WorldWideScience

Sample records for ed watson 1940-2006

  1. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  2. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  3. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  4. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  5. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  6. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  7. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  8. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  9. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  10. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  11. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  12. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  13. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  14. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  15. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  16. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  17. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  18. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  19. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  20. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  1. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  2. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  3. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  4. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  5. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  6. Inform@ed space

    DEFF Research Database (Denmark)

    Bjerrum, Peter; Olsen, Kasper Nefer

    2001-01-01

    Inform@ed space Sensorial Perception And Computer Enchancement - bidrag til Nordisk Arkitekturforskningsforenings IT-konference, AAA april 2001.......Inform@ed space Sensorial Perception And Computer Enchancement - bidrag til Nordisk Arkitekturforskningsforenings IT-konference, AAA april 2001....

  7. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  8. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  9. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  10. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  11. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  12. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  13. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  14. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  15. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  16. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  17. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  18. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  19. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  20. TechEdSat

    Data.gov (United States)

    National Aeronautics and Space Administration — TechEdSat is a 1U CubeSat built by San Jose State University in partnership with NASA Ames Research Center and AAC Microtec. Its mission is to evaluate Space...

  1. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  2. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  3. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  4. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  5. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  6. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  7. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  8. PREFACE: EDS2010 Preface

    Science.gov (United States)

    Heggie, Malcolm I.

    2011-03-01

    The biennial international conference on Extended Defects in Semiconductors started in 1978 with a meeting in Hünfeld, Germany. Subsequent meetings rotated between Poland, France, Great Britain, Germany, Russia and Italy, culminating in EDS2004 in Chernogolovka, EDS2006 in Halle and EDS2008 in Poitiers. EDS2010 was held at the University of Sussex at Brighton, UK from September 19th to 24th. An extension of the tabulation of this history, which first appeared on the EDS2006 website, is given in the attached PDF. It is with sadness that we note one of the founders of the series, Prof. Dr Helmut Alexander, passed away on 3 December 2009 and we were proud to dedicate EDS2010 to his memory. It has become a tradition to make an award in his name, and this year it was made to Ivan Isacov for his poster "Electrical levels of dislocation networks in p- and n-type silicon". A short and warm celebration of Prof. Dr Alexander's life by his friends and colleagues, Prof. Drs Helmut Gottschalk, Eicke Weber and Wolfgang Schröter, is included in this volume. The conference was a forum for the state-of-the-art of investigation and modelling of extended defects in semiconductors. Scientists from universities, research institutes and industry made contributions to a deeper understanding of extended defects, their interaction with point defects and their role in the development of semiconductor technology. The remit of the conference included extended defects, nanostructures, nanoparticles, quantum dots and interfaces within semiconducting materials ranging from narrow to wide band gaps, including graphene-derived materials and diamond. Scientific interests range from defect geometry, electronic structure, dynamics, spectroscopy, microscopy, reactions and chemistry to introduction mechanisms, such as implantation and strained layers and the operation of devices such as integrated circuits, heterostructures, and solar cells. The organisers were confronted with a long period between

  9. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  10. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  11. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  12. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  13. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  14. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  15. Erectile Dysfunction (ED)

    Science.gov (United States)

    ... Talking to Your Kids About VirginityTalking to Your Kids About Sex Home Diseases and Conditions Erectile Dysfunction (ED) Condition ... Well-Being Mental Health Sex and Birth Control Sex and Sexuality Birth Control ... and Toddlers Kids and Teens Pregnancy and Childbirth Women Men Seniors ...

  16. Ectodermal dysplasia (ED) syndrome.

    Science.gov (United States)

    Chee, Siew-Yin; Wanga, Chung-Hsing; Lina, Wei-De; Tsaia, Fuu-Jen

    2014-01-01

    Ectodermal dysplasia (ED) syndrome comprises a large, heterogeneous group of inherited disorders that are defined by primary defects in the development of 2 or more tissues derived from the embryonic ectoderm. The tissues primarily involved are the skin and its appendages (including hair follicles, eccrine glands, sebaceous glands, nails) and teeth. The clinical features include sparse hair, abnormal or missing teeth, and an inability to sweat due to lack of sweat glands. One such case report of ectodermal dysplasia is presented here.

  17. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  18. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  19. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  20. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  1. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  2. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  3. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  4. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  5. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  6. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  7. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  8. CriticalEd

    DEFF Research Database (Denmark)

    Kjellberg, Caspar Mølholt; Meredith, David

    2014-01-01

    . Since the comments are not input sequentially, with regard to position, but in arbitrary order, this list must be sorted by copy/pasting the rows into place—an error-prone and time-consuming process. Scholars who produce critical editions typically use off-the-shelf music notation software......The best text method is commonly applied among music scholars engaged in producing critical editions. In this method, a comment list is compiled, consisting of variant readings and editorial emendations. This list is maintained by inserting the comments into a document as the changes are made......, consisting of a Sibelius plug-in, a cross-platform application, called CriticalEd, and a REST-based solution, which handles data storage/retrieval. A prototype has been tested at the Danish Centre for Music Publication, and the results suggest that the system could greatly improve the efficiency...

  9. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  10. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  11. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  12. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. EDS becoms CERN Openlab contributor

    CERN Multimedia

    2007-01-01

    "EDS announced that it has become an official contributor to CERN openlab. The purpose of the joint project beteween CERN and EDS is to carry out research and development in the field of monitoring, management and operation of grid services." (1 page)

  14. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  15. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  16. EDS operator and control software

    International Nuclear Information System (INIS)

    Ott, L.L.

    1985-04-01

    The Enrichment Diagnostic System (EDS) was developed at Lawrence Livermore National Laboratory (LLNL) to acquire, display and analyze large quantities of transient data for a real-time Advanced Vapor Laser Isotope Separation (AVLIS) experiment. Major topics discussed in this paper are the EDS operator interface (SHELL) program, the data acquisition and analysis scheduling software, and the graphics software. The workstation concept used in EDS, the software used to configure a user's workstation, and the ownership and management of a diagnostic are described. An EDS diagnostic is a combination of hardware and software designed to study specific aspects of the process. Overall system performance is discussed from the standpoint of scheduling techniques, evaluation tools, optimization techniques, and program-to-program communication methods. EDS is based on a data driven design which keeps the need to modify software to a minimum. This design requires a fast and reliable data base management system. A third party data base management product, Berkeley Software System Database, written explicitly for HP1000's, is used for all EDS data bases. All graphics is done with an in-house graphics product, Device Independent Graphics Library (DIGLIB). Examples of devices supported by DIGLIB are: Versatec printer/plotters, Raster Technologies Graphic Display Controllers, and HP terminals (HP264x and HP262x). The benefits derived by using HP hardware and software as well as obstacles imposed by the HP environment are presented in relation to EDS development and implementation

  17. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  18. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  19. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  20. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  1. CME1003Pg023ED

    African Journals Online (AJOL)

    Chantel

    resistance alone or severe defects in ... skeletal muscle and liver, decreased ... weight loss through calorie-restrict- ed diets .... carbohydrate and lipid metabolism.12 ... and a variable effect on low-density ... months of therapy.18 Comparison.

  2. SJP0704Pg001ED

    African Journals Online (AJOL)

    Enrique

    and an updated overview of newer research in this field. It also gives practical ... schizophrenia, manic episodes, major depressive disorder sec- ondary to schizophrenia ..... of Cerebral Disorder. 3rd ed. London: Blackwell Science, 1998. 16.

  3. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  4. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  5. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  6. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  7. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  8. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  9. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  10. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  11. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  12. Mitigating Higher Ed Cyber Attacks

    Science.gov (United States)

    Rogers, Gary; Ashford, Tina

    2015-01-01

    In this presentation we will discuss the many and varied cyber attacks that have recently occurred in the higher ed community. We will discuss the perpetrators, the victims, the impact and how these institutions have evolved to meet this threat. Mitigation techniques and defense strategies will be covered as will a discussion of effective security…

  13. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  14. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  15. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  17. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  18. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  19. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  20. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  1. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  2. Cabaña ED

    Directory of Open Access Journals (Sweden)

    Lorena Troncoso Valencia

    2018-01-01

    Full Text Available Este proyecto denominado Cabaña Ed, de la arquitecta chilena Lorena Troncoso Valencia, es parte de una serie de obras emplazadas en la comuna de Pinto, Región de Ñuble de Chile. Zona de frondosa vegetación de árboles autóctonos y con fugas visuales hacia la cordillera de los Andes. La Cabaña Ed, donde predomina el uso de la madera, se integra muy sutilmente con ese entorno natural. Cabin ED, by the Chilean architect Lorena Troncoso Valencia, is part of a series of works located in the commune of Pinto, Ñuble Region, Chile. This area is characterized by lush vegetation of native trees and visual towards the Andes leaks. In this project the use of wood predominates, which is subtly integrated with the natural environment. In the edition of REVISTARQUIS 11, another project of the architect, located in that same zone of tourist development was presented.

  3. AdvancED Flex 4

    CERN Document Server

    Tiwari, Shashank; Schulze, Charlie

    2010-01-01

    AdvancED Flex 4 makes advanced Flex 4 concepts and techniques easy. Ajax, RIA, Web 2.0, mashups, mobile applications, the most sophisticated web tools, and the coolest interactive web applications are all covered with practical, visually oriented recipes. * Completely updated for the new tools in Flex 4* Demonstrates how to use Flex 4 to create robust and scalable enterprise-grade Rich Internet Applications.* Teaches you to build high-performance web applications with interactivity that really engages your users.* What you'll learn Practiced beginners and intermediate users of Flex, especially

  4. Real time analysis under EDS

    International Nuclear Information System (INIS)

    Schneberk, D.

    1985-07-01

    This paper describes the analysis component of the Enrichment Diagnostic System (EDS) developed for the Atomic Vapor Laser Isotope Separation Program (AVLIS) at Lawrence Livermore National Laboratory (LLNL). Four different types of analysis are performed on data acquired through EDS: (1) absorption spectroscopy on laser-generated spectral lines, (2) mass spectrometer analysis, (3) general purpose waveform analysis, and (4) separation performance calculations. The information produced from this data includes: measures of particle density and velocity, partial pressures of residual gases, and overall measures of isotope enrichment. The analysis component supports a variety of real-time modeling tasks, a means for broadcasting data to other nodes, and a great degree of flexibility for tailoring computations to the exact needs of the process. A particular data base structure and program flow is common to all types of analysis. Key elements of the analysis component are: (1) a fast access data base which can configure all types of analysis, (2) a selected set of analysis routines, (3) a general purpose data manipulation and graphics package for the results of real time analysis. Each of these components are described with an emphasis upon how each contributes to overall system capability. 3 figs

  5. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  6. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  7. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  8. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  9. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  10. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  11. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  12. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  13. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  16. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  17. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  18. New EdF's three challenges

    International Nuclear Information System (INIS)

    Lepetit, V.

    2005-01-01

    The opening of 15% of Electricite de France (EdF) capital to the private sector will allow the first world electric utility to raise 7 billions of euros of cash flow. EdF will have also to face the new European situation: a strained market, several consolidations to come and many competitors to deal with. EdF has to re-launch its production tool and to reinforce its interconnection capacities if it wants to stay the number one of power exports in Europe. The integration of Edison company (Italy) by EdF gives access to new gas capacities but other resources have to be found if EdF wants to enlarge its gas offer. A new concentration era is foreseen in Europe and EdF will have to seize the economic growth opportunities in particular in Europe and China. (J.S.)

  19. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  20. Hand-held ultrasound serving three EDs.

    Science.gov (United States)

    2007-02-01

    Having a portable ultrasound available to your ED will enable you to perform scans during the nighttime hours, instead of having patients wait for several hours until the radiology department opens. Additional time can be saved by having a technologist read the scans, which frees your ED physicians for other duties. Having ED docs contact the technologist directly, rather than going through a resident, also saves valuable time. Arriving at a diagnosis more quickly provides a boost to patient safety.

  1. The Impact of "ED" on Educational Research.

    Science.gov (United States)

    Florio, David H.

    1980-01-01

    The purposes, structure, and component parts of the newly formed Department of Education (ED) organizations from which educational research programs will be administered are discussed. As the climate surrounding ED changes, opportunities to take advantage of the elevated status of research will be presented. (Author/RL)

  2. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  3. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  4. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  6. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  7. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  8. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  9. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  10. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  11. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  12. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  13. ED breast cases and other breast emergencies.

    Science.gov (United States)

    Khadem, Nasim; Reddy, Sravanthi; Lee, Sandy; Larsen, Linda; Walker, Daphne

    2016-02-01

    Patients with pathologic processes of the breast commonly present in the Emergency Department (ED). Familiarity with the imaging and management of the most common entities is essential for the radiologist. Additionally, it is important to understand the limitations of ED imaging and management in the acute setting and to recognize when referrals to a specialty breast center are necessary. The goal of this article is to review the clinical presentations, pathophysiology, imaging, and management of emergency breast cases and common breast pathology seen in the ED.

  14. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  15. MicroED data collection and processing

    Energy Technology Data Exchange (ETDEWEB)

    Hattne, Johan; Reyes, Francis E.; Nannenga, Brent L.; Shi, Dan; Cruz, M. Jason de la [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147 (United States); Leslie, Andrew G. W. [Medical Research Council Laboratory of Molecular Biology, Cambridge (United Kingdom); Gonen, Tamir, E-mail: gonent@janelia.hhmi.org [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147 (United States)

    2015-07-01

    The collection and processing of MicroED data are presented. MicroED, a method at the intersection of X-ray crystallography and electron cryo-microscopy, has rapidly progressed by exploiting advances in both fields and has already been successfully employed to determine the atomic structures of several proteins from sub-micron-sized, three-dimensional crystals. A major limiting factor in X-ray crystallography is the requirement for large and well ordered crystals. By permitting electron diffraction patterns to be collected from much smaller crystals, or even single well ordered domains of large crystals composed of several small mosaic blocks, MicroED has the potential to overcome the limiting size requirement and enable structural studies on difficult-to-crystallize samples. This communication details the steps for sample preparation, data collection and reduction necessary to obtain refined, high-resolution, three-dimensional models by MicroED, and presents some of its unique challenges.

  16. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  17. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  18. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  19. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  20. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  1. On the quantitativeness of EDS STEM

    Energy Technology Data Exchange (ETDEWEB)

    Lugg, N.R. [Institute of Engineering Innovation, The University of Tokyo, 2-11-16, Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); Kothleitner, G. [Institute for Electron Microscopy and Nanoanalysis, Graz University of Technology, Steyrergasse 17, 8010 Graz (Austria); Centre for Electron Microscopy, Steyrergasse 17, 8010 Graz (Austria); Shibata, N.; Ikuhara, Y. [Institute of Engineering Innovation, The University of Tokyo, 2-11-16, Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan)

    2015-04-15

    Chemical mapping using energy dispersive X-ray spectroscopy (EDS) in scanning transmission electron microscopy (STEM) has recently shown to be a powerful technique in analyzing the elemental identity and location of atomic columns in materials at atomic resolution. However, most applications of EDS STEM have been used only to qualitatively map whether elements are present at specific sites. Obtaining calibrated EDS STEM maps so that they are on an absolute scale is a difficult task and even if one achieves this, extracting quantitative information about the specimen – such as the number or density of atoms under the probe – adds yet another layer of complexity to the analysis due to the multiple elastic and inelastic scattering of the electron probe. Quantitative information may be obtained by comparing calibrated EDS STEM with theoretical simulations, but in this case a model of the structure must be assumed a priori. Here we first theoretically explore how exactly elastic and thermal scattering of the probe confounds the quantitative information one is able to extract about the specimen from an EDS STEM map. We then show using simulation how tilting the specimen (or incident probe) can reduce the effects of scattering and how it can provide quantitative information about the specimen. We then discuss drawbacks of this method – such as the loss of atomic resolution along the tilt direction – but follow this with a possible remedy: precession averaged EDS STEM mapping. - Highlights: • Signal obtained in EDS STEM maps (of STO) compared to non-channelling signal. • Deviation from non-channelling signal occurs in on-axis experiments. • Tilting specimen: signal close to non-channelling case but atomic resolution is lost. • Tilt-precession series: non-channelling signal and atomic-resolution features obtained. • Associated issues are discussed.

  2. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  3. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  5. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  6. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  7. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  8. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  9. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  10. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  11. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  12. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  13. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  14. Transient data acquisition techniques under EDS

    International Nuclear Information System (INIS)

    Telford, S.

    1985-06-01

    This paper is the first of a series which describes the Enrichment Diagnostic System (EDS) developed for the MARS project at Lawrence Livermore National Laboratory. Although EDS was developed for use on AVLIS, the functional requirements, overall design, and specific techniques are applicable to any experimental data acquisition system involving large quantities of transient data. In particular this paper will discuss the techniques and equipment used to do the data acquisition. Included are what types of hardware are used and how that hardware (CAMAC, digital oscilloscopes) is interfaced to the HP computers. In this discussion the author will address the problems encountered and the solutions used, as well as the performance of the instrument/computer interfaces. The second topic the author will discuss is how the acquired data is associated to graphics and analysis portions of EDS through efficient real time data bases. This discussion will include how the acquired data is folded into the overall structure of EDS providing the user immediate access to raw and analyzed data. By example you will see how easily a new diagnostic can be added to the EDS structure without modifying the other parts of the system. 8 figs

  15. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  16. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  17. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  18. TED-Ed lessons & TED-Ed clubs: Educational activities to amplify students' voices

    Science.gov (United States)

    Villias, Georgios

    2017-04-01

    TED-Ed lessons and TED-Ed clubs are two powerful educational tools that can be used in today's school classrooms in order to create an educational environment that is engaging for the students and favors their active participation, created and fostered by TED-Ed. TED-Ed is TED's educational initiative, committed to create lessons worth sharing and amplify the voices and ideas of teachers and students around the world. TED-Ed animated lessons are fully organized lessons structured around an animated video that introduces new topics to learners in an exciting, thought-provoking way. These lessons have been created as a result of the cooperation between expert educators and animators and have been uploaded at the TED-Ed platform (http://ed.ted.com). On the other hand, TED-Ed Clubs are also an interesting way to offer students the chance, the voice and the opportunity to express their thoughts, engage actively on these matters and connect with each other, both at a local, as well as at an international level (http://ed.ted.com/clubs). By developing new TED-Ed lessons or by customizing appropriately existing animated TED-Ed lessons (translating, modifying the questions asked, introducing new discussion topics), I have created and implemented in my student-centered, didactic approach, a series of TED-ED animated lessons directly connected with the Greek national science syllabus that were used to spark students curiosity and initiate a further analytical discussion or introduce other relevant educational activities (http://gvillias.wixsite.com/education). Furthermore, at my school, we established Varvakeio TED-Ed Club, an environment that supports and empowers our students to research, develop and disseminate their own personal ideas that worth spreading. During the year, our members were inspired by watching TED talks presented by experts on their field on various different areas, including social, economical, environmental and technological-scientific issues. Our aim

  19. Association of ED with chronic periodontal disease.

    Science.gov (United States)

    Matsumoto, S; Matsuda, M; Takekawa, M; Okada, M; Hashizume, K; Wada, N; Hori, J; Tamaki, G; Kita, M; Iwata, T; Kakizaki, H

    2014-01-01

    To examine the relationship between chronic periodontal disease (CPD) and ED, the interview sheet including the CPD self-checklist (CPD score) and the five-item version of the International Index of Erectile Function (IIEF-5) was distributed to 300 adult men who received a comprehensive dental examination. Statistical analyses were performed by the Spearman's rank correlation coefficient and other methods. Statistical significance was accepted at the level of Pdysfunction and the systematic inflammatory changes associated with CPD. The present study also suggests that dental health is important as a preventive medicine for ED.

  20. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  1. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  2. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  3. I Failed the edTPA

    Science.gov (United States)

    Kuranishi, Adam; Oyler, Celia

    2017-01-01

    In this article, co-written by a teacher and a professor, the authors examine possible explanations for why Adam (first author), a New York City public school special educator, failed the edTPA, a teacher performance assessment required by all candidates for state certification. Adam completed a yearlong teaching residency where he was the special…

  4. Electrostatic-Dipole (ED) Fusion Confinement Studies

    Science.gov (United States)

    Miley, George H.; Shrestha, Prajakti J.; Yang, Yang; Thomas, Robert

    2004-11-01

    The Electrostatic-Dipole (ED) concept significantly differs from a "pure" dipole confinement device [1] in that the charged particles are preferentially confined to the high-pressure region interior of the dipole coil by the assistance of a surrounding spherical electrostatic grid. In present ED experiments, a current carrying coil is embedded inside the grid of an IEC such as to produce a magnetic dipole field. Charged particles are injected axisymmetrically from an ion gun (or duo-plasmatron) into the center of the ED confinement grid/dipole ring where they oscillate along the magnetic field lines and pass the peak field region at the center of the dipole region. As particles begin accelerating away from the center region towards the outer electrostatic grid region, they encounter a strong electrostatic potential (order of 10's of kilovolts) retarding force. The particles then decelerate, reverse direction and re-enter the dipole field region where again magnetic confinement dominates. This process continues, emulating a complex harmonic oscillator motion. The resulting pressure profile averaged over the field curvature offers good plasma stability in the ED configuration. The basic concept and results from preliminary experiments will be described. [1] M.E. Mauel, et al. "Dipole Equilibrium and Stability," 18th IAEA Conference of Plasma Phys. and Control. Nuclear Fusion, Varenna, Italy 2000, IAEA-F1-CN-70/TH

  5. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  6. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  7. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  8. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  9. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  10. Cytoplasmic Streaming - Skylab Student Experiment ED-63

    Science.gov (United States)

    1973-01-01

    This chart describes the Skylab student experiment (ED-63), Cytoplasmic Streaming, proposed by Cheryl A. Peitz of Arapahoe High School, Littleton, Colorado. Experiment ED-63 was to observe the effect of zero-gravity on cytoplasmic streaming in the aquatic plant named Elodea, commonly called water weed or water thyme. The phenomenon of cytoplasmic streaming is not well understood, but it is recognized as the circulation mechanism of the internal materials or cytoplasm of a cell. Cytoplasm is a gelatinous substance that has the ability to change its viscosity and flow, carrying various cell materials with it. The activity can be stimulated by sunlight or heat. In March 1972, NASA and the National Science Teachers Association selected 25 experiment proposals for flight on Skylab. Science advisors from the Marshall Space Flight Center aided and assisted the students in developing the proposals for flight on Skylab.

  11. Regional Energy Deployment System (ReEDS)

    Energy Technology Data Exchange (ETDEWEB)

    Short, W.; Sullivan, P.; Mai, T.; Mowers, M.; Uriarte, C.; Blair, N.; Heimiller, D.; Martinez, A.

    2011-12-01

    The Regional Energy Deployment System (ReEDS) is a deterministic optimization model of the deployment of electric power generation technologies and transmission infrastructure throughout the contiguous United States into the future. The model, developed by the National Renewable Energy Laboratory's Strategic Energy Analysis Center, is designed to analyze the critical energy issues in the electric sector, especially with respect to potential energy policies, such as clean energy and renewable energy standards or carbon restrictions. ReEDS provides a detailed treatment of electricity-generating and electrical storage technologies and specifically addresses a variety of issues related to renewable energy technologies, including accessibility and cost of transmission, regional quality of renewable resources, seasonal and diurnal generation profiles, variability of wind and solar power, and the influence of variability on the reliability of the electrical grid. ReEDS addresses these issues through a highly discretized regional structure, explicit statistical treatment of the variability in wind and solar output over time, and consideration of ancillary services' requirements and costs.

  12. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  13. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  14. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  15. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Ed overcrowding – matematic models for integrated solutions and decisions

    OpenAIRE

    ROTARU, LUCIANA TEODORA; BĂNICIOIU - COVEI, MIHAI

    2017-01-01

    Dear Editor In Chief, We are writing to You in line with an very interesting point of view regarding the Emergency Department (ED) development. The paper titled Improving Emergency Department Capacity Efficiency, published in your Journal 2016; 12(1): 52- 57, as an original articles, spotlight solution for ED crowding. So we are proposing a mathematics models for reciprocal accommodation of patients flows to the response capacity of the ED. ED overcrowding ...

  18. edX e-learning course development

    CERN Document Server

    Gilbert, Matthew A

    2015-01-01

    If you are an educator creating a course for edX or a corporate trainer using Open edX for large-scale learning and development initiatives, then edX E-Learning Course Development is the ideal book for you.

  19. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  20. EDS Coal Liquefaction Process Development. Phase V. Laboratory evaluation of the characteristics of EDS Illinois bottoms

    Energy Technology Data Exchange (ETDEWEB)

    Lao, T C; Levasseur, A A

    1984-02-01

    This interim report documents work carried out by Combustion Engineering, Inc. under a contract to Exxon Research and Engineering Company to develop a conceptual Hybrid Boiler design fueled by the vacuum distillation residue (vacuum bottoms) derived from Illinois No. 6 coal in the EDS Coal Liquefaction Process. This report was prepared by Combustion Engineering, Inc., and is the first of two reports on the predevelopment phase of the Hybrid Boiler program. This report covers the results of a laboratory investigation to assess the fuel and ash properties of EDS vacuum bottoms. The results of the laboratory testing reported here were used in conjunction with Combustion Engineering's design experience to predict fuel performance and to develop appropriate boiler design parameters. These boiler design parameters were used to prepare the engineering design study reported in EDS Interim Report FE-2893-113, the second of the two reports on the predevelopment phase of the Hybrid Boiler Program. 46 figures, 29 tables.

  1. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  2. Perceptions of empowerment among ED nurses.

    Science.gov (United States)

    DeVivo, Diane; Quinn Griffin, Mary T; Donahue, Moreen; Fitzpatrick, Joyce J

    2013-11-01

    Nurses' perceptions of empowerment have been linked to a number of variables in the hospital workplace, including job satisfaction, autonomy, and work effectiveness. Yet there have been no previous studies of perceptions of empowerment specifically among emergency department (ED) nurses. Registered nurses (RNs) employed in the EDs of 6 hospitals in a major health care system in the eastern United States were surveyed regarding their perceptions of empowerment. Of the 240 RNs eligible to participate, there were 167 usable surveys. There was a moderate level of empowerment among the RNs who participated, consistent with the level of empowerment reported in several other studies of staff nurses and nurses in other positions. The moderate level of empowerment in this sample may be attributed to the many opportunities for RN involvement in the hospitals within this health care system. Nurse leaders can initiate programs focused on enhancing RN perceptions of empowerment. In addition, there is a need for further research among RNs with different specialty preparation. Copyright © 2013. Published by Mosby, Inc.

  3. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  4. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  5. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  6. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  7. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  8. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  10. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  11. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  12. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  13. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  14. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  15. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  16. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  17. Giocare, tra violenza ed ecologia della mente.

    Directory of Open Access Journals (Sweden)

    Enrico Euli

    2008-07-01

    Full Text Available L'articolo riflette sulle relazioni tra comunicazione, violenza e gioco, nel tentativo di rintracciare tra loro convergenze, affinità e contrasti. Le nostre relazioni, infatti, ci immettono inerzialmente in dilemmi e paradossi di così alta complessità da rendere spesso inadeguati gli strumenti 'logici' ed 'analitici': dal che può derivare un senso di impotenza, rabbia, paralisi, ma anche un desiderio potente di controllo e di soluzione degli eventi. Entrambe queste strade ci conducono dentro le false alternative della violenza. La cultura del gioco, invece, ci propone (attraverso le sue pratiche, ma anche negli scritti teorici di Freud, Winnicott, Bateson, qui riassunti e rivisitati una modalità più creativa e nonviolenta, più prossima ad un' ecologia della mente e ad un'estetica delle emozioni.

  18. Pareto vs Simmel: residui ed emozioni

    Directory of Open Access Journals (Sweden)

    Silvia Fornari

    2017-08-01

    Full Text Available A cento anni dalla pubblicazione del Trattato di sociologia generale (Pareto 1988 siamo a mantenere vivo ed attuale lo studio paretiano con una rilettura contemporanea del suo pensiero. Ricordato per la grande versatilità intellettuale dagli economisti, rimane lo scienziato rigoroso ed analitico i cui contributi sono ancora discussi a livello internazionale. Noi ne analizzeremo gli aspetti che l’hanno portato ad avvicinarsi all’approccio sociologico, con l’introduzione della nota distinzione dell’azione sociale: logica e non-logica. Una dicotomia utilizzata per dare conto dei cambiamenti sociali riguardanti le modalità d’azione degli uomini e delle donne. Com’è noto le azioni logiche sono quelle che riguardano comportamenti mossi da logicità e raziocinio, in cui vi è una diretta relazione causa-effetto, azioni oggetto di studio degli economisti, e di cui non si occupano i sociologi. Le azioni non-logiche riguardano tutte le tipologie di agire umano che rientrano nel novero delle scienze sociali, e che rappresentano la parte più ampia dell’agire sociale. Sono le azioni guidate dai sentimenti, dall’emotività, dalla superstizione, ecc., illustrate da Pareto nel Trattato di sociologia generale e in saggi successivi, dove riprende anche il concetto di eterogenesi dei fini, formulato per la prima volta da Giambattista Vico. Concetto secondo il quale la storia umana, pur conservando in potenza la realizzazione di certi fini, non è lineare e lungo il suo percorso evolutivo può accadere che l’uomo nel tentativo di raggiungere una finalità arrivi a conclusioni opposte. Pareto collega la definizione del filosofo napoletano alle tipologie di azione sociale e alla loro distinzione (logiche, non-logiche. L’eterogenesi dei fini per Pareto è dunque l’esito di un particolare tipo di azione non-logica dell’essere umano e della collettività.

  19. Emergency Department (ED, ED Observation, Day Hospital, and Hospital Admissions for Adults with Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    Susan Silva

    2018-02-01

    Full Text Available Introduction: Use of alternative venues to manage uncomplicated vaso-occlusive crisis (VOC, such as a day hospital (DH or ED observation unit, for patients with sickle cell anemia, may significantly reduce admission rates, which may subsequently reduce 30-day readmission rates. Methods: In the context of a two-institution quality improvement project to implement best practices for management of patients with sickle cell disease (SCD VOC, we prospectively compared acute care encounters for utilization of 1 emergency department (ED; 2 ED observation unit; 3 DH, and 4 hospital admission, of two different patient cohorts with SCD presenting to our two study sites. Using a representative sample of patients from each institution, we also tabulated SCD patient visits or admissions to outside hospitals within 20 miles of the patients’ home institutions. Results: Over 30 months 427 patients (297 at Site 1 and 130 at Site 2 initiated 4,740 institutional visits, totaling 6,627 different acute care encounters, including combinations of encounters. The range of encounters varied from a low of 0 (203 of 500 patients [40.6%] at Site 1; 65 of 195 patients [33.3%] at Site 2, and a high of 152 (5/month acute care encounters for one patient at Site 2. Patients at Site 2 were more likely to be admitted to the hospital during the study period (88.4% vs. 74.4%, p=0.0011 and have an ED visit (96.9% vs. 85.5%, p=0.0002. DH was used more frequently at Site 1 (1.207 encounters for 297 patients at Site 1, vs. 199 encounters for 130 patients at Site 2, and ED observation was used at Site 1 only. Thirty-five percent of patients visited hospitals outside their home academic center. Conclusion: In this 30-month assessment of two sickle cell cohorts, healthcare utilization varied dramatically between individual patients. One cohort had more hospital admissions and ED encounters, while the other cohort had more day hospital encounters and used a sickle cell disease

  20. Hearing of Mr. Francois Roussely, President of EdF

    International Nuclear Information System (INIS)

    Roussely, F.

    2005-01-01

    This document is the proceedings of the hearing of F. Roussely, President of Electricite de France (EdF), at the commission of economic affairs of the French house of commons, about the advisability of the construction of the EPR (European pressurized reactor) demonstration plant and about its possible financing by EdF. In a first part, F. Roussely recalls the European context of deregulation of energy markets and its impact of the French electric power industry (opening of the French market, industrial and social actions of EdF, need of a new generation of nuclear reactor, preservation of EdF's energy mix, warranty of public utility, un-bundling between energy trade and distribution, EdF's turnover and profitability, EdF's foreign daughter companies). In a second part, F. Roussely answers a series of questions asked by the different members of the commission concerning the different points presented in the first part. (J.S.)

  1. Minor injury attendance times to the ED.

    LENUS (Irish Health Repository)

    Conlon, Ciaran

    2009-07-01

    The Health Service Executive (HSE) highlights the need for effective patient throughput and management, whilst providing appropriate staffing and therapeutic interventions. It acknowledges that patient need is integral to the development of a nurse led service and advocates planning staffing levels to reflect arrival times of patients. An observational study of all patients who presented to the emergency department in July 2005 and February 2006 was undertaken (n=7768). The study identified 1577 patients suitable for treatment by the Advanced Nurse Practitioner (ANP) in these two months, which represents 20% of all patient attendances to the ED in this time period. A data collection tool was devised collectively by the ANPs to identify appropriate patients. The findings of the study revealed that 73% of patients suitable for the ANP service presented between the hours of 0800 and 2000, of which 54% attended between 0800 and 1600 h. Sunday emerged as the busiest day in July 2005 whereas Monday was found to be the busiest day in February 2006. Friday was found to be consistently busy for both months.

  2. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  3. ExpandED Options: Learning beyond High School Walls

    Science.gov (United States)

    ExpandED Schools, 2014

    2014-01-01

    Through ExpandED Options by TASC, New York City high school students get academic credit for learning career-related skills that lead to paid summer jobs. Too many high school students--including those most likely to drop out--are bored or see classroom learning as irrelevant. ExpandED Options students live the connection between mastering new…

  4. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  5. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  6. TechEdSat Nano-Satellite Series Fact Sheet

    Science.gov (United States)

    Murbach, Marcus; Martinez, Andres; Guarneros Luna, Ali

    2014-01-01

    TechEdSat-3p is the second generation in the TechEdSat-X series. The TechEdSat Series uses the CubeSat standards established by the California Polytechnic State University Cal Poly), San Luis Obispo. With typical blocks being constructed from 1-unit (1U 10x10x10 cm) increments, the TechEdSat-3p has a 3U volume with a 30 cm length. The project uniquely pairs advanced university students with NASA researchers in a rapid design-to-flight experience lasting 1-2 semesters.The TechEdSat Nano-Satellite Series provides a rapid platform for testing technologies for future NASA Earth and planetary missions, as well as providing students with an early exposure to flight hardware development and management.

  7. ED leadership competency matrix: an administrative management tool.

    Science.gov (United States)

    Propp, Douglas A; Glickman, Seth; Uehara, Dennis T

    2003-10-01

    A successful ED relies on its leaders to master and demonstrate core competencies to be effective in the many arenas in which they interact and are responsible. A unique matrix model for the assessment of an ED leadership's key administrative skill sets is presented. The model incorporates capabilities related to the individual's cognitive aptitude, experience, acquired technical skills, behavioral characteristics, as well as the ability to manage relationships effectively. Based on the personnel inventory using the matrix, focused evaluation, development, and recruitment of ED key leaders occurs. This dynamic tool has provided a unique perspective for the evaluation and enhancement of overall ED leadership performance. It is hoped that incorporation of such a model will similarly improve the accomplishments of EDs at other institutions.

  8. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  9. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  10. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  11. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  12. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  13. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  15. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  16. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  20. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  1. Characterising non-urgent users of the emergency department (ED): A retrospective analysis of routine ED data.

    Science.gov (United States)

    O'Keeffe, Colin; Mason, Suzanne; Jacques, Richard; Nicholl, Jon

    2018-01-01

    The pressures of patient demand on emergency departments (EDs) continue to be reported worldwide, with an associated negative impact on ED crowding and waiting times. It has also been reported that a proportion of attendances to EDs in different international systems could be managed in settings such as primary care. This study used routine ED data to define, measure and profile non-urgent ED attendances that were suitable for management in alternative, non-emergency settings. We undertook a retrospective analysis of three years of Hospital Episode and Statistics Accident Emergency (HES A&E) data for one large region in England, United Kingdom (April 1st 2011 to March 31st 2014). Data was collected on all adult (>16 years) ED attendances from each of the 19 EDs in the region. A validated process based definition of non-urgent attendance was refined for this study and applied to the data. Using summary statistics non-urgent attenders were examined by variables hypothesised to influence them as follows: age at arrival, time of day and day of week and mode of arrival. Odds ratios were calculated to compare non-urgent attenders between groups. There were 3,667,601 first time attendances to EDs, of which 554,564 were defined as non-urgent (15.1%). Non-urgent attendances were significantly more likely to present out of hours than in hours (OR = 1.19, 95% CI: 1.18 to 1.20, Paged 16-44) compared to those aged 45-64 (odds ratio: 1.42, 95% CI: 1.41 to 1.43, Puse the ED to obtain healthcare that could be provided in a less urgent setting and also more likely to do this out of hours. Alternative services are required to manage non-urgent demand, currently being borne by the ED and the ambulance service, particularly in out of hours.

  2. EdF: high tension(s) metamorphosis

    International Nuclear Information System (INIS)

    Roussely, F.; Arnoux, P.; Baritault, A.; Alto, P.; Castets, C.; Secondi, J.

