activity. In this article, we have reported the scientific data published to date on the advantages of either mono- or multispecies probiotic products based on the outcome of the most significant clinical trials. According to published clinical trials, the efficacy of probiotic intervention for infectious or antimicrobial treatment-induced diarrhea, caused by different opportunistic bacterial or viral pathogens, was 48%. The probiotic preparations’ efficacy for silencing the clinical symptoms of IBS was 75% and for attenuating the inflammatory response during IBD was 83% whereas multistrain probiotics appear to have better efficacy.This article has been commented on by Tore Midtvedt, Editor-in-Chief. Please follow this link http://www.microbecolhealthdis.net/index.php/mehd/article/view/11620 to read his Editorial Remarks

  11. Chers Lecteurs

    Directory of Open Access Journals (Sweden)

    Mergeai, G.

    2012-01-01

    Full Text Available Dear Readers. Dear Readers, After supporting us for over 30 years, the Belgian Directorate General for Development Cooperation (DGD has decided to drastically reduce its contribution towards the publication of this year's Tropicultura (2012 and will be withdrawing its support altogether from 2013. This decision is linked to the DGD's plans to restructure and increase the effectiveness of all its activities. For this reason, the DGD no longer wishes to fund future initiatives that do not represent a sufficient critical mass. Unfortunately, the Tropicultura publication falls within this category. This decision, which we greatly regret, therefore has nothing to do with the scientific quality of our magazine. In order to cope with this reduced budget, we have decided to cease publishing and sending paper copies starting from No. 30-2. We still hope to identify a solution, however, in order to continue publishing Tropicultura after 2013. The edition that you have before you is therefore the last that you will receive in the post. All subsequent editions will be accessible directly on the magazine's website via the link: http://www.tropicultura.org/content/ Of course, we will keep you informed of how the situation develops. At the same time, I would like to reassure the relevant authors that all articles submitted to the magazine will be prepared for publication. This marks the start of a chapter and we trust that the subsequent pages will not remain blank. Guy Mergeai Editor-in-chief.

  12. Dr. Tomaž Furlan (1901–1961 and his fight against tuberculosis – on the 110th anniversary of his birth

    Directory of Open Access Journals (Sweden)

    Damjana Furlan Hrabar

    2012-05-01

    Full Text Available Dr Tomaž Furlan (1901–1961, physician and tuberculosis specialist at the Golnik sanatorium, greatly influenced Slovenian and former Yugoslav treatment of tuberculosis. Before the discovery of antituberculotics, he made a significant contribution to the surgical treatment of consumption using the collapse therapy, and especially by the help of extrapleural pneumolysis. After the discovery of the antibiotic streptomycin and other antituberculotics in the early 50’s, he and his colleagues successfully introduced chemotherapy, which gradually replaced surgical treatment and in the mid-Fifties greatly reduced tuberculosis morbidity and mortality rates. In 1955, Dr Furlan opened the first ward for the treatment of non-specific lung diseases at the Golnik hospital. He with his co-workers also fought against tuberculosis in Slovenia by founding dispensaries, vaccinating against the illness, carrying out X-ray diagnostics and founding a Register of tuberculosis. He published numerous professional and popular articles on tuberculosis and was editor-in-chief of the medical journal “The Fight against Tuberculosis”. During the interwar period (1918–1941 he was a Christian socialist, participated in politics and advocated socialism with Christian ethics. He was a great patriot, committed to the health and cultural and economic development of the Slovenian nation.

  13. The social thought of Jesuits of the Galician Province between 1884 and 1918, as presented in “Przeglad Powszechny”

    Directory of Open Access Journals (Sweden)

    Stanisław Pyszka

    2017-07-01

    Full Text Available “Przeglad Powszechny” first appeared in 1884, when the Jesuits in Krakow agreed to take over “Przeglad Lwowski” from Fr. Edward Podolski, who had been its editor. At the turn of the 19th and 20th centuries, the editors-in-chief of the “Przeglad” were Marian Ignacy Morawski SJ, Jan Pawelski SJ, Jan Urban SJ and Jan Rostworowski SJ. Thanks to their efforts and extensive prior editorial experience, “Przeglad” stood for a high level of quality, and was one of the most highly valued social and cultural journals devoted to religious, philosophical, ethical, cultural, historical and political issues. The overriding aims set out by the editors of the review were the dissemination of properly Catholic principles of conduct and obedience to the Church. The article will present the social thought of the Jesuits as they appeared in “Przeglad Powszechny” from the time of its inception until the recovery of Poland’s independence.

