WorldWideScience

Sample records for ebaf homologue mrna

  1. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  2. A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

    Science.gov (United States)

    Wang, S Y; Gudas, L J

    1990-09-15

    We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

  3. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  4. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  5. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  6. Uncertainty in regional and zonal monthly mean downward surface irradiances from Edition 4.0 CERES Energy Balanced and Filled (EBAF) data product

    Science.gov (United States)

    Kato, S.; Rutan, D. A.; Rose, F. G.; Loeb, N. G.

    2017-12-01

    The surface of the Earth receives solar radiation (shortwave) and emission from the atmosphere (longwave). At a global and annual mean approximately 12% of solar radiation incident on the surface is reflected and the rest is absorbed by the surface. The surface emits radiation proportional to the forth power of the temperature. Although the uncertainty in global and annual mean surface irradiances is estimated in earlier studies (Zhang et al. 1995, 2004; L'Ecuyer et al. 2008; Stephens et al. 2012; Kato et al. 2012), only a few studies estimated the uncertainty in computed surface irradiances at smaller spatial and temporal scales (Zhang et al. 1995, 2004; Kato et al. 2012). We use surface observations at 46 buoys and 36 land sites and newly released the Edition 4.0 Clouds and the Earth's Radiant Energy System (CERES) Energy Balanced and Filled (EBAF)-surface data product to estimate the uncertainty in regional and zonal monthly mean downward shortwave and longwave surface irradiances. The root-mean-square difference of monthly mean computed and observed irradiances is used for the regional uncertainty. The uncertainty is separated into bias and spatially random components. The random component decreases when irradiances are averaged over a larger area, nearly inversely proportional to the number of surface observation sites. The presentation provides the uncertainty in the regional and zonal monthly mean downward surface irradiances over ocean and land. ReferencesKato, S. and N.G.Loeb, D. A.Rutan, F. G. Rose, S. Sun-Mack,W.F.Miller, and Y. Chen, 2012. Surv. Geophys., 33, 395-412, doi:10.1007/s10712-012-9179-x. L'Ecuyer, T. S., N. B. Wood, T. Haladay, G. L. Stephens, and P. W. Stackhouse Jr., 2008, J. Geophys. Res., 113, D00A15, doi:10.1029/2008JD009951. Stephens, G. L. and Coauthors, 2012, Nat. Geosci., 5, 691-696, doi:10.1038/ngeo1580. Zhang, Y., W. B. Rossow, A. A. Lacis, V. Oinas, and M. I. Mishchenko, 2004, J. Geophys. Res., 109, D19105, doi:10.1029/2003JD

  7. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  8. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  9. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  10. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  11. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  12. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  13. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  14. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  15. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  16. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  17. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  18. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse

    Directory of Open Access Journals (Sweden)

    Green Carla B

    2001-05-01

    Full Text Available Abstract Background Nocturnin was originally identified by differential display as a circadian clock regulated gene with high expression at night in photoreceptors of the African clawed frog, Xenopus laevis. Although encoding a novel protein, the nocturnin cDNA had strong sequence similarity with a C-terminal domain of the yeast transcription factor CCR4, and with mouse and human ESTs. Since its original identification others have cloned mouse and human homologues of nocturnin/CCR4, and we have cloned a full-length cDNA from mouse retina, along with partial cDNAs from human, cow and chicken. The goal of this study was to determine the temporal pattern of nocturnin mRNA expression in multiple tissues of the mouse. Results cDNA sequence analysis revealed a high degree of conservation among vertebrate nocturnin/CCR4 homologues along with a possible homologue in Drosophila. Northern analysis of mRNA in C3H/He and C57/Bl6 mice revealed that the mNoc gene is expressed in a broad range of tissues, with greatest abundance in liver, kidney and testis. mNoc is also expressed in multiple brain regions including suprachiasmatic nucleus and pineal gland. Furthermore, mNoc exhibits circadian rhythmicity of mRNA abundance with peak levels at the time of light offset in the retina, spleen, heart, kidney and liver. Conclusion The widespread expression and rhythmicity of mNoc mRNA parallels the widespread expression of other circadian clock genes in mammalian tissues, and suggests that nocturnin plays an important role in clock function or as a circadian clock effector.

  20. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  1. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  2. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  3. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  4. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  5. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  6. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  8. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  9. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  10. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  11. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  12. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  13. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  14. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  15. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  16. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  17. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  18. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  19. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  20. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  1. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  2. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  3. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  4. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  5. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  6. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  7. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  8. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  9. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  10. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  11. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  12. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  13. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  14. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  15. Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

    Directory of Open Access Journals (Sweden)

    Daniela Toro-Ascuy

    2016-11-01

    Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.

  16. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  17. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  18. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  19. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  20. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  2. Clinical significance of LUNX mRNA, CK19 mRNA, CEA mRNA expression in detecting micrometastasis from lung cancer

    International Nuclear Information System (INIS)

    Zhu Guangying; Liu Delin; Chen Jie

    2003-01-01

    Objective: To evaluate the sensitivity, specificity and clinical significance of CK19 mRNA, CEA mRNA and LUNX mRNA for detecting micrometastasis by sampling the peripheral blood and regional lymph nodes of lung cancer patients. Methods: Reverse transcriptase chain reaction (RT-PCR) was used to detect LUNX mRNA, CK19 mRNA, CEA mRNA for micrometastasis by sampling the peripheral blood of 48 lung cancer patients and 44 regional lymph nodes of such patients treated by curative resection. Peripheral blood of 30 patients with pulmonary benign lesions and 10 normal healthy volunteers and lymph nodes of 6 patients with benign pulmonary diseases served as control. Results: 1) LUNX mRNA, CK19 mRNA, CEA mRNA were expressed in all (35/35) lung cancer tissues. 2) In the peripheral blood from 48 lung cancer patients, 30 (62.5%) were positive for LUNX mRNA, 24 (50.0%) positive for CK19 mRNA and 32(66.7%) positive for CEA mRNA. The positive detection rates of micrometastasis in 44 lymph nodes from lung cancer patients were 36.4% (16 out of 44) for LUNX mRNA, 27.3% (12 out of 44) for CK19 mRNA and 40.9% (18 out of 44) for CEA mRNA. 3) In the 30 blood samples from patients with pulmonary benign diseases, 2 (6.7%) expressed CK19 mRNA, but none expressed LUNX mRNA or CEA mRNA. All the 3 molecular markers were negative in the 10 blood samples from healthy volunteers. In 11 lymph nodes from patients with pulmonary benign lesions, none was positive for any of the three markers. 4) In 44 regional lymph nodes from lung cancer patients, 6 (13.6%) were positive for metastasis by histopathological examination, with a positive rate significantly lower than that of the RT-PCR (P<0.05). 5) The micrometastatic positive rate in the peripheral blood of 40 non-small cell lung cancer (NSCLC) patients was significantly related to TNM stage (P=0.01). Conclusions: LUNX mRNA, CK19 MRNA, CEA mRNA are all appropriate target genes for the detection of micrometastasis from lung cancer. LUNX mRNA and CEA mRNA

  3. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  4. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  5. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  6. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  7. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  8. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  9. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  10. The ApaH-like phosphatase TbALPH1 is the major mRNA decapping enzyme of trypanosomes.

    Directory of Open Access Journals (Sweden)

    Susanne Kramer

    2017-06-01

    Full Text Available 5'-3' decay is the major mRNA decay pathway in many eukaryotes, including trypanosomes. After deadenylation, mRNAs are decapped by the nudix hydrolase DCP2 of the decapping complex and finally degraded by the 5'-3' exoribonuclease. Uniquely, trypanosomes lack homologues to all subunits of the decapping complex, while deadenylation and 5'-3' degradation are conserved. Here, I show that the parasites use an ApaH-like phosphatase (ALPH1 as their major mRNA decapping enzyme. The protein was recently identified as a novel trypanosome stress granule protein and as involved in mRNA binding. A fraction of ALPH1 co-localises exclusively with the trypanosome 5'-3' exoribonuclease XRNA to a special granule at the posterior pole of the cell, indicating a connection between the two enzymes. RNAi depletion of ALPH1 is lethal and causes a massive increase in total mRNAs that are deadenylated, but have not yet started 5'-3' decay. These data suggest that ALPH1 acts downstream of deadenylation and upstream of mRNA degradation, consistent with a function in mRNA decapping. In vitro experiments show that recombinant, N-terminally truncated ALHP1 protein, but not a catalytically inactive mutant, sensitises the capped trypanosome spliced leader RNA to yeast Xrn1, but only if an RNA 5' polyphosphatase is included. This indicates that the decapping mechanism of ALPH1 differs from the decapping mechanism of Dcp2 by leaving more than one phosphate group at the mRNA's 5' end. This is the first reported function of a eukaryotic ApaH-like phosphatase, a bacterial-derived class of enzymes present in all phylogenetic super-groups of the eukaryotic kingdom. The substrates of eukaryotic ApaH-like phosphatases are unknown. However, the substrate of the related bacterial enzyme ApaH, diadenosine tetraphosphate, is highly reminiscent of a eukaryotic mRNA cap.

  11. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  12. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  13. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  14. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  15. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  16. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  17. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  18. mRNA processing in yeast

    International Nuclear Information System (INIS)

    Stevens, A.

    1982-01-01

    Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes

  19. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  20. Principles of mRNA transport in yeast.

    Science.gov (United States)

    Heym, Roland Gerhard; Niessing, Dierk

    2012-06-01

    mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.

  1. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  2. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  3. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  4. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  5. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  6. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  7. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  8. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  9. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  10. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  12. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  13. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  14. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  15. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  17. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. mRNA Cancer Vaccines-Messages that Prevail.

    Science.gov (United States)

    Grunwitz, Christian; Kranz, Lena M

    2017-01-01

    During the last decade, mRNA became increasingly recognized as a versatile tool for the development of new innovative therapeutics. Especially for vaccine development, mRNA is of outstanding interest and numerous clinical trials have been initiated. Strikingly, all of these studies have proven that large-scale GMP production of mRNA is feasible and concordantly report a favorable safety profile of mRNA vaccines. Induction of T-cell immunity is a multi-faceted process comprising antigen acquisition, antigen processing and presentation, as well as immune stimulation. The effectiveness of mRNA vaccines is critically dependent on making the antigen(s) of interest available to professional antigen-presenting cells, especially DCs. Efficient delivery of mRNA into DCs in vivo remains a major challenge in the mRNA vaccine field. This review summarizes the principles of mRNA vaccines and highlights the importance of in vivo mRNA delivery and recent advances in harnessing their therapeutic potential.

  19. CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.

    Science.gov (United States)

    Busi, Florent; Cresteil, Thierry

    2005-09-01

    The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.

  20. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  1. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  2. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  3. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  4. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  5. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  6. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  7. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  8. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  9. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  10. Green tea increases anti-inflammatory tristetraprolin and decreases pro-inflammatory tumor necrosis factor mRNA levels in rats

    Directory of Open Access Journals (Sweden)

    Roussel Anne M

    2007-01-01

    Full Text Available Abstract Background Tristetraprolin (TTP/ZFP36 family proteins have anti-inflammatory activity by binding to and destabilizing pro-inflammatory mRNAs such as Tnf mRNA, and represent a potential therapeutic target for inflammation-related diseases. Tea has anti-inflammatory properties but the molecular mechanisms have not been completely elucidated. We hypothesized that TTP and/or its homologues might contribute to the beneficial effects of tea as an anti-inflammatory product. Methods Quantitative real-time PCR was used to investigate the effects of green tea (0, 1, and 2 g solid extract/kg diet on the expression of Ttp family genes (Ttp/Tis11/Zfp36, Zfp36l1/Tis11b, Zfp36l2/Tis11d, Zfp36l3, pro-inflammatory genes (Tnf, Csf2/Gm-csf, Ptgs2/Cox2, and Elavl1/Hua/Hur and Vegf genes in liver and muscle of rats fed a high-fructose diet known to induce insulin resistance, oxidative stress, inflammation, and TNF-alpha levels. Results Ttp and Zfp36l1 mRNAs were the major forms in both liver and skeletal muscle. Ttp, Zfp36l1, and Zfp36l2 mRNA levels were more abundant in the liver than those in the muscle. Csf2/Gm-csf and Zfp36l3 mRNAs were undetectable in both tissues. Tea (1 g solid extract/kg diet increased Ttp mRNA levels by 50–140% but Tnf mRNA levels decreased by 30% in both tissues, and Ptgs2/Cox2 mRNA levels decreased by 40% in the muscle. Tea (2 g solid extract/kg diet increased Elavl1/Hua/Hur mRNA levels by 40% in the liver but did not affect any of the other mRNA levels in liver or muscle. Conclusion These results show that tea can modulate Ttp mRNA levels in animals and suggest that a post-transcriptional mechanism through TTP could partially account for tea's anti-inflammatory properties. The results also suggest that drinking adequate amounts of green tea may play a role in the prevention of inflammation-related diseases.

  11. Presence of albumin mRNA precursors in nuclei of analbuminemic rat liver lacking cytoplasmic albumin mRNA.

    OpenAIRE

    Esumi, H; Takahashi, Y; Sekiya, T; Sato, S; Nagase, S; Sugimura, T

    1982-01-01

    Analbuminemic rats, which lack serum albumin, were previously found to have no albumin mRNA in the cytoplasm of the liver. In the present study, the existence of nuclear albumin mRNA precursors in the liver of analbuminemic rats was examined by RNA X cDNA hybridization kinetics. Albumin mRNA precursors were present in the nuclei of analbuminemic rat liver at almost normal levels, despite the absence of albumin mRNA from the cytoplasm. Nuclear RNA of analbuminemic rat liver was subjected to el...

  12. Increased IL-10 mRNA and IL-23 mRNA expression in multiple sclerosis

    DEFF Research Database (Denmark)

    Krakauer, Martin; Sorensen, P; Khademi, M

    2008-01-01

    BACKGROUND: Interferon (IFN)-beta therapy in multiple sclerosis (MS) has been suggested to promote a deviation from T lymphocyte production of pathogenic Th1 cytokines to less detrimental Th2 cytokines, but this is still controversial. We studied patterns of in vivo blood mononuclear cell (MNC...... of any Th1 or Th2 cytokines. The largest changes in cytokine mRNA levels occurred early (~9-12 h) after an IFN-beta injection. CONCLUSION: We found no evidence of a Th1- or Th2-mRNA-promoting effect of IFN-beta therapy. The therapeutic effect of IFN-beta is more likely attributable to the induction...

  13. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  14. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  15. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  16. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  17. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  18. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  19. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung

    2010-01-01

    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  20. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  1. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  2. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  3. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  4. Research Article Molecular cloning and mRNA expression pattern of ...

    Indian Academy of Sciences (India)

    SAMSUNG

    homologue from the brain of Misgurnus anguillicaudatus using homologous cloning and ... developmental processes, including sex determination, embryonic stem cell ..... anguillicaudatus, possibly aiding in unravelling reproductive biology ... significant difference (p < 0.05) between female and male in the same tissue.

