WorldWideScience

Sample records for ed watson 1940-2006

  1. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  2. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  3. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  4. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  5. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  6. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  7. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  8. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  9. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  10. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  11. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  12. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  13. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  14. Snow shovel-related injuries and medical emergencies treated in US EDs, 1990 to 2006.

    Science.gov (United States)

    Watson, Daniel S; Shields, Brenda J; Smith, Gary A

    2011-01-01

    Injuries and medical emergencies associated with snow shovel use are common in the United States. This is a retrospective analysis of data from the National Electronic Injury Surveillance System. This study analyzes the epidemiologic features of snow shovel-related injuries and medical emergencies treated in US emergency departments (EDs) from 1990 to 2006. An estimated 195 100 individuals (95% confidence interval, 140 400-249 800) were treated in US EDs for snow shovel-related incidents during the 17-year study period, averaging 11 500 individuals annually (SD, 5300). The average annual rate of snow shovel-related injuries and medical emergencies was 4.15 per 100 000 population. Approximately two thirds (67.5%) of these incidents occurred among males. Children younger than 18 years comprised 15.3% of the cases, whereas older adults (55 years and older) accounted for 21.8%. The most common diagnosis was soft tissue injury (54.7%). Injuries to the lower back accounted for 34.3% of the cases. The most common mechanism of injury/nature of medical emergency was acute musculoskeletal exertion (53.9%) followed by slips and falls (20.0%) and being struck by a snow shovel (15.0%). Cardiac-related ED visits accounted for 6.7% of the cases, including all of the 1647 deaths in the study. Patients required hospitalization in 5.8% of the cases. Most snow shovel-related incidents (95.6%) occurred in and around the home. This is the first study to comprehensively examine snow shovel-related injuries and medical emergencies in the United States using a nationally representative sample. There are an estimated 11 500 snow shovel-related injuries and medical emergencies treated annually in US EDs. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  16. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  17. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  18. Interfacility transfers for US ischemic stroke and TIA, 2006-2014.

    Science.gov (United States)

    George, Benjamin P; Doyle, Sara J; Albert, George P; Busza, Ania; Holloway, Robert G; Sheth, Kevin N; Kelly, Adam G

    2018-05-01

    To investigate changes in emergency department (ED) transfers for ischemic stroke (IS) and TIA. We performed a retrospective observational study using the US Nationwide Emergency Department Sample to identify changes in interfacility ED transfers for IS and TIA from the perspective of the transferring ED (2006-2014). We calculated nationwide transfer rates and individual ED transfer rates for IS/TIA by diagnosis and hospital characteristics. Hospital-level fractional logistic regression examined changes in transfer rates over time. The population-estimated number of transfers for IS/TIA increased from 22,576 patient visits in 2006 to 54,485 patient visits in 2014 ( p trend TIA transfer increased from 3.4 (95% confidence interval [CI] 3.0-3.8) in 2006 to 7.6 (95% CI 7.2-7.9) in 2014 per 100 ED visits. Among individual EDs, mean transfer rates for IS/TIA increased from 8.2 per 100 ED visits (median 2.0, interquartile range [IQR] 0-10.2) to 19.4 per 100 ED visits (median 8.1, IQR 1.1-33.3) (2006-2014) ( p trend TIA increased threefold (2006-2014). Interfacility ED transfers for IS/TIA more than doubled from 2006 to 2014. Further work should determine the necessity of IS/TIA transfers and seek to optimize the US stroke care system. © 2018 American Academy of Neurology.

  19. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  20. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  1. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  2. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  3. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  4. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  5. Emergency department burden of constipation in the United States from 2006 to 2011.

    Science.gov (United States)

    Sommers, Thomas; Corban, Caroline; Sengupta, Neil; Jones, Michael; Cheng, Vivian; Bollom, Andrea; Nurko, Samuel; Kelley, John; Lembo, Anthony

    2015-04-01

    Although constipation is typically managed in an outpatient setting, there is an increasing trend in the frequency of constipation-related hospital visits. The aim of this study was to analyze trends related to chronic constipation (CC) in the United States with respect to emergency department (ED) visits, patient and hospital characteristics, and associated costs. Data from 2006 to 2011, in which constipation (The International Classification of Diseases, 9th Revision, Clinical Modification (ICD-9-CM) diagnosis codes 564.00-564.09) was the primary discharge diagnosis, were obtained from the National Emergency Department Sample (NEDS). Between 2006 and 2011, the frequency of constipation-related ED visits increased by 41.5%, from 497,034 visits to 703,391 visits, whereas the mean cost per patient rose by 56.4%, from $1,474 in 2006 to $2,306 in 2011. The aggregate national cost of constipation-related ED visits increased by 121.4%, from $732,886,977 in 2006 to $1,622,624,341 in 2011. All cost data were adjusted for inflation and reported in 2014 dollars. Infants (constipation-related ED visits in both 2006 and 2011. The late elders (85+ years) had the second highest constipation-related ED visit rate in 2006; however, the 1- to 17-year-old age group experienced a 50.7% increase in constipation-related ED visit rate from 2006 to 2011 and had the second highest constipation-related ED visit rate in 2011. The frequency of and the associated costs of ED visits for constipation are significant and have increased notably from 2006 to 2011.

  6. 7 CFR 1940.330 - Monitoring.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true Monitoring. 1940.330 Section 1940.330 Agriculture... REGULATIONS (CONTINUED) GENERAL Environmental Program § 1940.330 Monitoring. (a) FmHA or its successor agency... monitoring of approved projects will ensure that those measures which were identified in the preapproval...

  7. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  8. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  9. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  10. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  11. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  12. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  13. Christo Deltshev & Pavel Stoev (eds) (2006): European Arachnology 2005, Acta zoologica bulgaria, Suppl. No. 1; Proceedings of the 22nd European Colloquium of Arachnology, Blagoevgrad, Bulgaria, 1-6 August 2005

    OpenAIRE

    Kunz, Dirk

    2006-01-01

    book review: Christo Deltshev & Pavel Stoev (eds) (2006): European Arachnology 2005, Acta zoologica bulgaria, Suppl. No. 1; Proceedings of the 22nd European Colloquium of Arachnology, Blagoevgrad, Bulgaria, 1-6 August 2005

  14. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  15. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  16. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  17. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  18. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  19. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  20. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  1. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  2. Trends in Hospital Admission and Surgical Procedures Following ED visits for Diverticulitis

    Directory of Open Access Journals (Sweden)

    Margaret B. Greenwood-Ericksen

    2016-06-01

    Full Text Available Introduction: Diverticulitis is a common diagnosis in the emergency department (ED. Outpatient management of diverticulitis is safe in selected patients, yet the rates of admission and surgical procedures following ED visits for diverticulitis are unknown, as are the predictive patient characteristics. Our goal is to describe trends in admission and surgical procedures following ED visits for diverticulitis, and to determine which patient characteristics predict admission. Methods: We performed a cross-sectional descriptive analysis using data on ED visits from 2006-2011 to determine change in admission and surgical patterns over time. The Nationwide Emergency Department Sample database, a nationally representative administrative claims dataset, was used to analyze ED visits for diverticulitis. We included patients with a principal diagnosis of diverticulitis (ICD-9 codes 562.11, 562.13. We analyzed the rate of admission and surgery in all admitted patients and in low-risk patients, defined as age <50 with no comorbidities (Elixhauser. We used hierarchical multivariate logistic regression to identify patient characteristics associated with admission for diverticulitis. Results: From 2006 to 2011 ED visits for diverticulitis increased by 21.3% from 238,248 to 302,612, while the admission rate decreased from 55.7% to 48.5% (-7.2%, 95% CI [–7.78 to -6.62]; p<0.001 for trend. The admission rate among low-risk patients decreased from 35.2% in 2006 to 26.8% in 2011 (-8.4%, 95% CI [–9.6 to –7.2]; p<0.001 for trend. Admission for diverticulitis was independently associated with male gender, comorbid illnesses, higher income and commercial health insurance. The surgical rate decreased from 6.5% in 2006 to 4.7% in 2011 (-1.8%, 95% CI [–2.1 to –1.5]; p<0.001 for trend, and among low-risk patients decreased from 4.0% to 2.2% (- 1.8%, 95% CI [–4.5 to –1.7]; p<0.001 for trend. Conclusion: From 2006 to 2011 ED visits for diverticulitis increased

  3. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  4. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  5. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  6. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  7. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  8. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  9. Trends in Educational Inequality in Different Eras (1940-2010)--A Re-Examination of Opportunity Inequalities in Urban-Rural Education

    Science.gov (United States)

    Chunling, Li

    2015-01-01

    Based on national sampling survey data from 2006, 2008, and 2011, the author uses the Mare educational transition model to systematically examine changing trends in inequalities in urban-rural educational opportunities at all educational stages from 1940 to 2010. Through a comparative analysis of five birth year groups, inequalities in urban-rural…

  10. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  11. 7 CFR 1940.589 - Rural Business Enterprise Grants.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true Rural Business Enterprise Grants. 1940.589 Section 1940.589 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE... Loan and Grant Program Funds § 1940.589 Rural Business Enterprise Grants. (a) Amount available for...

  12. 21 CFR 892.1940 - Radiologic quality assurance instrument.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiologic quality assurance instrument. 892.1940 Section 892.1940 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1940 Radiologic quality assurance...

  13. PREFACE: EDS2010 Preface

    Science.gov (United States)

    Heggie, Malcolm I.

    2011-03-01

    The biennial international conference on Extended Defects in Semiconductors started in 1978 with a meeting in Hünfeld, Germany. Subsequent meetings rotated between Poland, France, Great Britain, Germany, Russia and Italy, culminating in EDS2004 in Chernogolovka, EDS2006 in Halle and EDS2008 in Poitiers. EDS2010 was held at the University of Sussex at Brighton, UK from September 19th to 24th. An extension of the tabulation of this history, which first appeared on the EDS2006 website, is given in the attached PDF. It is with sadness that we note one of the founders of the series, Prof. Dr Helmut Alexander, passed away on 3 December 2009 and we were proud to dedicate EDS2010 to his memory. It has become a tradition to make an award in his name, and this year it was made to Ivan Isacov for his poster "Electrical levels of dislocation networks in p- and n-type silicon". A short and warm celebration of Prof. Dr Alexander's life by his friends and colleagues, Prof. Drs Helmut Gottschalk, Eicke Weber and Wolfgang Schröter, is included in this volume. The conference was a forum for the state-of-the-art of investigation and modelling of extended defects in semiconductors. Scientists from universities, research institutes and industry made contributions to a deeper understanding of extended defects, their interaction with point defects and their role in the development of semiconductor technology. The remit of the conference included extended defects, nanostructures, nanoparticles, quantum dots and interfaces within semiconducting materials ranging from narrow to wide band gaps, including graphene-derived materials and diamond. Scientific interests range from defect geometry, electronic structure, dynamics, spectroscopy, microscopy, reactions and chemistry to introduction mechanisms, such as implantation and strained layers and the operation of devices such as integrated circuits, heterostructures, and solar cells. The organisers were confronted with a long period between

  14. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  15. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  16. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  17. Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

    Science.gov (United States)

    2012-07-01

    like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

  18. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  19. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  20. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  1. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  2. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  3. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  4. 7 CFR 1940.1000 - OMB control number.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true OMB control number. 1940.1000 Section 1940.1000 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS....1000 OMB control number. The collection of information requirements contained in this regulation has...

  5. 7 CFR 1940.578 - Housing Preservation Grant (HPG) program.

    Science.gov (United States)

    2010-01-01

    ... available for allocations. See § 1940.552(a) of this subpart. (b) Basic formula criteria, data source and... subpart. (d) Transition formula. See § 1940.552(d) of this subpart. (e) Base allocation. See § 1940.552(e.... Pooled funds will be combined with the National Office reserve to fund eligible projects. Remaining HPG...

  6. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  7. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  8. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  9. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  10. Viirastuslikud Sinimäed. Mõtteid Raimo Jõeranna filmi ainetel / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2006-01-01

    6-osalise ajaloodokumentaalide sarja "Kuum külm sõda" teist filmi "Sinimäed" : stsenaristid Kiur Aarma, Mart Laar, Eerik-Niiles Kross, Raimo Jõerand : režissöör Raimo Jõerand : Ruut Pictures 2006

  11. The 2006 California heat wave: impacts on hospitalizations and emergency department visits.

    Science.gov (United States)

    Knowlton, Kim; Rotkin-Ellman, Miriam; King, Galatea; Margolis, Helene G; Smith, Daniel; Solomon, Gina; Trent, Roger; English, Paul

    2009-01-01

    Climate models project that heat waves will increase in frequency and severity. Despite many studies of mortality from heat waves, few studies have examined morbidity. In this study we investigated whether any age or race/ethnicity groups experienced increased hospitalizations and emergency department (ED) visits overall or for selected illnesses during the 2006 California heat wave. We aggregated county-level hospitalizations and ED visits for all causes and for 10 cause groups into six geographic regions of California. We calculated excess morbidity and rate ratios (RRs) during the heat wave (15 July to 1 August 2006) and compared these data with those of a reference period (8-14 July and 12-22 August 2006). During the heat wave, 16,166 excess ED visits and 1,182 excess hospitalizations occurred statewide. ED visits for heat-related causes increased across the state [RR = 6.30; 95% confidence interval (CI), 5.67-7.01], especially in the Central Coast region, which includes San Francisco. Children (0-4 years of age) and the elderly (> or = 65 years of age) were at greatest risk. ED visits also showed significant increases for acute renal failure, cardiovascular diseases, diabetes, electrolyte imbalance, and nephritis. We observed significantly elevated RRs for hospitalizations for heat-related illnesses (RR = 10.15; 95% CI, 7.79-13.43), acute renal failure, electrolyte imbalance, and nephritis. The 2006 California heat wave had a substantial effect on morbidity, including regions with relatively modest temperatures. This suggests that population acclimatization and adaptive capacity influenced risk. By better understanding these impacts and population vulnerabilities, local communities can improve heat wave preparedness to cope with a globally warming future.

  12. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  13. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  14. 7 CFR 1940.406 - Real estate settlement procedures.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true Real estate settlement procedures. 1940.406 Section... AGRICULTURE (CONTINUED) PROGRAM REGULATIONS (CONTINUED) GENERAL Truth in Lending-Real Estate Settlement Procedures § 1940.406 Real estate settlement procedures. (a) General. This section provides the instructions...

  15. Oleh Pavlyshyn. Ievhen Petrushevych (1863-1940: Iliustrovanyi biohrafichnyi narys

    Directory of Open Access Journals (Sweden)

    Frank Golczewski

    2016-09-01

    Full Text Available Oleh Pavlyshyn. Ievhen Petrushevych (1863-1940: Iliustrovanyi biohrafichnyi narys. [Ievhen Petrushevych (1863-1940: Illustrated Biographic Sketch]. Lviv: Manuskrypt-Lviv, 2013. 400 pp. Illustrations. Bibliography. UAH 102,60, paper.

  16. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  17. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  18. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  19. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  1. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  2. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  3. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  4. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  5. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  6. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  7. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  8. Lithuania 1940 / Herbert Foster Anderson

    Index Scriptorium Estoniae

    Foster Anderson, Herbert

    2004-01-01

    Stseenid Leedu ennesõjaaegsest pealinnast Kaunasest briti ärimehe H. Foster Andersoni silme läbi 1940. aastal. Lühikokkuvõte raamatust: Foster Anderson, Herbert. Borderline Russia. London : Cresset press, 1942

  9. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  11. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  12. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  13. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  14. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  15. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  16. Hit Record Trends, 1940-1977.

    Science.gov (United States)

    Anderson, Bruce; And Others

    1980-01-01

    Examines trends in popular music by analyzing the number one recordings from 1940 to 1977 in terms of the relationships among four variables: manufacturer (market concentration), song type (musical genre), artist type (performance mode), and lyric content (vocal message). (JMF)

  17. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  18. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  19. Majandusminister kevadel 1940 : "Sööme praegu viimaseid reserve!" / Argo Ideon

    Index Scriptorium Estoniae

    Ideon, Argo, 1966-

    2009-01-01

    Arvustus : Faatum : Eesti tee hävingule 1939-1940 : riigikontrolör Karl Soonpää päevik Eesti Vabariigi saatuseaastatest 1939-1940 : Molotovi-Ribbentropi pakti tagamaad : dokumendid ja materjalid. Tallinn : SE & JS, 2009

  20. Disparities in emergency department visits in American children with asthma: 2006-2010.

    Science.gov (United States)

    Zhang, Qi; Lamichhane, Rajan; Diggs, Leigh Ann

    2017-09-01

    This article was to examine the trends in emergency department (ED) visits for asthma among American children in 2006-2010 across sociodemographic factors, parental smoking status, and children's body weight status. We analyzed 5,535 children aged 2-17 years with current asthma in the Asthma Call-Back Survey in 2006-2010. Multivariate log binomial regression was used to examine the disparities of ED visits by demographics, socioeconomic status, parental smoking status, children's body weight status, and the level of asthma control. We controlled for average state-level air pollutants. Prevalence ratios (PRs) and 95% confidence intervals (CIs) were reported. Minority children with current asthma had higher risks of ED visits compared with white children in 2009 and 2010, e.g., the PR (95% CI) for black children in 2009 was 3.64 (1.79, 7.41). Children who had current asthma and more highly educated parents experienced a higher risk of ED visits in 2007 (PRs [95% CI] = 2.15 [1.02, 4.53] and 2.97 [1.29, 6.83] for children with some college or college-graduated parents), but not significant in other years. Children with uncontrolled asthma were significantly more likely to visit the ED in 2008 (PRs [95% CI] = 2.79 [1.44, 5.41] and 6.96 [3.55, 13.64] for not-well-controlled and very poorly controlled children with asthma). Minority children with current asthma or children with uncontrolled asthma were more likely to visit EDs for asthma treatment. However, the disparities in ED visits across sociodemographics, health status, or asthma control vary in scale and significance across time. More research is needed to explain these differences.

  1. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  2. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  3. Eesti politsei hävitamine esimesel Nõukogude okupatsiooniaastal 1940/1941 / Mai Krikk

    Index Scriptorium Estoniae

    Krikk, Mai, 1946-

    2008-01-01

    Ülevaade Eesti politsei hävitamisest politseiametnike saatuse kaudu. Politseijuhid 1918-1940, lk. 145-148. - Lisad: 14. juunil 1941 represseeritud politseinikud ; represseeritud politseiametnikud 1940/1941

  4. 13 CFR 107.115 - 1940 Act and 1980 Act Companies.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false 1940 Act and 1980 Act Companies. 107.115 Section 107.115 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS... Companies. A 1940 Act or 1980 Act Company is eligible to apply for an SBIC license, and an existing Licensee...

  5. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  6. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  7. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  8. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  9. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  11. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  12. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  13. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  14. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  15. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  16. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  17. SOVIET POSTERS IN LITHUANIA IN 1940–1953

    Directory of Open Access Journals (Sweden)

    Bajoraite, Alma

    2006-12-01

    Full Text Available The Soviet occupation and their ideology brought to Lithuania a new poster quality. The paper analyzes the problem of posters propaganda and manipulation, the inheritance of the not traditional documents and their inventory. The goal of this paper is to analyze the soviet posters in Lithuania in 1940–1953.The principal problems of this paper are to research the formation and the domination of the posters in Lithuania: which role they had in the politics. The paper also analyzes the soviet posters impact on farming and their influence to the society.To sum up, the new trend of art appeared in 1940 in Lithuania, which had the principal goal to propagate the soviet ideology in all the political and social spheres. The goal of the soviet posters as the media of information was to provide the distorted view of the reality. The soviet posters had dominated in Lithuania in 1940–1953. This period had left a very interesting and rich heritage. It is the importatant part of the cultural and historical heritage.

  18. Radiography journals 1935-1940: '1937'

    International Nuclear Information System (INIS)

    Bentley, H. Brian

    2009-01-01

    This is the third of the series 1935-1937, two years before the Second World War and sixty-one years ago. There is much to indicate the contribution of physicists, radiologists and radiographers to the under pinning of the science of radiography. We shall continue the series with the period from 1938-1940.

  19. The Coast Artillery Journal. Volume 83, Number 5, September-October 1940

    Science.gov (United States)

    1940-10-01

    An army can use these methods as effectively as can American business. Cosmetic manufacturers know women will use a certain cosmetic , not only because...Department, sailing San Francisco, Oc- tober 8, 1940. )’lajor Fenton G. Epling, promoted Lieu- tenant Colonel, August 7, 1940. Major \\Villiam D. .Evans

  20. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  1. 7 CFR 1940.320 - Preparing EISs.

    Science.gov (United States)

    2010-01-01

    ... REGULATIONS (CONTINUED) GENERAL Environmental Program § 1940.320 Preparing EISs. (a) Responsibility. Whenever... implementation of the State's environmental impact analysis requirement, if one has been enacted or promulgated... of the natural and social sciences and the environmental design arts. The disciplines of the...

  2. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  5. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  6. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  7. Dierberger organizations (1893-1940

    Directory of Open Access Journals (Sweden)

    Marta Enokibara

    2016-12-01

    Full Text Available The purpose of this article is to draw a timeline on the Dierberger Organizations, namely the set of business buildings, companies and culture fields that were founded by the German Johann Dierberger (1859-1931 and his sons, from collected and catalogued material in his family’s file. The journey begins with the first firm, Estabelecimento Floricultura, founded in 1893 by Johann Dierberger, and ends in 1940, when the sons go on to conduct separate specialized firms.

  8. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  9. Information from 2006, 2010 and 2011 for the Karnmelkspruit Cape ...

    African Journals Online (AJOL)

    2006-08-05

    Aug 5, 2006 ... The Mazda Wildlife Fund is thanked for providing assistance with transport. Two reviewers are thanked for feedback on an earlier draft of this article. References. Barnes KN (ed.). 2000. The Eskom Red Data Book of Birds of South Africa, Lesotho and. Swaziland. BirdLife South Africa: Johannesburg.

  10. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  11. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  12. Minor injury attendance times to the ED.

    LENUS (Irish Health Repository)

    Conlon, Ciaran

    2009-07-01

    The Health Service Executive (HSE) highlights the need for effective patient throughput and management, whilst providing appropriate staffing and therapeutic interventions. It acknowledges that patient need is integral to the development of a nurse led service and advocates planning staffing levels to reflect arrival times of patients. An observational study of all patients who presented to the emergency department in July 2005 and February 2006 was undertaken (n=7768). The study identified 1577 patients suitable for treatment by the Advanced Nurse Practitioner (ANP) in these two months, which represents 20% of all patient attendances to the ED in this time period. A data collection tool was devised collectively by the ANPs to identify appropriate patients. The findings of the study revealed that 73% of patients suitable for the ANP service presented between the hours of 0800 and 2000, of which 54% attended between 0800 and 1600 h. Sunday emerged as the busiest day in July 2005 whereas Monday was found to be the busiest day in February 2006. Friday was found to be consistently busy for both months.

  13. Statistical yearbook 2005. Data available as of March 2006. 50 ed

    International Nuclear Information System (INIS)

    2006-08-01

    The Statistical Yearbook is an annual compilation of a wide range of international economic, social and environmental statistics on over 200 countries and areas, compiled from sources including UN agencies and other international, national and specialized organizations. The 50th issue contains data available to the Statistics Division as of March 2006 and presents them in 76 tables. The number of years of data shown in the tables varies from one to ten, with the ten-year tables covering 1994 to 2003 or 1995 to 2004. Accompanying the tables are technical notes providing brief descriptions of major statistical concepts, definitions and classifications

  14. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  15. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Nuclear facilities of EdF's operational hot base of Tricastin. 2009 annual report

    International Nuclear Information System (INIS)

    2010-01-01

    This annual report is established on account of article 21 of the 2006-686 French law from June 13, 2006, relative to the transparency and safety in the nuclear domain. It describes, first, the nuclear facilities of the EdF operational hot base of Tricastin, then, the measures taken to ensure their safety (personnel radioprotection, actions implemented for nuclear safety improvement, organisation in crisis situation, external and internal controls, technical assessment of the facilities), and finally the procedures of management of radioactive wastes. A glossary and the viewpoint of the Committee of Hygiene, safety and working conditions about the content of the document conclude the report. (J.S.)

  17. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  18. Re-evaluating the 1940s CO2 plateau

    Science.gov (United States)

    Bastos, Ana; Ciais, Philippe; Barichivich, Jonathan; Bopp, Laurent; Brovkin, Victor; Gasser, Thomas; Peng, Shushi; Pongratz, Julia; Viovy, Nicolas; Trudinger, Cathy M.

    2016-09-01

    The high-resolution CO2 record from Law Dome ice core reveals that atmospheric CO2 concentration stalled during the 1940s (so-called CO2 plateau). Since the fossil-fuel emissions did not decrease during the period, this stalling implies the persistence of a strong sink, perhaps sustained for as long as a decade or more. Double-deconvolution analyses have attributed this sink to the ocean, conceivably as a response to the very strong El Niño event in 1940-1942. However, this explanation is questionable, as recent ocean CO2 data indicate that the range of variability in the ocean sink has been rather modest in recent decades, and El Niño events have generally led to higher growth rates of atmospheric CO2 due to the offsetting terrestrial response. Here, we use the most up-to-date information on the different terms of the carbon budget: fossil-fuel emissions, four estimates of land-use change (LUC) emissions, ocean uptake from two different reconstructions, and the terrestrial sink modelled by the TRENDY project to identify the most likely causes of the 1940s plateau. We find that they greatly overestimate atmospheric CO2 growth rate during the plateau period, as well as in the 1960s, in spite of giving a plausible explanation for most of the 20th century carbon budget, especially from 1970 onwards. The mismatch between reconstructions and observations during the CO2 plateau epoch of 1940-1950 ranges between 0.9 and 2.0 Pg C yr-1, depending on the LUC dataset considered. This mismatch may be explained by (i) decadal variability in the ocean carbon sink not accounted for in the reconstructions we used, (ii) a further terrestrial sink currently missing in the estimates by land-surface models, or (iii) LUC processes not included in the current datasets. Ocean carbon models from CMIP5 indicate that natural variability in the ocean carbon sink could explain an additional 0.5 Pg C yr-1 uptake, but it is unlikely to be higher. The impact of the 1940-1942 El Niño on the

  19. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  20. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  1. The Film Book Bibliography 1940-1975.

    Science.gov (United States)

    Ellis, Jack C.; And Others

    More than 5,400 entries are included in this first attempt to cite and classify all English language books, monographs, and dissertations about film that appeared from 1940 to 1975. Intended as a source of information about existing film books and as a tool for researching available literature on any film topic, the bibliography uses ten basic…

  2. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  3. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  4. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  5. The fading American dream: Trends in absolute income mobility since 1940.

    Science.gov (United States)

    Chetty, Raj; Grusky, David; Hell, Maximilian; Hendren, Nathaniel; Manduca, Robert; Narang, Jimmy

    2017-04-28

    We estimated rates of "absolute income mobility"-the fraction of children who earn more than their parents-by combining data from U.S. Census and Current Population Survey cross sections with panel data from de-identified tax records. We found that rates of absolute mobility have fallen from approximately 90% for children born in 1940 to 50% for children born in the 1980s. Increasing Gross Domestic Product (GDP) growth rates alone cannot restore absolute mobility to the rates experienced by children born in the 1940s. However, distributing current GDP growth more equally across income groups as in the 1940 birth cohort would reverse more than 70% of the decline in mobility. These results imply that reviving the "American dream" of high rates of absolute mobility would require economic growth that is shared more broadly across the income distribution. Copyright © 2017, American Association for the Advancement of Science.

  6. TED-Ed lessons & TED-Ed clubs: Educational activities to amplify students' voices

    Science.gov (United States)

    Villias, Georgios

    2017-04-01

    TED-Ed lessons and TED-Ed clubs are two powerful educational tools that can be used in today's school classrooms in order to create an educational environment that is engaging for the students and favors their active participation, created and fostered by TED-Ed. TED-Ed is TED's educational initiative, committed to create lessons worth sharing and amplify the voices and ideas of teachers and students around the world. TED-Ed animated lessons are fully organized lessons structured around an animated video that introduces new topics to learners in an exciting, thought-provoking way. These lessons have been created as a result of the cooperation between expert educators and animators and have been uploaded at the TED-Ed platform (http://ed.ted.com). On the other hand, TED-Ed Clubs are also an interesting way to offer students the chance, the voice and the opportunity to express their thoughts, engage actively on these matters and connect with each other, both at a local, as well as at an international level (http://ed.ted.com/clubs). By developing new TED-Ed lessons or by customizing appropriately existing animated TED-Ed lessons (translating, modifying the questions asked, introducing new discussion topics), I have created and implemented in my student-centered, didactic approach, a series of TED-ED animated lessons directly connected with the Greek national science syllabus that were used to spark students curiosity and initiate a further analytical discussion or introduce other relevant educational activities (http://gvillias.wixsite.com/education). Furthermore, at my school, we established Varvakeio TED-Ed Club, an environment that supports and empowers our students to research, develop and disseminate their own personal ideas that worth spreading. During the year, our members were inspired by watching TED talks presented by experts on their field on various different areas, including social, economical, environmental and technological-scientific issues. Our aim

  7. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  8. Environmental Baseline Survey Report for the Title Transfer of Land Parcel ED-4 at the East Tennessee Technology Park, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    SAIC

    2008-05-01

    This environmental baseline survey (EBS) report documents the baseline environmental conditions of a land parcel referred to as 'ED-4' (ED-4) at the U. S. Department of Energy's (DOE's) East Tennessee Technology Park (ETTP). DOE is proposing to transfer the title of this land to the Heritage Center, LLC. Parcel ED-4 is a land parcel that consists of two noncontiguous areas comprising a total of approximately 18 acres located east of the ETTP. The western tract of ED-4 encompasses approximately 8.5 acres in the northeastern quadrant of the intersection of Boulevard Road and Highway 58. The eastern tract encompasses an area of approximately 9.5 acres in the northwestern quadrant of the intersection of Blair Road and Highway 58 (the Oak Ridge Turnpike). Aerial photographs and site maps from throughout the history of the ETTP, going back to its initial development in the 1940s as the Oak Ridge Gaseous Diffusion Plant (ORGDP), indicate that this area has been undeveloped woodland with the exception of three support facilities for workers constructing the ORGDP since federal acquisition in 1943. These three support facilities, which were located in the western tract of ED-4, included a recreation hall, the Town Hall Camp Operations Building, and the Property Warehouse. A railroad spur also formerly occupied a portion of Parcel ED-4. These former facilities only occupied approximately 5 percent of the total area of Parcel ED-4. This report provides supporting information for the transfer of this government-owned property at ETTP to a non-federal entity. This EBS is based upon the requirements of Sect. 120(h) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA). In order to support a Clean Parcel Determination (CPD) in accordance with CERCLA Sect. 120(h)(4)(d), groundwater and sediment samples were collected within, and adjacent to, the Parcel ED-4 study area. The potential for DOE to make a CPD for ED-4 is

  9. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  10. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  11. We Were Caught Unprepared: The 2006 Hezbollah-Israeli War

    Science.gov (United States)

    2008-01-01

    and would conduct the majority of its operations using standoff-based fi repower . Available historic evidence appears to indicate this rationale was...south of the Litani. The supplies were secreted in well-fortifi ed bunkers and entrenchments designed to withstand blistering IDF-precision fi repower ...Hezbollah to modify its doctrine. By the early summer of 2006, Hezbollah had transformed its original 13 22 principles of warfare (a doctrine that had

  12. Nonfatal, unintentional, non--fire-related carbon monoxide exposures--United States, 2004-2006.

    Science.gov (United States)

    2008-08-22

    Carbon monoxide (CO) is a colorless, odorless, nonirritating gas that is produced through the incomplete combustion of hydrocarbons. Sources of CO include combustion devices (e.g., boilers and furnaces), motor-vehicle exhaust, generators and other gasoline or diesel-powered engines, gas space heaters, woodstoves, gas stoves, fireplaces, tobacco smoke, and various occupational sources. CO poisoning is a leading cause of unintentional poisoning deaths in the United States; it was responsible for approximately 450 deaths each year during 1999-2004 and an estimated 15,200 emergency department (ED) visits each year during 2001-2003. Health effects of CO exposure can range from viral-like symptoms (e.g., fatigue, dizziness, headache, confusion, and nausea) to more severe conditions (e.g., disorientation, unconsciousness, long-term neurologic disabilities, coma, cardiorespiratory failure, and death). CO poisoning often is misdiagnosed and underdetected because of the nonspecific nature of symptoms. To update a previously published report and provide national estimates of CO-related ED visits during 2004-2006, CDC analyzed data from the National Electronic Injury Surveillance System--All Injury Program (NEISS-AIP) database. During 2004-2006, an estimated average of 20,636 ED visits for nonfatal, unintentional, non-fire-related CO exposures occurred each year. Approximately 73% of these exposures occurred in homes, and 41% occurred during winter months (December-February). Prevention efforts targeting residential and seasonal CO exposures can substantially reduce CO-related morbidity.

  13. Kultuurigenotsiid Eestis : kirjanikud (1940-1953) / Toomas Karjahärm

    Index Scriptorium Estoniae

    Karjahärm, Toomas, 1944-

    2006-01-01

    Eesti kunstiintelligentsi tagakiusamisest 1940-1953 Nõukogude ja natsi-Saksamaa okupatsioonivõimude poolt. Lähemalt on vaatluse all literaadid, professionaalsed kirjanikud, kriitikud ja tõlkijad, kes kuulusid kirjanike loomingulistesse liitudesse

  14. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Romanian-Magyar Relations in the Period 1940-1944. Sections

    Directory of Open Access Journals (Sweden)

    Cristian Sandache

    2017-07-01

    Full Text Available During the Second World War, Romania and Hungary were in the same political-military camp as allied states of Nazi Germany. The annexation of Northern Transylvania by Budapest as a result of the Vienna Diktat (August 30, 1940 intensified the tension between the two countries, both reaffirming throughout the war, that they have full historical and political rights over this region, denying the arguments presented in this sense by the other side. The persecutions and atrocities of the Hungarian authorities over the ethnic Romanians in the Transylvanian region ceded to Hungary were promptly reported to Germany and Italy by the diplomacy of Bucharest, which repeatedly tried to convince the Vienna decision that the act of 30 August 1940 had become obsolete.