    2003-01-01

    Electricite de France, the French electric utility, has to face a formidable mutation. The deregulation of the power market will lead to a social, commercial, judicial, financial and international 'big-bang'. The company has been weakened by disappointing results and by an embarrassing running into debts. This dossier analyzes the consequences of the deregulation of the French power market on the future evolution of EdF. It includes the analysis made by a French economist, E. Cohen, an interview and a portrait of F. Roussely, head of EdF, a presentation of Easenergy, a start-up of EdF which makes partnerships with US energy-related companies, the worries of EdF's employees and the redistribution of the syndicates power inside the company, the controversy around EdF's 2002 results and the points that remained in the shade, EdF's European competitors and the progressive opening of the French power market, EDF's production tool and its availability (58 nuclear reactors, 538 hydroelectric power plants and 26 thermal power plants), the costly foreign markets strategy of EdF and the under-capitalization of the company. (J.S.)

  3. MANY MEN USED ED TREATMENT WITHOUT THEIR PARTNERS’ KNOWLEDGE

    OpenAIRE

    Tan HM; Choo WY; Ng CJ; Low WY

    2007-01-01

    This paper aimed to identify and explore the understanding and perception of erectile dysfunction (ED) using exploratory qualitative approaches. This study was conducted in Klang Valley, Malaysia. Purposive sampling was used to recruit 17 urban men aged 40-75 years. A semi-structural interview guide was used to explore men’s understanding of ED, impacts on their well-being and experiences with treatments. The focus groups revealed that ED was perceived to be an important loss in men’s lives ...

  4. Note critiche sui rapporti tra diritto ed economia

    OpenAIRE

    Tuzet, Giovanni

    2017-01-01

    Il saggio inquadra teoricamente i principali rapporti fra diritto ed economia e analizza i vari metodi e approcci dell'analisi economica del diritto, rilvandone gli aspetti critici e discutendo infine gli approcci comportamentali e la "nudge theory".

  5. Structure of catalase determined by MicroED

    Science.gov (United States)

    Nannenga, Brent L; Shi, Dan; Hattne, Johan; Reyes, Francis E; Gonen, Tamir

    2014-01-01

    MicroED is a recently developed method that uses electron diffraction for structure determination from very small three-dimensional crystals of biological material. Previously we used a series of still diffraction patterns to determine the structure of lysozyme at 2.9 Å resolution with MicroED (Shi et al., 2013). Here we present the structure of bovine liver catalase determined from a single crystal at 3.2 Å resolution by MicroED. The data were collected by continuous rotation of the sample under constant exposure and were processed and refined using standard programs for X-ray crystallography. The ability of MicroED to determine the structure of bovine liver catalase, a protein that has long resisted atomic analysis by traditional electron crystallography, demonstrates the potential of this method for structure determination. DOI: http://dx.doi.org/10.7554/eLife.03600.001 PMID:25303172

  6. Elementi ed esercizi di geometria analitica e proiettiva

    CERN Document Server

    Francia, Giovanni

    1950-01-01

    La retta : preliminario ; coordinate cartesiane nel piano, equazioni della retta, distanze ed angoli ; cambiamento delle coordinate, coordinate polari ; il cerchio ; le coniche come luoghi geometrici : l'ellisse, l'iperbole, parabola.

  7. 2003 annual results of EdF group

    International Nuclear Information System (INIS)

    2004-03-01

    The Electricite de France (EdF) group Board of Directors, meeting on March 11, 2004, under the Chairmanship of Francois Roussely, reviewed the audited consolidated financial statements for the year ended 12/31/2003. This document presents the consolidated results of EdF group for 2003: consolidated financial statements, highlights of the year, focus on 2003 events, commercial results, EDF in Europe and worldwide, EDF France highlights, key figures. (J.S.)

  8. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  9. Ethane dimethanesulfonate (EDS) perturbs epididymal epithelial cell function in vitro

    International Nuclear Information System (INIS)

    Klinefelter, G.

    1990-01-01

    The formation of sperm granulomas in the epididymis following exposure to EDS, a Leydig cell toxicant, was reported by Cooper and Jackson in 1970. Recent work suggests that EDS may effect the epididymis directly. An in vitro system was developed to determine the nature of any direct effect. The caput epididymis from adult rats was dissected free of connective tissue and small pieces of the tissue were enzymatically digested until plaques of epididymal epithelial cells were obtained. Plaques were cultured on an extracellular matrix gelled on top of a semipermeable filter creating dual-compartment environments. The epithelial cells maintained typical morphology and protein secretion in this culture system for several days. Beginning on day 3, EDS (1 mM) was added to the basal compartment, with or without 35 S-methionine. After 24 hours, 35 S-labelled culture medium was taken from the apical compartment and analyzed by SDS-PAGE and fluorography. EDS caused decreased secretion of several proteins, including a 39 Kd molecule. Interestingly, a 39 Kd protein was also shown to disappear from sperm taken from the caput epididymidis following in vivo exposure to EDS. Unlabelled cultures were fixed and processed for light microscopy. No alterations in morphological integrity were observed. Thus, epididymal epithelial cell function is directly altered by EDS exposure

  10. Moments of disaster response in the emergency department (ED).

    Science.gov (United States)

    Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

    2017-11-01

    We experience our lives as a series of memorable moments, some good and some bad. Undoubtedly, the experience of participating in disaster response, is likely to stand out as a memorable moment in a nurses' career. This presentation will describe five distinct moments of nursing in the emergency department (ED) during a disaster response. A Hermeneutic Phenomenological approach informed by van Manen underpins the research process. Thirteen nurses from different countries around the world participated in interviews about their experience of working in the ED during a disaster. Thematic analysis resulted in five moments of disaster response which are common to the collective participant experience. The 5 themes emerge as Notification (as a nurse finds out that the ED will be receiving casualties), Waiting (waiting for the patients to arrive to the ED), Patient Arrival (the arrival of the first patients to the ED), Caring for patients (caring for people affected by the disaster) and Reflection (the moment the disaster response comes to an end). This paper provides an in-depth insight into the experience of nursing in the ED during a disaster response which can help generate awareness and inform future disaster preparedness of emergency nurses. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  11. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  12. MANY MEN USED ED TREATMENT WITHOUT THEIR PARTNERS’ KNOWLEDGE

    Directory of Open Access Journals (Sweden)

    Tan HM

    2007-01-01

    Full Text Available This paper aimed to identify and explore the understanding and perception of erectile dysfunction (ED using exploratory qualitative approaches. This study was conducted in Klang Valley, Malaysia. Purposive sampling was used to recruit 17 urban men aged 40-75 years. A semi-structural interview guide was used to explore men’s understanding of ED, impacts on their well-being and experiences with treatments. The focus groups revealed that ED was perceived to be an important loss in men’s lives as sexual performance was closely related to manhood. The men associated ED with a loss of masculinity and self-esteem. Men’s understanding of ED treatments was restricted to phophodiesterase type 5 inhibitors (PDE-5 inhibitors and traditional therapies. Although PDE-5 inhibitors were perceived to be effective, they were concerned about their safety and costs. Some of the men have learned to cope with ED rather than to seek help, particularly among older men, who attributed their decreased sexual capacities and erection difficulties to aging, and therefore conditioned themselves to accepting it. In contrast, younger men who have erectile difficulties are considered as ‘abnormal’, and are more likely to seek help and receive treatment for their sexual problem. Men’s knowledge of and experience with modern treatments of ED were mainly associated with PDE-5 inhibitors. Their perception towards PDE-5 inhibitors was largely influenced by personal experience, information from mass media and friends. The high cost and fear of side effects were two main deterrents in the use of PDE-5 inhibitors. Many men had conceded their use of PDE-5 inhibitors without their partners’ knowledge. They worried that their partners would view the matter with suspicion and mistrust.

  13. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  14. Met Ed gets reprieve: banks lend tax money

    International Nuclear Information System (INIS)

    Utroska, D.

    1981-01-01

    A consortium of banks agreed to loan Metropolitan Edison $23 million to pay its April 15 state taxes and temporarily relieve a cash-flow problem that is leading to default after the Pennsylvania Public Utility Commission expedited a rate request. The continued solvency of Met Ed is a matter of speculation because the present credit formula is based on liquid assets which the PUC did not address. While the action taken by the bankers gives Met Ed a reprieve, it does not provide a long-term solution. The Revolving Credit Agreement will expire on October 1. Met Ed is still faced with the problem of relicensing Three Mile Island-1 unit and the cost of underwriting the cleanup of the No. 2 unit

  15. Operational and financial impact of physician screening in the ED.

    Science.gov (United States)

    Soremekun, Olanrewaju A; Biddinger, Paul D; White, Benjamin A; Sinclair, Julia R; Chang, Yuchiao; Carignan, Sarah B; Brown, David F M

    2012-05-01

    Physician screening is one of many front-end interventions being implemented to improve emergency department (ED) efficiency. We aimed to quantify the operational and financial impact of this intervention at an urban tertiary academic center. We conducted a 2-year before-after analysis of a physician screening system at an urban tertiary academic center with 90 000 annual visits. Financial impact consisted of the ED and inpatient revenue generated from the incremental capacity and the reduction in left without being seen (LWBS) rates. The ED and inpatient margin contribution as well as capital expenditure were based on available published data. We summarized the financial impact using net present value of future cash flows performing sensitivity analysis on the assumptions. Operational outcome measures were ED length of stay and percentage of LWBS. During the first year, we estimate the contribution margin of the screening system to be $2.71 million and the incremental operational cost to be $1.86 million. Estimated capital expenditure for the system was $1 200 000. The NPV of this investment was $2.82 million, and time to break even from the initial investment was 13 months. Operationally, despite a 16.7% increase in patient volume and no decrease in boarding hours, there was a 7.4% decrease in ED length of stay and a reduction in LWBS from 3.3% to 1.8%. In addition to improving operational measures, the implementation of a physician screening program in the ED allowed for an incremental increase in patient care capacity leading to an overall positive financial impact. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  17. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  18. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  19. Teaching Russian Via Distance Learning, the EdNet Experience.

    Science.gov (United States)

    Zsiray, Stephen W., Jr.; And Others

    In Utah, the statewide distance education network (EdNet) enables students from five rural and suburban high schools to learn Russian and earn college credits. Courses in Russian are offered through a partnership involving the Cache County School District, Utah State University, and the Utah State Office of Education. Classes are taught on one…

  20. EdF-Gaz de France. No merger without dismembering

    International Nuclear Information System (INIS)

    Lepetit, V.

    2007-01-01

    Gathering together the two historical French energy monopolies, Electricite de France (EdF) and Gaz de France (GdF), and warranting low electricity and gas prices is still an attractive idea for some political and syndicate representatives. However, such a merger would create a dominating position which is forbidden with respect to Brussels criteria. (J.S.)

  1. Mai alguses linastub dokfilm "Sinimäed" / Andris Feldmanis

    Index Scriptorium Estoniae

    Feldmanis, Andris, 1982-

    2006-01-01

    Valminud on 6-osalise ajaloodokumentaalide sarja "Kuum külm sõda" teine film "Sinimäed" : stsenaristid Kiur Aarma, Mart Laar, Eerik-Niiles Kross, Raimo Jõerand : režissöör Raimo Jõerand : Ruut Pictures

  2. lsnjbhakta@gmail.com A Comparative SEM-EDS Elemental

    African Journals Online (AJOL)

    Michael Horsfall

    effect on food production in terrestrial and aquatic compartment in ... Processing and SEM-EDS analysis of mud: In the laboratory, the ... and for SEM image observation was 15 kV, applying .... by weathering in the Omi acid clay deposit, Japan.

  3. Murray Pittock, ed., The Edinburgh Companion to Scottish Romanticism.

    Directory of Open Access Journals (Sweden)

    Manfred Malzahn

    2013-10-01

    Full Text Available Murray Pittock, ed., The Edinburgh Companion to Scottish Romanticism. Edinburgh: Edinburgh University Press, 2011. Pp. 251. ISBN 978-0-7486-3845-1 (hardback. £ 65.00. ISBN 978-0-7486-3846-8 (paperback. £ 21.99.

  4. Review: Sanya Osha (ed.), The Social Contract in Africa (2014)

    OpenAIRE

    Damian Chukwudi Ukwandu

    2014-01-01

    Review of the edited volume:Sanya Osha (ed.), The Social Contract in Africa, Pretoria: Africa Institute for South Africa, 2014, ISBN 978-0-7983-0444-3, 200 pages Besprechung des Sammelbandes:Sanya Osha (Hrsg.), The Social Contract in Africa, Pretoria: Africa Institute for South Africa, 2014, ISBN 978-0-7983-0444-3, 200 Seiten

  5. Psychological and psychopathological variables associated with eating disorders (ED

    Directory of Open Access Journals (Sweden)

    Antonio Fernández-Delgado

    2016-07-01

    Full Text Available Objective: The aim of this study was to compare some psychological and psychopathological variables usually associated with different types of patients with eating disorders (ED. A total of 22 variables (psychological, psychopathological and specifically related to TCA were analyzed in three groups of patients with anorexia nervosa (AN, bulimia nervosa (BN and eating disorders not otherwise specified (EDNOS. Method: The sample consisted of 76 patients diagnosed with ED (mean age 20.13 ± 6.28 years; 69 women and 7 men. The following questionnaires were administered: Rosenberg's Self-Esteem Scale (SES, Symptom Checklist-90-Revised (SCL-90-R, Beck's Depression Inventory (BDI, State-Trait Anxiety Inventory (STAI, Body Shape Questionnaire (BSQ, Body Appreciation Scale (BAS, Eating Disorder Inventory-2 (EDI-2 and Body Image Quality of Life Inventory (BIQLI-SP. Results: Generally no significant differences between groups, except for the variables related to the BSQ and EDI-2 questionnaires, were found. The study of the correlations among the different variables specifically related to eating disorders and others, showed differences between groups. Conclusions: The present study shows few differences with respect to psychopathological symptoms among the different types of ED. Bearing in mind future studies, it would be interesting to use a bigger sample size, to include more men, and to distinguish between restricted/purging types of ED.

  6. Using Telemedicine to Address Crowding in the ED.

    Science.gov (United States)

    Guss, Benjamin; Mishkin, David; Sharma, Rahul

    2016-11-01

    Some health systems are piloting telemedicine solutions in the ED to address crowding and decrease patient wait times. One new program, implemented at the Lisa Perry Emergency Center at New York Presbyterian (NYP) Weill Cornell Medical Center in New York, involves offering low-acuity patients the option of visiting an off-site physician via telemedicine hookup. Administrators note that the approach can get patients in and out of the ED within 30 minutes, and patients have thus far been highly satisfied with the approach. However, an earlier telemedicine program piloted at the University of San Diego Health System’s (UCSD) Hillcrest Hospital in 2013 got bogged down due to administrative and insurance reimbursement hurdles, although the approach showed enough promise that there is interest in restarting the program. In the NYP program, patients are identified as appropriate candidates for the program at triage. They can opt to be seen remotely or through traditional means in the ED’s fast-track section. Administrators note that patients with complex problems requiring extensive workups are not suitable for the telemedicine approach. The most challenging aspect of implementing a successful telemedicine program in the ED is getting the workflows right, according to administrators. An earlier ED-based telemedicine program piloted at UCSD ran into difficulties because the model required the involvement of two physicians, and some insurers did not want to pay for the telemedicine visits. However, patients were receptive.

  7. Occupational stress in the ED: a systematic literature review.

    Science.gov (United States)

    Basu, Subhashis; Qayyum, Hasan; Mason, Suzanne

    2017-07-01

    Occupational stress is a major modern health and safety challenges. While the ED is known to be a high-pressure environment, the specific organisational stressors which affect ED staff have not been established. We conducted a systematic review of literature examining the sources of organisational stress in the ED, their link to adverse health outcomes and interventions designed to address them. A narrative review of contextual factors that may contribute to occupational stress was also performed. All articles written in English, French or Spanish were eligible for conclusion. Study quality was graded using a modified version of the Newcastle-Ottawa Scale. Twenty-five full-text articles were eligible for inclusion in our systematic review. Most were of moderate quality, with two low-quality and two high-quality studies, respectively. While high demand and low job control were commonly featured, other studies demonstrated the role of insufficient support at work, effort-reward imbalance and organisational injustice in the development of adverse health and occupational outcomes. We found only one intervention in a peer-reviewed journal evaluating a stress reduction programme in ED staff. Our review provides a guide to developing interventions that target the origins of stress in the ED. It suggests that those which reduce demand and increase workers' control over their job, improve managerial support, establish better working relationships and make workers' feel more valued for their efforts could be beneficial. We have detailed examples of successful interventions from other fields which may be applicable to this setting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. TrED: the Trichophyton rubrum Expression Database

    Directory of Open Access Journals (Sweden)

    Liu Tao

    2007-07-01

    Full Text Available Abstract Background Trichophyton rubrum is the most common dermatophyte species and the most frequent cause of fungal skin infections in humans worldwide. It's a major concern because feet and nail infections caused by this organism is extremely difficult to cure. A large set of expression data including expressed sequence tags (ESTs and transcriptional profiles of this important fungal pathogen are now available. Careful analysis of these data can give valuable information about potential virulence factors, antigens and novel metabolic pathways. We intend to create an integrated database TrED to facilitate the study of dermatophytes, and enhance the development of effective diagnostic and treatment strategies. Description All publicly available ESTs and expression profiles of T. rubrum during conidial germination in time-course experiments and challenged with antifungal agents are deposited in the database. In addition, comparative genomics hybridization results of 22 dermatophytic fungi strains from three genera, Trichophyton, Microsporum and Epidermophyton, are also included. ESTs are clustered and assembled to elongate the sequence length and abate redundancy. TrED provides functional analysis based on GenBank, Pfam, and KOG databases, along with KEGG pathway and GO vocabulary. It is integrated with a suite of custom web-based tools that facilitate querying and retrieving various EST properties, visualization and comparison of transcriptional profiles, and sequence-similarity searching by BLAST. Conclusion TrED is built upon a relational database, with a web interface offering analytic functions, to provide integrated access to various expression data of T. rubrum and comparative results of dermatophytes. It is devoted to be a comprehensive resource and platform to assist functional genomic studies in dermatophytes. TrED is available from URL: http://www.mgc.ac.cn/TrED/.

  9. Characterising non-urgent users of the emergency department (ED: A retrospective analysis of routine ED data.

    Directory of Open Access Journals (Sweden)

    Colin O'Keeffe

    Full Text Available The pressures of patient demand on emergency departments (EDs continue to be reported worldwide, with an associated negative impact on ED crowding and waiting times. It has also been reported that a proportion of attendances to EDs in different international systems could be managed in settings such as primary care. This study used routine ED data to define, measure and profile non-urgent ED attendances that were suitable for management in alternative, non-emergency settings.We undertook a retrospective analysis of three years of Hospital Episode and Statistics Accident Emergency (HES A&E data for one large region in England, United Kingdom (April 1st 2011 to March 31st 2014. Data was collected on all adult (>16 years ED attendances from each of the 19 EDs in the region. A validated process based definition of non-urgent attendance was refined for this study and applied to the data. Using summary statistics non-urgent attenders were examined by variables hypothesised to influence them as follows: age at arrival, time of day and day of week and mode of arrival. Odds ratios were calculated to compare non-urgent attenders between groups.There were 3,667,601 first time attendances to EDs, of which 554,564 were defined as non-urgent (15.1%. Non-urgent attendances were significantly more likely to present out of hours than in hours (OR = 1.19, 95% CI: 1.18 to 1.20, P<0.001. The odds of a non-urgent attendance were significantly higher for younger patients (aged 16-44 compared to those aged 45-64 (odds ratio: 1.42, 95% CI: 1.41 to 1.43, P<0.001 and the over 65's (odds ratio: 3.81, 95% CI: 3.78 to 3.85, P<0.001. Younger patients were significantly more likely to attend non-urgently out of hours compared to the 45-64's (OR = 1.24, 95% CI: 1.22 to 1.25, P<0.001 and the 65+'s (OR = 1.38, 95% CI: 1.35 to 1.40, P<0.001. 110,605/554,564 (19.9% of the non-urgent attendances arrived by ambulance, increasing significantly out of hours versus in hours (OR = 2

  10. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  11. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  12. Safe Handling of Snakes in an ED Setting.

    Science.gov (United States)

    Cockrell, Melanie; Swanson, Kristofer; Sanders, April; Prater, Samuel; von Wenckstern, Toni; Mick, JoAnn

    2017-01-01

    Efforts to improve consistency in management of snakes and venomous snake bites in the emergency department (ED) can improve patient and staff safety and outcomes, as well as improve surveillance data accuracy. The emergency department at a large academic medical center identified an opportunity to implement a standardized process for snake disposal and identification to reduce staff risk exposure to snake venom from snakes patients brought with them to the ED. A local snake consultation vendor and zoo Herpetologist assisted with development of a process for snake identification and disposal. All snakes have been identified and securely disposed of using the newly implemented process and no safety incidents have been reported. Other emergency department settings may consider developing a standardized process for snake disposal using listed specialized consultants combined with local resources and suppliers to promote employee and patient safety. Copyright © 2017 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

  13. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  14. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  15. MobilED: a step backwards to look ahead

    CSIR Research Space (South Africa)

    Van Den Berg, M

    2008-10-01

    Full Text Available Psychology, 52(3), 476-485. Gamache, P. (2002). University Students as Creators of Personal Knowledge: an alternative epistemological view. Teaching in Higher Education, 7(3), 277. Garcia, L., & Quek, F. (1997). Qualitative research in information systems... Kenney & N. Nieveen (Eds.), Educational Design Research (pp. 52-67). London: Routledge. Reeves, T. C., Herrington, J., & Olivier, R. (2005). Design Research: A Socially Responsible Approach to Instructional Technology Research in Higher Education...

  16. Attività antimicrobica, antivirale ed immunomodulante di peptidi anticorpali

    OpenAIRE

    Ciociola, Tecla

    2011-01-01

    Il progetto complessivo si è proposto di studiare le potenzialità immunoterapeutiche ed immunomodulanti di peptidi sintetici di derivazione anticorpale. I peptidi correlati ai CDR e molti decapeptidi, rappresentanti la regione variabile di un Ab anti-idiotipico ricombinante immagine interna di una tossina killer di lievito, hanno esibito attività fungicida in vitro nei confronti di Candida albicans. Un derivato alaninico di un decapeptide candidacida ha mostrato una incrementata efficacia ter...

  17. Azione citodifferenziante ed antitumorale dell'acido ellagico

    OpenAIRE

    Vanella, Luca

    2011-01-01

    Il lavoro ha lo scopo di valutare l'effetto citodifferenziante ed antitumorale dell'acido ellagico in tre diverse linee cellulari prostatiche a diverso grado di invasivita' (DU145, LnCap, BPH1). I risultati della Cromogranina A e della P75 NGRF, ottenuti mediante immunofluorescenza, evidenziano un'azione citodifferenziante dell'acido ellagico in maniera dose dipendente. Inoltre i risultati dimostrano come l'acido ellagico abbia la capacita' di ridurre, in maniera dose dipendente, sia l'espres...

  18. ED utilization trends in sports-related traumatic brain injury.

    Science.gov (United States)

    Hanson, Holly R; Pomerantz, Wendy J; Gittelman, Mike

    2013-10-01

    Emergency department (ED) visits for sports-related traumatic brain injuries (TBIs) have risen. This study evaluated how the number and severity of admissions have changed as ED visits for sports-related TBIs have increased. A retrospective study of children aged 0 to 19 years at a level 1 trauma center was performed. Patients from 2002 to 2011 with a primary or secondary diagnosis of TBI were identified from the hospital's inpatient and outpatient trauma registries. Frequencies were used to characterize the population, χ(2) analysis was performed to determine differences between groups, and regression analysis looked at relationship between year and injury severity score or length of stay. Sport was responsible for injury in 3878 (15.4%) cases during the study period; 3506 (90.4%) were discharged from the hospital, and 372 (9.6%) were admitted. Seventy-three percent were male patients and 78% Caucasian; mean age was 13 ± 3.5 years. ED visits for sports-related TBIs increased 92% over the study period, yet there was no significant change (χ(2) = 9.8, df = 9, P = .37) in the percentage of children admitted. Mean injury severity score for those admitted decreased from 7.8 to 4.8 (β = -0.46; P = .006); length of stay trended downward (β = -0.05; P = .05). The percentage of children being admitted from the ED with sports-related TBI has not changed over the past 10 years. The severity of admitted sports-related TBI is decreasing. Additional research is needed to correlate these trends with other TBI mechanisms.

  19. A comparison of the analysis of REE-bearing phosphates by standardless EDS and standardised EDS and WDS

    International Nuclear Information System (INIS)

    Griffin, B.J.; Hancock, R.C.; Trautman, R.L.

    2002-01-01

    Full text: Current generation energy dispersive X-ray analysis systems EDS on SEM are user-friendly with 'simple' software interfaces. Minimal training is considered necessary for operation. One aim of this study was to test this hypothesis. The second aim, as a part of other studies, was to compare the results of the x-ray microanalysis of a suite of rare earth element (REE) bearing standard glasses and also a suite of rare earth element (REE) bearing phosphate mineral grains using different analytical systems. Our results from the same sample mounts have been obtained using three analytical systems: an Oxford Instruments ISIS EDS on a JEOL 6400 SEM, a Noran Voyager EDS on a JEOL 6400 SEM and a Moran Scientific WDS package on a JEOL 6400 SEM. A total of forty nine natural mineral grains have been analysed for twenty-two elements, including the REE, Ca, P and F (where possible) by each analytical system. Additional analyses were obtained from simple REE-bearing glass standards, each containing only one REE at around 11 wt %. The natural mineral grain results obtained from the different analytical systems show a number of significant variations. The two EDS datasets are comparable in terms of total REE but generally are a factor of two less than the WDS dataset. Internally the EDS datasets differ in that one set shows consistently a strong negative yttrium oxide result (typically -1 wt %) due to an excessive correction for a strong phosphorus overlap (Ka on La) whereas the second dataset shows the reverse with typically 1 wt % yttrium oxide reported, as a result of inadequate correction of the phosphorus overlap. Major elements are comparable between the standard-based datasets but not with the standardless dataset although all show similar reproducibility. The standard glass results are more coherent and consistent, as would be expected from the simpler composition and higher abundances. One clear outcome from these data is that complex compositions where

  20. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  1. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  2. Active Intervention Can Decrease Burnout In Ed Nurses.

    Science.gov (United States)

    Wei, Rong; Ji, Hong; Li, Jianxin; Zhang, Liyao

    2017-03-01

    The aim of this study was to evaluate whether active intervention can decrease job burnout and improve performance among ED nurses. This study was carried out in the emergency departments of 3 hospitals randomly selected from 8 comprehensive high-level hospitals in Jinan, China. A total of 102 nurses were enrolled and randomly divided into control and intervention groups. For 6 months, nurses in intervention groups were treated with ordinary treatment plus comprehensive management, whereas nurses in the control group were treated with ordinary management, respectively. Questionnaires were sent and collected at baseline and at the end of the study. The Student t test was used to evaluate the effect of comprehensive management in decreasing burnout. All ED nurses showed symptoms of job burnout at different levels. Our data indicated that comprehensive management significantly decreased emotional exhaustion and depersonalization (P burnout in ED nurses and contribute to relieving work-related stress and may further protect against potential mental health problems. Copyright © 2016 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

  3. The implementation of Mask-Ed: reflections of academic participants.

    Science.gov (United States)

    Reid-Searl, Kerry; Levett-Jones, Tracy; Cooper, Simon; Happell, Brenda

    2014-09-01

    This paper profiles the findings from a study that explored the perspectives and experiences of nurse educators who implemented a novel simulation approach termed Mask-Ed. The technique involves the educator wearing a silicone mask and or body parts and transforming into a character. The premise of this approach is that the masked educator has domain specific knowledge related to the simulation scenario and can transmit this to learners in a way that is engaging, realistic, spontaneous and humanistic. Nurse educators charged with the responsibility of implementing Mask-Ed in three universities were invited to participate in the study by attending an introductory workshop, implementing the technique and then journaling their experiences, insights and perspectives over a 12 month period. The journal entries were then thematically analysed. Key themes were categorised under the headings of Preparation, Implementation and Impact; Reflexivity and Responsiveness; Student Engagement and Ownership; and Teaching and Learning. Mask-Ed is a simulation approach which allows students to interact with the 'characters' in humanistic ways that promote person-centred care and therapeutic communication. This simulation approach holds previously untapped potential for a range of learning experiences, however, to be effective, adequate resourcing, training, preparation and practice is required. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Impact of prospective verification of intravenous antibiotics in an ED.

    Science.gov (United States)

    Hunt, Allyson; Nakajima, Steven; Hall Zimmerman, Lisa; Patel, Manav

    2016-12-01

    Delay in appropriate antibiotic therapy is associated with an increase in mortality and prolonged length of stay. Automatic dispensing machines decrease the delivery time of intravenous (IV) antibiotics to patients in the emergency department (ED). However, when IV antibiotics are not reviewed by pharmacists before being administered, patients are at risk for receiving inappropriate antibiotic therapy. The objective of this study was to determine if a difference exists in the time to administration of appropriate antibiotic therapy before and after implementation of prospective verification of antibiotics in the ED. This retrospective, institutional review board-approved preimplementation vs postimplementation study evaluated patients 18years or older who were started on IV antibiotics in the ED. Patients were excluded if pregnant, if the patient is a prisoner, if no cultures were drawn, or if the patient was transferred from an outside facility. Appropriate antibiotic therapy was based on empiric source-specific evidence-based guidelines, appropriate pharmacokinetic and pharmacodynamic properties, and microbiologic data. The primary end point was the time from ED arrival to administration of appropriate antibiotic therapy. Of the 1628 evaluated, 128 patients met the inclusion criteria (64 pre vs 64 post). Patients were aged 65.2±17.0years, with most of infections being pneumonia (44%) and urinary tract infections (18%) and most patients being noncritically ill. Time to appropriate antibiotic therapy was reduced in the postgroup vs pregroup (8.1±8.6 vs 15.2±22.8hours, respectively, P=.03). In addition, appropriate empiric antibiotics were initiated more frequently after the implementation (92% post vs 66% pre; P=.0001). There was no difference in mortality or length of stay between the 2 groups. Prompt administration of the appropriate antibiotics is imperative in patients with infections presenting to the ED. The impact of prospective verification of

  5. Analysis of microtraces in invasive traumas using SEM/EDS.

    Science.gov (United States)

    Vermeij, E J; Zoon, P D; Chang, S B C G; Keereweer, I; Pieterman, R; Gerretsen, R R R

    2012-01-10

    Scanning electron microscopy in combination with energy-dispersive X-ray spectrometry (SEM/EDS) is a proven forensic tool and has been used to analyze several kinds of trace evidence. A forensic application of SEM/EDS is the examination of morphological characteristics of tool marks that tools and instruments leave on bone. The microtraces that are left behind by these tools and instruments on the bone are, however, often ignored or not noticed at all. In this paper we will describe the use of SEM/EDS for the analysis of microtraces in invasive sharp-force, blunt-force and bone-hacking traumas in bone. This research is part of a larger multi-disciplinary approach in which pathologists, forensic anthropologists, toolmark and microtrace experts work together to link observed injuries to a suspected weapon or, in case of an unknown weapon, to indicate a group of objects that could have been used as a weapon. Although there are a few difficulties one have to consider, the method itself is rather simple and straightforward to apply. A sample of dry and clean bone is placed into the SEM sample chamber and brightness and contrast are set such that bone appears grey, metal appears white and organic material appears black. The sample is then searched manually to find relevant features. Once features are found their elemental composition is measured by an energy dispersive X-ray spectrometer (EDS). This method is illustrated using several cases. It is shown that SEM/EDS analysis of microtraces in bone is a valuable tool to get clues about an unknown weapon and can associate a specific weapon with injuries on the basis of appearance and elemental composition. In particular the separate results from the various disciplines are complementary and may be combined to reach a conclusion with a stronger probative value. This is not only useful in the courtroom but above all in criminal investigations when one have to know for what weapon or object to look for. Copyright © 2011

  6. Self-Esteem and Emotional Intelligence among B.Ed Trainees of Tsunami Affected Coastal Belt

    Science.gov (United States)

    Babu M, Sameer

    2008-01-01

    Through this study the author investigates the relationship between self-esteem and emotional intelligence among B.Ed trainees of Tsunami affected coastal belt of Alappey district of Kerala, India. Stream of study, marital status and age based comparisons were made among the B.Ed trainees. 92 B.Ed trainees were the participants in the study. It…

  7. 34 CFR 110.1 - What is the purpose of ED's age discrimination regulations?

    Science.gov (United States)

    2010-07-01

    ... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 110.1 What is the purpose of ED's age discrimination regulations? The purpose of these regulations is to set out ED's rules for implementing the Age... 34 Education 1 2010-07-01 2010-07-01 false What is the purpose of ED's age discrimination...

  8. Mortal waiting for EdF and Gaz de France

    International Nuclear Information System (INIS)

    Jemain, A.

    2003-01-01

    Electricite de France (EdF) and Gaz de France (GdF) utilities have announced important investment programs for the forthcoming opening of gas and electricity markets to 2.5 millions of professionals by July 1, 2004. However, nothing can be done before the approval of the French government has been given for the change of their statuses (from the industrial and commercial public company status to the anonymous company status) and for the opening of their capital. Short paper. (J.S.)

  9. Open digital badges in Open edX

    OpenAIRE

    Hickey, Daniel T.; Barba, Lorena A.; Lemoie, Kerri; Amigot, Michael; Ewens, Damian

    2014-01-01

    Slides for the presentation at the Open edX Conference, Cambridge, MA 2014.   This talk presented the first public update of our collaboration to implement open digital badges in Dr. Barba's new MOOC, "Practical Numerical Methods with Python." It's a collaboration between Indiana University's Center for Research on Learning and Technology (led by Prof. Daniel T. Hickey);  Prof. Lorena Barba and her team at George Washington University, with her partners at IBL Studios Education, and...

  10. Esther Schor, ed. The Cambridge Companion to Mary Shelley

    Directory of Open Access Journals (Sweden)

    Anne BERTON

    2006-06-01

    Full Text Available “Today, whether she is found between staid cloth covers, in paperback, on the screen or in cyberspace, Mary Shelley is everywhere,” writes Esther Schor in her Introduction to this collection of essays (2. Interest in “the Author of Frankenstein” and of other works has grown steadily over the last twenty years, thanks notably to the publication of her Journals (The Journals of Mary Shelley, 1814-1844, ed. Paula R. Feldman and Diana Scott-Kilvert, 2 vols, Oxford: Clarendon, 1987, of her Lette...

  11. Bacteraemia in the ED: Are We Meeting Targets?

    LENUS (Irish Health Repository)

    Borhan, N

    2018-03-01

    When sepsis is identified early in the Emergency Department (ED) and its severe form is treated aggressively with the protocolised care bundle of early goal directed therapy (EGDT), improvements in mortality are significant1,2. Surviving sepsis guidelines recommend the administration of effective intravenous antimicrobials within the first hour of recognition of septic shock and severe sepsis without septic shock3. The Mater University Hospital has antimicrobial guidelines to guide empiric prescribing in adult sepsis available on the hospital intranet and on a smartphone app.

  12. The law that threatens EdF's monopoly

    International Nuclear Information System (INIS)

    Dupin, L.

    2010-01-01

    The French house of commons has examined the bill about the new organisation of the French electricity market (Nome in French). Its goal is to reform the actual market and to create a real competition. The bill has five stakes: to put an end to the European dispute, to give to EdF's competitors an access to its nuclear production, to improve the management of consumption peaks, to harmonize the generation and the consumption prices, to prepare the French market to the real competition. (J.S.)

  13. Offensive strategy: Suez wants to hustle EdF

    International Nuclear Information System (INIS)

    Jemain, A.

    2003-01-01

    Using Electrabel, its new energy pole, the private company Suez is looking for multiple ways of entry to reinforce its positions in France in the gas and electric power sectors in the prospect of the complete opening of energy markets in 2004. This article analyzes the strategy of Suez to become the most credible challenger of EdF, the French historical national electric utility: reorganization of its industrial and commercial activities, gain of new clients and definition of a new strategy for the gas market. (J.S.)

  14. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  15. The ED use and non-urgent visits of elderly patients

    OpenAIRE

    Gulacti, Umut; Lok, Ugur; Celik, Murat; Aktas, Nurettin; Polat, Haci

    2016-01-01

    Objective: To evaluate the use of the emergency department (ED) by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. Methods: This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. Results: A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patien...

  16. The ED use and non-urgent visits of elderly patients.

    Science.gov (United States)

    Gulacti, Umut; Lok, Ugur; Celik, Murat; Aktas, Nurettin; Polat, Haci

    2016-12-01

    To evaluate the use of the emergency department (ED) by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patients was higher than their representation within the general population (p elderly patients visiting polyclinics was 15.8%, the rate of elderly patients visiting the ED was 24.3% (p elderly age groups (p elderly population (17.5%, CI: 17.1-17.9). The proportion of ED visits for non-urgent conditions was 23.4%. Most of the ED visits were during the non-business hours (51.1%), and they were highest in the winter season (25.9%) and in January (10.2%). The hospitalization rate was 9.4%, and 37.9% of hospitalized patients were admitted to intensive care units. The proportion of ED visits by elderly patients was higher than their representation within the general population. Elderly patients often visited the ED instead of a polyclinic. The rate of inappropriate ED use by elderly patients in this hospital was higher than in other countries.