  5. Expression of calmodulin mRNA in rat olfactory neuroepithelium.

    Science.gov (United States)

    Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

    1991-04-01

    A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

  6. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  7. mRNA localization mechanisms in Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Lysangela R Alves

    Full Text Available Asymmetric mRNA localization is a sophisticated tool for regulating and optimizing protein synthesis and maintaining cell polarity. Molecular mechanisms involved in the regulated localization of transcripts are widespread in higher eukaryotes and fungi, but not in protozoa. Trypanosomes are ancient eukaryotes that branched off early in eukaryote evolution. We hypothesized that these organisms would have basic mechanisms of mRNA localization. FISH assays with probes against transcripts coding for proteins with restricted distributions showed a discrete localization of the mRNAs in the cytoplasm. Moreover, cruzipain mRNA was found inside reservosomes suggesting new unexpected functions for this vacuolar organelle. Individual mRNAs were also mobilized to RNA granules in response to nutritional stress. The cytoplasmic distribution of these transcripts changed with cell differentiation, suggesting that localization mechanisms might be involved in the regulation of stage-specific protein expression. Transfection assays with reporter genes showed that, as in higher eukaryotes, 3'UTRs were responsible for guiding mRNAs to their final location. Our results strongly suggest that Trypanosoma cruzi have a core, basic mechanism of mRNA localization. This kind of controlled mRNA transport is ancient, dating back to early eukaryote evolution.

  8. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  9. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  10. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  11. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  12. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  13. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  14. Protein Structure and the Sequential Structure of mRNA

    DEFF Research Database (Denmark)

    Brunak, Søren; Engelbrecht, Jacob

    1996-01-01

    entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment, By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets, These signals do not originate from......A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting...... protein, The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain, A complete search for GenBank nucleotide sequences coding for structural...

  15. Increased IL-10 mRNA and IL-23 mRNA expression in multiple sclerosis: interferon-beta treatment increases IL-10 mRNA expression while reducing IL-23 mRNA expression

    DEFF Research Database (Denmark)

    Krakauer, M.; Sorensen, P.; Khademi, M.

    2008-01-01

    volunteers served to confirm initial findings. mRNA was analyzed by real-time reverse transcriptase polymerase chain reaction (PCR). RESULTS: We found elevated expression of interleukin (IL)-23 and IL-10 in untreated MS patients. IFN-beta therapy increased IL-10 and decreased IL-23 expression independently...... of the regulatory cytokine IL-10. The elevated IL-23 mRNA levels in MS patients are noteworthy in view of the newly discovered IL-23-driven Th17 T-cell subset, which is crucial in animal models of MS. Since IFN-beta therapy resulted in decreased IL-23 mRNA levels, the Th17 axis could be another target of IFN...

  16. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  17. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  18. Complexity on Acute Myeloid Leukemia mRNA Transcript Variant

    Directory of Open Access Journals (Sweden)

    Carlo Cattani

    2011-01-01

    Full Text Available This paper deals with the sequence analysis of acute myeloid leukemia mRNA. Six transcript variants of mlf1 mRNA, with more than 2000 bps, are analyzed by focusing on the autocorrelation of each distribution. Through the correlation matrix, some patches and similarities are singled out and commented, with respect to similar distributions. The comparison of Kolmogorov fractal dimension will be also given in order to classify the six variants. The existence of a fractal shape, patterns, and symmetries are discussed as well.

  19. Detection of melatonin receptor mRNA in human muscle

    International Nuclear Information System (INIS)

    Li Lei

    2004-01-01

    To verify the expression of melatonin receptor mRNA in human, muscle, muscle beside vertebrae was collected to obtain total RNA and the mRNA of melatonin receptor was detected by RT-PCR method. The electrophoretic results of RT-PCR products by mt 1 and MT 2 primer were all positive and the sequence is corresponding with human melatonin receptor cDNA. It suggests that melatonin may act on the muscle beside vertebrae directly and regulate its growth and development. (authors)

  20. Cloning and mRNA expression pattern analysis under low ...

    African Journals Online (AJOL)

    This research cloned endochitinase-antifreeze protein precursor (EAPP) gene of Dong-mu 70 rye (Secale cereale) by designing special primers according to Genbank's EAPP gene sequence, and analyzing the influence of low temperature stress on the expression of mRNA with RT-PCR. The results indicated that the ...

  1. Midbrain expression of Delta-like 1 homologue is regulated by GDNF and is associated with dopaminergic differentiation

    DEFF Research Database (Denmark)

    Christophersen, Nicolai S.; Gronborg, Mette; Petersen, Thomas Nordahl

    2007-01-01

    upregulation with increased positive staining of cell bodies in the SNc and fibers in the striatum. Analysis of the developmental regulation of Dlk1 in the murine ventral midbrain showed that the upregulation of Dlk1 mRNA correlated with the generation of tyrosine hydroxylase (TH)-positive neurons. Furthermore...

  2. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  3. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  4. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  6. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  7. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  8. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  9. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  10. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  11. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  12. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  13. Interleukin-21 mRNA expression during virus infections

    DEFF Research Database (Denmark)

    Holm, Christian; Nyvold, Charlotte Guldborg; Paludan, Søren Riis

    2006-01-01

    and activational effects of IL-21 on different leukocytes come into play in vivo in an immune response has so far not been fully investigated. We show here for the first time in vivo, that IL-21 mRNA is produced in the spleen when mice are challenged with herpes simplex virus type 2 (HSV-2) or lymphocytic...... choriomeningitis virus (LCMV). We show in HSV-2 challenged mice that this production takes place in CD4+ T cell fractions and is absent in CD4+ T cell-depleted fractions. We also show that the peak of IL-21 mRNA production in both the HSV-2 and LCMV-challenged mice coincides with the onset of the adaptive immune...

  14. Collagen mRNA levels changes during colorectal cancer carcinogenesis

    DEFF Research Database (Denmark)

    Skovbjerg, Hanne; Anthonsen, Dorit; Lothe, Inger M B

    2009-01-01

    BACKGROUND: Invasive growth of epithelial cancers is a complex multi-step process which involves dissolution of the basement membrane. Type IV collagen is a major component in most basement membranes. Type VII collagen is related to anchoring fibrils and is found primarily in the basement membrane...... zone of stratified epithelia. Immunohistochemical studies have previously reported changes in steady-state levels of different alpha(IV) chains in several epithelial cancer types. In the present study we aimed to quantitatively determine the mRNA levels of type IV collagen (alpha1/alpha 4/alpha 6......) and type VII collagen (alpha1) during colorectal cancer carcinogenesis. METHODS: Using quantitative RT-PCR, we have determined the mRNA levels for alpha1(IV), alpha 4(IV), alpha 6(IV), and alpha1(VII) in colorectal cancer tissue (n = 33), adenomas (n = 29) and in normal tissue from the same individuals...

  15. Peptide inhibitors of botulinum neurotoxin by mRNA display

    International Nuclear Information System (INIS)

    Yiadom, Kwabena P.A.B.; Muhie, Seid; Yang, David C.H.

    2005-01-01

    Botulinum neurotoxins (BoNTs) are extremely toxic. The metalloproteases associated with the toxins cleave proteins essential for neurotransmitter secretion. Inhibitors of the metalloprotease are currently sought to control the toxicity of BoNTs. Toward that goal, we produced a synthetic cDNA for the expression and purification of the metalloprotease of BoNT/A in Escherichia coli as a biotin-ubiquitin fusion protein, and constructed a combinatorial peptide library to screen for BoNT/A light chain inhibitors using mRNA display. A protease assay was developed using immobilized intact SNAP-25 as the substrate. The new peptide inhibitors showed a 10-fold increase in affinity to BoNT/A light chain than the parent peptide. Interestingly, the sequences of the new peptide inhibitors showed abundant hydrophobic residues but few hydrophilic residues. The results suggest that mRNA display may provide a general approach in developing peptide inhibitors of BoNTs

  16. Regulation of mRNA translation influences hypoxia tolerance

    International Nuclear Information System (INIS)

    Koritzinsky, M.; Wouters, B.G.; Koumenis, C.

    2003-01-01

    Hypoxia is a heterogenous but common characteristic of human tumours and poor oxygenation is associated with poor prognosis. We believe that the presence of viable hypoxic tumor cells reflects in part an adaptation and tolerance of these cells to oxygen deficiency. Since oxidative phosphorylation is compromized during hypoxia, adaptation may involve both the upregulation of glycolysis as well as downregulation of energy consumption. mRNA translation is one of the most energy costly cellular processes, and we and others have shown that global mRNA translation is rapidly inhibited during hypoxia. However, some mRNAs, including those coding for HIF-1 α and VEGF, remain efficiently translated during hypoxia. Clearly, the mechanisms responsible for the overall inhibition of translation during hypoxia does not compromize the translation of certain hypoxia-induced mRNA species. We therefore hypothesize that the inhibition of mRNA translation serves to promote hypoxia tolerance in two ways: i) through conservation of energy and ii) through differential gene expression involved in hypoxia adaptation. We have recently identified two pathways that are responsible for the global inhibition of translation during hypoxia. The phosphorylation of the eukaryotic initiation factor eIF2 α by the ER resident kinase PERK results in down-regulation of protein synthesis shortly after the onset of hypoxia. In addition, the initiation complex eIF4F is disrupted during long lasting hypoxic conditions. The identification of the molecular pathways responsible for the inhibition of overall translation during hypoxia has rendered it possible to investigate their importance for hypoxia tolerance. We have found that mouse embryo fibroblasts that are knockout for PERK and therefore not able to inhibit protein synthesis efficiently during oxygen deficiency are significantly less tolerant to hypoxia than their wildtype counterparts. We are currently also investigating the functional significance

  17. Cup regulates oskar mRNA stability during oogenesis.

    Science.gov (United States)

    Broyer, Risa M; Monfort, Elena; Wilhelm, James E

    2017-01-01

    The proper regulation of the localization, translation, and stability of maternally deposited transcripts is essential for embryonic development in many organisms. These different forms of regulation are mediated by the various protein subunits of the ribonucleoprotein (RNP) complexes that assemble on maternal mRNAs. However, while many of the subunits that regulate the localization and translation of maternal transcripts have been identified, relatively little is known about how maternal mRNAs are stockpiled and stored in a stable form to support early development. One of the best characterized regulators of maternal transcripts is Cup - a broadly conserved component of the maternal RNP complex that in Drosophila acts as a translational repressor of the localized message oskar. In this study, we have found that loss of cup disrupts the localization of both the oskar mRNA and its associated proteins to the posterior pole of the developing oocyte. This defect is not due to a failure to specify the oocyte or to disruption of RNP transport. Rather, the localization defects are due to a drop in oskar mRNA levels in cup mutant egg chambers. Thus, in addition to its role in regulating oskar mRNA translation, Cup also plays a critical role in controlling the stability of the oskar transcript. This suggests that Cup is ideally positioned to coordinate the translational control function of the maternal RNP complex with its role in storing maternal transcripts in a stable form. Published by Elsevier Inc.

  18. Natural selection and algorithmic design of mRNA.

    Science.gov (United States)

    Cohen, Barry; Skiena, Steven

    2003-01-01

    Messenger RNA (mRNA) sequences serve as templates for proteins according to the triplet code, in which each of the 4(3) = 64 different codons (sequences of three consecutive nucleotide bases) in RNA either terminate transcription or map to one of the 20 different amino acids (or residues) which build up proteins. Because there are more codons than residues, there is inherent redundancy in the coding. Certain residues (e.g., tryptophan) have only a single corresponding codon, while other residues (e.g., arginine) have as many as six corresponding codons. This freedom implies that the number of possible RNA sequences coding for a given protein grows exponentially in the length of the protein. Thus nature has wide latitude to select among mRNA sequences which are informationally equivalent, but structurally and energetically divergent. In this paper, we explore how nature takes advantage of this freedom and how to algorithmically design structures more energetically favorable than have been built through natural selection. In particular: (1) Natural Selection--we perform the first large-scale computational experiment comparing the stability of mRNA sequences from a variety of organisms to random synonymous sequences which respect the codon preferences of the organism. This experiment was conducted on over 27,000 sequences from 34 microbial species with 36 genomic structures. We provide evidence that in all genomic structures highly stable sequences are disproportionately abundant, and in 19 of 36 cases highly unstable sequences are disproportionately abundant. This suggests that the stability of mRNA sequences is subject to natural selection. (2) Artificial Selection--motivated by these biological results, we examine the algorithmic problem of designing the most stable and unstable mRNA sequences which code for a target protein. We give a polynomial-time dynamic programming solution to the most stable sequence problem (MSSP), which is asymptotically no more complex

  19. [Effects of lipopolysaccharides extracted from Porphyromonas endodontalis on the expression of IL-1beta mRNA and IL-6 mRNA in osteoblasts].

    Science.gov (United States)

    Yang, Di; Li, Ren; Qiu, Li-Hong; Li, Chen

    2009-04-01

    To quantify the IL-1 beta mRNA and IL-6 mRNA expression induced by lipopolysaccharides (LPS)extracted from Porphyromonas endodontalis(P.e) in osteoblasts, and to relate P.e-LPS to bone absorption pathogenesis in lesions of chronical apical periodontitis. MG63 was treated with different concentrations of P.e-LPS(0-50 microg/mL) for different hours(0-24h). The expression of IL-1 beta mRNA and IL-6 mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR).Statistical analysis was performed using one- way ANOVA and Dunnett t test with SPSS11.0 software package. The level of IL-1 beta mRNA and IL-6 mRNA increased significantly after treatment with P.e-LPS at more than 5 microg/mL (P<0.01)and for more than 1 hour (P<0.01), which indicated that P.e-LPS induced osteoblasts to express IL-1 beta mRNA and IL-6 mRNA in dose and time dependent manners. P.e-LPS may promote bone resorption in lesions of chronical apical periodontitis by inducing IL-1 beta mRNA and IL-6 mRNA expression in osteoblasts.

  20. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  1. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  2. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  4. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  5. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  6. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  7. Intergenic mRNA molecules resulting from trans-splicing.

    Science.gov (United States)

    Finta, Csaba; Zaphiropoulos, Peter G

    2002-02-22

    Accumulated recent evidence is indicating that alternative splicing represents a generalized process that increases the complexity of human gene expression. Here we show that mRNA production may not necessarily be limited to single genes, as human liver also has the potential to produce a variety of hybrid cytochrome P450 3A mRNA molecules. The four known cytochrome P450 3A genes in humans, CYP3A4, CYP3A5, CYP3A7, and CYP3A43, share a high degree of similarity, consist of 13 exons with conserved exon-intron boundaries, and form a cluster on chromosome 7. The chimeric CYP3A mRNA molecules described herein are characterized by CYP3A43 exon 1 joined at canonical splice sites to distinct sets of CYP3A4 or CYP3A5 exons. Because the CYP3A43 gene is in a head-to-head orientation with the CYP3A4 and CYP3A5 genes, bypassing transcriptional termination can not account for the formation of hybrid CYP3A mRNAs. Thus, the mechanism generating these molecules has to be an RNA processing event that joins exons of independent pre-mRNA molecules, i.e. trans-splicing. Using quantitative real-time polymerase chain reaction, the ratio of one CYP3A43/3A4 intergenic combination was estimated to be approximately 0.15% that of the CYP3A43 mRNAs. Moreover, trans-splicing has been found not to interfere with polyadenylation. Heterologous expression of the chimeric species composed of CYP3A43 exon 1 joined to exons 2-13 of CYP3A4 revealed catalytic activity toward testosterone.