  16. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  17. Inform@ed space

    DEFF Research Database (Denmark)

    Bjerrum, Peter; Olsen, Kasper Nefer

    2001-01-01

    Inform@ed space Sensorial Perception And Computer Enchancement - bidrag til Nordisk Arkitekturforskningsforenings IT-konference, AAA april 2001.......Inform@ed space Sensorial Perception And Computer Enchancement - bidrag til Nordisk Arkitekturforskningsforenings IT-konference, AAA april 2001....

  18. President Roosevelt's 1940 Dedication of the First NCI Building

    Science.gov (United States)

    Watch this video excerpt of the dedication of the National Institute of Health, October 31, 1940. President Roosevelt spoke of the importance of the National Cancer Institute, which would be located in Building 6.

  19. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  20. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  1. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  2. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  3. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  4. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  6. Sõjandustemaatika Eesti meditsiiniperioodikas 1920-1940 (Kommenteeritud bibliograafia) / Ken Kalling

    Index Scriptorium Estoniae

    Kalling, Ken, 1963-

    2004-01-01

    Ülevaade 1920.-1940. aastatel ajakirjades Eesti Arst ja Tervis ilmunud sõjandusega seotud kirjutistest, lisatud on ka väljaande "Sõjaväe arstide teadusliste koosolekute protokollid" sisukorrad. Artiklis pööratakse tähelepanu tervishoiu ja riigikaitse seostele

  7. The Relationship Between the Use of a Worksite Medical Home and ED Visits or Hospitalizations

    Directory of Open Access Journals (Sweden)

    Marissa Stroo BS

    2015-10-01

    Full Text Available Worksite medical homes may be a good model for improving employee health. The aim of this study was to compare the likelihood of being seen in the emergency department (ED or being hospitalized by level of use (no use, occasional use, or primary care of a worksite medical home, overall and by type of user (employee, adult dependent, or pediatric dependent. This was a retrospective analysis of claims data, using covariate-adjusted logistic regression models for ED visits and inpatient hospitalizations. Secondary data for the years 2006 to 2008 from a company that offers an on-site health care center (HCC were used. Analyses were based on a data set that combines health plan claims and human resources demographic data. Overall, people who did not use the HCC were more likely to be seen in the ED (adjusted odds ratio [OR] = 1.20, 95% confidence interval or CI [1.06, 1.37], P = .005 or to be hospitalized (adjusted OR = 1.58; 95% CI [1.34, 1.86]; P < .0001 compared with those who used the HCC for primary care. Both ED visits and hospitalizations for employees and dependents in this study were lower among those who used the worksite medical home for primary care. Worksite medical homes can improve chronic disease management and thus reduce ED visits and hospitalizations. These findings contribute to growing evidence that worksite medical homes are potentially cost-effective.

  8. New EdF's three challenges

    International Nuclear Information System (INIS)

    Lepetit, V.

    2005-01-01

    The opening of 15% of Electricite de France (EdF) capital to the private sector will allow the first world electric utility to raise 7 billions of euros of cash flow. EdF will have also to face the new European situation: a strained market, several consolidations to come and many competitors to deal with. EdF has to re-launch its production tool and to reinforce its interconnection capacities if it wants to stay the number one of power exports in Europe. The integration of Edison company (Italy) by EdF gives access to new gas capacities but other resources have to be found if EdF wants to enlarge its gas offer. A new concentration era is foreseen in Europe and EdF will have to seize the economic growth opportunities in particular in Europe and China. (J.S.)

  9. Nõukogude mood 1940. ja 50. aastatel / I. Andrejeva

    Index Scriptorium Estoniae

    Andrejeva, I.

    1985-01-01

    Sõjaaja riietusest, moejoonest. Moskva Moemajast (1949. aastast üleliiduline), moekunstnikke. Ajakirja "Zhurnal Mod" loomisest. 1940. aastate lõpuks kinnistunud moesuunast. Tegutsenud moemajad. Ajakirjas "Zhurnal Mod" (1954, nr. 2) väljakuulutatud kleidimudelite konkursi võitja - Melanie Kaarma, üks III preemia - Astrid Bulkina. S. Razumovskajalt artikkel "Eesti moekunstnikud" (Zhurnal Mod, 1954, nr. 3)

  10. "Universaalne valitsemisvahend": kaitseseisukord Eesti Vabariigis aastatel 1938-1940 / Peeter Kenkmann

    Index Scriptorium Estoniae

    Kenkmann, Peeter, 1977-

    2018-01-01

    Artiklis käsitletakse Eesti Vabariigis aastatel 1938-1940 kehtinud kaitseseisukorda. Kaitseseisukorrast 1938. aasta põhiseaduses ja kaitseseisukorra seaduses, poliitilise ühinemise seaduse eelnõust ning riigi julgeoleku ja avaliku korra seaduse eelnõust

  11. The emergence of sociology from political economy in the United States: 1890 to 1940.

    Science.gov (United States)

    Young, Cristobal

    2009-01-01

    Professional sociology in the U.S. began as a field area within economics, but gradually emerged as a separate discipline. Using new data on joint meetings and the separation of departments, I track interdisciplinary relations through three phases: sponsorship (1890-1905), collaboration (1905-1940), and disengagement (post-1940). In the early years, sociology was mostly a branch of economics departments. With the formation of the American Sociological Society, relations with economics began to be more characterized by professionally autonomous collaboration. The 1920s saw a large wave of sociology departments separating from economics. Still, joint annual meetings (including joint presidential addresses) remained the norm until 1940. Paradigmatic conflict between institutional and neoclassical economists was the major force that sustained the economics-sociology collaboration. As institutionalism faded from the scene in the late 1930s, so went interdisciplinary contact.

  12. Review: Donald Seekins: Burma and Japan since 1940. From ‘Co-Prosperity’ to ‘Quiet Dialogue’ (2008 Buchbesprechung: Donald Seekins: Burma and Japan since 1940. From ‘Co-Prosperity’ to ‘Quiet Dialogue’ (2008

    Directory of Open Access Journals (Sweden)

    Hans-Bernd Zöllner

    2009-04-01

    Full Text Available Review of the monograph: Donald Seekins: Burma and Japan since 1940. From ‘Co-Prosperity’ to ‘Quiet Dialogue’ Copenhagen: NIAS Press, 2008, ISBN 978 87 7694 017 1, 191 pages Besprechung der Monographie: Donald Seekins: Burma and Japan since 1940. From ‘Co-Prosperity’ to ‘Quiet Dialogue’ Kopenhagen: NIAS Press, 2008, ISBN 978 87 7694 017 1, 191 Seiten

  13. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  14. Londýn 1940, rodí se Československo-Polsko

    Czech Academy of Sciences Publication Activity Database

    Smetana, Vít; Němeček, J.; Ruczaj, M.; Kaiser, D.

    -, 9.10.2015 (2015), s. 26-29 ISSN 2336-4971 Institutional support: RVO:68378114 Keywords : Czechoslovakia * Poland * London Subject RIV: AB - History https://tydenik.echo24.cz/a/iLFD7/londyn-1940-rodi-se-ceskoslovensko-polsko

  15. Evolution of physics examining 1940-2000 at Cambridge

    Science.gov (United States)

    Roberts, A.; Brown, L. M.

    2001-07-01

    Much controversy exists about the supposed changing examination standards. Emphasis has been placed on the standards of GCSE and A-level examinations. However, many large employers recruit graduates, and so university examination standards also deserve attention. Here, Cambridge University Part II (third year undergraduate) examinations in Physics are studied since 1940. Trends in prescriptiveness, choice of questions, and other variables were found.

  16. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  17. Characterising non-urgent users of the emergency department (ED): A retrospective analysis of routine ED data.

    Science.gov (United States)

    O'Keeffe, Colin; Mason, Suzanne; Jacques, Richard; Nicholl, Jon

    2018-01-01

    The pressures of patient demand on emergency departments (EDs) continue to be reported worldwide, with an associated negative impact on ED crowding and waiting times. It has also been reported that a proportion of attendances to EDs in different international systems could be managed in settings such as primary care. This study used routine ED data to define, measure and profile non-urgent ED attendances that were suitable for management in alternative, non-emergency settings. We undertook a retrospective analysis of three years of Hospital Episode and Statistics Accident Emergency (HES A&E) data for one large region in England, United Kingdom (April 1st 2011 to March 31st 2014). Data was collected on all adult (>16 years) ED attendances from each of the 19 EDs in the region. A validated process based definition of non-urgent attendance was refined for this study and applied to the data. Using summary statistics non-urgent attenders were examined by variables hypothesised to influence them as follows: age at arrival, time of day and day of week and mode of arrival. Odds ratios were calculated to compare non-urgent attenders between groups. There were 3,667,601 first time attendances to EDs, of which 554,564 were defined as non-urgent (15.1%). Non-urgent attendances were significantly more likely to present out of hours than in hours (OR = 1.19, 95% CI: 1.18 to 1.20, Paged 16-44) compared to those aged 45-64 (odds ratio: 1.42, 95% CI: 1.41 to 1.43, Puse the ED to obtain healthcare that could be provided in a less urgent setting and also more likely to do this out of hours. Alternative services are required to manage non-urgent demand, currently being borne by the ED and the ambulance service, particularly in out of hours.

  18. EDS operator and control software

    International Nuclear Information System (INIS)

    Ott, L.L.

    1985-04-01

    The Enrichment Diagnostic System (EDS) was developed at Lawrence Livermore National Laboratory (LLNL) to acquire, display and analyze large quantities of transient data for a real-time Advanced Vapor Laser Isotope Separation (AVLIS) experiment. Major topics discussed in this paper are the EDS operator interface (SHELL) program, the data acquisition and analysis scheduling software, and the graphics software. The workstation concept used in EDS, the software used to configure a user's workstation, and the ownership and management of a diagnostic are described. An EDS diagnostic is a combination of hardware and software designed to study specific aspects of the process. Overall system performance is discussed from the standpoint of scheduling techniques, evaluation tools, optimization techniques, and program-to-program communication methods. EDS is based on a data driven design which keeps the need to modify software to a minimum. This design requires a fast and reliable data base management system. A third party data base management product, Berkeley Software System Database, written explicitly for HP1000's, is used for all EDS data bases. All graphics is done with an in-house graphics product, Device Independent Graphics Library (DIGLIB). Examples of devices supported by DIGLIB are: Versatec printer/plotters, Raster Technologies Graphic Display Controllers, and HP terminals (HP264x and HP262x). The benefits derived by using HP hardware and software as well as obstacles imposed by the HP environment are presented in relation to EDS development and implementation

  19. edX e-learning course development

    CERN Document Server

    Gilbert, Matthew A

    2015-01-01

    If you are an educator creating a course for edX or a corporate trainer using Open edX for large-scale learning and development initiatives, then edX E-Learning Course Development is the ideal book for you.

  20. Incidence, admission rates, and economic burden of pediatric emergency department visits for urinary tract infection: data from the nationwide emergency department sample, 2006 to 2011.

    Science.gov (United States)

    Sood, Akshay; Penna, Frank J; Eleswarapu, Sriram; Pucheril, Dan; Weaver, John; Abd-El-Barr, Abd-El-Rahman; Wagner, Jordan C; Lakshmanan, Yegappan; Menon, Mani; Trinh, Quoc-Dien; Sammon, Jesse D; Elder, Jack S

    2015-10-01

    The Emergency Department (ED) is being increasingly utilized as a pathway for management of acute conditions such as the urinary tract infections (UTIs). We sought to assess the contemporary trends in pediatric UTI associated ED visits, subsequent hospitalization, and corresponding financial expenditure, using a large nationally representative pediatric cohort. Further, we describe the predictors of admission following a UTI associated ED visit. The Nationwide Emergency Department Sample (NEDS; 2006-2011) was queried to assess temporal-trends in pediatric (age ≤17 years) ED visits for a primary diagnosis of UTI (ICD9 CM code 590.X, 595.0, and 599.0), subsequent hospital admission, and total charges. These trends were examined using the estimated annual percent change (EAPC) method. Multivariable regression models fitted with generalized estimating equations (GEE) identified the predictors of hospital admission. Of the 1,904,379 children presenting to the ED for management of UTI, 86 042 (4.7%) underwent hospital admission. Female ED visits accounted for almost 90% of visits and increased significantly (EAPC 3.28%; p = 0.003) from 709 visits per 100 000 in 2006 to 844 visits per 100 000 in 2011. Male UTI incidence remained unchanged over the study-period (p = 0.292). The overall UTI associated ED visits also increased significantly during the study-period (EAPC 3.14%; p = 0.006) because of the increase in female UTI associated ED visits. Overall hospital admissions declined significantly over the study-period (EAPC -5.59%; p = 0.021). Total associated charges increased significantly at an annual rate of 18.26%, increasing from 254 million USD in 2006 to 464 million USD in 2011 (p predictors of admission included younger age (p pediatric UTI is on the rise. This rise in incidence could be due to several factors, including increasing prevalence of metabolic conditions such as obesity, diabetes and metabolic syndrome in children predisposing them to infections, or

  1. [The Amazon Sanitation Plan (1940-1942)].

    Science.gov (United States)

    Andrade, Rômulo de Paula; Hochman, Gilberto

    2007-12-01

    The article addresses the Amazon Sanitation Plan and the political context in which it was formulated between 1940 and 1941. It examines the role of Getúlio Vargas, the activities of the plan's main protagonists (such as Evandro Chagas, João de Barros Barreto, and Valério Konder), its key proposals, and its demise as of 1942 upon creation of the Special Public Health Service (Sesp), which grew out of cooperation agreements between Brazil and the US following both nations' involvement in World War II. A reproduction of the Plan as published in the Arquivos de Higiene in 1941 is included.

  2. Endovenous laser therapy for occlusion of incompetent saphenous veins using 1940nm

    Science.gov (United States)

    Sroka, Ronald; Pongratz, Thomas; Esipova, Anna; Dikic, Slobodan; Demhasaj, Sahit; Comsa, Florin; Schmedt, Claus-Georg

    2015-07-01

    Objective: Several studies indicate that ELT using wavelengths of high water absorption showed advantages compared to conventional ELT. Thulium-Lasers emit nearby the local absorption maximum of water at 1940nm. In this clinical study the effectiveness, safety and the feasibility of 1940nm-ELT is proven. Materials and Method: A single centric, prospective observational study was performed. 1940nm-laserenergy was applied using radial emitting fibres with continuous pullback (1mm/s). Treatment was performed under anesthesia (general, spinal, tumescent) thus simultaneous miniphlebectomy and ligation of perforators could be applied. Patient and technical details were systematically collected. Evaluation included: standardized questionnaire, clinical examination, color-duplex ultrasonography preoperatively, 3d, 4w, 6m postoperatively, statistic. Results: The 1940nm-ELT study include 55 patients (female/men=34/21, mean age 55y, range 23-90y) treating n=72 vessels. The mean maximum diameter of great saphenous veins (GSV, n=59) was 7.5mm (range 3.7-11.3mm) and of small saphenous veins (SSV, n=13) was 5.3mm (3.0-10.0mm). The mean applied longitudinal endovenous energy density (LEED) was 64.3J/cm (40.3-98.2J/cm) in GSVs and 51.0J/cm (37.6-72.7J/cm) in SSVs. Complete occlusion of the vein without sign of reflux was achieved in 100%. The mean length of non-occluded stump at the sapheno-femoral junction was 6.0mm (1.0-20.0mm). Postoperative reduction of the diameter of GSV was 1.6mm (21.3%) and 2.0mm (37.7%) in SSV. One (1.4%) endovenous heat induced thrombus (EHIT) was observed. Further adverse events were: paresthesia 10/72 (13.9%), ecchymosis 1/72 (1.4%), lymphocele 1/72 (1.4%), hyperpigmentation 1/72 (1.4%). The mean postoperative pain intensity was 1.3 and 1.8 single doses of analgesics were administered. Normal physical activity was reached after 3d (1-21d). Conclusion: 1940nm-ELT using radial light application effectively eliminates the reflux in insufficient saphenous

  3. Tiit Kask, Aldur Vunk (Hrsg.): Reis (nõukogude) läände / Journey to the [Soviet] west. Kuurortlinn Pärnu 1940-88. Artiklite kogumik / Resort town of Pärnu 1940-88. Collection of articles, Pärnu: Pärnu Linnavalitsus 2009, 121 S., 97 Abb. / Andr

    Index Scriptorium Estoniae

    Fülberth, Andreas

    2011-01-01

    Raamatuarvustus: Reis (nõukogude) läände : kuurortlinn Pärnu 1940-88 : artiklite kogumik = Journey to the [Soviet] West : resort town of Pärnu during 1940-88 : collection of articles. Pärnu, 2009

  4. EdF: high tension(s) metamorphosis

    International Nuclear Information System (INIS)

    Roussely, F.; Arnoux, P.; Baritault, A.; Alto, P.; Castets, C.; Secondi, J.

    2003-01-01

    Electricite de France, the French electric utility, has to face a formidable mutation. The deregulation of the power market will lead to a social, commercial, judicial, financial and international 'big-bang'. The company has been weakened by disappointing results and by an embarrassing running into debts. This dossier analyzes the consequences of the deregulation of the French power market on the future evolution of EdF. It includes the analysis made by a French economist, E. Cohen, an interview and a portrait of F. Roussely, head of EdF, a presentation of Easenergy, a start-up of EdF which makes partnerships with US energy-related companies, the worries of EdF's employees and the redistribution of the syndicates power inside the company, the controversy around EdF's 2002 results and the points that remained in the shade, EdF's European competitors and the progressive opening of the French power market, EDF's production tool and its availability (58 nuclear reactors, 538 hydroelectric power plants and 26 thermal power plants), the costly foreign markets strategy of EdF and the under-capitalization of the company. (J.S.)

  5. Pioneering women in American mathematics the pre-1940 PhD's

    CERN Document Server

    Green, Judy

    2008-01-01

    More than 14 percent of the PhD's awarded in the United States during the first four decades of the twentieth century went to women, a proportion not achieved again until the 1980s. This book is the result of a study in which the authors identified all of the American women who earned PhD's in mathematics before 1940, and collected extensive biographical and bibliographical information about each of them. By reconstructing as complete a picture as possible of this group of women, Green and LaDuke reveal insights into the larger scientific and cultural communities in which they lived and worked. The book contains an extended introductory essay, as well as biographical entries for each of the 228 women in the study. The authors examine family backgrounds, education, careers, and other professional activities. They show that there were many more women earning PhD's in mathematics before 1940 than is commonly thought. Extended biographies and bibliographical information are available from the companion website fo...

  6. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  7. East Asian Regionalisms and Korea in the 1940’s

    Directory of Open Access Journals (Sweden)

    Byong Kwon Song

    2014-02-01

    Full Text Available This paper seeks to consider the various types of regionalisms in East Asia during the 1940’s, and Korea’s position in the United States’ “Great China Policy” and demilitarization and democratization plans for Japan. After World War II, although aspects of regionalism were formed by the Cold War in East Asia, the regional structure of Northeast Asia was originally formed from the ‘turn of the century’ through the Asian Pacific War. From the beginning of the 1940’s, Japan promoted the idea of a “Greater East Asia Co-prosperity Sphere” in order to justify its hegemonic position in the East Asian regional order. In addition, the United States and Japan’s readjustment plans appeared to be related to strategies regarding the regional order of East Asia. During World War II, the victorious U.S. had already become one of the world’s superpowers and by principle, collaboration between the superpowers (United States, Great Britain, China, and the Soviet Union revealed an initiative for a four country police state. Japan devised a survival strategy in the case of its defeat. During the war in the early 1940’s, these policies and plans were used to recognize Großraum around the East Asian region. This paper points out the significance of the 1940’s and the continuity between the awareness of the wartime situation and the prospective situation during the postwar period. During the 1940’s, three forms of regionalism in East Asia appeared. The first was Japan’s regional hegemony over the East Asian regional order. In order to preserve regional hegemony, Imperial Japan gave specific meaning to Korea as an extension of its own economy. The second is based on the United States as an offshore hegemonic power, which chose China as a subordinate partner within East Asia and used the division of labor through sub-horizontal industry based on an initiative to suppress Japan. In order to weaken the economic dominance of Japanese Empire

  8. The Mexican Army and Political Order Since 1940

    Science.gov (United States)

    1973-09-01

    especially those led by the Central Campesina Independiente (CCI) and Uni6n General de Obreros y Campesinos de Mexico (UGOI). More dramatically, the army has...civilian officials of the Finance Ministry, military officers m also now in charge of arms registration throughout the country, ns# head customs posts ...not be so inactive, nor the political system as highly demilitarized, as it often appears. For the post -1940 period, the historical depolit

  9. Eesti Vabariigi eriotstarbelised metsad perioodil 1918-1940 / Toivo Meikar

    Index Scriptorium Estoniae

    Meikar, Toivo, 1947-

    2013-01-01

    Riigi eriotstarbelisteks metsadeks loeti Eesti Vabariigis perioodil 1918-1940 väljaspool riigi metsavalitsust teiste riiklike institutsioonide halduses olevaid metsi. Suurimaks metsavaldajaks oli kaitseministeerium, teiseks suurimaks metsavaldajaks oli Tartu Ülikool, kellele anti õppe- ja katsemetskonna loomiseks 1912. a kasutada Kastre-Peravalla (Järvselja) 8439 ha suurune mets. Ka 1905. a. Vene metsaseadusest ning Eesti 1919. a. ja 1934. a. metsaseadustest

  10. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  11. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  12. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  13. Fire Severity Controlled Susceptibility to a 1940s Spruce Beetle Outbreak in Colorado, USA.

    Directory of Open Access Journals (Sweden)

    Dominik Kulakowski

    Full Text Available The frequency, magnitude, and size of forest disturbances are increasing globally. Much recent research has focused on how the occurrence of one disturbance may affect susceptibility to subsequent disturbances. While much has been learned about such linked disturbances, the strength of the interactions is likely to be contingent on the severity of disturbances as well as climatic conditions, both of which can affect disturbance intensity and tree resistance to disturbances. Subalpine forests in western Colorado were affected by extensive and severe wildfires in the late 19th century and an extensive and severe outbreak of spruce beetle (Dendroctonus rufipennis in the 1940s. Previous research found that most, but not all, of the stands that burned and established following the late 19th century fires were not susceptible to the 1940s outbreak as beetles preferentially attack larger trees and stands in advanced stages of development. However, previous research also left open the possibility that some stands that burned and established following the 19th century fires may have been attacked during the 1940s outbreak. Understanding how strongly stand structure, as shaped by disturbances of varying severity, affected susceptibility to past outbreaks is important to provide a baseline for assessing the degree to which recent climate change may be relaxing the preferences of beetles for larger trees and for stands in latter stages of structural development and thereby changing the nature of linked disturbances. Here, dendroecological methods were used to study disturbance history and tree age of stands in the White River National Forest in Western Colorado that were identified in historical documents or remotely-sensed images as having burned in the 19th century and having been attacked by spruce beetle in the 1940s. Dendroecological reconstructions indicate that in young post-fire stands only old remnant trees that survived the otherwise stand

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Matey Mateev (1940-2010)

    CERN Multimedia

    2010-01-01

    Matey Mateev and his wife Rumiana died in a car accident on 25 July. Mateev, who was born in 1940, was a major figure in Bulgarian physics and had very close ties with CERN. The Mateevs had two children –Dragomir and Iliana- and a granddaughter, born three days before they died.   The academic activities of Mateev -Mag, to his many friends- were centred around the St. Clement of Ohrid University of Sofia, from which he graduated in 1963, to become professor in 1984 and subsequently Head of Theoretical Physics, Dean of Physics and Vice-Rector. From 1980 onwards, without interruption, Mag led one of the University's most well-attended courses and was the students' favourite teacher. Mateev and the late Alexander (Sande) Donkov -another central figure at the University- wrote a book together on quantum mechanics, like so many physicists eventually do. Mag’s research ventured into high-temperature superconductivity, the growth of crystals in a micro-gravity environment and the ...

  16. Racial measurement and statistical field in Brazilian census (1872-1940: a convergent approach

    Directory of Open Access Journals (Sweden)

    Alexandre de Paiva Rio Camargo

    2009-12-01

    Full Text Available This paper investigates the meanings given by the racial classification in several Brazilian census. It proposes a convergent analysis of the social-political conventions established for the research (1872, 1890, 1940 or omission (1920 of the racial item of the surveys in different historical moments and the emergency of the technical community of statisticians in the midst of changing in paradigm census. As a method, it assumes a circularity between the social system of racial classification, the interpretations chapters on national identity hired to introduce the census – “O povo brasileiro e sua evolução” by Oliveira Vianna (1920, and “A cultura brasileira” by Fernando de Azevedo (1940 – and the role played by the technical requirements in the taken positions of the statisticians. The article analyzes the reports written by the census committees and organizers at the verbal level, in order to compare the arguments presented to the informations and crossings obtained in the matrix level. It takes the 1940 census as a turning point in the statistical activity because it reveals the structural conflict between the policy function primarily reserved for statistics and the consecration of the technical competence. Accordingly, this paper addresses the gradual release of statistical ideology from the political propaganda on the color.

  17. EDS becoms CERN Openlab contributor

    CERN Multimedia

    2007-01-01

    "EDS announced that it has become an official contributor to CERN openlab. The purpose of the joint project beteween CERN and EDS is to carry out research and development in the field of monitoring, management and operation of grid services." (1 page)

  18. RT-PCR Analysis of ED-A,ED-B, and IIICS Fibronectin Domains: A New Screening Marker For Bladder Cancer

    Directory of Open Access Journals (Sweden)

    M Ahmadi Javid

    2004-12-01

    Full Text Available Background: Fibronectin seems to play a very important role in the progression and invasion of bladder cancer. EDA, EDB, and IIICS domains of fibronectin are not expressed in the adult persons but they’re expressed in different cancers. The aim of this study is to investigate the mRNA of fibronectin in transitional carcinoma cells (TCC of bladder to study these domains. Methods: A total of 20 patients with known bladder cancer were studied. Two of them excluded since their excised tissues were not enough for both the pathological examination and RNA study. Another 20 (control group were normal volunteers who needed bladder operations. The excised tissue was immediately transferred to RNAlater (Ambion,TX. RNA was extracted via RNAWIZ (Ambion, TX. cDNA was made via RevertAid First Strand cDNA Synthesis Kit (Fermentas. PCR of the cDNAs was performed using primers for EDA, EDB, and IIICS (Eurogentec,Belgium. Results: For the first time, we present the expression of the oncofetal fibronectin mRNA in the transitional cell carcinoma of bladder. The high grade muscle invasive (G3T2 tumor, expressed ED-A, ED-B, and IIICS. Expression of ED-A, ED-B, and IIICS was confirmed in the two patients with G3T1 TCC. The four patients with G2Ta and G3Ta expressed both ED-A and ED-B. The four patients with G1T1 tumor expressed ED-A only, similar to the nine patients with G1Ta tumor. None of the normal volunteers expressed the oncofetal extra domains. The sensitivity of ED-A positive fibronectin RNA for detecting TCC of any kind is 100%, and of ED-B was only 35%. The specificity of ED-B positive fibronectin RNA for the high grade TCC is 100%. Conclusion: ED-A, ED-B, and IIICS could be used as useful markers for the diagnosis and following up of bladder carcinoma. Keywords: Transitional Cell Carcinoma, bladder cancer, fibronectin, RT-PCR, oncofetal.

  19. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  20. Risk of Fall-Related Injury due to Adverse Weather Events, Philadelphia, Pennsylvania, 2006-2011.

    Science.gov (United States)

    Gevitz, Kathryn; Madera, Robbie; Newbern, Claire; Lojo, José; Johnson, Caroline C

    Following a surge in fall-related visits to local hospital emergency departments (EDs) after a severe ice storm, the Philadelphia Department of Public Health examined the association between inclement winter weather events and fall-related ED visits during a 5-year period. Using a standardized set of keywords, we identified fall-related injuries in ED chief complaint logs submitted as part of Philadelphia Department of Public Health's syndromic surveillance from December 2006 through March 2011. We compared days when falls exceeded the winter fall threshold (ie, "high-fall days") with control days within the same winter season. We then conducted matched case-control analysis to identify weather and patient characteristics related to increased fall-related ED visits. Fifteen high-fall days occurred during winter months in the 5-year period. In multivariable analysis, 18- to 64-year-olds were twice as likely to receive ED care for fall-related injuries on high-fall days than on control days. The crude odds of ED visits occurring from 7:00 am to 10:59 am were 70% higher on high-fall days vs control days. Snow was a predictor of a high-fall day: the adjusted odds of snow before a high-fall day as compared with snow before a control day was 13.4. The association between the number of fall-related ED visits and weather-related fall injuries, age, and timing suggests that many events occurred en route to work in the morning. Promoting work closures or delaying openings after severe winter weather would allow time for better snow or ice removal, and including "fall risk" in winter weather advisories might effectively warn morning commuters. Both strategies could help reduce the number of weather-related fall injuries.

  1. Pätsi kiri Soome saadikule juulis 1940 / Hellar Grabbi, Konstantin Päts

    Index Scriptorium Estoniae

    Grabbi, Hellar, 1929-

    2005-01-01

    1940. aasta juulis koostatud märgukirja sarnast läkitust on hakatud kutsuma ka K. Pätsi poliitiliseks testamendiks. Kirja kohaletoimetamise lugu ja Ella Grabbi roll selles. Lisa: Konstantin Pätsi kiri. Lk. 91-92

  2. Genetics Home Reference: hereditary paraganglioma-pheochromocytoma

    Science.gov (United States)

    ... 295(6):628. Citation on PubMed Selak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

  3. A short history of the Australian College of Optometry 1940-2015.

    Science.gov (United States)

    Cole, Barry L

    2015-09-01

    This paper gives an account of the history of the Australian College of Optometry from its foundation in 1940 and its achievements in optometric education, research and clinical service over the ensuing 75 years. © 2015 The Authors. Clinical and Experimental Optometry © 2015 Optometry Australia.

  4. ¿Quedan indios en Colombia? El movimiento indigenista de 1940 a 1950

    Directory of Open Access Journals (Sweden)

    Jimena Perry

    2016-09-01

    Full Text Available Un grupo de intelectuales colombianos, influenciados por las ideas de Manuel Gamio sobre la integración y asimilación a la sociedad de los pueblos amerindios y las discusiones del Primer Congreso Interamericano en Pátzcuaro, México, 1940, decidieron seguir los pasos del Instituto Indigenista Interamericano y crear el Instituto Indigenista de Colombia en 1942. Aunque eran diferentes los contextos de México y Colombia durante este tiempo, los intelectuales colombianos intentaron aplicar las ideas indigenistas mexicanas en el país sin mucho éxito, porque las élites gobernantes estaban divididas sobre el tema de los grupos indígenas en la nación. Mi trabajo argumenta que el fracaso del Instituto colombiano se debió a una combinación de violencia, escasos recursos y la falta de conciencia de los políticos y las élites blancas sobre el problema indio en el país. Como resultado, el Instituto cerró temporalmente hasta 1958. Este texto subraya las influencias del movimiento indigenista mexicano en los proyectos indigenistas colombianos entre 1940 y 1950. Basada en periódicos y revistas colombianas, las cartas de los indigenistas colombianos encontradas en la Biblioteca Luis Ángel Arango, Bogotá, y documentos encontrados en la Nettie Lee Benson Latin American Collection de la Universidad de Texas en Austin, discuto por qué el indigenismo colombiano de la década 1940-1950 no prosperó.

  5. Women, feminism and social change in Argentina, Chile and Uruguay, 1980-1940

    Directory of Open Access Journals (Sweden)

    Guimoar Dueñas

    1996-01-01

    Full Text Available Asunción Lavrin. Women, feminism and social change in Argentina, Chile and Uruguay, 1890-1940. Lincoln and London: University of Nebraska Press, 1995, 481 páginas. Tercer volúmen de la serie Engendering Latin America.

  6. Hearing of Mr. Francois Roussely, President of EdF; Audition de M. Francois Roussely, President d'EdF

    Energy Technology Data Exchange (ETDEWEB)

    Roussely, F. [Electricite de France (EDF), 75 - Paris (France)

    2005-07-01

    This document is the proceedings of the hearing of F. Roussely, President of Electricite de France (EdF), at the commission of economic affairs of the French house of commons, about the advisability of the construction of the EPR (European pressurized reactor) demonstration plant and about its possible financing by EdF. In a first part, F. Roussely recalls the European context of deregulation of energy markets and its impact of the French electric power industry (opening of the French market, industrial and social actions of EdF, need of a new generation of nuclear reactor, preservation of EdF's energy mix, warranty of public utility, un-bundling between energy trade and distribution, EdF's turnover and profitability, EdF's foreign daughter companies). In a second part, F. Roussely answers a series of questions asked by the different members of the commission concerning the different points presented in the first part. (J.S.)

  7. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  8. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  9. Carlo Caso (1940 - 2007)

    CERN Multimedia

    Leonardo Rossi

    Carlo Caso (1940 - 2007) Our friend and colleague Carlo Caso passed away on July 7th, after several months of courageous fight against cancer. Carlo spent most of his scientific career at CERN, taking an active part in the experimental programme of the laboratory. His long and fruitful involvement in particle physics started in the sixties, in the Genoa group led by G. Tomasini. He then made several experiments using the CERN liquid hydrogen bubble chambers -first the 2000HBC and later BEBC- to study various facets of the production and decay of meson and baryon resonances. He later made his own group and joined the NA27 Collaboration to exploit the EHS Spectrometer with a rapid cycling bubble chamber as vertex detector. Amongst their many achievements, they were the first to measure, with excellent precision, the lifetime of the charmed D mesons. At the start of the LEP era, Carlo and his group moved to the DELPHI experiment, participating in the construction and running of the HPC electromagnetic c...