  17. The relative contribution of provider and ED-level factors to variation among the top 15 reasons for ED admission.

    Science.gov (United States)

    Khojah, Imad; Li, Suhui; Luo, Qian; Davis, Griffin; Galarraga, Jessica E; Granovsky, Michael; Litvak, Ori; Davis, Samuel; Shesser, Robert; Pines, Jesse M

    2017-09-01

    We examine adult emergency department (ED) admission rates for the top 15 most frequently admitted conditions, and assess the relative contribution in admission rate variation attributable to the provider and hospital. This was a retrospective, cross-sectional study of ED encounters (≥18years) from 19 EDs and 603 providers (January 2012-December 2013), linked to the Area Health Resources File for county-level information on healthcare resources. "Hospital admission" was the outcome, a composite of inpatient, observation, or intra-hospital transfer. We studied the 15 most commonly admitted conditions, and calculated condition-specific risk-standardized hospital admission rates (RSARs) using multi-level hierarchical generalized linear models. We then decomposed the relative contribution of provider-level and hospital-level variation for each condition. The top 15 conditions made up 34% of encounters and 49% of admissions. After adjustment, the eight conditions with the highest hospital-level variation were: 1) injuries, 2) extremity fracture (except hip fracture), 3) skin infection, 4) lower respiratory disease, 5) asthma/chronic obstructive pulmonary disease (A&C), 6) abdominal pain, 7) fluid/electrolyte disorders, and 8) chest pain. Hospital-level intra-class correlation coefficients (ICC) ranged from 0.042 for A&C to 0.167 for extremity fractures. Provider-level ICCs ranged from 0.026 for abdominal pain to 0.104 for chest pain. Several patient, hospital, and community factors were associated with admission rates, but these varied across conditions. For different conditions, there were different contributions to variation at the hospital- and provider-level. These findings deserve consideration when designing interventions to optimize admission decisions and in value-based payment programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Improving ED specimen TAT using Lean Six Sigma.

    Science.gov (United States)

    Sanders, Janet H; Karr, Tedd

    2015-01-01

    Lean and Six Sigma are continuous improvement methodologies that have garnered international fame for improving manufacturing and service processes. Increasingly these methodologies are demonstrating their power to also improve healthcare processes. The purpose of this paper is to discuss a case study for the application of Lean and Six Sigma tools in the reduction of turnaround time (TAT) for Emergency Department (ED) specimens. This application of the scientific methodologies uncovered opportunities to improve the entire ED to lab system for the specimens. This case study provides details on the completion of a Lean Six Sigma project in a 1,000 bed tertiary care teaching hospital. Six Sigma's Define, Measure, Analyze, Improve, and Control methodology is very similar to good medical practice: first, relevant information is obtained and assembled; second, a careful and thorough diagnosis is completed; third, a treatment is proposed and implemented; and fourth, checks are made to determine if the treatment was effective. Lean's primary goal is to do more with less work and waste. The Lean methodology was used to identify and eliminate waste through rapid implementation of change. The initial focus of this project was the reduction of turn-around-times for ED specimens. However, the results led to better processes for both the internal and external customers of this and other processes. The project results included: a 50 percent decrease in vials used for testing, a 50 percent decrease in unused or extra specimens, a 90 percent decrease in ED specimens without orders, a 30 percent decrease in complete blood count analysis (CBCA) Median TAT, a 50 percent decrease in CBCA TAT Variation, a 10 percent decrease in Troponin TAT Variation, a 18.2 percent decrease in URPN TAT Variation, and a 2-5 minute decrease in ED registered nurses rainbow draw time. This case study demonstrated how the quantitative power of Six Sigma and the speed of Lean worked in harmony to improve

  19. EdF let Germans manage Stredoslovenska Energetika

    International Nuclear Information System (INIS)

    Janoska, J.

    2003-01-01

    According to provisions of privatisation and shareholders agreement Stredoslovenska energetika (SSE), a.s., Zilina should be managed by the largest European power concern Electricite de France (EdF). But so far, one year after the acquisition, the only French member of the Supervisory board is its Chairman Patrick Luccioni. The Board has 5 members and two of them are German - Peter Weis and Martin Konerman. The latter joined in September this year. He came to Slovakia after years spent in Boards of Hungarian distribution companies - Elmu in Budapest and Emasz in Miskolcz. The name of Peter Weis still can be found on the web page of Emasz on the list of members of Supervisory Board. Strategic partner in both the mentioned Hungarian distribution companies is the third largest player on the German energy market - Energie Baden-Wurttemberg (EnBW). The French concern with its 35-percent stake is the biggest individual shareholder of the EnBW. EdF is reassessing its international projects. Due to an investment embargo the French will not be among the prospects interested in acquisition of Slovenske elektrarne, a.s., Bratislava but the company management has also announced its intention to sell its minority stakes in northern and eastern Europe. The Paris head office of EdF announced its decision in the time when privatisation of Slovak distribution companies was culminating. And so in order to maintain its influence the 49-percent stake in SSE together with management control over the company will be transferred to EnBW. Spokeswoman of EnBW, Petra Wollmer did not say the company would not plan any acquisitions in area of its core business but stressed that these would have to be thoroughly examined. She did not wish to comment on any potential plans the company may have in Slovakia or that would relate to changes in the management bodies of SSE. Not even the Head of Communication Department of the Slovak distribution company, Pavel Muller was allowed to publish any

  20. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  1. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  2. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  3. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  4. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  5. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Proteste ed emancipazione alla frontiera europea. Il caso di Lampedusa

    Directory of Open Access Journals (Sweden)

    Annalisa Lendaro

    Full Text Available Riassunto Questo articolo si propone di approfondire a livello teorico i legami tra proteste ed emancipazione dei migranti senza status legale, che si trovano in situazione di detenzione amministrativa sull’isola italiana di Lampedusa. Il presente contributo mette in evidenza il fatto che l’agency dei migranti, seppur privi di libertà e di uno status legale, è determinante per sbloccare una situazione di crisi in un contesto simile allo stato di eccezione descritto da Agamben. Più precisamente, la protesta dei migranti di Lampedusa mostra in che modo la sospensione dello stato di diritto apra degli spiragli per, non solo denunciare l’ingiustizia di alcune norme, ma anche per agire.

  10. Expert knowledge in radiation protection. 2. rev. ed.

    International Nuclear Information System (INIS)

    Spang, A.

    1990-01-01

    This revised version of the first edition, which was published in 1983, incorporates the full scale of developments and changes made since then, as e.g.: the new Radiation Protection Ordinance, which introduces the concept and definition of effective dose, ED, and limits the maximum permissible occupational exposure to 400 mSv. Changes have become effective for instance in the transport regulations, in the regulations for radioactive waste delivery and collection, in the field of health physics, and with regard to activities under outside contract; b) the EURATOM basic standards and the new SI units: Becquerel and Sievert have replaced Curie and Rem; c) a number of ICRP recommendations, events and scientific results, which frequently make radiation protection more plausible, or sometimes even necessary; d) the new DIN standards and BMU regulations, which also are a valuable source of reference for the radiation protection officer. (orig./HP) [de

  11. EDS V25 containment vessel explosive qualification test report.

    Energy Technology Data Exchange (ETDEWEB)

    Rudolphi, John Joseph

    2012-04-01

    The V25 containment vessel was procured by the Project Manager, Non-Stockpile Chemical Materiel (PMNSCM) as a replacement vessel for use on the P2 Explosive Destruction Systems. It is the first EDS vessel to be fabricated under Code Case 2564 of the ASME Boiler and Pressure Vessel Code, which provides rules for the design of impulsively loaded vessels. The explosive rating for the vessel based on the Code Case is nine (9) pounds TNT-equivalent for up to 637 detonations. This limit is an increase from the 4.8 pounds TNT-equivalency rating for previous vessels. This report describes the explosive qualification tests that were performed in the vessel as part of the process for qualifying the vessel for explosive use. The tests consisted of a 11.25 pound TNT equivalent bare charge detonation followed by a 9 pound TNT equivalent detonation.

  12. EDS'09: 13th International Conference on Elastic & Diffractive Scattering

    CERN Document Server

    CERN. Geneva

    2009-01-01

    The series of International Conferences on Elastic and Diffractive Scattering was founded in 1985 in the picturesque old French town of Blois, famous for its XIV - XVIIth century château, inside of which the first meeting took place. Since then, meetings have been organised every two years in different places of the world: New York (1987), Evanston (1989), Isola d'Elba (1991), Providence (1993), Blois (1995), Seoul (1997), Protvino (1999), Prague (2001), Helsinki (2003), Blois (2005) and Hamburg (2007). The conference will focus on the most recent experimental and theoretical results in particle physics with an emphasis on Quantum Chromodynamics (QCD). http://cern.ch/eds09/ The conference agenda is now full. No further contributions can be accepted.

  13. Multiple metamorphoses for EdF and GdF

    International Nuclear Information System (INIS)

    Jemain, A.

    2004-01-01

    The draft of law, modifying the statute of the French electric and gas utilities, Electricite de France (EdF) and Gaz de France (GdF), that the French government has presented to the Council of State, mixes some European and French preoccupations. The reason is the urgency of the planning and the date line of July 1, 2004 with the opening of the gas and power markets to 3.5 millions of professionals. The draft includes the obligations and missions of public utility of both companies, the transposition of the European directives, the conclusions of the negotiation of retirement pensions with the syndicate organizations, and the transformation of both public companies into anonymous companies. Short paper. (J.S.)

  14. Competition at the attack of EdF's dams

    International Nuclear Information System (INIS)

    James, O.; Gateaud, P.; Dupin, L.

    2010-01-01

    The exploitation of French hydroelectric dams is at the eve of a big upheaval. EdF, the historical operator, and GdF Suez the French number two of hydropower generation are going to face the strong competition of the big European energy groups. France will open 20% of its hydroelectric potential to competition in order to be in agreement with the opening of energy markets imposed by the European Union, and to increase by 10% the hydroelectric power as requested by the French government policy. The candidates will have to fulfill 3 criteria: investing to increase production, reducing the environmental impacts, and accepting the principle of paying fees. However, some of the French dams suffer from serious pathologies and the health of thousands of small dams remains unknown because of the lack of available data. (J.S.)

  15. ED services: the impact of caring behaviors on patient loyalty.

    Science.gov (United States)

    Liu, Sandra S; Franz, David; Allen, Monette; Chang, En-Chung; Janowiak, Dana; Mayne, Patricia; White, Ruth

    2010-09-01

    This article describes an observational study of caring behaviors in the emergency departments of 4 Ascension Health hospitals and the impact of these behaviors on patient loyalty to the associated hospital. These hospitals were diverse in size and geography, representing 3 large urban community hospitals in metropolitan areas and 1 in a midsized city. Research assistants from Purdue University (West Lafayette, IN) conducted observations at the first study site and validated survey instruments. The Purdue research assistants trained contracted observers at the subsequent study sites. The research assistants conducted observational studies of caregivers in the emergency departments at 4 study sites using convenience sampling of patients. Caring behaviors were rated from 0 (did not occur) to 5 (high intensity). The observation included additional information, for example, caregiver roles, timing, and type of visit. Observed and unobserved patients completed exit surveys that recorded patient responses to the likelihood-to-recommend (loyalty) questions, patient perceptions of care, and demographic information. Common themes across all study sites emerged, including (1) the area that patients considered most important to an ED experience (prompt attention to their needs upon arrival to the emergency department); (2) the area that patients rated as least positive in their actual ED experience (prompt attention to their needs upon arrival to the emergency department); (3) caring behaviors that significantly affected patient loyalty (eg, making sure that the patient is aware of care-related details, working with a caring touch, and making the treatment procedure clearly understood by the patient); and (4) the impact of wait time to see a caregiver on patient loyalty. A number of correlations between caring behaviors and patient loyalty were statistically significant (P loyalty but that occurred least frequently. The study showed through factor analysis that some caring

  16. Softball injuries treated in US EDs, 1994 to 2010.

    Science.gov (United States)

    Birchak, John C; Rochette, Lynne M; Smith, Gary A

    2013-06-01

    Softball is a popular participant sport in the United States. This study investigated the epidemiology of softball injuries with comparisons between children and adults. Data from the National Electronic Injury Surveillance System for patients 7 years and older treated in an emergency department (ED) for a softball injury from 1994 through 2010 were analyzed. An estimated 2107823 (95% confidence interval [CI], 1736417-2479229) patients were treated in US EDs for a softball injury during the 17-year study period. The annual number of injuries decreased by 23.0% from 1994 to 2010 (P softball injuries increased significantly during the study period (P = .035). The most commonly injured body regions were the hand/wrist (22.2%) and face (19.3%). Being hit by a ball was the most common mechanism of injury (52.4%) and accounted for most of face (89.6%) and head (75.7%) injuries. Injuries associated with running (relative risk, 2.36; 95% CI, 1.97-2.82) and diving for a ball (relative risk, 4.61; 95% CI, 3.50-6.09) were more likely to occur among adult than pediatric patients. To our knowledge, this is the first study to investigate softball injuries using a nationally representative sample. Softball is a common source of injury among children and adults. Increased efforts are needed to promote safety measures, such as face guards, mouth guards, safety softballs, and break-away bases, to decrease these injuries. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. SED-ED, a workflow editor for computational biology experiments written in SED-ML.

    Science.gov (United States)

    Adams, Richard R

    2012-04-15

    The simulation experiment description markup language (SED-ML) is a new community data standard to encode computational biology experiments in a computer-readable XML format. Its widespread adoption will require the development of software support to work with SED-ML files. Here, we describe a software tool, SED-ED, to view, edit, validate and annotate SED-ML documents while shielding end-users from the underlying XML representation. SED-ED supports modellers who wish to create, understand and further develop a simulation description provided in SED-ML format. SED-ED is available as a standalone Java application, as an Eclipse plug-in and as an SBSI (www.sbsi.ed.ac.uk) plug-in, all under an MIT open-source license. Source code is at https://sed-ed-sedmleditor.googlecode.com/svn. The application itself is available from https://sourceforge.net/projects/jlibsedml/files/SED-ED/.

  18. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  19. RT-PCR Analysis of ED-A,ED-B, and IIICS Fibronectin Domains: A New Screening Marker For Bladder Cancer

    Directory of Open Access Journals (Sweden)

    M Ahmadi Javid

    2004-12-01

    Full Text Available Background: Fibronectin seems to play a very important role in the progression and invasion of bladder cancer. EDA, EDB, and IIICS domains of fibronectin are not expressed in the adult persons but they’re expressed in different cancers. The aim of this study is to investigate the mRNA of fibronectin in transitional carcinoma cells (TCC of bladder to study these domains. Methods: A total of 20 patients with known bladder cancer were studied. Two of them excluded since their excised tissues were not enough for both the pathological examination and RNA study. Another 20 (control group were normal volunteers who needed bladder operations. The excised tissue was immediately transferred to RNAlater (Ambion,TX. RNA was extracted via RNAWIZ (Ambion, TX. cDNA was made via RevertAid First Strand cDNA Synthesis Kit (Fermentas. PCR of the cDNAs was performed using primers for EDA, EDB, and IIICS (Eurogentec,Belgium. Results: For the first time, we present the expression of the oncofetal fibronectin mRNA in the transitional cell carcinoma of bladder. The high grade muscle invasive (G3T2 tumor, expressed ED-A, ED-B, and IIICS. Expression of ED-A, ED-B, and IIICS was confirmed in the two patients with G3T1 TCC. The four patients with G2Ta and G3Ta expressed both ED-A and ED-B. The four patients with G1T1 tumor expressed ED-A only, similar to the nine patients with G1Ta tumor. None of the normal volunteers expressed the oncofetal extra domains. The sensitivity of ED-A positive fibronectin RNA for detecting TCC of any kind is 100%, and of ED-B was only 35%. The specificity of ED-B positive fibronectin RNA for the high grade TCC is 100%. Conclusion: ED-A, ED-B, and IIICS could be used as useful markers for the diagnosis and following up of bladder carcinoma. Keywords: Transitional Cell Carcinoma, bladder cancer, fibronectin, RT-PCR, oncofetal.

  20. The ED use and non-urgent visits of elderly patients

    Directory of Open Access Journals (Sweden)

    Umut Gulacti

    2016-12-01

    Full Text Available Objective: To evaluate the use of the emergency department (ED by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. Methods: This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. Results: A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patients was higher than their representation within the general population (p < 0.001. While the rate of elderly patients visiting polyclinics was 15.8%, the rate of elderly patients visiting the ED was 24.3% (p < 0.001. For both genders, the rates of ED visits for patients between 65 and 74 years old was higher than for other elderly age groups (p < 0.001. The prevalence of upper respiratory tract infection (URTI was the highest within the elderly population (17.5%, CI: 17.1–17.9. The proportion of ED visits for non-urgent conditions was 23.4%. Most of the ED visits were during the non-business hours (51.1%, and they were highest in the winter season (25.9% and in January (10.2%. The hospitalization rate was 9.4%, and 37.9% of hospitalized patients were admitted to intensive care units. Conclusion: The proportion of ED visits by elderly patients was higher than their representation within the general population. Elderly patients often visited the ED instead of a polyclinic. The rate of inappropriate ED use by elderly patients in this hospital was higher than in other countries. Keywords: Non-urgent, Prevalence, Visit, Main disease, Elderly patient, Emergency department

  1. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  2. ED pharmacist monitoring of provider antibiotic selection aids appropriate treatment for outpatient UTI.

    Science.gov (United States)

    Lingenfelter, Erin; Drapkin, Zachary; Fritz, Kelly; Youngquist, Scott; Madsen, Troy; Fix, Megan

    2016-08-01

    We sought to determine whether an emergency department (ED) pharmacist could aid in the monitoring and correction of inappropriate empiric antibiotic selection for urinary tract infections in an outpatient ED population. Urine cultures with greater than 100 000 CFU/mL bacteria from the University of Utah Emergency Department over 1 year (October 2011-Sept 2012) were identified using our electronic medical record system. Per ED protocol, an ED pharmacist reviews all cultures and performs a chart review of patient symptoms, diagnosis, and discharge antibiotics to determine whether the treatment was appropriate. A retrospective review of this process was performed to identify how often inappropriate treatment was recognized and intervened on by an ED pharmacist. Of the 180 cultures included, a total of 42 (23%) of empiric discharge treatments were considered inappropriate and required intervention. In 35 (83%) of 42 patients, the ED pharmacist was able to contact the patient and make appropriate changes; the remaining 7 patients were unable to be contacted, and no change could be made in their treatment. A chart review of all urine cultures with greater than 100 000 CFU/mL performed by an ED pharmacist helped identify inappropriate treatment in 23% of patients discharged to home with the diagnosis of urinary tract infection. Of these patients who had received inappropriate treatment, an ED pharmacist was able to intervene in 83% of cases. These data highlight the role of ED pharmacists in improving patient care after discharge. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. 8 Different approaches needed to manage ED demand among different age-groups.

    Science.gov (United States)

    Rimmer, Melanie; Ablard, Suzanne; O'Keeffe, Colin; Mason, Suzanne

    2017-12-01

    A variety of interventions have been proposed to manage rising demand for Emergency and Urgent Care, described by an NHS England review as unsustainable in the long term. However it is unlikely that any suggested approach will be equally suitable for the diverse population of ED users.We aimed to understand the patterns of demand amongst different types of patients attending ED. We also sought to understand the intended and unintended effects of demand management initiatives. Our study combined insights from routine data, a survey of ED patients, and qualitative interviews with ED staff. This paper describes the results of our analysis of the interviews. We conducted semi-structured interviews with 25 ED and Urgent Care Centre staff across 7 hospital sites in Yorkshire and Humber between 25 April and 11 July 2016. The interview topic guide asked about 4 broad areas; job role, description of patients and their impact on demand, description of inappropriate attendance, and current/future initiatives to deal with rising demand. Interviews were transcribed verbatim and analysed using framework analysis. We analysed the results to identify groups of patients with different patterns of use of ED services. We also explored ED staff experiences of demand management initiatives, and their suggestions for future initiatives. Although we did not ask specifically about patients' age, our analysis revealed that ED staff categorised attenders as children and young people, working age people, and older people. These groups had different reasons for attendance, different routes to the ED, different rate of non-urgent attendance, and different issues driving demand. Staff also described variation in the time taken to treat patients of different ages, with the oldest and youngest patients described as requiring the most time.There was no consensus amongst staff about the effectiveness of initiatives for managing demand. A strikingly wide variety of initiatives were mentioned

  4. A preliminary examination of Loss of Control Eating Disorder (LOC-ED) in middle childhood.

    Science.gov (United States)

    Matherne, Camden E; Tanofsky-Kraff, Marian; Altschul, Anne M; Shank, Lisa M; Schvey, Natasha A; Brady, Sheila M; Galescu, Ovidiu; Demidowich, Andrew P; Yanovski, Susan Z; Yanovski, Jack A

    2015-08-01

    Loss of Control Eating Disorder (LOC-ED) has been proposed as a diagnostic category for children 6-12years with binge-type eating. However, characteristics of youth with LOC-ED have not been examined. We tested the hypothesis that the proposed criteria for LOC-ED would identify children with greater adiposity, more disordered eating attitudes, and greater mood disturbance than those without LOC-ED. Participants were 251 youth (10.29years±1.54, 53.8% female, 57.8% White, 35.5% Black, 2.0% Asian, 4.8% Hispanic, 53.0% overweight). Youth were interviewed regarding eating attitudes and behaviors, completed questionnaires to assess general psychopathology, and underwent measurements of body fat mass. Using previously proposed criteria for LOC-ED, children were classified as LOC-ED (n=19), LOC in the absence of the full disorder (subLOC, n=33), and youth not reporting LOC (noLOC, n=199). LOC-ED youth had higher BMIz (p=0.001) and adiposity (p=0.003) and reported greater disordered eating concerns (pdisordered eating attitudes (p=0.02). SubLOC youth had greater disordered eating concerns (pdisordered eating cognitions and anthropometric measures compared to youth without LOC-ED. Longitudinal studies are needed to determine if those with LOC-ED are at particularly increased risk for progression of disordered eating and excess weight gain. Published by Elsevier Ltd.

  5. A Preliminary Examination of Loss of Control Eating Disorder (LOC-ED) in Middle Childhood

    Science.gov (United States)

    Matherne, Camden E.; Tanofsky-Kraff, Marian; Altschul, Anne M.; Shank, Lisa M.; Schvey, Natasha A.; Brady, Sheila M.; Galescu, Ovidiu; Demidowich, Andrew P.; Yanovski, Susan Z.; Yanovski, Jack A.

    2015-01-01

    Loss of Control Eating Disorder (LOC-ED) has been proposed as a diagnostic category for children 6–12y with binge-type eating. However, characteristics of youth with LOC-ED have not been examined. We tested the hypothesis that the proposed criteria for LOC-ED would identify children with greater adiposity, more disordered eating attitudes, and greater mood disturbance than those without LOC-ED. Participants were 251 youth (10.29y ± 1.54, 53.8% female, 57.8 % White, 35.5% Black, 2.0% Asian, 4.8% Hispanic, 53.0% overweight). Youth were interviewed regarding eating attitudes and behaviors, completed questionnaires to assess general psychopathology, and underwent measurements of body fat mass. Using previously proposed criteria for LOC-ED, children were classified as LOC-ED (n = 19), LOC in the absence of the full disorder (subLOC, n = 33), and youth not reporting LOC (noLOC, n = 199). LOC-ED youth had higher BMIz (p = 0.001) and adiposity (p = 0.003) and reported greater disordered eating concerns (p eating attitudes (p = 0.02). SubLOC youth had greater disordered eating concerns (p eating cognitions and anthropometric measures compared to youth without LOC-ED. Longitudinal studies are needed to determine if those with LOC-ED are at particularly increased risk for progression of disordered eating and excess weight gain. PMID:25913008

  6. EBSD and EDS of nickel sulfide inclusions in glass

    International Nuclear Information System (INIS)

    Miflin, G.E.; Barry, J.C.

    2002-01-01

    Full text: A delayed phase transformation in small nickel sulfide inclusions can cause spontaneous fracture in toughened glass. Typically, a phase transformation within a 5 ?g nickel sulphide inclusion may break a window which weighs more than 50 kg. In most cases the nickel sulfide inclusions are detected only after window failure, although it is possible to detect the inclusions within intact glass. It is known that only type three nickel sulphide inclusions, that is, inclusions with a composition in the range Ni 7 S 6 to NiS 1.03 , break the glass. The solid-state phase transformation of alpha Ni 1-x S to beta NiS which induces a 2.5% volume increase has been given as the main reason for the spontaneous fracture. The aim of this present study is to investigate the crystal structure of phases within the type three inclusions using scanning electron microscopy (SEM) and electron backscatter diffraction (EBSD). With EBSD it is possible to map regions of alpha Ni 1-x S and to distinguish those regions from regions with beta Ni 1-x S when the elemental compositions of the two regions are identical. The inclusions of this study came from two sources. One set of inclusions were found at initiation-of-fracture in glass windows that had failed by spontaneous fracture, while the other set were found in intact windows. All of the inclusions came from windows on buildings in the Brisbane area. The EBSD analysis was done at 20kV with the stage tilted to 70 degrees on a Philips XL30 SEM with LaB 6 filament, and with attached Oxford/Link Opal camera and software. EBSD mapping was done for alpha nickel sulfide (Ni 1-x S), beta nickel sulphide (NiS), heazelwoodite (Ni 3 S 2 ), and godlevskite (Ni 9 S 8 ). The integration time was 1.3 seconds for each point. Colour coded crystal phase and grain orientation maps were produced. EDS analysis was also done on the Philips XL30 with attached EDAX EDS detector. We found that although the EBSD technique is successful in identifying alpha

  7. Hearing of Mr. Francois Roussely, President of EdF; Audition de M. Francois Roussely, President d'EdF

    Energy Technology Data Exchange (ETDEWEB)

    Roussely, F. [Electricite de France (EDF), 75 - Paris (France)

    2005-07-01

    This document is the proceedings of the hearing of F. Roussely, President of Electricite de France (EdF), at the commission of economic affairs of the French house of commons, about the advisability of the construction of the EPR (European pressurized reactor) demonstration plant and about its possible financing by EdF. In a first part, F. Roussely recalls the European context of deregulation of energy markets and its impact of the French electric power industry (opening of the French market, industrial and social actions of EdF, need of a new generation of nuclear reactor, preservation of EdF's energy mix, warranty of public utility, un-bundling between energy trade and distribution, EdF's turnover and profitability, EdF's foreign daughter companies). In a second part, F. Roussely answers a series of questions asked by the different members of the commission concerning the different points presented in the first part. (J.S.)

  8. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  9. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  10. Etica ed evoluzionismo: la proposta di Marc Hauser

    Directory of Open Access Journals (Sweden)

    Irene Pilloni

    2013-11-01

    Full Text Available Le recenti scoperte nell’ambito della psicologia evoluzionistica potrebbero offrire una risposta al dibattito sull’origine evoluzionistica della facoltà morale dell’Homo sapiens. In passato, il tentativo di spiegare il comportamento morale a partire dalla teoria dell’evoluzione è stato intrapreso dal padre fondatore dell’evoluzionismo Charles Darwin, successivamente da T.H. Huxley e da H. Spencer e infine dal sociobiologo E. Wilson a metà degli anni ‘70 del Novecento. Oggi questa impresa è stata ereditata dallo psicologo evoluzionista Marc Hauser, le cui indagini prendono avvio da un’analogia tra facoltà morale e facoltà linguistica. Questa analogia gli consente di affermare che la pluralità di codici morali adottati dagli uomini nelle differenti culture dipende da un numero limitato di principi morali, nello stesso modo in cui la varietà di lingue con cui gli uomini si esprimono, dipende da un numero limitato di principi linguistici universali. Dunque, sembrerebbe che l’evoluzione biologica abbia plasmato dei principi morali universali e uniformi che si presentano costanti in tutti gli uomini a prescindere dalla loro appartenenza culturale. Come vadano intesi i principi morali universali e quale rapporto intercorre tra di essi e i vari codici morali sarà l’argomento di questo saggio, il quale tenterà di analizzare la proposta di Marc Hauser all’interno della cornice dei rapporti tra etica ed evoluzionismo.

  11. Estimation of lens dose of radioactive isotopes using ED3

    Energy Technology Data Exchange (ETDEWEB)

    Song, Ha Jin; Ju, Yong Jin; Jang, Han; Kang, Kyeong Won; Chung, Woon Kwan [Chosun University, Gwangju (Korea, Republic of); Dong, Kyung Rae [Gwangju Health University, Gwangju (Korea, Republic of); Choi, Eun Jin; Kwak, Jong Gil [Dongshin University Graduate School, Naju (Korea, Republic of); Ryu, Jae Kwang [Asan Medical Center, Seoul (Korea, Republic of)

    2017-03-15

    It is suggested that the dose limit recommended in the Enforcement Decree of Korea's Nuclear Safety Act should not exceed 150 mSv per year for radiation workers. Recently, however, ICRP 118 report has suggested that the threshold dose of the lens should be reduced to 0.2⁓0.5 Gy and the mean dose should not exceed 50 mSv per year for an average of 20 mSv over 5 years. Based on these contents, '1'2'3I, '9'9mTc, and '1'8F-FDG, which are radioisotope drugs that are used directly by radiation workers in the nuclear medicine department in Korea are expected to receive a large dose of radiation in the lens in distribution and injection jobs to administer them to patients. The ED3 Active Extremity Dosimeter was used to measure the dose of the lens in the nuclear medicine and radiation workers and how much of the dose was received per 1 mCi.

  12. Verbo come elemento della frase in friulano ed in frances

    Directory of Open Access Journals (Sweden)

    David Bizjak

    2003-12-01

    Full Text Available Il presente lavoro e dedicato a una parte della sfera del verbo nel friulano  lettera­ rio della seconda meta del ventesimo secolo, alla perifrasi verbale e alla locuzione verbale. Nella definizione della perifrasi verbale (PV ho seguito il modello dei lin­ guisti spagnoli Javier Garcia Gonzales, Fernandez de Castro e Leonard Gomez Torrego, essendo ilpunto di partenza ilmio postulato che la PV rappresenti in friu­ lano una categoria grammaticale a parte o, almeno, una categoria in via di gramma­ ticalizzazione. Parallelamente alla situazione in friulano osservo quella nel francese scritto contemporaneo, con lo scopo di constatare delle eventuali somiglianze e diffe­ renze. Tenendo in considerazione la realta linguistica nella regione Friuli-Venezia Giulia, dove le interferenze fra l'italiano, il friulano ed il veneto sono tali che un non-friulanofono non riesce facilmente a distinguere quando si tratta di un sintag­ ma di origine friulana e quando di un calco sintattico sull'italiano, sembra oppor­ tuno, in numerosi casi, confrontare ilsintagma friulano e quello francese anche con la variante corrispondente in italiano letterario moderno; inoltre, nel capitolo in cui sono trattati i cosiddetti tempi bicomposti, vengono citati alcuni esempi nelle diver­ se varieta venete.

  13. Spazio, movimento, prospettiva ed empatia: un prototipo di videogame didattico

    Directory of Open Access Journals (Sweden)

    Pio Alfredo Di Tore

    2014-09-01

    Full Text Available Questo lavoro presenta la cornice teorica che sta alla base della progettazione di un videogame didattico pensato per valutare le abilità di perspective taking (capacità di adottare la prospettiva altrui e di mental rotation (rotazione mentale dei giocatori. Lo studio mira a rilevare come tali abilità siano coinvolte nella relazione empatica e a verificarne le implicazioni in campo educativo. Il lavoro adotta la definizione di empatia riconducibile ad Alain Berthoz ed alla teoria spaziale dell’empatia qui presentata con i relativi sistemi di riferimento spaziale. È inoltre fornita una rapida revisione della letteratura sulla rappresentazione dello spazio nel bambino e sulla rappresentazione dello spazio nel gioco (su base visiva. Infine, il lavoro descrive il prototipo di gioco – realizzato presso l’Università di Salerno – in cui il giocatore si trova alle prese con tre differenti compiti di cui due progettati per misurare le abilità di perspective taking mentre il terzo è calibrato sulle abilità di mental rotation.

  14. Strategies for Elevating the Public and Professional Regard of the Ed.D.

    Science.gov (United States)

    Guthrie, James W.; Marsh, David D.

    2009-01-01

    A nationwide strategy for improving Ed.D. programs is needed to overcome two important dilemmas that are typical in schools of education: low academic status for Ed.D. programs and an overreliance on tuition as a source of revenue. Other major hindrances are the lack of agreement about research-based standards, a weak alignment with other elements…

  15. Book Review: John M. Hobson and Leonard Seabrooke (2007) (eds) Everyday Politics of the World Economy

    DEFF Research Database (Denmark)

    Strange, Michael Stewart

    2009-01-01

    Book Review: John M. Hobson and Leonard Seabrooke (2007) (eds) Everyday Politics of the World Economy (Cambridge: Cambridge University Press), 254pp. Udgivelsesdato: 2009......Book Review: John M. Hobson and Leonard Seabrooke (2007) (eds) Everyday Politics of the World Economy (Cambridge: Cambridge University Press), 254pp. Udgivelsesdato: 2009...

  16. The University Supervisor, edTPA, and the New Making of the Teacher

    Science.gov (United States)

    Donovan, Martha K.; Cannon, Susan O.

    2018-01-01

    As university supervisors at a large, urban university in the southern US, we examined the ways that the Education Teacher Performance Assessment (edTPA) shaped the pedagogic relationships and decision-making processes of our students and ourselves during the spring of 2016. We situated this study of edTPA within the framework of critical policy…

  17. Unstandardized Responses to a "Standardized" Test: The edTPA as Gatekeeper and Curriculum Change Agent

    Science.gov (United States)

    Ledwell, Katherine; Oyler, Celia

    2016-01-01

    We examine edTPA (a teacher performance assessment) implementation at one private university during the first year that our state required this exam for initial teaching certification. Using data from semi-structured interviews with 19 teacher educators from 12 programs as well as public information on edTPA pass rates, we explore whether the…

  18. Multiple Intelligence and Digital Learning Awareness of Prospective B.Ed Teachers

    Science.gov (United States)

    Gracious, F. L. Antony; Shyla, F. L. Jasmine Anne

    2012-01-01

    The present study Multiple Intelligence and Digital Learning Awareness of prospective B.Ed teachers was probed to find the relationship between Multiple Intelligence and Digital Learning Awareness of Prospective B.Ed Teachers. Data for the study were collected using self made Multiple Intelligence Inventory and Digital Learning Awareness Scale.…

  19. Is There a Future for Teacher Ed Curriculum? An Answer from History and Moral Philosophy

    Science.gov (United States)

    Null, J. Wesley

    2008-01-01

    Is there a future for teacher ed "curriculum"? The author contends that he is not sure if there is a future for teacher ed curriculum, but if such a future is to exist, the answer will come only from history and moral philosophy. In this article, the author opines that individuals cannot make good decisions about the future of teacher ed…

  20. Connecting Teachers and Ed-Tech Developers: Lessons from NYC's "Gap App" Program. Technical Appendices

    Science.gov (United States)

    Villavicencio, Adriana; Siman, Nina; Lafayette, Camille; Kang, David

    2016-01-01

    In 2011, with support from a federal Investing in Innovation grant, the NYC Department of Education launched Innovate NYC Schools. The initiative was designed to address two, related challenges to effectively integrating education technology (ed-tech) into classrooms: First, procurement of ed-tech tools is often hampered by a disconnect between…

  1. Connecting Teachers and Ed-Tech Developers: Lessons from NYC's "Gap App" Program. Report

    Science.gov (United States)

    Villavicencio, Adriana; Siman, Nina; Lafayette, Camille; Kang, David

    2016-01-01

    In 2011, with support from a federal Investing in Innovation grant, the NYC Department of Education launched Innovate NYC Schools. The initiative was designed to address two, related challenges to effectively integrating education technology (ed-tech) into classrooms: First, procurement of ed-tech tools is often hampered by a disconnect between…

  2. EDs find physical therapists are an underused asset for musculoskeletal injuries, patient education.

    Science.gov (United States)

    2011-04-01

    Some EDs are finding that the unique skill sets offered by physical therapists (PT) can be an asset to emergency care while also improving the patient experience. Experts say PTs are particularly valuable in the management of musculoskeletal pain and injuries, but they are also being used for wound care, gait training, and balance assessment. ED administrators say consistent, daily coverage is essential to making a PT program successful; otherwise, ED clinicians will neglect to use their services. PTs need to be comfortable with proactively marketing their skills to other ED clinicians who may not be used to having access to this resource. Experts say PT services in the ED can be reimbursed at a level that is consistent with reimbursement in other inpatient and outpatient settings.