  8. mRNA transfection of mouse and human neural stem cell cultures

    OpenAIRE

    McLenachan, Samuel; Zhang, D.; Palomo, A.B.; Edel, Michael John; Chen, F.K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has ...

  9. Nucleolin Mediates MicroRNA-directed CSF-1 mRNA Deadenylation but Increases Translation of CSF-1 mRNA*

    Science.gov (United States)

    Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.

    2013-01-01

    CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of

  10. A glimpse at mRNA dynamics reveals cellular domains and rapid trafficking through granules

    NARCIS (Netherlands)

    Gemert, Alice Myriam Christi van

    2011-01-01

    mRNA transport and targeting are essential to gene expression regulation. Specific mRNA sequences can bind several proteins and together form RiboNucleoProtein particles (RNP). The various proteins within the RNP determine mRNA fate: translation, transport or decay. RNP composition varies with

  11. Matrin 3 binds and stabilizes mRNA.

    Directory of Open Access Journals (Sweden)

    Maayan Salton

    Full Text Available Matrin 3 (MATR3 is a highly conserved, inner nuclear matrix protein with two zinc finger domains and two RNA recognition motifs (RRM, whose function is largely unknown. Recently we found MATR3 to be phosphorylated by the protein kinase ATM, which activates the cellular response to double strand breaks in the DNA. Here, we show that MATR3 interacts in an RNA-dependent manner with several proteins with established roles in RNA processing, and maintains its interaction with RNA via its RRM2 domain. Deep sequencing of the bound RNA (RIP-seq identified several small noncoding RNA species. Using microarray analysis to explore MATR3's role in transcription, we identified 77 transcripts whose amounts depended on the presence of MATR3. We validated this finding with nine transcripts which were also bound to the MATR3 complex. Finally, we demonstrated the importance of MATR3 for maintaining the stability of several of these mRNA species and conclude that it has a role in mRNA stabilization. The data suggest that the cellular level of MATR3, known to be highly regulated, modulates the stability of a group of gene transcripts.

  12. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  13. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  14. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  15. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  16. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  17. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  18. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  19. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  20. Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors of mRNA transcription

    International Nuclear Information System (INIS)

    Dreyfuss, G.; Adam, S.A.; Choi, Y.D.

    1984-01-01

    Exposure of intact cells to UV light brings about cross-linking of polyadenylated mRNA to a set of cytoplasmic proteins which are in direct contact with the mRNA in vivo. Substantial amounts of an additional protein of molecular weight 38,000 become cross-linked to the mRNA when cells are treated with inhibitors of mRNA synthesis (actinomycin D, camptothecin, and 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole) or after infection with vesicular stomatitis virus. Cordycepin, which inhibits polyadenylation but not mRNA synthesis, has no such effect. Inhibitors of protein synthesis and of rRNA synthesis are also without effect on 38K cross-linking to mRNA. The onset of the effect of inhibitors of mRNA synthesis on the UV cross-linkable interaction between mRNA and 38K is rapid and reaches a maximal level in less than 60 min, and it is completely and rapidly reversible. In cells treated with actinomycin D, the amount of 38K which becomes cross-linked to mRNA is proportional to the extent of inhibition of mRNA synthesis. The association of 38K with mRNA during transcriptional arrest does not require protein synthesis because simultaneous treatment with the protein synthesis inhibitor emetine does not interfere with it. The effectors which promote the interaction of 38K with mRNA do not affect the proteins which are in contact with polyadenylated heterogeneous nuclear RNA and do not markedly affect protein synthesis in the cell. The 38K protein can be isolated with the polyribosomal polyadenylated fraction from which it was purified, and monoclonal antibodies against it were prepared

  1. Effect of in vitro estrogenic pesticides on human oestrogen receptor α and β mRNA levels

    DEFF Research Database (Denmark)

    Theander Grünfeld, Heidi; Bonefeld-Jørgensen, Eva Cecilie

    2004-01-01

    of the ERα mRNA level, but only significantly for prochloraz, dieldrin, and tolchlofos-methyl. Alone no pesticides affected the ERβ mRNA level significantly, but chlorpyrifos increased the mRNA level weakly. Co-exposure with E2 elicited a significant increased ERβ mRNA level by prochloraz, fenarimol...

  2. Nuclear Imprisonment: Viral Strategies to Arrest Host mRNA Nuclear Export

    Science.gov (United States)

    Kuss, Sharon K.; Mata, Miguel A.; Zhang, Liang; Fontoura, Beatriz M. A.

    2013-01-01

    Viruses possess many strategies to impair host cellular responses to infection. Nuclear export of host messenger RNAs (mRNA) that encode antiviral factors is critical for antiviral protein production and control of viral infections. Several viruses have evolved sophisticated strategies to inhibit nuclear export of host mRNAs, including targeting mRNA export factors and nucleoporins to compromise their roles in nucleo-cytoplasmic trafficking of cellular mRNA. Here, we present a review of research focused on suppression of host mRNA nuclear export by viruses, including influenza A virus and vesicular stomatitis virus, and the impact of this viral suppression on host antiviral responses. PMID:23872491

  3. Cytoplasmic Control of Sense-Antisense mRNA Pairs

    Directory of Open Access Journals (Sweden)

    Flore Sinturel

    2015-09-01

    Full Text Available Transcriptome analyses have revealed that convergent gene transcription can produce many 3′-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3′-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3′-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3′-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5′-3′ cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression.

  4. Cytoplasmic Control of Sense-Antisense mRNA Pairs.

    Science.gov (United States)

    Sinturel, Flore; Navickas, Albertas; Wery, Maxime; Descrimes, Marc; Morillon, Antonin; Torchet, Claire; Benard, Lionel

    2015-09-22

    Transcriptome analyses have revealed that convergent gene transcription can produce many 3'-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3'-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3'-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3'-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD) in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs) form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5'-3' cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Regulation of mRNA translation during mitosis.

    Science.gov (United States)

    Tanenbaum, Marvin E; Stern-Ginossar, Noam; Weissman, Jonathan S; Vale, Ronald D

    2015-08-25

    Passage through mitosis is driven by precisely-timed changes in transcriptional regulation and protein degradation. However, the importance of translational regulation during mitosis remains poorly understood. Here, using ribosome profiling, we find both a global translational repression and identified ~200 mRNAs that undergo specific translational regulation at mitotic entry. In contrast, few changes in mRNA abundance are observed, indicating that regulation of translation is the primary mechanism of modulating protein expression during mitosis. Interestingly, 91% of the mRNAs that undergo gene-specific regulation in mitosis are translationally repressed, rather than activated. One of the most pronounced translationally-repressed genes is Emi1, an inhibitor of the anaphase promoting complex (APC) which is degraded during mitosis. We show that full APC activation requires translational repression of Emi1 in addition to its degradation. These results identify gene-specific translational repression as a means of controlling the mitotic proteome, which may complement post-translational mechanisms for inactivating protein function.

  6. IER5 gene's mRNA expression after irradiation

    International Nuclear Information System (INIS)

    Ding Kuke; Shen Jingjing; Xu Lili; Li Yanling; Zhou Ping; Ma Binrong; Zhao Zengqiang; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To explore the effect of irradiation on IER5 gene expression. Methods: Two kinds of cells (AHH-1 and HeLa) and the BALB/c-nu mice inoculated with tumor cells were exposed to 60 Co γ- rays and analyzed by real-time PCR. The above-mentioned irradiated objects were firstly divided into groups by different doses and post-radiation time, then mRNA were extracted and reverse-transcripted to DNA before real-time PCR test. Results: Under the same condition, AHH-1 was more sensitive to radiation than HeLa. The dose level corresponding to the expression peak of AHH-1 was less than that of HeLa. For AHH-1 cells, the response to 2 Gy irradiation was earlier than that to 10 Gy. But there was not remarkable difference for HeLa response between 2 and 10 Gy, and the top transcriptional levels for both cells nearly simultaneously appeared at 2 h after irradiation. In addition, the IER5 gene of human liver tumor was more sensitive than that of lung cancer and brain tumor. Conclusions: IER5 might be a candidate biomarker of radiation injury, and had the potential value in radiation-therapy for liver tumor. (authors)

  7. mRNA related to insulin family in human placenta

    International Nuclear Information System (INIS)

    Younes, M.A.; D'Agostino, J.B.; Frazier, M.L.; Besch, P.K.

    1986-01-01

    The authors have previously reported that human term placenta contains mRNA displaying sequence homology to a rat preproinsulin I cDNA clone (p119). When placental poly(A + ) RNA was analyzed for homology to p119 by RNA/DNA blot hybridization, prominent hybridization was observed which was found by densitometric analysis to be three-fold higher than control. To further characterize this insulin-like message, a cDNA library was generated (approx.7000 transformants) using normal term cesarean-sectioned tissue to prepare placental poly(A + ) RNA templates. Five hundred transformants were initially screened by colony hybridization using a 32 P-labeled rat preproinsulin I cDNA as probe. Of the ten initial positives obtained, three were found to be true positives based on Southern hybridization analyses of the recombinant plasmids. Using Taq I digested pBr322 as a size marker, the cDNAs were found to be approximately 300 bp in length. Preliminary DNA sequencing using the Sanger dideoxy chain termination method has revealed that one of these clones displays significant homology to the 5' region of human insulin-like growth factors I and II

  8. mRNA related to insulin family in human placenta

    Energy Technology Data Exchange (ETDEWEB)

    Younes, M.A.; D' Agostino, J.B.; Frazier, M.L.; Besch, P.K.

    1986-03-01

    The authors have previously reported that human term placenta contains mRNA displaying sequence homology to a rat preproinsulin I cDNA clone (p119). When placental poly(A/sup +/) RNA was analyzed for homology to p119 by RNA/DNA blot hybridization, prominent hybridization was observed which was found by densitometric analysis to be three-fold higher than control. To further characterize this insulin-like message, a cDNA library was generated (approx.7000 transformants) using normal term cesarean-sectioned tissue to prepare placental poly(A/sup +/) RNA templates. Five hundred transformants were initially screened by colony hybridization using a /sup 32/P-labeled rat preproinsulin I cDNA as probe. Of the ten initial positives obtained, three were found to be true positives based on Southern hybridization analyses of the recombinant plasmids. Using Taq I digested pBr322 as a size marker, the cDNAs were found to be approximately 300 bp in length. Preliminary DNA sequencing using the Sanger dideoxy chain termination method has revealed that one of these clones displays significant homology to the 5' region of human insulin-like growth factors I and II.

  9. In human granulosa cells from small antral follicles, androgen receptor mRNA and androgen levels in follicular fluid correlate with FSH receptor mRNA

    DEFF Research Database (Denmark)

    Nielsen, M. E.; Rasmussen, I. A.; Kristensen, S. G.

    2011-01-01

    significantly with the expression of AMHRII, but did not correlate with any of the hormones in the follicular fluid. These data demonstrate an intimate association between AR expression in immature granulosa cells, and the expression of FSHR in normal small human antral follicles and between the follicular......Human small antral follicles (diameter 3-9 mm) were obtained from ovaries surgically removed for fertility preservation. From the individual aspirated follicles, granulosa cells and the corresponding follicular fluid were isolated in 64 follicles, of which 55 were available for mRNA analysis (24...... and to the follicular fluid concentrations of AMH, inhibin-B, progesterone and estradiol. AR mRNA expression in granulosa cells and the follicular fluid content of androgens both showed a highly significant positive association with the expression of FSHR mRNA in granulosa cells. AR mRNA expression also correlated...

  10. Bioinspired nanocomplex for spatiotemporal imaging of sequential mRNA expression in differentiating neural stem cells.

    Science.gov (United States)

    Wang, Zhe; Zhang, Ruili; Wang, Zhongliang; Wang, He-Fang; Wang, Yu; Zhao, Jun; Wang, Fu; Li, Weitao; Niu, Gang; Kiesewetter, Dale O; Chen, Xiaoyuan

    2014-12-23

    Messenger RNA plays a pivotal role in regulating cellular activities. The expression dynamics of specific mRNA contains substantial information on the intracellular milieu. Unlike the imaging of stationary mRNAs, real-time intracellular imaging of the dynamics of mRNA expression is of great value for investigating mRNA biology and exploring specific cellular cascades. In addition to advanced imaging methods, timely extracellular stimulation is another key factor in regulating the mRNA expression repertoire. The integration of effective stimulation and imaging into a single robust system would significantly improve stimulation efficiency and imaging accuracy, producing fewer unwanted artifacts. In this study, we developed a multifunctional nanocomplex to enable self-activating and spatiotemporal imaging of the dynamics of mRNA sequential expression during the neural stem cell differentiation process. This nanocomplex showed improved enzymatic stability, fast recognition kinetics, and high specificity. With a mechanism regulated by endogenous cell machinery, this nanocomplex realized the successive stimulating motif release and the dynamic imaging of chronological mRNA expression during neural stem cell differentiation without the use of transgenetic manipulation. The dynamic imaging montage of mRNA expression ultimately facilitated genetic heterogeneity analysis. In vivo lateral ventricle injection of this nanocomplex enabled endogenous neural stem cell activation and labeling at their specific differentiation stages. This nanocomplex is highly amenable as an alternative tool to explore the dynamics of intricate mRNA activities in various physiological and pathological conditions.

  11. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  12. Coordinated Regulations of mRNA Synthesis and Decay during Cold Acclimation in Arabidopsis Cells.

    KAUST Repository

    Arae, Toshihiro

    2017-04-18

    Plants possess a cold acclimation system to acquire freezing tolerance through pre-exposure to non-freezing low temperatures. The transcriptional cascade of C-repeat binding factors (CBFs)/dehydration response element-binding factors (DREBs) is considered a major transcriptional regulatory pathway during cold acclimation. However, little is known regarding the functional significance of mRNA stability regulation in the response of gene expression to cold stress. The actual level of individual mRNAs is determined by a balance between mRNA synthesis and degradation. Therefore, it is important to assess the regulatory steps to increase our understanding of gene regulation. Here, we analyzed temporal changes in mRNA amounts and half-lives in response to cold stress in Arabidopsis cell cultures based on genome-wide analysis. In this mRNA decay array method, mRNA half-life measurements and microarray analyses were combined. In addition, temporal changes in the integrated value of transcription rates were estimated from the above two parameters using a mathematical approach. Our results showed that several cold-responsive genes, including Cold-regulated 15a, were relatively destabilized, whereas the mRNA amounts were increased during cold treatment by accelerating the transcription rate to overcome the destabilization. Considering the kinetics of mRNA synthesis and degradation, this apparently contradictory result supports that mRNA destabilization is advantageous for the swift increase in CBF-responsive genes in response to cold stress.