  10. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  11. Characterising non-urgent users of the emergency department (ED: A retrospective analysis of routine ED data.

    Directory of Open Access Journals (Sweden)

    Colin O'Keeffe

    Full Text Available The pressures of patient demand on emergency departments (EDs continue to be reported worldwide, with an associated negative impact on ED crowding and waiting times. It has also been reported that a proportion of attendances to EDs in different international systems could be managed in settings such as primary care. This study used routine ED data to define, measure and profile non-urgent ED attendances that were suitable for management in alternative, non-emergency settings.We undertook a retrospective analysis of three years of Hospital Episode and Statistics Accident Emergency (HES A&E data for one large region in England, United Kingdom (April 1st 2011 to March 31st 2014. Data was collected on all adult (>16 years ED attendances from each of the 19 EDs in the region. A validated process based definition of non-urgent attendance was refined for this study and applied to the data. Using summary statistics non-urgent attenders were examined by variables hypothesised to influence them as follows: age at arrival, time of day and day of week and mode of arrival. Odds ratios were calculated to compare non-urgent attenders between groups.There were 3,667,601 first time attendances to EDs, of which 554,564 were defined as non-urgent (15.1%. Non-urgent attendances were significantly more likely to present out of hours than in hours (OR = 1.19, 95% CI: 1.18 to 1.20, P<0.001. The odds of a non-urgent attendance were significantly higher for younger patients (aged 16-44 compared to those aged 45-64 (odds ratio: 1.42, 95% CI: 1.41 to 1.43, P<0.001 and the over 65's (odds ratio: 3.81, 95% CI: 3.78 to 3.85, P<0.001. Younger patients were significantly more likely to attend non-urgently out of hours compared to the 45-64's (OR = 1.24, 95% CI: 1.22 to 1.25, P<0.001 and the 65+'s (OR = 1.38, 95% CI: 1.35 to 1.40, P<0.001. 110,605/554,564 (19.9% of the non-urgent attendances arrived by ambulance, increasing significantly out of hours versus in hours (OR = 2

  12. Evolucion de la demanda Mexicana de importaciones: 1940-2009

    OpenAIRE

    Jose Romero

    2012-01-01

    El proposito de este trabajo es especificar y estimar una funcion agregada deimportaciones para Mexicoy discutir las implicaciones de politica de los resultados. La estimacionestabasada en datos trimestrales de importaciones reales, PIB real y precios relativos durante el periodo 1940-2009. En el analisisempirico de la demanda agregada de importaciones de Mexico se usan tecnicas de correccion de errores. En el estudio encontramos un quiebre estructural despues de 1982, lo que nos llevo a esti...

  13. Hand-held ultrasound serving three EDs.

    Science.gov (United States)

    2007-02-01

    Having a portable ultrasound available to your ED will enable you to perform scans during the nighttime hours, instead of having patients wait for several hours until the radiology department opens. Additional time can be saved by having a technologist read the scans, which frees your ED physicians for other duties. Having ED docs contact the technologist directly, rather than going through a resident, also saves valuable time. Arriving at a diagnosis more quickly provides a boost to patient safety.

  14. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  15. Cabaña ED

    Directory of Open Access Journals (Sweden)

    Lorena Troncoso Valencia

    2018-01-01

    Full Text Available Este proyecto denominado Cabaña Ed, de la arquitecta chilena Lorena Troncoso Valencia, es parte de una serie de obras emplazadas en la comuna de Pinto, Región de Ñuble de Chile. Zona de frondosa vegetación de árboles autóctonos y con fugas visuales hacia la cordillera de los Andes. La Cabaña Ed, donde predomina el uso de la madera, se integra muy sutilmente con ese entorno natural. Cabin ED, by the Chilean architect Lorena Troncoso Valencia, is part of a series of works located in the commune of Pinto, Ñuble Region, Chile. This area is characterized by lush vegetation of native trees and visual towards the Andes leaks. In this project the use of wood predominates, which is subtly integrated with the natural environment. In the edition of REVISTARQUIS 11, another project of the architect, located in that same zone of tourist development was presented.

  16. Biographical Sources in the Sciences--Life, Earth and Physical Sciences (1989-2006). LC Science Tracer Bullet. TB 06-4

    Science.gov (United States)

    Freitag, Ruth, Comp.; Bradley, Michelle Cadoree, Comp.

    2006-01-01

    This guide offers a systematic approach to the wide variety of published biographical information on men and women of science in the life, earth and physical sciences, primarily from 1989 to 2006, and complements Library of Congress Science Tracer Bullet "TB88-3" ("Biographical Sources in the Sciences," compiled 1988 [ED306074]) and "TB06-7"…

  17. Fire Severity Controlled Susceptibility to a 1940s Spruce Beetle Outbreak in Colorado, USA.

    Science.gov (United States)

    Kulakowski, Dominik; Veblen, Thomas T; Bebi, Peter

    2016-01-01

    The frequency, magnitude, and size of forest disturbances are increasing globally. Much recent research has focused on how the occurrence of one disturbance may affect susceptibility to subsequent disturbances. While much has been learned about such linked disturbances, the strength of the interactions is likely to be contingent on the severity of disturbances as well as climatic conditions, both of which can affect disturbance intensity and tree resistance to disturbances. Subalpine forests in western Colorado were affected by extensive and severe wildfires in the late 19th century and an extensive and severe outbreak of spruce beetle (Dendroctonus rufipennis) in the 1940s. Previous research found that most, but not all, of the stands that burned and established following the late 19th century fires were not susceptible to the 1940s outbreak as beetles preferentially attack larger trees and stands in advanced stages of development. However, previous research also left open the possibility that some stands that burned and established following the 19th century fires may have been attacked during the 1940s outbreak. Understanding how strongly stand structure, as shaped by disturbances of varying severity, affected susceptibility to past outbreaks is important to provide a baseline for assessing the degree to which recent climate change may be relaxing the preferences of beetles for larger trees and for stands in latter stages of structural development and thereby changing the nature of linked disturbances. Here, dendroecological methods were used to study disturbance history and tree age of stands in the White River National Forest in Western Colorado that were identified in historical documents or remotely-sensed images as having burned in the 19th century and having been attacked by spruce beetle in the 1940s. Dendroecological reconstructions indicate that in young post-fire stands only old remnant trees that survived the otherwise stand-replacing fires were

  18. On the quantitativeness of EDS STEM

    Energy Technology Data Exchange (ETDEWEB)

    Lugg, N.R. [Institute of Engineering Innovation, The University of Tokyo, 2-11-16, Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); Kothleitner, G. [Institute for Electron Microscopy and Nanoanalysis, Graz University of Technology, Steyrergasse 17, 8010 Graz (Austria); Centre for Electron Microscopy, Steyrergasse 17, 8010 Graz (Austria); Shibata, N.; Ikuhara, Y. [Institute of Engineering Innovation, The University of Tokyo, 2-11-16, Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan)

    2015-04-15

    Chemical mapping using energy dispersive X-ray spectroscopy (EDS) in scanning transmission electron microscopy (STEM) has recently shown to be a powerful technique in analyzing the elemental identity and location of atomic columns in materials at atomic resolution. However, most applications of EDS STEM have been used only to qualitatively map whether elements are present at specific sites. Obtaining calibrated EDS STEM maps so that they are on an absolute scale is a difficult task and even if one achieves this, extracting quantitative information about the specimen – such as the number or density of atoms under the probe – adds yet another layer of complexity to the analysis due to the multiple elastic and inelastic scattering of the electron probe. Quantitative information may be obtained by comparing calibrated EDS STEM with theoretical simulations, but in this case a model of the structure must be assumed a priori. Here we first theoretically explore how exactly elastic and thermal scattering of the probe confounds the quantitative information one is able to extract about the specimen from an EDS STEM map. We then show using simulation how tilting the specimen (or incident probe) can reduce the effects of scattering and how it can provide quantitative information about the specimen. We then discuss drawbacks of this method – such as the loss of atomic resolution along the tilt direction – but follow this with a possible remedy: precession averaged EDS STEM mapping. - Highlights: • Signal obtained in EDS STEM maps (of STO) compared to non-channelling signal. • Deviation from non-channelling signal occurs in on-axis experiments. • Tilting specimen: signal close to non-channelling case but atomic resolution is lost. • Tilt-precession series: non-channelling signal and atomic-resolution features obtained. • Associated issues are discussed.

  19. Transient data acquisition techniques under EDS

    International Nuclear Information System (INIS)

    Telford, S.

    1985-06-01

    This paper is the first of a series which describes the Enrichment Diagnostic System (EDS) developed for the MARS project at Lawrence Livermore National Laboratory. Although EDS was developed for use on AVLIS, the functional requirements, overall design, and specific techniques are applicable to any experimental data acquisition system involving large quantities of transient data. In particular this paper will discuss the techniques and equipment used to do the data acquisition. Included are what types of hardware are used and how that hardware (CAMAC, digital oscilloscopes) is interfaced to the HP computers. In this discussion the author will address the problems encountered and the solutions used, as well as the performance of the instrument/computer interfaces. The second topic the author will discuss is how the acquired data is associated to graphics and analysis portions of EDS through efficient real time data bases. This discussion will include how the acquired data is folded into the overall structure of EDS providing the user immediate access to raw and analyzed data. By example you will see how easily a new diagnostic can be added to the EDS structure without modifying the other parts of the system. 8 figs

  20. Geraldine Reymenants, Marie Elisabeth Belpaire. Gender en macht in het literaire veld 1900-1940

    Directory of Open Access Journals (Sweden)

    Monica Soeting

    2017-02-01

    Full Text Available Geraldine Reymenants, Marie Elisabeth Belpaire. Gender en macht in het literaire veld 1900-1940 (kadoc-studies 35; Leuven: Universitaire Pers Leuven, 2013, 288 pp., isbn 9789058679444.

  1. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  2. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  3. 8. armee ületab erikäsuga määratud päeval riigipiiri ja tungib peale... : dokumente Eesti sõjalisest okupeerimisest 1940. aasta suvel / Tõnu Tannberg, Enn Tarvel

    Index Scriptorium Estoniae

    Tannberg, Tõnu, 1961-

    2006-01-01

    Balti riikide vastu suunatud otsestest sõjalistest ettevalmistustest NSV Liidus alates 1939. a. septembrist kuni 1940. aasta okupatsioonini Venemaa arhiividest pärit dokumentide alusel. Lisa: NSV Liidu kaitse rahvakomissari direktiiv nr. 02622 9. juunist 1940. aastast Balti Laevastiku lahinguvalmidusse seadmiseks ; Lahingukäsk Punaarmee 8. armeele 13. juunist 1940 Eesti vallutamiseks ; Käsk Punaarmee 8. armee vägedele 22. juunist 1940 asuda lahinguvalmidusse Tartu linnas ; Lahingukäsk Punaarmee 8. armee laskurpolgule 14. juulil 1940 võimalike vastuhakkamiste mahasurumiseks Riigivolikogu valimiste puhul Pärnu- ja Läänemaal

  4. Transposable Element Junctions in Marker Development and Genomic Characterization of Barley

    Czech Academy of Sciences Publication Activity Database

    Mazaheri, M.; Kianian, P.M.A.; Mergoum, M.; Valentini, G.L.; Seetan, R.; Pirseyedi, S.M.; Kumar, A.; Gu, Y.Q.; Stein, N.; Kubaláková, Marie; Doležel, Jaroslav; Denton, A.M.; Kianian, S.F.

    2014-01-01

    Roč. 7, č. 1 (2014) ISSN 1940-3372 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional support: RVO:61389030 Keywords : CHROMOSOME 3B * BREAD WHEAT * EVOLUTION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.933, year: 2014

  5. MicroED data collection and processing

    Energy Technology Data Exchange (ETDEWEB)

    Hattne, Johan; Reyes, Francis E.; Nannenga, Brent L.; Shi, Dan; Cruz, M. Jason de la [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147 (United States); Leslie, Andrew G. W. [Medical Research Council Laboratory of Molecular Biology, Cambridge (United Kingdom); Gonen, Tamir, E-mail: gonent@janelia.hhmi.org [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147 (United States)

    2015-07-01

    The collection and processing of MicroED data are presented. MicroED, a method at the intersection of X-ray crystallography and electron cryo-microscopy, has rapidly progressed by exploiting advances in both fields and has already been successfully employed to determine the atomic structures of several proteins from sub-micron-sized, three-dimensional crystals. A major limiting factor in X-ray crystallography is the requirement for large and well ordered crystals. By permitting electron diffraction patterns to be collected from much smaller crystals, or even single well ordered domains of large crystals composed of several small mosaic blocks, MicroED has the potential to overcome the limiting size requirement and enable structural studies on difficult-to-crystallize samples. This communication details the steps for sample preparation, data collection and reduction necessary to obtain refined, high-resolution, three-dimensional models by MicroED, and presents some of its unique challenges.

  6. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  7. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  8. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  9. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  10. Land use change (1940-2004) in six aquifer regions in Zacatecas, Mexico

    Science.gov (United States)

    In the years from 1940 to 1970, the development of the State of Zacatecas was based on extractive mining activities to sustain development. From 1965 and 1980, the attention turned agriculture, particularly to development of groundwater resources for irrigation. Due to the lack of a long-term plan f...

  11. Group Member or Outsider: Perceptions of Undergraduates with Disabilities on Leisure Time Physical Activity

    Science.gov (United States)

    Devine, Mary Ann

    2013-01-01

    College provides students with many opportunities to achieve academic success and enrich other aspects of their lives. Participating in campus activities can reduce stress, create social connections, promote healthy active living, and broaden civic engagement (Lindsey & Sessoms, 2006; Watson, Ayers, Zizzi, & Naoi, 2006). Studies noting…

  12. ED leadership competency matrix: an administrative management tool.

    Science.gov (United States)

    Propp, Douglas A; Glickman, Seth; Uehara, Dennis T

    2003-10-01

    A successful ED relies on its leaders to master and demonstrate core competencies to be effective in the many arenas in which they interact and are responsible. A unique matrix model for the assessment of an ED leadership's key administrative skill sets is presented. The model incorporates capabilities related to the individual's cognitive aptitude, experience, acquired technical skills, behavioral characteristics, as well as the ability to manage relationships effectively. Based on the personnel inventory using the matrix, focused evaluation, development, and recruitment of ED key leaders occurs. This dynamic tool has provided a unique perspective for the evaluation and enhancement of overall ED leadership performance. It is hoped that incorporation of such a model will similarly improve the accomplishments of EDs at other institutions.

  13. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  14. TechEdSat

    Data.gov (United States)

    National Aeronautics and Space Administration — TechEdSat is a 1U CubeSat built by San Jose State University in partnership with NASA Ames Research Center and AAC Microtec. Its mission is to evaluate Space...

  15. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  16. TechEdSat Nano-Satellite Series Fact Sheet

    Science.gov (United States)

    Murbach, Marcus; Martinez, Andres; Guarneros Luna, Ali

    2014-01-01

    TechEdSat-3p is the second generation in the TechEdSat-X series. The TechEdSat Series uses the CubeSat standards established by the California Polytechnic State University Cal Poly), San Luis Obispo. With typical blocks being constructed from 1-unit (1U 10x10x10 cm) increments, the TechEdSat-3p has a 3U volume with a 30 cm length. The project uniquely pairs advanced university students with NASA researchers in a rapid design-to-flight experience lasting 1-2 semesters.The TechEdSat Nano-Satellite Series provides a rapid platform for testing technologies for future NASA Earth and planetary missions, as well as providing students with an early exposure to flight hardware development and management.

  17. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  18. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  19. Nitrogen accumulation profiles of selected grain and vegetable crops: A bibliography (1940-1992)

    Energy Technology Data Exchange (ETDEWEB)

    Meischen, S.J.; Byrd, K.R.

    1994-10-01

    A bibliography of nitrogen accumulation profile data for 25 vegetable and grain crops reported between 1940 and 1992 is presented. The selected crops are asparagus, broccoli, brussels sprouts, cabbage, carrots, cauliflower, celery, corn, cotton, cucumber, field bean, field pea, garlic, lettuce, onions, and peppers.

  20. Flags, funerals and fanfares : Herero and missionary contestations of the acceptable, 1900-1940

    NARCIS (Netherlands)

    Gewald, J.B.

    2002-01-01

    This article describes the contested relationship that existed between the Herero and German missionaries in Namibia between 1900 and 1940. It argues that Herero converted to Christianity with specific aims and intentions, which were not necessarily the same as those envisaged or intended by German

  1. Nuclear safety and radiation protection report of EdF's Tricastin operational hot base nuclear facilities (BCOT) - 2010

    International Nuclear Information System (INIS)

    2011-06-01

    This safety report was established under the article 21 of the French law no. 2006-686 of June 13, 2006 relative to nuclear safety and information transparency. It presents, first, the Tricastin operational hot base facility (INB no. 157, Bollene, Vaucluse (FR)), a nuclear workshop for storage and maintenance and qualification operations on some EdF equipments. Then, the nuclear safety and radiation protection measures taken regarding the facility are reviewed: nuclear safety definition, radiation protection of intervening parties, safety and radiation protection improvement paths, crisis management, external and internal controls, technical situation of facilities, administrative procedures in progress. The incidents and accidents which occurred in 2010, if some, are reported as well as the effluents discharge in the environment. Finally, The radioactive materials and wastes generated by the facility is presented and sorted by type of waste, quantities and type of conditioning. The document concludes with a glossary and a list of recommendations from the Committees for health, safety and working conditions. (J.S.)

  2. Geographic Information System (GIS) characterization of Perdido Bay historical seagrass coverage, 1940 (NODC Accession 0000604)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — GIS representations of 1940 Historical seagrass coverage in Perdido Bay from United States Geological Survey/National Wetlands Research Center (USGS/NWRC).

  3. The ED use and non-urgent visits of elderly patients.

    Science.gov (United States)

    Gulacti, Umut; Lok, Ugur; Celik, Murat; Aktas, Nurettin; Polat, Haci

    2016-12-01

    To evaluate the use of the emergency department (ED) by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patients was higher than their representation within the general population (p elderly patients visiting polyclinics was 15.8%, the rate of elderly patients visiting the ED was 24.3% (p elderly age groups (p elderly population (17.5%, CI: 17.1-17.9). The proportion of ED visits for non-urgent conditions was 23.4%. Most of the ED visits were during the non-business hours (51.1%), and they were highest in the winter season (25.9%) and in January (10.2%). The hospitalization rate was 9.4%, and 37.9% of hospitalized patients were admitted to intensive care units. The proportion of ED visits by elderly patients was higher than their representation within the general population. Elderly patients often visited the ED instead of a polyclinic. The rate of inappropriate ED use by elderly patients in this hospital was higher than in other countries.

  4. Are there any indians left in Colombia? The indigenista movement from 1940 to 1950

    Directory of Open Access Journals (Sweden)

    Jimena Perry

    2016-09-01

    Full Text Available This paper examines the creation of the Colombian Indigenista Institute, CII (1942, its institutional history, and its closure (1949. The CII, influenced by the Mexican indigenista movement, fought for indigenous peoples’ visibility for eight years. In the end, however, the CII failed due to a combination of internal factors such as ideological disagreements, and internal ones, including violence, scarce resources, and lack of awareness on the part of politicians and elites about the status, challenges, and even existence of Amerindian groups in Colombia. Three Colombian scholars created the CII. They attended the First Inter-American Indigenista Congress (Pátzcuaro 1940 where they got in touch with Manuel Gamio, then director of the Interamerican Indigenista Institute. Gamio´s ideas —that Indians have the right to govern themselves, to have tribal organizations, to elect their community leaders, and to maintain and assert their cultural identity— inspired the Colombians. In this paper, I trace the influences of the Mexican indigenista movement on Colombian indigenismo projects between 1940 and 1950. I draw on a variety of sources including Colombian newspapers and magazines, as well as letters of the indigenistas housed at the Colombian library Luis Ángel Arango in Bogotá and the Nettie Lee Benson Latin American Collection at the University of Texas at Austin. I conclude by explaining why Colombian indigenismo of the decade between 1940 and 1950 ultimately failed.

  5. ED breast cases and other breast emergencies.

    Science.gov (United States)

    Khadem, Nasim; Reddy, Sravanthi; Lee, Sandy; Larsen, Linda; Walker, Daphne

    2016-02-01

    Patients with pathologic processes of the breast commonly present in the Emergency Department (ED). Familiarity with the imaging and management of the most common entities is essential for the radiologist. Additionally, it is important to understand the limitations of ED imaging and management in the acute setting and to recognize when referrals to a specialty breast center are necessary. The goal of this article is to review the clinical presentations, pathophysiology, imaging, and management of emergency breast cases and common breast pathology seen in the ED.

  6. Uranium from German nuclear projects of the 1940ies. A nuclear forensic study; Uran aus deutschen Nuklearprojekten der 1940er Jahre. Eine nuklearforensische Untersuchung

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, Klaus; Wallenius, Maria; Luetzenkirchen, Klaus [European Comission, Joint Research Centre (JRC), Karlsruhe (Germany). Inst. for Transuranium Elements (ITU); and others

    2015-11-02

    In the 1940ies in Germany studies using uranium in different geometries were started. Using the isotope ration Th-230/U-234 it was possible to determine the materials used in 1949-1943.The geographic origin was determined from trace amounts of rare earths. The uranium used in German research projects came from Czech uranium mines. Traces of U-236 and Pu-236 were found corresponding to the normal occurrence. This fact indicates that no significant neutron irradiation has occurred.

  7. THE FIRST CONTACT WITH MODERNITY IN THE TURKISH PAINTING: 1940-1960

    Directory of Open Access Journals (Sweden)

    Seyfi BAŞKAN

    2014-11-01

    Full Text Available Although 1920’s and 1930’s were the most important years of the westernization/innovation process for the Republican period Turkish community, the ‘comparability’ of the developments in this subject with the originated ‘West’, and its expanding to the larger public layers has happened during the period starting in mid-1940’s until 1960. Especially during these years, the connection with the modernism made by the official idealism of the government had the artists gain a feeling of an unprecedented importance, power and a great mission, unlike the impotence feeling the artist had in the later periods of the Republican era. In the art environment of the period which has gained its ‘form’ with the demands of the public authority just like in the 1930’s, the political and ideological burden of the artists for the creation of a ‘modern’ society have become important and great. Although the pictographic excitement and aesthetic creation levels have been under the art environment or artist’s general artistic level because of the plain expressivity burdened by these paintings which have their message part outweighs; because of various reasons, in these periods an important part of the artists have fulfilled their job as witnessing the history by reflecting the social – political and cultural aura of their period in their paintings. But beside this, they have made the first experiments of the ‘new trends’ enabled by the abstract painting, without excluding the figurative painting. With this concept the years of 1940-1960 have also become a period in which the ‘modernism’ has been interpreted without being ‘quotation’. The conditions and principles of the modern Turkish art environment, which is in an effort to exceed the very aspirated, style boundaries of the present day, are also had been grounded in the intellectual environment of the years between 1940-1960.

  8. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  9. Teaching in Catholic Schools from the Perspectives of Lay Teachers, 1940-1980

    Science.gov (United States)

    Cloud, Natalie

    2017-01-01

    This paper seeks to address a gap in the literature regarding lay teachers and their role and status within Catholic schools, studies have been carried out investigating this from the perspective of teaching religious and the Catholic Church but have yet to fully investigate this from the lay teachers' perspectives themselves. The period 1940-1980…

  10. Worker radiation doses in the United States at the dawn of the atomic era (1940--1960)

    International Nuclear Information System (INIS)

    Strom, D.J.; Smith, M.H.; Swinth, K.L.; Pettengill, H.J.

    1994-06-01

    Radiation doses to workers at the Manhattan Engineer District (MED) and US Atomic Energy Commission (AEC) sites due to external irradiation during 1940--1960 are reviewed. Categorized radiation dose data were available from AEC annual reports for some years. Annual individual radiation dose data for ten MED/AEC sites for all years were available from the US Department of Energy's (DOE) Comprehensive Epidemiologic Data Resource (CEDR). These data are combined to produce an estimate of external collective dose equivalent to 172,000 person-rems (1720 person-Sv) for 1940--1960. During this period there were 41 overexposures, 19 criticality incidents, and 3 deaths due to acute radiation syndrome among several hundred thousand workers

  11. ’Pure jazz’ and ‘charlatanry’: a history of De Jazzwereld Magazine, 1931-1940.

    NARCIS (Netherlands)

    van de Leur, W.

    2012-01-01

    One of the world’s first periodicals dedicated to jazz, the Dutch magazine De Jazzwereld (1931-1940) displays a fascinating history that documents stylistic changes in the music and sheds light on the culture’s evolving views regarding authenticity and popularity.

  12. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  13. South African Journal of Sports Medicine - Vol 26, No 1 (2014)

    African Journals Online (AJOL)

    The prevalence of self-reported neck pain in rugby union players in Gauteng Province · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. ED Watson, R-L Hodge, M Gekis, 26-30. http://dx.doi.org/10.7196/sajsm.512 ...

  14. Erectile Dysfunction (ED)

    Science.gov (United States)

    ... Talking to Your Kids About VirginityTalking to Your Kids About Sex Home Diseases and Conditions Erectile Dysfunction (ED) Condition ... Well-Being Mental Health Sex and Birth Control Sex and Sexuality Birth Control ... and Toddlers Kids and Teens Pregnancy and Childbirth Women Men Seniors ...

  15. Erwin van Loo, ‘Eenige wakkere jongens’. Nederlandse oorlogsvliegers in de Britse luchtstrijdkrachten, 1940-1945

    Directory of Open Access Journals (Sweden)

    Marc Dierikx

    2016-11-01

    Full Text Available Erwin van Loo, ‘Eenige wakkere jongens’. Nederlandse oorlogsvliegers in de Britse luchtstrijdkrachten, 1940-1945 (Proefschrift Universiteit van Amsterdam 2013; Amsterdam: Boom, 2013, 515 pp., isbn 978 94 6105 926 0.

  16. Structure of catalase determined by MicroED

    Science.gov (United States)

    Nannenga, Brent L; Shi, Dan; Hattne, Johan; Reyes, Francis E; Gonen, Tamir

    2014-01-01

    MicroED is a recently developed method that uses electron diffraction for structure determination from very small three-dimensional crystals of biological material. Previously we used a series of still diffraction patterns to determine the structure of lysozyme at 2.9 Å resolution with MicroED (Shi et al., 2013). Here we present the structure of bovine liver catalase determined from a single crystal at 3.2 Å resolution by MicroED. The data were collected by continuous rotation of the sample under constant exposure and were processed and refined using standard programs for X-ray crystallography. The ability of MicroED to determine the structure of bovine liver catalase, a protein that has long resisted atomic analysis by traditional electron crystallography, demonstrates the potential of this method for structure determination. DOI: http://dx.doi.org/10.7554/eLife.03600.001 PMID:25303172

  17. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  18. The ED use and non-urgent visits of elderly patients

    Directory of Open Access Journals (Sweden)

    Umut Gulacti

    2016-12-01

    Full Text Available Objective: To evaluate the use of the emergency department (ED by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. Methods: This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. Results: A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patients was higher than their representation within the general population (p < 0.001. While the rate of elderly patients visiting polyclinics was 15.8%, the rate of elderly patients visiting the ED was 24.3% (p < 0.001. For both genders, the rates of ED visits for patients between 65 and 74 years old was higher than for other elderly age groups (p < 0.001. The prevalence of upper respiratory tract infection (URTI was the highest within the elderly population (17.5%, CI: 17.1–17.9. The proportion of ED visits for non-urgent conditions was 23.4%. Most of the ED visits were during the non-business hours (51.1%, and they were highest in the winter season (25.9% and in January (10.2%. The hospitalization rate was 9.4%, and 37.9% of hospitalized patients were admitted to intensive care units. Conclusion: The proportion of ED visits by elderly patients was higher than their representation within the general population. Elderly patients often visited the ED instead of a polyclinic. The rate of inappropriate ED use by elderly patients in this hospital was higher than in other countries. Keywords: Non-urgent, Prevalence, Visit, Main disease, Elderly patient, Emergency department

  19. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  20. Examination of US puberty-timing data from 1940 to 1994 for secular trends

    DEFF Research Database (Denmark)

    Euling, Susan Y; Herman-Giddens, Marcia E; Lee, Peter A

    2008-01-01

    different methods. As a result, conclusions from data comparisons have not been consistent. An expert panel was asked to evaluate the weight of evidence for whether the data, collected from 1940 to 1994, are sufficient to suggest or establish a secular trend in the timing of puberty markers in US boys...

  1. Siam and the League of Nations : modernization, sovereignty, and multilateral diplomacy, 1920-1940

    NARCIS (Netherlands)

    Hell, Stefan Matthias

    2007-01-01

    This study analyses the relations between Siam and the League of Nations from 1920 to 1940. It identifies Siam’s policy towards the League as a cornerstone of Siam’s foreign policy and an important element of Siam’s domestic modernization during the sixth, seventh and eighth reigns of the Chakri

  2. Hearing of Mr. Francois Roussely, President of EdF

    International Nuclear Information System (INIS)

    Roussely, F.

    2005-01-01

    This document is the proceedings of the hearing of F. Roussely, President of Electricite de France (EdF), at the commission of economic affairs of the French house of commons, about the advisability of the construction of the EPR (European pressurized reactor) demonstration plant and about its possible financing by EdF. In a first part, F. Roussely recalls the European context of deregulation of energy markets and its impact of the French electric power industry (opening of the French market, industrial and social actions of EdF, need of a new generation of nuclear reactor, preservation of EdF's energy mix, warranty of public utility, un-bundling between energy trade and distribution, EdF's turnover and profitability, EdF's foreign daughter companies). In a second part, F. Roussely answers a series of questions asked by the different members of the commission concerning the different points presented in the first part. (J.S.)

  3. The ED use and non-urgent visits of elderly patients

    OpenAIRE

    Gulacti, Umut; Lok, Ugur; Celik, Murat; Aktas, Nurettin; Polat, Haci

    2016-01-01

    Objective: To evaluate the use of the emergency department (ED) by elderly patients, their non-urgent visits and the prevalence of main disease for ED visits. Methods: This cross-sectional study was conducted on patients aged 65 years and over who visited the ED of a tertiary care university hospital in Turkey between January 2015 and January 2016 retrospectively. Results: A total of 36,369 elderly patients who visited the ED were included in the study. The rate of ED visits by elderly patien...

  4. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  5. Viktor Hamburger's Department of Zoology in the 1940s: a student perspective.

    Science.gov (United States)

    Wenger, B S; Wenger, E

    2001-04-01

    Eleanor and Byron Wenger were graduate students in the Department of Zoology in the 1940s. Both took several courses with Viktor, and he was thesis advisor for both of us. We have attempted to provide a summary of life in the department from a student perspective as well as our impression of Viktor's style of mentoring and guiding student research and education.

  6. The Impact of "ED" on Educational Research.

    Science.gov (United States)

    Florio, David H.

    1980-01-01

    The purposes, structure, and component parts of the newly formed Department of Education (ED) organizations from which educational research programs will be administered are discussed. As the climate surrounding ED changes, opportunities to take advantage of the elevated status of research will be presented. (Author/RL)

  7. Emergency Department (ED, ED Observation, Day Hospital, and Hospital Admissions for Adults with Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    Susan Silva

    2018-02-01

    Full Text Available Introduction: Use of alternative venues to manage uncomplicated vaso-occlusive crisis (VOC, such as a day hospital (DH or ED observation unit, for patients with sickle cell anemia, may significantly reduce admission rates, which may subsequently reduce 30-day readmission rates. Methods: In the context of a two-institution quality improvement project to implement best practices for management of patients with sickle cell disease (SCD VOC, we prospectively compared acute care encounters for utilization of 1 emergency department (ED; 2 ED observation unit; 3 DH, and 4 hospital admission, of two different patient cohorts with SCD presenting to our two study sites. Using a representative sample of patients from each institution, we also tabulated SCD patient visits or admissions to outside hospitals within 20 miles of the patients’ home institutions. Results: Over 30 months 427 patients (297 at Site 1 and 130 at Site 2 initiated 4,740 institutional visits, totaling 6,627 different acute care encounters, including combinations of encounters. The range of encounters varied from a low of 0 (203 of 500 patients [40.6%] at Site 1; 65 of 195 patients [33.3%] at Site 2, and a high of 152 (5/month acute care encounters for one patient at Site 2. Patients at Site 2 were more likely to be admitted to the hospital during the study period (88.4% vs. 74.4%, p=0.0011 and have an ED visit (96.9% vs. 85.5%, p=0.0002. DH was used more frequently at Site 1 (1.207 encounters for 297 patients at Site 1, vs. 199 encounters for 130 patients at Site 2, and ED observation was used at Site 1 only. Thirty-five percent of patients visited hospitals outside their home academic center. Conclusion: In this 30-month assessment of two sickle cell cohorts, healthcare utilization varied dramatically between individual patients. One cohort had more hospital admissions and ED encounters, while the other cohort had more day hospital encounters and used a sickle cell disease

  8. Het Nationaal Arbeids-Secretariaat 1893-1940 : De geschiedenis van de eerste vakcentrale in Nederland

    NARCIS (Netherlands)

    Hoekman, P.H.; Houkes, J.

    2015-01-01

    This study analyses the development of the founding, growth and downfall of the Nationaal Arbeids-Secretariaat (NAS), the National Labour Secretariat, the first national confederation of trade union federations in the Netherlands, between 1893 and 1940. The foundation of the NAS resulted from the

  9. A Vision System Model

    Science.gov (United States)

    1991-06-01

    Away" in Mind and Cognition: A Reader. Ed. William G. Lycan. Cambridge MA: Basil Blackwell. Pp. 63-77. (1990c). Descartes , Rene . Rules for the Direction...other case, we accept that we cannot or need not understand the methods of the brain [behaviorism - Watson; Dualism - Descartes ; Intentionalism

  10. CHAPTER 1

    African Journals Online (AJOL)

    Dr Olaleye

    1Department of Physiotherapy, Faculty of College Allied Health Sciences, Bayero University, Kano, Nigeria ... motor recovery on QoL of Nigerian stroke survivors in the acute and sub-acute stages of recovery is .... instruments include the World Health Organization .... Preedly VR and Ronald R Watson (eds) Handbook of.