  14. Transdisciplinary unifying implications of circadian findings in the 1950s

    Science.gov (United States)

    Halberg, Franz; Cornélissen, Germaine; Katinas, George; Syutkina, Elena V; Sothern, Robert B; Zaslavskaya, Rina; Halberg, Francine; Watanabe, Yoshihiko; Schwartzkopff, Othild; Otsuka, Kuniaki; Tarquini, Roberto; Frederico, Perfetto; Siggelova, Jarmila

    2003-01-01

    A few puzzles relating to a small fraction of my endeavors in the 1950s are summarized herein, with answers to a few questions of the Editor-in-Chief, to suggest that the rules of variability in time complement the rules of genetics as a biological variability in space. I advocate to replace truisms such as a relative constancy or homeostasis, that have served bioscience very well for very long. They were never intended, however, to lower a curtain of ignorance over everyday physiology. In raising these curtains, we unveil a range of dynamics, resolvable in the data collection and as-one-goes analysis by computers built into smaller and smaller devices, for a continued self-surveillance of the normal and for an individualized detection of the abnormal. The current medical art based on spotchecks interpreted by reference to a time-unqualified normal range can become a science of time series with tests relating to the individual in inferential statistical terms. This is already doable for the case of blood pressure, but eventually should become possible for many other variables interpreted today only based on the quicksand of clinical trials on groups. These ignore individual differences and hence the individual's needs. Chronomics (mapping time structures) with the major aim of quantifying normalcy by dynamic reference values for detecting earliest risk elevation, also yields the dividend of allowing molecular biology to focus on the normal as well as on the grossly abnormal. PMID:14728726

  15. It's not about you: a simple proposition for improving biology education.

    Science.gov (United States)

    Wright, Robin

    2014-10-01

    THE Genetics Society of America's Elizabeth W. Jones Award for Excellence in Education recognizes significant and sustained impact on genetics education. Consistent with her philosophy of linking research and education, the 2014 Awardee Robin Wright includes undergraduate students in all of her research. She seeks to teach how to think like and to actually be a biologist, working in teams and looking at real-world problems. She emphasizes a learner-centered model of classroom work that promotes and enhances lifelong skills, and has transformed biology education at the University of Minnesota through several efforts including developing the interactive, stimulating Foundations of Biology course sequence, encouraging active learning and open-ended research; supporting the construction of Active Learning Classrooms; and establishing Student Learning Outcomes, standards that measure biology education. She serves as founding editor-in-chief of CourseSource, focusing national effort to collect learner-centered, outcomes-based teaching resources in undergraduate biology. Copyright © 2014 by the Genetics Society of America.

  16. Elevating the quality of disability and rehabilitation research: mandatory use of the reporting guidelines.

    Science.gov (United States)

    Chan, Leighton; Heinemann, Allen W; Roberts, Jason

    2014-01-01

    Note from the AJOT Editor-in-Chief: Since 2010, the American Journal of Occupational Therapy (AJOT) has adopted reporting standards based on the Consolidated Standards of Reporting Trials (CONSORT) Statement and American Psychological Association (APA) guidelines in an effort to publish transparent clinical research that can be easily evaluated for methodological and analytical rigor (APA Publications and Communications Board Working Group on Journal Article Reporting Standards, 2008; Moher, Schulz, & Altman, 2001). AJOT has now joined 28 other major rehabilitation and disability journals in a collaborative initiative to enhance clinical research reporting standards through adoption of the EQUATOR Network reporting guidelines, described below. Authors will now be required to use these guidelines in the preparation of manuscripts that will be submitted to AJOT. Reviewers will also use these guidelines to evaluate the quality and rigor of all AJOT submissions. By adopting these standards we hope to further enhance the quality and clinical applicability of articles to our readers. Copyright © 2014 by the American Occupational Therapy Association, Inc.