  3. Report from the commission about the industrial and financial project of EdF

    International Nuclear Information System (INIS)

    2004-01-01

    This report takes stock of the work carried out by the commission appointed by the French ministry of economy, finances and industry about the industrial and financial project of Electricite de France (EdF) in the framework of the liberalization of European energy markets. The report presents the conclusions of the commission about EdF's position in the new competition context, about the financial position of the group and about the foreseeable strategic options and their consequences in terms of equity fund needs. 5 appendixes present: the evolution of electricity prices, EdF and the energy policy, the electricity market and the competition in Europe, the EdF group: presentation and main adaptation stakes, the financial situation of EdF group. (J.S.)

  4. Toward reliable and repeatable automated STEM-EDS metrology with high throughput

    Science.gov (United States)

    Zhong, Zhenxin; Donald, Jason; Dutrow, Gavin; Roller, Justin; Ugurlu, Ozan; Verheijen, Martin; Bidiuk, Oleksii

    2018-03-01

    New materials and designs in complex 3D architectures in logic and memory devices have raised complexity in S/TEM metrology. In this paper, we report about a newly developed, automated, scanning transmission electron microscopy (STEM) based, energy dispersive X-ray spectroscopy (STEM-EDS) metrology method that addresses these challenges. Different methodologies toward repeatable and efficient, automated STEM-EDS metrology with high throughput are presented: we introduce the best known auto-EDS acquisition and quantification methods for robust and reliable metrology and present how electron exposure dose impacts the EDS metrology reproducibility, either due to poor signalto-noise ratio (SNR) at low dose or due to sample modifications at high dose conditions. Finally, we discuss the limitations of the STEM-EDS metrology technique and propose strategies to optimize the process both in terms of throughput and metrology reliability.

  5. A mechanistic nitrogen limitation model for CLM(ED)

    Science.gov (United States)

    Ali, A. A.; Xu, C.; McDowell, N. G.; Rogers, A.; Wullschleger, S. D.; Fisher, R.; Vrugt, J. A.

    2014-12-01

    Photosynthetic capacity is a key plant trait that determines the rate of photosynthesis; however, in Earth System Models it is either a fixed value or derived from a linear function of leaf nitrogen content. A mechanistic leaf nitrogen allocation model have been developed for a DOE-sponsored Community Land Model coupled to the Ecosystem Demography model (CLM-ED) to predict the photosynthetic capacity [Vc,max25 (μmol CO2 m-2 s-1)] under different environmental conditions at the global scale. We collected more than 800 data points of photosynthetic capacity (Vc,max25) for 124 species from 57 studies with the corresponding leaf nitrogen content and environmental conditions (temperature, radiation, humidity and day length) from literature and the NGEE arctic site (Barrow). Based on the data, we found that environmental control of Vc,max25 is about 4 times stronger than the leaf nitrogen content. Using the Markov-Chain Monte Carlo simulation approach, we fitted the collected data to our newly developed nitrogen allocation model, which predict the leaf nitrogen investment in different components including structure, storage, respiration, light capture, carboxylation and electron transport at different environmental conditions. Our results showed that our nitrogen allocation model explained 52% of variance in observed Vc,max25 and 65% variance in observed Jmax25 using a single set of fitted model parameters for all species. Across the growing season, we found that the modeled Vc,max25 explained 49% of the variability in measured Vc,max25. In the context of future global warming, our model predicts that a temperature increase by 5oC and the doubling of atmospheric carbon dioxide reduced the Vc,max25 by 5%, 11%, respectively.

  6. Results of EDS uranium samples characterization after hydrogen loading

    International Nuclear Information System (INIS)

    Chicea, D.; Dash, J.

    2003-01-01

    Several experiments of loading natural uranium foils with hydrogen were done. Electrolysis was used for loading hydrogen into uranium, because it is the most efficient way for H loading. The composition of the surface and near surface of the samples was determined using an Oxford EDS spectrometer on a Scanning Electron Microscope, manufactured by ISI. Images were taken with several magnifications up to 3.4KX. Results reveal that when low current density was used, the surface patterns changed from granules on the surface having a typical size of 2-4 microns to pits under the surface having a typical size under one micron. When high current density was used the surface changed and presented deep fissures. The deep fissures are the result of the mechanical strain induced by the lattice expansion caused by hydrogen absorption. The surface composition was determined before and after hydrogen loading. Uranium, thorium platinum and carbon concentration were measured. Experiments suggest that the amount of thorium increases on the uranium sample with the total electric charge transported through electrolyte. Carbon concentration was found to decrease on the surface of the sample as the total electric charge transported through electrolyte increased. Platinum is used in electrolysis experiment as anode primarily because it does not dissolve in electrolyte and therefore it is not electro-deposited on the cathode surface. The results of the platinum concentration measurements on the surface of the samples we loaded with hydrogen reveal that the platinum concentration increased dramatically as the current density increased and that created platinum spots on the cathode surface. Work is in progress on the subject. (authors)

  7. Improving performance in the ED through laboratory information exchange systems.

    Science.gov (United States)

    Raymond, Louis; Paré, Guy; Maillet, Éric; Ortiz de Guinea, Ana; Trudel, Marie-Claude; Marsan, Josianne

    2018-03-12

    The accessibility of laboratory test results is crucial to the performance of emergency departments and to the safety of patients. This study aims to develop a better understanding of which laboratory information exchange (LIE) systems emergency care physicians (ECPs) are using to consult their patients' laboratory test results and which benefits they derive from such use. A survey of 163 (36%) ECPs in Quebec was conducted in collaboration with the Quebec's Department of Health and Social Services. Descriptive statistics, chi-square tests, cluster analyses, and ANOVAs were conducted. The great majority of respondents indicated that they use several LIE systems including interoperable electronic health record (iEHR) systems, laboratory results viewers (LRVs), and emergency department information systems (EDIS) to consult their patients' laboratory results. Three distinct profiles of LIE users were observed. The extent of LIE usage was found to be primarily determined by the functional design differences between LIE systems available in the EDs. Our findings also indicate that the more widespread LIE usage, the higher the perceived benefits. More specifically, physicians who make extensive use of iEHR systems and LRVs obtain the widest range of benefits in terms of efficiency, quality, and safety of emergency care. Extensive use of LIE systems allows ECPs to better determine and monitor the health status of their patients, verify their diagnostic assumptions, and apply evidence-based practices in laboratory medicine. But for such benefits to be possible, ECPs must be provided with LIE systems that produce accurate, up-to-date, complete, and easy-to-interpret information.

  8. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  9. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  10. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  11. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  12. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  13. Mechanical Ventilation and ARDS in the ED: A Multicenter, Observational, Prospective, Cross-sectional Study.

    Science.gov (United States)

    Fuller, Brian M; Mohr, Nicholas M; Miller, Christopher N; Deitchman, Andrew R; Levine, Brian J; Castagno, Nicole; Hassebroek, Elizabeth C; Dhedhi, Adam; Scott-Wittenborn, Nicholas; Grace, Edward; Lehew, Courtney; Kollef, Marin H

    2015-08-01

    There are few data regarding mechanical ventilation and ARDS in the ED. This could be a vital arena for prevention and treatment. This study was a multicenter, observational, prospective, cohort study aimed at analyzing ventilation practices in the ED. The primary outcome was the incidence of ARDS after admission. Multivariable logistic regression was used to determine the predictors of ARDS. We analyzed 219 patients receiving mechanical ventilation to assess ED ventilation practices. Median tidal volume was 7.6 mL/kg predicted body weight (PBW) (interquartile range, 6.9-8.9), with a range of 4.3 to 12.2 mL/kg PBW. Lung-protective ventilation was used in 122 patients (55.7%). The incidence of ARDS after admission from the ED was 14.7%, with a mean onset of 2.3 days. Progression to ARDS was associated with higher illness severity and intubation in the prehospital environment or transferring facility. Of the 15 patients with ARDS in the ED (6.8%), lung-protective ventilation was used in seven (46.7%). Patients who progressed to ARDS experienced greater duration in organ failure and ICU length of stay and higher mortality. Lung-protective ventilation is infrequent in patients receiving mechanical ventilation in the ED, regardless of ARDS status. Progression to ARDS is common after admission, occurs early, and worsens outcome. Patient- and treatment-related factors present in the ED are associated with ARDS. Given the limited treatment options for ARDS, and the early onset after admission from the ED, measures to prevent onset and to mitigate severity should be instituted in the ED. ClinicalTrials.gov; No.: NCT01628523; URL: www.clinicaltrials.gov.

  14. ED50 and ED95 of Intrathecal Bupivacaine Coadministered with Sufentanil for Cesarean Delivery Under Combined Spinal-epidural in Severely Preeclamptic Patients

    Institute of Scientific and Technical Information of China (English)

    Fei Xiao; Wen-Ping Xu; Xiao-Min Zhang; Yin-Fa Zhang; Li-Zhong Wang; Xin-Zhong Chen

    2015-01-01

    Background:Spinal anesthesia was considered as a reasonable anesthetic option in severe preeclampsia when cesarean delivery is indicated,and there is no indwelling epidural catheter or contraindication to spinal anesthesia.However,the ideal dose of intrathecal bupivacaine has not been quantified for cesarean delivery for severe preeclamptic patients.This study aimed to determine the ED50 and ED95 of intrathecal bupivacaine for severely preeclamptic patients undergoing elective cesarean delivery.Methods:Two hundred severely preeclamptic patients are undergoing elective cesarean delivery under combined spinal-epidural anesthesia enrolled in this randomized,double-blinded,dose-ranging study.Patients received 4 mg,6 mg,8 mg,or 10 mg intrathecal hyperbaric bupivacaine with 2.5 μg sufentanil.Successful spinal anesthesia was defined as a T6 sensory level achieved within 10 minutes after intrathecal drug administration and/or no epidural supplement was required during the cesarean section.The ED50 and ED95 were calculated with a logistic regression model.Results:ED50 and ED95 ofintrathecal bupivacaine for successful spinal anesthesia were 5.67 mg (95% confidence interval [CI]:5.20-6.10 mg) and 8.82 mg (95% CI:8.14-9.87 mg) respectively.The incidence of hypotension in Group 8 mg and Group 10 mg was higher than that in Group 4 mg and Group 6 mg (P < 0.05).The sensory block was significantly different among groups 10 minutes after intrathecal injection (P < 0.05).The use of lidocaine in Group 4 mg was higher than that in other groups (P < 0.05).The use of phenylephrine in Group 8 mg and Group 10 mg was higher than that in the other two groups (P < 0.05).The lowest systolic blood pressure before the infant delivery of Group 8 mg and Group 10 mg was lower than the other two groups (P < 0.05).The satisfaction of muscle relaxation in Group 4 mg was lower than other groups (P < 0.05).There was no significant difference in patients' satisfaction and the newborns

  15. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  16. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

    Directory of Open Access Journals (Sweden)

    Ana V García

    2010-07-01

    Full Text Available An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1. In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

  18. Hispaania võib oma väed Iraagist ära tuua / Erkki Bahovski

    Index Scriptorium Estoniae

    Bahovski, Erkki, 1970-

    2004-01-01

    Hispaania parlamendivalimised võitnud sotsialistliku partei liider, arvatav uus peaminister Jose Luis Rodriguez Zapatero lubas Hispaania väed Iraagist ära tuua. Diagrammid: Hispaania valimistulemused

  19. Ekspert : "Väed Afganistanist välja!" / Aadu Hiietamm

    Index Scriptorium Estoniae

    Hiietamm, Aadu, 1954-

    2007-01-01

    Saksa kriisiekspert Peter Scholl-Latour on seisukohal, et välisväed peavad Afganistanist lahkuma, sest seni pole keegi suutnud seal sõda võita. P. Scholl-Latouri artiklist poliitikaajakirjas Cicero

  20. Review: G.-M. de Schryver et al. (Eds.). Oxford Bilingual School ...

    African Journals Online (AJOL)

    Abstract. G.-M. de Schryver et al. (Eds.). Oxford Bilingual School Dictionary: IsiXhosa and English. 2014, 562 pp. ISBN 978-0-19-576682-0. Cape Town: Oxford University Press Southern Africa. Price R129.95.

  1. Designing a Peer-Mentoring Program for Education Doctorate (EdD) Students

    OpenAIRE

    Kendra Lowery; Rachel Geesa; Kat McConnell

    2018-01-01

    Objectives: In preparation for creating a peer-mentoring program for education doctorate (EdD) students, we conducted a literature review to learn about the characteristics of peer-mentoring programs for graduate students and EdD students specifically. Method: Our search criteria included articles about peer mentoring for graduate students only; published in peer-reviewed journals since the year 2000; and about programs that involved more experienced students, students farther along in t...

  2. 2003 annual results of EdF group; Resultats annuels 2003 du groupe EDF

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-03-01

    The Electricite de France (EdF) group Board of Directors, meeting on March 11, 2004, under the Chairmanship of Francois Roussely, reviewed the audited consolidated financial statements for the year ended 12/31/2003. This document presents the consolidated results of EdF group for 2003: consolidated financial statements, highlights of the year, focus on 2003 events, commercial results, EDF in Europe and worldwide, EDF France highlights, key figures. (J.S.)

  3. Broad Categories for the Diagnosis of Eating Disorders (BCD-ED): An Alternative System for Classification

    OpenAIRE

    Walsh, B. Timothy; Sysko, Robyn

    2009-01-01

    Eating Disorder Not Otherwise Specified (EDNOS), a residual category in DSM-IV, is the most commonly used eating disorder diagnosis in clinical settings. However, the features of individuals with EDNOS are heterogeneous and difficult to characterize. A diagnostic scheme, termed Broad Categories for the Diagnosis of Eating Disorders (BCD-ED), is proposed to diminish use of the EDNOS category markedly while preserving the existing eating disorder categories. The BCD-ED scheme consists of three ...

  4. A Chinese translation of the EdFED-Q and assessment of equivalence.

    Science.gov (United States)

    Lin, Li-Chan; Chang, Chia-Chi

    2003-01-01

    The purpose of this study was to translate the Edinburgh Feeding Evaluation in Dementia Questionnaire (EdFED-Q) from the original English into a Chinese language version and to assess the equivalence of the English and Chinese EdFED-Q versions. To use a directly translated instrument without minimal explanation of the procedures for determining the equivalence between the original and secondary language instrument is questionable. Ensuring equivalence of a translated Chinese version of the EdFED-Q for patients with dementia is an essential prerequisite for identifying culturally specific expressions of feeding difficulty under investigation. Phase 1 consisted of experts doing the initial translation into Chinese and then English back-translations of the questionnaire. Six experts determined the equality of the Chinese and English versions, and five monolingual nurses provided information for the C-EdFED-Q. In phase 2, two bilingual gerontological nurses rated 33 residents with dementia to determine equivalence across time. In phase 3, three groups of bilingual nurses used the Chinese, English, and finally both versions simultaneously to judge a model case's feeding behavior on the videotape. In phase 1, the rating on the equality of the items on the Chinese and English versions was 0.969. In phase 2, kappa coefficients for all items on the C-EdFED-Q and E-EdFED-Q ranged from 0.44 to 1.00. In determining the consistency of the scores for the C-EdFED-Q and E-EdFED-Q between the two raters across time, the intraclass correlation coefficient for the absolute agreement was found to range from 0.85 to 0.90. In phase 3, except for items 6 and 9, all items showed no significant difference among the three groups. Further studies to assess the relationship between constructs and to compare it with known and predicted relationships are recommended.

  5. Point-of-Care Ultrasonography for Evaluation of Acute Dyspnea in the ED.

    Science.gov (United States)

    Zanobetti, Maurizio; Scorpiniti, Margherita; Gigli, Chiara; Nazerian, Peiman; Vanni, Simone; Innocenti, Francesca; Stefanone, Valerio T; Savinelli, Caterina; Coppa, Alessandro; Bigiarini, Sofia; Caldi, Francesca; Tassinari, Irene; Conti, Alberto; Grifoni, Stefano; Pini, Riccardo

    2017-06-01

    Acute dyspnea is a common symptom in the ED. The standard approach to dyspnea often relies on radiologic and laboratory results, causing excessive delay before adequate therapy is started. Use of an integrated point-of-care ultrasonography (PoCUS) approach can shorten the time needed to formulate a diagnosis, while maintaining an acceptable safety profile. Consecutive adult patients presenting with dyspnea and admitted after ED evaluation were prospectively enrolled. The gold standard was the final diagnosis assessed by two expert reviewers. Two physicians independently evaluated the patient; a sonographer performed an ultrasound evaluation of the lung, heart, and inferior vena cava, while the treating physician requested traditional tests as needed. Time needed to formulate the ultrasound and the ED diagnoses was recorded and compared. Accuracy and concordance of the ultrasound and the ED diagnoses were calculated. A total of 2,683 patients were enrolled. The average time needed to formulate the ultrasound diagnosis was significantly lower than that required for ED diagnosis (24 ± 10 min vs 186 ± 72 min; P = .025). The ultrasound and the ED diagnoses showed good overall concordance (κ = 0.71). There were no statistically significant differences in the accuracy of PoCUS and the standard ED evaluation for the diagnosis of acute coronary syndrome, pneumonia, pleural effusion, pericardial effusion, pneumothorax, and dyspnea from other causes. PoCUS was significantly more sensitive for the diagnosis of heart failure, whereas a standard ED evaluation performed better in the diagnosis of COPD/asthma and pulmonary embolism. PoCUS represents a feasible and reliable diagnostic approach to the patient with dyspnea, allowing a reduction in time to diagnosis. This protocol could help to stratify patients who should undergo a more detailed evaluation. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  6. Test Review: Gilliam, J. E. (2015), "Attention-Deficit/Hyperactivity Disorder Test" (2nd Ed) [Assessment Instrument]. Austin, TX: Pro-Ed.

    Science.gov (United States)

    Perdue, Elizabeth A.

    2016-01-01

    The "Attention-Deficit/Hyperactivity Disorder Test-Second Edition" (ADHDT-2) is published through Pro-Ed in Austin, Texas. It was formally published in 2014, following critical revisions of the ADHDT, the reportedly popular initial version of this test that was published in 1995. The ADHDT-2 purports to act as a screener for individuals…

  7. Effect of Job Specialization on the Hospital Stay and Job Satisfaction of ED Nurses.

    Science.gov (United States)

    Shamsi, Vahid; Mahmoudi, Hosein; Sirati Nir, Masoud; Babatabar Darzi, Hosein

    2016-02-01

    In recent decades, the increasing crowdedness of the emergency departments has posed various problems for patients and healthcare systems worldwide. These problems include prolonged hospital stay, patient dissatisfaction and nurse burnout or job dissatisfaction. The aim of this study was to investigate the effect of emergency department (ED) nurses' job specialization on their job satisfaction and the length of patient stay in the ED. This before-after quasi-experimental study was conducted from April to May 2014 at the Baqiyatallah Hospital, Tehran, Iran. Initially, 35 patients were recruited as controls and the length of their stay in the ED was measured in minutes via a chronometer; Moreover, nurses' job satisfaction was evaluated using the Mohrman-Cooke-Mohrman job satisfaction scale. Then, a job specialization intervention was developed based on the stabilization model. After that, 35 new patients were recruited to the treatment group and received specialized care services. Accordingly, the length of their stay in the ED was measured. Moreover, the same nurses' job satisfaction was re-evaluated after the study. The study intervention lasted one month. Data were analyzed using the SPSS software version 20 and statistical tests such as the Kolmogrov-Smirnov, the paired and the independent t, and chi-square tests. There was a significant difference between the two groups of patients concerning the length of their stay in the ED (P nurses had greater job satisfaction after the study (P job specialization intervention can improve nurses' satisfaction and relieve the crowdedness of the EDs.

  8. Solving the worldwide emergency department crowding problem - what can we learn from an Israeli ED?

    Science.gov (United States)

    Pines, Jesse M; Bernstein, Steven L

    2015-01-01

    ED crowding is a prevalent and important issue facing hospitals in Israel and around the world, including North and South America, Europe, Australia, Asia and Africa. ED crowding is associated with poorer quality of care and poorer health outcomes, along with extended waits for care. Crowding is caused by a periodic mismatch between the supply of ED and hospital resources and the demand for patient care. In a recent article in the Israel Journal of Health Policy Research, Bashkin et al. present an Ishikawa diagram describing several factors related to longer length of stay (LOS), and higher levels of ED crowding, including management, process, environmental, human factors, and resource issues. Several solutions exist to reduce ED crowding, which involve addressing several of the issues identified by Bashkin et al. This includes reducing the demand for and variation in care, and better matching the supply of resources to demands in care in real time. However, what is needed to reduce crowding is an institutional imperative from senior leadership, implemented by engaged ED and hospital leadership with multi-disciplinary cross-unit collaboration, sufficient resources to implement effective interventions, access to data, and a sustained commitment over time. This may move the culture of a hospital to facilitate improved flow within and across units and ultimately improve quality and safety over the long-term.

  9. A 5-year comparison of ED visits by homeless and nonhomeless patients.

    Science.gov (United States)

    Tadros, Allison; Layman, Shelley M; Brewer, Marissa Pantaleone; Davis, Stephen M

    2016-05-01

    A 2005 study examined emergency department (ED) utilization by homeless patients in the United States. Within the following 5 years, unemployment increased by 5%. The objective was to analyze changes in ED utilization between 2005 and 2010 by homeless patients and compare with nonhomeless visits. Data from the 2010 National Hospital Ambulatory Medical Care Survey were evaluated. Approximately 679854 visits were made by homeless patients, the majority of which were made by men (72.3%) and patients between the ages of 45 and 64 (50.5%). Homeless patients were twice as likely to be uninsured. ED visits by homeless patients had increased by 44% during the 5-year period. Arrival to the ED by ambulance increased by 14% between the study years, and homeless patients were less likely to be admitted. The number of visits by homeless patients in the ED increased proportionally to an overall increase in ED visits between 2005 and 2010. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Bio-EdIP: An automatic approach for in vitro cell confluence images quantification.

    Science.gov (United States)

    Cardona, Andrés; Ariza-Jiménez, Leandro; Uribe, Diego; Arroyave, Johanna C; Galeano, July; Cortés-Mancera, Fabian M

    2017-07-01

    Cell imaging is a widely-employed technique to analyze multiple biological processes. Therefore, simple, accurate and quantitative tools are needed to understand cellular events. For this purpose, Bio-EdIP was developed as a user-friendly tool to quantify confluence levels using cell culture images. The proposed algorithm combines a pre-processing step with subsequent stages that involve local processing techniques and a morphological reconstruction-based segmentation algorithm. Segmentation performance was assessed in three constructed image sets, comparing F-measure scores and AUC values (ROC analysis) for Bio-EdIP, its previous version and TScratch. Furthermore, segmentation results were compared with published algorithms using eight public benchmarks. Bio-EdIP automatically segmented cell-free regions from images of in vitro cell culture. Based on mean F-measure scores and ROC analysis, Bio-EdIP conserved a high performance regardless of image characteristics of the constructed dataset, when compared with its previous version and TScratch. Although acquisition quality of the public dataset affected Bio-EdIP segmentation, performance was better in two out of eight public sets. Bio-EdIP is a user-friendly interface, which is useful for the automatic analysis of confluence levels and cell growth processes using in vitro cell culture images. Here, we also presented new manually annotated data for algorithms evaluation. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The use of SEM/EDS method in mineralogical analysis of ordinary chondritic meteorite

    Directory of Open Access Journals (Sweden)

    Breda Mirtič

    2009-12-01

    Full Text Available The aim of this study was to evaluate the potential of scanning electron microscopy coupled with energy dispersiveX-ray spectroscopy (SEM/EDS for determination of mineral phases according to their stoichiometry and assessment of mineral composition of ordinary chondritic meteorite. For the purposes of this study, H3 type ordinary chondritic meteorite Abbott was selected. SEM/EDS allows identification and characterisation of mineralphases, whose size is below the resolution of an optical microscope. Mineral phases in chondrules and interstitial matrix were located in backscattered electron (BSE mode and were assessed from atomic proportions of constituent elements, obtained by the EDS analysis. SEM/EDS analyses of mineral phases showed that Abbott meteorite is characterised by Fe-rich (Fe, Ni-alloy kamacite, Fe-sulphide troilite or pyrrhotite, chromite, Mg-rich olivine, orthopyroxene bronzite or hypersthene, clinopyroxene Al-diopside, acid plagioclase oligoclase, accessory mineral chlorapatite and secondary minerals Fe-hydroxides (goethite or lepidocrocite. Results of semi-quantitative analyses confirmed that most of analysed mineralphases conform well to stoichiometric minerals with minor deviations of oxygen from stoichiometric proportions. Comparison between mineral phases in chondrules and interstitial matrix was also performed, however it showed no significant differences in elemental composition.Differences in chemical composition between minerals in interstitial matrix and chondrules are sometimes too small to be discernedby the SEM/EDS, therefore knowledge of SEM/EDS capabilities is important for correct interpretation of chondrite formation.

  12. Extensive FE-SEM/EDS, HR-TEM/EDS and ToF-SIMS studies of micron- to nano-particles in anthracite fly ash

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Joana [Centro de Geologia, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); DaBoit, Kátia [Institute of Environmental Research and Human Development, IPADHC, Capivari de Baixo, Santa Catarina (Brazil); Flores, Deolinda [Centro de Geologia, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Departamento de Geociências, Ambiente e Ordenamento do Território, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Kronbauer, Marcio A. [Laboratory of Environmental Researches and Nanotechnology Development, Centro Universitário La Salle, Victor Barreto, 2288 Centro 92010-000, Canoas, RS (Brazil); Silva, Luis F.O., E-mail: felipeqma@hotmail.com [Laboratory of Environmental Researches and Nanotechnology Development, Centro Universitário La Salle, Victor Barreto, 2288 Centro 92010-000, Canoas, RS (Brazil); Environmental Science and Nanotechnology Department, Catarinense Institute of Environmental Research and Human Development, IPADHC, Capivari de Baixo, Santa Catarina (Brazil)

    2013-05-01

    The generation of anthropogenic carbonaceous matter and mixed crystalline/amorphous mineral ultrafine/nano-particles in the 1 to 100 nm size range by worldwide coal power plants represents serious environmental problems due to their potential hazards. Coal fly ash (CFA) that resulted from anthracite combustion in a Portuguese thermal power plant was studied in this work. The physico-chemical characterization of ultrafine/nano-particles present in the CFA samples and their interaction with environment are the aim of this study. The methodologies applied for this work were field emission scanning electron microscopy (FE-SEM) with energy dispersive X-ray spectroscopy (EDS), high-resolution transmission electron microscopy with energy dispersive X-ray spectroscopy (HR-TEM/EDS) and time of flight secondary ion mass spectrometry (ToF-SIMS). Some hazardous volatile elements, C, N, S and Hg contents were also determined in the studied samples. Generally, the CFA samples comprise carbonaceous, glassy and metallic solid spheres with some containing mixed amorphous/crystalline phases. The EDS analysis coupled with the FE-SEM and HR-TEM observations of the fly ash particles with 100 to 0.1 nm demonstrates that these materials contain a small but significant proportion of encapsulated HVEs. In addition, the presence of abundant multi-walled carbon nanotubes (MWCNTs) and amorphous carbon particles, both containing hazardous volatile elements (HVEs), was also evidenced by the FE-SEM/EDS and HR-TEM/EDS analysis. A wide range of organic and inorganic compounds was determined by chemical maps obtained in ToF-SIMS analysis. - Highlights: ► We examine changes in the level of ultrafine and nanoparticles of coal mining. ► Increasing geochemical information will increase human health information in this area. ► Electron bean and Tof-SIMS increase area information.

  13. Effect of a redesigned fracture management pathway and 'virtual' fracture clinic on ED performance.

    Science.gov (United States)

    Vardy, J; Jenkins, P J; Clark, K; Chekroud, M; Begbie, K; Anthony, I; Rymaszewski, L A; Ireland, A J

    2014-06-13

    Collaboration between the orthopaedic and emergency medicine (ED) services has resulted in standardised treatment pathways, leaflet supported discharge and a virtual fracture clinic review. Patients with minor, stable fractures are discharged with no further follow-up arranged. We aimed to examine the time taken to assess and treat these patients in the ED along with the rate of unplanned reattendance. A retrospective study was undertaken that covered 1 year before the change and 1 year after. Prospectively collected administrative data from the electronic patient record system were analysed and compared before and after the change. An ED and orthopaedic unit, serving a population of 300 000, in a publicly funded health system. 2840 patients treated with referral to a traditional fracture clinic and 3374 patients managed according to the newly redesigned protocol. Time for assessment and treatment of patients with orthopaedic injuries not requiring immediate operative management, and 7-day unplanned reattendance. Where plaster backslabs were replaced with removable splints, the consultation time was reduced. There was no change in treatment time for other injuries treated by the new discharge protocol. There was no increase in unplanned ED attendance, related to the injury, within 7 days (p=0.149). There was a decrease in patients reattending the ED due to a missed fracture clinic appointment. This process did not require any new time resources from the ED staff. This process brought significant benefits to the ED as treatment pathways were agreed. The pathway reduced unnecessary reattendance of patients at face-to-face fracture clinics for a review of stable, self-limiting injuries. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Initial mechanical ventilator settings and lung protective ventilation in the ED.

    Science.gov (United States)

    Wilcox, Susan R; Richards, Jeremy B; Fisher, Daniel F; Sankoff, Jeffrey; Seigel, Todd A

    2016-08-01

    Mechanical ventilation with low tidal volumes has been shown to improve outcomes for patients both with and without acute respiratory distress syndrome. This study aims to characterize mechanically ventilated patients in the emergency department (ED), describe the initial ED ventilator settings, and assess for associations between lung protective ventilation strategies in the ED and outcomes. This was a multicenter, prospective, observational study of mechanical ventilation at 3 academic EDs. We defined lung protective ventilation as a tidal volume of less than or equal to 8 mL/kg of predicted body weight and compared outcomes for patients ventilated with lung protective vs non-lung protective ventilation, including inhospital mortality, ventilator days, intensive care unit length of stay, and hospital length of stay. Data from 433 patients were analyzed. Altered mental status without respiratory pathology was the most common reason for intubation, followed by trauma and respiratory failure. Two hundred sixty-one patients (60.3%) received lung protective ventilation, but most patients were ventilated with a low positive end-expiratory pressure, high fraction of inspired oxygen strategy. Patients were ventilated in the ED for a mean of 5 hours and 7 minutes but had few ventilator adjustments. Outcomes were not significantly different between patients receiving lung protective vs non-lung protective ventilation. Nearly 40% of ED patients were ventilated with non-lung protective ventilation as well as with low positive end-expiratory pressure and high fraction of inspired oxygen. Despite a mean ED ventilation time of more than 5 hours, few patients had adjustments made to their ventilators. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Modelling the growth of Populus species using Ecosystem Demography (ED) model

    Science.gov (United States)

    Wang, D.; Lebauer, D. S.; Feng, X.; Dietze, M. C.

    2010-12-01

    Hybrid poplar plantations are an important source being evaluated for biomass production. Effective management of such plantations requires adequate growth and yield models. The Ecosystem Demography model (ED) makes predictions about the large scales of interest in above- and belowground ecosystem structure and the fluxes of carbon and water from a description of the fine-scale physiological processes. In this study, we used a workflow management tool, the Predictive Ecophysiological Carbon flux Analyzer (PECAn), to integrate literature data, field measurement and the ED model to provide predictions of ecosystem functioning. Parameters for the ED ensemble runs were sampled from the posterior distribution of ecophysiological traits of Populus species compiled from the literature using a Bayesian meta-analysis approach. Sensitivity analysis was performed to identify the parameters which contribute the most to the uncertainties of the ED model output. Model emulation techniques were used to update parameter posterior distributions using field-observed data in northern Wisconsin hybrid poplar plantations. Model results were evaluated with 5-year field-observed data in a hybrid poplar plantation at New Franklin, MO. ED was then used to predict the spatial variability of poplar yield in the coterminous United States (United States minus Alaska and Hawaii). Sensitivity analysis showed that root respiration, dark respiration, growth respiration, stomatal slope and specific leaf area contribute the most to the uncertainty, which suggests that our field measurements and data collection should focus on these parameters. The ED model successfully captured the inter-annual and spatial variability of the yield of poplar. Analyses in progress with the ED model focus on evaluating the ecosystem services of short-rotation woody plantations, such as impacts on soil carbon storage, water use, and nutrient retention.

  16. Electroencephalography findings in patients presenting to the ED for evaluation of seizures.

    Science.gov (United States)

    Kadambi, Pooja; Hart, Kimberly W; Adeoye, Opeolu M; Lindsell, Christopher J; Knight, William A

    2015-01-01

    Status epilepticus is a life-threatening, time-sensitive emergency. Acquiring an electroencephalogram (EEG) in the emergency department (ED) could impact therapeutic and disposition decisions for patients with suspected status epilepticus. The objective of this study is to estimate the proportion of EEGs diagnostic for seizures in patients presenting to an ED with a complaint of seizures. This retrospective chart review included adults presenting to the ED of an urban, academic, tertiary care hospital with suspected seizures or status epilepticus, who received an EEG within 24 hours of hospital admission. Data abstraction was performed by a single, trained, nonblinded abstractor. Seizures were defined as an epileptologist's diagnosis of either seizures or status epilepticus on EEG. The proportion of patients with seizures is given with confidence interval95 (CI95). Of 120 included patients, 67 (56%) had a history of epilepsy. Mean age was 52 years (SD, 16), 58% were White, and 61% were male. Within 24 hours, 3% had an EEG diagnostic for seizures. Electroencephalogram was obtained in the ED in 32 (27%) of 120 (CI95, 19%-35%), and 2 (6%) of 32 (CI95, 1%-19%) had seizures. Electroencephalogram was performed inpatient for 88 (73%) of 120 (CI95, 65%-81%), and 2 (2%) of 88 (CI95, 0.5%-7.1%) had seizures. Only 3% of ED patients with suspected seizures or status epilepticus had EEG confirmation of seizures within 24 hours. Early EEG acquisition in the ED may identify a group of patients amenable to ED observation and subsequent discharge from the hospital. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Improved Early Detection of Sepsis in the ED With a Novel Monocyte Distribution Width Biomarker.

    Science.gov (United States)

    Crouser, Elliott D; Parrillo, Joseph E; Seymour, Christopher; Angus, Derek C; Bicking, Keri; Tejidor, Liliana; Magari, Robert; Careaga, Diana; Williams, JoAnna; Closser, Douglas R; Samoszuk, Michael; Herren, Luke; Robart, Emily; Chaves, Fernando

    2017-09-01

    Sepsis most often presents to the ED, and delayed detection is harmful. WBC count is often used to detect sepsis, but changes in WBC count size also correspond to sepsis. We sought to determine if volume increases of circulating immune cells add value to the WBC count for early sepsis detection in the ED. A blinded, prospective cohort study was conducted in two different ED populations within a large academic hospital. Neutrophil and monocyte volume parameters were measured in conjunction with routine CBC testing on a UniCel DxH 800 analyzer at the time of ED admission and were evaluated for the detection of sepsis. There were 1,320 subjects in the ED consecutively enrolled and categorized as control subjects (n = 879) and those with systemic inflammatory response syndrome (SIRS) (n = 203), infection (n = 140), or sepsis (n = 98). Compared with other parameters, monocyte distribution width (MDW) best discriminated sepsis from all other conditions (area under the curve [AUC], 0.79; 95% CI, 0.73-0.84; sensitivity, 0.77; specificity, 0.73; MDW threshold, 20.50), sepsis from SIRS (AUC, 0.74; 95% CI, 0.67-0.84), and severe sepsis from noninfected patients in the ED (AUC, 0.88; 95% CI, 0.75-0.99; negative predictive value, 99%). The added value of MDW to WBC count was statistically significant (AUC, 0.89 for MDW + WBC vs 0.81 for WBC alone; P sepsis compared with WBC count alone at the time of admission in the ED. ClinicalTrials.gov; No.: NCT02232750; URL: www.clinicaltrials.gov. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  18. Efficient Round-Trip Time Optimization for Replica-Exchange Enveloping Distribution Sampling (RE-EDS).

    Science.gov (United States)

    Sidler, Dominik; Cristòfol-Clough, Michael; Riniker, Sereina

    2017-06-13

    Replica-exchange enveloping distribution sampling (RE-EDS) allows the efficient estimation of free-energy differences between multiple end-states from a single molecular dynamics (MD) simulation. In EDS, a reference state is sampled, which can be tuned by two types of parameters, i.e., smoothness parameters(s) and energy offsets, such that all end-states are sufficiently sampled. However, the choice of these parameters is not trivial. Replica exchange (RE) or parallel tempering is a widely applied technique to enhance sampling. By combining EDS with the RE technique, the parameter choice problem could be simplified and the challenge shifted toward an optimal distribution of the replicas in the smoothness-parameter space. The choice of a certain replica distribution can alter the sampling efficiency significantly. In this work, global round-trip time optimization (GRTO) algorithms are tested for the use in RE-EDS simulations. In addition, a local round-trip time optimization (LRTO) algorithm is proposed for systems with slowly adapting environments, where a reliable estimate for the round-trip time is challenging to obtain. The optimization algorithms were applied to RE-EDS simulations of a system of nine small-molecule inhibitors of phenylethanolamine N-methyltransferase (PNMT). The energy offsets were determined using our recently proposed parallel energy-offset (PEOE) estimation scheme. While the multistate GRTO algorithm yielded the best replica distribution for the ligands in water, the multistate LRTO algorithm was found to be the method of choice for the ligands in complex with PNMT. With this, the 36 alchemical free-energy differences between the nine ligands were calculated successfully from a single RE-EDS simulation 10 ns in length. Thus, RE-EDS presents an efficient method for the estimation of relative binding free energies.