  11. Hormone Stories in Argentina.Obesity in children and early diagnosis of pregnancy in the 1930s and 1940s

    Directory of Open Access Journals (Sweden)

    Cecilia Rustoyburu

    2015-09-01

    Full Text Available This article inquires, from a gender perspective, knowledge production about hormones in Argentina, between the years 1930-1940. We understand that a historical analysis of scientific ideas and clinical practices allows explore how they involved on the social scenario which they belong, plus the institutional contexts where they are elaborated. We will focus on endocrinologist's Hospital de Niños de Buenos Aires perspective about obesity on childhood, and adipose genital síndrome, andearly diagnosis of pregnancy and chorionic gonadotropin hormone in the 1930s and 1940s

  12. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  13. EDS Coal Liquefaction Process Development. Phase V. Laboratory evaluation of the characteristics of EDS Illinois bottoms

    Energy Technology Data Exchange (ETDEWEB)

    Lao, T C; Levasseur, A A

    1984-02-01

    This interim report documents work carried out by Combustion Engineering, Inc. under a contract to Exxon Research and Engineering Company to develop a conceptual Hybrid Boiler design fueled by the vacuum distillation residue (vacuum bottoms) derived from Illinois No. 6 coal in the EDS Coal Liquefaction Process. This report was prepared by Combustion Engineering, Inc., and is the first of two reports on the predevelopment phase of the Hybrid Boiler program. This report covers the results of a laboratory investigation to assess the fuel and ash properties of EDS vacuum bottoms. The results of the laboratory testing reported here were used in conjunction with Combustion Engineering's design experience to predict fuel performance and to develop appropriate boiler design parameters. These boiler design parameters were used to prepare the engineering design study reported in EDS Interim Report FE-2893-113, the second of the two reports on the predevelopment phase of the Hybrid Boiler Program. 46 figures, 29 tables.

  14. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  15. The US Business Cycle, 1867-2006 : A Dynamic Factor Approach

    NARCIS (Netherlands)

    Ritschl, Albrecht; Sarferaz, Samad; Uebele, Martin

    We estimate a Stock/Watson index of economic activity to assess U.S. business cycle volatility since 1867. We replicate the Great Moderation of the 1980s and 1990s and find exceptionally low volatility also in the Golden Age of the 1960s. Postwar moderation relative to pre-1914 occurs under constant

  16. 'Transatlantic Print Culture, 1880-1940: Emerging Media, Emerging Modernisms', edited by Ann Ardis and Patrick Collier

    Directory of Open Access Journals (Sweden)

    Janet Floyd

    2009-11-01

    Full Text Available A review of 'Transatlantic Print Culture, 1880-1940: Emerging Media, Emerging Modernisms', edited by Ann Ardis and Patrick Collier (London: Palgrave Macmillan, 2008. Hardback, 259 pages, £50, ISBN 9780554269.

  17. Carbon trends. July 2006; Tendances carbone. Juillet 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-15

    This newsletter makes a monthly synthesis of the European CO{sub 2} market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from June 2005 to June 2006), economic activity indicators (industrial production index from April 2005 to April 2006), confidence index of business leaders (from June 2005 to June 2006), changes in energy prices (from July 2005 to June 2006), CO{sub 2} quotas allocated to European Union countries and detailed indicators of CO{sub 2} market, climate, economic activity and energy prices. (J.S.)

  18. Carbon trends. May 2006; Tendances carbone. Mai 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-05-15

    This newsletter makes a monthly synthesis of the European CO{sub 2} market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from May 2005 to April 2006), economic activity indicators (industrial production from February 2005 to February 2006), confidence index of business leaders (from April 2005 to April 2006), changes in energy prices (from May 2005 to April 2006), CO{sub 2} quotas allocated to European Union countries and detailed indicators of CO{sub 2} market, climate, economic activity and energy prices. (J.S.)

  19. Carbon trends. June 2006; Tendances carbone. Juin 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-06-15

    This newsletter makes a monthly synthesis of the European CO{sub 2} market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from June 2005 to May 2006), economic activity indicators (industrial production from March 2005 to March 2006), confidence index of business leaders (from May 2005 to May 2006), changes in energy prices (from June 2005 to May 2006), CO{sub 2} quotas allocated to European Union countries and detailed indicators of CO{sub 2} market, climate, economic activity and energy prices. (J.S.)

  20. Ed overcrowding – matematic models for integrated solutions and decisions

    OpenAIRE

    ROTARU, LUCIANA TEODORA; BĂNICIOIU - COVEI, MIHAI

    2017-01-01

    Dear Editor In Chief, We are writing to You in line with an very interesting point of view regarding the Emergency Department (ED) development. The paper titled Improving Emergency Department Capacity Efficiency, published in your Journal 2016; 12(1): 52- 57, as an original articles, spotlight solution for ED crowding. So we are proposing a mathematics models for reciprocal accommodation of patients flows to the response capacity of the ED. ED overcrowding ...

  1. Demographic knowledge and nation-building: the Peruvian census of 1940.

    Science.gov (United States)

    López, Raúl Necochea

    2010-09-01

    The demographers who organized the 1940 census of Peru portrayed the increasingly mixed-race Peruvian population as indicative of the breaking down of cultural barriers to the emergence of a robust Peruvian identity, a process that, they claimed, would lead to greater national development. This paper analyzes the ways in which demographers constructed cultural heterogeneity as a potential national asset. This reveals how scientific knowledge of miscegenation affected the formation of a nationalist project in the second half of the twentieth century, and also how demographers' ideological commitments to socialism shaped scientific practice.

  2. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  3. Electrostatic-Dipole (ED) Fusion Confinement Studies

    Science.gov (United States)

    Miley, George H.; Shrestha, Prajakti J.; Yang, Yang; Thomas, Robert

    2004-11-01

    The Electrostatic-Dipole (ED) concept significantly differs from a "pure" dipole confinement device [1] in that the charged particles are preferentially confined to the high-pressure region interior of the dipole coil by the assistance of a surrounding spherical electrostatic grid. In present ED experiments, a current carrying coil is embedded inside the grid of an IEC such as to produce a magnetic dipole field. Charged particles are injected axisymmetrically from an ion gun (or duo-plasmatron) into the center of the ED confinement grid/dipole ring where they oscillate along the magnetic field lines and pass the peak field region at the center of the dipole region. As particles begin accelerating away from the center region towards the outer electrostatic grid region, they encounter a strong electrostatic potential (order of 10's of kilovolts) retarding force. The particles then decelerate, reverse direction and re-enter the dipole field region where again magnetic confinement dominates. This process continues, emulating a complex harmonic oscillator motion. The resulting pressure profile averaged over the field curvature offers good plasma stability in the ED configuration. The basic concept and results from preliminary experiments will be described. [1] M.E. Mauel, et al. "Dipole Equilibrium and Stability," 18th IAEA Conference of Plasma Phys. and Control. Nuclear Fusion, Varenna, Italy 2000, IAEA-F1-CN-70/TH

  4. Die Familiennamen des ostfriesischen Kreises Leer : sprachliche und geographisch-statistische Untersuchungen zum Namenbestand um 1940

    NARCIS (Netherlands)

    Ebeling, Rudolf Albert

    2008-01-01

    In deze studie wordt het in 1979 gepubliceerde familienanenregister van de Oostfriese 'Kreis’ Leer ( R. A. Ebeling: Familiennamen im Landkreis Leer um 1940) naamkundig gekarakteriseerd d.m.v. een beschrijving van het onomastisch specifieke van dat repertoire en een onderzoek naar de mogelijke

  5. La Industria Harinera en Duitama-Boyacá 1920-1940

    OpenAIRE

    Plazas Díaz, Leidy Carolina

    2012-01-01

    El siguiente artículo es producto de una investigación cualitativa con enfoque histórico sobre la consolidación de la Industria Harinera en Duitama, a partir de la revisión de fuentes de archivo y de trabajo de campo. Este texto pretende hacer un análisis histórico sobre la tecnificación en la producción de harina y los cambios sociales generados por la llegada de la primera fábrica al municipio de Duitama, en el periodo de 1911 a 1940. También busca aportar a los estudios regionales de la hi...

  6. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  7. Moments of disaster response in the emergency department (ED).

    Science.gov (United States)

    Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

    2017-11-01

    We experience our lives as a series of memorable moments, some good and some bad. Undoubtedly, the experience of participating in disaster response, is likely to stand out as a memorable moment in a nurses' career. This presentation will describe five distinct moments of nursing in the emergency department (ED) during a disaster response. A Hermeneutic Phenomenological approach informed by van Manen underpins the research process. Thirteen nurses from different countries around the world participated in interviews about their experience of working in the ED during a disaster. Thematic analysis resulted in five moments of disaster response which are common to the collective participant experience. The 5 themes emerge as Notification (as a nurse finds out that the ED will be receiving casualties), Waiting (waiting for the patients to arrive to the ED), Patient Arrival (the arrival of the first patients to the ED), Caring for patients (caring for people affected by the disaster) and Reflection (the moment the disaster response comes to an end). This paper provides an in-depth insight into the experience of nursing in the ED during a disaster response which can help generate awareness and inform future disaster preparedness of emergency nurses. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  8. Swiss electricity statistics 2006; Schweizerische Elektrizitaetsstatistik 2006/Statistique suisse de l'electricite 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    This comprehensive report made by the Swiss Federal Office of Energy (SFOE) presents the statistics on electricity production and usage in Switzerland for the year 2006. First of all, an overview of Switzerland's electricity supply in 2006 is presented. Details are noted of the amounts generated by different sources including nuclear, hydro-power, storage schemes and thermal power stations as well as energy transfer with neighbouring countries. A second chapter takes a look at the balance of imports and exports with illustrative flow diagrams along with tables for total figures from 1950 through to 2006. For the summer and winter periods, figures from 1995 to 2006 are presented. The third chapter examines the production of electricity in the various types of power stations and the developments over the years 1950 to 2006, whereby, for example, statistics on regional generation and power station type are looked at. The fourth chapter looks at electricity consumption in various sectors from 1983 to 2006 and compares the figures with international data. The fifth chapter looks at generation, consumption and loading on particular, selected days and chapter six considers energy exchange with Switzerland's neighbours. Chapter seven takes a look at possibilities for extending generation facilities in the period up to 2013.

  9. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  10. 7 CFR 4290.1940 - Integration of this part with other regulations applicable to USDA's programs.

    Science.gov (United States)

    2010-01-01

    ... Agriculture (Continued) RURAL BUSINESS-COOPERATIVE SERVICE AND RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL BUSINESS INVESTMENT COMPANY (âRBICâ) PROGRAM Miscellaneous § 4290.1940 Integration of this... extent applicable to this part, the Secretary will comply with subpart D of 7 CFR part 1900 and RD...

  11. Common Wheat Chromosome 5B Composition Analysis Using Low-Coverage 454 Sequencing

    Czech Academy of Sciences Publication Activity Database

    Sergeeva, E.M.; Afonnikov, D. A.; Koltunova, M. K.; Gusev, V.D.; Miroshnichenko, L. A.; Vrána, Jan; Kubaláková, Marie; Poncet, C.; Sourdille, P.; Feuillet, C.; Doležel, Jaroslav; Salina, E.A.

    2014-01-01

    Roč. 7, č. 2 (2014) ISSN 1940-3372 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional support: RVO:61389030 Keywords : GENOME SHOTGUN SEQUENCES * IN-SITU HYBRIDIZATION * HEXAPLOID WHEAT Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.933, year: 2014

  12. I RAPPORTI TRA L'ALBANIA E LA GRAN BRETAGNA (1940-1950)

    OpenAIRE

    COTA, JULIAN

    2012-01-01

    La presente tesi ha avuto l’obiettivo di illustrare i rapporti tra l’Albania e la Gran Bretagna nel decennio tra il 1940 al 1950. Il lavoro viene svolto basandosi su tre momenti; a) l’ingresso dell’Albania nell’ottica della politica estera della Gran Bretagna e l’invio delle missioni militari britanniche in Albania. b) La fine della Guerra collocò l’Albania dall’altra parte della cortina di ferro rispetto ai britannici causando il peggioramento dei rapporti tra i due governi dopo gli...

  13. Coal fire mapping of East Basuria Colliery, Jharia coalfield using ...

    Indian Academy of Sciences (India)

    detect coal fire regions based on surface tem- perature ..... and non-coal fire regions have been delineated well in the ..... System Development Notes; Paterson Grant and Watson .... Schloemer S 2006 Innovative technologies for exploration,.

  14. 2003 annual results of EdF group

    International Nuclear Information System (INIS)

    2004-03-01

    The Electricite de France (EdF) group Board of Directors, meeting on March 11, 2004, under the Chairmanship of Francois Roussely, reviewed the audited consolidated financial statements for the year ended 12/31/2003. This document presents the consolidated results of EdF group for 2003: consolidated financial statements, highlights of the year, focus on 2003 events, commercial results, EDF in Europe and worldwide, EDF France highlights, key figures. (J.S.)

  15. The Celluloid Ceiling: Women Academics, Social Expectations, and Narrative in 1940s American Film

    Science.gov (United States)

    Reynolds, Pauline J.

    2009-01-01

    This paper examines the portrayal of women university academics in American films from the 1940s. It applies analytical tools from a critical methodology to access the socio-cultural ideas and values attributed to the female professoriate during what is a period of great change for women in American society. This analysis reveals that the values…

  16. Regional Energy Deployment System (ReEDS)

    Energy Technology Data Exchange (ETDEWEB)

    Short, W.; Sullivan, P.; Mai, T.; Mowers, M.; Uriarte, C.; Blair, N.; Heimiller, D.; Martinez, A.

    2011-12-01

    The Regional Energy Deployment System (ReEDS) is a deterministic optimization model of the deployment of electric power generation technologies and transmission infrastructure throughout the contiguous United States into the future. The model, developed by the National Renewable Energy Laboratory's Strategic Energy Analysis Center, is designed to analyze the critical energy issues in the electric sector, especially with respect to potential energy policies, such as clean energy and renewable energy standards or carbon restrictions. ReEDS provides a detailed treatment of electricity-generating and electrical storage technologies and specifically addresses a variety of issues related to renewable energy technologies, including accessibility and cost of transmission, regional quality of renewable resources, seasonal and diurnal generation profiles, variability of wind and solar power, and the influence of variability on the reliability of the electrical grid. ReEDS addresses these issues through a highly discretized regional structure, explicit statistical treatment of the variability in wind and solar output over time, and consideration of ancillary services' requirements and costs.

  17. «…For our happy childhood»: juvenile criminal liability in soviet legislation of 1920–1940

    Directory of Open Access Journals (Sweden)

    Еvgeny F. Krinko

    2010-12-01

    Full Text Available The article is concerned with the dynamics of juvenile criminal liability in Soviet legislation of 1920–1940 and states tightening penalties for young and juvenile offenders under rise in child crime.

  18. MANY MEN USED ED TREATMENT WITHOUT THEIR PARTNERS’ KNOWLEDGE

    OpenAIRE

    Tan HM; Choo WY; Ng CJ; Low WY

    2007-01-01

    This paper aimed to identify and explore the understanding and perception of erectile dysfunction (ED) using exploratory qualitative approaches. This study was conducted in Klang Valley, Malaysia. Purposive sampling was used to recruit 17 urban men aged 40-75 years. A semi-structural interview guide was used to explore men’s understanding of ED, impacts on their well-being and experiences with treatments. The focus groups revealed that ED was perceived to be an important loss in men’s lives ...

  19. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  20. The Type II supernovae 2006V and 2006au

    DEFF Research Database (Denmark)

    Taddia, F.; Stritzinger, M. D.; Sollerman, J.

    2012-01-01

    curve evolution similar to that of SN 1987A. At the earliest epochs, SN 2006au also displays an initial dip which we interpret as the signature of the adiabatic cooling phase that ensues shock break-out. SNe 2006V and 2006au are both found to be bluer, hotter and brighter than SN 1987A. Spectra of SNe...

  1. Positivism, Impressionism and Magic: modifying the modern canon in America and France from the 1940s

    Directory of Open Access Journals (Sweden)

    Gavin Parkinson

    2017-12-01

    Full Text Available This article narrates for the first time the competing views over Impressionism in America and France in the 1940s and 1950s, between modernist art history led by Clement Greenberg, on the one hand, and Surrealism led by André Breton, on the other. It argues that the sustained critique of Surrealism against positivism in the early 1940s helped to determine accidentally the modernist reconstitution of Impressionism – a movement that had suffered some neglect historiographically due to the emergence and rise of the utterly dissimilar Surrealism in the 1920s and 1930s – that was continued into the 1950s. The observation of and resistance to the triumph of American abstraction and revival of Impressionism in that decade by a now thoroughly esoteric Surrealism are shown to be another facet of this chapter forgotten by art history.

  2. El mercado matrimonial de las familias tradicionales argentinas, 1900-1940: Algunas dimensiones y tendencias The Marriage Market of Traditional Argentinean Families, 1900-1940: Some Aspects and Trends

    Directory of Open Access Journals (Sweden)

    Leandro Losada

    2012-04-01

    Full Text Available El artículo estudia el mercado matrimonial de las familias tradicionales argentinas entre 1900 y 1940, a partir de una muestra de 550 casamientos y del análisis de sus pautas sociales y culturales. El periodo elegido incluye el momento de máximo esplendor de esas familias en la sociedad argentina (entre 1900 y mediados de la década de 1910 aproximadamente así como el arco temporal en que se produjo el ocaso de su gravitación (las décadas de 1920 y 1930. El propósito es pensar la relación entre las pautas matrimoniales y el ascenso y la declinación de la elite tradicional, un problema hasta el momento descuidado por la historiografía argentina.The article studies the marriage market of traditional Argentinean families between 1900 and 1940 on the basis of a study of 550 marriages and the analysis of their social and cultural patterns. The period chosen includes the florescence of these families in Argentinean society (approximately between 1900 and the middle of the 1910s as well as the are of time during which they declined (the 1920s and 1930s. The aim is to explore the link between marriage patterns and the rise and fall of the traditional elite, a problem that has so far been neglected by Argentinean historiography.

  3. CERN Technical Training 2006: LabVIEW Course Sessions (September-December 2006)

    CERN Multimedia

    2006-01-01

    The following LabVIEW course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2006, and in collaboration with National Instruments (CH): LabVIEW Basics 1 (course in English): 11-13.9.2006 (3 days, only 3 places available) LabVIEW Basics 2 (course in English): 14-15.9.2006 (2 days) LabVIEW: Working efficiently with LabVIEW 8 (course in English): 18.9.2006 (1 day) **NEW COURSE** LabVIEW Application Development (course in English): 13-15.11.2006 (3 days. Pre-requisite: LabVIEW Basics I ans II, or equivalent experience) LabVIEW Advanced Programming (course in English): 16-17.11.2006 (2 days. Pre-requisite: LabVIEW Application Development, or equivalent experience) LabVIEW Base 1 (course in French): 4-6.12.2006 (3 days, only 1 place available) LabVIEW Base 2 (course in French): 7-8.12.2006 (2 days) If you are interested in attending any of the above course sessions, please discuss with your supervisor and/or your DTO, and apply electronically via EDH from the cour...

  4. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  5. MANY MEN USED ED TREATMENT WITHOUT THEIR PARTNERS’ KNOWLEDGE

    Directory of Open Access Journals (Sweden)

    Tan HM

    2007-01-01

    Full Text Available This paper aimed to identify and explore the understanding and perception of erectile dysfunction (ED using exploratory qualitative approaches. This study was conducted in Klang Valley, Malaysia. Purposive sampling was used to recruit 17 urban men aged 40-75 years. A semi-structural interview guide was used to explore men’s understanding of ED, impacts on their well-being and experiences with treatments. The focus groups revealed that ED was perceived to be an important loss in men’s lives as sexual performance was closely related to manhood. The men associated ED with a loss of masculinity and self-esteem. Men’s understanding of ED treatments was restricted to phophodiesterase type 5 inhibitors (PDE-5 inhibitors and traditional therapies. Although PDE-5 inhibitors were perceived to be effective, they were concerned about their safety and costs. Some of the men have learned to cope with ED rather than to seek help, particularly among older men, who attributed their decreased sexual capacities and erection difficulties to aging, and therefore conditioned themselves to accepting it. In contrast, younger men who have erectile difficulties are considered as ‘abnormal’, and are more likely to seek help and receive treatment for their sexual problem. Men’s knowledge of and experience with modern treatments of ED were mainly associated with PDE-5 inhibitors. Their perception towards PDE-5 inhibitors was largely influenced by personal experience, information from mass media and friends. The high cost and fear of side effects were two main deterrents in the use of PDE-5 inhibitors. Many men had conceded their use of PDE-5 inhibitors without their partners’ knowledge. They worried that their partners would view the matter with suspicion and mistrust.

  6. Admission rates and costs associated with emergency presentation of urolithiasis: analysis of the Nationwide Emergency Department Sample 2006-2009.

    Science.gov (United States)

    Eaton, Samuel H; Cashy, John; Pearl, Jeffrey A; Stein, Daniel M; Perry, Kent; Nadler, Robert B

    2013-12-01

    We sought to examine a large nationwide (United States) sample of emergency department (ED) visits to determine data related to utilization and costs of care for urolithiasis in this setting. Nationwide Emergency Department Sample was analyzed from 2006 to 2009. All patients presenting to the ED with a diagnosis of upper tract urolithiasis were analyzed. Admission rates and total cost were compared by region, hospital type, and payer type. Numbers are weighted estimates that are designed to approximate the total national rate. An average of 1.2 million patients per year were identified with the diagnosis of urolithiasis out of 120 million visits to the ED annually. Overall average rate of admission was 19.21%. Admission rates were highest in the Northeast (24.88%), among teaching hospitals (22.27%), and among Medicare patients (42.04%). The lowest admission rates were noted for self-pay patients (9.76%) and nonmetropolitan hospitals (13.49%). The smallest increases in costs over time were noted in the Northeast. Total costs were least in nonmetropolitan hospitals; however, more patients were transferred to other hospitals. When assessing hospital ownership status, private for-profit hospitals had similar admission rates compared with private not-for-profit hospitals (16.6% vs 15.9%); however, costs were 64% and 48% higher for ED and inpatient admission costs, respectively. Presentation of urolithiasis to the ED is common, and is associated with significant costs to the medical system, which are increasing over time. Costs and rates of admission differ by region, payer type, and hospital type, which may allow us to identify the causes for cost discrepancies and areas to improve efficiency of care delivery.

  7. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  8. Fathers of U.S. Children Born in 2001: Findings from the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) E.D. TAB. NCES 2006-002

    Science.gov (United States)

    Avenilla, Frank; Rosenthal, Emily; Tice, Pete

    2006-01-01

    This E.D. TAB presents information about the biological fathers of children born in the United States in the year 2001. It is the first publication of findings using the data collected from fathers during the base year collection of the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B). It presents information on the demographic…

  9. ExpandED Options: Learning beyond High School Walls

    Science.gov (United States)

    ExpandED Schools, 2014

    2014-01-01

    Through ExpandED Options by TASC, New York City high school students get academic credit for learning career-related skills that lead to paid summer jobs. Too many high school students--including those most likely to drop out--are bored or see classroom learning as irrelevant. ExpandED Options students live the connection between mastering new…

  10. President lahkub areenilt : Konstantin Pätsi viimane avalik esinemine 21. juunil 1940. a. / Olev Liivik, Hiljar Tammela

    Index Scriptorium Estoniae

    Liivik, Olev, 1975-

    2010-01-01

    21. juunil 1940. aastal Kadrioru presidendilossi ees toimunud meeleavalduse ning Konstantin Pätsi pöördumise kajastustest ja tõlgendustest järgneva 70 aasta jooksul ilmunud kirjutistes (ajakirjanduses, mälestustes, akadeemilistes ajalookäsitlustes, ilukirjanduses)

  11. TrED: the Trichophyton rubrum Expression Database

    Directory of Open Access Journals (Sweden)

    Liu Tao

    2007-07-01

    Full Text Available Abstract Background Trichophyton rubrum is the most common dermatophyte species and the most frequent cause of fungal skin infections in humans worldwide. It's a major concern because feet and nail infections caused by this organism is extremely difficult to cure. A large set of expression data including expressed sequence tags (ESTs and transcriptional profiles of this important fungal pathogen are now available. Careful analysis of these data can give valuable information about potential virulence factors, antigens and novel metabolic pathways. We intend to create an integrated database TrED to facilitate the study of dermatophytes, and enhance the development of effective diagnostic and treatment strategies. Description All publicly available ESTs and expression profiles of T. rubrum during conidial germination in time-course experiments and challenged with antifungal agents are deposited in the database. In addition, comparative genomics hybridization results of 22 dermatophytic fungi strains from three genera, Trichophyton, Microsporum and Epidermophyton, are also included. ESTs are clustered and assembled to elongate the sequence length and abate redundancy. TrED provides functional analysis based on GenBank, Pfam, and KOG databases, along with KEGG pathway and GO vocabulary. It is integrated with a suite of custom web-based tools that facilitate querying and retrieving various EST properties, visualization and comparison of transcriptional profiles, and sequence-similarity searching by BLAST. Conclusion TrED is built upon a relational database, with a web interface offering analytic functions, to provide integrated access to various expression data of T. rubrum and comparative results of dermatophytes. It is devoted to be a comprehensive resource and platform to assist functional genomic studies in dermatophytes. TrED is available from URL: http://www.mgc.ac.cn/TrED/.

  12. A comparison of the analysis of REE-bearing phosphates by standardless EDS and standardised EDS and WDS

    International Nuclear Information System (INIS)

    Griffin, B.J.; Hancock, R.C.; Trautman, R.L.

    2002-01-01

    Full text: Current generation energy dispersive X-ray analysis systems EDS on SEM are user-friendly with 'simple' software interfaces. Minimal training is considered necessary for operation. One aim of this study was to test this hypothesis. The second aim, as a part of other studies, was to compare the results of the x-ray microanalysis of a suite of rare earth element (REE) bearing standard glasses and also a suite of rare earth element (REE) bearing phosphate mineral grains using different analytical systems. Our results from the same sample mounts have been obtained using three analytical systems: an Oxford Instruments ISIS EDS on a JEOL 6400 SEM, a Noran Voyager EDS on a JEOL 6400 SEM and a Moran Scientific WDS package on a JEOL 6400 SEM. A total of forty nine natural mineral grains have been analysed for twenty-two elements, including the REE, Ca, P and F (where possible) by each analytical system. Additional analyses were obtained from simple REE-bearing glass standards, each containing only one REE at around 11 wt %. The natural mineral grain results obtained from the different analytical systems show a number of significant variations. The two EDS datasets are comparable in terms of total REE but generally are a factor of two less than the WDS dataset. Internally the EDS datasets differ in that one set shows consistently a strong negative yttrium oxide result (typically -1 wt %) due to an excessive correction for a strong phosphorus overlap (Ka on La) whereas the second dataset shows the reverse with typically 1 wt % yttrium oxide reported, as a result of inadequate correction of the phosphorus overlap. Major elements are comparable between the standard-based datasets but not with the standardless dataset although all show similar reproducibility. The standard glass results are more coherent and consistent, as would be expected from the simpler composition and higher abundances. One clear outcome from these data is that complex compositions where

  13. [Sebastian Rimestad. The Challenges of Modernity to the Orthodox Church in Estonia and Latvia (1917-1940)]/ Svetlana Bogojavlenska

    Index Scriptorium Estoniae

    Bogojavlenska, Svetlana

    2014-01-01

    Arvustus: Sebastian Rimestad. The Challenges of Modernity to the Orthodox Church in Estonia and Latvia (1917-1940). (Erfurter Studien zur Kulturgeschichte des orthdoxen Christentums, Bd. 6). Lang, Frankfurt am Main u. a. 2012

  14. CME1003Pg023ED

    African Journals Online (AJOL)

    Chantel

    resistance alone or severe defects in ... skeletal muscle and liver, decreased ... weight loss through calorie-restrict- ed diets .... carbohydrate and lipid metabolism.12 ... and a variable effect on low-density ... months of therapy.18 Comparison.

  15. SJP0704Pg001ED

    African Journals Online (AJOL)

    Enrique

    and an updated overview of newer research in this field. It also gives practical ... schizophrenia, manic episodes, major depressive disorder sec- ondary to schizophrenia ..... of Cerebral Disorder. 3rd ed. London: Blackwell Science, 1998. 16.

  16. CULTURAL NATIONALISM IN A COLONIAL CONTEXT: LAOS IN FRENCH INDOCHINA, 1893-1940

    DEFF Research Database (Denmark)

    Ivarsson, Søren

    2008-01-01

    In general, studies dealing with the link between French colonialism and nationalism in Laos have focused on the anti-colonial or revolutionary aspects of Lao nationalism. This is true for texts written by Western scholars as well as officially sanctioned books on Lao history published in Laos. T....... This chapter approaches Lao nationalism from a cultural perspective, through a discussion of how a specific idea about Laos and its culture was formed under French colonial rule in the period 1893-1940....

  17. Transnational entanglements in the history of psychiatry. South Tyrolian patients in German asylums, c. 1940-1945

    Directory of Open Access Journals (Sweden)

    Thomas Müller

    2016-12-01

    Full Text Available Object of this article is the destiny of psychiatric inmates in Wuerttemberg asylums, 1940-1945. These patients from Italian regions of Vicenza, Udine, Trento, Alto Adige and various locations more were delegated and, to a substantial number, illegally deported to the German asylums Zwiefalten, Schussenried and Weissenau, all in South Wuerttemberg, in 1940 and 1943. Attention is focused on the pioneering state pre-negotiations, and the so-called option treaties between the German Reich and Fascist Italy as part of the general aspect of National Socialist bio-Politics. The treatment of these South Tyrol patients in the asylums themselves, as well as their fate will be put into the context of the resettlement actions at the margins of the Third Reich, which started in 1939 and widely affected the European continent. It is referred to other sub-groups of migrating population from Italy to the German Reich as well, as a contrasting aspect of this contribution

  18. Ethane dimethanesulfonate (EDS) perturbs epididymal epithelial cell function in vitro

    International Nuclear Information System (INIS)

    Klinefelter, G.

    1990-01-01

    The formation of sperm granulomas in the epididymis following exposure to EDS, a Leydig cell toxicant, was reported by Cooper and Jackson in 1970. Recent work suggests that EDS may effect the epididymis directly. An in vitro system was developed to determine the nature of any direct effect. The caput epididymis from adult rats was dissected free of connective tissue and small pieces of the tissue were enzymatically digested until plaques of epididymal epithelial cells were obtained. Plaques were cultured on an extracellular matrix gelled on top of a semipermeable filter creating dual-compartment environments. The epithelial cells maintained typical morphology and protein secretion in this culture system for several days. Beginning on day 3, EDS (1 mM) was added to the basal compartment, with or without 35 S-methionine. After 24 hours, 35 S-labelled culture medium was taken from the apical compartment and analyzed by SDS-PAGE and fluorography. EDS caused decreased secretion of several proteins, including a 39 Kd molecule. Interestingly, a 39 Kd protein was also shown to disappear from sperm taken from the caput epididymidis following in vivo exposure to EDS. Unlabelled cultures were fixed and processed for light microscopy. No alterations in morphological integrity were observed. Thus, epididymal epithelial cell function is directly altered by EDS exposure

  19. More about the events in 1940 : three obstacles to Russia's saying, "We are terribly sorry" / Yelena Sukhina

    Index Scriptorium Estoniae

    Sukhina, Yelena

    2002-01-01

    Venemaa suhtumisest 1939.-1940. a. sündmustesse. Venemaa ei vabanda Eesti riigi ja rahva ees, sest: 1)Eesti okupeerimist õigustatakse enesekaitsega; 2)Eestis ja Venemaal olid ja on erinevad väärtushinnangud; 3)kahel riigil on erinevad sõjakogemused

  20. Met Ed gets reprieve: banks lend tax money

    International Nuclear Information System (INIS)

    Utroska, D.

    1981-01-01

    A consortium of banks agreed to loan Metropolitan Edison $23 million to pay its April 15 state taxes and temporarily relieve a cash-flow problem that is leading to default after the Pennsylvania Public Utility Commission expedited a rate request. The continued solvency of Met Ed is a matter of speculation because the present credit formula is based on liquid assets which the PUC did not address. While the action taken by the bankers gives Met Ed a reprieve, it does not provide a long-term solution. The Revolving Credit Agreement will expire on October 1. Met Ed is still faced with the problem of relicensing Three Mile Island-1 unit and the cost of underwriting the cleanup of the No. 2 unit

  1. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  2. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  3. Europython 2006

    CERN Multimedia

    2006-01-01

    Europython 2006 - Annual Python Developer Conference, 3-5 July 2006, CERN Software developers from around the world will gather July 3-5 in Geneva, Switzerland for EuroPython 2006, the fifth annual conference for the Python programming language. The event is hosted this year at CERN, the birthplace of the Web, and promises an exciting slate of keynotes and talks. 'Python keeps growing each year, and EuroPython keeps getting better as well,' says Benedikt Hegner, host and one of the lead organizers for EuroPython 2006. 'This year saw Guido van Rossum, Python's creator, moving to Google with other key Python developers. Hosting EuroPython at CERN is a prestigious step for EuroPython as well. EuroPython 2006 will be keynoted both by Mr. van Rossum as well as Dr. Alan Kay, an originator of object-oriented programming and pioneer of graphical computing. The schedule has 3 days of talks in 8 tracks covering agile development, business, teaching, games, an expanded web frameworks track, and more. The organize...