  17. ACADEMICIAN GHEORGHE DUCA – THE SCIENTIST WHO LIVES THE PRESENT BY LEARNING FROM THE PAST AND INVESTING IN THE FUTURE

    Directory of Open Access Journals (Sweden)

    Aurelian GULEA

    2016-12-01

    Full Text Available It is our privilege to give a special dedication to the Editor-in-chief of Chemistry Journal of Moldova and our colleague, Academician Gheorghe Duca, who stands at the origins of the Journal. Our appreciation and admiration for the renowned scientist, pedagogue and public person, Gheorghe Duca, descends from the certitude that he is a pioneer and an impassioned animator in the field of his scientific activity – Ecological Chemistry. Through his research work, initiatives and especially his visions, Acad. Gheorghe Duca is, indisputably, a Personality of European value. As the founder of the scientific school of Ecological Chemistry in Republic of Moldova, he developed the theory of redox phenomenon in the environment, the ecological audit methodology and formulated the basic principles of environmental education. Under the supervision of Acad. Gheorghe Duca many disciples became accomplished specialists, including 4 DSc and 22 PhD. The scientific results of Acad. Gheorghe Duca are reflected in more than 70 books, 150 patents and about 1000 scientifi c papers. Through the initiatives of Acad. Gheorghe Duca, Republic of Moldova got the reputation of an international scientific center in the field of Ecology. Under the leadership of Acad. Gheorghe Duca five editions of Ecological Chemistry conferences were organized in Chisinau.

  18. On palaeogeographic map

    Directory of Open Access Journals (Sweden)

    Zeng-Zhao Feng

    2016-01-01

    Full Text Available The palaeogeographic map is a graphic representation of physical geographical characteristics in geological history periods and human history periods. It is the most important result of palaeogeographic study. The author, as the Editor-in-Chief of Journal of Palaeogeography, Chinese Edition and English Edition, aimed at the problems of the articles submitted to and published in the Journal of Palaeogeography in recent years and the relevant papers and books of others, and integrated with his practice of palaeogeographic study and mapping, wrote this paper. The content mainly includes the data of palaeogeographic mapping, the problems of palaeogeographic mapping method, the “Single factor analysis and multifactor comprehensive mapping method —— Methodology of quantitative lithofacies palaeogeography”, i.e., the “4 steps mapping method”, the nomenclature of each palaeogeographic unit in palaeogeographic map, the explanation of each palaeogeographic unit in palaeogeographic map, the explanation of significance of palaeogeographic map and palaeogeographic article, the evaluative standards of palaeogeographic map and palaeogeographic article, and the self-evaluation. Criticisms and corrections are welcome.

  19. A new beginning

    Directory of Open Access Journals (Sweden)

    John A Martignetti

    2011-03-01

    Full Text Available John A MartignettiMount Sinai School of Medicine, Departments of Genetics and Genomic Science, Pediatrics, and Oncological Sciences, New York, USAIf you, as Oedipus was, were a traveler in ancient Thebes you may have been met by a perched chimeric interrogator posing a question only slightly more foreboding than “Why a new genetics journal?” The mythical Sphinx, literally interpreted as representing the old pre-Olympian culture on the precipice of replacement, guarded the entrance to Thebes, and asked a riddle of all travelers prior to granting them entry.“Which creature is it that in the morning goes on four legs, at midday on two, and in the evening upon three?”Similarly, as you question why submit your work to, or review for, and indeed, even become the Editor-in-Chief of a new online access journal a sense of fear may overwhelm. While the Sphnix’s punishment of being torn asunder and devoured may at least seem quick and to the point, would the efforts of being part of a new endeavor somehow be more inhumane.

  20. Appropriate roles for the subscriber, publisher, editor, author, and reviewer in the archives of plastic surgery.

    Science.gov (United States)

    Hwang, Kun

    2013-11-01

    Authors, editors and reviewers, publishers, and subscribers all play their role in scientific journals. These 5 stakeholders are essential to journals. In this paper, firstly, I briefly summarize the role of each journal stakeholder and their respective goals. Secondly, the status of each participant in the Archives of Plastic Surgery is described. Finally, I propose an appropriate role and plan for each of them. Specific roles and responsibilities include the following: subscribers should welcome and submit the critiques of published papers in letters to the editor. Publishers should trust editors and provide them with adequate financial support for ongoing quality improvement of the journal. The editor-in-chief should be given a sufficient period of time-several years-to build up journal quality and train the incoming editor. The editors, including section editors, are also responsible for increasing the author pool. One editor might be designated a 'devil's referee', that is, a kind of devil's advocate with the responsibility of examining the originality of the manuscript, taking a skeptical view of the manuscript, and looking for holes in the methods and results of reported experiments. Authors' responsibilities include submitting manuscripts with scientific integrity and being ready to take responsibility for their articles even long after publication. Finally, reviewers' responsibilities include identifying similar articles not cited. Reviewers are also welcome to write a discussion on the article they review.