  19. Suicide Prevention in an Emergency Department Population: The ED-SAFE Study.

    Science.gov (United States)

    Miller, Ivan W; Camargo, Carlos A; Arias, Sarah A; Sullivan, Ashley F; Allen, Michael H; Goldstein, Amy B; Manton, Anne P; Espinola, Janice A; Jones, Richard; Hasegawa, Kohei; Boudreaux, Edwin D

    2017-06-01

    Suicide is a leading cause of deaths in the United States. Although the emergency department (ED) is an opportune setting for initiating suicide prevention efforts, ED-initiated suicide prevention interventions remain underdeveloped. To determine whether an ED-initiated intervention reduces subsequent suicidal behavior. This multicenter study of 8 EDs in the United States enrolled adults with a recent suicide attempt or ideation and was composed of 3 sequential phases: (1) a treatment as usual (TAU) phase from August 2010 to December 2011, (2) a universal screening (screening) phase from September 2011 to December 2012, and (3) a universal screening plus intervention (intervention) phase from July 2012 to November 2013. Screening consisted of universal suicide risk screening. The intervention phase consisted of universal screening plus an intervention, which included secondary suicide risk screening by the ED physician, discharge resources, and post-ED telephone calls focused on reducing suicide risk. The primary outcome was suicide attempts (nonfatal and fatal) over the 52-week follow-up period. The proportion and total number of attempts were analyzed. A total of 1376 participants were recruited, including 769 females (55.9%) with a median (interquartile range) age of 37 (26-47) years. A total of 288 participants (20.9%) made at least 1 suicide attempt, and there were 548 total suicide attempts among participants. There were no significant differences in risk reduction between the TAU and screening phases (23% vs 22%, respectively). However, compared with the TAU phase, patients in the intervention phase showed a 5% absolute reduction in suicide attempt risk (23% vs 18%), with a relative risk reduction of 20%. Participants in the intervention phase had 30% fewer total suicide attempts than participants in the TAU phase. Negative binomial regression analysis indicated that the participants in the intervention phase had significantly fewer total suicide attempts

  20. oneED: Embedding a mindfulness-based wellness programme into an emergency department.

    Science.gov (United States)

    Braganza, Shahina; Young, Jessica; Sweeny, Amy; Brazil, Victoria

    2018-03-30

    ED staff are subject to many stressors, but there are few descriptions of collective approaches to enhancing wellness in this setting. We aim to describe a programme developed to address these issues at department level, to report the feasibility and sustainability of the programme, and its impact on staff. The oneED programme was developed and delivered in a tertiary ED. The programme included a 1 day mindfulness workshop, followed by ongoing mindfulness activities embedded in clinical areas over the subsequent 12 months. A mixed-methods evaluation of the programme was conducted, which included quantitative validated psychological tools to measure anxiety, depression and emotional exhaustion, and pragmatic evaluation using surveys of participants and iterative appreciative inquiry. Eighty staff members attended the mindfulness workshop; 66 from ED. Following the workshop, understanding and frequency of mindfulness practice increased significantly in 47% of participants. Free-text survey results demonstrated that staff found the programme to be acceptable (80% survey participants) and of perceived value to themselves (50%) and the ED (60%). Appreciative inquiry led to modification of the programme: the 4 min pause is now conducted weekly rather than daily, the pause consists of a variety of activities, and group activities are made more overtly optional. A departmental wellness programme embedding mindfulness practice is feasible and sustainable. Potential for success is enhanced by an approach that is open to modification according to each institution's culture. © 2018 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  1. Why a disaster is not just normal business ramped up: Disaster response among ED nurses.

    Science.gov (United States)

    Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

    2017-11-15

    The emergency department (ED) is a familiar place for the emergency nurse who spends their working days inside it. A disaster threatens that familiarity and creates changes that make working in the ED during a disaster response different from the everyday experience of working in the ED. This research reports on an aspect of the findings from a larger study about the experience of working as a nurse in the ED during a disaster response. Thirteen nurses from 8 different countries were interviewed about their experience. The findings from this research demonstrate that a disaster event leads to a chain reaction of changes in process, space and practice. Nurses' respond to the news of a disaster event with shock and disbelief. The ED may change as a result of the event requiring nurses to work in an altered environment or a completely different setting. These changes provoke nurses to alter their behaviour and practice and reflect on the experience after the response. Emergency nurses have a high likelihood of participating in disaster response and as such should be adequately prepared. This highlights how disaster response is different and leads to recommendations to enhance training for emergency nurses which will better prepare them Disasterresponse is not normal business ramped up. There are a number of challenges and changes that should be considered when preparing emergency nurses for the realities of disaster response. Copyright © 2017 College of Emergency Nursing Australasia. All rights reserved.

  2. The Relationship Between the Use of a Worksite Medical Home and ED Visits or Hospitalizations

    Directory of Open Access Journals (Sweden)

    Marissa Stroo BS

    2015-10-01

    Full Text Available Worksite medical homes may be a good model for improving employee health. The aim of this study was to compare the likelihood of being seen in the emergency department (ED or being hospitalized by level of use (no use, occasional use, or primary care of a worksite medical home, overall and by type of user (employee, adult dependent, or pediatric dependent. This was a retrospective analysis of claims data, using covariate-adjusted logistic regression models for ED visits and inpatient hospitalizations. Secondary data for the years 2006 to 2008 from a company that offers an on-site health care center (HCC were used. Analyses were based on a data set that combines health plan claims and human resources demographic data. Overall, people who did not use the HCC were more likely to be seen in the ED (adjusted odds ratio [OR] = 1.20, 95% confidence interval or CI [1.06, 1.37], P = .005 or to be hospitalized (adjusted OR = 1.58; 95% CI [1.34, 1.86]; P < .0001 compared with those who used the HCC for primary care. Both ED visits and hospitalizations for employees and dependents in this study were lower among those who used the worksite medical home for primary care. Worksite medical homes can improve chronic disease management and thus reduce ED visits and hospitalizations. These findings contribute to growing evidence that worksite medical homes are potentially cost-effective.

  3. Characterisation of nanoparticles by means of high-resolution SEM/EDS in transmission mode

    International Nuclear Information System (INIS)

    Hodoroaba, V-D; Rades, S; Mielke, J; Ortel, E; Salge, T; Schmidt, R

    2016-01-01

    Advances in scanning electron microscopy (SEM) enable the high-resolution imaging of single nanoparticles (NPs) with sizes well below 10 nm. The SEM analysis in transmission mode (T-SEM) of NPs on thin film supports has many benefits when compared to the analysis of NPs on bulk substrates. The enhanced material (mass - thickness) contrast of the T-SEM imaging mode is well suited for in-depth and, particularly valuable, to very accurate, traceable, lateral dimensional measurements of NPs. Compared to samples prepared on bulk substrates, T-SEM with energy dispersive X-ray spectroscopy (EDS) achieves a drastically improved spatial resolution of the emitted X-rays. The poor signal-to-noise ratio of the X-ray spectra emitted by a single nanoparticle (NP) can be improved by the use of high-sensitivity (high collection solid angle) silicon drift (SDD), energy-dispersive X-ray spectrometers (EDS). The EDS spectral imaging of a single NP with a spatial resolution below 10 nm has become possible. This is demonstrated by means of various examples of nanostructures. Advanced data processing of T-SEM/EDS results sets the stage for the automated classification of NPs by feature analysis. This method combines the detection of morphological structures of interest by image processing of T-SEM micrographs with the chemical classification by EDS. (paper)

  4. Two-Step Process for ED UTI Screening in Febrile Young Children: Reducing Catheterization Rates.

    Science.gov (United States)

    Lavelle, Jane M; Blackstone, Mercedes M; Funari, Mary Kate; Roper, Christine; Lopez, Patricia; Schast, Aileen; Taylor, April M; Voorhis, Catherine B; Henien, Mira; Shaw, Kathy N

    2016-07-01

    Urinary tract infection (UTI) screening in febrile young children can be painful and time consuming. We implemented a screening protocol for UTI in a high-volume pediatric emergency department (ED) to reduce urethral catheterization, limiting catheterization to children with positive screens from urine bag specimens. This quality-improvement initiative was implemented using 3 Plan-Do-Study-Act cycles, beginning with a small test of the proposed change in 1 ED area. To ensure appropriate patients received timely screening, care teams discussed patient risk factors and created patient-specific, appropriate procedures. The intervention was extended to the entire ED after providing education. Finally, visual cues were added into the electronic health record, and nursing scripts were developed to enlist family participation. A time-series design was used to study the impact of the 6-month intervention by using a p-chart to determine special cause variation. The primary outcome measure for the study was defined as the catheterization rate in febrile children ages 6 to 24 months. The ED reduced catheterization rates among febrile young children from 63% to UTIs among those followed within the hospital's network. A 2-step less-invasive process for screening febrile young children for UTI can be instituted in a high-volume ED without increasing length of stay or missing cases of UTI. Copyright © 2016 by the American Academy of Pediatrics.

  5. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  6. Treatment motivation of men with ED: what motivates men with ED to seek professional help and how can women support their partners?

    Science.gov (United States)

    Gerster, S; Günzler, C; Roesler, C; Leiber, C; Berner, M M

    2013-01-01

    Although ED can impair sexual satisfaction as well as the quality of partnership and life, men affected often avoid seeking treatment. There is growing evidence that women have an influence on their partner's help-seeking behavior. This qualitative study examined men with ED and their female partners in order to detect motivational factors for men to seek treatment and motivational actions of the women to support their partners. Twelve couples took part in a semi-structured telephone interview, which was performed separately in men and women. Analysis was on the basis of the Grounded Theory. The identified motivational factors could be divided into extrinsic (for example, media, female partner) and intrinsic (for example, desire to clarify the cause of the ED, hope for improvement) factors. Women can support their partners in treatment-seeking through various motivational actions such as talking with each other, showing interest and dealing actively with the problem, appealing to the male self-esteem, supporting the doctor's visit, forcing the treatment, active cooperation and participation in the treatment or initiating sexual intercourse. On the basis of these findings, recommendations for women were developed to support their partners and increase the probability of help-seeking behavior.

  7. Dependence and physical exercise: Spanish validation of the Exercise Dependence Scale-Revised (EDS-R).

    Science.gov (United States)

    Sicilia, Alvaro; González-Cutre, David

    2011-05-01

    The purpose of this study was to validate the Spanish version of the Exercise Dependence Scale-Revised (EDS-R). To achieve this goal, a sample of 531 sport center users was used and the psychometric properties of the EDS-R were examined through different analyses. The results supported both the first-order seven-factor model and the higher-order model (seven first-order factors and one second-order factor). The structure of both models was invariant across age. Correlations among the subscales indicated a related factor model, supporting construct validity of the scale. Alpha values over .70 (except for Reduction in Other Activities) and suitable levels of temporal stability were obtained. Users practicing more than three days per week had higher scores in all subscales than the group practicing with a frequency of three days or fewer. The findings of this study provided reliability and validity for the EDS-R in a Spanish context.

  8. "Etica ed Estetica sono tutt’uno" Riflessioni su TLP 6.421

    Directory of Open Access Journals (Sweden)

    Gabriele Tomasi

    2011-01-01

    Full Text Available Per il primo Wittgenstein etica ed estetica erano tutt’uno. Scopo del saggio è fornire un’interpretazione di questa concezione. Esaminando il modo in cui è proposta nel Tractatus e considerando alcune annotazioni dei Quaderni 1914-1916 si evidenzia che l’unità di etica ed estetica è in un modo di vedere il mondo per cui esso non appare come fonte di limitazione. L’etica è un’estensione al mondo - alla vita - della capacità di conferire significato che nell’arte si realizza nei riguardi di oggetti particolari. Affermando l’unità di etica ed estetica Wittgenstein attira l’attenzione sul fatto che la radice dell’etica è in un certo modo di vedere le cose, in un atteggiamento verso la vita. Si tratta della prospettiva di un valore non connesso a come il mondo è e che è evocato dalla meraviglia per l’esistenza del mondo.

  9. [Efficacy of low-dose tadalafil on ED assessed by Self-Esteem and Relationship Questionnaire].

    Science.gov (United States)

    Li, Jing-Ping; Li, Fei; Guo, Wen-Bin; Zhou, Qi-Zhao; Liu, Cun-Dong; Mao, Xiang-Ming; Tan, Wan-Long; Zheng, Shao-Bin

    2010-12-01

    To explore the effects of low-dose oral tadalafil on self-esteem, confidence and sexual relationship in ED patients. We treated 17 ED patients with oral tadalafil at the low dose of 5 mg once daily for 12 weeks, and used the paired t test to compare their scores on The Self-Esteem and Relationship Questionnaire (SEAR) and IIEF-5 and the results of nocturnal penile tumescence (NPT) obtained by nocturnal electrobioimpedance volumetric assessment (NEVA) before and after the medication. The scores on SEAR and IIEF-5 were significantly increased (P P Low-dose oral tadalafil once daily can significantly improve the self-esteem, confidence, sexual relationship satisfaction and NPT of ED patients.

  10. EdF speaks about economic advantages of fuel reprocessing as compared with interim storage

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    The French company Electricite de France (EdF) will prefer nuclear fuel reprocessing and plutonium recycling to spent fuel storage also in the years after 2000. This option is economically advantageous if the proportional cost of reprocessing does not exceed 1900 FRF/kg heavy metal. Economic analysis shows that this is feasible. EdF will soon have to reprocess annually about 1000 Mt spent fuel to supply enough plutonium for MOX fuel fabrication to feed as many as 28 PWR units and the Superphenix reactor. Spent fuel reprocessing is seen as promising as long as the efficiency of the MOX fuel approaches that of natural uranium based fuel. The French national industrial, political and legal context of EdF operations is also considered. (P.A.)

  11. Effect of advanced age and vital signs on admission from an ED observation unit.

    Science.gov (United States)

    Caterino, Jeffrey M; Hoover, Emily M; Moseley, Mark G

    2013-01-01

    The primary objective was to determine the relationship between advanced age and need for admission from an emergency department (ED) observation unit. The secondary objective was to determine the relationship between initial ED vital signs and admission. We conducted a prospective, observational cohort study of ED patients placed in an ED-based observation unit. Multivariable penalized maximum likelihood logistic regression was used to identify independent predictors of need for hospital admission. Age was examined continuously and at a cutoff of 65 years or more. Vital signs were examined continuously and at commonly accepted cutoffs.We additionally controlled for demographics, comorbid conditions, laboratory values, and observation protocol. Three hundred patients were enrolled, 12% (n = 35) were 65 years or older, and 11% (n = 33) required admission. Admission rates were 2.9% (95% confidence interval [CI], 0.07%-14.9%) in older adults and 12.1% (95% CI, 8.4%-16.6%) in younger adults. In multivariable analysis, age was not associated with admission (odds ratio [OR], 0.30; 95% CI, 0.05-1.67). Predictors of admission included systolic pressure 180 mm Hg or greater (OR, 4.19; 95% CI, 1.08-16.30), log Charlson comorbidity score (OR, 2.93; 95% CI, 1.57-5.46), and white blood cell count 14,000/mm(3) or greater (OR, 11.35; 95% CI, 3.42-37.72). Among patients placed in an ED observation unit, age 65 years or more is not associated with need for admission. Older adults can successfully be discharged from these units. Systolic pressure 180 mm Hg or greater was the only predictive vital sign. In determining appropriateness of patients selected for an ED observation unit, advanced age should not be an automatic disqualifying criterion. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Are triage questions sufficient to assign fall risk precautions in the ED?

    Science.gov (United States)

    Southerland, Lauren T; Slattery, Lauren; Rosenthal, Joseph A; Kegelmeyer, Deborah; Kloos, Anne

    2017-02-01

    The American College of Emergency Physicians Geriatric Emergency Department (ED) Guidelines and the Center for Disease Control recommend that older adults be assessed for risk of falls. The standard ED assessment is a verbal query of fall risk factors, which may be inadequate. We hypothesized that the addition of a functional balance test endorsed by the Center for Disease Control Stop Elderly Accidents, Deaths, and Injuries Falls Prevention Guidelines, the 4-Stage Balance Test (4SBT), would improve the detection of patients at risk for falls. Prospective pilot study of a convenience sample of ambulatory adults 65 years and older in the ED. All participants received the standard nursing triage fall risk assessment. After patients were stabilized in their ED room, the 4SBT was administered. The 58 participants had an average age of 74.1 years (range, 65-94), 40.0% were women, and 98% were community dwelling. Five (8.6%) presented to the ED for a fall-related chief complaint. The nursing triage screen identified 39.7% (n=23) as at risk for falls, whereas the 4SBT identified 43% (n=25). Combining triage questions with the 4SBT identified 60.3% (n=35) as at high risk for falls, as compared with 39.7% (n=23) with triage questions alone (Ppatients at high risk by 4SBT and missed by triage questions were inpatients unaware that they were at risk for falls (new diagnoses). Incorporating a quick functional test of balance into the ED assessment for fall risk is feasible and significantly increases the detection of older adults at risk for falls. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. A Successful ED Fall Risk Program Using the KINDER 1 Fall RiskAssessment Tool.

    Science.gov (United States)

    Townsend, Ann B; Valle-Ortiz, Marisol; Sansweet, Tracy

    2016-11-01

    Emergency nurses did not perform falls risk assessments routinely on our ED patients; the instrument used was aimed at inpatients. We identified a need to revise fall assessment practices specific to our emergency department. The purpose of the performance improvement project was to reduce ED falls and evaluate the use of an ED-specific fall risk tool, the KINDER 1 Fall Risk Assessment. The plan was to establish fall risk assessment practices at point of ED entry and to decrease total falls. We retrospectively reviewed ED fall data for each quarter of 2013, which included risk assessments scores, the total number of falls, and the circumstances of each fall. Using Kotter's framework to guide a successful change process, we implemented the KINDER 1 to assess fall risk. During the first 4 weeks of the project, 937 patients (27%) were identified as high risk for falls using the KINDER 1. During the subsequent 3 quarters, the total number of falls decreased; reported falls without injuries dropped from 0.21 to 0.07 per 1000 patients, and falls with injuries were reduced from 0.21 to 0.0 per 1000 patients. The results of this project represented a valuable step toward achieving our goal to keep ED patients safe from injuries as a result of falls. The findings add to the body of nursing knowledge on the application of clinical-based performance improvement projects to improve patient outcomes and to provide data on the use of the KINDER 1 tool, which has not been extensively tested. Copyright © 2016 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

  14. Barriers and facilitators to ED physician use of the test and treatment for BPPV.

    Science.gov (United States)

    Kerber, Kevin A; Forman, Jane; Damschroder, Laura; Telian, Steven A; Fagerlin, Angela; Johnson, Patricia; Brown, Devin L; An, Lawrence C; Morgenstern, Lewis B; Meurer, William J

    2017-06-01

    The test and treatment for benign paroxysmal positional vertigo (BPPV) are evidence-based practices supported by clinical guideline statements. Yet these practices are underutilized in the emergency department (ED) and interventions to promote their use are needed. To inform the development of an intervention, we interviewed ED physicians to explore barriers and facilitators to the current use of the Dix-Hallpike test (DHT) and the canalith repositioning maneuver (CRM). We conducted semi-structured in-person interviews with ED physicians who were recruited at annual ED society meetings in the United States. We analyzed data thematically using qualitative content analysis methods. Based on 50 interviews with ED physicians, barriers that contributed to infrequent use of DHT/CRM that emerged were (1) prior negative experiences or forgetting how to perform them and (2) reliance on the history of present illness to identify BPPV, or using the DHT but misattributing patterns of nystagmus. Based on participants' responses, the principal facilitator of DHT/CRM use was prior positive experiences using these, even if infrequent. When asked which clinical supports would facilitate more frequent use of DHT/CRM, participants agreed supports needed to be brief, readily accessible, and easy to use, and to include well-annotated video examples. Interventions to promote the use of the DHT/CRM in the ED need to overcome prior negative experiences with the DHT/CRM, overreliance on the history of present illness, and the underuse and misattribution of patterns of nystagmus. Future resources need to be sensitive to provider preferences for succinct information and video examples.

  15. Paid sick leave is associated with fewer ED visits among US private sector working adults.

    Science.gov (United States)

    Bhuyan, Soumitra S; Wang, Yang; Bhatt, Jay; Dismuke, S Edward; Carlton, Erik L; Gentry, Dan; LaGrange, Chad; Chang, Cyril F

    2016-05-01

    The United States (US) is the only developed country that does not guarantee short-term or longer-term paid sick leave. This study used a multiyear nationally representative database to examine the association between availability of paid sick leave and frequency of emergency department (ED) use among US private sector employees. We used the National Health Interview Survey data (2012-2014). The final study sample consists of 42,460 US adults between 18 and 64years of age and working in nongovernmental private sector. Our results suggest that availability of paid sick leave is significantly associated with lower likelihood of ED use, for both moderate (1-3 times/year) and repeated users (4 or more times/year). After controlling for confounding factors, respondents with paid sick leave are 14% less likely to be moderate ED users (adjusted odds ratio, 0.86; 95% CI, 0.79-0.93) and 32% less likely to be repeated ED users (adjusted odds ratio, 0.68; 95% CI, 0.50-0.91). Although expansion of health insurance coverage under the Affordable Care Act has not been shown to reduce utilization of high cost health care services such as the ED, our study suggests other factors such as the availability of paid sick leave may do so, by allowing patients to seek care through other more cost-effective mechanisms (eg, primary care providers). To reduce ED utilization, health policymakers should consider alternative reforms including paid sick leave. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. EdF in the core of UK's nuclear industry... before expecting more

    International Nuclear Information System (INIS)

    Moal, C.

    2008-01-01

    With the announcement at the end of September 2008 of EdF's friendly takeover bid on British Energy, the French group confirms its will of dominating the European nuclear industry before going back to the assault of the US market. Together, EdF and British Energy (owner of 8 NPPs (9.5 GW) and 1 coal-fired power plant (2 GW)) will make a turnover of 11.9 billion euro with 19800 employees and 85.6 TWh of production. Short paper. (J.S.)

  17. Trends in Hospital Admission and Surgical Procedures Following ED visits for Diverticulitis

    Directory of Open Access Journals (Sweden)

    Margaret B. Greenwood-Ericksen

    2016-06-01

    Full Text Available Introduction: Diverticulitis is a common diagnosis in the emergency department (ED. Outpatient management of diverticulitis is safe in selected patients, yet the rates of admission and surgical procedures following ED visits for diverticulitis are unknown, as are the predictive patient characteristics. Our goal is to describe trends in admission and surgical procedures following ED visits for diverticulitis, and to determine which patient characteristics predict admission. Methods: We performed a cross-sectional descriptive analysis using data on ED visits from 2006-2011 to determine change in admission and surgical patterns over time. The Nationwide Emergency Department Sample database, a nationally representative administrative claims dataset, was used to analyze ED visits for diverticulitis. We included patients with a principal diagnosis of diverticulitis (ICD-9 codes 562.11, 562.13. We analyzed the rate of admission and surgery in all admitted patients and in low-risk patients, defined as age <50 with no comorbidities (Elixhauser. We used hierarchical multivariate logistic regression to identify patient characteristics associated with admission for diverticulitis. Results: From 2006 to 2011 ED visits for diverticulitis increased by 21.3% from 238,248 to 302,612, while the admission rate decreased from 55.7% to 48.5% (-7.2%, 95% CI [–7.78 to -6.62]; p<0.001 for trend. The admission rate among low-risk patients decreased from 35.2% in 2006 to 26.8% in 2011 (-8.4%, 95% CI [–9.6 to –7.2]; p<0.001 for trend. Admission for diverticulitis was independently associated with male gender, comorbid illnesses, higher income and commercial health insurance. The surgical rate decreased from 6.5% in 2006 to 4.7% in 2011 (-1.8%, 95% CI [–2.1 to –1.5]; p<0.001 for trend, and among low-risk patients decreased from 4.0% to 2.2% (- 1.8%, 95% CI [–4.5 to –1.7]; p<0.001 for trend. Conclusion: From 2006 to 2011 ED visits for diverticulitis increased

  18. The Impact of Inpatient Boarding on ED Efficiency: A Discrete-Event Simulation Study

    OpenAIRE

    Bair, Aaron E.; Song, Wheyming T.; Chen, Yi-Chun; Morris, Beth A.

    2009-01-01

    In this study, a discrete-event simulation approach was used to model Emergency Department’s (ED) patient flow to investigate the effect of inpatient boarding on the ED efficiency in terms of the National Emergency Department Crowding Scale (NEDOCS) score and the rate of patients who leave without being seen (LWBS). The decision variable in this model was the boarder-released-ratio defined as the ratio of admitted patients whose boarding time is zero to all admitted patients. Our analysis sho...

  19. Change at a Large Urban District: Developing and Operationalizing an Ed Tech Standards and Support System at Chicago Public Schools

    OpenAIRE

    Sayeed, Dilara Alim

    2015-01-01

    Chicago Public Schools (CPS) aims to effectively and efficiently leverage Education Technology (referred to as Ed Tech) to serve as a powerful resource for strong instruction. The term Ed Tech at CPS refers to digital instructional products and programs, used by students or educators, for teaching and learning. Examples of Ed Tech include literacy programs such as Achieve3000, websites or platforms such as Khan Academy or eSpark, along with a myriad other technological inventions that are rap...

  20. Diseños de plantación y formación de árboles frutales (7ª ed.)

    OpenAIRE

    Cambra Ruiz de Velasco, Mariano; Cambra Ruiz de Velasco, Rafael

    1983-01-01

    158 Pags., 45 Figs., Tabls. ** Historia de las ediciones anteriores y posteriores: 1ª ed., 1962; 2ª ed., 1964; 3ª ed., 1966; 4ª ed., 1967; 5ª ed., 1971; 6ª ed., 1974; 8ª ed., 1991. ** Última edición, en 2004, por CSIC: Diseños de plantación y formación de árboles frutales / M. Cambra Ruiz de Velasco, R. Cambra Ruiz de Velasco.-- Madrid : Consejo Superior de Investigaciones Científicas, 2004.-- [149] p. ; 24 cm.-- (Biblioteca de ciencias, 16).

  1. Diseños de plantación y formación de árboles frutales (8ª ed.)

    OpenAIRE

    Cambra Ruiz de Velasco, Mariano; Cambra Ruiz de Velasco, Rafael

    1991-01-01

    164 Pags., con 45 Figs. y 9 Tabls. ** Historia de las ediciones anteriores: 1ª ed., 1962; 2ª ed., 1964; 3ª ed., 1966; 4ª ed., 1967; 5ª ed., 1971 (Incorpora Sistemas de formación de apéndice); 6ª ed., 1974; 7ª ed., 1983. ** Última edición, en 2004, por CSIC: Diseños de plantación y formación de árboles frutales / M. Cambra Ruiz de Velasco, R. Cambra Ruiz de Velasco.-- Madrid : Consejo Superior de Investigaciones Científicas, 2004.-- [149] p. ; 24 cm.-- (Biblioteca de ciencia...

  2. Ideas. A History: From Fire to Freud. 2. ed.; Ideen. Eine Kulturgeschichte von der Entdeckung des Feuers bis zur Moderne

    Energy Technology Data Exchange (ETDEWEB)

    Watson, P.

    2005-07-01

    In this hugely ambitious and exciting book Peter Watson tells the history of ideas from prehistory to the present day, seeking a new way to tell the history of the world. The book begins over a million years ago with a discussion of how the earliest ideas might have originated. Looking at animal behaviour that appears to require some thought tool-making, territoriality, counting, language (or at least sounds), pairbonding Peter Watson moves on to the apeman and the development of simple ideas such as cooking, the earliest language, the emergence of family life. All the obvious areas will be tackled the Ancient Greeks, Christian theology, the ideas of Jesus, astrological thought, the soul, the self, beliefs about the heavens, the ideas of Islam, the Crusades, humanism, the Renaissance, Gutenberg and the book, the scientific revolution, the age of discovery, Shakespeare, the idea of Revolution, the Romantic imagination, Darwin, imperialism, modernism, Freud right up to the present day and the internet. (orig./GL) [German] Beginnt die Ideengeschichte der Menschheit, als die Fruehmenschen erstmals Feuer machen, vor ca. 1,8 Millionen Jahren? Oder schon mit dem ersten Faustkeil vor etwa 2,5 Millionen Jahren? Warum entwickelte sich vor 40 000 Jahren eine komplexe Sprache? Wie kamen das Minus- und das Plus-Zeichen in die Vorstellungswelt, und wie entstand das Bild vom Paradies? Peter Watson laedt ein zu einer Expedition durch die abenteuerliche Welt menschlicher Ideen. Vom ersten Feuer, dem ersten Werkzeug und den ersten Worten ueber die Geburt der Goetter, die ersten Gesetze und die Entwicklung grosser Zentren von Wissen und Weisheit bis hin zu den umwaelzenden Ideen der Moderne: das Groesste und das Kleinste, das Selbst-Bewusstsein des Individuums und die Entdeckung des Unbewussten. Dabei ordnet Watson die riesige Materialfuelle nach drei zentralen Ideen, die fuer ihn die Geschichte der Menschheit praegen: die Seele, mehr als die Idee von einem Gott, Europa, mehr als das

  3. Barriers and Facilitators to Implementing the HEADS-ED: A Rapid Screening Tool for Pediatric Patients in Emergency Departments.

    Science.gov (United States)

    MacWilliams, Kate; Curran, Janet; Racek, Jakub; Cloutier, Paula; Cappelli, Mario

    2017-12-01

    This study sought to identify barriers and facilitators to the implementation of the HEADS-ED, a screening tool appropriate for use in the emergency department (ED) that facilitates standardized assessments, discharge planning, charting, and linking pediatric mental health patients to appropriate community resources. A qualitative theory-based design was used to identify barriers and facilitators to implementing the HEADS-ED tool. Focus groups were conducted with participants recruited from 6 different ED settings across 2 provinces (Ontario and Nova Scotia). The Theoretical Domains Framework was used as a conceptual framework to guide data collection and to identify themes from focus group discussions. The following themes spanning 12 domains were identified as reflective of participants' beliefs about the barriers and facilitators to implementing the HEADS-ED tool: knowledge, skills, beliefs about capabilities, social professional role and identity, optimism, beliefs about consequences, reinforcement, environmental context and resources, social influences, emotion, behavioral regulation and memory, and attention and decision process. The HEADS-ED has the potential to address the need for better discharge planning, complete charting, and standardized assessments for the increasing population of pediatric mental health patients who present to EDs. This study has identified potential barriers and facilitators, which should be considered when developing an implementation plan for adopting the HEADS-ED tool into practice within EDs.

  4. Is the Ed School the Dead School? Premature Obituaries for an Institution.

    Science.gov (United States)

    Thelin, John R.

    1989-01-01

    Geraldine Clifford and James Guthrie's book "Ed School: A Brief for Professional Education" is reviewed. They concluded that no school of education has been able to maintain a central place within a distinguished American university. Their recommendation that education faculty ought to de-emphasize the social science research model is…

  5. Effect of Job Specialization on the Hospital Stay and Job Satisfaction of ED Nurses

    OpenAIRE

    Shamsi; Mahmoudi; Sirati Nir; Babatabar Darzi

    2016-01-01

    Background In recent decades, the increasing crowdedness of the emergency departments has posed various problems for patients and healthcare systems worldwide. These problems include prolonged hospital stay, patient dissatisfaction and nurse burnout or job dissatisfaction. Objectives The aim of this study was to investigate the effect of emergency department (ED) nurses’ job specialization on their job satisfaction and the length ...

  6. Exploring Older Adult ED Fall Patients' Understanding of Their Fall: A Qualitative Study.

    Science.gov (United States)

    Shankar, Kalpana N; Taylor, Devon; Rizzo, Caroline T; Liu, Shan W

    2017-12-01

    We sought to understand older patients' perspectives about their fall, fall risk factors, and attitude toward emergency department (ED) fall-prevention interventions. We conducted semistructured interviews between July 2015 and January 2016 of community-dwelling, nondemented patients in the ED, who presented with a fall to an urban, teaching hospital. Interviews were halted once we achieve thematic saturation with the data coded and categorized into themes. Of the 63 patients interviewed, patients blamed falls on the environment, accidents, a medical condition, or themselves. Three major themes were generated: (1) patients blamed falls on a multitude of things but never acknowledged a possible multifactorial rationale, (2) patients have variable level of concerns regarding their current fall and future fall risk, and (3) patients demonstrated a range of receptiveness to ED interventions aimed at preventing falls but provided little input as to what those interventions should be. Many older patients who fall do not understand their fall risk. However, based on the responses provided, older adults tend to be more receptive to intervention and more concerned about their future fall risk, making the ED an appropriate setting for intervention.

  7. ReEDS-Mexico: A Capacity Expansion Model of the Mexican Power System

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Jonathan L [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Cole, Wesley J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Spyrou, Evangelia [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-29

    This report documents the ReEDS-Mexico capacity expansion model, which is an extension of the ReEDS model to the Mexican power system. In recent years Mexico’s power sector has undergone considerable reform that has significant potential to impact the future electricity mix (Alpizar–Castro and Rodríguez–Monroy 2016). Day-ahead and real-time trading in Mexico’s power markets opened in early 2016. In addition to this reform, Mexico is striving to ensure that 35% of its electricity is generated from clean energy sources by 2024, 40% by 2035, and 50% by 2050 (Presidencia de la República 2016). These rapid changes in both the market and the generation mix create a need for robust tools that can help electricity sector stakeholders make informed decisions. The purpose of this report is to document the extension of the National Renewable Energy Laboratory’s (NREL’s) Regional Energy Deployment System (ReEDS) model (Eurek et al. 2016) to cover the Mexico power system. This extension, which we will refer to throughout this paper as ReEDS-Mexico, provides a model of the Mexico power sector using a system-wide, least-cost optimization framework.

  8. Developing a multidisciplinary approach within the ED towards domestic violence presentations.

    Science.gov (United States)

    Basu, Subhashis; Ratcliffe, Giles

    2014-03-01

    To improve the detection and quality of care of patients who attend the emergency department (ED) with confirmed or suspected domestic abuse (DA). A quality improvement report on the design, implementation and evaluation of a specialised service and structured training programme to detect and manage DA presentations within an emergency medicine department. The study was set in the ED at the Northern General Hospital, Sheffield, UK. Key measures for improvement included introducing a service within the ED to help staff manage DA and coordinate responses; improve staff confidence in detecting DA; develop a structured and consistent process by which to manage DA presentations. An Independent Domestic Violence Advocate service was introduced into the department in July 2011 through a multiagency agreement. A structured training and education programme was delivered to ED staff. A 'communications form' was developed for DA risk assessment and case management. The process was reviewed quarterly. One hundred and seventy-two referrals were made to the service (121 distinct clients) over a 12-month period. Staff reported greater confidence in detecting DA, and community partners highlighted the role the service had in improving DA detection and care quality within the city. Strong leadership and prioritising the issue within the department has facilitated the development of the process and contributed substantially to its success. Support from community partners has been invaluable in tailoring the service and education programme to the needs of staff and patients within the department.

  9. Using Ontological Engineering to Overcome AI-ED Problems: Contribution, Impact and Perspectives

    Science.gov (United States)

    Mizoguchi, Riichiro; Bourdeau, Jacqueline

    2016-01-01

    This article reflects on the ontology engineering methodology discussed by the paper entitled "Using Ontological Engineering to Overcome AI-ED Problems" published in this journal in 2000. We discuss the achievements obtained in the last 10 years, the impact of our work as well as recent trends and perspectives in ontology engineering for…

  10. Impact of Curricular Reforms on Educational Philosophy Courses in M.Ed Programmes

    Science.gov (United States)

    Gafoor, K. Abdul; Remia, K. R.

    2014-01-01

    In the context of Vision of Teacher Education envisaged in National Curriculum Framework for Teacher Education, this study probes "Do M.Ed programmes provide for the prerequisites of educational philosophy for teacher educators?" and "whether the syllabi following credit and non credit pattern vary in their coverage of content of…

  11. Viirastuslikud Sinimäed. Mõtteid Raimo Jõeranna filmi ainetel / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2006-01-01

    6-osalise ajaloodokumentaalide sarja "Kuum külm sõda" teist filmi "Sinimäed" : stsenaristid Kiur Aarma, Mart Laar, Eerik-Niiles Kross, Raimo Jõerand : režissöör Raimo Jõerand : Ruut Pictures 2006

  12. Next Generation Science Standards and edTPA: Evidence of Science and Engineering Practices

    Science.gov (United States)

    Brownstein, Erica M.; Horvath, Larry

    2016-01-01

    Science teacher educators in the United States are currently preparing future science teachers to effectively implement the "Next Generation Science Standards" (NGSS) and, in thirteen states, to successfully pass a content-specific high stakes teacher performance assessment, the edTPA. Science education and teacher performance assessment…

  13. Controlled wear of vitrified abrasive materials for precision grinding ...

    Indian Academy of Sciences (India)

    The study of bonding hard materials such as aluminium oxide and cubic boron nitride (BN) and the nature of interfacial cohesion between these materials and glass is very important from the perspective of high precision grinding. Vitrified grinding wheels are typically used to remove large volumes of metal and to produce ...