  4. ED50 and ED95 of Intrathecal Bupivacaine Coadministered with Sufentanil for Cesarean Delivery Under Combined Spinal-epidural in Severely Preeclamptic Patients

    Institute of Scientific and Technical Information of China (English)

    Fei Xiao; Wen-Ping Xu; Xiao-Min Zhang; Yin-Fa Zhang; Li-Zhong Wang; Xin-Zhong Chen

    2015-01-01

    Background:Spinal anesthesia was considered as a reasonable anesthetic option in severe preeclampsia when cesarean delivery is indicated,and there is no indwelling epidural catheter or contraindication to spinal anesthesia.However,the ideal dose of intrathecal bupivacaine has not been quantified for cesarean delivery for severe preeclamptic patients.This study aimed to determine the ED50 and ED95 of intrathecal bupivacaine for severely preeclamptic patients undergoing elective cesarean delivery.Methods:Two hundred severely preeclamptic patients are undergoing elective cesarean delivery under combined spinal-epidural anesthesia enrolled in this randomized,double-blinded,dose-ranging study.Patients received 4 mg,6 mg,8 mg,or 10 mg intrathecal hyperbaric bupivacaine with 2.5 μg sufentanil.Successful spinal anesthesia was defined as a T6 sensory level achieved within 10 minutes after intrathecal drug administration and/or no epidural supplement was required during the cesarean section.The ED50 and ED95 were calculated with a logistic regression model.Results:ED50 and ED95 ofintrathecal bupivacaine for successful spinal anesthesia were 5.67 mg (95% confidence interval [CI]:5.20-6.10 mg) and 8.82 mg (95% CI:8.14-9.87 mg) respectively.The incidence of hypotension in Group 8 mg and Group 10 mg was higher than that in Group 4 mg and Group 6 mg (P < 0.05).The sensory block was significantly different among groups 10 minutes after intrathecal injection (P < 0.05).The use of lidocaine in Group 4 mg was higher than that in other groups (P < 0.05).The use of phenylephrine in Group 8 mg and Group 10 mg was higher than that in the other two groups (P < 0.05).The lowest systolic blood pressure before the infant delivery of Group 8 mg and Group 10 mg was lower than the other two groups (P < 0.05).The satisfaction of muscle relaxation in Group 4 mg was lower than other groups (P < 0.05).There was no significant difference in patients' satisfaction and the newborns

  5. La represión política en Sevilla durante el franquismo, 1940-1951

    Directory of Open Access Journals (Sweden)

    Aurelio Peral Peral

    2005-01-01

    Full Text Available Este artículo trata sobre algunos casos, especialmente representativos, de la represión franquista llevada a cabo en Sevilla, contra personas civiles juzgadas por Tribunales Militares entre 1940 y 1951, inculpadas de contravenir la legislación vigente mediante hechos de tipo político acontecidos tras la Guerra Civil. Se destacan los elevados castigos a penas de prisión impuestos, en relación con la aparentemente reducida importancia de las acciones llevadas a cabo, por lo que es de considerar que con estas condenas se trataba de coartar la creación de una oposición significativa al régimen.This article deals with some specially representativo cases of Franco s repression carried out in Seville against civil people. These people werejudged by Military Courts between 1940 and 1951 and accused of infringement of current legislation trough political facts occurred after the Civil War. It must be highiighted the severo punishments to prison penalties charged, in relation with the apparently few importance of the actions carried out. Thus we must consider that with these penalties they tried to restrict the creation of a significant opposition to Franco s rule.

  6. Monumentality and public space in Lourenço Marques in the 1930 and 1940

    Directory of Open Access Journals (Sweden)

    Gerbert Verheij

    2012-01-01

    Full Text Available Lourenço Marques, actual Maputo (Mozambique, is subjected to a series of aesthetic interventions in its public space during the 1930s e 1940s. These seek to “monumentalize” and “portugalize” the city, responding to its recently acquired status as capital of the Colony. Two monuments appear as especially important and exemplary: the Padrão de Guerra, a lately built First War memorial (1935, and the monument to the hero of the “pacification campaigns” of the 1890s, Mouzinho de Albuquerque (1940. Around these monuments, a large number of commemorative and celebrative practices are developed. Such practices posit the monument as a “national allegory” and reproduce, in the context of a modern city, auratic and cult values. As such, they add an important dimension to the monument’s role in the authoritarian reformulation of the city’s public space as an “imperial” space, as well as in the putative hegemonization of the representations of the community imagined as a “Nation”. They allow, therefore, to approach the political-ideological use and utility of the monument within the organization of public space.

  7. The statistical mind in modern society. The Netherlands 1850-1940. Volume II: statistics and scientific work

    NARCIS (Netherlands)

    Stamhuis, I.H.; Klep, P.M.M.; Maarseveen, J.G.S.J. van

    2008-01-01

    In the period 1850-1940 statistics developed as a new combination of theory and practice. A wide range of phenomena were looked at in a novel way and this statistical mindset had a pervasive influence in contemporary society. This development of statistics is closely interlinked with the process of

  8. 'De menschen koopen alleen boeken, welke ze nodig hebben'. Uitgeverij De Erven F. Bohn, 1900-1940

    NARCIS (Netherlands)

    Claeyssens, Steven Achiel Adriana

    2014-01-01

    A history of the Dutch publishing firm De Erven F. Bohn during the years 1900-1940, the study argues that the Dutch publishing industry in this period is characterised by a proliferation of different publishing fields, resulting in a gradual evolution of most large publishing houses from general to

  9. CERN Technical Training 2006: LabVIEW Course Sessions (September-December 2006)

    CERN Multimedia

    2006-01-01

    The following LabVIEW course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2006, and in collaboration with National Instruments (CH): LabVIEW Basics 1 (course in English): 11-13.9.2006 (3 days, only 3 places available) (course in English): 14-15.9.2006 (2 days) LabVIEW: Working efficiently with LabVIEW 8 (course in English): 18.9.2006 (1 day) **NEW COURSE** LabVIEW Application Development (course in English): 13-15.11.2006 (3 days. Pre-requisite: LabVIEW Basics I ans II, or equivalent experience) LabVIEW Advanced Programming (course in English): 16-17.11.2006 (2 days. Pre-requisite: LabVIEW Application Development, or equivalent experience) LabVIEW Base 1 (course in French): 4-6.12.2006 (3 days, only 1 place available) LabVIEW Base 2 (course in French): 7-8.12.2006 (2 days) If you are interested in attending any of the above course sessions, please discuss with your supervisor and/or your DTO,...

  10. Mode of Address, Emotion, and Stylistics: Images of Children in American Magazine Advertising, 1940-1950.

    Science.gov (United States)

    Viser, Victor J.

    1997-01-01

    Codes 1038 magazine advertisements spanning 1940 through 1950 for mode of address in the child's body, face, eyes, and other areas. Indicates, regarding mode of address, significant rotating image trends toward a more direct address in the eyes and face of the child in the postwar period--trends that were absent in prewar and war years. (PA)

  11. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  12. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  13. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  14. General of the Army George C. Marshall’s Strategic Leadership

    Science.gov (United States)

    2017-03-15

    Depression to perform conservation tasks in rural areas.31 In 1938, Marshall moved to the War Plans Division of the General Staff. Unbeknownst to...125 US Army Center of Military History, “Omar Nelson Bradley: The Centennial ,” US Army, 2006...Omar Nelson Bradley: The Centennial .” US Army, 2006. Accessed April 2, 2017. http://www.history.army.mil/brochures/bradley/bradley.htm. Watson

  15. Coccidioidomycosis Outbreaks, United States and Worldwide, 1940-2015.

    Science.gov (United States)

    Freedman, Michael; Jackson, Brendan R; McCotter, Orion; Benedict, Kaitlin

    2018-03-01

    Coccidioidomycosis causes substantial illness and death in the United States each year. Although most cases are sporadic, outbreaks provide insight into the clinical and environmental features of coccidioidomycosis, high-risk activities, and the geographic range of Coccidioides fungi. We identified reports published in English of 47 coccidioidomycosis outbreaks worldwide that resulted in 1,464 cases during 1940-2015. Most (85%) outbreaks were associated with environmental exposures; the 2 largest outbreaks resulted from an earthquake and a large dust storm. More than one third of outbreaks occurred in areas where the fungus was not previously known to be endemic, and more than half of outbreaks involved occupational exposures. Coccidioidomycosis outbreaks can be difficult to detect and challenging to prevent given the unknown effectiveness of environmental control methods and personal protective equipment; therefore, increased awareness of coccidioidomycosis outbreaks is needed among public health professionals, healthcare providers, and the public.

  16. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  17. Toward reliable and repeatable automated STEM-EDS metrology with high throughput

    Science.gov (United States)

    Zhong, Zhenxin; Donald, Jason; Dutrow, Gavin; Roller, Justin; Ugurlu, Ozan; Verheijen, Martin; Bidiuk, Oleksii

    2018-03-01

    New materials and designs in complex 3D architectures in logic and memory devices have raised complexity in S/TEM metrology. In this paper, we report about a newly developed, automated, scanning transmission electron microscopy (STEM) based, energy dispersive X-ray spectroscopy (STEM-EDS) metrology method that addresses these challenges. Different methodologies toward repeatable and efficient, automated STEM-EDS metrology with high throughput are presented: we introduce the best known auto-EDS acquisition and quantification methods for robust and reliable metrology and present how electron exposure dose impacts the EDS metrology reproducibility, either due to poor signalto-noise ratio (SNR) at low dose or due to sample modifications at high dose conditions. Finally, we discuss the limitations of the STEM-EDS metrology technique and propose strategies to optimize the process both in terms of throughput and metrology reliability.

  18. Concession Policy and Practice at the Russian Far East in 1920-1940s: Trade-Offs and Results

    Directory of Open Access Journals (Sweden)

    Yudina Taisiya V.

    2016-09-01

    Full Text Available Modern political leverage from western countries to Russia allows researchers to use domestic historical experience of 1920-1940s. International isolation of Soviet Russia induced the search of different ways out, including making concessionary agreements with foreign entrepreneurs. Since 1921 concessionary agreements were made between Soviet Russia/USSR and Germany, England, USA, Japan, Norway, Poland, Austria, Italy, France, Persia, Denmark, Finland, Latvia, Holland, Sweden, Estonia, Lithuania, Turkey, China and Mongolia. Soviet economy began attracting private foreign capital. At the end of the 1920s Soviet government set a course to liquidate private property. Share of concessionary enterprises in the national economy decreased. But despite the absence of any new concessionary agreements since 1929, concessionary affairs in USSR lasted till mid-1940 and only with Japan because of its deep political meaning. The author analyzes Japan concessions’ activity, such as “Kita Karafuto Koogio Kabusiki Kaisha” and “Kita Karafuto Sekio Kabusiki Kaisha” in 1930-1940s (pre- and World War II period, workers’ socio-economic conditions, relations between Japanese concessioners and Soviet authorities. Permanent infringements of concessionary agreements by Japan concessioners including concessions workers’ food and goods supply, price making, Soviet workers’ housing provision and dismissal, meeting safety requirements were registered. However, neither Japan concessioners dissolve their enterprises nor Soviet authorities annulled concessionary agreements. The author concludes that originally in 1925 granting concessions to Japan businessmen in USSR was among the conditions of Japan government diplomatic recognition of USSR. Further Japan concessions in USSR were deterrent factor from Japan military invasion to the Russian Far East.

  19. Association of ED with chronic periodontal disease.

    Science.gov (United States)

    Matsumoto, S; Matsuda, M; Takekawa, M; Okada, M; Hashizume, K; Wada, N; Hori, J; Tamaki, G; Kita, M; Iwata, T; Kakizaki, H

    2014-01-01

    To examine the relationship between chronic periodontal disease (CPD) and ED, the interview sheet including the CPD self-checklist (CPD score) and the five-item version of the International Index of Erectile Function (IIEF-5) was distributed to 300 adult men who received a comprehensive dental examination. Statistical analyses were performed by the Spearman's rank correlation coefficient and other methods. Statistical significance was accepted at the level of Pdysfunction and the systematic inflammatory changes associated with CPD. The present study also suggests that dental health is important as a preventive medicine for ED.

  20. A natação em piscinas nos clubes da cidade de Porto Alegre (décadas de 1930 e 1940)

    OpenAIRE

    Assmann, Alice Beatriz; Silva, Carolina Fernandes da; Mazo, Janice Zarpellon

    2013-01-01

    Este estudo objetiva descrever como se sucedeu a prática da natação em piscinas nos clubes da cidade de Porto Alegre nas décadas de 1930 e 1940. As fontes consultadas evidenciaram que a natação era praticada primeiramente em rios e lagos. O marco da prática institucionalizada da natação, não apenas em Porto Alegre, mas no Brasil, foi a construção da primeira piscina do país em 1885 no Lago Guaíba, por iniciativa da atual SOGIPA. Somente, na década de 1940 foram construídas piscinas em clubes ...

  1. O IDEÁRIO LIBERAL NAS REFORMAS EDUCACIONAIS BRASILEIRA ENTRE 1920 E 1940

    Directory of Open Access Journals (Sweden)

    Maria Joselia Zanlorense

    2017-03-01

    Full Text Available Neste texto discute-se as reformas educacionais as quais direcionaram a educação profissional no Brasil entre 1920 a 1940, momento que aconteceram os movimentos que visaram discutia educação brasileira culminando nas reformas educacionais as quais direcionaram a formação do trabalhador, mantendo a dualidade de ensino. Pondera-se neste estudo o ideário liberal e conservador na educação, a influência do ideário da Escola Nova e seus defensores no Brasil. A Reforma Francisco Campos que proporcionou mudanças no ensino comercial e superior; a criação do Instituto de Organização e Racional do Trabalho – IDOTR que buscou a organização no espaço das fábricas e o controle do trabalhador atendendo os ditames do capital. Apresenta-se a instauração do Estado Novo e a ratificação da educação profissional direcionada aos menos favorecidos economicamente pela Constituição Federal de 1937. Na década de 1940 ocorreram novas reformas educacionais denominadas de Leis Orgânicas do Ensino as quais, em tempos conservadores, consolidaram a dualidade de ensino com princípios liberais proporcionando à elite o acesso à formação clássica humanística e o ensino profissional direcionado à classe trabalhadora.

  2. [History of pedagogy and educational sciences in the Baltic countries from 1940 to 1990. An overview] / Mare Oja

    Index Scriptorium Estoniae

    Oja, Mare, 1960-

    2014-01-01

    Arvustus: History of pedagogy and educational sciences in the Baltic countries from 1940 to 1990. An overview. Hrsg. im Auftrag der Baltic Association of Historians of Pedagogy von Vadim Rõuk und Vidimantas Raudys. Verlag RaKa. Riga 2013

  3. Bibliographie 2006-2007

    Directory of Open Access Journals (Sweden)

    Florence Klein

    2007-12-01

    Full Text Available 1. Histoire, genres et théories littérairesArrighetti, G. (2006, Poesia, poetiche e storia nella riflessione dei greci. Studi, Giardini, Pisa (Biblioteca di studi antichi 89.Asmis, E. (2006 « Epicurean poetics » in A. Laird (éd., Ancient literary criticism. (Oxford Readings in Classical Studies. Oxford : Oxford UP, p. 238-266.Ax, W. (2006 Text und Stil. Studien zur antiken Literatur und deren Rezeption ; Stuttgart, Steiner. Batstone, W. W. (2006 « Provocation : The Point of Reception T...

  4. Hinke Piersma en Jeroen Kemperman, Openstaande rekeningen. De gemeente Amsterdam en de gevolgen van roof en rechtsherstel, 1940-1950.

    Directory of Open Access Journals (Sweden)

    Regina Grüter

    2017-05-01

    Full Text Available Hinke Piersma en Jeroen Kemperman, Openstaande rekeningen. De gemeente Amsterdam en de gevolgen van roof en rechtsherstel, 1940-1950 (Amsterdam: Boom, 2015, 256 pp., isbn 978 908 953 661 7.

  5. Mahlburg's Work on Crank Functions

    Indian Academy of Sciences (India)

    IAS Admin

    640–651, 2006. [8]. G N Watson, Ramanujan's Vermutung uber zerfallungsanzahlen, J. Reine Angew Math., Vol.179, pp.97–128, 1938. [9]. J Lehner, Ramanujan identities involving the partition function for the moduli 11α, Amer. J. Math.

  6. 8 Different approaches needed to manage ED demand among different age-groups.

    Science.gov (United States)

    Rimmer, Melanie; Ablard, Suzanne; O'Keeffe, Colin; Mason, Suzanne

    2017-12-01

    A variety of interventions have been proposed to manage rising demand for Emergency and Urgent Care, described by an NHS England review as unsustainable in the long term. However it is unlikely that any suggested approach will be equally suitable for the diverse population of ED users.We aimed to understand the patterns of demand amongst different types of patients attending ED. We also sought to understand the intended and unintended effects of demand management initiatives. Our study combined insights from routine data, a survey of ED patients, and qualitative interviews with ED staff. This paper describes the results of our analysis of the interviews. We conducted semi-structured interviews with 25 ED and Urgent Care Centre staff across 7 hospital sites in Yorkshire and Humber between 25 April and 11 July 2016. The interview topic guide asked about 4 broad areas; job role, description of patients and their impact on demand, description of inappropriate attendance, and current/future initiatives to deal with rising demand. Interviews were transcribed verbatim and analysed using framework analysis. We analysed the results to identify groups of patients with different patterns of use of ED services. We also explored ED staff experiences of demand management initiatives, and their suggestions for future initiatives. Although we did not ask specifically about patients' age, our analysis revealed that ED staff categorised attenders as children and young people, working age people, and older people. These groups had different reasons for attendance, different routes to the ED, different rate of non-urgent attendance, and different issues driving demand. Staff also described variation in the time taken to treat patients of different ages, with the oldest and youngest patients described as requiring the most time.There was no consensus amongst staff about the effectiveness of initiatives for managing demand. A strikingly wide variety of initiatives were mentioned

  7. Anne K. Bang: Islamic Sufi Networks in the Western Indian Ocean (c. 1880-1940. Ripples of Reform.

    Directory of Open Access Journals (Sweden)

    Angelika Brodersen

    2015-03-01

    Full Text Available This contribution offers a review of Anne K. Bang's book: Islamic Sufi Networks in the Western Indian Ocean (c. 1880-1940. Ripples of Reform. Islam in Africa, Volume 16. Leiden: Brill 2014. xiv + 227 pages, € 104.00, ISBN 978-900-425-1342.

  8. A 5-year comparison of ED visits by homeless and nonhomeless patients.

    Science.gov (United States)

    Tadros, Allison; Layman, Shelley M; Brewer, Marissa Pantaleone; Davis, Stephen M

    2016-05-01

    A 2005 study examined emergency department (ED) utilization by homeless patients in the United States. Within the following 5 years, unemployment increased by 5%. The objective was to analyze changes in ED utilization between 2005 and 2010 by homeless patients and compare with nonhomeless visits. Data from the 2010 National Hospital Ambulatory Medical Care Survey were evaluated. Approximately 679854 visits were made by homeless patients, the majority of which were made by men (72.3%) and patients between the ages of 45 and 64 (50.5%). Homeless patients were twice as likely to be uninsured. ED visits by homeless patients had increased by 44% during the 5-year period. Arrival to the ED by ambulance increased by 14% between the study years, and homeless patients were less likely to be admitted. The number of visits by homeless patients in the ED increased proportionally to an overall increase in ED visits between 2005 and 2010. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. RECENT REFERENCES: JULY 1, 2006 TO SEPTEMBER 30, 2006

    Energy Technology Data Exchange (ETDEWEB)

    WINCHELL, D.F.

    2006-09-30

    This document lists experimental references added to Nuclear Science References (NSR) during the period July 1, 2006 to September 30, 2006. The first section lists keynumbers and keywords sorted by mass and nuclide. The second section lists all references, ordered by keynumber.

  10. Plague in Arab Maghreb, 1940-2015: a review

    Directory of Open Access Journals (Sweden)

    Maliya Alia Malek

    2016-06-01

    Full Text Available We reviewed the epidemiology of 49 plague outbreaks which resulted in about 7,612 cases in 30 localities in the Arabic Maghreb (Mauritania, Morocco, Algeria, Tunisia, Libya and Egypt over 75 years. Between 1940 and 1950, most cases recorded in Morocco (75% and Egypt (20%, resulted from plague imported to Mediterranean harbours and transmitted by rat ectoparasites. In contrast, the re-emergence of plague in the southern part of Western Sahara in 1953 and in northeast Libya in 1976, was traced to direct contact between nomadic populations and infected goats and camels in natural foci, including the consumption of contaminated meat, illustrating this neglected oral route of contamination. Further familial outbreaks were traced to human ectoparasite transmission. Efforts to identify the factors contributing to natural foci may guide where to focus the surveillance of sentinel animals in order to eradicate human plague, if not Y. pestis from the Arab Maghreb.

  11. Meie tipud 2006 : ¡Eesti kirjanduskriitika artikliauhinnast 2006. aastal / Linnar Priimägi

    Index Scriptorium Estoniae

    Priimägi, Linnar, 1954-

    2007-01-01

    Eesti kirjanduskriitika 2006. aasta artikliauhinna neljast nominendist Anne Lillest (Antiiktragöödia, esteetika paradoksid ja Mati Unt. Keel ja Kirjandus 2006, nr. 6), Toomas Haugist (A. H. T. surm Aafrikas. Lisandusi Leo Frobeniuse "Jumala külalise" kadunud tõlkele. Looming 2006, nr. 6), Märt Väljatagast (Orja teadvus varjus ja valguses. Looming 2006, nr. 12) ja Eneken Laanesest (Mäletamise lühis: Ene Mihkelsoni "Ahasveeruse uni". Keel ja Kirjandus 2006, nr. 6)

  12. Role modeling excellence in clinical nursing practice.

    Science.gov (United States)

    Perry, R N Beth

    2009-01-01

    Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

  13. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  14. Walka o przetrwanie. Życie codzienne dzieci polskich w Kazachstanie w latach 1940-1942

    OpenAIRE

    Bujanowska, Beata

    2001-01-01

    Wydanie publikacji dofinansowane przez Komitet Badań Naukowych In the years of 1940-1942 the Soviet authorities conducted mass deportations of Polish population from so called „Western Ukraine” and „Western Byelorussia”. Many thousand of Polish children started their lifes in Kazakhstan and wide regions of Norther Russia. They became unguilty victims of the Stalin’s regime and carried the consequences great policy of adults. During four mass deportation, according to the NKWD d...

  15. Grafica de carte din RSS Moldovenească în perioada de instaurare a realismului socialist (1940–1953

    Directory of Open Access Journals (Sweden)

    Victoria Rocaciuc

    2016-10-01

    Full Text Available Initially, the publishing processes in the MASSR and Bessarabia of the interwar period developed completely differently in the aesthetic and ideological scope. Their unification is observed after 1940. In the art of book graphics of the Moldavian Soviet Socialist Republic, the transition to socialist realism was characterized by documentation and the domination of illustration characteristics, accumulation of professional skills, formation of creative manners and the author’s styles of illustrators. Evgheni Merega was among the first graphic artists involved in these processes who cooperated with: Tiraspol State Printing House, the State Publishing House (Chisinau, „Shkoala sovetica” and „Uchpedgiz”. Boris Nesvedov and Valentina Neceaev started in the interwar period. In the period 1940–1953, Leonid Grigoraşenco, Ilia Bogdesco, Boris Şirocorad, Iacob Averbuh, Ioachim Postolachi, Aleksandr Neforosov etc. made a name for themselves in the field of book graphics.

  16. Estonia's occupations revisited. Accounts of an era / comp. by Heiki Ahonen ; ed. by Enn Tarvel

    Index Scriptorium Estoniae

    2005-01-01

    Eesti riigi (valitsusliikmete saatus, omavalitsuse likvideerimine, kaitseväe ning kohtunike saatus, kohtusüsteemi likvideerimine) ja rahva (arreteerimised 1940-41, küüditamine, repressioonid, kolhooside moodustamine) hävitamisest, vastupanust

  17. Una aproximación a las prácticas de enseñanza de la lectura y la escritura en una escuela colombiana en 1940 (An approach to the teaching practices of reading and writing in a Colombian school in 1940 (Une approche des pratiques d’enseignements de la lecture et de l’écriture dans une école colombienne en 1940 (Uma aproximação às práticas de ensino de leitura e escritura em uma escola colombiana em 1940

    Directory of Open Access Journals (Sweden)

    María Del Pilar Mora-R.

    2009-12-01

    Full Text Available Se presenta una aproximación a las prácticas de enseñanza de la lengua en una escuela colombiana, en 1940. Las fuentes utilizadas: la legislación sobre educación del periodo comprendido entre 1900 y 1940, la cartilla Alegría de leer, el testimonio sobre lo vivido por un alumno de la época, así como su cuaderno de caligrafía de primer año elemental. El estudio hace énfasis en las relaciones de los componentes del sistema didáctico. El referente metodológico en este estudio de caso fue la Teoría Fundamentada y el procesamiento de los datos implicó el uso de análisis de contenido y análisis de discurso. La investigación aporta a la reconstrucción de la memoria histórica de la didáctica de la lengua, en Colombia.

  18. Albrecht Scholz (1940-2013): German dermatologist and historian of dermatology.

    Science.gov (United States)

    Grzybowski, Andrzej; Parish, Lawrence Charles; Plewig, Gerd

    2014-01-01

    Albrecht Scholz (Figure 1) was born in Görlitz (now Zgorzelec, a city located at the Polish-German border, covering both sides of the River Nysa) on September 6, 1940, the youngest of three children. His father was a laryngologist, specializing in voice and hearing impairment. Scholz attended school in his hometown and in 1958 passed his Matura examination, after which he studied medicine at both Humboldt University in Berlin and the “Carl Gustav Carus” Medical Academy in Dresden. Following successful completion of the state examination in 1964 and an internship at the Reichenbach Hospital the following year, he was granted the right to practice medicine. His 1964 doctoral dissertation was titled, “Evaluation of Astrand's Steps in Elderly Patients.”

  19. Extensive FE-SEM/EDS, HR-TEM/EDS and ToF-SIMS studies of micron- to nano-particles in anthracite fly ash

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Joana [Centro de Geologia, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); DaBoit, Kátia [Institute of Environmental Research and Human Development, IPADHC, Capivari de Baixo, Santa Catarina (Brazil); Flores, Deolinda [Centro de Geologia, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Departamento de Geociências, Ambiente e Ordenamento do Território, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Kronbauer, Marcio A. [Laboratory of Environmental Researches and Nanotechnology Development, Centro Universitário La Salle, Victor Barreto, 2288 Centro 92010-000, Canoas, RS (Brazil); Silva, Luis F.O., E-mail: felipeqma@hotmail.com [Laboratory of Environmental Researches and Nanotechnology Development, Centro Universitário La Salle, Victor Barreto, 2288 Centro 92010-000, Canoas, RS (Brazil); Environmental Science and Nanotechnology Department, Catarinense Institute of Environmental Research and Human Development, IPADHC, Capivari de Baixo, Santa Catarina (Brazil)

    2013-05-01

    The generation of anthropogenic carbonaceous matter and mixed crystalline/amorphous mineral ultrafine/nano-particles in the 1 to 100 nm size range by worldwide coal power plants represents serious environmental problems due to their potential hazards. Coal fly ash (CFA) that resulted from anthracite combustion in a Portuguese thermal power plant was studied in this work. The physico-chemical characterization of ultrafine/nano-particles present in the CFA samples and their interaction with environment are the aim of this study. The methodologies applied for this work were field emission scanning electron microscopy (FE-SEM) with energy dispersive X-ray spectroscopy (EDS), high-resolution transmission electron microscopy with energy dispersive X-ray spectroscopy (HR-TEM/EDS) and time of flight secondary ion mass spectrometry (ToF-SIMS). Some hazardous volatile elements, C, N, S and Hg contents were also determined in the studied samples. Generally, the CFA samples comprise carbonaceous, glassy and metallic solid spheres with some containing mixed amorphous/crystalline phases. The EDS analysis coupled with the FE-SEM and HR-TEM observations of the fly ash particles with 100 to 0.1 nm demonstrates that these materials contain a small but significant proportion of encapsulated HVEs. In addition, the presence of abundant multi-walled carbon nanotubes (MWCNTs) and amorphous carbon particles, both containing hazardous volatile elements (HVEs), was also evidenced by the FE-SEM/EDS and HR-TEM/EDS analysis. A wide range of organic and inorganic compounds was determined by chemical maps obtained in ToF-SIMS analysis. - Highlights: ► We examine changes in the level of ultrafine and nanoparticles of coal mining. ► Increasing geochemical information will increase human health information in this area. ► Electron bean and Tof-SIMS increase area information.

  20. Suicide Prevention in an Emergency Department Population: The ED-SAFE Study.

    Science.gov (United States)

    Miller, Ivan W; Camargo, Carlos A; Arias, Sarah A; Sullivan, Ashley F; Allen, Michael H; Goldstein, Amy B; Manton, Anne P; Espinola, Janice A; Jones, Richard; Hasegawa, Kohei; Boudreaux, Edwin D

    2017-06-01

    Suicide is a leading cause of deaths in the United States. Although the emergency department (ED) is an opportune setting for initiating suicide prevention efforts, ED-initiated suicide prevention interventions remain underdeveloped. To determine whether an ED-initiated intervention reduces subsequent suicidal behavior. This multicenter study of 8 EDs in the United States enrolled adults with a recent suicide attempt or ideation and was composed of 3 sequential phases: (1) a treatment as usual (TAU) phase from August 2010 to December 2011, (2) a universal screening (screening) phase from September 2011 to December 2012, and (3) a universal screening plus intervention (intervention) phase from July 2012 to November 2013. Screening consisted of universal suicide risk screening. The intervention phase consisted of universal screening plus an intervention, which included secondary suicide risk screening by the ED physician, discharge resources, and post-ED telephone calls focused on reducing suicide risk. The primary outcome was suicide attempts (nonfatal and fatal) over the 52-week follow-up period. The proportion and total number of attempts were analyzed. A total of 1376 participants were recruited, including 769 females (55.9%) with a median (interquartile range) age of 37 (26-47) years. A total of 288 participants (20.9%) made at least 1 suicide attempt, and there were 548 total suicide attempts among participants. There were no significant differences in risk reduction between the TAU and screening phases (23% vs 22%, respectively). However, compared with the TAU phase, patients in the intervention phase showed a 5% absolute reduction in suicide attempt risk (23% vs 18%), with a relative risk reduction of 20%. Participants in the intervention phase had 30% fewer total suicide attempts than participants in the TAU phase. Negative binomial regression analysis indicated that the participants in the intervention phase had significantly fewer total suicide attempts

  1. Where Money Mattered: Organizational and Economic Consequences of State Public School Expenditures in the United States: 1880-1940.

    Science.gov (United States)

    Balfanz, Robert

    1997-01-01

    Uses historical, state-level schooling data, manufacturing productivity measures, and quantitative research to examine relationships between changes in rate and distribution of public school expenditures, public schooling organization, and state-level economic growth from 1880-1940. Significant effects for per-student spending on school…

  2. The apotheosis of holding company accounting: Unilever's financial reporting innovations from the 1920s tot the 1940s

    NARCIS (Netherlands)

    Camfferman, C.; Zeff, S.A.

    2003-01-01

    The annual reports of Unilever were widely hailed in the 1940s as outstanding examples of holding company accounting. The accounts did indeed contain many new and innovative features, including segment reporting of sales turnover. This contrasts with the frequently negative assessments of the

  3. The pre-Anschluss Vienna School of Medicine - the physicians: Sigmund Freud (1856-1939), Julius Wagner-Jauregg (1857-1940) and Karel Wenckebach (1864-1940).

    Science.gov (United States)

    Shaw, Lily Bzl; Shaw, Robert A

    2016-05-01

    Three physicians are discussed. Sigmund Freud, probably the best-known member of the Vienna School of Medicine, was the path-breaking pioneer in psychoanalysis and psychotherapy. Julius Wagner-Jauregg was a psychiatrist who discovered the link between iodine deficiency and goitre and also developed malaria therapy to treat progressive paralysis caused by syphilis for which he was awarded the Nobel Prize. Karel Wenckebach, the pioneering Dutch cardiologist, is best known for the Wenckebach block. After the Anschluss, fate dealt very different hands to these three physicians. Freud fled to London where he soon died. Wagner-Jauregg, who had some pan-Germanic sympathies as well as views on eugenics, left a controversial legacy. The Dutch cardiologist Wenckebach died in Vienna shortly after his homeland had been invaded in 1940 by that of his hosts. © IMechE 2014.

  4. Edwin B. Wilson and the rise of mathematical economics in America, 1920-1940

    OpenAIRE

    Carvajalino, Juan

    2017-01-01

    In the paper, Edwin B. Wilson's influence on the rise of mathematical economics in America between the 1920s and 1940s is explored. The focus is laid on showing how on the grounds of his foundational ideas about science Wilson worked at the organizational and educational fronts to modernize economics, at this at three levels. First, the paper shows the ways in which around 1930 Wilson was key, at the nationwide level, in the constitution of the first organized community of American mathematic...

  5. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  6. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  7. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  8. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  9. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  10. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  11. Scientific days of Marcoule 2006; Journees scientifiques Marcoule 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    The sixth scientific days of Marcoule 2006 took place in La Grande Motte, on 15-19 May 2006. During these days, the research works of the PhD students of Marcoule and Pierrelatte centers are presented. A summary of the progress of each PhD thesis is given below. (O.M.)