  13. Primary induction of vitellogenin mRNA in the rooster by 17beta-estradiol.

    Science.gov (United States)

    Burns, A T; Deeley, R G; Gordon, J I; Udell, D S; Mullinix, K P; Goldberger, R F

    1978-01-01

    We have studied the kinetics of vitellogenin mRNA accumulation in rooster liver after a primary injection of 17beta-estradiol. The levels of vitellogenin mRNA have been determined both by hybridization of total cellular RNA to vitellogenin cDNA and by translation of vitellogenin mRNA in a wheat germ cell-free system. The results obtained by both methods of analysis are in good agreement and indicate that vitellogenin mRNA is present in the liver of normal roosters at a level of 0-5 molecules per liver cell and increases in amount during the 3 days following injection of estrogen, reaching a level of almost 6000 molecules per cell at the peak of the response. The level of vitellogenin mRNA declined exponentially during the next 14 days with a half-life of 29 hr, reaching a level of less than 10 molecules per cell at 17 days after injection of the hormone. The levels of vitellogenin mRNA after stimulation with estrogen have been correlated with the in vivo rate of synthesis of the vitellogenin polypeptide. The results indicate that the rate of vitellogenin synthesis is closely correlated with the level of vitellogenin mRNA. On the basis of these findings, we conclude that vitellogenin mRNA does not exist in the liver in an untranslated form after withdrawal from estrogen. PMID:273910

  14. Survivin mRNA antagonists using locked nucleic acid, potential for molecular cancer therapy

    DEFF Research Database (Denmark)

    Fisker, Niels; Westergaard, Majken; Hansen, Henrik Frydenlund

    2007-01-01

    We have investigated the effects of different locked nucleic acid modified antisense mRNA antagonists against Survivin in a prostate cancer model. These mRNA antagonists were found to be potent inhibitors of Survivin expression at low nanomolar concentrations. Additionally there was a pronounced ...

  15. Coordinated Regulations of mRNA Synthesis and Decay during Cold Acclimation in Arabidopsis Cells.

    KAUST Repository

    Arae, Toshihiro; Isai, Shiori; Sakai, Akira; Mineta, Katsuhiko; Hirai, Masami Yokota; Suzuki, Yuya; Kanaya, Shigehiko; Yamaguchi, Junji; Naito, Satoshi; Chiba, Yukako

    2017-01-01

    stress in Arabidopsis cell cultures based on genome-wide analysis. In this mRNA decay array method, mRNA half-life measurements and microarray analyses were combined. In addition, temporal changes in the integrated value of transcription rates were

  16. In situ localization of chalcone synthase mRNA in pea root nodule development.

    NARCIS (Netherlands)

    Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.

    1992-01-01

    In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it

  17. Responses of mRNA expression of PepT1 in small intestine to ...

    African Journals Online (AJOL)

    To study the effect of circulation small peptides concentration on mRNA expression in small intestine, graded amount of soybean small peptides (SSP) were infused into lactating goats through duodenal fistulas. Peptide-bound amino acid (PBAA) concentration in arterial plasma and the mRNA expression of PepT1 was ...

  18. Exogenous mRNA encoding tetanus or botulinum neurotoxins expressed in Aplysia neurons

    NARCIS (Netherlands)

    Mochida, Sumiko; Poulain, Bernard; Eisel, Ulrich; Binz, Thomas; Kurazono, Hisao; Niemann, Heiner; Tauc, Ladislav; Bullock, Theodore H.

    1990-01-01

    Injection of exogenous mRNA purified from various tissue preparations into cellular translation systems such as Xenopus oocytes has allowed expression of complex proteins (e.g., receptors for neurotransmitters). No evidence for expression of injected exogenous mRNA, however, has been reported in

  19. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  20. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  1. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  2. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  3. The potential role of IGF-I receptor mRNA in rats with diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    匡洪宇; 邹伟; 刘丹; 史榕荇; 程丽华; 殷慧清; 刘晓民

    2003-01-01

    Objective To evaluate the potential role of insulin-like growth factor-1 receptor mRNA(IGF-IR mRNA) in the onset and development of retinopathy in diabetic rats.Methods A diabetic model was duplicated in Wistar rats. The early changes in the retina were examined using light and transmission electron microscopy. Expression of IGF-IR mRNA was analyzed using in situ hybridization.Results Weak expression of IGF-IR mRNA(5%) was found in retinas of normal rats, but was significantly increased (15% and 18%) in the retinas of diabetic rats after 3 and 6 months of diabetes (P<0.01). In situ hybridization and morphological study demonstrated that there was a positive correlation between IGF-IR mRNA expression and retinal changes at various stages.Conclusion Increased IGF-IR mRNA might play an important role in the onset and development of diabetic retinopathy.

  4. Simultaneous isolation of mRNA and native protein from minute samples of cells

    DEFF Research Database (Denmark)

    Petersen, Tonny Studsgaard; Andersen, Claus Yding

    2014-01-01

    Precious biological samples often lack a sufficient number of cells for multiple procedures, such as extraction of mRNA while maintaining protein in a non-denatured state suitable for subsequent characterization. Here we present a new method for the simultaneous purification of mRNA and native...... in their native state for traditional protein assays. We validated the procedure using neonatal rat ovaries and small numbers of human granulosa cells, demonstrating the extraction of mRNA suitable for gene expression analysis with simultaneous isolation of native proteins suitable for downstream characterization...... proteins from samples containing small numbers of cells. Our approach utilizes oligodeoxythymidylate [oligo(dT)25]-coated paramagnetic beads in an optimized reaction buffer to isolate mRNA comparable in quantity and quality to mRNA isolated with existing methods, while maintaining the proteins...

  5. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  6. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  7. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  8. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  9. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  10. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  11. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  12. Impairment of FOS mRNA stabilization following translation arrest in granulocytes from myelodysplastic syndrome patients.

    Science.gov (United States)

    Feng, Xiaomin; Shikama, Yayoi; Shichishima, Tsutomu; Noji, Hideyoshi; Ikeda, Kazuhiko; Ogawa, Kazuei; Kimura, Hideo; Takeishi, Yasuchika; Kimura, Junko

    2013-01-01

    Although quantitative and qualitative granulocyte defects have been described in myelodysplastic syndromes (MDS), the underlying molecular basis of granulocyte dysfunction in MDS is largely unknown. We recently found that FOS mRNA elevation under translation-inhibiting stimuli was significantly smaller in granulocytes from MDS patients than in healthy individuals. The aim of this study is to clarify the cause of the impaired FOS induction in MDS. We first examined the mechanisms of FOS mRNA elevation using granulocytes from healthy donors cultured with the translation inhibitor emetine. Emetine increased both transcription and mRNA stability of FOS. p38 MAPK inhibition abolished the emetine-induced increase of FOS transcription but did not affect FOS mRNA stabilization. The binding of an AU-rich element (ARE)-binding protein HuR to FOS mRNA containing an ARE in 3'UTR was increased by emetine, and the knockdown of HuR reduced the FOS mRNA stabilizing effect of emetine. We next compared the emetine-induced transcription and mRNA stabilization of FOS between MDS patients and healthy controls. Increased rates of FOS transcription by emetine were similar in MDS and controls. In the absence of emetine, FOS mRNA decayed to nearly 17% of initial levels in 45 min in both groups. In the presence of emetine, however, 76.7±19.8% of FOS mRNA remained after 45 min in healthy controls, versus 37.9±25.5% in MDS (Pknowledge, this is the first report demonstrating attenuation of stress-induced FOS mRNA stabilization in MDS granulocytes.

  13. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  14. Genomic characterization and expression profiles upon bacterial infection of a novel cystatin B homologue from disk abalone (Haliotis discus discus).

    Science.gov (United States)

    Premachandra, H K A; Wan, Qiang; Elvitigala, Don Anushka Sandaruwan; De Zoysa, Mahanama; Choi, Cheol Young; Whang, Ilson; Lee, Jehee

    2012-12-01

    Cystatins are a large family of cysteine proteinase inhibitors which are involved in diverse biological and pathological processes. In the present study, we identified a gene related to cystatin superfamily, AbCyt B, from disk abalone Haliotis discus discus by expressed sequence tag (EST) analysis and BAC library screening. The complete cDNA sequence of AbCyt B is comprised of 1967 nucleotides with a 306 bp open reading frame (ORF) encoding for 101 amino acids. The amino acid sequence consists of a single cystatin-like domain, which has a cysteine proteinase inhibitor signature, a conserved Gly in N-terminal region, QVVAG motif and a variant of PW motif. No signal peptide, disulfide bonds or carbohydrate side chains were identified. Analysis of deduced amino acid sequence revealed that AbCyt B shares up to 44.7% identity and 65.7% similarity with the cystatin B genes from other organisms. The genomic sequence of AbCyt B is approximately 8.4 Kb, consisting of three exons and two introns. Phylogenetic tree analysis showed that AbCyt B was closely related to the cystatin B from pacific oyster (Crassostrea gigas) under the family 1.Functional analysis of recombinant AbCyt B protein exhibited inhibitory activity against the papain, with almost 84% inhibition at a concentration of 3.5 μmol/L. In tissue expression analysis, AbCyt B transcripts were expressed abundantly in the hemocyte, gill, mantle, and digestive tract, while weakly in muscle, testis, and hepatopancreas. After the immune challenge with Vibrio parahemolyticus, the AbCyt B showed significant (P<0.05) up-regulation of relative mRNA expression in gill and hemocytes at 24 and 6 h of post infection, respectively. These results collectively suggest that AbCyst B is a potent inhibitor of cysteine proteinases and is also potentially involved in immune responses against invading bacterial pathogens in abalone. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. High ALK mRNA expression has a negative prognostic significance in rhabdomyosarcoma

    Science.gov (United States)

    Bonvini, P; Zin, A; Alaggio, R; Pawel, B; Bisogno, G; Rosolen, A

    2013-01-01

    Background: Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase aberrantly expressed in cancer, but its clinical and functional importance remain controversial. Mutation or amplification of ALK, as well as its expression levels assessed by conventional immunohistochemistry methods, has been linked to prognosis in cancer, although with potential bias because of the semi-quantitative approaches. Herein, we measured ALK mRNA expression in rhabdomyosarcoma (RMS) and determined its clinical impact on patients' stratification and outcome. Methods: Specimens were obtained from RMS patients and cell lines, and ALK expression was analysed by quantitative RT–PCR, western blotting, IHC, and copy number analysis. Results: High ALK mRNA expression was detected in the vast majority of PAX3/7-FOXO1-positive tumours, whereas PAX3/7-FOXO1-negative RMS displayed considerably lower amounts of both mRNA and protein. Notably, ALK mRNA distinguished unfavourable PAX3/7-FOXO1-positive tumours from PAX3/7-FOXO1-negative RMS (Ptumour size (PALK mRNA levels were of prognostic relevance by Cox univariate regression analysis and correlated with increased risk of relapse (P=0.001) and survival (P=0.01), whereas by multivariate analysis elevated ALK mRNA expression resulted a negative prognostic marker when clinical stage was not included. Conclusion: Quantitative assessment of ALK mRNA expression helps to improve risk stratification of RMS patients and identifies tumours with adverse biological characteristics and aggressive behaviour. PMID:24149177

  16. The hypoxic proteome is influenced by gene-specific changes in mRNA translation

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.

    2005-01-01

    Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia

  17. Complement mRNA in the mammalian brain: responses to Alzheimer's disease and experimental brain lesioning.

    Science.gov (United States)

    Johnson, S A; Lampert-Etchells, M; Pasinetti, G M; Rozovsky, I; Finch, C E

    1992-01-01

    This study describes evidence in the adult human and rat brain for mRNAs that encode two complement (C) proteins, C1qB and C4. C proteins are important effectors of humoral immunity and inflammation in peripheral tissues but have not been considered as normally present in brain. Previous immunocytochemical studies showed that C proteins are associated with plaques, tangles, and dystrophic neurites in Alzheimer's disease (AD), but their source is unknown. Combined immunocytochemistry and in situ hybridization techniques show C4 mRNA in pyramidal neurons and C1qB mRNA in microglia. Primary rat neuron cultures also show C1qB mRNA. In the cortex from AD brains, there were two- to threefold increases of C1qB mRNA and C4 mRNA, and increased C1qB mRNA prevalence was in part associated with microglia. As a model for AD, we examined entorhinal cortex perforant path transection in the rat brain, which caused rapid increases of C1qB mRNA in the ipsilateral, but not contralateral, hippocampus and entorhinal cortex. The role of brain-derived acute and chronic C induction during AD and experimental lesions can now be considered in relation to functions of C proteins that pertain to cell degeneration and/or cell preservation and synaptic plasticity.

  18. The mRNA expression of XRCC repair genes in mice after γ-ray radiation

    International Nuclear Information System (INIS)

    Wang Qin; Yue Jingyin; Li Jin; Mu Chuanjie; Fan Feiyue

    2006-01-01

    Objective: To investigate the role of XRCC repair genes in radioresistance of IRM-2 inbred mice. Methods: Northern hybridization was used to measure mRNA expression of XRCC1 and XRCC5 genes in IRM-2 inbred mice. ICR/JCL and 615 after exposure to different doses of γ-ray radiation at different postirradiation time. Results: The levels of XRCC1 and XRCC5 mRNA expression in control IRM-2 mice were higher significantly than those in their control parental mice (P<0.01 and P<0.05). The mRNA expression of XRCC genes in ICR/JCL and 615 mice all increased to some extent after exposure 1, 2 and 4 Gy radiation. But the levels were significantly higher at 2h postirradiation (P<0.05) . The levels of XRCC mRNA expression in IRM-2 mice did not increase significnatly compared with the control mice after exposure 1 and 2 Gy radiation. But the levels of XRCC1 and XRCC5 mRNA expression increased markedly at 4Gy 1h postirradiation (P<0.05 and P<0.01). Conclusion: The basal levels of XRCC1 and XRCC5 mRNA expression in IRM-2 mice were high. The high level of XRCC5 mRNA expression was involved in the repair of DNA double strand breaks induced by higher dose radiation, which perhaps was one of radioresistance causes of IRM-2 mice. (authors)

  19. Single-cell mRNA transfection studies: delivery, kinetics and statistics by numbers.

    Science.gov (United States)

    Leonhardt, Carolin; Schwake, Gerlinde; Stögbauer, Tobias R; Rappl, Susanne; Kuhr, Jan-Timm; Ligon, Thomas S; Rädler, Joachim O

    2014-05-01

    In artificial gene delivery, messenger RNA (mRNA) is an attractive alternative to plasmid DNA (pDNA) since it does not require transfer into the cell nucleus. Here we show that, unlike for pDNA transfection, the delivery statistics and dynamics of mRNA-mediated expression are generic and predictable in terms of mathematical modeling. We measured the single-cell expression time-courses and levels of enhanced green fluorescent protein (eGFP) using time-lapse microscopy and flow cytometry (FC). The single-cell analysis provides direct access to the distribution of onset times, life times and expression rates of mRNA and eGFP. We introduce a two-step stochastic delivery model that reproduces the number distribution of successfully delivered and translated mRNA molecules and thereby the dose-response relation. Our results establish a statistical framework for mRNA transfection and as such should advance the development of RNA carriers and small interfering/micro RNA-based drugs. This team of authors established a statistical framework for mRNA transfection by using a two-step stochastic delivery model that reproduces the number distribution of successfully delivered and translated mRNA molecules and thereby their dose-response relation. This study establishes a nice connection between theory and experimental planning and will aid the cellular delivery of mRNA molecules. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  1. NONOates regulate KCl cotransporter-1 and -3 mRNA expression in vascular smooth muscle cells.