  14. Modelling the electromechanical interactions in a null-flux EDS Maglev system

    NARCIS (Netherlands)

    Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.; Fair, H.D.

    2004-01-01

    The fundamental electromechanical interactionsin a passive null-ux EDS maglev system aremediated by the voltages induced in the levita-tion coils by the sled magnets, and by the forcesexerted on the sled as a result of the inducedcurrents. This paper presents a reliable andcompact method to

  15. Introducing the Collaborative E-Learning Design Method (CoED)

    DEFF Research Database (Denmark)

    Ryberg, Thomas; Buus, Lillian; Nyvang, Tom

    2015-01-01

    In this chapter, a specific learning design method is introduced and explained, namely the Collaborative E-learning Design method (CoED), which has been developed through various projects in “e-Learning Lab – Centre for User Driven Innovation, Learning and Design” (Nyvang & Georgsen, 2007). We br...

  16. APA Reporting Standards in Quantitative Research Dissertations from an Online EdD Program

    Science.gov (United States)

    Salgado, Griselle

    2013-01-01

    This study was an investigation of the reporting practices in dissertations with quantitative research designs produced by students enrolled in an online Doctor of Education (EdD) program, one that follows the American Psychological Association (APA) standards for reporting research. Limited, empirical information exists about the competencies in…

  17. Systematic Review of ED-based Intimate Partner Violence Intervention Research

    Directory of Open Access Journals (Sweden)

    Esther K. Choo,

    2015-12-01

    Full Text Available Introduction: Assessment reactivity may be a factor in the modest results of brief interventions for substance use in the emergency department (ED. The presence of assessment reactivity in studies of interventions for intimate partner violence (IPV has not been studied. Our objectives were to identify ED IPV intervention studies and evaluate the presence of a consistently positive effect on the control groups. Methods: We performed a systematic search of electronic databases for English=language intervention studies addressing IPV in the ED published since 1990. Study selection and assessment of methodologic quality were performed by two independent reviewers. Data extraction was performed by one reviewer and then independently checked for completeness and accuracy by a second reviewer. Results: Of 3,620 unique manuscripts identified by database search, 667 underwent abstract review and 12 underwent full-text review. Only three met full eligibility criteria; data on the control arm were available for two studies. In these two studies, IPV-related outcomes improved for both the experimental and control condition. Conclusion: The paucity of controlled trials of IPV precluded a robust evaluation for assessment reactivity. This study highlighted a critical gap in ED research on IPV.

  18. Social Foundations and School Reform Networks: The Case Against E.D. Hirsch.

    Science.gov (United States)

    Ognibene, Richard

    1998-01-01

    Critiques the views of E.D. Hirsch, highlighting limitations of his book, "The Schools We Need and Why We Don't Have Them." The paper acknowledges Hirsch's influence on public opinion about school reform, but details flaws and errors Hirsch makes, asking foundational scholars in teacher education to better prepare students to respond to…

  19. Communicative Learning Outcomes and World Language edTPA: Characteristics of High-Scoring Portfolios

    Science.gov (United States)

    Swanson, Pete; Hildebrandt, Susan A.

    2017-01-01

    Teacher accountability continues to be at the forefront of educational policy in the United States, with the current focus on the Outcomes of K-12 teaching and teacher education (Cochran-Smith 2000). edTPA, a high-stakes assessment used in many states to make licensure or certification decisions, purports to measure those content-specific…

  20. SEM-EDS Observation of Structure Changes in Synthetic Zeolites Modified for CO2 Capture Needs

    Science.gov (United States)

    Wdowin, Magdalena; Panek, Rafal; Franus, Wojciech

    Carbon dioxide is the main greenhouse gas and its amount still increase in the atmosphere. Air pollution and greenhouse effect caused by CO2 emission have become a major threat to the environment on a global scale. Carbon dioxide sequestration (i.e. capture and consequently geological storage) is the key strategy within the portfolio of actions to reduce CO2 emission to the atmosphere. The most costly stage is capture of CO2, therefore there is a need to search new solutions of this technology. For this purpose it was examined Na-X synthetic zeolites, that were silver and PEI (polyethyleneimine) activated. SEM-EDS investigation enable to find a changes in structure of this materials after treatment. Where, as a result of silver activation from EDS analysis it is seen that Ag occur in Na-X structure, what indicate a substitution of Ag2+ for Na+ ions in crystal lattice. Analysing wt% the EDS analysis has shown that zeolite Na-X after silver impregnation becomes Ag-X zeolite. For Na-X-PEI activated it is observed a distinct organic compound in the form of coatings on Na-X crystals causing a sealing of pores in tested zeolite. Further examination of these materials concern determination of surface properties and experiments of CO2 sorption. But SEM-EDS analysis enable to determine the extent of activation, what is very important in determination of optimal conditions for such treatment in order to obtain better sorbent of CO2.

  1. The EdUReP approach plus manual therapy for the management of insertional Achilles tendinopathy.

    Science.gov (United States)

    Sartorio, Francesco; Zanetta, Anna; Ferriero, Giorgio; Bravini, Elisabetta; Vercelli, Stefano

    2018-05-01

    Insertional Achilles tendinopathy (IAT) is a challenging overuse disorder. The aim of this case report was to study the feasibility of a comprehensive rehabilitative approach according to the Education, Unloading, Reloading, and Prevention (EdUReP) framework combined with Instrument-Augmented Soft Tissue Mobilization (I-ASTM). An active 51-year-old man patient with chronic IAT was studied. Clinical assessment battery was composed by visual analogue scale for pain during the Achilles tendon palpation test, passive straight leg raise test, single leg hop test, Patient-Specific Functional Scale, and Foot and Ankle Ability Measure. The patient was treated over a 8 weeks period using the EdUReP guidelines plus 8 sessions of I-ASTM, applied with a solid instrument to the Achilles tendon and to the muscle fibrotic areas previously identified during evaluation. Clinically significant improvements were observed in all outcome measures, and a resume of patient's usual sports activities without pain or limitations was possible after treatment. Results lasted over a 6-month follow-up. To the best of our knowledge, this is the first study applying a comprehensive approach based on accurate physical assessment, and using the EdUReP theoretical model. The combination of the EdUReP model and manual therapy was effective in resolving the patient's symptoms and restore his usual sport activities. While these results cannot be generalized, the present findings could provide a valuable foundation for future researches.

  2. Culture, Knowledge and Power: What the Conservatives Have Learnt from E.D. Hirsch

    Science.gov (United States)

    Yandell, John

    2017-01-01

    British Conservatives happily acknowledge the debt that they owe to E.D. Hirsch. To understand the nature of their curricular project, and how it is located within the wider goals of education and social policy, we need to attend carefully to the character of this transatlantic borrowing. Its emphases and omissions reveal much about the…

  3. A Comparative SEM-EDS Elemental Composition of Mud in Coastal ...

    African Journals Online (AJOL)

    The present study was aimed to understand the comparative abundance and source of elemental constituents in mud of four coastal shrimp farming areas, Vunh Tau (VT), Nha Trang (NT), Da Nang (DN) and Hue (HU) in Viet Nam using SEM-EDS analysis. Mud samples were collected from shrimp farming coastal zones ...

  4. GESTATIONAL EXPOSURE TO ETHANE DIMETHANESULFONATE (EDS) ALTERS DEVELOPMENT OF THE MOUSE TESTIS

    Science.gov (United States)

    GESTATIONAL EXPOSURE TO ETHANE DIMETHANESULFONATE (EDS) ALTERS DEVELOPMENT OF THE MOUSE TESTIS. D.K. Tarka*1,2, J.D. Suarez*2, N.L. Roberts*2, J.M. Rogers*1,2, M.P. Hardy3, and G.R. Klinefelter1,2. 1University of North Carolina, Curriculum in Toxicology, Chapel Hill, NC; 2USEPA,...

  5. Cross-sectional analysis of fouled SWRO membranes by STEM-EDS

    KAUST Repository

    Aubry, Cyril

    2014-01-01

    The intact cross-section of two fouled reverse osmosis membranes was characterized using a scanning transmission electron microscope (STEM) equipped with an electron energy dispersive spectroscope (EDS). Focused ion beam (FIB) was used to prepare a thin lamella of each membrane. These lamellas were then attached to a TEM grid for further STEM/EDS analysis. The foulant in sample A was mainly inorganic in nature and predominantly composed of alumino-silicate particles. These particles were surrounded by carbon at high concentrations, indicating the presence of organic materials. Iron was diffusely present in the cake layer and this could have enhanced the fouling process. The cake layer of membrane B was mainly consisted of organic matter (C, O, and N representing 95% of the total elemental composition) and organized in thin parallel layers. Small concentrations of Si, F, Na, Mg, and Cl were detected inside the active layer and support layer of the membrane. Due to the high sensitivity of the cake layer of membrane A to the electron beam, STEM/EDS line analyses might have been performed on large areas. On the other hand, the cake layer of sample B was resistant to the electron beam and the resolution of STEM/EDS was gradually improved until obtaining a resolution of 25. nm. © 2013 Elsevier B.V.

  6. A Novel Semiconductor CIGS Photovoltaic Material and Thin-Film ED Technology

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    In order to achieve low-cost high-efficiency thin-film solar cells, a novel Semiconductor Photovoltaic (PV) active material CuIn1-xGaxSe2 (CIGS) and thin-film Electro-Deposition (ED) technology is explored. Firstly,the PV materials and technologies is investigated, then the detailed experimental processes of CIGS/Mo/glass structure by using the novel ED technology and the results are reported. These results shows that high quality CIGS polycrystalline thin-films can be obtained by the ED method, in which the polycrystalline CIGS is definitely identified by the (112), (204, 220) characteristic peaks of the tetragonal structure, the continuous CIGS thin-film layers with particle average size of about 2μm of length and around 1.6μm of thickness. The thickness and solargrade quality of CIGS thin-films can be produced with good repeatability. Discussion and analysis on the ED technique, CIGS energy band and sodium (Na) impurity properties, were also performed. The alloy CIGS exhibits not only increasing band-gap with increasing x, but also a change in material properties that is relevant to the device operation. The beneficial impurity Na originating from the low-cost soda-lime glass substrate becomes one prerequisite for high quality CIGS films. These novel material and technology are very useful for low-cost high-efficiency thin-film solar cells and other devices.

  7. Problemi di fisica meccanica e termologia, ottica ed elettricità

    CERN Document Server

    Foglia, C

    1962-01-01

    Equazioni dimensionali ed unità di misura ; elementi di calcolo vettoriale ; cinematica ; dinamica ; fenomeni ondulatori ; meccanica dei fluidi ; termologia ; elettrostatica ; la corrente elettrica nei conduttori ohmici e non ohmici ; elettromagnetismo e correnti alternate ; equazioni di Maxwell e onde elettromagntiche ; ottica geometrica ; interferenza e diffrazione della luce ; polarizzazione della luce ; applicazioni elementari della teoria degli errori.

  8. Broad Categories for the Diagnosis of Eating Disorders (BCD-ED): An Alternative System for Classification

    Science.gov (United States)

    Walsh, B. Timothy; Sysko, Robyn

    2009-01-01

    Eating Disorder Not Otherwise Specified (EDNOS), a residual category in DSM-IV, is the most commonly used eating disorder diagnosis in clinical settings. However, the features of individuals with EDNOS are heterogeneous and difficult to characterize. A diagnostic scheme, termed Broad Categories for the Diagnosis of Eating Disorders (BCD-ED), is proposed to diminish use of the EDNOS category markedly while preserving the existing eating disorder categories. The BCD-ED scheme consists of three broad categories, in a hierarchical relationship, consisting of: Anorexia Nervosa and Behaviorally Similar disorders, Bulimia Nervosa and Behaviorally Similar Disorders, Binge Eating Disorder and Behaviorally Similar Disorders, and a residual category of EDNOS. The advantages and disadvantages of adopting this scheme for DSM-V are considered, and issues relevant to BCD-ED are discussed. Specifically, we review the proportion of individuals with DSM-IV EDNOS that would be re-classified under the BCD-ED system, support for the hierarchy of the three categories, and the potential risk of “overdiagnosis.” PMID:19650083

  9. J. Crush and D.A. McDonald. (eds). 2002. Transnationalism and ...

    African Journals Online (AJOL)

    J. Crush and D.A. McDonald. (eds). 2002. Transnationalism and New African Immigration to South Africa. Cape Town. Southern African Migration Project and the Canadian Association of African Studies. IV + 188 pp. ISBN 0-88911-926-0.

  10. Learning the Attachment Theory with the CM-ED Concept Map Editor

    Science.gov (United States)

    Rueda, U.; Arruarte, A.; Elorriaga, J. A.; Herran, E.

    2009-01-01

    This paper presents a study carried out at the University of the Basque Country UPV/EHU with the aim of evaluating the CM-ED (concept map editor) with social education students. Concept mapping is a widely accepted technique that promotes meaningful learning. Graphically representing concepts of the learning domain and relationships between them…

  11. Syncope prevalence in the ED compared to general practice and population: a strong selection process

    NARCIS (Netherlands)

    Olde Nordkamp, Louise R. A.; van Dijk, Nynke; Ganzeboom, Karin S.; Reitsma, Johannes B.; Luitse, Jan S. K.; Dekker, Lukas R. C.; Shen, Win-Kuang; Wieling, Wouter

    2009-01-01

    Objective: We assessed the prevalence and distribution of the different causes of transient loss of consciousness (TLOC) in the emergency department (ED) and chest pain unit (CPU) and estimated the proportion of persons with syncope in the general population who seek medical attention from either

  12. Data of evolutionary structure change: 1BXSC-2D4ED [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available KIQ-GRTIP >GGG - > ATOM 8584 CA ...bID> D 2D4ED AEHAMEDRTFP ...>GGG > ATOM 13219 CA ALA D 139 -2.022 -17.489 1.680 1.0...AFQ---RWSRT >HHHHH---HGGG > ATOM...XS C 1BXSC RQAFQIGSPWRTM

  13. Ameerika mäed pensioniraha näitel / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2011-01-01

    2010. aasta lõpuks oli kohustuslike pensionifondide vara väärtus taas tõusnud kõrgemale sissemaksete mahust. Keskmiselt on fondide reaaltootlus olnud negatiivne. USA börsianalüütiku Ed Eastelingi raamatust "Tõenäolised tulemused: aktsiaturu pikaajalised perspektiivid". Diagrammid

  14. Anisakiasis presenting to the ED: clinical manifestations, time course, hematologic tests, computed tomographic findings, and treatment.

    Science.gov (United States)

    Takabayashi, Takeshi; Mochizuki, Toshiaki; Otani, Norio; Nishiyama, Kei; Ishimatsu, Shinichi

    2014-12-01

    The prevalence of anisakiasis is rare in the United States and Europe compared with that in Japan, with few reports of its presentation in the emergency department (ED). This study describes the clinical, hematologic, computed tomographic (CT) characteristics, and treatment in gastric and small intestinal anisakiasis patients in the ED. We retrospectively reviewed the data of 83 consecutive anisakiasis presentations in our ED between 2003 and 2012. Gastric anisakiasis was endoscopically diagnosed with the Anisakis polypide. Small intestinal anisakiasis was diagnosed based on both hematologic (Anisakis antibody) and CT findings. Of the 83 cases, 39 had gastric anisakiasis and 44 had small intestinal anisakiasis based on our diagnostic criteria. Although all patients had abdominal pain, the gastric anisakiasis group developed symptoms significantly earlier (peaking within 6 hours) than the small intestinal anisakiasis group (peaking within 48 hours), and fewer patients with gastric anisakiasis needed admission therapy (5% vs 57%, Pfindings revealed edematous wall thickening in all patients, and ascites and phlegmon of the mesenteric fat were more frequently observed in the small intestinal anisakiasis group. In the ED, early and accurate diagnosis of anisakiasis is important to treat and explain to the patient, and diagnosis can be facilitated by a history of raw seafood ingestion, evaluation of the time-to-symptom development, and classic CT findings. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. EdD Students’ Self-Efficacy and Interest in Conducting Research

    Directory of Open Access Journals (Sweden)

    Monica R Kerrigan

    2016-03-01

    Full Text Available Today’s educational practitioners are expected to know how to gather, analyze, and report on data for accountability purposes and to use that information to improve student outcomes. However, there is little understanding of how to support practitioners’ learning of and engagement with research and few studies on the research experiences of students enrolled in Doctorate of Education (EdD programs. The success of students enrolled in Doctor of Philosophy (PhD programs in conducting research has been found to be related to students’ self-efficacy and interest, but these concepts have not been explored with EdD students who are more likely to engage in applied research in their workplace than to create a research-focused career. This study sought to understand the self-efficacy and interest that EdD students enrolled in an Educational Leadership program have in research skills and tasks in order to improve research course offerings. Our findings with EdD students are consistent with existing research on PhD students regarding research self-efficacy but we did not observe significant changes in students’ interest over time. We suggest avenues for future study in light of current accountability reporting requirements for practitioners.

  16. An Analysis of Professional Practice Ed.D. Dissertations in Educational Technology

    Science.gov (United States)

    Dawson, Kara; Kumar, Swapna

    2014-01-01

    The University of Florida offers an online professional practice Ed.D. focused on Educational Technology. Twenty-three students have completed professional practice dissertations and graduated since the program's inception in 2008. The purpose of this article is to share what these dissertations have looked like and to begin a dialogue about…

  17. Exploring personality clusters among parents of ED subjects. Relationship with parents' psychopathology, attachment, and family dynamics.

    Science.gov (United States)

    Amianto, Federico; Daga, Giovanni Abbate; Bertorello, Antonella; Fassino, Secondo

    2013-10-01

    Eating disorders are some of the most difficult mental disorders to treat and manage. Family interacts with genetic dispositions and other pathogenic factors, and may influence the outburst, development and outcome of EDs. The present study explores with a cluster analysis the personality traits of parents of ED subjects. One-hundred-eight mothers and 104 fathers were tested with Temperament Character Inventory (TCI), Eating Disorder Inventory-2 (EDI-2), State-Trait Anger Expression Inventory (STAX), Family Assessment Device (FAD), Attachment Style Questionnaire (ASQ), Symptom Questionnaire (SQ), Psychological Well-Being scales (PWB). The cluster distribution of parents based on personality traits was explored. Parents' clusters TCI scores were compared as regards personality, psychopathology, attachment and family features. Cross distribution of temperament and character clusters in mothers and fathers, among couples and ED diagnoses of the daughters was explored. Two clusters of mothers and fathers were identified with temperament clustering. Character traits led to two mothers and three fathers clusters. Mothers temperament cluster 1 (MTC1) correspond to a explosive/adventurous profile, MTC2 to a cautious/passive-dependent profile. Fathers temperament cluster 1 (FTC1) was explosive/methodic, FTC2 was independent/methodic. Character clustering distinguished very immature mothers (MCC1) and majority (65%) of character mature mothers with low self-transcendence (MCC2). A third of fathers was severely immature (FCC1), a third impaired as regards relationships (poor cooperativeness and self-transcendence; FCC2), and one third character mature fathers with low self-transcendence (FCC3). Each cluster evidences specific psychopathology and attachment characteristics. FTC1 was more frequently associated with character immaturity. No significant clusters' cross correlation was found in parental couples. Parents' clusters analyze in depth the univocal picture of

  18. Tackling causes and costs of ED presentation for American football injuries: a population-level study.

    Science.gov (United States)

    Smart, Blair J; Haring, R Sterling; Asemota, Anthony O; Scott, John W; Canner, Joseph K; Nejim, Besma J; George, Benjamin P; Alsulaim, Hatim; Kirsch, Thomas D; Schneider, Eric B

    2016-07-01

    American tackle football is the most popular high-energy impact sport in the United States, with approximately 9 million participants competing annually. Previous epidemiologic studies of football-related injuries have generally focused on specific geographic areas or pediatric age groups. Our study sought to examine patient characteristics and outcomes, including hospital charges, among athletes presenting for emergency department (ED) treatment of football-related injury across all age groups in a large nationally representative data set. Patients presenting for ED treatment of injuries sustained playing American tackle football (identified using International Classification of Diseases, Ninth Revision, Clinical Modification code E007.0) from 2010 to 2011 were studied in the Nationwide Emergency Department Sample. Patient-specific injuries were identified using the primary International Classification of Diseases, Ninth Revision, Clinical Modification diagnosis code and categorized by type and anatomical region. Standard descriptive methods examined patient demographics, diagnosis categories, and ED and inpatient outcomes and charges. During the study period 397363 football players presented for ED treatment, 95.8% of whom were male. Sprains/strains (25.6%), limb fractures (20.7%), and head injuries (including traumatic brain injury; 17.5%) represented the most presenting injuries. Overall, 97.9% of patients underwent routine ED discharge with 1.1% admitted directly and fewer than 11 patients in the 2-year study period dying prior to discharge. The proportion of admitted patients who required surgical interventions was 15.7%, of which 89.9% were orthopedic, 4.7% neurologic, and 2.6% abdominal. Among individuals admitted to inpatient care, mean hospital length of stay was 2.4days (95% confidence interval, 2.2-2.6) and 95.6% underwent routine discharge home. The mean total charge for all patients was $1941 (95% confidence interval, $1890-$1992) with substantial

  19. Missing the boat: odds for the patients who leave ED without being seen

    Directory of Open Access Journals (Sweden)

    Fayyaz Jabeen

    2013-01-01

    Full Text Available Abstract Background A patient left without being seen is a well-recognized indicator of Emergency Department overcrowding. The aim of this study was to define the characteristics of LWBS patients, their rates and associated factors from a tertiary care hospital of Pakistan. Methods A retrospective patient record review was undertaken. All patients presenting to the Aga Khan University Hospital, Karachi, between April and December of the year 2010, were included in the study. Information was collected on age, sex, presenting complaints, ED capacity, month, time, shift, day of the week, and waiting times in the ED. A basic descriptive analysis was made and the rates of LWBS patients were determined among the patient subgroups. Logistic regression analysis was used to assess the risk factors associated with a patient not being seen in the ED. Results A total of 38,762 patients visited ED during the study period. Among them 5,086 (13% patients left without being seen. Percentage of leaving was highest in the night shift (20%. The percentage was twice as high when the ED was on diversion (19.8% compared to regular periods of operation (9.8%. Mean waiting time before leaving the ED in pediatric patients was 154 minutes while for adults it was 171 minutes. More than 32% of patients had waited for more than 180 minutes before they left without being seen, compared to the patients who were seen in ED. Important predictors for LWBS included; Triage category P4 i.e. walk –in-patients had an OR of 13.62(8.72-21.3, Diversion status, OR 1.49(1.26-1.76, night shift , OR 2.44(1.95-3.05 and Pediatric age, OR 0.57(0.48-0.66. Conclusions Our study elucidates the LWBS population characteristics and identifies the risk factors for this phenomenon. Targeted interventions should be planned and implemented to decrease the waiting time and alternate services should be provided for high-risk patients (for LWBS to minimize their number.

  20. Progress of the BT-EdF-CEA project. The lithium polymer battery; Avancees du projet BT-EdF-CEA. Batterie lithium polymere

    Energy Technology Data Exchange (ETDEWEB)

    Marginedes, D.; Majastre, H. [Bollore Technologies, 29 - Quimper (France); Baudry, P.; Lascaud, S. [Electricite de France, 77 - Moret sur Loing (France). Direction des Etudes et Recherches; Bloch, D.; Lebrun, N. [CEA Grenoble, CEREM, 38 (France)

    1996-12-31

    The lithium-polymer energy storage technology requires the production of thin films of huge surface. The BT-EdF-CEA consortium has studied the various manufacturing techniques of these films and their assembly. The process was chosen according to its productivity, low expensiveness, ecological impact and energy performances with capacities reaching 40 Ah. This paper explains: the objectives and specifications of the project, the advantage of the consortium and the role of the different partners, the results (coating, dry extrusion and battery element manufacturing techniques), and the electrochemical performances of the elements. (J.S.)

  1. Progress of the BT-EdF-CEA project. The lithium polymer battery; Avancees du projet BT-EdF-CEA. Batterie lithium polymere

    Energy Technology Data Exchange (ETDEWEB)

    Marginedes, D; Majastre, H [Bollore Technologies, 29 - Quimper (France); Baudry, P; Lascaud, S [Electricite de France, 77 - Moret sur Loing (France). Direction des Etudes et Recherches; Bloch, D; Lebrun, N [CEA Grenoble, CEREM, 38 (France)

    1997-12-31

    The lithium-polymer energy storage technology requires the production of thin films of huge surface. The BT-EdF-CEA consortium has studied the various manufacturing techniques of these films and their assembly. The process was chosen according to its productivity, low expensiveness, ecological impact and energy performances with capacities reaching 40 Ah. This paper explains: the objectives and specifications of the project, the advantage of the consortium and the role of the different partners, the results (coating, dry extrusion and battery element manufacturing techniques), and the electrochemical performances of the elements. (J.S.)

  2. Factorial Structure and Preliminary Validation of the Schema Mode Inventory for Eating Disorders (SMI-ED).

    Science.gov (United States)

    Simpson, Susan G; Pietrabissa, Giada; Rossi, Alessandro; Seychell, Tahnee; Manzoni, Gian Mauro; Munro, Calum; Nesci, Julian B; Castelnuovo, Gianluca

    2018-01-01

    Objective: The aim of this study was to examine the psychometric properties and factorial structure of the Schema Mode Inventory for Eating Disorders (SMI-ED) in a disordered eating population. Method: 573 participants with disordered eating patterns as measured by the Eating Disorder Examination Questionnaire (EDE-Q) completed the 190-item adapted version of the Schema Mode Inventory (SMI). The new SMI-ED was developed by clinicians/researchers specializing in the treatment of eating disorders, through combining items from the original SMI with a set of additional questions specifically representative of the eating disorder population. Psychometric testing included Confirmatory Factor Analysis (CFA) and internal consistency (Cronbach's α). Multivariate Analyses of Covariance (MANCOVA) was also run to test statistical differences between the EDE-Q subscales on the SMI-ED modes, while controlling for possible confounding variables. Results: Factorial analysis confirmed an acceptable 16-related-factors solution for the SMI-ED, thus providing preliminary evidence for the adequate validity of the new measure based on internal structure. Concurrent validity was also established through moderate to high correlations on the modes most relevant to eating disorders with EDE-Q subscales. This study represents the first step in creating a psychometrically sound instrument for measuring schema modes in eating disorders, and provides greater insight into the relevant schema modes within this population. Conclusion: This research represents an important preliminary step toward understanding and labeling the schema mode model for this clinical group. Findings from the psychometric evaluation of SMI-ED suggest that this is a useful tool which may further assist in the measurement and conceptualization of schema modes in this population.

  3. Factorial Structure and Preliminary Validation of the Schema Mode Inventory for Eating Disorders (SMI-ED

    Directory of Open Access Journals (Sweden)

    Susan G. Simpson

    2018-04-01

    Full Text Available Objective: The aim of this study was to examine the psychometric properties and factorial structure of the Schema Mode Inventory for Eating Disorders (SMI-ED in a disordered eating population.Method: 573 participants with disordered eating patterns as measured by the Eating Disorder Examination Questionnaire (EDE-Q completed the 190-item adapted version of the Schema Mode Inventory (SMI. The new SMI-ED was developed by clinicians/researchers specializing in the treatment of eating disorders, through combining items from the original SMI with a set of additional questions specifically representative of the eating disorder population. Psychometric testing included Confirmatory Factor Analysis (CFA and internal consistency (Cronbach's α. Multivariate Analyses of Covariance (MANCOVA was also run to test statistical differences between the EDE-Q subscales on the SMI-ED modes, while controlling for possible confounding variables.Results: Factorial analysis confirmed an acceptable 16-related-factors solution for the SMI-ED, thus providing preliminary evidence for the adequate validity of the new measure based on internal structure. Concurrent validity was also established through moderate to high correlations on the modes most relevant to eating disorders with EDE-Q subscales. This study represents the first step in creating a psychometrically sound instrument for measuring schema modes in eating disorders, and provides greater insight into the relevant schema modes within this population.Conclusion: This research represents an important preliminary step toward understanding and labeling the schema mode model for this clinical group. Findings from the psychometric evaluation of SMI-ED suggest that this is a useful tool which may further assist in the measurement and conceptualization of schema modes in this population.

  4. Torrefied Biomass Pellets—Comparing Grindability in Different Laboratory Mills

    Directory of Open Access Journals (Sweden)

    Jan Hari Arti Khalsa

    2016-10-01

    Full Text Available The firing and co-firing of biomass in pulverized coal fired power plants around the world is expected to increase in the coming years. Torrefaction may prove to be a suitable way of upgrading biomass for such an application. For transport and storage purposes, the torrefied biomass will tend to be in pellet form. Whilst standard methods for the assessment of the milling characteristics of coal exist, this is not the case for torrefied materials—whether in pellet form or not. The grindability of the fuel directly impacts the overall efficiency of the combustion process and as such it is an important parameter. In the present study, the grindability of different torrefied biomass pellets was tested in three different laboratory mill types; cutting mill (CM, hammer mill (HM and impact mill (IM. The specific grinding energy (SGE required for a defined mass throughput of pellets in each mill was measured and results were compared to other pellet characterization methods (e.g., durability, and hardness as well as the modified Hardgrove Index. Seven different torrefied biomass pellets including willow, pine, beech, poplar, spruce, forest residue and straw were used as feedstock. On average, the particle-size distribution width (across all feedstock was narrowest for the IM (0.41 mm, followed by the HM (0.51 mm and widest for the CM (0.62 mm. Regarding the SGE, the IM consumed on average 8.23 Wh/kg while CM and HM consumed 5.15 and 5.24 Wh/kg, respectively. From the three mills compared in this study, the IM seems better fit for being used in a standardized method that could be developed in the future, e.g., as an ISO standard.

  5. Is scanning electron microscopy/energy dispersive X-ray spectrometry (SEM/EDS) quantitative?

    Science.gov (United States)

    Newbury, Dale E; Ritchie, Nicholas W M

    2013-01-01

    Scanning electron microscopy/energy dispersive X-ray spectrometry (SEM/EDS) is a widely applied elemental microanalysis method capable of identifying and quantifying all elements in the periodic table except H, He, and Li. By following the "k-ratio" (unknown/standard) measurement protocol development for electron-excited wavelength dispersive spectrometry (WDS), SEM/EDS can achieve accuracy and precision equivalent to WDS and at substantially lower electron dose, even when severe X-ray peak overlaps occur, provided sufficient counts are recorded. Achieving this level of performance is now much more practical with the advent of the high-throughput silicon drift detector energy dispersive X-ray spectrometer (SDD-EDS). However, three measurement issues continue to diminish the impact of SEM/EDS: (1) In the qualitative analysis (i.e., element identification) that must precede quantitative analysis, at least some current and many legacy software systems are vulnerable to occasional misidentification of major constituent peaks, with the frequency of misidentifications rising significantly for minor and trace constituents. (2) The use of standardless analysis, which is subject to much broader systematic errors, leads to quantitative results that, while useful, do not have sufficient accuracy to solve critical problems, e.g. determining the formula of a compound. (3) EDS spectrometers have such a large volume of acceptance that apparently credible spectra can be obtained from specimens with complex topography that introduce uncontrolled geometric factors that modify X-ray generation and propagation, resulting in very large systematic errors, often a factor of ten or more. © Wiley Periodicals, Inc.

  6. Factorial Structure and Preliminary Validation of the Schema Mode Inventory for Eating Disorders (SMI-ED)

    Science.gov (United States)

    Simpson, Susan G.; Pietrabissa, Giada; Rossi, Alessandro; Seychell, Tahnee; Manzoni, Gian Mauro; Munro, Calum; Nesci, Julian B.; Castelnuovo, Gianluca

    2018-01-01

    Objective: The aim of this study was to examine the psychometric properties and factorial structure of the Schema Mode Inventory for Eating Disorders (SMI-ED) in a disordered eating population. Method: 573 participants with disordered eating patterns as measured by the Eating Disorder Examination Questionnaire (EDE-Q) completed the 190-item adapted version of the Schema Mode Inventory (SMI). The new SMI-ED was developed by clinicians/researchers specializing in the treatment of eating disorders, through combining items from the original SMI with a set of additional questions specifically representative of the eating disorder population. Psychometric testing included Confirmatory Factor Analysis (CFA) and internal consistency (Cronbach's α). Multivariate Analyses of Covariance (MANCOVA) was also run to test statistical differences between the EDE-Q subscales on the SMI-ED modes, while controlling for possible confounding variables. Results: Factorial analysis confirmed an acceptable 16-related-factors solution for the SMI-ED, thus providing preliminary evidence for the adequate validity of the new measure based on internal structure. Concurrent validity was also established through moderate to high correlations on the modes most relevant to eating disorders with EDE-Q subscales. This study represents the first step in creating a psychometrically sound instrument for measuring schema modes in eating disorders, and provides greater insight into the relevant schema modes within this population. Conclusion: This research represents an important preliminary step toward understanding and labeling the schema mode model for this clinical group. Findings from the psychometric evaluation of SMI-ED suggest that this is a useful tool which may further assist in the measurement and conceptualization of schema modes in this population. PMID:29740379

  7. Effectiveness of Mathematics Teaching and Learning Experiences through Wireless Technology as Recent Style to Enhance B.Ed. Trainees

    Science.gov (United States)

    Joan, D. R. Robert

    2015-01-01

    The objective of the study was to find out the effect of learning through Wireless technologies and the traditional method in teaching and learning Mathematics. The investigator adopted experimental research to find the effectiveness of implementing Wireless technologies in the population of B.Ed. trainees. The investigator selected 32 B.Ed.…

  8. All-Natural Tips to Improve Your Sex Life: Exercise, Diet Changes May Help Reverse ED (Erectile Dysfunction)

    Science.gov (United States)

    ... in the journal Atherosclerosis found that men with vitamin D deficiency have a 30% greater risk for ED. 3. Slim down. Obesity raises risks for vascular disease and diabetes, two major causes of ED. And excess fat tinkers with several hormones that may feed ...

  9. Mentoring from Different Social Spheres: How Can Multiple Mentors Help in Doctoral Student Success in Ed.D Programs?

    Science.gov (United States)

    Terry, Tarae; Ghosh, Rajashi

    2015-01-01

    Doctoral students leave their programs early due to lack of mentoring relationships needed to support degree completion and success. However, how mentoring contributes to Ed.D degree completion is not widely studied. In this qualitative narrative study, we sought to explore how multiple mentoring relationships reduced attrition in an Ed.D program.…

  10. Using Google Flu Trends data in forecasting influenza-like-illness related ED visits in Omaha, Nebraska.

    Science.gov (United States)

    Araz, Ozgur M; Bentley, Dan; Muelleman, Robert L

    2014-09-01

    Emergency department (ED) visits increase during the influenza seasons. It is essential to identify statistically significant correlates in order to develop an accurate forecasting model for ED visits. Forecasting influenza-like-illness (ILI)-related ED visits can significantly help in developing robust resource management strategies at the EDs. We first performed correlation analyses to understand temporal correlations between several predictors of ILI-related ED visits. We used the data available for Douglas County, the biggest county in Nebraska, for Omaha, the biggest city in the state, and for a major hospital in Omaha. The data set included total and positive influenza test results from the hospital (ie, Antigen rapid (Ag) and Respiratory Syncytial Virus Infection (RSV) tests); an Internet-based influenza surveillance system data, that is, Google Flu Trends, for both Nebraska and Omaha; total ED visits in Douglas County attributable to ILI; and ILI surveillance network data for Douglas County and Nebraska as the predictors and data for the hospital's ILI-related ED visits as the dependent variable. We used Seasonal Autoregressive Integrated Moving Average and Holt Winters methods with3 linear regression models to forecast ILI-related ED visits at the hospital and evaluated model performances by comparing the root means square errors (RMSEs). Because of strong positive correlations with ILI-related ED visits between 2008 and 2012, we validated the use of Google Flu Trends data as a predictor in an ED influenza surveillance tool. Of the 5 forecasting models we have tested, linear regression models performed significantly better when Google Flu Trends data were included as a predictor. Regression models including Google Flu Trends data as a predictor variable have lower RMSE, and the lowest is achieved when all other variables are also included in the model in our forecasting experiments for the first 5 weeks of 2013 (with RMSE = 57.61). Google Flu Trends data

  11. New 'patent accelerated care environment' aims to facilitate work flow, free up ED for acute care needs.

    Science.gov (United States)

    2012-02-01

    Faced with rising acuity levels and surging demand, Virginia Mason Medical Center modified the Clinical Decision Unit concept used in many EDs, and developed a new Patient Accelerated Care Environment (PACE) to care for observation patients, process patients for discharge, and to prepare patients for admission.The approach is designed to utilize ED beds for initial processing of patients, allowing resuscitative care if needed, and treating and releasing the patients with quick care needs. Using the Virginia Mason Production System, a methodology that is modeled after Toyota production techniques, developers designed an optimal work flow pattern and then built infrastructure to facilitate that process. All patients who present to the ED for care are seen by the ED team through a "team greet" approach. Approximately 35% to 40% of patients who come to the ED for care are transferred to the PACE unit. Patients assigned to the PACE unit typically remain there for 4 to 48 hours, depending on their care needs.