  12. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  13. Areva in 2006

    International Nuclear Information System (INIS)

    2007-01-01

    This document is the 2006 activity report of the Areva group and presents the 2006 highlights of the nuclear division (front end of the nuclear cycle, pressurized water reactors, treatment and recycling of used nuclear fuel) and of the Transmission and Distribution division. Content: Message from the Chairman of the Supervisory Board; Message from the Chief Executive Officer; the World in 2006; Areva 2006 highlights; business review; key data; Areva around the World; policy of continuous innovation; five years of sustainable development; governance; Continuous improvement; Financial performance; Innovation; Customer satisfaction; Commitment to employees; Environmental protection; Risk management and prevention; Dialogue and consensus building; Community involvement; corporate governance; organization of the group; Share information and shareholder relations; glossary; learn more

  14. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  15. Tallinna linnaehituslik areng arhitekt Herbert Johansoni suunamisel aastail 1930-1940 / Dmitri Bruns

    Index Scriptorium Estoniae

    Bruns, Dmitri, 1929-

    2005-01-01

    1930-ndate keskel pöörasid Tallinna linnaplaneerijad põhitähelepanu ehitustegevuse elustamisele peatänavate ääres, linna laialivalgumise tõkestamisele, uusehitiste kvaliteedi parandamisele. H. Johansonist. Järg vt. nr. 7-8, lk. 53-55 "Tallinna linnaehituslik areng Herbert Johansoni juhtimisel 1934-1940" (Tallinna linnaplaani muudatused, Kopli poolsaare aedlinnaku planeerimine), nr. 9, lk. 38-40 "Tallinna areng Herbert Johansoni suunamisel" (esimeste suurmajade kerkimine Pärnu ja Narva maanteedele), nr. 10, lk. 42-44 "Herbert Johansoni viimased aastad linnaarhitektina" (Kadrioru pargi korrastamine, valmisid kabelid Metsa- ja Liiva kalmistul, mõned alustatud ehitistest valmisid pärast sõda)

  16. Initial mechanical ventilator settings and lung protective ventilation in the ED.

    Science.gov (United States)

    Wilcox, Susan R; Richards, Jeremy B; Fisher, Daniel F; Sankoff, Jeffrey; Seigel, Todd A

    2016-08-01

    Mechanical ventilation with low tidal volumes has been shown to improve outcomes for patients both with and without acute respiratory distress syndrome. This study aims to characterize mechanically ventilated patients in the emergency department (ED), describe the initial ED ventilator settings, and assess for associations between lung protective ventilation strategies in the ED and outcomes. This was a multicenter, prospective, observational study of mechanical ventilation at 3 academic EDs. We defined lung protective ventilation as a tidal volume of less than or equal to 8 mL/kg of predicted body weight and compared outcomes for patients ventilated with lung protective vs non-lung protective ventilation, including inhospital mortality, ventilator days, intensive care unit length of stay, and hospital length of stay. Data from 433 patients were analyzed. Altered mental status without respiratory pathology was the most common reason for intubation, followed by trauma and respiratory failure. Two hundred sixty-one patients (60.3%) received lung protective ventilation, but most patients were ventilated with a low positive end-expiratory pressure, high fraction of inspired oxygen strategy. Patients were ventilated in the ED for a mean of 5 hours and 7 minutes but had few ventilator adjustments. Outcomes were not significantly different between patients receiving lung protective vs non-lung protective ventilation. Nearly 40% of ED patients were ventilated with non-lung protective ventilation as well as with low positive end-expiratory pressure and high fraction of inspired oxygen. Despite a mean ED ventilation time of more than 5 hours, few patients had adjustments made to their ventilators. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. SED-ED, a workflow editor for computational biology experiments written in SED-ML.

    Science.gov (United States)

    Adams, Richard R

    2012-04-15

    The simulation experiment description markup language (SED-ML) is a new community data standard to encode computational biology experiments in a computer-readable XML format. Its widespread adoption will require the development of software support to work with SED-ML files. Here, we describe a software tool, SED-ED, to view, edit, validate and annotate SED-ML documents while shielding end-users from the underlying XML representation. SED-ED supports modellers who wish to create, understand and further develop a simulation description provided in SED-ML format. SED-ED is available as a standalone Java application, as an Eclipse plug-in and as an SBSI (www.sbsi.ed.ac.uk) plug-in, all under an MIT open-source license. Source code is at https://sed-ed-sedmleditor.googlecode.com/svn. The application itself is available from https://sourceforge.net/projects/jlibsedml/files/SED-ED/.

  18. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  19. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  20. Sabine Dullin. La frontière épaisse: Aux origines des politiques soviétiques (1920-1940

    Directory of Open Access Journals (Sweden)

    Andrea Chandler

    2016-09-01

    Full Text Available Sabine Dullin. La frontière épaisse: Aux origines des politiques soviétiques (1920-1940. En temps & lieux 55. Paris: Éditions de l'École des hautes études en sciences sociales, 2014. 356 pp. Illustrations. Maps. Tables. Bibliography. Index of places. Index of names. Paper.

  1. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  2. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  3. ED pharmacist monitoring of provider antibiotic selection aids appropriate treatment for outpatient UTI.

    Science.gov (United States)

    Lingenfelter, Erin; Drapkin, Zachary; Fritz, Kelly; Youngquist, Scott; Madsen, Troy; Fix, Megan

    2016-08-01

    We sought to determine whether an emergency department (ED) pharmacist could aid in the monitoring and correction of inappropriate empiric antibiotic selection for urinary tract infections in an outpatient ED population. Urine cultures with greater than 100 000 CFU/mL bacteria from the University of Utah Emergency Department over 1 year (October 2011-Sept 2012) were identified using our electronic medical record system. Per ED protocol, an ED pharmacist reviews all cultures and performs a chart review of patient symptoms, diagnosis, and discharge antibiotics to determine whether the treatment was appropriate. A retrospective review of this process was performed to identify how often inappropriate treatment was recognized and intervened on by an ED pharmacist. Of the 180 cultures included, a total of 42 (23%) of empiric discharge treatments were considered inappropriate and required intervention. In 35 (83%) of 42 patients, the ED pharmacist was able to contact the patient and make appropriate changes; the remaining 7 patients were unable to be contacted, and no change could be made in their treatment. A chart review of all urine cultures with greater than 100 000 CFU/mL performed by an ED pharmacist helped identify inappropriate treatment in 23% of patients discharged to home with the diagnosis of urinary tract infection. Of these patients who had received inappropriate treatment, an ED pharmacist was able to intervene in 83% of cases. These data highlight the role of ED pharmacists in improving patient care after discharge. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Operational and financial impact of physician screening in the ED.

    Science.gov (United States)

    Soremekun, Olanrewaju A; Biddinger, Paul D; White, Benjamin A; Sinclair, Julia R; Chang, Yuchiao; Carignan, Sarah B; Brown, David F M

    2012-05-01

    Physician screening is one of many front-end interventions being implemented to improve emergency department (ED) efficiency. We aimed to quantify the operational and financial impact of this intervention at an urban tertiary academic center. We conducted a 2-year before-after analysis of a physician screening system at an urban tertiary academic center with 90 000 annual visits. Financial impact consisted of the ED and inpatient revenue generated from the incremental capacity and the reduction in left without being seen (LWBS) rates. The ED and inpatient margin contribution as well as capital expenditure were based on available published data. We summarized the financial impact using net present value of future cash flows performing sensitivity analysis on the assumptions. Operational outcome measures were ED length of stay and percentage of LWBS. During the first year, we estimate the contribution margin of the screening system to be $2.71 million and the incremental operational cost to be $1.86 million. Estimated capital expenditure for the system was $1 200 000. The NPV of this investment was $2.82 million, and time to break even from the initial investment was 13 months. Operationally, despite a 16.7% increase in patient volume and no decrease in boarding hours, there was a 7.4% decrease in ED length of stay and a reduction in LWBS from 3.3% to 1.8%. In addition to improving operational measures, the implementation of a physician screening program in the ED allowed for an incremental increase in patient care capacity leading to an overall positive financial impact. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  6. Using Telemedicine to Address Crowding in the ED.

    Science.gov (United States)

    Guss, Benjamin; Mishkin, David; Sharma, Rahul

    2016-11-01

    Some health systems are piloting telemedicine solutions in the ED to address crowding and decrease patient wait times. One new program, implemented at the Lisa Perry Emergency Center at New York Presbyterian (NYP) Weill Cornell Medical Center in New York, involves offering low-acuity patients the option of visiting an off-site physician via telemedicine hookup. Administrators note that the approach can get patients in and out of the ED within 30 minutes, and patients have thus far been highly satisfied with the approach. However, an earlier telemedicine program piloted at the University of San Diego Health System’s (UCSD) Hillcrest Hospital in 2013 got bogged down due to administrative and insurance reimbursement hurdles, although the approach showed enough promise that there is interest in restarting the program. In the NYP program, patients are identified as appropriate candidates for the program at triage. They can opt to be seen remotely or through traditional means in the ED’s fast-track section. Administrators note that patients with complex problems requiring extensive workups are not suitable for the telemedicine approach. The most challenging aspect of implementing a successful telemedicine program in the ED is getting the workflows right, according to administrators. An earlier ED-based telemedicine program piloted at UCSD ran into difficulties because the model required the involvement of two physicians, and some insurers did not want to pay for the telemedicine visits. However, patients were receptive.

  7. Evaluation of respiration of mitochondria in cancer cells exposed to mitochondria-targeted agents.

    Czech Academy of Sciences Publication Activity Database

    Klučková, Katarína; Dong, L. F.; Bajziková, Martina; Rohlena, Jakub; Neužil, Jiří

    2015-01-01

    Roč. 1265, 07 Oct 2015 (2015), s. 181-194 ISSN 1940-6029 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : Animals * Antineoplastic Agents * drug effects * *pharmacology Subject RIV: EB - Genetics ; Molecular Biology

  8. Mitigating Higher Ed Cyber Attacks

    Science.gov (United States)

    Rogers, Gary; Ashford, Tina

    2015-01-01

    In this presentation we will discuss the many and varied cyber attacks that have recently occurred in the higher ed community. We will discuss the perpetrators, the victims, the impact and how these institutions have evolved to meet this threat. Mitigation techniques and defense strategies will be covered as will a discussion of effective security…

  9. I Failed the edTPA

    Science.gov (United States)

    Kuranishi, Adam; Oyler, Celia

    2017-01-01

    In this article, co-written by a teacher and a professor, the authors examine possible explanations for why Adam (first author), a New York City public school special educator, failed the edTPA, a teacher performance assessment required by all candidates for state certification. Adam completed a yearlong teaching residency where he was the special…

  10. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  11. The US Business Cycle, 1867-2006: A Dynamic Factor Approach

    OpenAIRE

    Ritschl, Albrecht; Sarferaz, Samad; Uebele, Martin

    2016-01-01

    We estimate a Stock/Watson index of economic activity to assess U.S. business cycle volatility since 1867. We replicate the Great Moderation of the 1980s and 1990s and find exceptionally low volatility also in the Golden Age of the 1960s. Postwar moderation relative to pre-1914 occurs under constant but not time-varying factor loadings, suggesting structural change toward more volatile sectors. For comparable series, the U.S. postwar business cycle was as volatile overall as under the Classic...

  12. The relationship between career decision self-efficacy and self-directed learning amongst female university students : a cross-cultural study

    OpenAIRE

    2011-01-01

    M.A. The career landscape has undergone considerable change within the past three decades (Hackett, Lent & Greenhaus, 1991; Sharf, 2002). Globalisation, the opening up of markets and rapid technological advances have produced a new world of work. Career choices and career challenges are more numerous and the career decision-making process more complex (Stead & Watson, 2006b). Baruch (2006) suggests that with these changes comes a need to address the preparation of future recruits. Accordin...

  13. 150th anniversary of veterinary education and the veterinary profession in North America: part 2, 1940-1970.

    Science.gov (United States)

    Smith, Donald F

    2011-01-01

    This article is the second in a series of four to be published in the Journal of Veterinary Medical Education (JVME). These articles are abridged versions of six lectures that make up an elective course on the history of the veterinary profession in North America offered at Cornell University's College of Veterinary Medicine to students in all four years of the program. The course is built in part on a series of biographies and interviews captured in a collection at http://www.vet.cornell.edu/legacy, and complemented by a growing collection of historical and public policy blogs at http://www.veterinarylegacy.blogsite.com. This article describes the development of the veterinary profession from 1940 to 1970, with particular emphasis on World War II, the Land Grant colleges established in the mid- and late 1940s, women in veterinary medicine (1910-1970), and African-Americans (ca. 1890-1945). Though the article is somewhat Cornell-centric because the lectures were presented to Cornell students at their home institution, many events are representative of the broader American experience.

  14. Measurements for municipalities 2006

    NARCIS (Netherlands)

    B. Kuhry; J.J.J. Jonker; with cooperation of Bureau Zenc

    2006-01-01

    Original title: Maten voor gemeenten 2006. Measurements for municipalities 2006 (Maten voor gemeenten 2006) presents a national picture of the performance delivered by local authorities and the costs of doing so. The analyses relate to the period 1999-2004. This is the fourth time

  15. Report from the commission about the industrial and financial project of EdF

    International Nuclear Information System (INIS)

    2004-01-01

    This report takes stock of the work carried out by the commission appointed by the French ministry of economy, finances and industry about the industrial and financial project of Electricite de France (EdF) in the framework of the liberalization of European energy markets. The report presents the conclusions of the commission about EdF's position in the new competition context, about the financial position of the group and about the foreseeable strategic options and their consequences in terms of equity fund needs. 5 appendixes present: the evolution of electricity prices, EdF and the energy policy, the electricity market and the competition in Europe, the EdF group: presentation and main adaptation stakes, the financial situation of EdF group. (J.S.)

  16. EDs find physical therapists are an underused asset for musculoskeletal injuries, patient education.

    Science.gov (United States)

    2011-04-01

    Some EDs are finding that the unique skill sets offered by physical therapists (PT) can be an asset to emergency care while also improving the patient experience. Experts say PTs are particularly valuable in the management of musculoskeletal pain and injuries, but they are also being used for wound care, gait training, and balance assessment. ED administrators say consistent, daily coverage is essential to making a PT program successful; otherwise, ED clinicians will neglect to use their services. PTs need to be comfortable with proactively marketing their skills to other ED clinicians who may not be used to having access to this resource. Experts say PT services in the ED can be reimbursed at a level that is consistent with reimbursement in other inpatient and outpatient settings.

  17. A Preliminary Examination of Loss of Control Eating Disorder (LOC-ED) in Middle Childhood

    Science.gov (United States)

    Matherne, Camden E.; Tanofsky-Kraff, Marian; Altschul, Anne M.; Shank, Lisa M.; Schvey, Natasha A.; Brady, Sheila M.; Galescu, Ovidiu; Demidowich, Andrew P.; Yanovski, Susan Z.; Yanovski, Jack A.

    2015-01-01

    Loss of Control Eating Disorder (LOC-ED) has been proposed as a diagnostic category for children 6–12y with binge-type eating. However, characteristics of youth with LOC-ED have not been examined. We tested the hypothesis that the proposed criteria for LOC-ED would identify children with greater adiposity, more disordered eating attitudes, and greater mood disturbance than those without LOC-ED. Participants were 251 youth (10.29y ± 1.54, 53.8% female, 57.8 % White, 35.5% Black, 2.0% Asian, 4.8% Hispanic, 53.0% overweight). Youth were interviewed regarding eating attitudes and behaviors, completed questionnaires to assess general psychopathology, and underwent measurements of body fat mass. Using previously proposed criteria for LOC-ED, children were classified as LOC-ED (n = 19), LOC in the absence of the full disorder (subLOC, n = 33), and youth not reporting LOC (noLOC, n = 199). LOC-ED youth had higher BMIz (p = 0.001) and adiposity (p = 0.003) and reported greater disordered eating concerns (p eating attitudes (p = 0.02). SubLOC youth had greater disordered eating concerns (p eating cognitions and anthropometric measures compared to youth without LOC-ED. Longitudinal studies are needed to determine if those with LOC-ED are at particularly increased risk for progression of disordered eating and excess weight gain. PMID:25913008

  18. A preliminary examination of Loss of Control Eating Disorder (LOC-ED) in middle childhood.

    Science.gov (United States)

    Matherne, Camden E; Tanofsky-Kraff, Marian; Altschul, Anne M; Shank, Lisa M; Schvey, Natasha A; Brady, Sheila M; Galescu, Ovidiu; Demidowich, Andrew P; Yanovski, Susan Z; Yanovski, Jack A

    2015-08-01

    Loss of Control Eating Disorder (LOC-ED) has been proposed as a diagnostic category for children 6-12years with binge-type eating. However, characteristics of youth with LOC-ED have not been examined. We tested the hypothesis that the proposed criteria for LOC-ED would identify children with greater adiposity, more disordered eating attitudes, and greater mood disturbance than those without LOC-ED. Participants were 251 youth (10.29years±1.54, 53.8% female, 57.8% White, 35.5% Black, 2.0% Asian, 4.8% Hispanic, 53.0% overweight). Youth were interviewed regarding eating attitudes and behaviors, completed questionnaires to assess general psychopathology, and underwent measurements of body fat mass. Using previously proposed criteria for LOC-ED, children were classified as LOC-ED (n=19), LOC in the absence of the full disorder (subLOC, n=33), and youth not reporting LOC (noLOC, n=199). LOC-ED youth had higher BMIz (p=0.001) and adiposity (p=0.003) and reported greater disordered eating concerns (pdisordered eating attitudes (p=0.02). SubLOC youth had greater disordered eating concerns (pdisordered eating cognitions and anthropometric measures compared to youth without LOC-ED. Longitudinal studies are needed to determine if those with LOC-ED are at particularly increased risk for progression of disordered eating and excess weight gain. Published by Elsevier Ltd.

  19. Conspiracy, Guilt and Rationality: The Memory and History of the German Military Occupation of Denmark on 9 April 1940

    DEFF Research Database (Denmark)

    Roslyng-Jensen, Palle

    2013-01-01

    The German Military Occupation of Denmark 9. April 1940 was undertaken as a surprise attack and met very short Danish military resistance. It created for long debates, juridical encounters and dicussuions regarding future Danish military policy. Historical analyses did not became dominant before ...

  20. Modelling the growth of Populus species using Ecosystem Demography (ED) model

    Science.gov (United States)

    Wang, D.; Lebauer, D. S.; Feng, X.; Dietze, M. C.

    2010-12-01

    Hybrid poplar plantations are an important source being evaluated for biomass production. Effective management of such plantations requires adequate growth and yield models. The Ecosystem Demography model (ED) makes predictions about the large scales of interest in above- and belowground ecosystem structure and the fluxes of carbon and water from a description of the fine-scale physiological processes. In this study, we used a workflow management tool, the Predictive Ecophysiological Carbon flux Analyzer (PECAn), to integrate literature data, field measurement and the ED model to provide predictions of ecosystem functioning. Parameters for the ED ensemble runs were sampled from the posterior distribution of ecophysiological traits of Populus species compiled from the literature using a Bayesian meta-analysis approach. Sensitivity analysis was performed to identify the parameters which contribute the most to the uncertainties of the ED model output. Model emulation techniques were used to update parameter posterior distributions using field-observed data in northern Wisconsin hybrid poplar plantations. Model results were evaluated with 5-year field-observed data in a hybrid poplar plantation at New Franklin, MO. ED was then used to predict the spatial variability of poplar yield in the coterminous United States (United States minus Alaska and Hawaii). Sensitivity analysis showed that root respiration, dark respiration, growth respiration, stomatal slope and specific leaf area contribute the most to the uncertainty, which suggests that our field measurements and data collection should focus on these parameters. The ED model successfully captured the inter-annual and spatial variability of the yield of poplar. Analyses in progress with the ED model focus on evaluating the ecosystem services of short-rotation woody plantations, such as impacts on soil carbon storage, water use, and nutrient retention.

  1. Ideas. A History: From Fire to Freud. 2. ed.; Ideen. Eine Kulturgeschichte von der Entdeckung des Feuers bis zur Moderne

    Energy Technology Data Exchange (ETDEWEB)

    Watson, P.

    2005-07-01

    In this hugely ambitious and exciting book Peter Watson tells the history of ideas from prehistory to the present day, seeking a new way to tell the history of the world. The book begins over a million years ago with a discussion of how the earliest ideas might have originated. Looking at animal behaviour that appears to require some thought tool-making, territoriality, counting, language (or at least sounds), pairbonding Peter Watson moves on to the apeman and the development of simple ideas such as cooking, the earliest language, the emergence of family life. All the obvious areas will be tackled the Ancient Greeks, Christian theology, the ideas of Jesus, astrological thought, the soul, the self, beliefs about the heavens, the ideas of Islam, the Crusades, humanism, the Renaissance, Gutenberg and the book, the scientific revolution, the age of discovery, Shakespeare, the idea of Revolution, the Romantic imagination, Darwin, imperialism, modernism, Freud right up to the present day and the internet. (orig./GL) [German] Beginnt die Ideengeschichte der Menschheit, als die Fruehmenschen erstmals Feuer machen, vor ca. 1,8 Millionen Jahren? Oder schon mit dem ersten Faustkeil vor etwa 2,5 Millionen Jahren? Warum entwickelte sich vor 40 000 Jahren eine komplexe Sprache? Wie kamen das Minus- und das Plus-Zeichen in die Vorstellungswelt, und wie entstand das Bild vom Paradies? Peter Watson laedt ein zu einer Expedition durch die abenteuerliche Welt menschlicher Ideen. Vom ersten Feuer, dem ersten Werkzeug und den ersten Worten ueber die Geburt der Goetter, die ersten Gesetze und die Entwicklung grosser Zentren von Wissen und Weisheit bis hin zu den umwaelzenden Ideen der Moderne: das Groesste und das Kleinste, das Selbst-Bewusstsein des Individuums und die Entdeckung des Unbewussten. Dabei ordnet Watson die riesige Materialfuelle nach drei zentralen Ideen, die fuer ihn die Geschichte der Menschheit praegen: die Seele, mehr als die Idee von einem Gott, Europa, mehr als das

  2. Hydrodynamic Simulation of the Columbia River, Hanford Reach, 1940--2004

    Energy Technology Data Exchange (ETDEWEB)

    Waichler, Scott R.; Perkins, William A.; Richmond, Marshall C.

    2005-06-15

    Many hydrological and biological problems in the Columbia River corridor through the Hanford Site require estimates of river stage (water surface elevation) or river flow and velocity. Systematic collection of river stage data at locations in the Hanford Reach began in 1991, but many environmental projects need river stage information at unmeasured locations or over longer time periods. The Modular Aquatic Simulation System 1D (MASS1), a one-dimensional, unsteady hydrodynamic and water quality model, was used to simulate the Columbia River from Priest Rapids Dam to McNary Dam from 1940 to 2004, providing estimates of water surface elevation, volumetric flow rate, and flow velocity at 161 locations on the Hanford Reach. The primary input data were bathymetric/topographic cross sections of the Columbia River channel, flow rates at Priest Rapids Dam, and stage at McNary Dam. Other inputs included Yakima River and Snake River inflows. Available flow data at a gaging station just below Priest Rapids Dam was mean daily flow from 1940 to 1986 and hourly thereafter. McNary dam was completed in 1957, and hourly stage data are available beginning in 1975. MASS1 was run at an hourly timestep and calibrated and tested using 1991--2004 river stage data from six Hanford Reach locations (areas 100B, 100N, 100D, 100H, 100F, and 300). Manning's roughness coefficient in the Reach above each river recorder location was adjusted using an automated genetic algorithm and gradient search technique in three separate calibrations, corresponding to different data subsets, with minimization of mean absolute error as the objective. The primary calibration was based on 1999, a representative year, and included all locations. The first alternative calibration also used all locations but was limited in time to a high-flow period during spring and early summer of 1997. The second alternative calibration was based on 1999 and included only 300 Area stage data. Model goodness-of-fit for all

  3. 34 CFR 110.1 - What is the purpose of ED's age discrimination regulations?

    Science.gov (United States)

    2010-07-01

    ... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 110.1 What is the purpose of ED's age discrimination regulations? The purpose of these regulations is to set out ED's rules for implementing the Age... 34 Education 1 2010-07-01 2010-07-01 false What is the purpose of ED's age discrimination...

  4. A Chinese translation of the EdFED-Q and assessment of equivalence.

    Science.gov (United States)

    Lin, Li-Chan; Chang, Chia-Chi

    2003-01-01

    The purpose of this study was to translate the Edinburgh Feeding Evaluation in Dementia Questionnaire (EdFED-Q) from the original English into a Chinese language version and to assess the equivalence of the English and Chinese EdFED-Q versions. To use a directly translated instrument without minimal explanation of the procedures for determining the equivalence between the original and secondary language instrument is questionable. Ensuring equivalence of a translated Chinese version of the EdFED-Q for patients with dementia is an essential prerequisite for identifying culturally specific expressions of feeding difficulty under investigation. Phase 1 consisted of experts doing the initial translation into Chinese and then English back-translations of the questionnaire. Six experts determined the equality of the Chinese and English versions, and five monolingual nurses provided information for the C-EdFED-Q. In phase 2, two bilingual gerontological nurses rated 33 residents with dementia to determine equivalence across time. In phase 3, three groups of bilingual nurses used the Chinese, English, and finally both versions simultaneously to judge a model case's feeding behavior on the videotape. In phase 1, the rating on the equality of the items on the Chinese and English versions was 0.969. In phase 2, kappa coefficients for all items on the C-EdFED-Q and E-EdFED-Q ranged from 0.44 to 1.00. In determining the consistency of the scores for the C-EdFED-Q and E-EdFED-Q between the two raters across time, the intraclass correlation coefficient for the absolute agreement was found to range from 0.85 to 0.90. In phase 3, except for items 6 and 9, all items showed no significant difference among the three groups. Further studies to assess the relationship between constructs and to compare it with known and predicted relationships are recommended.

  5. Point-of-Care Ultrasonography for Evaluation of Acute Dyspnea in the ED.

    Science.gov (United States)

    Zanobetti, Maurizio; Scorpiniti, Margherita; Gigli, Chiara; Nazerian, Peiman; Vanni, Simone; Innocenti, Francesca; Stefanone, Valerio T; Savinelli, Caterina; Coppa, Alessandro; Bigiarini, Sofia; Caldi, Francesca; Tassinari, Irene; Conti, Alberto; Grifoni, Stefano; Pini, Riccardo

    2017-06-01

    Acute dyspnea is a common symptom in the ED. The standard approach to dyspnea often relies on radiologic and laboratory results, causing excessive delay before adequate therapy is started. Use of an integrated point-of-care ultrasonography (PoCUS) approach can shorten the time needed to formulate a diagnosis, while maintaining an acceptable safety profile. Consecutive adult patients presenting with dyspnea and admitted after ED evaluation were prospectively enrolled. The gold standard was the final diagnosis assessed by two expert reviewers. Two physicians independently evaluated the patient; a sonographer performed an ultrasound evaluation of the lung, heart, and inferior vena cava, while the treating physician requested traditional tests as needed. Time needed to formulate the ultrasound and the ED diagnoses was recorded and compared. Accuracy and concordance of the ultrasound and the ED diagnoses were calculated. A total of 2,683 patients were enrolled. The average time needed to formulate the ultrasound diagnosis was significantly lower than that required for ED diagnosis (24 ± 10 min vs 186 ± 72 min; P = .025). The ultrasound and the ED diagnoses showed good overall concordance (κ = 0.71). There were no statistically significant differences in the accuracy of PoCUS and the standard ED evaluation for the diagnosis of acute coronary syndrome, pneumonia, pleural effusion, pericardial effusion, pneumothorax, and dyspnea from other causes. PoCUS was significantly more sensitive for the diagnosis of heart failure, whereas a standard ED evaluation performed better in the diagnosis of COPD/asthma and pulmonary embolism. PoCUS represents a feasible and reliable diagnostic approach to the patient with dyspnea, allowing a reduction in time to diagnosis. This protocol could help to stratify patients who should undergo a more detailed evaluation. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  6. Fresh Air and Good Food: Children and the Anti-Tuberculosis Campaign in the Netherlands c.1900-1940

    Science.gov (United States)

    Bakker, Nelleke

    2010-01-01

    As elsewhere in the Western world, between 1900 and 1940 the anti-tuberculosis campaign in the Netherlands produced a wide range of initiatives to promote child health. In each of these the social and the medical were linked, as the hygienic "mood" was encouraged by a child-saving ethos that focused upon the poor. In this article the…

  7. Carbon trends. June 2006

    International Nuclear Information System (INIS)

    2006-06-01

    This newsletter makes a monthly synthesis of the European CO 2 market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from June 2005 to May 2006), economic activity indicators (industrial production from March 2005 to March 2006), confidence index of business leaders (from May 2005 to May 2006), changes in energy prices (from June 2005 to May 2006), CO 2 quotas allocated to European Union countries and detailed indicators of CO 2 market, climate, economic activity and energy prices. (J.S.)

  8. Carbon trends. April 2006

    International Nuclear Information System (INIS)

    2006-04-01

    This newsletter makes a monthly synthesis of the European CO 2 market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from April 2005 to March 2006), economic activity indicators (industrial production from January 2005 to January 2006), confidence index of business leaders (from March 2005 to March 2006), changes in energy prices (from April 2005 to March 2006), CO 2 quotas allocated to European Union countries and detailed indicators of CO 2 market, climate, economic activity and energy prices. (J.S.)

  9. Carbon trends. May 2006

    International Nuclear Information System (INIS)

    2006-05-01

    This newsletter makes a monthly synthesis of the European CO 2 market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from May 2005 to April 2006), economic activity indicators (industrial production from February 2005 to February 2006), confidence index of business leaders (from April 2005 to April 2006), changes in energy prices (from May 2005 to April 2006), CO 2 quotas allocated to European Union countries and detailed indicators of CO 2 market, climate, economic activity and energy prices. (J.S.)

  10. Active Intervention Can Decrease Burnout In Ed Nurses.

    Science.gov (United States)

    Wei, Rong; Ji, Hong; Li, Jianxin; Zhang, Liyao

    2017-03-01

    The aim of this study was to evaluate whether active intervention can decrease job burnout and improve performance among ED nurses. This study was carried out in the emergency departments of 3 hospitals randomly selected from 8 comprehensive high-level hospitals in Jinan, China. A total of 102 nurses were enrolled and randomly divided into control and intervention groups. For 6 months, nurses in intervention groups were treated with ordinary treatment plus comprehensive management, whereas nurses in the control group were treated with ordinary management, respectively. Questionnaires were sent and collected at baseline and at the end of the study. The Student t test was used to evaluate the effect of comprehensive management in decreasing burnout. All ED nurses showed symptoms of job burnout at different levels. Our data indicated that comprehensive management significantly decreased emotional exhaustion and depersonalization (P burnout in ED nurses and contribute to relieving work-related stress and may further protect against potential mental health problems. Copyright © 2016 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

  11. Christianisation, Frenchification and Malgachisation: Mission Education during War and Rebellion in French Colonial Madagascar in the 1940s

    Science.gov (United States)

    Rosnes, Ellen Vea

    2017-01-01

    Education was an instrument in Christian missions' and colonial powers' civilisation projects. At the same time, education was also instrumental in fostering opposition. This article approaches perceptions of education mainly from the perspective of Norwegian Lutheran missionaries in French colonial Madagascar during the 1940s. The focus is on how…

  12. CERN Technical Training 2006: Software and System Technologies Curriculum - Scheduled Course Sessions (August-December 2006)

    CERN Multimedia

    2006-01-01

    The Software and System Technologies Curriculum of the CERN Technical Training Programme offers comprehensive training in C++, Java, Perl, Python, XML, OO programming, JCOP/PVSS, database design and Oracle. In the PERL, C++, OO and Java course series there are some places available on the following course sessions, scheduled until the end of this year: PERL 5 - Introduction: 31.8-1.9.2006 (2 days) C++ for Particle Physicists: 16-20.10.2006 (6 half days, the popular course given by Paul Kunz) Object-Oriented Analysis and Design using UML: 17-19.10.2006 (3 days) JAVA 2 Enterprise Edition - Part 1: Web Applications: 19-20.10.2006 (2 days) JAVA - Level 1: 30.10-1.11.2006 (3 days) PERL 5 - Advanced Aspects: 2.11.2006 (1 day) C++ Programming Part 1 - Introduction to Object-Oriented Design and Programming: 14-16.11.2006 (3 days) JAVA - Level 2: 4-7.12.2006 (4 days) C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls: 12-15.12.2006 (4 days) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBea...

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  14. Carbon trends. July 2006

    International Nuclear Information System (INIS)

    2006-07-01

    This newsletter makes a monthly synthesis of the European CO 2 market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from June 2005 to June 2006), economic activity indicators (industrial production index from April 2005 to April 2006), confidence index of business leaders (from June 2005 to June 2006), changes in energy prices (from July 2005 to June 2006), CO 2 quotas allocated to European Union countries and detailed indicators of CO 2 market, climate, economic activity and energy prices. (J.S.)

  15. Communists and Advertisement. The Experience of Costa Rica in the 1940s

    Directory of Open Access Journals (Sweden)

    Iván Molina Jiménez

    2013-07-01

    Full Text Available In this article, we identify the main characteristics of the advertising included in the Vanguardia magazine (1941-1942 and the Combate (1944 and Tinchera (1946 newspapers, all of them publications linked with the Communist Party in Costa Rica. It also considers the specific details of the individuals, institutions and companies that published advertisements in these media. Finally, we analyze to what extent some of the contents of those advertisements were related to broader discourses which took place in the 1940s (economic nationalism and defense of democracy, while others promoted values, beliefs, worldviews and lifestyles different from the culture the Communists were trying to spread.