    Science.gov (United States)

    Di Fulvio, Mauricio; Lauf, Peter K; Shah, Shalin; Adragna, Norma C

    2003-05-01

    Nitric oxide (NO) donors regulate KCl cotransport (KCC) activity and cotransporter-1 and -3 (KCC1 and KCC3) mRNA expression in sheep erythrocytes and in primary cultures of rat vascular smooth muscle cells (VSMCs), respectively. In this study, we used NONOates as rapid and slow NO releasers to provide direct evidence implicating NO as a regulator of KCC3 gene expression at the mRNA level. In addition, we used the expression of KCC3 mRNA to further investigate the mechanism of action of these NO donors at the cellular level. Treatment of VSMCs with rapid NO releasers, like NOC-5 and NOC-9, as well as with the direct NO-independent soluble guanylyl cyclase (sGC) stimulator YC-1, acutely increased KCC3 mRNA expression in a concentration- and time-dependent manner. The slow NO releaser NOC-18 had no effect on KCC3 gene expression. A specific NO scavenger completely prevented the NONOate-induced KCC3 mRNA expression. Inhibition of sGC with LY-83583 blocked the NONOate- and YC-1-induced KCC3 mRNA expression. This study shows that in primary cultures of rat VSMCs, the fast NO releasers NOC-9 and NOC-5, but not the slow NO releaser NOC-18, acutely upregulate KCC3 mRNA expression in a NO/sGC-dependent manner.

  2. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  3. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier

    2010-03-01

    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  4. A novel link between Sus1 and the cytoplasmic mRNA decay machinery suggests a broad role in mRNA metabolism

    Directory of Open Access Journals (Sweden)

    Llopis Ana

    2010-03-01

    Full Text Available Abstract Background Gene expression is achieved by the coordinated action of multiple factors to ensure a perfect synchrony from chromatin epigenetic regulation through to mRNA export. Sus1 is a conserved mRNA export/transcription factor and is a key player in coupling transcription initiation, elongation and mRNA export. In the nucleus, Sus1 is associated to the transcriptional co-activator SAGA and to the NPC associated complex termed TREX2/THSC. Through these associations, Sus1 mediates the nuclear dynamics of different gene loci and facilitate the export of the new transcripts. Results In this study, we have investigated whether the yeast Sus1 protein is linked to factors involved in mRNA degradation pathways. We provide evidence for genetic interactions between SUS1 and genes coding for components of P-bodies such as PAT1, LSM1, LSM6 and DHH1. We demonstrate that SUS1 deletion is synthetic lethal with 5'→3' decay machinery components LSM1 and PAT1 and has a strong genetic interaction with LSM6 and DHH1. Interestingly, Sus1 overexpression led to an accumulation of Sus1 in cytoplasmic granules, which can co-localise with components of P-bodies and stress granules. In addition, we have identified novel physical interactions between Sus1 and factors associated to P-bodies/stress granules. Finally, absence of LSM1 and PAT1 slightly promotes the Sus1-TREX2 association. Conclusions In this study, we found genetic and biochemical association between Sus1 and components responsible for cytoplasmic mRNA metabolism. Moreover, Sus1 accumulates in discrete cytoplasmic granules, which partially co-localise with P-bodies and stress granules under specific conditions. These interactions suggest a role for Sus1 in gene expression during cytoplasmic mRNA metabolism in addition to its nuclear function.

  5. Negative regulation of neuromedin U mRNA expression in the rat pars tuberalis by melatonin.

    Directory of Open Access Journals (Sweden)

    Sayaka Aizawa

    Full Text Available The pars tuberalis (PT is part of the anterior pituitary gland surrounding the median eminence as a thin cell layer. The characteristics of PT differ from those of the pars distalis (PD, such as cell composition and gene expression, suggesting that the PT has a unique physiological function compared to the PD. Because the PT highly expresses melatonin receptor type 1, it is considered a mediator of seasonal and/or circadian signals of melatonin. Expression of neuromedin U (NMU that is known to regulate energy balance has been previously reported in the rat PT; however, the regulatory mechanism of NMU mRNA expression and secretion in the PT are still obscure. In this study, we examined both the diurnal change of NMU mRNA expression in the rat PT and the effects of melatonin on NMU in vivo. In situ hybridization and quantitative PCR analysis of laser microdissected PT samples revealed that NMU mRNA expression in the PT has diurnal variation that is high during the light phase and low during the dark phase. Furthermore, melatonin administration significantly suppressed NMU mRNA expression in the PT in vivo. On the other hand, 48 h fasting did not have an effect on PT-NMU mRNA expression, and the diurnal change of NMU mRNA expression was maintained. We also found the highest expression of neuromedin U receptor type 2 (NMUR2 mRNA in the third ventricle ependymal cell layer, followed by the arcuate nucleus and the spinal cord. These results suggest that NMU mRNA expression in the PT is downregulated by melatonin during the dark phase and shows diurnal change. Considering that NMU mRNA in the PT showed the highest expression level in the brain, PT-NMU may act on NMUR2 in the brain, especially in the third ventricle ependymal cell layer, with a circadian rhythm.

  6. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    International Nuclear Information System (INIS)

    Toki, Yasumichi; Sasaki, Katsunori; Tanaka, Hiroki; Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro; Torimoto, Yoshihiro; Ohtake, Takaaki; Kohgo, Yutaka

    2016-01-01

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  7. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Toki, Yasumichi [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Sasaki, Katsunori, E-mail: k-sasaki@asahikawa-med.ac.jp [Department of Gastrointestinal Immunology and Regenerative Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Tanaka, Hiroki [Department of Legal Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Torimoto, Yoshihiro [Oncology Center, Asahikawa Medical University Hospital, Hokkaido 078-8510 (Japan); Ohtake, Takaaki; Kohgo, Yutaka [Department of Gastroenterology, International University of Health and Welfare Hospital, Tochigi 329-2763 (Japan)

    2016-08-05

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  8. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance.

    Science.gov (United States)

    Morimoto, Shimpei; Yahara, Koji

    2018-03-01

    Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential

  9. T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

    Science.gov (United States)

    Fauser, S; Kern, P

    1997-04-01

    In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

  10. HLA-G allelic variants are associated with differences in the HLA-G mRNA isoform profile and HLA-G mRNA levels

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F; Hylenius, Sine; Rørbye, Christina

    2003-01-01

    between mother and fetus in several ways. Finally, the expression of membrane-bound HLA-G and soluble HLA-G has been proposed to influence the outcome of pregnancy, and an aberrant HLA-G expression in pre-eclamptic placentas and spontaneous abortions has been reported. Here, an association between certain...... HLA-G polymorphisms and the mRNA levels of the different alternatively spliced HLA-G isoforms in first trimester trophoblast cell populations is reported. Several alternatively spliced HLA-G mRNA isoforms, including a 14-bp polymorphism in the 3'UTR end (exon 8) of the HLA-G gene, are expressed...

  11. Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis

    NARCIS (Netherlands)

    Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J

    1996-01-01

    Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,

  12. All-in-one detector of circulating mRNA based on a smartphone

    Science.gov (United States)

    Cmiel, Vratislav; Gumulec, Jaromir; Svoboda, Ondrej; Raudenska, Martina; Hudcova, Kristyna; Sekora, Jiri; Balogh, Jaroslav; Masarik, Michal; Provaznik, Ivo

    2016-03-01

    Metallothionein is significantly elevated in various tumors, notably in prostate cancer on both mRNA and protein level. We demonstrated a strong predictive potential of free circulating metallothionein 2A isoform mRNA for patients with this cancer. Circulating mRNA detection relies on expensive equipment and requires high level of expertise. In this work we developed compact "all-in-one" laboratory system which replace microvolume spectrophotometer, thermocycler and realtime PCR machines. We managed to design and construct a microprocessor controlled heating/cooling chamber that ensures required temperature gradient. The chamber includes implemented optical system to enable fluorescence excitation and fluorescence analysis using a smart-phone.

  13. Adipose tissue interleukin-18 mRNA and plasma interleukin-18: effect of obesity and exercise

    DEFF Research Database (Denmark)

    Leick, Lotte; Lindegaard, Birgitte; Stensvold, Dorthe

    2007-01-01

    resistance was tested. Furthermore, we speculated that acute exercise and exercise training would regulate AT IL-18 mRNA expression. RESEARCH METHODS AND PROCEDURES: Non-obese subjects with BMI women: n = 18; men; n = 11) and obese subjects with BMI >30 kg/m(2) (women: n = 6; men: n = 7...... of regular physical activity with improved insulin sensitivity.......OBJECTIVES: Obesity and a physically inactive lifestyle are associated with increased risk of developing insulin resistance. The hypothesis that obesity is associated with increased adipose tissue (AT) interleukin (IL)-18 mRNA expression and that AT IL-18 mRNA expression is related to insulin...

  14. Assessing mRNA nuclear export in mammalian cells by microinjection.

    Science.gov (United States)

    Lee, Eliza S; Palazzo, Alexander F

    2017-08-15

    The nuclear export of mRNAs is an important yet little understood part of eukaryotic gene expression. One of the easiest methods for monitoring mRNA export in mammalian tissue culture cells is through the microinjection of DNA plasmids into the nucleus and monitoring the distribution of the transcribed product over time. Here we describe how to setup a microscope equipped with a micromanipulator used in cell microinjections, and we explain how to perform a nuclear mRNA export assay and obtain the nuclear export rate for any given mRNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein

    OpenAIRE

    Pinder, Benjamin D; Smibert, Craig A

    2012-01-01

    Argonaute 1 directly interacts with the RNA binding protein Smaug in Drosophila, is thereby recruited to the Smaug target nanos mRNA and is required for Smaug-mediated translational repression of the nanos mRNA.

  16. [Impacts of the formula of Suoquanwan(SQW) on expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency].

    Science.gov (United States)

    Cao, Hong-Ying; Wu, Qing-He; Huang, Ping; He, Jin-Yang

    2009-06-01

    To observe the impacts of the formula of Suoquanwan (SQW) on the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency. The model rats were induced by adenine (250 mg/kg) for 4 weeks, then treated respectively with SQW or dDAVP. The expression of AQP-2 mRNA and AVPR-V2 mRNA in kidney of Yang-deficiency model by realtime fluorescence quantitative PCR method were investigated. In model rats, the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney decreased, dDAVP and SQW high dose could increased the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney. The others had no influence on the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney. SQW can increase the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency.

  17. Localization of insulin receptor mRNA in rat brain by in situ hybridization

    International Nuclear Information System (INIS)

    Marks, J.L.; Porte, D. Jr.; Stahl, W.L.; Baskin, D.G.

    1990-01-01

    Insulin receptor mRNA was demonstrated in rat brain slices by in situ hybridization with three 35 S-oligonucleotide probes and contact film autoradiography. Specificity was confirmed by showing that (a) excess unlabeled probe abolished the signal, (b) an oligonucleotide probe for rat neuropeptide Y mRNA showed a different distribution of hybridization signal, and (c) the distribution of insulin receptor binding was consistent with the distribution of insulin receptor mRNA. Insulin receptor mRNA was most abundant in the granule cell layers of the olfactory bulb, cerebellum and dentate gyrus, in the pyramidal cell body layers of the pyriform cortex and hippocampus, in the choroid plexus and in the arcuate nucleus of the hypothalamus

  18. FATHEAD MINNOW VITELLOGENIN: CDNA SEQUENCE AND MRNA AND PROTEIN EXPRESSION AFTER 17 BETA-ESTRADIOL TREATMENT

    Science.gov (United States)

    In the present study, a sensitive ribonuclease protection assay (RPA) for VTG mRNA was developed for the fathead minnow (Pimephales promelas), a species proposed for routine endocrine-disrupting chemical (EDC) screening.

  19. 60Co γ-irradiation enhances expression of GAP-43 mRNA in rat brain

    International Nuclear Information System (INIS)

    Su Bingyin; Cai Wenqin; Zhang Chenggang

    2001-01-01

    Objective: To study the relationship between the expression of GAP-43 mRNA and nerve regeneration in rat brain after 60 Co γ-irradiation. Methods: Wistar rats were subjected to whole-body irradiation with 8 Gy 60 Co γ-rays. The expression of GAP-43 was detected by in situ hybridization histochemistry using Dig-cRNA probe. Results: It was found that the expression of GAP-43 mRNA increased in the cerebral cortex, caudate, putamen, globus pallidum, thalamus and hypothalamus one week after 8 Gy 60 Co γ-irradiation. The peak of GAP-43 mRNA expression was observed in the fourth week and then began to decrease but still remained at a higher than normal level. However, it decreased to a low level after 7 weeks. Conclusion: Enhanced expression of GAP-43 mRNA after 60 Co γ-irradiation in rat brain is associated with nerve regeneration and reconstruction of synapse

  20. Differential expression of PARP1 mRNA in leucocytes of patients ...

    Indian Academy of Sciences (India)

    P. 2011 Differential expression of PARP1 mRNA in leucocytes of patients with Down's syndrome. J. Genet. ... of Alzheimer disease at an earlier age than subjects with- ... family and personal informed consent. .... In effect, they report that.

  1. Nerve growth factor mRNA in brain: localization by in situ hybridization

    International Nuclear Information System (INIS)

    Rennert, P.D.; Heinrich, G.

    1986-01-01

    Nerve Growth Factor is a 118 amino acid polypeptide that plays an important role in the differentiation and survival of neurons. The recent discovery that a mRNA that encodes beta Nerve Growth Factor is present in brain suggests that the Nerve Growth Factor gene may not only regulate gene expression of peripheral but also of central neurons. To identify the site(s) of Nerve Growth Factor mRNA production in the brain and to determine which cells express the Nerve Growth Factor gene, the technique of in situ hybridization was employed. A 32P-labeled RNA probe complementary to Nerve Growth Factor mRNA hybridized to cells in the stratum granulosum of the dentate gyrus and the stratum pyramidale of the hippocampus. These observations identify for the first time cellular sites of Nerve Growth Factor gene expression in the central nervous system, and suggest that Nerve Growth Factor mRNA is produced by neurons

  2. Astrocyte cultures derived from human brain tissue express angiotensinogen mRNA

    International Nuclear Information System (INIS)

    Milsted, A.; Barna, B.P.; Ransohoff, R.M.; Brosnihan, K.B.; Ferrario, C.M.