  12. Male sexuality and regulation of emotions: a study on the association between alexithymia and erectile dysfunction (ED).

    Science.gov (United States)

    Michetti, P M; Rossi, R; Bonanno, D; Tiesi, A; Simonelli, C

    2006-01-01

    Alexithymia is a multidimensional construct that describes a constellation of personality features characterised by difficulties in differentiating, identifying and communicating emotions. The purpose of the present study was to investigate prevalence of alexithymia in outpatients with erectile dysfunction (ED), both in the psychogenic lifelong type (PLED) and in the acquired one (PAED). ED severity was evaluated with the International Index of Erectile Function (IIEF) and alexithymia was measured using the Italian version of the 20-item Toronto Alexithymia Scale (TAS-20). The results suggest a high incidence of alexithymic characteristics in patients with psychogenic ED, a positive correlation between the alexithymia level and ED severity in patients with PAED and statistically significant differences in the alexithymia level between the two subgroups PLED and PAED. We assumed that alexithymia contributes to the origin of the PLED, and to a more severe manifestation of ED, once it appears in the acquired form.

  13. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  14. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  15. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  16. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  17. Higher Ed Meets Public Ed.

    Science.gov (United States)

    Olenick, Mary Jo

    1996-01-01

    The University of Connecticut is revitalizing the Avery Point campus with two new buildings. A Marine Sciences and Technology Center will serve graduate and undergraduate students. A separate Marine Sciences Field Station/Hostel will house Project Oceanology: a science program for students in grades 5-12. (MLF)

  18. ED accreditation update. Physicians, medical staff may report safety concerns without fear of disciplinary action.

    Science.gov (United States)

    2007-11-01

    Educating your staff about The Joint Commission's requirements for concerns about hospital safety and quality of care requires the ED manager to set a tone of openness and cooperation, while at the same time emphasizing your department's role in addressing such concerns: * The ED should be the first place that staff members communicate quality and safety concerns. It is only when a problem is not addressed that they should take the issue to hospital administration and, if necessary, The Joint Commission. * A single event should not trigger a report to The Joint Commission, unless it is unusually serious. Otherwise, only a series of events should trigger a report. * Reassure your staff that you care about what is reported and will act quickly on it. Educate your staff about the reporting forms, and follow up with random audits to ensure compliance.

  19. As personagens femininas nos contos de fadas: uma perspectiva edípica

    Directory of Open Access Journals (Sweden)

    Cristina Rothier Duarte

    2016-09-01

    Full Text Available A presente pesquisa trata de uma proposta de análise de personagens femininas protagonistas em dois contos de fadas, segundo uma perspectiva edípica. Como metodologia, empregou-se pesquisas bibliográficas de cunho qualitativo-interpretativo. A investigação revelou que, a partir da leitura dos contos de fadas, a resolução dos conflitos enfrentados pelas meninas em razão do Complexo de Édipo é facilitada. Desse modo, essas narrativas se apresentam como importante instrumento que pode ser empregado, para que a passagem da menina pela fase edípica seja funcional, aproximando o seu desfecho da normalidade, o que significa maior possibilidade de um desenvolvimento sem desencadeamento de distúrbios psicanalíticos que poderiam se refletir em sua vida adulta.

  20. Predicting tularemia with clinical, laboratory and demographical findings in the ED.

    Science.gov (United States)

    Yapar, Derya; Erenler, Ali Kemal; Terzi, Özlem; Akdoğan, Özlem; Ece, Yasemin; Baykam, Nurcan

    2016-02-01

    We aimed to determine clinical, laboratory and demographical characteristics of tularemia on admission to Emergency Department (ED). Medical data of 317 patients admitted to ED and subsequently hospitalized with suspected tularemia between January 1, 2011, and May 31, 2015, were collected. Patients were divided into 2 groups according to microagglutination test results, as tularemia (+) and tularemia (-). Of the 317 patients involved, 49 were found to be tularemia (+) and 268 were tularemia (-). Mean age of the tularemia (+) patients was found to be higher than that of tularemia (-) patients. When compared to tularemia (-) patients, a significant portion of patients in tularemia (+) patients were elderly, living in rural areas and had contact with rodents. When clinical and laboratory findings of the 2 groups were compared, any statistical significance could not be determined. Tularemia is a disease of elderly people living in rural areas. Contact with rodents also increases risk of tularemia in suspected patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. The impact of inpatient boarding on ED efficiency: a discrete-event simulation study.

    Science.gov (United States)

    Bair, Aaron E; Song, Wheyming T; Chen, Yi-Chun; Morris, Beth A

    2010-10-01

    In this study, a discrete-event simulation approach was used to model Emergency Department's (ED) patient flow to investigate the effect of inpatient boarding on the ED efficiency in terms of the National Emergency Department Crowding Scale (NEDOCS) score and the rate of patients who leave without being seen (LWBS). The decision variable in this model was the boarder-released-ratio defined as the ratio of admitted patients whose boarding time is zero to all admitted patients. Our analysis shows that the Overcrowded(+) (a NEDOCS score over 100) ratio decreased from 88.4% to 50.4%, and the rate of LWBS patients decreased from 10.8% to 8.4% when the boarder-released-ratio changed from 0% to 100%. These results show that inpatient boarding significantly impacts both the NEDOCS score and the rate of LWBS patient and this analysis provides a quantification of the impact of boarding on emergency department patient crowding.

  2. Webová aplikace v desktopovém prostředí

    OpenAIRE

    Bugáň, Marek

    2014-01-01

    Tato bakalářská práce by měla ukázat, jak se dá pracovat s webovými aplikacemi v destkopovém prostředí. Jsou zde popsány technologie, které se dají požít pro vývoj těchto aplikací. Jádrem práce je popsat a demonstrovat vývoj aplikací v prostředí Google Chrome API. This bachelor thesis shoul show us, how to work with web application in desktop environment. It show us, wthch technologies we can use for development of this kind of application. The aim of thesis is to describe and demonstrate ...

  3. Investigation of Detectability of Elementary Composition of Rainbow trout muscle with EDS (Energy Dispersive Spectroscopy Method

    Directory of Open Access Journals (Sweden)

    Saltuk Buğrahan CEYHUN

    2017-06-01

    Full Text Available In present study, it is investigated that detectability of elementary composition of rainbow trout muscle using Energy Dispersive Spectroscopy (EDS. EDS system which has worked with attached to scanning electron microscope can do qualitative and semi-quantitative elementary analyses on selected region of sample using characteristic X-rays. For this purpose, it was performed four point and two mapping analyses from four samples. According to results, it was detected 13 elements which are consist of C, N and O in 87.70 percentage. As a result, although the method is sensitive and reliable, it is concluded that not adequate for elemental analysis alone but can be used as a support for analyzes with systems such as especially atomic absorption and ICP-MS.

  4. Urine culture guided antibiotic interventions: A pharmacist driven antimicrobial stewardship effort in the ED.

    Science.gov (United States)

    Zhang, Xi; Rowan, Nicole; Pflugeisen, Bethann Mangel; Alajbegovic, Sanjin

    2017-04-01

    Antibiotics are overprescribed for abnormal urine tests including asymptomatic bacteriuria (AB), contributing to rising antimicrobial resistance rates. Pharmacists reviewed urine cultures daily from emergency department (ED) encounters to assess antibiotic appropriateness. We studied antibiotic prescribing practices and assessed compliance to national guidelines, correlations with urine analysis (UA) components, and opportunities for antimicrobial stewardship in the ED. This quality improvement project (QIP) was a prospective cohort study at a community hospital ED, with data collected from finalized urine cultures resulting October 30, 2014 through January 5, 2015. Analyses were conducted using Chi-squared and Fisher Exact tests and stepwise multiple logistic regression. Urine cultures from 457 encounters were reviewed, of which 136 met the inclusion criteria as non-pregnant and asymptomatic for urinary tract infection (UTI). 43% of 136 patients were treated with antibiotics, for a total of 426 antibiotic days. Pharmacist interventions for these patients resulted in 122/426 (29%) of potential antibiotic days saved. Factors found to significantly increase the odds of antibiotic prescribing in asymptomatic patients included presence of leukocyte esterase (OR=4.5, 95% CI: 1.2-17.2; p=0.03) or nitrites (OR=10.8, 95% CI: 1.7-68.1; p=0.01) in the urine and age≥75 (OR=3.5, 95% CI: 1.2-9.6, p=0.02). Pharmacist intervention in discontinuing or modifying antibiotics for asymptomatic patients with urine cultures reduced unnecessary antibiotic exposure and was a first step in antimicrobial stewardship efforts in the ED. Future work includes limiting urine tests and subsequent antibiotic therapy for non-pregnant asymptomatic patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. ED-WAVE tool design approach: Case of a textile wastewater treatment plant in Blantyre, Malawi

    Science.gov (United States)

    Chipofya, V.; Kraslawski, A.; Avramenko, Y.

    The ED-WAVE tool is a PC based package for imparting training on wastewater treatment technologies. The system consists of four modules viz. Reference Library, Process Builder, Case Study Manager, and Treatment Adviser. The principles of case-based design and case-based reasoning as applied in the ED-WAVE tool are utilised in this paper to evaluate the design approach of the wastewater treatment plant at Mapeto David Whitehead & Sons (MDW&S) textile and garments factory, Blantyre, Malawi. The case being compared with MDW&S in the ED-WAVE tool is Textile Case 4 in Sri Lanka (2003). Equalisation, coagulation and rotating biological contactors is the sequencing of treatment units at Textile Case 4 in Sri Lanka. Screening, oxidation ditches and sedimentation is the sequencing of treatment units at MDW&S textile and garments factory. The study suggests that aerobic biological treatment is necessary in the treatment of wastewater from a textile and garments factory. MDW&S incorporates a sedimentation process which is necessary for the removal of settleable matter before the effluent is discharged to the municipal wastewater treatment plant. The study confirmed the practical use of the ED-WAVE tool in the design of wastewater treatment systems, where after encountering a new situation; already collected decision scenarios (cases) are invoked and modified in order to arrive at a particular design alternative. What is necessary, however, is to appropriately modify the case arrived at through the Case Study Manager in order to come up with a design appropriate to the local situation taking into account technical, socio-economic and environmental aspects.

  6. Emergency Doses (ED) - Revision 3: A calculator code for environmental dose computations

    International Nuclear Information System (INIS)

    Rittmann, P.D.

    1990-12-01

    The calculator program ED (Emergency Doses) was developed from several HP-41CV calculator programs documented in the report Seven Health Physics Calculator Programs for the HP-41CV, RHO-HS-ST-5P (Rittman 1984). The program was developed to enable estimates of offsite impacts more rapidly and reliably than was possible with the software available for emergency response at that time. The ED - Revision 3, documented in this report, revises the inhalation dose model to match that of ICRP 30, and adds the simple estimates for air concentration downwind from a chemical release. In addition, the method for calculating the Pasquill dispersion parameters was revised to match the GENII code within the limitations of a hand-held calculator (e.g., plume rise and building wake effects are not included). The summary report generator for printed output, which had been present in the code from the original version, was eliminated in Revision 3 to make room for the dispersion model, the chemical release portion, and the methods of looping back to an input menu until there is no further no change. This program runs on the Hewlett-Packard programmable calculators known as the HP-41CV and the HP-41CX. The documentation for ED - Revision 3 includes a guide for users, sample problems, detailed verification tests and results, model descriptions, code description (with program listing), and independent peer review. This software is intended to be used by individuals with some training in the use of air transport models. There are some user inputs that require intelligent application of the model to the actual conditions of the accident. The results calculated using ED - Revision 3 are only correct to the extent allowed by the mathematical models. 9 refs., 36 tabs

  7. re ipit tion re onstru tion using ringEwidth hronology of rim lyn ed r ...

    Indian Academy of Sciences (India)

    r nges from IHHEEIUS mF hue to he vy r inf ll it does not grow in the e stern rim l y eyond q rhw lF he ringEwidth hronology of rim l y n ed r @eh. IIUIEEIWVVAD prep red from tree ores olle ted from two disjun t m ture forests in western rim l y . @figure IAD h s een used in the present studyF het ils of the methodology ...

  8. "Head käed" tõid Berlinalelt auhinna / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2002-01-01

    Berliini 52. filmifestivali tulemustest. Festivali "Panorama Special" kavas olnud Peeter Simmi "Head käed" saavutas hea publikuedu ning jagas sloveenlase Maja Weiss'i filmiga "Piirivalvur" Manfred Salzgeberi auhinda, mis on mõeldud subtiitrite tegemiseks filmi levitamisel euroopa ekraanidele. Kuldkaru jagasid briti Paul Greengrassi "Verine pühapäev" ja jaapanlase Hayao Miyazaki animafilm "Vaimudest viidud". Parima režissööri Hõbekaru sai Otar Ioseliani

  9. TEM EDS analysis of epitaxially-grown self-assembled indium islands

    Directory of Open Access Journals (Sweden)

    Jasmine Sears

    2017-05-01

    Full Text Available Epitaxially-grown self-assembled indium nanostructures, or islands, show promise as nanoantennas. The elemental composition and internal structure of indium islands grown on gallium arsenide are explored using Transmission Electron Microscopy (TEM Energy Dispersive Spectroscopy (EDS. Several sizes of islands are examined, with larger islands exhibiting high (>94% average indium purity and smaller islands containing inhomogeneous gallium and arsenic contamination. These results enable more accurate predictions of indium nanoantenna behavior as a function of growth parameters.

  10. Snow shovel-related injuries and medical emergencies treated in US EDs, 1990 to 2006.

    Science.gov (United States)

    Watson, Daniel S; Shields, Brenda J; Smith, Gary A

    2011-01-01

    Injuries and medical emergencies associated with snow shovel use are common in the United States. This is a retrospective analysis of data from the National Electronic Injury Surveillance System. This study analyzes the epidemiologic features of snow shovel-related injuries and medical emergencies treated in US emergency departments (EDs) from 1990 to 2006. An estimated 195 100 individuals (95% confidence interval, 140 400-249 800) were treated in US EDs for snow shovel-related incidents during the 17-year study period, averaging 11 500 individuals annually (SD, 5300). The average annual rate of snow shovel-related injuries and medical emergencies was 4.15 per 100 000 population. Approximately two thirds (67.5%) of these incidents occurred among males. Children younger than 18 years comprised 15.3% of the cases, whereas older adults (55 years and older) accounted for 21.8%. The most common diagnosis was soft tissue injury (54.7%). Injuries to the lower back accounted for 34.3% of the cases. The most common mechanism of injury/nature of medical emergency was acute musculoskeletal exertion (53.9%) followed by slips and falls (20.0%) and being struck by a snow shovel (15.0%). Cardiac-related ED visits accounted for 6.7% of the cases, including all of the 1647 deaths in the study. Patients required hospitalization in 5.8% of the cases. Most snow shovel-related incidents (95.6%) occurred in and around the home. This is the first study to comprehensively examine snow shovel-related injuries and medical emergencies in the United States using a nationally representative sample. There are an estimated 11 500 snow shovel-related injuries and medical emergencies treated annually in US EDs. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. The ED95 of Nalbuphine in Outpatient-Induced Abortion Compared to Equivalent Sufentanil.

    Science.gov (United States)

    Chen, Limei; Zhou, Yamei; Cai, Yaoyao; Bao, Nana; Xu, Xuzhong; Shi, Beibei

    2018-04-07

    This prospective study evaluated the 95% effective dose (ED 95 ) of nalbuphine in inhibiting body movement during outpatient-induced abortion and its clinical efficacy versus the equivalent of sufentanil. The study was divided into two parts. For the first part, voluntary first-trimester patients who needed induced abortions were recruited to measure the ED 95 of nalbuphine in inhibiting body movement during induced abortion using the sequential method (the Dixon up-and-down method). In the second part, this was a double-blind, randomized study. Sixty cases of first-trimester patients were recruited and were randomly divided into two groups (n = 30), including group N (nalbuphine at the ED 95 dose) and group S (sufentanil at an equivalent dose). Propofol was given to both groups as the sedative. The circulation, respiration and body movement of the two groups in surgery were observed. The amount of propofol, the awakening time, the time to leave the hospital and the analgesic effect were recorded. The ED 95 of nalbuphine in inhibiting body movement during painless surgical abortion was 0.128 mg/kg (95% confidence intervals 0.098-0.483 mg/kg). Both nalbuphine and the equivalent dose of sufentanil provided a good intraoperative and post-operative analgesic effect in outpatient-induced abortion. However, the post-operative morbidity of dizziness for nalbuphine was less than for sufentanil (p abortion as an intraoperative and post-operative analgesic and showed a better effect compared with sufentanil. © 2018 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  12. A novel multidimensional geriatric screening tool in the ED: evaluation of feasibility and clinical relevance.

    Science.gov (United States)

    Schoenenberger, Andreas W; Bieri, Christoph; Özgüler, Onur; Moser, André; Haberkern, Monika; Zimmermann, Heinz; Stuck, Andreas E; Exadaktylos, Aristomenis

    2014-06-01

    Geriatric problems frequently go undetected in older patients in emergency departments (EDs), thus increasing their risk of adverse outcomes. We evaluated a novel emergency geriatric screening (EGS) tool designed to detect geriatric problems. The EGS tool consisted of short validated instruments used to screen 4 domains (cognition, falls, mobility, and activities of daily living). Emergency geriatric screening was introduced for ED patients 75 years or older throughout a 4-month period. We analyzed the prevalence of abnormal EGS and whether EGS increased the number of EGS-related diagnoses in the ED during the screening, as compared with a preceding control period. Emergency geriatric screening was performed on 338 (42.5%) of 795 patients presenting during screening. Emergency geriatric screening was unfeasible in 175 patients (22.0%) because of life-threatening conditions and was not performed in 282 (35.5%) for logistical reasons. Emergency geriatric screening took less than 5 minutes to perform in most (85.8%) cases. Among screened patients, 285 (84.3%) had at least 1 abnormal EGS finding. In 270 of these patients, at least 1 abnormal EGS finding did not result in a diagnosis in the ED and was reported for further workup to subsequent care. During screening, 142 patients (42.0%) had at least 1 diagnosis listed within the 4 EGS domains, significantly more than the 29.3% in the control period (odds ratio 1.75; 95% confidence interval, 1.34-2.29; Pdeterminants of subsequent care. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Predictors of 30-day mortality in patients admitted to ED for acute heart failure.

    Science.gov (United States)

    Marchetti, Matthieu; Benedetti, Antoine; Mimoz, Olivier; Lardeur, Jean-Yves; Guenezan, Jérémy; Marjanovic, Nicolas

    2017-03-01

    Acute heart failure (AHF) is a leading cause of admission in emergency departments (ED). It is associated with significant in-hospital mortality, suggesting that there is room for improvement of care. Our aims were to investigate clinical patterns, biological characteristics and determinants of 30-day mortality. We conducted a single site, retrospective review of adult patients (≥18years) admitted to ED for AHF over a 12-month period. Data collected included demographics, clinical, biological and outcomes data. Epidemiologic data were collected at baseline, and patients were followed up during a 30-day period. There were a total of 322 patients. Mean age was 83.9±9.1years, and 47% of the patients were men. Among them, 59 patients (18.3%) died within 30days of admission to the ED. The following three characteristics were associated with increased mortality: age>85years (OR=1.5[95%CI:0.8-2.7], p=0.01), creatinine clearance 5000pg/mL (OR=2.2[95%CI:1.2-4], p<0.001). The best Nt-proBNP cut-off value to predict first-day mortality was 9000pg/mL (area under the curve (AUC) [95%CI] of 0.790 [0.634-0.935], p<0.001). For 7-day mortality, it was 7900pg/mL (0.698 [0.578-0.819], p<0.001) and for 30-day mortality, 5000pg/mL (0.667 [0.576-0.758], p<0.001). Nt-proBNP level on admission, age and creatinine clearance, are predictive of 30-day mortality in adult patients admitted to ED for AHF. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. HigherEd 2.0: Using social media in engineering education

    OpenAIRE

    Berger, Edward

    2014-01-01

    Social media (blogs, wikis, video, and a digital authoring culture) has emerged in the last decade as a dominant feature of the technology landscape, especially for our current generation of digital-native students. Leveraging these tools for higher education in general, and engineering education in particular, should be of immediate and pressing concern for engineering educators. This discussion summarizes the HigherEd 2.0 project, the creative convergence of higher education and “web 2.0” t...

  15. Patient input into the development and enhancement of ED discharge instructions: a focus group study.

    Science.gov (United States)

    Buckley, Barbara A; McCarthy, Danielle M; Forth, Victoria E; Tanabe, Paula; Schmidt, Michael J; Adams, James G; Engel, Kirsten G

    2013-11-01

    Previous research indicates that patients have difficulty understanding ED discharge instructions; these findings have important implications for adherence and outcomes. The objective of this study was to obtain direct patient input to inform specific revisions to discharge documents created through a literacy-guided approach and to identify common themes within patient feedback that can serve as a framework for the creation of discharge documents in the future. Based on extensive literature review and input from ED providers, subspecialists, and health literacy and communication experts, discharge instructions were created for 5 common ED diagnoses. Participants were recruited from a federally qualified health center to participate in a series of 5 focus group sessions. Demographic information was obtained and a Rapid Estimate of Adult Literacy in Medicine (REALM) assessment was performed. During each of the 1-hour focus group sessions, participants reviewed discharge instructions for 1 of 5 diagnoses. Participants were asked to provide input into the content, organization, and presentation of the documents. Using qualitative techniques, latent and manifest content analysis was performed to code for emergent themes across all 5 diagnoses. Fifty-seven percent of participants were female and the average age was 32 years. The average REALM score was 57.3. Through qualitative analysis, 8 emergent themes were identified from the focus groups. Patient input provides meaningful guidance in the development of diagnosis-specific discharge instructions. Several themes and patterns were identified, with broad significance for the design of ED discharge instructions. Copyright © 2013 Emergency Nurses Association. Published by Mosby, Inc. All rights reserved.

  16. Improvement in Student Science Proficiency Through InSciEd Out

    Science.gov (United States)

    Sonju, James D.; Leicester, Jean E.; Hoody, Maggie; LaBounty, Thomas J.; Frimannsdottir, Katrin R.; Ekker, Stephen C.

    2012-01-01

    Abstract Integrated Science Education Outreach (InSciEd Out) is a collaboration formed between Mayo Clinic, Winona State University, and Rochester Public Schools (MN) with the shared vision of achieving excellence in science education. InSciEd Out employs an equitable partnership model between scientists, teachers, education researchers, and the community. Teams of teachers from all disciplines within a single school experience cutting-edge science using the zebrafish model system, as well as current pedagogical methods, during a summer internship at the Mayo Clinic. Within the internship, the teachers produce new curriculum that directly addresses opportunities for science education improvement at their own school. Zebrafish are introduced within the new curriculum to support a living model of the practice of science. Following partnership with the InSciEd Out program and 2 years of implementation in the classroom, teacher-interns from a K–8 public school reported access to local scientific technology and expertise they had not previously recognized. Teachers also reported improved integration of other disciplines into the scientific curriculum and a flow of concepts vertically from K through 8. Students more than doubled selection of an Honors science track in high school to nearly 90%. 98% of students who took the Minnesota Comprehensive Assessments in their 5th and 8th grade year (a span that includes 2 years of InSciEd Out) showed medium or high growth in science proficiency. These metrics indicate that cooperation between educators and scientists can result in positive change in student science proficiency and demonstrate that a higher expectation in science education can be achieved in US public schools. PMID:23244687

  17. Representation of Solar Capacity Value in the ReEDS Capacity Expansion Model

    Energy Technology Data Exchange (ETDEWEB)

    Sigrin, B. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Sullivan, P. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Ibanez, E. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Margolis, R. [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2014-03-01

    An important issue for electricity system operators is the estimation of renewables' capacity contributions to reliably meeting system demand, or their capacity value. While the capacity value of thermal generation can be estimated easily, assessment of wind and solar requires a more nuanced approach due to the resource variability. Reliability-based methods, particularly assessment of the Effective Load-Carrying Capacity, are considered to be the most robust and widely-accepted techniques for addressing this resource variability. This report compares estimates of solar PV capacity value by the Regional Energy Deployment System (ReEDS) capacity expansion model against two sources. The first comparison is against values published by utilities or other entities for known electrical systems at existing solar penetration levels. The second comparison is against a time-series ELCC simulation tool for high renewable penetration scenarios in the Western Interconnection. Results from the ReEDS model are found to compare well with both comparisons, despite being resolved at a super-hourly temporal resolution. Two results are relevant for other capacity-based models that use a super-hourly resolution to model solar capacity value. First, solar capacity value should not be parameterized as a static value, but must decay with increasing penetration. This is because -- for an afternoon-peaking system -- as solar penetration increases, the system's peak net load shifts to later in the day -- when solar output is lower. Second, long-term planning models should determine system adequacy requirements in each time period in order to approximate LOLP calculations. Within the ReEDS model we resolve these issues by using a capacity value estimate that varies by time-slice. Within each time period the net load and shadow price on ReEDS's planning reserve constraint signals the relative importance of additional firm capacity.

  18. Vývojové prostředí NetBeans

    OpenAIRE

    Pitka, Lukáš

    2007-01-01

    Tato bakalářská práce představuje základní aspekty vývojového prostředí NetBeans IDE. NetBeans IDE je prostředí pro programovací jazyk Java. Práce je napsána jako příručka pro uživatele začínající s NetBeans IDE, přičemž se předpokládá se určitá znalost programovacího jazyka Java. Hlavním přínosem práce je usnadnění a zefektivnění práce s NetBeans IDE. První kapitola práce je spíše teoretická, zabývá se obecně pojmem vývojové prostředí. V dalších částech jsou rozebírány aspekty NetBeans IDE, ...

  19. A new e-learning platform for radiology education (RadEd).

    Science.gov (United States)

    Xiberta, Pau; Boada, Imma

    2016-04-01

    One of the key elements of e-learning platforms is the content provided to the students. Content creation is a time demanding task that requires teachers to prepare material taking into account that it will be accessed on-line. Moreover, the teacher is restricted by the functionalities provided by the e-learning platforms. In contexts such as radiology where images have a key role, the required functionalities are still more specific and difficult to be provided by these platforms. Our purpose is to create a framework to make teacher's tasks easier, specially when he has to deal with contents where images have a main role. In this paper, we present RadEd, a new web-based teaching framework that integrates a smart editor to create case-based exercises that support image interaction such as changing the window width and the grey scale used to render the image, taking measurements on the image, attaching labels to images and selecting parts of the images, amongst others. It also provides functionalities to prepare courses with different topics, exercises and theory material, and also functionalities to control students' work. Different experts have used RadEd and all of them have considered it a very useful and valuable tool to prepare courses where radiological images are the main component. RadEd provides teachers functionalities to prepare more realistic cases and students the ability to make a more specific diagnosis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Morphological, chemical and structural characterisation of deciduous enamel: SEM, EDS, XRD, FTIR and XPS analysis.

    Science.gov (United States)

    Zamudio-Ortega, C M; Contreras-Bulnes, R; Scougall-Vilchis, R J; Morales-Luckie, R A; Olea-Mejía, O F; Rodríguez-Vilchis, L E

    2014-09-01

    The purpose of this study was to characterise the enamel surface of sound deciduous teeth in terms of morphology, chemical composition, structure and crystalline phases. The enamel of 30 human deciduous teeth was examined by: Scanning Electron Microscopy (SEM), Energy Dispersive X-Ray Spectroscopy (EDS), X-ray Powder Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FTIR), and X-ray Photoelectron Spectroscopy (XPS). Chemical differences between incisors and canines were statistically evaluated using the Mann-Whitney U test (p ≤ 0.05). Three enamel patterns were observed by SEM: 'mostly smooth with some groves', 'abundant microporosities' and 'exposed prisms'. The average Ca/P molar ratios were 1.37 and 1.03 by EDS and XPS, respectively. The crystallite size determined by XRD was 210.82 ± 16.78 Å. The mean ratio between Ca bonded to phosphate and Ca bonded to hydroxyl was approximately 10:1. The enamel of sound deciduous teeth showed two main patterns: 'mostly smooth with some groves' and 'abundant microporosities'. 'Exposed prisms' was a secondary pattern. There were slight variations among the Ca/P molar ratios found by EDS and XPS, suggesting differences in the mineral content from the enamel surface to the interior. The crystalline phases found in enamel were hydroxyapatite and carbonate apatite, with major type B than type A carbonate incorporation.

  1. Sugammadex ED90 dose to reverse the rocuronium neuromuscular blockade in obese patients

    Directory of Open Access Journals (Sweden)

    MAURO PRADO DA SILVA

    Full Text Available ABSTRACT Objective: to determine the ED90 (minimum effective dose in 90% of patients of sugammadex for the reversal of rocuronium-induced moderate neuromuscular blockade (NMB in patients with grade III obesity undergoing bariatric surgery. Methods: we conducted a prospective study with the biased coin up-and-down sequential design. We chosen the following doses: 2.0mg/Kg, 2.2mg/Kg, 2.4mg/Kg, 2.6mg/Kg, 2.8mg/Kg. The complete reversal of rocuronium-induced NMB considered a T4/T1 ratio ≥0.9 as measured by TOF. After induction of general anesthesia and calibration of the peripheral nerve stimulator and accelerometer, we injected rocuronium 0.6mg/kg. We administered propofol and remifentanil by continuous infusion, and intermittent boluses of rocuronium throughout the procedure. Results: we evaluated 31 patients, of whom 26 had displayed successful reversal of the NMB with sugammadex, and failure in five. The mean time to complete moderate NMB reversal was 213 seconds (172-300, median 25-75%. The ED90 of sugammadex calculated by regression was 2.39mg/kg, with a 95% confidence interval of 2.27-2.46 mg/kg. Conclusion: the ED90 of sugammadex in patients with grade III obesity or higher was 2.39mg/kg.

  2. A method to test the performance of an energy-dispersive X-ray spectrometer (EDS).

    Science.gov (United States)

    Hodoroaba, Vasile-Dan; Procop, Mathias

    2014-10-01

    A test material for routine performance evaluation of energy-dispersive X-ray spectrometers (EDS) is presented. It consists of a synthetic, thick coating of C, Al, Mn, Cu, and Zr, in an elemental composition that provides interference-free characteristic X-ray lines of similar intensities at 10 kV scanning electron microscope voltage. The EDS energy resolution at the C-K, Mn-Lα, Cu-Lα, Al-K, Zr-Lα, and Mn-Kα lines, the calibration state of the energy scale, and the Mn-Lα/Mn-Kα intensity ratio as a measure for the low-energy detection efficiency are calculated by a dedicated software package from the 10 kV spectrum. Measurements at various input count rates and processor shaping times enable an estimation of the operation conditions for which the X-ray spectrum is not yet corrupted by pile-up events. Representative examples of EDS systems characterized with the test material and the related software are presented and discussed.

  3. The impact of an ED-only full-capacity protocol.

    Science.gov (United States)

    Watase, Taketo; Fu, Rongwei; Foster, Denise; Langley, Denise; Handel, Daniel A

    2012-10-01

    The objective of this study was to assess the impact of an emergency department (ED)-only full-capacity protocol and diversion, controlling for patient volumes and other potential confounding factors. This was a preintervention and postintervention cohort study using data 12 months before and 12 months after the implementation of the protocol. During the implementation period, attending physicians and charge nurses were educated with clear and simple figures on the criteria for the initiation of the new protocol. A multiple logistic regression model was used to compare ambulance diversion between the 2 periods. The proportion of days when the ED went on diversion at least once during a 24-hour period was 60.4% during the preimplementation period and 20% in the postimplementation periods (P model, the use of the new protocol was significantly associated with decreased odds of diversion rate in the postimplementation period (odds ratio, 0.32; 95% confidence interval, 0.21-0.48). Our predivert/full-capacity protocol is a simple and generalizable strategy that can be implemented within the boundaries of the ED and is significantly associated with a decreased diversion rate. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. The epidemiology of assault-related hospital in-patient admissions and ED attendances.

    LENUS (Irish Health Repository)

    O'Farrell, A

    2013-03-01

    The aim of this study was to describe the epidemiology and impact of serious assault warranting in-patient care over six years and its impact on ED attendances in a large teaching hospital in Dublin over 2 years. There were 16,079 emergency assault-related inpatient hospital discharges reducing from 60.1 per 100,000 population in 2005 to 50.6 per 100,000 population in 2010. The median length of stay was 1 day (1-466) representing 49,870 bed days. The majority were young males (13,921, 86.6%; median age 26 years). Overall crime figures showed a similar reduction. However, knife crimes did not reduce over this period. Data on ED attendances confirmed the age and gender profile and also showed an increase at weekends. Alcohol misuse was recorded in 2,292\\/16079 (14%) of in-patient cases and 242\\/2484 (10%) in ED attendances. An inter-sectoral preventative approach specifically targeting knife crime is required to reduce this burden on health services.

  5. Detection of glass particles on bone lesions using SEM-EDS.

    Science.gov (United States)

    Montoriol, Romain; Guilbeau-Frugier, Céline; Chantalat, Elodie; Roumiguié, Mathieu; Delisle, Marie-Bernadette; Payré, Bruno; Telmon, Norbert; Savall, Frédéric

    2017-09-01

    The problem of identifying the wounding agent in forensic cases is recurrent. Moreover, when several tools are involved, distinguishing the origin of lesions can be difficult. Scanning electron microscopy (SEM)/energy dispersive X-ray analysis (EDS) equipment is increasingly available to the scientific and medical community, and some studies have reported its use in forensic anthropology. However, at our knowledge, no study has reported the use of SEM-EDS in forensic cases involving glass tools, whether in case reports or experiments. We performed an experimental study on human rib fragments, on which we manually created wounds using fragments of window and mirror glass. SEM-EDS was executed on samples without any further preparation on low vacuum mode, then on the same samples after defleshing them completely by boiling them. Window and mirror glass particles were detected on experimental wounds. Both had silica in their spectra, and the opaque side of the mirror contained titanium, allowing for their identification. Boiling and defleshing the bone samples involved a loss of information in terms of the number of wounds detected as positive for glass particles and in the number of glass particles detected, for both window and mirror glass. We suggest the analysis of wounds with suspected glass particles using low vacuum mode and with no defleshment by boiling.

  6. SEM/EDS and optical microscopy analyses of microplastics in ocean trawl and fish guts.

    Science.gov (United States)

    Wang, Zhong-Min; Wagner, Jeff; Ghosal, Sutapa; Bedi, Gagandeep; Wall, Stephen

    2017-12-15

    Microplastic particles from Atlantic and Pacific Ocean trawls, lab-fed fish guts and ocean fish guts have been characterized using optical microscopy and SEM/EDS in terms of size, morphology, and chemistry. We assessed whether these measurements could serve as a rapid screening process for subsequent identification of the likely microplastic candidates by micro-spectroscopy. Optical microscopy enabled morphological classification of the types of particles or fibers present in the sample, as well as the quantification of particle size ranges and fiber lengths. SEM/EDS analysis was used to rule out non-plastic particles and screen the prepared samples for potential microplastic, based on their element signatures and surface characteristics. Chlorinated plastics such as polyvinyl chloride (PVC) could be easily identified with SEM/EDS due to their unique elemental signatures including chlorine, as could mineral species that are falsely identified as plastics by optical microscopy. Particle morphology determined by optical microscopy and SEM suggests the fish ingested particles contained both degradation fragments from larger plastic pieces and also manufactured microplastics. SEM images of microplastic particle surfaces revealed characteristic cracks consistent with environmental exposure, as well as pigment particles consistent with manufactured materials. Most of the microplastic surfaces in the fish guts and ocean trawls were covered with biofilms, radiolarians, and crustaceans. Many of the fish stomachs contained micro-shell pieces which visually resembled microplastics. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Adaptation of Lorke's method to determine and compare ED50 values: the cases of two anticonvulsants drugs.