  16. Occupational stress in the ED: a systematic literature review.

    Science.gov (United States)

    Basu, Subhashis; Qayyum, Hasan; Mason, Suzanne

    2017-07-01

    Occupational stress is a major modern health and safety challenges. While the ED is known to be a high-pressure environment, the specific organisational stressors which affect ED staff have not been established. We conducted a systematic review of literature examining the sources of organisational stress in the ED, their link to adverse health outcomes and interventions designed to address them. A narrative review of contextual factors that may contribute to occupational stress was also performed. All articles written in English, French or Spanish were eligible for conclusion. Study quality was graded using a modified version of the Newcastle-Ottawa Scale. Twenty-five full-text articles were eligible for inclusion in our systematic review. Most were of moderate quality, with two low-quality and two high-quality studies, respectively. While high demand and low job control were commonly featured, other studies demonstrated the role of insufficient support at work, effort-reward imbalance and organisational injustice in the development of adverse health and occupational outcomes. We found only one intervention in a peer-reviewed journal evaluating a stress reduction programme in ED staff. Our review provides a guide to developing interventions that target the origins of stress in the ED. It suggests that those which reduce demand and increase workers' control over their job, improve managerial support, establish better working relationships and make workers' feel more valued for their efforts could be beneficial. We have detailed examples of successful interventions from other fields which may be applicable to this setting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  17. Ectodermal dysplasia (ED) syndrome.

    Science.gov (United States)

    Chee, Siew-Yin; Wanga, Chung-Hsing; Lina, Wei-De; Tsaia, Fuu-Jen

    2014-01-01

    Ectodermal dysplasia (ED) syndrome comprises a large, heterogeneous group of inherited disorders that are defined by primary defects in the development of 2 or more tissues derived from the embryonic ectoderm. The tissues primarily involved are the skin and its appendages (including hair follicles, eccrine glands, sebaceous glands, nails) and teeth. The clinical features include sparse hair, abnormal or missing teeth, and an inability to sweat due to lack of sweat glands. One such case report of ectodermal dysplasia is presented here.

  18. A Model for Predicting Cognitive and Emotional Health from Structural and Functional Neurocircuitry Following Traumatic Brain Injury

    Science.gov (United States)

    2016-10-01

    sports leagues and sports complexes such as: Tucson Women’s Soccer League, Maracana Indoor Sports Arena, and Tucson Indoor Sports Center. We have also...tractography. In Watson, RR & Killgore, WD (Eds), Nutrition and 21 Lifestyle in Neurological Autoimmune Diseases (in press). Published Abstracts...ultimate frisbee (n = 1), soccer (n = 1), ice hockey (n = 2), lacrosse (n = 1), martial arts (n = 2), weight lifting/ gym (n = 4) and track and field (n

  19. CriticalEd

    DEFF Research Database (Denmark)

    Kjellberg, Caspar Mølholt; Meredith, David

    2014-01-01

    . Since the comments are not input sequentially, with regard to position, but in arbitrary order, this list must be sorted by copy/pasting the rows into place—an error-prone and time-consuming process. Scholars who produce critical editions typically use off-the-shelf music notation software......The best text method is commonly applied among music scholars engaged in producing critical editions. In this method, a comment list is compiled, consisting of variant readings and editorial emendations. This list is maintained by inserting the comments into a document as the changes are made......, consisting of a Sibelius plug-in, a cross-platform application, called CriticalEd, and a REST-based solution, which handles data storage/retrieval. A prototype has been tested at the Danish Centre for Music Publication, and the results suggest that the system could greatly improve the efficiency...

  20. [Baltic eugenics: Bio-politics, race and nation in interwar Estonia, Latvia and Lithuania 1918-1940] / Raiko Jäärats

    Index Scriptorium Estoniae

    Jäärats, Raiko, 1980-

    2014-01-01

    Arvustus: Baltic eugenics: Bio-politics, race and nation in interwar Estonia, Latvia and Lithuania 1918-1940 (On the boundary of two worlds. identity, fredom and moral imagination in the Baltics, 35). Hrsg. von Björn M. Felder und Paul J. Weindling. Rodopi, Amsterdam u.a. 2013

  1. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  2. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  3. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  4. Psychological and psychopathological variables associated with eating disorders (ED

    Directory of Open Access Journals (Sweden)

    Antonio Fernández-Delgado

    2016-07-01

    Full Text Available Objective: The aim of this study was to compare some psychological and psychopathological variables usually associated with different types of patients with eating disorders (ED. A total of 22 variables (psychological, psychopathological and specifically related to TCA were analyzed in three groups of patients with anorexia nervosa (AN, bulimia nervosa (BN and eating disorders not otherwise specified (EDNOS. Method: The sample consisted of 76 patients diagnosed with ED (mean age 20.13 ± 6.28 years; 69 women and 7 men. The following questionnaires were administered: Rosenberg's Self-Esteem Scale (SES, Symptom Checklist-90-Revised (SCL-90-R, Beck's Depression Inventory (BDI, State-Trait Anxiety Inventory (STAI, Body Shape Questionnaire (BSQ, Body Appreciation Scale (BAS, Eating Disorder Inventory-2 (EDI-2 and Body Image Quality of Life Inventory (BIQLI-SP. Results: Generally no significant differences between groups, except for the variables related to the BSQ and EDI-2 questionnaires, were found. The study of the correlations among the different variables specifically related to eating disorders and others, showed differences between groups. Conclusions: The present study shows few differences with respect to psychopathological symptoms among the different types of ED. Bearing in mind future studies, it would be interesting to use a bigger sample size, to include more men, and to distinguish between restricted/purging types of ED.

  5. Systematics of the Jaguar catfish genus Liosomadoras Fowler, 1940 (Auchenipteridae: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available Liosomadoras Fowler, 1940 includes two nominal species: L. oncinus, described from the rio Negro in Brazil, and L. morrowi described from the Peruvian Amazon. Both species are known from only few specimens deposited in fish collections, and information on these fishes is scarce. In order to rectify this situation, diagnoses of the genus and its species and an osteological description of L. oncinus are presented based on recently collected specimens. In addition, the taxonomy of the species of Liosomadoras is reviewed, and L. morrowi is confirmed as distinct from L. oncinus, and also distributed in the Brazilian Amazon. Liosomadoras is hypothesized as a relatively basal genus within Auchenipterinae, sister to all other species of the group, except Asterophysus batrachus and Tocantinsia piresi.

  6. National Wood-fuel Programme 2000-2006. Activity Report 2000-2006

    International Nuclear Information System (INIS)

    2008-01-01

    When ADEME launched its Wood-fuel programme throughout all of France in late 1999, its aim was to guide this resource supply chain to maturity and stable development in all user sectors: domestic, multi-family housing, commercial/institutional and industrial applications. To this end the Wood-fuel Programme 2000-2006 was assigned objectives and endowed with significant financial means for studies and coordination in order to support and carry out general-interest projects, piloted by ADEME. The stated goal was to replace fossil fuels, avoid carbon emissions and establish quality assurance standards for household firewood and wood-fired devices. This report presents: 1 - the Wood Energy stakes for the environment, for employment, and for the economy, the biomass energy net benefits; 2 - the Wood Energy key figures: Production and consumption, Single-family homes and wood heating, Breakdown of types of devices used, Sales of wood-fired devices, Number of housing/institutional boilers in use, Number of industrial boilers in use; 3 - the Wood Energy objectives: Domestic heating, Industrial boiler plants, District heating for housing/institutional/commercial uses; 4 - the Wood Energy program operation: Program coordination by ADEME, Partnerships and State-Region planning agreements, 2000-2006 funding system (modified in 2004) and Other financial instruments; 5 - the 2000-2006 assessment: Main results, Conclusions and recommendations, Evaluation contributions: five key points, Evaluation of employment in the solid biofuels supply chain, Supply for community, institutional and commercial boilers; 6 - Information and communication: Initiatives supported or accompanied by ADEME between 2000 and 2004, Publications supported by ADEME. In appendix: fuels and energy content, regional assessments, national research program on bio-energies - PNRB 2006 (Review and stakes, PNRB results in 2006), wood heating R and D, studies funded by ADEME, 2006 ADEME's correspondents, glossary

  7. Real time analysis under EDS

    International Nuclear Information System (INIS)

    Schneberk, D.

    1985-07-01

    This paper describes the analysis component of the Enrichment Diagnostic System (EDS) developed for the Atomic Vapor Laser Isotope Separation Program (AVLIS) at Lawrence Livermore National Laboratory (LLNL). Four different types of analysis are performed on data acquired through EDS: (1) absorption spectroscopy on laser-generated spectral lines, (2) mass spectrometer analysis, (3) general purpose waveform analysis, and (4) separation performance calculations. The information produced from this data includes: measures of particle density and velocity, partial pressures of residual gases, and overall measures of isotope enrichment. The analysis component supports a variety of real-time modeling tasks, a means for broadcasting data to other nodes, and a great degree of flexibility for tailoring computations to the exact needs of the process. A particular data base structure and program flow is common to all types of analysis. Key elements of the analysis component are: (1) a fast access data base which can configure all types of analysis, (2) a selected set of analysis routines, (3) a general purpose data manipulation and graphics package for the results of real time analysis. Each of these components are described with an emphasis upon how each contributes to overall system capability. 3 figs

  8. Systematic Review of ED-based Intimate Partner Violence Intervention Research

    Directory of Open Access Journals (Sweden)

    Esther K. Choo,

    2015-12-01

    Full Text Available Introduction: Assessment reactivity may be a factor in the modest results of brief interventions for substance use in the emergency department (ED. The presence of assessment reactivity in studies of interventions for intimate partner violence (IPV has not been studied. Our objectives were to identify ED IPV intervention studies and evaluate the presence of a consistently positive effect on the control groups. Methods: We performed a systematic search of electronic databases for English=language intervention studies addressing IPV in the ED published since 1990. Study selection and assessment of methodologic quality were performed by two independent reviewers. Data extraction was performed by one reviewer and then independently checked for completeness and accuracy by a second reviewer. Results: Of 3,620 unique manuscripts identified by database search, 667 underwent abstract review and 12 underwent full-text review. Only three met full eligibility criteria; data on the control arm were available for two studies. In these two studies, IPV-related outcomes improved for both the experimental and control condition. Conclusion: The paucity of controlled trials of IPV precluded a robust evaluation for assessment reactivity. This study highlighted a critical gap in ED research on IPV.

  9. Electroencephalography findings in patients presenting to the ED for evaluation of seizures.

    Science.gov (United States)

    Kadambi, Pooja; Hart, Kimberly W; Adeoye, Opeolu M; Lindsell, Christopher J; Knight, William A

    2015-01-01

    Status epilepticus is a life-threatening, time-sensitive emergency. Acquiring an electroencephalogram (EEG) in the emergency department (ED) could impact therapeutic and disposition decisions for patients with suspected status epilepticus. The objective of this study is to estimate the proportion of EEGs diagnostic for seizures in patients presenting to an ED with a complaint of seizures. This retrospective chart review included adults presenting to the ED of an urban, academic, tertiary care hospital with suspected seizures or status epilepticus, who received an EEG within 24 hours of hospital admission. Data abstraction was performed by a single, trained, nonblinded abstractor. Seizures were defined as an epileptologist's diagnosis of either seizures or status epilepticus on EEG. The proportion of patients with seizures is given with confidence interval95 (CI95). Of 120 included patients, 67 (56%) had a history of epilepsy. Mean age was 52 years (SD, 16), 58% were White, and 61% were male. Within 24 hours, 3% had an EEG diagnostic for seizures. Electroencephalogram was obtained in the ED in 32 (27%) of 120 (CI95, 19%-35%), and 2 (6%) of 32 (CI95, 1%-19%) had seizures. Electroencephalogram was performed inpatient for 88 (73%) of 120 (CI95, 65%-81%), and 2 (2%) of 88 (CI95, 0.5%-7.1%) had seizures. Only 3% of ED patients with suspected seizures or status epilepticus had EEG confirmation of seizures within 24 hours. Early EEG acquisition in the ED may identify a group of patients amenable to ED observation and subsequent discharge from the hospital. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. CERN Technical Training 2006: Software and System Technologies Curriculum - Scheduled Course Sessions (October-December 2006)

    CERN Multimedia

    2006-01-01

    he Software and System Technologies Curriculum of the CERN Technical Training Programme offers comprehensive training in C++, Java, Perl, Python, XML, OO programming, JCOP/PVSS, database design and Oracle. In the PERL, C++, OO and Java course series there are some places available on the following course sessions, scheduled until the end of this year: Object-Oriented Analysis and Design using UML: 17-19 October 2006 (3 days) JAVA 2 Enterprise Edition - Part 1: Web Applications: 19-20 October 2006 (2 days) JAVA - Level 1: 30 Oct. -1 Nov. 2006 (3 days) PERL 5 - Advanced Aspects: 2 November 2006 (1 day) C++ Programming Part 1 - Introduction to Object-Oriented Design and Programming: 14-16 November 2006 (3 days) JAVA - Level 2: 4-7 December 2006 (4 days) C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls: 12-15 December 2006 (4 days) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans : 18.20 December 2006 (3 days) All the above sessions will be given in English, at the CERN Training Centre....

  12. The statistical mind in modern society. The Netherlands 1850-1940. Volume I: official Statistics, social progress and modern enterprise

    NARCIS (Netherlands)

    Maarseveen, J.G.S.J. van; Klep, P.M.M.; Stamhuis, I.H.

    2008-01-01

    In the period 1850-1940 statistics developed as a new combination of theory and practice. A wide range of phenomena were looked at in a novel way and this statistical mindset had a pervasive influence in contemporary society. This development of statistics is closely interlinked with the process of

  13. Multiplex immunoassays for quantification of cytokines, growth factors, and other proteins in stem cell communication

    Czech Academy of Sciences Publication Activity Database

    Valeková, Ivona; Kupcová Skalníková, Helena; Jarkovská, Karla; Motlík, Jan; Kovářová, Hana

    -, č. 1212 (2015), s. 39-63 ISSN 1940 -6029 R&D Projects: GA MŠk ED2.1.00/03.0124; GA TA ČR(CZ) TA01011466 Institutional support: RVO:67985904 Keywords : multiplex immunoassays * antibody microarray * luminex xMAP Subject RIV: EB - Genetics ; Molecular Biology

  14. Behavioral deficits in adult rats treated neonatally with glutamate

    Czech Academy of Sciences Publication Activity Database

    Hliňák, Zdeněk; Gandalovičová, D.; Krejčí, I.

    2005-01-01

    Roč. 27, č. 3 (2005), s. 465-473 ISSN 0892-0362 R&D Projects: GA MZd(CZ) NF6474 Institutional research plan: CEZ:AV0Z5011922 Keywords : neonatal treatment * monosodium glutamate * long-term effect Subject RIV: ED - Physiology Impact factor: 1.940, year: 2005

  15. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Multiple Intelligence and Digital Learning Awareness of Prospective B.Ed Teachers

    Science.gov (United States)

    Gracious, F. L. Antony; Shyla, F. L. Jasmine Anne

    2012-01-01

    The present study Multiple Intelligence and Digital Learning Awareness of prospective B.Ed teachers was probed to find the relationship between Multiple Intelligence and Digital Learning Awareness of Prospective B.Ed Teachers. Data for the study were collected using self made Multiple Intelligence Inventory and Digital Learning Awareness Scale.…

  17. Newcastle Disease Viruses Causing Recent Outbreaks Worldwide Show Unexpectedly High Genetic Similarity to Historical Virulent Isolates from the 1940s

    Science.gov (United States)

    Dimitrov, Kiril M.; Lee, Dong-Hun; Williams-Coplin, Dawn; Olivier, Timothy L.; Miller, Patti J.

    2016-01-01

    Virulent strains of Newcastle disease virus (NDV) cause Newcastle disease (ND), a devastating disease of poultry and wild birds. Phylogenetic analyses clearly distinguish historical isolates (obtained prior to 1960) from currently circulating viruses of class II genotypes V, VI, VII, and XII through XVIII. Here, partial and complete genomic sequences of recent virulent isolates of genotypes II and IX from China, Egypt, and India were found to be nearly identical to those of historical viruses isolated in the 1940s. Phylogenetic analysis, nucleotide distances, and rates of change demonstrate that these recent isolates have not evolved significantly from the most closely related ancestors from the 1940s. The low rates of change for these virulent viruses (7.05 × 10−5 and 2.05 × 10−5 per year, respectively) and the minimal genetic distances existing between these and historical viruses (0.3 to 1.2%) of the same genotypes indicate an unnatural origin. As with any other RNA virus, Newcastle disease virus is expected to evolve naturally; thus, these findings suggest that some recent field isolates should be excluded from evolutionary studies. Furthermore, phylogenetic analyses show that these recent virulent isolates are more closely related to virulent strains isolated during the 1940s, which have been and continue to be used in laboratory and experimental challenge studies. Since the preservation of viable viruses in the environment for over 6 decades is highly unlikely, it is possible that the source of some of the recent virulent viruses isolated from poultry and wild birds might be laboratory viruses. PMID:26888902

  18. Mechanical Ventilation and ARDS in the ED: A Multicenter, Observational, Prospective, Cross-sectional Study.

    Science.gov (United States)

    Fuller, Brian M; Mohr, Nicholas M; Miller, Christopher N; Deitchman, Andrew R; Levine, Brian J; Castagno, Nicole; Hassebroek, Elizabeth C; Dhedhi, Adam; Scott-Wittenborn, Nicholas; Grace, Edward; Lehew, Courtney; Kollef, Marin H

    2015-08-01

    There are few data regarding mechanical ventilation and ARDS in the ED. This could be a vital arena for prevention and treatment. This study was a multicenter, observational, prospective, cohort study aimed at analyzing ventilation practices in the ED. The primary outcome was the incidence of ARDS after admission. Multivariable logistic regression was used to determine the predictors of ARDS. We analyzed 219 patients receiving mechanical ventilation to assess ED ventilation practices. Median tidal volume was 7.6 mL/kg predicted body weight (PBW) (interquartile range, 6.9-8.9), with a range of 4.3 to 12.2 mL/kg PBW. Lung-protective ventilation was used in 122 patients (55.7%). The incidence of ARDS after admission from the ED was 14.7%, with a mean onset of 2.3 days. Progression to ARDS was associated with higher illness severity and intubation in the prehospital environment or transferring facility. Of the 15 patients with ARDS in the ED (6.8%), lung-protective ventilation was used in seven (46.7%). Patients who progressed to ARDS experienced greater duration in organ failure and ICU length of stay and higher mortality. Lung-protective ventilation is infrequent in patients receiving mechanical ventilation in the ED, regardless of ARDS status. Progression to ARDS is common after admission, occurs early, and worsens outcome. Patient- and treatment-related factors present in the ED are associated with ARDS. Given the limited treatment options for ARDS, and the early onset after admission from the ED, measures to prevent onset and to mitigate severity should be instituted in the ED. ClinicalTrials.gov; No.: NCT01628523; URL: www.clinicaltrials.gov.

  19. Towards a reinterpretation of Normal Science: Kuhn and the Physics of his time (1940-1951

    Directory of Open Access Journals (Sweden)

    Mayoral de Lucas, Juan Vicente

    2011-06-01

    Full Text Available This paper deals with Thomas Kuhn’s experience as a physicist — his training in the field, his brief period as a physicist during World War II, and his doctoral research — from 1940 to 1951. Its aim is to offer a basis to assess statements as Mara Beller’s (1999 that Kuhn’s account of normal science is partially founded on personal circumstances and experience, and not only on the historical record or available evidence from the sociology of science — a thesis here considered highly credible.

    Este artículo habla de la experiencia de Thomas Kuhn como físico: su educación en la disciplina, su servicio como experto durante la Segunda Guerra Mundial, y su investigación doctoral. Estudiamos un lapso de tiempo que va de 1940 a 1951. El objetivo en última instancia es ofrecer base empírica para valorar una afirmación como la de Mara Beller (1999, que dice que la descripción kuhniana de la ciencia normal está parcialmente basada en circunstancias y experiencias personales, no sólo en los datos históricos o en la evidencia disponible de la sociología de la ciencia. En este artículo se establece que dicha tesis es plausible.

  20. [Strategies, actors, promises and fears in the smallpox vaccinations campaigns in Mexico: from the Porfiriato to the Post-revolution (1880-1940)].

    Science.gov (United States)

    Agostoni, Claudia

    2011-02-01

    The article examines some of the strategies employed by the Mexican health authorities that led to the organization of massive and obligatory smallpox vaccination campaigns from the late 1880s to the 1940s, a period of Mexican history that corresponds to the Porfirio Díaz regime (1877-1911), to the armed phase of the Mexican Revolution (1910-1920), and to the first two decades of the Post-revolutionary governments (1920-1940). Attention will be placed of the vaccination programs in the main urban settings, notably in Mexico City, as well as the gradual but decisive organization and regulation of vaccination campaigns in the heterogeneous rural milieu. Furthermore, the importance that hygienic education acquired will be explored, as well as the divergent and contested responses that emerged due to the obligatory vaccination campaigns, responses that included resistance, fear, uncertainty and widespread acceptance.

  1. Sobre “Monumentalidade e Espaço Públic Lourenço Marques (1930-1940” de Gerbert Verheij

    Directory of Open Access Journals (Sweden)

    José Guilherme Abreu

    2012-01-01

    Full Text Available This article reproduces the reasoning by Prof. Abreu, on the jury to evaluate the master thesis in History of Art, “Monumentality and Public Space in Lourenço Marques (1930-1940” by Gerbert Verheij, held in Faculty of Social Sciences and Humanities at the Universidade Nova de Lisboa on January 3, 2012

  2. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  3. Cosmic-ray work with emulsions in the 1940s and 1950s

    International Nuclear Information System (INIS)

    Perkins, D.H.

    1989-01-01

    This chapter considers technical advances made in the 1940s and 1950s in the production of photographic emulsions for use in detecting and studying cosmic rays. The discovery, of the pion predicted theoretically by Yukawa in 1947 is described, and the dependance of its discovery on the new sensitive emulsions noted. The paper also charts work by physicists in a number of countries on kaons, the other intermediate mass particles discovered at this time. Later technical advances included thicker emulsions (up to 1,000 μm) and very large polyethylene balloons to take experimental apparatus up into the high cosmic-ray intensity stratosphere. Many of the balloon experiments were international collaborations. (UK)

  4. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  5. AdvancED Flex 4

    CERN Document Server

    Tiwari, Shashank; Schulze, Charlie

    2010-01-01

    AdvancED Flex 4 makes advanced Flex 4 concepts and techniques easy. Ajax, RIA, Web 2.0, mashups, mobile applications, the most sophisticated web tools, and the coolest interactive web applications are all covered with practical, visually oriented recipes. * Completely updated for the new tools in Flex 4* Demonstrates how to use Flex 4 to create robust and scalable enterprise-grade Rich Internet Applications.* Teaches you to build high-performance web applications with interactivity that really engages your users.* What you'll learn Practiced beginners and intermediate users of Flex, especially

  6. changes in activities of enzymes of glutamate metabolism in rat ...

    African Journals Online (AJOL)

    Eth. j Sci. & Technci 4(1 ; 45-56. 2006. iSSN 1816-3375 phenyi glyoxal etc (Elliot, 1951; ..... B. and Watson. ... In: Keler, L. J. Jr., Garattini, S., Kare, M.R., Reynolds, ... Patel, A J, Weir, M.D., Hunt, A., Tahourdin, C.S.M. and Thomas, D G.J. (1985).

  7. Report on the perception of the Soviet-Estonian relations by the inhabitants of the Pechora region in 1939-1940 / Nadezhda Lebedeva

    Index Scriptorium Estoniae

    Lebedeva, Nadezhda

    2000-01-01

    Sotsioloogilisest küsitlusest, mille eesmärgiks oli uurida maaelanike majandustegevust piiriäärsetel aladel. Pihkva oblasti Kruppi küla elanikelt küsiti ka nende arvamust selle kohta, kuidas nad hindasid poliitilist olukorda 1939.-1940. a.

  8. Swiss electricity statistics 2006

    International Nuclear Information System (INIS)

    2007-01-01

    This comprehensive report made by the Swiss Federal Office of Energy (SFOE) presents the statistics on electricity production and usage in Switzerland for the year 2006. First of all, an overview of Switzerland's electricity supply in 2006 is presented. Details are noted of the amounts generated by different sources including nuclear, hydro-power, storage schemes and thermal power stations as well as energy transfer with neighbouring countries. A second chapter takes a look at the balance of imports and exports with illustrative flow diagrams along with tables for total figures from 1950 through to 2006. For the summer and winter periods, figures from 1995 to 2006 are presented. The third chapter examines the production of electricity in the various types of power stations and the developments over the years 1950 to 2006, whereby, for example, statistics on regional generation and power station type are looked at. The fourth chapter looks at electricity consumption in various sectors from 1983 to 2006 and compares the figures with international data. The fifth chapter looks at generation, consumption and loading on particular, selected days and chapter six considers energy exchange with Switzerland's neighbours. Chapter seven takes a look at possibilities for extending generation facilities in the period up to 2013

  9. EdD Students’ Self-Efficacy and Interest in Conducting Research

    Directory of Open Access Journals (Sweden)

    Monica R Kerrigan

    2016-03-01

    Full Text Available Today’s educational practitioners are expected to know how to gather, analyze, and report on data for accountability purposes and to use that information to improve student outcomes. However, there is little understanding of how to support practitioners’ learning of and engagement with research and few studies on the research experiences of students enrolled in Doctorate of Education (EdD programs. The success of students enrolled in Doctor of Philosophy (PhD programs in conducting research has been found to be related to students’ self-efficacy and interest, but these concepts have not been explored with EdD students who are more likely to engage in applied research in their workplace than to create a research-focused career. This study sought to understand the self-efficacy and interest that EdD students enrolled in an Educational Leadership program have in research skills and tasks in order to improve research course offerings. Our findings with EdD students are consistent with existing research on PhD students regarding research self-efficacy but we did not observe significant changes in students’ interest over time. We suggest avenues for future study in light of current accountability reporting requirements for practitioners.

  10. Learning from Health Care Workers' Opinions for Improving Quality ...

    African Journals Online (AJOL)

    hanumantp

    was on management and follow‑up of neonatal cases 47.5% (19/40), second on a need ... the tertiary referral hospital (Pearson χ2 [2] = 53.8; P < 0.001). ...... Dar es Salaam, [Accessed on 13th July, .... Child Fetal Neonatal Ed 2008;93:F69‑73.

  11. Maailma turism 2006 / Piret Kallas

    Index Scriptorium Estoniae

    Kallas, Piret

    2007-01-01

    2006. aastal tehti kogu maailmas 842 miljonit ööbimisega välisreisi, mis on 4,5 protsenti enam kui 2005. aastal. Maailma turismitrendid 2006-2007, prognoos 2007. aastaks. Euroopa turismi arengust 2006. aastal. Allikas: UNWTO World Tourism Barometer, jaan. 2007

  12. Analysis of microtraces in invasive traumas using SEM/EDS.

    Science.gov (United States)

    Vermeij, E J; Zoon, P D; Chang, S B C G; Keereweer, I; Pieterman, R; Gerretsen, R R R

    2012-01-10

    Scanning electron microscopy in combination with energy-dispersive X-ray spectrometry (SEM/EDS) is a proven forensic tool and has been used to analyze several kinds of trace evidence. A forensic application of SEM/EDS is the examination of morphological characteristics of tool marks that tools and instruments leave on bone. The microtraces that are left behind by these tools and instruments on the bone are, however, often ignored or not noticed at all. In this paper we will describe the use of SEM/EDS for the analysis of microtraces in invasive sharp-force, blunt-force and bone-hacking traumas in bone. This research is part of a larger multi-disciplinary approach in which pathologists, forensic anthropologists, toolmark and microtrace experts work together to link observed injuries to a suspected weapon or, in case of an unknown weapon, to indicate a group of objects that could have been used as a weapon. Although there are a few difficulties one have to consider, the method itself is rather simple and straightforward to apply. A sample of dry and clean bone is placed into the SEM sample chamber and brightness and contrast are set such that bone appears grey, metal appears white and organic material appears black. The sample is then searched manually to find relevant features. Once features are found their elemental composition is measured by an energy dispersive X-ray spectrometer (EDS). This method is illustrated using several cases. It is shown that SEM/EDS analysis of microtraces in bone is a valuable tool to get clues about an unknown weapon and can associate a specific weapon with injuries on the basis of appearance and elemental composition. In particular the separate results from the various disciplines are complementary and may be combined to reach a conclusion with a stronger probative value. This is not only useful in the courtroom but above all in criminal investigations when one have to know for what weapon or object to look for. Copyright © 2011

  13. Youth Homelessness 2006

    Science.gov (United States)

    MacKenzie, David; Chamberlain, Chris

    2008-01-01

    The third national census of homeless school students, conducted in 2006, found that the number of homeless students had decreased since 2001. There were 9,389 homeless students in 2006 compared with 12,227 in 2001. Three groups were over-represented in the homeless population: Indigenous students, young people from single parent and blended…

  14. Approaches for quantifying antimicrobial consumption per animal species based on national sales data: a Swiss example, 2006 to 2013.

    Science.gov (United States)

    Carmo, Luís P; Schüpbach-Regula, Gertraud; Müntener, Cedric; Chevance, Anne; Moulin, Gérard; Magouras, Ioannis

    2017-02-09

    Antimicrobial use in animals is known to contribute to the global burden of antimicrobial resistance. Therefore, it is critical to monitor antimicrobial sales for livestock and pets. Despite the availability of veterinary antimicrobial sales data in most European countries, surveillance currently lacks consumption monitoring at the animal species level. In this study, alternative methods were investigated for stratifying antimicrobial sales per species using Swiss data (2006-2013). Three approaches were considered: (i) Equal Distribution (ED) allocated antimicrobial sales evenly across all species each product was licensed for; (ii) Biomass Distribution (BMD) stratified antimicrobial consumption, weighting the representativeness of each species' total biomass; and (iii) Longitudinal Study Extrapolation (LSE) assigned antimicrobial sales per species based on a field study describing prescription patterns in Switzerland. LSE is expected to provide the best estimates because it relies on field data. Given the Swiss example, BMD appears to be a reliable method when prescription data are not available, whereas ED seems to underestimate consumption in species with larger populations and higher treatment intensity. These methods represent a valuable tool for improving the monitoring systems of veterinary antimicrobial consumption across Europe. This article is copyright of The Authors, 2017.

  15. Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

    Directory of Open Access Journals (Sweden)

    Ana V García

    2010-07-01

    Full Text Available An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1. In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

  16. Monopoly of Force: The Nexus of DDR and SSR

    Science.gov (United States)

    2011-01-01

    Washington, DC, May 4, 2010. 52 Vanessa Farr, Albrecht Schnabel, and Henri Myrttinen, eds., Sexed Pistols: Gendered Impacts of Small Arms and...discussion of various lessons learned see Edward Bell and Charlotte Watson, DDR: Sup- porting Security and Development: The EU’s Added Value, London...45 Specker, The R-Phase of DDR Processes, 4. 46 This distinction has been made by many authors. See, for example, Ball and van de Goor, 2–3; Mark

  17. Self-Esteem and Emotional Intelligence among B.Ed Trainees of Tsunami Affected Coastal Belt

    Science.gov (United States)

    Babu M, Sameer

    2008-01-01

    Through this study the author investigates the relationship between self-esteem and emotional intelligence among B.Ed trainees of Tsunami affected coastal belt of Alappey district of Kerala, India. Stream of study, marital status and age based comparisons were made among the B.Ed trainees. 92 B.Ed trainees were the participants in the study. It…

  18. Diseños de plantación y formación de árboles frutales (7ª ed.)

    OpenAIRE

    Cambra Ruiz de Velasco, Mariano; Cambra Ruiz de Velasco, Rafael

    1983-01-01

    158 Pags., 45 Figs., Tabls. ** Historia de las ediciones anteriores y posteriores: 1ª ed., 1962; 2ª ed., 1964; 3ª ed., 1966; 4ª ed., 1967; 5ª ed., 1971; 6ª ed., 1974; 8ª ed., 1991. ** Última edición, en 2004, por CSIC: Diseños de plantación y formación de árboles frutales / M. Cambra Ruiz de Velasco, R. Cambra Ruiz de Velasco.-- Madrid : Consejo Superior de Investigaciones Científicas, 2004.-- [149] p. ; 24 cm.-- (Biblioteca de ciencias, 16).

  19. Vývojové prostředí NetBeans

    OpenAIRE

    Pitka, Lukáš

    2007-01-01

    Tato bakalářská práce představuje základní aspekty vývojového prostředí NetBeans IDE. NetBeans IDE je prostředí pro programovací jazyk Java. Práce je napsána jako příručka pro uživatele začínající s NetBeans IDE, přičemž se předpokládá se určitá znalost programovacího jazyka Java. Hlavním přínosem práce je usnadnění a zefektivnění práce s NetBeans IDE. První kapitola práce je spíše teoretická, zabývá se obecně pojmem vývojové prostředí. V dalších částech jsou rozebírány aspekty NetBeans IDE, ...

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  1. Perceptions of empowerment among ED nurses.

    Science.gov (United States)

    DeVivo, Diane; Quinn Griffin, Mary T; Donahue, Moreen; Fitzpatrick, Joyce J

    2013-11-01

    Nurses' perceptions of empowerment have been linked to a number of variables in the hospital workplace, including job satisfaction, autonomy, and work effectiveness. Yet there have been no previous studies of perceptions of empowerment specifically among emergency department (ED) nurses. Registered nurses (RNs) employed in the EDs of 6 hospitals in a major health care system in the eastern United States were surveyed regarding their perceptions of empowerment. Of the 240 RNs eligible to participate, there were 167 usable surveys. There was a moderate level of empowerment among the RNs who participated, consistent with the level of empowerment reported in several other studies of staff nurses and nurses in other positions. The moderate level of empowerment in this sample may be attributed to the many opportunities for RN involvement in the hospitals within this health care system. Nurse leaders can initiate programs focused on enhancing RN perceptions of empowerment. In addition, there is a need for further research among RNs with different specialty preparation. Copyright © 2013. Published by Mosby, Inc.