    1990-01-01

    The authors have identified human cultured cell lines that are useful for studying angiotensinogen gene expression and its regulation in the central nervous system. A model cell system of human central nervous system origin expressing angiotensinogen has not previously been available. Expression of angiotensinogen mRNA appears to be a basal property of noninduced human astrocytes, since astrocytic cell lines derived from human glioblastomas or nonneoplastic human brain tissue invariably produced angiotensinogen mRNA. In situ hybridization histochemistry revealed that angiotensinogen mRNA production was not limited to a subpopulation of astrocytes because >99% of cells in these cultures contained angiotensinogen mRNA. These cell lines will be useful in studies of the molecular mechanisms controlling angiotensin synthesis and the role of biologically active angiotensin in the human brain by allowing the authors to examine regulation of expression of the renin-angiotensin system in human astrocyte cultures

  3. Nuclear Imprisonment: Viral Strategies to Arrest Host mRNA Nuclear Export

    Directory of Open Access Journals (Sweden)

    Beatriz M. A. Fontoura

    2013-07-01

    Full Text Available Viruses possess many strategies to impair host cellular responses to infection. Nuclear export of host messenger RNAs (mRNA that encode antiviral factors is critical for antiviral protein production and control of viral infections. Several viruses have evolved sophisticated strategies to inhibit nuclear export of host mRNAs, including targeting mRNA export factors and nucleoporins to compromise their roles in nucleo-cytoplasmic trafficking of cellular mRNA. Here, we present a review of research focused on suppression of host mRNA nuclear export by viruses, including influenza A virus and vesicular stomatitis virus, and the impact of this viral suppression on host antiviral responses.

  4. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    OpenAIRE

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-01-01

    An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.

  5. Naturally occurring BRCA2 alternative mRNA splicing events in clinically relevant samples

    DEFF Research Database (Denmark)

    Fackenthal, James D; Yoshimatsu, Toshio; Zhang, Bifeng

    2016-01-01

    patterns and thereby disrupt gene function. mRNA analyses are therefore among the tests used to interpret the clinical significance of some genetic variants. However, these could be confounded by the appearance of naturally occurring alternative transcripts unrelated to germline sequence variation...... to characterise the spectrum of naturally occurring BRCA2 mRNA alternate-splicing events. METHODS: mRNA was prepared from several blood and breast tissue-derived cells and cell lines by contributing ENIGMA laboratories. cDNA representing BRCA2 alternate splice sites was amplified and visualised using capillary...... or agarose gel electrophoresis, followed by sequencing. RESULTS: We demonstrate the existence of 24 different BRCA2 mRNA alternate-splicing events in lymphoblastoid cell lines and both breast cancer and non-cancerous breast cell lines. CONCLUSIONS: These naturally occurring alternate-splicing events...

  6. The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans.

    Science.gov (United States)

    Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi

    2012-04-15

    The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.

  7. Regulation of mRNA Translation Is a Novel Mechanism for Phthalate Toxicity.

    Directory of Open Access Journals (Sweden)

    Jun Ling

    Full Text Available Phthalates are a group of plasticizers that are widely used in many consumer products and medical devices, thus generating a huge burden to human health. Phthalates have been known to cause a number of developmental and reproductive disorders functioning as endocrine modulators. They are also involved in carcinogenesis with mechanisms less understood. To further understand the molecular mechanisms of phthalate toxicity, in this study we reported a new effect of phthalates on mRNA translation/protein synthesis, a key regulatory step of gene expression. Butyl benzyl phthalate (BBP was found to directly inhibit mRNA translation in vitro but showed a complicated pattern of affecting mRNA translation in cells. In human kidney embryonic cell (HEK-293T, BBP increased cap-dependent mRNA translation at lower concentrations but showed inhibitory effect at higher concentrations. Cap-independent translation was not affected. On the other hand, mono (2-ethylhexyl phthalate (MEHP as a major metabolite of another important phthalate di (2-ethylhexyl phthalate (DEHP inhibited both can-dependent and -independent mRNA translation in vivo. In contrast, BBP and MEHP exhibited an overall promoting effect on mRNA translation in cancer cells. Mechanistic studies identified that the level and phosphorylation of eIF4E-BP (eIF4E binding protein and the amount of eIF4GI in eIF4F complex were altered in accordance with the effect of BBP on translation. BBP was also identified to directly bind to eIF4E, providing a further mechanism underlying the regulation of mRNA by phthalate. At the cellular level BBP inhibited normal cell growth but slightly promoted cancer cells (HT29 growth. Overall, this study provides the first evidence that phthalates can directly regulate mRNA translation as a novel mechanism to mediate their biological toxicities.

  8. Lower FOXO3 mRNA expression in granulosa cells is involved in unexplained infertility.

    Science.gov (United States)

    Yamamoto, Hikaru; Yamashita, Yoshiki; Saito, Natsuho; Hayashi, Atsushi; Hayashi, Masami; Terai, Yoshito; Ohmichi, Masahide

    2017-06-01

    The aim of this study was to investigate whether FOXO1 and FOXO3 mRNA expression in granulosa cells is the cause of unexplained infertility. Thirty-one patients aged infertility and 18 with male partner infertility as a control group) whose serum anti-Müllerian hormone level was >0.5 ng/μL were enrolled in the study. All patients underwent oocyte retrieval under a short protocol from June 2012 to October 2013. Real-time PCR was carried out using mRNA extracted from granulosa cells retrieved from mature follicles. We compared FOXO1 and FOXO3 mRNA expression ratios in granulosa cells between the unexplained infertility group and the male infertility group. The relation between FOXO1 and FOXO3 mRNA expression ratios in granulosa cells and assisted reproduction technology clinical outcome was also examined. FOXO3 mRNA expression ratio was significantly lower in the unexplained infertility group than in the male infertility group. Moreover, FOXO3 mRNA expression ratio showed a positive correlation with both the number of retrieved oocytes and serum anti-Müllerian hormone level. A positive correlation was also identified between FOXO1 mRNA expression and total dose of hMG. As well, the number of retrieved oocytes in the unexplained infertility group was statistically lower than that in the male infertility group. A lower FOXO3 mRNA expression in granulosa cells leads to poor oocyte development in patients with unexplained infertility undergoing controlled ovarian stimulation for in vitro fertilization-embryo transfer. © 2017 Japan Society of Obstetrics and Gynecology.

  9. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  10. mRNA transfection of mouse and human neural stem cell cultures.

    Directory of Open Access Journals (Sweden)

    Samuel McLenachan

    Full Text Available The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  11. mRNA Transfection of Mouse and Human Neural Stem Cell Cultures

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J.; Chen, Fred K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages. PMID:24386231

  12. mRNA transfection of mouse and human neural stem cell cultures.

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J; Chen, Fred K

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  13. Creatine kinase and alpha-actin mRNA levels decrease in diabetic rat hearts

    International Nuclear Information System (INIS)

    Popovich, B.; Barrieux, A.; Dillmann, W.H.

    1987-01-01

    Diabetic cardiomyopathy is associated with cardiac atrophy and isoenzyme redistribution. To determine if tissue specific changes occur in mRNAs coding for α-actin and creatine kinase (CK), they performed RNA blot analysis. Total ventricular RNA from control (C) and 4 wk old diabetic (D) rats were hybridized with 32 P cDNA probes for α-actin and CK. A tissue independent cDNA probe, CHOA was also used. Signal intensity was quantified by photodensitometry. D CK mRNA was 47 +/- 16% lower in D vs C. Insulin increases CK mRNA by 20% at 1.5 hs, and completely reverses the deficit after 4 wks. D α-actin mRNA is 66 +/- 18% lower in D vs C. Insulin normalized α-actin mRNA by 5 hs. CHOA mRNA is unchanged in D vs C, but D + insulin CHOA mRNA is 30 +/- 2% lower than C. In rats with diabetic cardiomyopathy, muscle specific CK and α-actin mRNAs are decreased. Insulin treatment reverses these changes

  14. Myeloperoxidase mRNA detection for lineage determination of leukemic blasts: retrospective analysis.

    Science.gov (United States)

    Crisan, D; Anstett, M J

    1995-07-01

    Myeloperoxidase (MPO) mRNA is an early myeloid marker; its detection in the morphologically and immunophenotypically primitive blasts of acute undifferentiated leukemia (AUL) establishes myeloid lineage and allows reclassification as acute myelogenous leukemia with minimal differentiation (AML-MO). We have previously reported a procedure for MPO mRNA detection by RT-PCR (reverse transcription-polymerase chain reaction) and an adaptation for use of routine hematology smears. This variant procedure allows retrospective analysis of mRNA and is used in the present study to evaluate the lineage of leukemic blasts in seven cases with morphology and cytochemistry consistent with AUL. All hematology smears used in this study were air-dried, unstained or Wright-stained and stored at room temperature for periods varying between 3 days and 2 years. MPO mRNA was detected in six cases, establishing the myeloid lineage of the blasts and the diagnosis of AML-MO. In the remaining case, the blasts were MPO mRNA negative, confirming the diagnosis of AUL. The RT-PCR procedure for retrospective mRNA analysis is useful in the clinical setting, due to its high specificity and sensitivity, speed (less than 24 h), safety (no radioactivity) and convenient use of routine hematology smears; it is particularly attractive in clinical situations when fresh or frozen specimens are no longer available at the time when the need for molecular diagnostics becomes apparent.

  15. Three-Dimensional Mapping of mRNA Export through the Nuclear Pore Complex

    Directory of Open Access Journals (Sweden)

    Steven J. Schnell

    2014-11-01

    Full Text Available The locations of transcription and translation of mRNA in eukaryotic cells are spatially separated by the nuclear envelope (NE. Plenty of nuclear pore complexes (NPCs embedded in the NE function as the major gateway for the export of transcribed mRNAs from the nucleus to the cytoplasm. Whereas the NPC, perhaps one of the largest protein complexes, provides a relatively large channel for macromolecules to selectively pass through it in inherently three-dimensional (3D movements, this channel is nonetheless below the diffraction limit of conventional light microscopy. A full understanding of the mRNA export mechanism urgently requires real-time mapping of the 3D dynamics of mRNA in the NPC of live cells with innovative imaging techniques breaking the diffraction limit of conventional light microscopy. Recently, super-resolution fluorescence microscopy and single-particle tracking (SPT techniques have been applied to the study of nuclear export of mRNA in live cells. In this review, we emphasize the necessity of 3D mapping techniques in the study of mRNA export, briefly summarize the feasibility of current 3D imaging approaches, and highlight the new features of mRNA nuclear export elucidated with a newly developed 3D imaging approach combining SPT-based super-resolution imaging and 2D-to-3D deconvolution algorithms.

  16. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    International Nuclear Information System (INIS)

    Lazarus, Kyren A.; Zhao, Zhe; Knower, Kevin C.; To, Sarah Q.; Chand, Ashwini L.; Clyne, Colin D.

    2013-01-01

    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E 2 ), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E 2 , showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E 2 treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer

  17. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Lazarus, Kyren A. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Environmental and Biotechnology Centre, Swinburne University, Hawthorn, Victoria 3122 (Australia); Zhao, Zhe; Knower, Kevin C. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); To, Sarah Q. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia); Chand, Ashwini L. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Clyne, Colin D., E-mail: Colin.clyne@princehenrys.org [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia)

    2013-08-30

    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E{sub 2}), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E{sub 2}, showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E{sub 2} treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer.

  18. Rift Valley fever virus NSS gene expression correlates with a defect in nuclear mRNA export.

    Science.gov (United States)

    Copeland, Anna Maria; Van Deusen, Nicole M; Schmaljohn, Connie S

    2015-12-01

    We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NSS gene, but not the N, GN or NSM genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NSS, confirming that expression of NSS is likely responsible for this phenomenon. Published by Elsevier Inc.

  19. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  20. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  1. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  2. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  3. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  4. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  5. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  8. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  9. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  11. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  12. UCP2 mRNA expression is dependent on glucose metabolism in pancreatic islets

    International Nuclear Information System (INIS)

    Dalgaard, Louise T.

    2012-01-01

    Highlights: ► UCP2 mRNA levels are decreased in islets of Langerhans from glucokinase deficient mice. ► UCP2 mRNA up-regulation by glucose is dependent on glucokinase. ► Absence of UCP2 increases GSIS of glucokinase heterozygous pancreatic islets. ► This may protect glucokinase deficient mice from hyperglycemic damages. -- Abstract: Uncoupling Protein 2 (UCP2) is expressed in the pancreatic β-cell, where it partially uncouples the mitochondrial proton gradient, decreasing both ATP-production and glucose-stimulated insulin secretion (GSIS). Increased glucose levels up-regulate UCP2 mRNA and protein levels, but the mechanism for UCP2 up-regulation in response to increased glucose is unknown. The aim was to examine the effects of glucokinase (GK) deficiency on UCP2 mRNA levels and to characterize the interaction between UCP2 and GK with regard to glucose-stimulated insulin secretion in pancreatic islets. UCP2 mRNA expression was reduced in GK+/− islets and GK heterozygosity prevented glucose-induced up-regulation of islet UCP2 mRNA. In contrast to UCP2 protein function UCP2 mRNA regulation was not dependent on superoxide generation, but rather on products of glucose metabolism, because MnTBAP, a superoxide dismutase mimetic, did not prevent the glucose-induced up-regulation of UCP2. Glucose-stimulated insulin secretion was increased in UCP2−/− and GK+/− islets compared with GK+/− islets and UCP2 deficiency improved glucose tolerance of GK+/− mice. Accordingly, UCP2 deficiency increased ATP-levels of GK+/− mice. Thus, the compensatory down-regulation of UCP2 is involved in preserving the insulin secretory capacity of GK mutant mice and might also be implicated in limiting disease progression in MODY2 patients.

  13. Protein functional features are reflected in the patterns of mRNA translation speed.

    Science.gov (United States)

    López, Daniel; Pazos, Florencio

    2015-07-09

    The degeneracy of the genetic code makes it possible for the same amino acid string to be coded by different messenger RNA (mRNA) sequences. These "synonymous mRNAs" may differ largely in a number of aspects related to their overall translational efficiency, such as secondary structure content and availability of the encoded transfer RNAs (tRNAs). Consequently, they may render different yields of the translated polypeptides. These mRNA features related to translation efficiency are also playing a role locally, resulting in a non-uniform translation speed along the mRNA, which has been previously related to some protein structural features and also used to explain some dramatic effects of "silent" single-nucleotide-polymorphisms (SNPs). In this work we perform the first large scale analysis of the relationship between three experimental proxies of mRNA local translation efficiency and the local features of the corresponding encoded proteins. We found that a number of protein functional and structural features are reflected in the patterns of ribosome occupancy, secondary structure and tRNA availability along the mRNA. One or more of these proxies of translation speed have distinctive patterns around the mRNA regions coding for certain protein local features. In some cases the three patterns follow a similar trend. We also show specific examples where these patterns of translation speed point to the protein's important structural and functional features. This support the idea that the genome not only codes the protein functional features as sequences of amino acids, but also as subtle patterns of mRNA properties which, probably through local effects on the translation speed, have some consequence on the final polypeptide. These results open the possibility of predicting a protein's functional regions based on a single genomic sequence, and have implications for heterologous protein expression and fine-tuning protein function.