    Science.gov (United States)

    Garrido-Acosta, Osvaldo; Meza-Toledo, Sergio Enrique; Anguiano-Robledo, Liliana; Valencia-Hernández, Ignacio; Chamorro-Cevallos, Germán

    2014-01-01

    We determined the median effective dose (ED50) values for the anticonvulsants phenobarbital and sodium valproate using a modification of Lorke's method. This modification allowed appropriate statistical analysis and the use of a smaller number of mice per compound tested. The anticonvulsant activities of phenobarbital and sodium valproate were evaluated in male CD1 mice by maximal electroshock (MES) and intraperitoneal administration of pentylenetetrazole (PTZ). The anticonvulsant ED50 values were obtained through modifications of Lorke's method that involved changes in the selection of the three first doses in the initial test and the fourth dose in the second test. Furthermore, a test was added to evaluate the ED50 calculated by the modified Lorke's method, allowing statistical analysis of the data and determination of the confidence limits for ED50. The ED50 for phenobarbital against MES- and PTZ-induced seizures was 16.3mg/kg and 12.7mg/kg, respectively. The sodium valproate values were 261.2mg/kg and 159.7mg/kg, respectively. These results are similar to those found using the traditional methods of finding ED50, suggesting that the modifications made to Lorke's method generate equal results using fewer mice while increasing confidence in the statistical analysis. This adaptation of Lorke's method can be used to determine median letal dose (LD50) or ED50 for compounds with other pharmacological activities. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez

    2009-01-01

    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  9. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  10. Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

    Directory of Open Access Journals (Sweden)

    Brent Tisserat

    2018-04-01

    Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

  11. Characterization of low alloy ferritic steel–Ni base alloy dissimilar metal weld interface by SPM techniques, SEM/EDS, TEM/EDS and SVET

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Siyan; Ding, Jie; Ming, Hongliang; Zhang, Zhiming; Wang, Jianqiu, E-mail: wangjianqiu@imr.ac.cn

    2015-02-15

    The interface region of welded A508–Alloy 52 M is characterized by scanning probe microscope (SPM) techniques, scanning electron microscopy (SEM)/energy dispersive spectroscopy (EDS), transmission electron microscopy (TEM)/Energy Dispersive Spectroscopy (EDS) and scanning vibrate electrode technique (SVET). The regions along the welded A508–Alloy 52 M interface can be categorized into two types according to their different microstructures. In the type-I interface region, A508 and Alloy 52 M are separated by the fusion boundary, while in the type-II interface region, A508 and Alloy 52 M are separated by a martensite zone. A508, martensite zone and grain boundaries in Alloy 52 M are ferromagnetic while the Alloy 52 M matrix is paramagnetic. The Volta potentials measured by scanning Kelvin probe force microscopy (SKPFM) of A508, martensite zone and Alloy 52 M follow the order: V{sub 52} {sub M} > V{sub A508} > V{sub martensite}. The corrosion behavior of A508–Alloy 52 M interface region is galvanic corrosion, in which Alloy 52 M is cathode while A508 is anode. The martensite dissolves faster than Alloy 52 M, but slower than A508 in the test solution. - Highlights: • The A508–Alloy 52 M interface regions can be categorized into two types. • The chromium depleted region is observed along the Alloy 52 M grain boundary. • The Alloy 52 M grain boundaries which are close to the interface are ferromagnetic. • Martensite zone has lower Volta potential but higher corrosion resistance than A508.

  12. INSIST-ED: Italian Society of Andrology registry on penile prosthesis surgery. First data analysis

    Directory of Open Access Journals (Sweden)

    Edoardo Pescatori

    2016-07-01

    Full Text Available Objectives: The Italian Society of Andrology, i.e. “Società Italiana di Andrologia” (S.I.A., launched on December 2014 a prospective, multicenter, monitored and internal review board approved Registry for penile implants, the “INSIST-ED” (Italian Nationwide Systematic Inventarisation of Surgical Treatment for ED Registry. Purpose of this first report is to present a baseline data analysis of the characteristics of penile implant surgery in Italy. Material and methods: The INSIST-ED Registry is open to all surgeons implanting penile prostheses (all brands, all models in Italy, providing anonymous patient, device, surgical procedure, outcome, follow-up data, for both first and revision surgeries. A Registry project Board overviews all the steps of the project, and a Registry Monitor interacts with the Registry implanting surgeons. Results: As by April 8, 2016, 31 implanting surgeons actively joined the Registry, entering 367 surgical procedures in its database, that comprise: 310 first implants, 43 prosthesis substitutions, 14 device explants without substitution. Implanted devices account for: 288 three-component devices (81,3%, 20 two-component devices (5,4%, 45 non-hydraulic devices (12,3%. Leading primary ED etiologies in first implant surgeries resulted: former radical pelvic surgery in 111 cases (35,8%, Peyronie’s disease in 66 cases (21,3%, diabetes in 39 cases (12,6%. Two intraoperative complications have been recorded. Main reasons for 57 revision surgeries were: device failure (52,6%, erosion (19,3%, infection (12,3%, patient dissatisfaction (10,5%. Surgical settings for patients undergoing a first penile implant were: public hospitals in 251 cases (81%, private environments in 59 cases (19%. Conclusions: The INSIST-ED Registry represents the first European experience of penile prosthesis Registry. This baseline data analysis shows that: three-pieces inflatable prosthesis is the most implanted device, leading etiology of

  13. Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    de Cock, Evi S A; Emons, Wilco H M; Nefs, Giesje

    2011-01-01

    BACKGROUND: Depression is a common complication in type 2 diabetes (DM2), affecting 10-30% of patients. Since depression is underrecognized and undertreated, it is important that reliable and validated depression screening tools are available for use in patients with DM2. The Edinburgh Depression...... Scale (EDS) is a widely used method for screening depression. However, there is still debate about the dimensionality of the test. Furthermore, the EDS was originally developed to screen for depression in postpartum women. Empirical evidence that the EDS has comparable measurement properties in both...

  14. Hornborg, A. & Hill, J. D. (eds. 2011. Ethnicity in Ancient Amazonia: Reconstructing Past Identities from Archaeology, Linguistics and Ethnohistory

    Directory of Open Access Journals (Sweden)

    Phil Riris

    2013-02-01

    Full Text Available Book review: Hornborg, A. & Hill, J. D. (eds. 2011. 'Ethnicity in Ancient Amazonia:' 'Reconstructing Past Identities from Archaeology, Linguistics and Ethnohistory.' Boulder: University Press of Colorado, £60

  15. Berliini filmifestivalil näeb ka Peeter Simmi filmi "Head käed" / Triin Tael

    Index Scriptorium Estoniae

    Tael, Triin

    2002-01-01

    Berliini 52. filmifestival algas eile sakslase Tom Tykweri mängufilmiga "Taevas". Esmakordselt on festivali "Panorama" kavas eesti mängufilm, milleks on Peeter Simmi "Head käed". Eesti filmid on esil ka festivali suurel filmiturul

  16. Joep van Gennip, Vefie Poels en Marie-Antoinette Willemsen (eds., Creatie en recreatie. Cultuur en ontspanning in het kloosterleven

    Directory of Open Access Journals (Sweden)

    Thomas Quartier

    2017-06-01

    Full Text Available Joep van Gennip, Vefie Poels en Marie-Antoinette Willemsen (eds., Creatie en recreatie. Cultuur en ontspanning in het kloosterleven (Hilversum: Verloren, 2014, 234 pp., isbn 978 908 704 469 5.

  17. Peter van Dam, James Kennedy, Friso Wielenga (eds., Achter de zuilen. Op zoek naar religie in naoorlogs Nederland

    Directory of Open Access Journals (Sweden)

    Kim Christiaens

    2016-04-01

    Full Text Available Peter van Dam, James Kennedy, Friso Wielenga (eds., Achter de zuilen. Op zoek naar religie in naoorlogs Nederland (Amsterdam: Amsterdam University Press, 2014, 456 pp., isbn 978 90 8964 680 4. 

  18. Bedding, not boarding. Psychiatric patients boarded in hospital EDs create crisis for patient care and hospital finances.

    Science.gov (United States)

    Kutscher, Beth

    2013-11-18

    As the supply of psychiatric beds dwindles, hospitals are devising innovative ways handle psych patients who come through the emergency department. Some collaborate with other hospitals, use separate pysch EDs or refer patients to residential treatment centers.

  19. Review: Iwanaga, Kazuki (ed. (2008, Women’s Political Participation and Representation in Asia. Obstacles and Challenges

    Directory of Open Access Journals (Sweden)

    Dagmar Hellmann-Rajanayagam

    2010-04-01

    Full Text Available Review of the edited volume: Iwanaga, Kazuki (ed. (2008, Women’s Political Participation and Representation in Asia. Obstacles and Challenges, Copenhagen: NIAS Press, = Women and Politics in Asia No. 2, ISBN 9788776940164, XVII and 314 pages.

  20. Effect Of A “No Superuser Opioid Prescription” Policy On ED Visits And Statewide Opioid Prescription

    Directory of Open Access Journals (Sweden)

    Zachary P. Kahler

    2017-07-01

    Full Text Available Introduction: The U.S. opioid epidemic has highlighted the need to identify patients at risk of opioid abuse and overdose. We initiated a novel emergency department- (ED based interventional protocol to transition our superuser patients from the ED to an outpatient chronic pain program. The objective was to evaluate the protocol’s effect on superusers’ annual ED visits. Secondary outcomes included a quantitative evaluation of statewide opioid prescriptions for these patients, unique prescribers of controlled substances, and ancillary testing. Methods: Patients were referred to the program with the following inclusion criteria: ≥ 6 visits per year to the ED; at least one visit identified by the attending physician as primarily driven by opioid-seeking behavior; and a review by a committee comprising ED administration and case management. Patients were referred to a pain management clinic and informed that they would no longer receive opioid prescriptions from visits to the ED for chronic pain complaints. Electronic medical record (EMR alerts notified ED providers of the patient’s referral at subsequent visits. We analyzed one year of data pre- and post-referral. Results: A total of 243 patients had one year of data post-referral for analysis. Median annual ED visits decreased from 14 to 4 (58% decrease, 95% CI [50 to 66]. We also found statistically significant decreases for these patients’ state prescription drug monitoring program (PDMP opioid prescriptions (21 to 13, total unique controlled-substance prescribers (11 to 7, computed tomography imaging (2 to 0, radiographs (5 to 1, electrocardiograms (12 to 4, and labs run (47 to 13. Conclusion: This program and the EMR-based alerts were successful at decreasing local ED visits, annual opioid prescriptions, and hospital resource allocation for this population of patients. There is no evidence that these patients diverted their visits to neighboring EDs after being informed that they

  1. Right to know: reducing risks of fecal pathogen exposure for ED patients and staff.

    Science.gov (United States)

    Delaney, Molly Bridget

    2014-07-01

    The purpose of this article is to review the literature regarding the multiple challenges that contribute to ED bedside toileting and examine best practices that will reduce fecal exposure, cross-contamination among patients, and employee splash injuries. We searched the Cumulative Index to Nursing and Allied Health Literature, MEDLINE, and Cochrane database for information about the multiple challenges involved in bedside toileting, using the following search terms: bedside toileting, gastroenteritis, macerator, sluice machine, fecal pathogen exposure, and splash injury. In addition, costs and benefits of reusable versus disposable bedside toileting equipment were compared and contrasted. Emergency departments have a higher exposure rate to fecal pathogens with current methods of bedside toileting. Short incubation periods may not allow the proper lead time needed for patients to access primary care providers. As a result, emergency departments and urgent care centers become a likely point of entry into the health care system. Although most inpatient rooms have built-in bathrooms, most emergency departments and outpatient examination rooms do not. Although many patients are ambulatory, restrictive monitoring equipment is required. For safety reasons, staff must bring toileting equipment to the bedsides of both ambulatory and non-ambulatory patients. Hopper dependence creates longer walking distances and delays. These delays may lead to incontinence events, skin breakdown, more frequent bed changes, and higher linen and labor costs. Reusable bedside toileting equipment is associated with at-risk behaviors. Examples are procrastination and sanitization shortcuts. These behaviors risk cross-contamination of patients especially when urgent situations require equipment to be reused in the interim. ED patients and staff are 5 times more likely to undergo fecal exposure. The 5 phases of ED bedside toileting at which risks occur are as follows: equipment setup, transport

  2. Sugammadex ED90 dose to reverse the rocuronium neuromuscular blockade in obese patients.

    Science.gov (United States)

    Silva, Mauro Prado DA; Matsui, Christiano; Kim, Daniel Dongiou; Vieira, Joaquim Edson; Malheiros, Carlos Alberto; Mathias, Ligia Andrade Silva Telles

    2017-01-01

    to determine the ED90 (minimum effective dose in 90% of patients) of sugammadex for the reversal of rocuronium-induced moderate neuromuscular blockade (NMB) in patients with grade III obesity undergoing bariatric surgery. we conducted a prospective study with the biased coin up-and-down sequential design. We chosen the following doses: 2.0mg/Kg, 2.2mg/Kg, 2.4mg/Kg, 2.6mg/Kg, 2.8mg/Kg. The complete reversal of rocuronium-induced NMB considered a T4/T1 ratio ≥0.9 as measured by TOF. After induction of general anesthesia and calibration of the peripheral nerve stimulator and accelerometer, we injected rocuronium 0.6mg/kg. We administered propofol and remifentanil by continuous infusion, and intermittent boluses of rocuronium throughout the procedure. we evaluated 31 patients, of whom 26 had displayed successful reversal of the NMB with sugammadex, and failure in five. The mean time to complete moderate NMB reversal was 213 seconds (172-300, median 25-75%). The ED90 of sugammadex calculated by regression was 2.39mg/kg, with a 95% confidence interval of 2.27-2.46 mg/kg. the ED90 of sugammadex in patients with grade III obesity or higher was 2.39mg/kg. determinar a ED90 (dose mínima eficaz em 90% dos pacientes) de sugamadex para a reversão de bloqueio neuromuscular (BNM) moderado induzido pelo rocurônio em pacientes com obesidade grau III submetidos à cirurgia bariátrica. estudo prospectivo com o método de projeção sequencial para cima e para baixo da moeda enviesada. As seguintes doses foram escolhidas: 2,0mg/kg-1, 2,2mg/kg-1, 2,4mg/kg-1, 2,6mg/kg-1, 2,8mg/kg-1. A reversão completa de BNM induzido por rocurônio considerou uma relação T4/T1 ≥0,9 na medida do TOF. Após a indução da anestesia geral e calibração do estimulador de nervo periférico e acelerômetro, rocurônio 0,6mg/kg-1 foi injetado. Infusão contínua de propofol e remifentanil, e bolus intermitente de rocurônio foram injetados durante todo o procedimento. trinta e um pacientes foram

  3. Testosterone deficiency causes penile fibrosis and organic erectile dysfunction in aging men. Evaluating association among Age, TDS and ED.

    Science.gov (United States)

    Iacono, Fabrizio; Prezioso, Domenico; Ruffo, Antonio; Illiano, Ester; Romis, Leo; Di Lauro, G; Romeo, Giuseppe; Amato, Bruno

    2012-01-01

    We studied the possible correlation between age, testosterone deficiency, cavernosal fibrosis and erectile dysfunction (ED). 47 patients with ED were enrolled between September 2010 and October 2011. IIEF-EF score, NPTR test using the Rigiscan method, total and free testosterone levels, and cavernosum biopsy were carried out on all patients. Patients aged 65 or over were defined as Old Age (OA) while patients under 65 were defined Young age (YA). The strength of the relationships found was estimated by Odds Ratio. 74% of patients with values of over 52% collagen fibers in the corpora cavernosa were found to have organic ED. A significant difference was found in age, percentage of collagen fibers, testosterone levels between patients with Positive Rigiscan (PR) and Negative Rigiscan (NR). Hypotestosteronaemia increased the risk of ED with PR (OR: 21.4, 95% CI: 20.2-22.6) and in both young age patients (OR: 4.3, 95% CI: 2.4-6.2) and old age patients (OR: 15.5, 95% CI: 13.4-17.6). Moreover cavernosal fibrosis increased the risk of ED with PR in both young age patients (OR: 8.2, 95% CI: 6.4-10.0 and old age patients (OR: 24.6, 95% CI: 20.8-28.4). This study demonstrates a strong association among age, testosterone deficiency, cavernosal fibrosis and ED with PR. Age, testosterone deficiency and cavernosal fibrosis are potentially correctable factors of cavernosal fibrosis and organic ED. Further, prospective studies are needed to evaluate if testosterone treatment, alone or in association with PDE5 inhibitors, may lower the risk of cavernosal fibrosis or decrease the severity the fibrosis in ED patients.

  4. Review: Michael Crandall & Karen E. Fisher (Eds) Digital Inclusion: Measuring the Impact of Information and Community Technology

    DEFF Research Database (Denmark)

    Pors, Niels Ole

    2010-01-01

    Review: Michael Crandall & Karen E. Fisher (Eds) Digital Inclusion: Measuring the Impact of Information and Community Technology. Medford. Information Today. ASIS&T Monographs, 2009. 185 pages. $ 59.50. ISBN 978-1-57387-373-4......Review: Michael Crandall & Karen E. Fisher (Eds) Digital Inclusion: Measuring the Impact of Information and Community Technology. Medford. Information Today. ASIS&T Monographs, 2009. 185 pages. $ 59.50. ISBN 978-1-57387-373-4...

  5. Intimate partner violence and mental health symptoms in African American female ED patients.

    Science.gov (United States)

    Houry, Debra; Kemball, Robin; Rhodes, Karin V; Kaslow, Nadine J

    2006-07-01

    Intimate partner violence (IPV) victims often seek care in the ED, whether for an injury from abuse or other sequelae such as mental health symptoms. The objective of the study was to assess whether depressive symptoms, posttraumatic stress disorder (PTSD), and suicidality were associated with physical, sexual, or emotional IPV in African American female ED patients and to determine if experiencing multiple types of abuse was associated with increased mental health symptoms. All eligible African American female patients were approached in the ED waiting room during study periods. Patients participated in the screening process via a computer kiosk. Questions regarding IPV and mental health symptoms were asked using validated tools. In this prospective cohort, 569 participated and 36% of those in a relationship in the past year (n=461) disclosed that there were victims of IPV in the past year. In the past year, 22% experienced recent physical abuse, 9% recent sexual abuse, and 32% recent emotional abuse. A Pearson correlation was conducted and showed that all mental health symptoms were positively correlated with each type of IPV and each type of mental health symptom category. Mental health symptoms increased significantly with amount of abuse: depression (odds ratio [OR], 5.9 for 3 types of abuse), PTSD (OR, 9.4 for 3), and suicidality (OR, 17.5 for 3). Emotional, sexual, and physical IPV were significantly associated with mental health symptoms. Each type of abuse was independently associated with depression, suicidality, and PTSD. Experiencing more than 1 type of abuse was also correlated with increased mental health symptoms.

  6. Composition and microstructure of MTA and Aureoseal Plus: XRF, EDS, XRD and FESEM evaluation.

    Science.gov (United States)

    Cianconi, L; Palopoli, P; Campanella, V; Mancini, M

    2016-12-01

    The aim of this study was to determine the chemical composition and the phases' microstructure of Aureoseal Plus (OGNA, Italy) and ProRoot MTA (Dentsply Tulsa Dental, USA) and to compare their characteristics. Study Design: Comparing Aureoseal Plus and ProRoot MTA microstructure by means of several analyses type. The chemical analysis of the two cements was assessed following the UNI EN ISO 196-2 norm. X-Ray fluorescence (XRF) was used to determine the element composition. The crystalline structure was analysed quantitatively using x-ray diffraction (XRD). Powders morphology was evaluated using a scanning electron microscope (SEM) with backscattering detectors, and a field emission scanning electron microscope (FESEM). Elemental analysis was performed by energy dispersive x-ray analysis (EDS). The semi-quantitative XRF analysis showed the presence of heavy metal oxides in both cements. The XRD spectra of the two cements reported the presence of dicalcium silicate, tricalcium silicate, tricalcium aluminate, tetracalcium aluminoferrite, bismuth oxide and gypsum. SEM analysis showed that ProRoot MTA powder is less coarse and more homogeneous than Aureoseal. Both powders are formed by particles of different shapes: round, prismatic and oblong. The EDS analysis showed that some ProRoot MTA particles, differently from Aureoseal, contain Ca, Si, Al and Fe. Oblong particles in ProRoot and Aureoseal are rich of bismuth. The strong interest in developing new Portland cement-based endodontic sealers will create materials with increased handling characteristics and physicochemical properties. A thorough investigation on two cement powders was carried out by using XRF, XRD, SEM and EDS analysis. To date there was a lack of studies on Aureoseal Plus. This cement is similar in composition to ProRoot MTA. Despite that it has distinctive elements that could improve its characteristics, resulting in a good alternative to MTA.

  7. Enhancing the ED Approach to Pediatric Sexual Assault Care: Implementation of a Pediatric SART Program

    Science.gov (United States)

    Goyal, MK; Mollen, CJ; Hayes, KL; Molnar, J; Christian, CW; Scribano, PV; Lavelle, J

    2013-01-01

    Objective Describe the experience of a novel pediatric Sexual Assault Response Team (SART) program in the first three years of implementation, and compare patient characteristics, evaluation, and treatment among subpopulations of patients. Methods Retrospective chart review of a consecutive sample of patients evaluated at a pediatric ED who met institutional criteria for a SART evaluation. Associations of evaluation and treatment with gender, menarchal status, and presence of injuries were measured using logistic regression. Results One hundred and eighty-four patients met criteria for SART evaluation, of whom 87.5% were female; mean age was 10.1 years (+/− 4.6 years). The majority of patients underwent forensic evidence collection (89.1%), which varied by menarchal status among females (p<0.01), but not by gender. Evidence of acute anogenital injury on physical exam was found in 20.6% of patients. As per the Center for Disease Control and Prevention guidelines for acute sexual assault evaluations in pediatric patients, menarchal females were more likely to undergo testing for sexually transmitted infections (STI) and pregnancy (p<0.01) and to be offered pregnancy, STI, and HIV prophylaxis (p<0.01). Conclusions In an effort to improve quality and consistency of acute sexual assault examinations in a pediatric ED, development of a SART program supported the majority of eligible patients undergoing forensic evidence collection. Furthermore, a substantial number of patients had evidence of injury on exam. These findings underscore the importance of having properly trained personnel to support ED care for pediatric victims of acute sexual assault. PMID:23974714

  8. La narrazione orale tra bambini ed adulti: da flusso continuo a vena carsica?

    Directory of Open Access Journals (Sweden)

    Milena Bernardi

    2010-02-01

    Full Text Available Con il segmento di ricerca che viene presentato nella sua prima fase si prende in esame l’ipotesi di un processo, in atto da tempo, di trasformazione e/o di declino della narrazione orale nel rapporto quotidiano tra adulti e bambini, inteso, in questo specifico contesto, come “spia” dei mutamenti degli stili educativi e degli interscambi tra famiglie ed operatori dei servizi in relazione all’alleanza educativa. La complessità dei filoni di studio che rimandano alla voce “narrazione” negli ambiti delle scienze umane esige la precisazione della curvatura “narrativa” scelta per la ricerca in corso: curvatura che appartiene all’epistemologia della letteratura per l’infanzia e della pedagogia della narrazione in quanto permette di imboccare la strada della ricerca pedagogica rivolta innanzi tutto ai significati che il narrare assume nella relazione educativa e poi ai modi ed alle forme della narrazione che coinvolgono l’infanzia. In un’epoca di grande vitalità e visibilità delle narrazioni, tra cui abbondano le produzioni scritte, illustrate, filmate per l’infanzia, sembra esserci una zona marginale e quasi sommersa della comunicazione narrante che rischia di sfumare in una sorta di oblio. E’ la zona della narrazione orale esperita in praesentia da bambini ed adulti insieme, tessuta con fili di parole che restituiscono senso all’intero arco delle esperienze, tentando di riordinare il disordine che spesso connota la realtà, interpretando, stabilendo connessioni, impregnando di quel senso i vissuti, i fatti, le relazioni, le cose e le parole stesse, ancora, nelle voci. Del rischio e delle conseguenze che possono derivare dalla sua mancanza si occupa questo contributo di ricerca che, dal punto di vista metodologico, si è avvalso e si avvale sia di analisi condotte sul corpus dei testi sia della raccolta di dati e informazioni tramite incontri condotti con la modalità del focus group, con educatrici e genitori.

  9. Tamsulosin does not increase 1-week passage rate of ureteral stones in ED patients.

    Science.gov (United States)

    Berger, David A; Ross, Michael A; Hollander, Jay B; Ziadeh, James; Chen, Charity; Jackson, Raymond E; Swor, Robert A

    2015-12-01

    The objective of the study is to determine if tamsulosin initiated in the emergency department (ED) decreases the time to ureteral stone passage at 1 week or time to pain resolution, compared to placebo. We performed a prospective, randomized, double-blinded, placebo-controlled trial of tamsulosin vs placebo in ED patients with ureterolithiasis on computed tomography. Patients were identified and enrolled between April 2007 and February 2009 and were randomized to either 0.4 mg of tamsulosin or placebo for 1 week. We contacted participants using a telephone survey on post-ED visit days 1, 2, 3, and 7. The primary outcome was time to stone passage, with secondary outcomes being maximum pain score and amount of pain medication required. Of the 127 patients enrolled during this study, 15 were lost to follow-up, and 12 required surgical interventions before the 7-day mark, leaving 100 patients for analysis. Of the 100 patients, 53 received tamsulosin and 47 received placebo. There was no difference between groups in percentage of male, mean age, initial serum creatinine, average stone size, stone location, and history of prior stone. The probability that the patient did not pass a stone at 7 days was not different between tamsulosin and placebo, 62.1% (95% confidence interval, 49.1%-75.1%) vs 54.4% (95% confidence interval, 40.3%-68.6%; P = .58). There was no significant difference in the high pain score (P = .12) or hydrocodone/acetaminophen intake (P = .76) between treatment groups at any of the time points. This study reveals no difference in the proportion of stone passage or high pain score and pain medication utilization at 7 days between tamsulosin and placebo. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. MetEd Learning Resources from COMET: Assisting With User Readiness for the JPSS Era

    Science.gov (United States)

    Bol, A.; Page, E. M.; Dills, P. N.; Lee, T.; Weingroff, M.; Stevermer, A.

    2017-12-01

    The COMET® Program (www.comet.ucar.edu) is funded by NOAA NESDIS as well as EUMETSAT and the Meteorological Service of Canada to develop and deliver education and training in satellite meteorology. COMET's self-paced online training resources are freely available 24/7/365 via the MetEd Website (meted.ucar.edu) to help learners stay current regarding new instruments, capabilities, products and applications. Experts from NOAA-NESDIS and its Cooperative Institutes, the Meteorological Service of Canada, EUMETSAT, the Naval Research Laboratory and others, work with COMET staff to create lessons that encourage greater use of current and future satellite observations and products. As of fall 2017, over 90 satellite-focused, interactive lessons are available in English via the MetEd Web site at http://meted.ucar.edu/topics/satellite. Many of these lessons are also available in Spanish and French, with some Portuguese offerings also available, making learning resources more accessible to a larger international audience. This presentation will focus on COMET's satellite training offerings that are directly applicable to helping users learn more about the capabilities of the S-NPP and JPSS satellite series just in time for JPSS-1 becoming operational. MetEd's educational offerings include lessons on the VIIRS imager and its applications, and a recently updated lesson on nighttime visible observation using the VIIRS Day-Night Band. We'll show how the lessons introduce users to the advances these systems bring to forecasting, numerical weather prediction, and environmental monitoring. We'll also highlight newly developed lessons covering various aspects of JPSS for National Weather Service forecasters, and discuss current and future work.

  11. 43 Management of acute low back pain in the ED: a systematic review.

    Science.gov (United States)

    Ashbrook, Jane; Rodgdakis, Nikos; Goodwin, Peter; Yeowell, Gill; Callaghan, Michael

    2017-12-01

    There is no consensus on the management of low back pain in the ED and evidence suggests that these patients are likely to receive unwarranted imaging and inappropriate opioid prescription.The purpose of this study is to review the available literature pertaining to the clinical management of acute low back pain in the ED. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) and Realist And Meta-narrative Evidence Syntheses: Evolving Standards (RAMESES) guidelines were observed during this review.Trials were included if the population studied were adults with acute low back pain in an emergency setting. All diagnostic tests and therapeutic interventions were evaluated.Methodological quality and risk of bias was appraised using the Downs and Black checklist. 19 articles were identified including 1896 patients that were sub-grouped according to management.In the pharmacological subgroup corticosteroids were effective in patients with radicular pain, NSAIDs were as effective as other medication with less adverse events, Phenyramidol was not superior to placebo, promethazine and morhpine combined was not more effective than morphine alone and ketamine was no more effective than morphine but had a worse adverse effect profile.In the emergency transport group TENS and active warming both showed effects in reducing pain, anxiety and heart rate.In the physical therapy management group less pain and greater satisfaction were reported.In the adjunct interventions group showed a trend towards pain reduction in the use of heat/ice packs and short term pain relief in acupuncture and auricular acupuncture. More high quality trials are needed to determine an evidence-based management protocol for the treatment of acute low back pain in the ED. © 2017, Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  12. Experts: to crack down on violence in the ED, establish a robust system of reporting, educating staff.

    Science.gov (United States)

    2013-09-01

    Researchers say that most ED personnel will experience some form of physical or verbal violence at some point in their careers. However, when such incidents are regularly reported, the patients involved can be flagged in a hospital's computer system, making future events involving the same patients much less likely. Further, when ED personnel are alert to the clues that a patient or family member is becoming agitated, early intervention can usually prevent the situation from escalating to violence. About one-half of all ED personnel will experience a physical assault, and 97%-100% will experience verbal abuse during their careers, according to research. A first step in developing a strategy for dealing with violence is to educate ED personnel about what constitutes workplace violence so that all such incidents can be reported. Experts say many ED workers fail to recognize some instances of violence, based on the intent of the person involved. However, intent should not be a factor, they say. In many cases, empathy and good customer service skills can prevent tense situations from escalating to violence, but experts say that it is important to intervene at the first sign of agitation. ED administrators should gather input from frontline staff on how to most effectively derail instances of violence.

  13. RadConEd: A Graphical Data Editor for the Radiological Consequences Model, RadCon

    International Nuclear Information System (INIS)

    Crawford, J.; Domel, R.U.

    2000-05-01

    This document describes the application, RadConEd, which has been designed and implemented to enable users of the RadCon system to update these parameter files. The RadCon system is written in the Java programming language, and as such provides portability across computer platforms. The software described in this report was developed in line with the portability requirements of RadCon, thus providing a uniform user interface across computer platforms and bypassing the need of using system editors. In addition a number of data integrity measures were implemented

  14. Automated element identification for EDS spectra evaluation using quantification and integrated spectra simulation approaches

    International Nuclear Information System (INIS)

    Eggert, F

    2010-01-01

    This work describes first real automated solution for qualitative evaluation of EDS spectra in X-ray microanalysis. It uses a combination of integrated standardless quantitative evaluation, computation of analytical errors to a final uncertainty, and parts of recently developed simulation approaches. Multiple spectra reconstruction assessments and peak searches of the residual spectrum are powerful enough to solve the qualitative analytical question automatically for totally unknown specimens. The integrated quantitative assessment is useful to improve the confidence of the qualitative analysis. Therefore, the qualitative element analysis becomes a part of integrated quantitative spectrum evaluation, where the quantitative results are used to iteratively refine element decisions, spectrum deconvolution, and simulation steps.

  15. Sum rules for the ed - NN scattering reactions and microscopic potential field-theoretical approach

    International Nuclear Information System (INIS)

    Machivariani, A.I.

    1996-01-01

    The connections between the equal-time commutators of nucleon and photon field-operators and relativistic potential approach of ed - NN scattering equations is established. Namely, it is demonstrated that: 1) equal-time commutator between nucleon field operators generated completeness condition for NN interaction functions, 2) the off-mass shell contributions in γd - NN exchange currents or in microscopic NN potential are determined by equal time commutator between nucleon field operator and photon or nucleon source operators, and 3) equal-time commutators between source operators produce sum rules for same vertex functions and effective potentials [ru

  16. Detector system for e-d scattering experiments on the VEPP-3 storage ring

    International Nuclear Information System (INIS)

    Isaeva, L.G.; Lazarenko, B.A.; Nikolenko, D.M.; Popov, S.G.; Rachek, I.A.; Ukraintsev, Yu.G.; Tsentalovich, E.P.; Wojtsekhowski, B.B.; Nelubin, V.V.

    1993-01-01

    Experiments on electron scattering from polarized deuterons were carried out on the VEPP-3 storage ring at the Novosibirsk Institute for Nuclear Physics. The e-D coincidences were detected for elastic scattering experiments, and the p-n coincidences for photo disintegration studies. The tensor analyzing power of the elastic scattering was measured in the range of momentum transfer up to 3 f -1 , and of photo disintegration in the range of photon energy up to 500 MeV. The detector system created for these experiments and the data analysis procedures are described in this paper. (orig.)

  17. Vlivy jaderné energetiky na životní prostředí

    OpenAIRE

    Malkova, Kristina

    2013-01-01

    Title: Environmental impacts of nuclear energy Author: Malkova Kristina Supervisor: Ing. Luboš Matějíček, Dr., Ústav pro životní prostředí Přírodovědecké fakulty Univerzity Karlovy v Praze, Benátská 2, 128 01 Praha 2 Supervisor's e-mail adress: Abstract: The thesis is focused on study the impact of nuclear energy on the environment regard to non - renewable and renewable energy sources. The work includes evaluation of the entire fuel cycle of the use of various technolo...

  18. ESSEA On-Line Courses and the WestEd Eisenhower Regional Consortium (WERC)

    Science.gov (United States)

    Rognier, E.

    2001-12-01

    The WestEd Eisenhower Regional Consortium (WERC) is in its second year of offering two Earth Systems Science On-line Graduate courses from IGES - one for High School teachers, and one for Middle School teachers. These high-quality courses support WERC's commitment to "supporting increased scientific and mathematical literacy among our nation's youth through services and other support aimed at enhancing the efforts of those who provide K-12 science and mathematics education." WERC has been able to use its EdGateway online community network to offer these courses to environmental education and science teachers nationwide. Through partnerships with the North American Association for Environmental Education (NAAEE), the National Environmental Education Advancement Project (NEEAP), and other regional, state and local science and environmental education organizations, WERC has a broad reach in connecting with science educators nationwide. WERC manages several state and national listservs, which enable us to reach thousands of educators with information about the courses. EdGateway also provides a private online community in which we offer the courses. WERC partners with two Master Teachers from Utah, who facilitate the courses, and with the Center for Science and Mathematics Education at Weber State University, who provides low-cost graduate credit for the courses. Our students have included classroom teachers from upper elementary through high school, community college science teachers, and environmental science center staff who provide inservice for teachers. Educators from Hawaii to New Jersey have provided diverse personal experiences of Earth Systems Science events, and add richness to the online discussions. Two Earth Science Experts, Dr. Rick Ford from Weber State University, and Dr. Art Sussman from WestEd also contribute to the high caliber of learning the students experience in the courses. (Dr. Sussman's book, Dr. Art's Guide to Planet Earth, is used as one of

  19. Programs of monitoring of the steam generators of EdF nuclear power plants

    International Nuclear Information System (INIS)

    2001-01-01

    This decision from the French authority of nuclear safety (ASN) modifies the decision DSIN/GRE-BCCN no 000632 from October 31, 2000 concerning the preventive maintenance programs of the steam generators of Electricite de France (EdF) reactors. The main themes of the previous decision are not changed, i.e. the improvement of circumferential crack detection means, the reinforcement of the external skin control of tubes and the correction of vibrational instabilities for a given family of tubes. The modification concerns only the paragraph 2.b relative to the internal crack control of the 600 MA alloy tubes in the rolling transition zone. This paragraph is abrogated. (J.S.)

  20. Application of SEM/EDS to environmental geochemistry of heavy metals

    Directory of Open Access Journals (Sweden)

    Mateja Gosar

    2009-06-01

    Full Text Available Heavy metals represent a ubiquitous constituent of the near-surface environment, present in widely varyingconcentrations that typically have little impact on human behaviour and health. However, the mining of metals anduse of these metals in industrial processes has produced significant anthropogenic inputs of metals to both localand global environments. As such, a rigorous overview of the current accumulation of heavy metals and knowledgeof mineralogy of heavy metal-bearing phases is important for understanding their stability, solubility, mobility,bioavailability and toxicity. These data are of fundamental importance for environmental risk assessment and evaluationof future scenarios. Since conventional geochemical analyses provide limited information, other analyticalmethods have to be utilized for the characterisation of heavy metal-bearing phases. Significant analytical methodfor identification and characterisation of heavy metals in environmental media is a scanning electron microscopecoupled with energy dispersive X-ray spectrometer (SEM/EDS, an apparatus for qualitative and semi-quantitative chemical analysis at microne level, newly introduced to Geological Survey of Slovenia. Use of SEM/EDS was already introduced to environmental studies world-wide. In Slovenia, SEM/EDS analyses of environmental media werefirstly carried out on the Meža River stream sediments and snow deposits from Ljubljana urban area.Heavy metal-bearing phases in the Meža River stream sediments were apportioned to three source areas: Mežica mining/smelting area (geogenic-technogenic origin, Ravne ironworks area (technogenic origin and the Meža River catchment area (geogenic origin, which corresponds to data obtained by conventional geochemical and multivariate statistical methods. Airborne particles, identified in urban snow deposits, were interpreted as geogenic particles, represented by fragments of heavy metal-bearing minerals, and technogenic particles that