  2. Castelao en Buenos Aires, 1940-1950

    Directory of Open Access Journals (Sweden)

    Henrique Monteagudo

    2016-05-01

    Full Text Available En la presente aportación nos proponemos ofrecer una visión sintética de la trayectoria de Alfonso D. Rodríguez Castelao (Rianxo, 1986― Buenos Aires, 1950 durante la década 1940-1950. Esta década, que transcurrió casi completamente en Buenos Aires, constituyó una etapa importantísima no sólo de su biografía sino también de su proyección hacia la comunidad gallega transoceánica (la “Galicia ideal” que él mismo contribuyó decisivamente a construir, y, al mismo tiempo, de la forja de su imagen como figura clave de esa comunidad. Contemplaremos su actuación en el plano de la acción política en el marco del exilio español y en estrecha relación con los nacionalistas vascos y catalanes, con particular atención a su proyección en la comunidad gallega del Plata ―compuesta por emigrantes y exiliados, con sus tensiones internas― y a sus complejas relaciones con la resistencia galleguista del interior. Analizaremos los dilemas entre sus dimensiones artística y política, en las que se encarna la contraposición que él mismo establece entre la Tradición y la Historia de un pueblo con personalidad cultural propia que reivindica como nación. Finalmente, comprobaremos cómo se desarrollan discursivamente estas tensiones en su pieza oratoria más importante, “Alba de Gloria”.

  3. When Lions Write History: Black History Textbooks, African-American Educators, & the Alternative Black Curriculum in Social Studies Education, 1890-1940

    Science.gov (United States)

    King, LaGarrett J.

    2014-01-01

    The African proverb, "Until the lions have their historians, tales of the hunt shall always glorify the hunter," is used to metaphorically describe how dominant groups inscribe power through historical narrative. In this article the author discusses how African-American educators between the years of 1890-1940 conceptualized citizenship…

  4. «Short Course in History of Ukraine» in the Context of Soviet Scientific History of late 1940s

    Directory of Open Access Journals (Sweden)

    Lubov A. Sidorova

    2012-06-01

    Full Text Available The contribution considers one of the events of ideological campaign, struggling for cosmopolitism, bourgeois objectivism and nationalism in Soviet historical science of the late 1940s. Special attention is attached to the consideration of the model “Short Course in History of Ukraine” as the instrument of political and ideological verification.

  5. Elektroonilise side andmete säilitamise saaga sai lahenduse, Eestis siiski veel mitte / Uno Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Uno, 1952-

    2016-01-01

    Euroopa Liidu direktiivist 2006/24/EÜ, mis käsitleb elektrooniliste sideteenuste ja sidevõrkude pakkujate tegevusega kaasnevate või nende töödeldud andmete säilitamist. Euroopa Kohtu otsusest asjas Tele2 Sverige ja Watson jt. Euroopa Kohtu seisukohtadest liiklus- ja asukohaandmete säilitamise kohta. Asjakohasest õiguslikust raamistikust Eestis

  6. ED utilization trends in sports-related traumatic brain injury.

    Science.gov (United States)

    Hanson, Holly R; Pomerantz, Wendy J; Gittelman, Mike

    2013-10-01

    Emergency department (ED) visits for sports-related traumatic brain injuries (TBIs) have risen. This study evaluated how the number and severity of admissions have changed as ED visits for sports-related TBIs have increased. A retrospective study of children aged 0 to 19 years at a level 1 trauma center was performed. Patients from 2002 to 2011 with a primary or secondary diagnosis of TBI were identified from the hospital's inpatient and outpatient trauma registries. Frequencies were used to characterize the population, χ(2) analysis was performed to determine differences between groups, and regression analysis looked at relationship between year and injury severity score or length of stay. Sport was responsible for injury in 3878 (15.4%) cases during the study period; 3506 (90.4%) were discharged from the hospital, and 372 (9.6%) were admitted. Seventy-three percent were male patients and 78% Caucasian; mean age was 13 ± 3.5 years. ED visits for sports-related TBIs increased 92% over the study period, yet there was no significant change (χ(2) = 9.8, df = 9, P = .37) in the percentage of children admitted. Mean injury severity score for those admitted decreased from 7.8 to 4.8 (β = -0.46; P = .006); length of stay trended downward (β = -0.05; P = .05). The percentage of children being admitted from the ED with sports-related TBI has not changed over the past 10 years. The severity of admitted sports-related TBI is decreasing. Additional research is needed to correlate these trends with other TBI mechanisms.

  7. Bio-EdIP: An automatic approach for in vitro cell confluence images quantification.

    Science.gov (United States)

    Cardona, Andrés; Ariza-Jiménez, Leandro; Uribe, Diego; Arroyave, Johanna C; Galeano, July; Cortés-Mancera, Fabian M

    2017-07-01

    Cell imaging is a widely-employed technique to analyze multiple biological processes. Therefore, simple, accurate and quantitative tools are needed to understand cellular events. For this purpose, Bio-EdIP was developed as a user-friendly tool to quantify confluence levels using cell culture images. The proposed algorithm combines a pre-processing step with subsequent stages that involve local processing techniques and a morphological reconstruction-based segmentation algorithm. Segmentation performance was assessed in three constructed image sets, comparing F-measure scores and AUC values (ROC analysis) for Bio-EdIP, its previous version and TScratch. Furthermore, segmentation results were compared with published algorithms using eight public benchmarks. Bio-EdIP automatically segmented cell-free regions from images of in vitro cell culture. Based on mean F-measure scores and ROC analysis, Bio-EdIP conserved a high performance regardless of image characteristics of the constructed dataset, when compared with its previous version and TScratch. Although acquisition quality of the public dataset affected Bio-EdIP segmentation, performance was better in two out of eight public sets. Bio-EdIP is a user-friendly interface, which is useful for the automatic analysis of confluence levels and cell growth processes using in vitro cell culture images. Here, we also presented new manually annotated data for algorithms evaluation. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Torrefied Biomass Pellets—Comparing Grindability in Different Laboratory Mills

    Directory of Open Access Journals (Sweden)

    Jan Hari Arti Khalsa

    2016-10-01

    Full Text Available The firing and co-firing of biomass in pulverized coal fired power plants around the world is expected to increase in the coming years. Torrefaction may prove to be a suitable way of upgrading biomass for such an application. For transport and storage purposes, the torrefied biomass will tend to be in pellet form. Whilst standard methods for the assessment of the milling characteristics of coal exist, this is not the case for torrefied materials—whether in pellet form or not. The grindability of the fuel directly impacts the overall efficiency of the combustion process and as such it is an important parameter. In the present study, the grindability of different torrefied biomass pellets was tested in three different laboratory mill types; cutting mill (CM, hammer mill (HM and impact mill (IM. The specific grinding energy (SGE required for a defined mass throughput of pellets in each mill was measured and results were compared to other pellet characterization methods (e.g., durability, and hardness as well as the modified Hardgrove Index. Seven different torrefied biomass pellets including willow, pine, beech, poplar, spruce, forest residue and straw were used as feedstock. On average, the particle-size distribution width (across all feedstock was narrowest for the IM (0.41 mm, followed by the HM (0.51 mm and widest for the CM (0.62 mm. Regarding the SGE, the IM consumed on average 8.23 Wh/kg while CM and HM consumed 5.15 and 5.24 Wh/kg, respectively. From the three mills compared in this study, the IM seems better fit for being used in a standardized method that could be developed in the future, e.g., as an ISO standard.

  9. Treatment motivation of men with ED: what motivates men with ED to seek professional help and how can women support their partners?

    Science.gov (United States)

    Gerster, S; Günzler, C; Roesler, C; Leiber, C; Berner, M M

    2013-01-01

    Although ED can impair sexual satisfaction as well as the quality of partnership and life, men affected often avoid seeking treatment. There is growing evidence that women have an influence on their partner's help-seeking behavior. This qualitative study examined men with ED and their female partners in order to detect motivational factors for men to seek treatment and motivational actions of the women to support their partners. Twelve couples took part in a semi-structured telephone interview, which was performed separately in men and women. Analysis was on the basis of the Grounded Theory. The identified motivational factors could be divided into extrinsic (for example, media, female partner) and intrinsic (for example, desire to clarify the cause of the ED, hope for improvement) factors. Women can support their partners in treatment-seeking through various motivational actions such as talking with each other, showing interest and dealing actively with the problem, appealing to the male self-esteem, supporting the doctor's visit, forcing the treatment, active cooperation and participation in the treatment or initiating sexual intercourse. On the basis of these findings, recommendations for women were developed to support their partners and increase the probability of help-seeking behavior.

  10. Diseños de plantación y formación de árboles frutales (8ª ed.)

    OpenAIRE

    Cambra Ruiz de Velasco, Mariano; Cambra Ruiz de Velasco, Rafael

    1991-01-01

    164 Pags., con 45 Figs. y 9 Tabls. ** Historia de las ediciones anteriores: 1ª ed., 1962; 2ª ed., 1964; 3ª ed., 1966; 4ª ed., 1967; 5ª ed., 1971 (Incorpora Sistemas de formación de apéndice); 6ª ed., 1974; 7ª ed., 1983. ** Última edición, en 2004, por CSIC: Diseños de plantación y formación de árboles frutales / M. Cambra Ruiz de Velasco, R. Cambra Ruiz de Velasco.-- Madrid : Consejo Superior de Investigaciones Científicas, 2004.-- [149] p. ; 24 cm.-- (Biblioteca de ciencia...

  11. Historical Submerged Aquatic Vegetation (SAV) Distributions from Coastal Alabama, Gulf of Mexico from 1940-01-01 to 1966-10-21 (NCEI Accession 0162477)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Historic black and white aerial photographs of coastal Alabama (Mobile Bay and adjacent waters) from 1940, 1955, and 1966 were digitized and georeferenced using Blue...

  12. Cytoplasmic Streaming - Skylab Student Experiment ED-63

    Science.gov (United States)

    1973-01-01

    This chart describes the Skylab student experiment (ED-63), Cytoplasmic Streaming, proposed by Cheryl A. Peitz of Arapahoe High School, Littleton, Colorado. Experiment ED-63 was to observe the effect of zero-gravity on cytoplasmic streaming in the aquatic plant named Elodea, commonly called water weed or water thyme. The phenomenon of cytoplasmic streaming is not well understood, but it is recognized as the circulation mechanism of the internal materials or cytoplasm of a cell. Cytoplasm is a gelatinous substance that has the ability to change its viscosity and flow, carrying various cell materials with it. The activity can be stimulated by sunlight or heat. In March 1972, NASA and the National Science Teachers Association selected 25 experiment proposals for flight on Skylab. Science advisors from the Marshall Space Flight Center aided and assisted the students in developing the proposals for flight on Skylab.

  13. Cross-sectional analysis of fouled SWRO membranes by STEM-EDS

    KAUST Repository

    Aubry, Cyril

    2014-01-01

    The intact cross-section of two fouled reverse osmosis membranes was characterized using a scanning transmission electron microscope (STEM) equipped with an electron energy dispersive spectroscope (EDS). Focused ion beam (FIB) was used to prepare a thin lamella of each membrane. These lamellas were then attached to a TEM grid for further STEM/EDS analysis. The foulant in sample A was mainly inorganic in nature and predominantly composed of alumino-silicate particles. These particles were surrounded by carbon at high concentrations, indicating the presence of organic materials. Iron was diffusely present in the cake layer and this could have enhanced the fouling process. The cake layer of membrane B was mainly consisted of organic matter (C, O, and N representing 95% of the total elemental composition) and organized in thin parallel layers. Small concentrations of Si, F, Na, Mg, and Cl were detected inside the active layer and support layer of the membrane. Due to the high sensitivity of the cake layer of membrane A to the electron beam, STEM/EDS line analyses might have been performed on large areas. On the other hand, the cake layer of sample B was resistant to the electron beam and the resolution of STEM/EDS was gradually improved until obtaining a resolution of 25. nm. © 2013 Elsevier B.V.

  14. Using Google Flu Trends data in forecasting influenza-like-illness related ED visits in Omaha, Nebraska.

    Science.gov (United States)

    Araz, Ozgur M; Bentley, Dan; Muelleman, Robert L

    2014-09-01

    Emergency department (ED) visits increase during the influenza seasons. It is essential to identify statistically significant correlates in order to develop an accurate forecasting model for ED visits. Forecasting influenza-like-illness (ILI)-related ED visits can significantly help in developing robust resource management strategies at the EDs. We first performed correlation analyses to understand temporal correlations between several predictors of ILI-related ED visits. We used the data available for Douglas County, the biggest county in Nebraska, for Omaha, the biggest city in the state, and for a major hospital in Omaha. The data set included total and positive influenza test results from the hospital (ie, Antigen rapid (Ag) and Respiratory Syncytial Virus Infection (RSV) tests); an Internet-based influenza surveillance system data, that is, Google Flu Trends, for both Nebraska and Omaha; total ED visits in Douglas County attributable to ILI; and ILI surveillance network data for Douglas County and Nebraska as the predictors and data for the hospital's ILI-related ED visits as the dependent variable. We used Seasonal Autoregressive Integrated Moving Average and Holt Winters methods with3 linear regression models to forecast ILI-related ED visits at the hospital and evaluated model performances by comparing the root means square errors (RMSEs). Because of strong positive correlations with ILI-related ED visits between 2008 and 2012, we validated the use of Google Flu Trends data as a predictor in an ED influenza surveillance tool. Of the 5 forecasting models we have tested, linear regression models performed significantly better when Google Flu Trends data were included as a predictor. Regression models including Google Flu Trends data as a predictor variable have lower RMSE, and the lowest is achieved when all other variables are also included in the model in our forecasting experiments for the first 5 weeks of 2013 (with RMSE = 57.61). Google Flu Trends data

  15. Elementi ed esercizi di geometria analitica e proiettiva

    CERN Document Server

    Francia, Giovanni

    1950-01-01

    La retta : preliminario ; coordinate cartesiane nel piano, equazioni della retta, distanze ed angoli ; cambiamento delle coordinate, coordinate polari ; il cerchio ; le coniche come luoghi geometrici : l'ellisse, l'iperbole, parabola.

  16. Geopolítica e hidrocarburos: Las prospecciones petrolíferas en el área canario-sahariana (1940-1980

    Directory of Open Access Journals (Sweden)

    Martín Fernández, Carlos S.

    2016-06-01

    Full Text Available The Canary-Saharan area occupies a very particular region that has historically aroused a considerable socio-economic interest, first because it is the intersection of several trade routes, the productivity of their fishing grounds and the existence of large deposits of hydrocarbons. This last resource has aroused the ambition of the big European and North-American transnationals for decades. This article is to highlight the great historical journey that the searching of hydrocarbons has taken in the area, stopping in the period 1940-1980.El área canario-sahariana ocupa una zona muy particular que ha despertado históricamente un notable interés socioeconómico. En primer lugar por ser la intersección de varias rutas comerciales. También por la productividad de su banco pesquero y por la existencia de importantes yacimientos de hidrocarburos. Este último recurso ha despertado la ambición de las grandes transnacionales desde hace décadas. Este artículo viene a destacar el gran recorrido histórico que ha tenido la búsqueda de hidrocarburos en la zona, deteniéndose en el periodo 1940-1980.

  17. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  18. Carbon trends. March 2006

    International Nuclear Information System (INIS)

    2006-03-01

    This newsletter makes a monthly synthesis of the European CO 2 market: traded volumes, spot prices, conformability of facilities, supply and demand, climate indexes (temperature, precipitations from March 2005 to February 2006), economic activity indicators (industrial production from December 2004 to December 2005), confidence index of business leaders (from February 2005 to February 2006), changes in energy prices (from March 2005 to February 2006), CO 2 quotas allocated to European Union countries and detailed indicators of CO 2 market, climate, economic activity and energy prices. (J.S.)

  19. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  20. Are triage questions sufficient to assign fall risk precautions in the ED?

    Science.gov (United States)

    Southerland, Lauren T; Slattery, Lauren; Rosenthal, Joseph A; Kegelmeyer, Deborah; Kloos, Anne

    2017-02-01

    The American College of Emergency Physicians Geriatric Emergency Department (ED) Guidelines and the Center for Disease Control recommend that older adults be assessed for risk of falls. The standard ED assessment is a verbal query of fall risk factors, which may be inadequate. We hypothesized that the addition of a functional balance test endorsed by the Center for Disease Control Stop Elderly Accidents, Deaths, and Injuries Falls Prevention Guidelines, the 4-Stage Balance Test (4SBT), would improve the detection of patients at risk for falls. Prospective pilot study of a convenience sample of ambulatory adults 65 years and older in the ED. All participants received the standard nursing triage fall risk assessment. After patients were stabilized in their ED room, the 4SBT was administered. The 58 participants had an average age of 74.1 years (range, 65-94), 40.0% were women, and 98% were community dwelling. Five (8.6%) presented to the ED for a fall-related chief complaint. The nursing triage screen identified 39.7% (n=23) as at risk for falls, whereas the 4SBT identified 43% (n=25). Combining triage questions with the 4SBT identified 60.3% (n=35) as at high risk for falls, as compared with 39.7% (n=23) with triage questions alone (Ppatients at high risk by 4SBT and missed by triage questions were inpatients unaware that they were at risk for falls (new diagnoses). Incorporating a quick functional test of balance into the ED assessment for fall risk is feasible and significantly increases the detection of older adults at risk for falls. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Estrategias, actores, promesas y temores en las campañas de vacunación antivariolosa en México: del Porfiriato a la Posrevolución (1880-1940 Strategies, actors, promises and fears in the smallpox vaccinations campaigns in Mexico: from the Porfiriato to the Post-revolution (1880-1940

    Directory of Open Access Journals (Sweden)

    Claudia Agostoni

    2011-02-01

    Full Text Available El artículo estudia algunas de las estrategias a las que recurrieron las autoridades de salud durante la puesta en marcha de programas vacunación antivariolosa durante los años de 1880 a 1940, periodo que corresponde al gobierno encabezado por Porfirio Díaz (1877-1911, a la fase armada de la Revolución Mexicana (1910-1920, y a las dos primeras décadas del estado posrevolucionario (1920-1940. Por una parte se prestará atención a la preeminencia que tuvo la vacunación en los centros urbanos, notablemente en la ciudad de México; y por la otra, se destacará la gradual, pero decisiva, organización y reglamentación de la vacunación antivariolosa en los programas destinados para el heterogéneo y desigual ámbito rural. Asimismo, se analizará la importancia que adquirió la educación higiénica, y se prestará atención a las divergentes respuestas que la aplicación masiva y cotidiana de la vacuna suscitó en las ciudades principales y en pequeños pueblos y municipios rurales, respuestas que incluyeron la resistencia, el temor, la incredulidad y la franca aceptación.The article examines some of the strategies employed by the Mexican health authorities that led to the organization of massive and obligatory smallpox vaccination campaigns from the late 1880s to the 1940s, a period of Mexican history that corresponds to the Porfirio Díaz regime (1877-1911, to the armed phase of the Mexican Revolution (1910-1920, and to the first two decades of the Post-revolutionary governments (1920-1940. Attention will be placed of the vaccination programs in the main urban settings, notably in Mexico City, as well as the gradual but decisive organization and regulation of vaccination campaigns in the heterogeneous rural milieu. Furthermore, the importance that hygienic education acquired will be explored, as well as the divergent and contested responses that emerged due to the obligatory vaccination campaigns, responses that included resistance, fear

  2. End-of-year closure 2006/2007

    CERN Document Server

    HR Department

    2006-01-01

    As announced in Weekly Bulletin No. 3-4/2006, the Laboratory will be closed from Saturday 23 December 2006 to Sunday 7 January 2007 inclusive. This period consists of 16 days: 4 days' official holiday, i.e. 24, 25 and 31 December 2006, and 1 January 2007; 2 days, 26 December 2006 to compensate for 24 December 2006, and 2 January 2007 to compensate for 31 December 2006 (Article R II 4.33 of the Staff Regulations); 6 days' special paid leave in accordance with Article R II 4.34 of the Staff Regulations, i.e. 27, 28 and 29 December 2006, and 3, 4 and 5 January 2007; 3 Saturdays, i.e. 23 and 30 December 2006, and 6 January 2007; 1 Sunday, i.e. 7 January 2007. The first working day in the New Year will be Monday 8 January 2007. Further information is available from Department Secretariats, specifically concerning the conditions applicable to members of the personnel who are required to work during this period. Human Resources Department Tel. 73903

  3. De vicarios y obispos. El establecimiento de la diócesis de Tijuana, 1940-1964

    OpenAIRE

    Muñoz Núñez, Julio Adrián; Jaimes Martínez, Ramiro

    2016-01-01

    Resumen: Durante la segunda mitad del siglo XIX y la primera del XX, en Baja California se trató de trasformar a una iglesia católica misional en una diocesana, pero sin éxito. Sin embargo, a partir de la década de 1940 el nuevo vicario y la orden de los Misioneros del Espíritu Santo reorganizaron la estructura eclesial y aprovecharon las trasformaciones sociales, económicas y políticas ocurridas en Baja California. En este trabajo se analizan algunos aspectos del proceso de consolidación ins...

  4. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  5. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  6. Efficient Round-Trip Time Optimization for Replica-Exchange Enveloping Distribution Sampling (RE-EDS).

    Science.gov (United States)

    Sidler, Dominik; Cristòfol-Clough, Michael; Riniker, Sereina

    2017-06-13

    Replica-exchange enveloping distribution sampling (RE-EDS) allows the efficient estimation of free-energy differences between multiple end-states from a single molecular dynamics (MD) simulation. In EDS, a reference state is sampled, which can be tuned by two types of parameters, i.e., smoothness parameters(s) and energy offsets, such that all end-states are sufficiently sampled. However, the choice of these parameters is not trivial. Replica exchange (RE) or parallel tempering is a widely applied technique to enhance sampling. By combining EDS with the RE technique, the parameter choice problem could be simplified and the challenge shifted toward an optimal distribution of the replicas in the smoothness-parameter space. The choice of a certain replica distribution can alter the sampling efficiency significantly. In this work, global round-trip time optimization (GRTO) algorithms are tested for the use in RE-EDS simulations. In addition, a local round-trip time optimization (LRTO) algorithm is proposed for systems with slowly adapting environments, where a reliable estimate for the round-trip time is challenging to obtain. The optimization algorithms were applied to RE-EDS simulations of a system of nine small-molecule inhibitors of phenylethanolamine N-methyltransferase (PNMT). The energy offsets were determined using our recently proposed parallel energy-offset (PEOE) estimation scheme. While the multistate GRTO algorithm yielded the best replica distribution for the ligands in water, the multistate LRTO algorithm was found to be the method of choice for the ligands in complex with PNMT. With this, the 36 alchemical free-energy differences between the nine ligands were calculated successfully from a single RE-EDS simulation 10 ns in length. Thus, RE-EDS presents an efficient method for the estimation of relative binding free energies.

  7. The use of SEM/EDS method in mineralogical analysis of ordinary chondritic meteorite

    Directory of Open Access Journals (Sweden)

    Breda Mirtič

    2009-12-01

    Full Text Available The aim of this study was to evaluate the potential of scanning electron microscopy coupled with energy dispersiveX-ray spectroscopy (SEM/EDS for determination of mineral phases according to their stoichiometry and assessment of mineral composition of ordinary chondritic meteorite. For the purposes of this study, H3 type ordinary chondritic meteorite Abbott was selected. SEM/EDS allows identification and characterisation of mineralphases, whose size is below the resolution of an optical microscope. Mineral phases in chondrules and interstitial matrix were located in backscattered electron (BSE mode and were assessed from atomic proportions of constituent elements, obtained by the EDS analysis. SEM/EDS analyses of mineral phases showed that Abbott meteorite is characterised by Fe-rich (Fe, Ni-alloy kamacite, Fe-sulphide troilite or pyrrhotite, chromite, Mg-rich olivine, orthopyroxene bronzite or hypersthene, clinopyroxene Al-diopside, acid plagioclase oligoclase, accessory mineral chlorapatite and secondary minerals Fe-hydroxides (goethite or lepidocrocite. Results of semi-quantitative analyses confirmed that most of analysed mineralphases conform well to stoichiometric minerals with minor deviations of oxygen from stoichiometric proportions. Comparison between mineral phases in chondrules and interstitial matrix was also performed, however it showed no significant differences in elemental composition.Differences in chemical composition between minerals in interstitial matrix and chondrules are sometimes too small to be discernedby the SEM/EDS, therefore knowledge of SEM/EDS capabilities is important for correct interpretation of chondrite formation.

  8. Not the events of 1940 in the Baltics, but the events of 1939-44 in Finland, Estonia, Latvia, Lithuania, Slovakia and Tyva / Toomas Alatalu

    Index Scriptorium Estoniae

    Alatalu, Toomas, 1942-

    2002-01-01

    Baltimaade okupeerimine 1940. a. toimus sama skeemi alusel nagu mitme teise riigi puhul. Venemaa ei vallutanud soovitud alasid sõjalist jõudu kasutades, vaid nö. seaduslikul teel poliitiliste lepete sõlmimisega

  9. The impact of an ED-only full-capacity protocol.

    Science.gov (United States)

    Watase, Taketo; Fu, Rongwei; Foster, Denise; Langley, Denise; Handel, Daniel A

    2012-10-01

    The objective of this study was to assess the impact of an emergency department (ED)-only full-capacity protocol and diversion, controlling for patient volumes and other potential confounding factors. This was a preintervention and postintervention cohort study using data 12 months before and 12 months after the implementation of the protocol. During the implementation period, attending physicians and charge nurses were educated with clear and simple figures on the criteria for the initiation of the new protocol. A multiple logistic regression model was used to compare ambulance diversion between the 2 periods. The proportion of days when the ED went on diversion at least once during a 24-hour period was 60.4% during the preimplementation period and 20% in the postimplementation periods (P model, the use of the new protocol was significantly associated with decreased odds of diversion rate in the postimplementation period (odds ratio, 0.32; 95% confidence interval, 0.21-0.48). Our predivert/full-capacity protocol is a simple and generalizable strategy that can be implemented within the boundaries of the ED and is significantly associated with a decreased diversion rate. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Veemajandus, 2006 = Water management, 2006 / Kadi Siimer

    Index Scriptorium Estoniae

    Siimer, Kadi

    2007-01-01

    Eestis võeti 2006. aastal kõigist veeallikatest kokku 1,6 miljardit kuupmeetrit vett, tekkinud heitveest vajas puhastamist 264 miljonit kuupmeetrit, võrreldes 2005. aastaga vähenes 2 protsenti loodusesse juhitud heitvee orgaaniliste ainete reostuskoormus. Graafikud. Diagramm. Tabelid

  11. Avaliku sektori kulutused keskkonnakaitsele, 2006 = Environmental protection expenditure of public sector, 2006 / Kersti Salu

    Index Scriptorium Estoniae

    Salu, Kersti

    2008-01-01

    Keskvalitsus kulutas 2006. aastal 2,2 miljardit krooni keskkonnakaitsele, kohalikud omavalitsused 339 miljonit krooni ning Keskkonnainvesteeringute Keskuse keskkonnaprojektide kogumaksumus oli 2006. aastal ligikaudu 600 miljonit krooni. Tabelid. Diagramm

  12. CERN Technical Training 2006: ANSYS Course Sessions (August-September 2006)

    CERN Multimedia

    2006-01-01

    The following ANSYS course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2006, and in collaboration with CAD-FEM AG (CH): ANSYS Design Modeler (course in French): 29-30.8.2006 (2 days) ANSYS Workbench (course in French): 12-15.9.2006 (4 days, only 2 places available) If you are interested in attending any of the above course sessions, please discuss with your supervisor and/or your DTO, and apply electronically via EDH from the course description pages that can be found at under "Upcoming course sessions", with the detailed course programmes. The complete training offer of ANSYS courses at CERN can be found at the same website, under the Mechanical Design curriculum. CERN Technical Training courses are open only to the members of CERN personnel (staff members and fellows; associates, students, users, project associates; apprentices: employees of CERN contractors, with some restrictions). In particular, quoted prices and programmes refer specifically to the CERN ...

  13. ANDRA, 2006 activity report; ANDRA, Rapport d'activite 2006

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    The French national agency of radioactive waste management (ANDRA) was marked in 2006 by two outstanding events: the publication of the national inventory of radioactive wastes and valorisable materials, and the vote of the law from June 28, 2006 relative to the sustainable management of radioactive wastes and materials. This road-map law has an impact on ANDRA's activities for the coming years. This activity report presents several 2006 highlights of ANDRA's missions as well: the public service mission, the by-law about the effluents of the Aube plant for the storage of low-medium activity wastes, the building of the first 'double-cell' at the very-low activity waste storage plant of Aube, the research studies about the project of deep underground disposal of high-medium activity, long-living wastes, and the public information about ANDRA's technical and scientific know-how. The management and financial reports are attached in appendix. (J.S.)

  14. Effect Of A “No Superuser Opioid Prescription” Policy On ED Visits And Statewide Opioid Prescription

    Directory of Open Access Journals (Sweden)

    Zachary P. Kahler

    2017-07-01

    Full Text Available Introduction: The U.S. opioid epidemic has highlighted the need to identify patients at risk of opioid abuse and overdose. We initiated a novel emergency department- (ED based interventional protocol to transition our superuser patients from the ED to an outpatient chronic pain program. The objective was to evaluate the protocol’s effect on superusers’ annual ED visits. Secondary outcomes included a quantitative evaluation of statewide opioid prescriptions for these patients, unique prescribers of controlled substances, and ancillary testing. Methods: Patients were referred to the program with the following inclusion criteria: ≥ 6 visits per year to the ED; at least one visit identified by the attending physician as primarily driven by opioid-seeking behavior; and a review by a committee comprising ED administration and case management. Patients were referred to a pain management clinic and informed that they would no longer receive opioid prescriptions from visits to the ED for chronic pain complaints. Electronic medical record (EMR alerts notified ED providers of the patient’s referral at subsequent visits. We analyzed one year of data pre- and post-referral. Results: A total of 243 patients had one year of data post-referral for analysis. Median annual ED visits decreased from 14 to 4 (58% decrease, 95% CI [50 to 66]. We also found statistically significant decreases for these patients’ state prescription drug monitoring program (PDMP opioid prescriptions (21 to 13, total unique controlled-substance prescribers (11 to 7, computed tomography imaging (2 to 0, radiographs (5 to 1, electrocardiograms (12 to 4, and labs run (47 to 13. Conclusion: This program and the EMR-based alerts were successful at decreasing local ED visits, annual opioid prescriptions, and hospital resource allocation for this population of patients. There is no evidence that these patients diverted their visits to neighboring EDs after being informed that they

  15. The University Supervisor, edTPA, and the New Making of the Teacher

    Science.gov (United States)

    Donovan, Martha K.; Cannon, Susan O.

    2018-01-01

    As university supervisors at a large, urban university in the southern US, we examined the ways that the Education Teacher Performance Assessment (edTPA) shaped the pedagogic relationships and decision-making processes of our students and ourselves during the spring of 2016. We situated this study of edTPA within the framework of critical policy…

  16. Sociopolitical Change and Inequality of Educational Opportunities: Influences of Family Background and Institutional Factors on the Acquisition of Education (1940-2001)

    Science.gov (United States)

    Chunling, Li

    2012-01-01

    This article analyzes the influences of family background and institutional factors on the acquisition of education (1940-2001) and demonstrates that the increase or decrease in the inequality of educational opportunity allocations are closely linked to the government's relevant policies. The rapid growth of the inequality in educational…

  17. Eesti loomakasvatus 2006. aastal / Matti Piirsalu

    Index Scriptorium Estoniae

    Piirsalu, Matti, 1947-

    2007-01-01

    Eesti Statistikaameti ning Põllumajandusministeeriumi koostatud 2006. aasta loomakasvatuse andmete analüüs. Tabelid: Loomade ja lindude arv seisuga 31. detsember; Lihatoodang elusmassis 2005. ja 2006. aastal; Prognoositav lihatoodang tapamassis 2005. ja 2006. aastal

  18. Strategies for Elevating the Public and Professional Regard of the Ed.D.

    Science.gov (United States)

    Guthrie, James W.; Marsh, David D.

    2009-01-01

    A nationwide strategy for improving Ed.D. programs is needed to overcome two important dilemmas that are typical in schools of education: low academic status for Ed.D. programs and an overreliance on tuition as a source of revenue. Other major hindrances are the lack of agreement about research-based standards, a weak alignment with other elements…

  19. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  20. Historic (1940 to present) changes in Lillooet River planform (BC, Canada)

    Science.gov (United States)

    Zei, Caterina

    2017-04-01

    Historic (1940 to present) changes in Lillooet River planform (BC, Canada) Zei C.*, Giardino M.*, Perotti L.*, Roberti G.***, **Ward B.C.**, Clague J.J.** *Department of Earth Sciences, Geositlab, Università degli Studi di Torino, Torino, Italia; **Department of Earth Sciences, Simon Fraser University, Burnaby, British Columbia, Canada ***Université Blaise Pascal - Laboratoire Magmas et Volcans Clermont-Ferrand, France We conducted a geomorphological study of changes in the planform of Lillooet River (Coast Mountain, British Columbia, Canada) over the past 75 years. The study involved identification and interpretations of channel changes in the reach of the river between Mount Meager (the source of the landslide) and Pemberton Meadows. Lillooet River flows about 95 km southeast from its headwaters at Lillooet Glacier to Lillooet Lake near Pemberton, the largest community in the valley. Between the mouth of Meager Creek and Pemberton Meadows, the river is unregulated and has a braided planform resulting from the very high delivery of sediment due to frequent landslides and debris flows sourced on the Mount Meager volcanic complex. Below Pemberton Meadows, the river occupies a single channel confined between dikes. A rich archive of historical vertical aerial photographs exists for the study area, In addition, a high-resolution digital elevation model was produced from LiDAR data acquired in 2015. We processed each set of photos dating back to 1940 with the software Agisoft Photoscan to produce high resolution orthophotos. Analysis of these datasets, complemented with field investigation, showed that the river channel in the braided reach shifted laterally up to 550 m between 1981 and 2010; likely caused in part by five floods with peak discharges of more than 800 m^3/s and four landslides on the flanks of Mount Meager massif with volumes up to 13 x 106 m^3. Channel avulsions were probably triggered by accumulation of in-channel rafts of coarse woody debris and are