  14. ZMS regulation of M2 muscarinic receptor mRNA stability requires protein factor

    International Nuclear Information System (INIS)

    Zhang Yongfang; Xia Zongqin; Hu Ya'er

    2010-01-01

    Aim The aim of this work is to study the elevation mechanism of ZMS on muscarinic M2 receptor mRNA expression. Methods Actinomycin D was added to cultured CHOm2 cells to stop the de novo synthesis of M2 receptor mRNA and samples were taken at various times to determine the time course of mRNA of M2 receptor with real-time quantitative RT-PCR. Half-life of M2 receptor mRNA and the effect of ZMS on the half-life was obtained from the slope of the exponential curves. Cycloheximide was added at 4 h prior to and 24 h after the addition of ZMS to examine the effect of de novo protein synthesis on the action of ZMS. Results The half-life of m2 mRNA was prolonged by ZMS treatment without cycloheximide (4.75±0.54 h and 2.13 h±0.23 h for ZMS and vehicle treated groups, respectively, P<0.05). When cycloheximide was added to the culture medium 4h prior to the addition of ZMS, the effect of ZMS in prolonging the half-life of m2 mRNA disappeared (3.06 h±0.23 h and 3.00 h±l.20 h for cells with and without ZMS, respectively). However, when the ZMS was added to the medium 24h prior to the addition of cycloheximide, the action of ZMS was not abolished by cycloheximide (half-life was 5.43 h±1.13 h and 2.46 h±0.09 h for cells with and without ZMS, respectively). Conclusion These data suggest that de novo protein synthesis was required for the increase in M2 mRNA stability induced by ZMS. (authors)

  15. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  16. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  17. Association of chemerin mRNA expression in human epicardial adipose tissue with coronary atherosclerosis

    Directory of Open Access Journals (Sweden)

    Wang Linjie

    2011-10-01

    Full Text Available Abstract Background Growing evidence suggests that epicardial adipose tissue (EAT may play a key role in the pathogenesis and development of coronary artery disease (CAD by producing several inflammatory adipokines. Chemerin, a novel adipokine, has been reported to be involved in regulating immune responses and glucolipid metabolism. Given these properties, chemerin may provide an interesting link between obesity, inflammation and atherosclerosis. In this study, we sought to determine the relationship of chemerin expression in EAT and the severity of coronary atherosclerosis in Han Chinese patients. Methods Serums and adipose tissue biopsies (epicardial and thoracic subcutaneous were obtained from CAD (n = 37 and NCAD (n = 16 patients undergoing elective cardiac surgery. Gensini score was used to assess the severity of CAD. Serum levels of chemerin, adiponectin and insulin were measured by ELISA. Chemerin protein expression in adipose tissue was detected by immunohistochemistry. The mRNA levels of chemerin, chemR23, adiponectin and TNF-alpha in adipose tissue were detected by RT-PCR. Results We found that EAT of CAD group showed significantly higher levels of chemerin and TNF-alpha mRNA, and significantly lower level of adiponectin mRNA than that of NCAD patients. In CAD group, significantly higher levels of chemerin mRNA and protein were observed in EAT than in paired subcutaneous adipose tissue (SAT, whereas such significant difference was not found in NCAD group. Chemerin mRNA expression in EAT was positively correlated with Gensini score (r = 0.365, P P P P P P P > 0.05. Conclusions The expressions of chemerin mRNA and protein are significantly higher in EAT from patients with CAD in Han Chinese patients. Furthermore, the severity of coronary atherosclerosis is positive correlated with the level of chemerin mRNA in EAT rather than its circulating level.

  18. mRNA fragments in in vitro culture media are associated with bovine preimplantation embryonic development.

    Science.gov (United States)

    Kropp, Jenna; Khatib, Hasan

    2015-01-01

    In vitro production (IVP) systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage) embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerate conditioned media. Differential expression was confirmed by quantitative real-time PCR for fragments of mRNA POSTN and VSNL-1, in four additional biological replicates of media. To better understand the mechanisms of mRNA secretion into the media, the expression of a predicted RNA binding protein of POSTN, PUM2, was knocked down using an antisense oligonucleotide gapmer. Supplementation of a PUM2 gapmer significantly reduced blastocyst development and decreased secretion of POSTN mRNA into the media. Overall, differential mRNA expression in the media was repeatable and sets the framework for future study of mRNA biomarkers in in vitro culture media to improve predictability of reproductive performance.

  19. Consequences of metaphase II oocyte cryopreservation on mRNA content.

    Science.gov (United States)

    Chamayou, S; Bonaventura, G; Alecci, C; Tibullo, D; Di Raimondo, F; Guglielmino, A; Barcellona, M L

    2011-04-01

    We studied the consequences of freezing/thawing processes on mRNA contents in MII oocytes after slow-freezing/rapid thawing (SF/RT) and vitrification/warming (V/W) protocols, and compared the results to fresh MII oocytes. We quantified the nuclear transcript mRNA responsible for the translation of proteins belonging either to trans-regulatory protein family or to functional structural proteins such as proteins involved in DNA structural organization (NAP1L1, TOP1, H1F0H1), chromosomal structure maintenance (SMC, SCC3, RAD21, SMC1A, SMC1B, STAG3, REC8), mitochondrial energetic pathways (ATP5GJ, SDHC), cell cycle regulation and processes (CLTA, MAPK6, CKS2) and staminal cell potency-development competence stage (DPPA3, OCT4, FOXJ2). Surplus MII oocytes were donated from patients in IVF cycles and divided in three groups of 15 oocytes. Group 1 was comprised of non-cryopreserved oocytes and Groups 2 and 3 underwent SF/RT and V/W procedures, respectively. There was an overall decrease of mRNA extracted from cryopreserved oocytes compared to control group. Only 39.4% of mRNA content were preserved after SF/RT while 63.3% of mRNA content were maintained after V/W. Oocyte cryopreservation is associated with molecular injury associated with the decrease of stored mRNA. However the V/W protocol is more conservative than SF/RT resulting in a level of mRNA sufficient to maintain biologic functions in the subsequent fertilized oocyte. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Arc mRNA induction in striatal efferent neurons associated with response learning.

    Science.gov (United States)

    Daberkow, D P; Riedy, M D; Kesner, R P; Keefe, K A

    2007-07-01

    The dorsal striatum is involved in motor-response learning, but the extent to which distinct populations of striatal efferent neurons are differentially involved in such learning is unknown. Activity-regulated, cytoskeleton-associated (Arc) protein is an effector immediate-early gene implicated in synaptic plasticity. We examined arc mRNA expression in striatopallidal vs. striatonigral efferent neurons in dorsomedial and dorsolateral striatum of rats engaged in reversal learning on a T-maze motor-response task. Male Sprague-Dawley rats learned to turn right or left for 3 days. Half of the rats then underwent reversal training. The remaining rats were yoked to rats undergoing reversal training, such that they ran the same number of trials but ran them as continued-acquisition trials. Brains were removed and processed using double-label fluorescent in situ hybridization for arc and preproenkephalin (PPE) mRNA. In the reversal, but not the continued-acquisition, group there was a significant relation between the overall arc mRNA signal in dorsomedial striatum and the number of trials run, with rats reaching criterion in fewer trials having higher levels of arc mRNA expression. A similar relation was seen between the numbers of PPE(+) and PPE(-) neurons in dorsomedial striatum with cytoplasmic arc mRNA expression. Interestingly, in behaviourally activated animals significantly more PPE(-) neurons had cytoplasmic arc mRNA expression. These data suggest that Arc in both striatonigral and striatopallidal efferent neurons is involved in striatal synaptic plasticity mediating motor-response learning in the T-maze and that there is differential processing of arc mRNA in distinct subpopulations of striatal efferent neurons.

  1. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  2. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  3. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  5. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

    International Nuclear Information System (INIS)

    Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

    2012-01-01

    Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

  7. Extracellular tumor-related mRNA in plasma of lymphoma patients and survival implications.

    Directory of Open Access Journals (Sweden)

    Vanesa Garcia

    Full Text Available BACKGROUND: We studied anomalous extracellular mRNAs in plasma from patients with diffuse large B-cell lymphoma (DLBCL and their survival implications. mRNAs studied have been reported in the literature as markers of poor (BCL2, CCND2, MYC and favorable outcome (LMO2, BCL6, FN1 in tumors. These markers were also analyzed in lymphoma tissues to test possible associations with their presence in plasma. METHODOLOGY/PRINCIPAL FINDINGS: mRNA from 42 plasma samples and 12 tumors from patients with DLBCL was analyzed by real-time PCR. Samples post-treatment were studied. The immunohistochemistry of BCL2 and BCL6 was defined. Presence of circulating tumor cells was determined by analyzing the clonality of the immunoglobulin heavy-chain genes by PCR. In DLBCL, MYC mRNA was associated with short overall survival. mRNA targets with unfavorable outcome in tumors were associated with characteristics indicative of poor prognosis, with partial treatment response and with short progression-free survival in patients with complete response. In patients with low IPI score, unfavorable mRNA targets were related to shorter overall survival, partial response, high LDH levels and death. mRNA disappeared in post-treatment samples of patients with complete response, and persisted in those with partial response or death. No associations were found between circulating tumor cells and plasma mRNA. Absence of BCL6 protein in tumors was associated with presence of unfavorable plasma mRNA. CONCLUSIONS/SIGNIFICANCE: Through a non-invasive procedure, tumor-derived mRNAs can be obtained in plasma. mRNA detected in plasma did not proceed from circulating tumor cells. In our study, unfavorable targets in plasma were associated with poor prognosis in B-cell lymphomas, mainly MYC mRNA. Moreover, the unfavorable targets in plasma could help us to classify patients with poor outcome within the good prognosis group according to IPI.

  8. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance

    Directory of Open Access Journals (Sweden)

    Shimpei Morimoto

    2018-03-01

    Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after

  9. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

    Science.gov (United States)

    Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

    2018-03-01

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

  10. Single step production of Cas9 mRNA for zygote injection.

    Science.gov (United States)

    Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

    2018-03-01

    Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

  11. Photodynamic antisense regulation of mRNA having a point mutation with psoralen-conjugated oligonucleotide.

    Science.gov (United States)

    Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2008-01-01

    Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.

  12. Generation of human induced pluripotent stem cells using non-synthetic mRNA.

    Science.gov (United States)

    Rohani, L; Fabian, C; Holland, H; Naaldijk, Y; Dressel, R; Löffler-Wirth, H; Binder, H; Arnold, A; Stolzing, A

    2016-05-01

    Here we describe some of the crucial steps to generate induced pluripotent stem cells (iPSCs) using mRNA transfection. Our approach uses a V. virus-derived capping enzyme instead of a cap-analog, ensuring 100% proper cap orientation for in vitro transcribed mRNA. V. virus' 2'-O-Methyltransferase enzyme creates a cap1 structure found in higher eukaryotes and has higher translation efficiency compared to other methods. Use of the polymeric transfection reagent polyethylenimine proved superior to other transfection methods. The mRNA created via this method did not trigger an intracellular immune response via human IFN-gamma (hIFN-γ) or alpha (hIFN-α) release, thus circumventing the use of suppressors. Resulting mRNA and protein were expressed at high levels for over 48h, thus obviating daily transfections. Using this method, we demonstrated swift activation of pluripotency associated genes in human fibroblasts. Low oxygen conditions further facilitated colony formation. Differentiation into different germ layers was confirmed via teratoma assay. Reprogramming with non-synthetic mRNA holds great promise for safe generation of iPSCs of human origin. Using the protocols described herein we hope to make this method more accessible to other groups as a fast, inexpensive, and non-viral reprogramming approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Enhanced Delivery and Potency of Self-Amplifying mRNA Vaccines by Electroporation in Situ

    Directory of Open Access Journals (Sweden)

    Kaustuv Banerjee

    2013-08-01

    Full Text Available Nucleic acid-based vaccines such as viral vectors, plasmid DNA (pDNA, and mRNA are being developed as a means to address limitations of both live-attenuated and subunit vaccines. DNA vaccines have been shown to be potent in a wide variety of animal species and several products are now licensed for commercial veterinary but not human use. Electroporation delivery technologies have been shown to improve the generation of T and B cell responses from synthetic DNA vaccines in many animal species and now in humans. However, parallel RNA approaches have lagged due to potential issues of potency and production. Many of the obstacles to mRNA vaccine development have recently been addressed, resulting in a revival in the use of non-amplifying and self-amplifying mRNA for vaccine and gene therapy applications. In this paper, we explore the utility of EP for the in vivo delivery of large, self-amplifying mRNA, as measured by reporter gene expression and immunogenicity of genes encoding HIV envelope protein. These studies demonstrated that EP delivery of self-amplifying mRNA elicited strong and broad immune responses in mice, which were comparable to those induced by EP delivery of pDNA.

  14. Selective translation of the measles virus nucleocapsid mRNA by La protein

    Directory of Open Access Journals (Sweden)

    Yoshihisa eInoue

    2011-08-01

    Full Text Available Measles, caused by measles virus (MeV infection, is the leading cause of death in children because of secondary infections attributable to MeV-induced immune suppression. Recently, we have shown that wild-type MeVs induce the suppression of protein synthesis in host cells (referred to as "shutoff" and that viral mRNAs are preferentially translated under shutoff conditions in infected cells. To determine the mechanism behind the preferential translation of viral mRNA, we focused on the 5 untranslated region (UTR of nucleocapsid (N mRNA. The La/SSB autoantigen (La was found to specifically bind to an N-5UTR probe. Recombinant La enhanced the translation of luciferase mRNA containing the N-5UTR (N-fLuc, and RNA interference of La suppressed N-fLuc translation. Furthermore, recombinant MeV lacking the La-binding motif in the N-5UTR displayed delayed viral protein synthesis and growth kinetics at an early phase of infection. These results suggest that La induced predominant translation of N mRNA via binding to its 5UTR under shutoff conditions. This is the first report on a cellular factor that specifically regulates paramyxovirus mRNA translation.

  15. Regulation of the growth hormone (GH) receptor and GH-binding protein mRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kaji, Hidesuke; Ohashi, Shin-Ichirou; Abe, Hiromi; Chihara, Kazuo [Kobe Univ. School of Medicine, Kobe (Japan)

    1994-12-31

    In fasting rats, a transient increase in growth hormone-binding protein (GHBP) mRNA levels was observed after 1 day, in muscle, heart, and liver, but not in fat tissues. The liver GH receptor (GHR) mRNA level was significantly increased after 1 day (but not after 5 days) of bovine GH (bGH) treatment in fed rats. Both the liver GHR mRNA level and the net increment of plasma IGF-I markedly decreased after 5 days of bGH administration in fasting rats. These findings suggest that GHR and GHBP mRNAs in the liver are expressed in a different way and that the expression of GHBP mRNA is regulated differently between tissues, at least in rats. The results also suggest that refractoriness to GH in a sustained fasting state might be beneficial in preventing anabolic effects of GH. In humans, GHR mRNA in lymphocytes, from subjects with either GH-deficiency or acromegaly, could be detected by the reverse transcription-polymerase chain reaction method. In one patient with partial GH insensitivity, a heterozygous missense mutation (P561T) was identified in the cytoplasmic domain of GHR. 15 refs., 4 figs.

  16. Hepatic chemerin mRNA in morbidly obese patients with nonalcoholic fatty liver disease.

    Science.gov (United States)

    Kajor, Maciej; Kukla, Michał; Waluga, Marek; Liszka, Łukasz; Dyaczyński, Michał; Kowalski, Grzegorz; Żądło, Dominika; Berdowska, Agnieszka; Chapuła, Mateusz; Kostrząb-Zdebel, Anna; Bułdak, Rafał J; Sawczyn, Tomasz; Hartleb, Marek

    The aim of this study was to investigate hepatic chemerin mRNA, serum chemerin concentration, and immunohistochemical staining for chemerin and and chemokine receptor-like 1 (CMKLR1) in hepatic tissue in 56 morbidly obese women with nonalcoholic fatty liver disease (NAFLD) and to search for a relationship with metabolic and histopathological features. Chemerin mRNA was assessed by quantitative real-time PCR, chemerin, and CMKLR1 immunohistochemical expression with specific antibodies, while serum chemerin concentration was assessed with commercially available enzyme-linked immunosorbent assays. Serum chemerin concentration reached 874.1 ±234.6 ng/ml. There was no difference in serum chemerin levels between patients with BMI steatosis, and definite nonalcoholic steatohepatitis (NASH). Liver chemerin mRNA was observed in all included patients and was markedly, but insignificantly, higher in those with BMI ≥ 40 kg/m2, hepatocyte ballooning, greater extent of steatosis, and definite NASH. Hepatic chemerin mRNA might be a predictor of hepatic steatosis, hepatocyte ballooning, and NAFLD activity score (NAS) but seemed not to be a primary driver regulating liver necroinflammatory activity and fibrosis. The lack of association between serum chemerin and hepatic chemerin mRNA may suggest that adipose tissue but not the liver is the main source of chemerin in morbidly obese women.

  17. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  18. Kinetics of lipid-nanoparticle-mediated intracellular mRNA delivery and function

    Science.gov (United States)

    Zhdanov, Vladimir P.

    2017-10-01

    mRNA delivery into cells forms the basis for one of the new and promising ways to treat various diseases. Among suitable carriers, lipid nanoparticles (LNPs) with a size of about 100 nm are now often employed. Despite high current interest in this area, the understanding of the basic details of LNP-mediated mRNA delivery and function is limited. To clarify the kinetics of mRNA release from LNPs, the author uses three generic models implying (i) exponential, (ii) diffusion-controlled, and (iii) detachment-controlled kinetic regimes, respectively. Despite the distinct differences in these kinetics, the associated transient kinetics of mRNA translation to the corresponding protein and its degradation are shown to be not too sensitive to the details of the mRNA delivery by LNPs (or other nanocarriers). In addition, the author illustrates how this protein may temporarily influence the expression of one gene or a few equivalent genes. The analysis includes positive or negative regulation of the gene transcription via the attachment of the protein without or with positive or negative feedback in the gene expression. Stable, bistable, and oscillatory schemes have been scrutinized in this context.

  19. Applying the breaks on gene expression - mRNA deadenylation by Pop2p

    DEFF Research Database (Denmark)

    Andersen, Kasper Røjkjær; Jonstrup, Anette Thyssen; Van, Lan Bich

    When driving a car, control of the brakes is just as important as control of the accelerator pedal. Likewise, in gene expression, regulation of mRNA degradation is as important as regulation of its synthesis (Mühlemann, 2005). The rate-determining step of mRNA decay in eukaryotes seems to be the ......When driving a car, control of the brakes is just as important as control of the accelerator pedal. Likewise, in gene expression, regulation of mRNA degradation is as important as regulation of its synthesis (Mühlemann, 2005). The rate-determining step of mRNA decay in eukaryotes seems...... to be the shortening of the poly(A) tail (deadenylation), as this step is slower than the subsequent decapping and degradation of the mRNA body. The Mega-Dalton Ccr4-Not complex contains two exonucleases, Ccr4p and Pop2p, responsible for this process. It is not known at present why two conserved nucleases are needed...

  20. Tau mRNA 3'UTR-to-CDS ratio is increased in Alzheimer disease.

    Science.gov (United States)

    García-Escudero, Vega; Gargini, Ricardo; Martín-Maestro, Patricia; García, Esther; García-Escudero, Ramón; Avila, Jesús

    2017-08-10

    Neurons frequently show an imbalance in expression of the 3' untranslated region (3'UTR) relative to the coding DNA sequence (CDS) region of mature messenger RNAs (mRNA). The ratio varies among different cells or parts of the brain. The Map2 protein levels per cell depend on the 3'UTR-to-CDS ratio rather than the total mRNA amount, which suggests powerful regulation of protein expression by 3'UTR sequences. Here we found that MAPT (the microtubule-associated protein tau gene) 3'UTR levels are particularly high with respect to other genes; indeed, the 3'UTR-to-CDS ratio of MAPT is balanced in healthy brain in mouse and human. The tau protein accumulates in Alzheimer diseased brain. We nonetheless observed that the levels of RNA encoding MAPT/tau were diminished in these patients' brains. To explain this apparently contradictory result, we studied MAPT mRNA stoichiometry in coding and non-coding regions, and found that the 3'UTR-to-CDS ratio was higher in the hippocampus of Alzheimer disease patients, with higher tau protein but lower total mRNA levels. Our data indicate that changes in the 3'UTR-to-CDS ratio have a regulatory role in the disease. Future research should thus consider not only mRNA levels, but also the ratios between coding and non-coding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. The actin binding cytoskeletal protein Moesin is involved in nuclear mRNA export.

    Science.gov (United States)

    Kristó, Ildikó; Bajusz, Csaba; Borsos, Barbara N; Pankotai, Tibor; Dopie, Joseph; Jankovics, Ferenc; Vartiainen, Maria K; Erdélyi, Miklós; Vilmos, Péter

    2017-10-01

    Current models imply that the evolutionarily conserved, actin-binding Ezrin-Radixin-Moesin (ERM) proteins perform their activities at the plasma membrane by anchoring membrane proteins to the cortical actin network. Here we show that beside its cytoplasmic functions, the single ERM protein of Drosophila, Moesin, has a novel role in the nucleus. The activation of transcription by heat shock or hormonal treatment increases the amount of nuclear Moesin, indicating biological function for the protein in the nucleus. The distribution of Moesin in the nucleus suggests a function in transcription and the depletion of mRNA export factors Nup98 or its interacting partner, Rae1, leads to the nuclear accumulation of Moesin, suggesting that the nuclear function of the protein is linked to mRNA export. Moesin localizes to mRNP particles through the interaction with the mRNA export factor PCID2 and knock down of Moesin leads to the accumulation of mRNA in the nucleus. Based on our results we propose that, beyond its well-known, manifold functions in the cytoplasm, the ERM protein of Drosophila is a new, functional component of the nucleus where it participates in mRNA export. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome

    KAUST Repository

    Kö ster, Tino; Marondedze, Claudius; Meyer, Katja; Staiger, Dorothee

    2017-01-01

    RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.

  3. RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome

    KAUST Repository

    Köster, Tino

    2017-04-13

    RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.

  4. Relative workload determines exercise-induced increases in PGC-1alpha mRNA

    DEFF Research Database (Denmark)

    Nordsborg, Nikolai Baastrup; Lundby, Carsten; Leick, Lotte

    2010-01-01

    INTRODUCTION:: The hypothesis that brief intermittent exercise induced increases in human skeletal muscle metabolic mRNA is dependent on relative workload was investigated. METHODS:: Trained (n=10) and untrained (n=8) subjects performed exhaustive intermittent cycling exercise (4x4 min @ 85% of VO2...... peak, interspersed by 3 min). Trained subjects also performed the intermittent exercise at the same absolute workload as untrained, corresponding to 70% of VO2 peak (n=6). RESULTS:: Exercise at 85% of VO2 peak elevated (P... and untrained, respectively. PGC-1alpha mRNA expression was increased (Pelevated (3.1+/-0.7 mM) and PGC-1alpha mRNA content was less (P

  5. Overexpression of protease nexin-1 mRNA and protein in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Gao, Shan; Krogdahl, Annelise; Sørensen, Jens Ahm

    2007-01-01

    -1 has been almost totally neglected. We have now compared the level of PN-1 mRNA in 20 cases of oral squamous cell carcinomas and in matched samples of the corresponding normal oral tissues. We found that the average PN-1 mRNA level in tumours and normal tissues was significantly different, being...... increased up to 13 fold in tumour samples compared with the average level in normal tissues. The PN-1 mRNA level was significantly higher in tumours from patients with lymph node metastasis than in tumours from patients without. We could conclude that PN-1 is frequently overexpressed in oral squamous cell...... carcinomas and that its level may correlate with the occurrence of lymph node metastasis. We hypothesise that PN-1 may have a tumour biological function similar to that of PAI-1....

  6. Visfatin mRNA expression in human subcutaneous adipose tissue is regulated by exercise

    DEFF Research Database (Denmark)

    Frydelund-Larsen, Lone; Åkerström, Thorbjörn; Nielsen, Søren

    2006-01-01

    in abdominal subcutaneous adipose tissue and skeletal muscle biopsies obtained from healthy young men at time points 0, 3, 4.5, 6, 9, and 24 h in relation to either 3 h of ergometer cycle exercise at 60% of Vo(2 max) or rest. Adipose tissue visfatin mRNA expression increased threefold at the time points 3, 4......Visfatin [pre-beta-cell colony-enhancing factor (PBEF)] is a novel adipokine that is produced by adipose tissue, skeletal muscle, and liver and has insulin-mimetic actions. Regular exercise enhances insulin sensitivity. In the present study, we therefore examined visfatin mRNA expression.......5, and 6 h in response to exercise (n = 8) compared with preexercise samples and compared with the resting control group (n = 7, P = 0.001). Visfatin mRNA expression in skeletal muscle was not influenced by exercise. The exercise-induced increase in adipose tissue visfatin was, however, not accompanied...

  7. Postage for the messenger: Designating routes for Nuclear mRNA Export

    Science.gov (United States)

    Natalizio, Barbara J.; Wente, Susan R.

    2013-01-01

    Transcription of messenger(m) RNA occurs in the nucleus, making the translocation of mRNA across the nuclear envelope (NE) boundary a critical determinant of proper gene expression and cell survival. A major mRNA export route occurs via the NXF1-dependent pathway through the nuclear pore complexes (NPCs) embedded in the NE. However, recent findings have discovered new evidence supporting the existence of multiple mechanisms for crossing the NE, including both NPC-mediated and NE budding-mediated pathways. An analysis of the trans-acting factors and cis components that define these pathways reveals shared elements as well as mechanistic differences. We review here the current understanding of the mechanisms that characterize each pathway and highlight the determinants that influence mRNA transport fate. PMID:23583578

  8. Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.

    Science.gov (United States)

    Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A

    2016-04-20

    As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. An investigation of nutrient-dependent mRNA translation in Drosophila larvae

    Directory of Open Access Journals (Sweden)

    Sabarish Nagarajan

    2014-10-01

    Full Text Available The larval period of the Drosophila life cycle is characterized by immense growth. In nutrient rich conditions, larvae increase in mass approximately two hundred-fold in five days. However, upon nutrient deprivation, growth is arrested. The prevailing view is that dietary amino acids drive this larval growth by activating the conserved insulin/PI3 kinase and Target of rapamycin (TOR pathways and promoting anabolic metabolism. One key anabolic process is protein synthesis. However, few studies have attempted to measure mRNA translation during larval development or examine the signaling requirements for nutrient-dependent regulation. Our work addresses this issue. Using polysome analyses, we observed that starvation rapidly (within thirty minutes decreased larval mRNA translation, with a maximal decrease at 6–18 hours. By analyzing individual genes, we observed that nutrient-deprivation led to a general reduction in mRNA translation, regardless of any starvation-mediated changes (increase or decrease in total transcript levels. Although sugars and amino acids are key regulators of translation in animal cells and are the major macronutrients in the larval diet, we found that they alone were not sufficient to maintain mRNA translation in larvae. The insulin/PI3 kinase and TOR pathways are widely proposed as the main link between nutrients and mRNA translation in animal cells. However, we found that genetic activation of PI3K and TOR signaling, or regulation of two effectors – 4EBP and S6K – could not prevent the starvation-mediated translation inhibition. Similarly, we showed that the nutrient stress-activated eIF2α kinases, GCN2 and PERK, were not required for starvation-induced inhibition of translation in larvae. These findings indicate that nutrient control of mRNA translation in larvae is more complex than simply amino acid activation of insulin and TOR signaling.

  10. Characterization of a major late herpes simplex virus type 1 mRNA.

    Science.gov (United States)

    Costa, R H; Devi, B G; Anderson, K P; Gaylord, B H; Wagner, E K

    1981-05-01

    A major, late 6-kilobase (6-kb) mRNa mapping in the large unique region of herpes simplex virus type 1 (HSV-1) was characterized by using two recombinant DNA clones, one containing EcoRI fragment G (0.190 to 0.30 map units) in lambda. WES.B (L. Enquist, M. Madden, P. Schiop-Stansly, and G. Vandl Woude, Science 203:541-544, 1979) and one containing HindIII fragment J (0.181 to 0.259 map units) in pBR322. This 6-kb mRNA had its 3' end to the left of 0.231 on the prototypical arrangement of the HSV-1 genome and was transcribed from right to left. It was bounded on both sides by regions containing a large number of distinct mRNA species, and its 3' end was partially colinear with a 1.5-kb mRNA which encoded a 35,000-dalton polypeptide. The 6-kb mRNA encoded a 155,000-dalton polypeptide which was shown to be the only one of this size detectable by hybrid-arrested translation encoded by late polyadenylated polyribosomal RNA. The S1 nuclease mapping experiments indicated that there were no introns in the coding sequence for this mRNA and that its 3' end mapped approximately 800 nucleotides to the left of the BglII site at 0.231, whereas its 5' end extended very close to the BamHI site at 0.266.

  11. SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export.

    Science.gov (United States)

    Müller-McNicoll, Michaela; Botti, Valentina; de Jesus Domingues, Antonio M; Brandl, Holger; Schwich, Oliver D; Steiner, Michaela C; Curk, Tomaz; Poser, Ina; Zarnack, Kathi; Neugebauer, Karla M

    2016-03-01

    Nuclear export factor 1 (NXF1) exports mRNA to the cytoplasm after recruitment to mRNA by specific adaptor proteins. How and why cells use numerous different export adaptors is poorly understood. Here we critically evaluate members of the SR protein family (SRSF1-7) for their potential to act as NXF1 adaptors that couple pre-mRNA processing to mRNA export. Consistent with this proposal, >1000 endogenous mRNAs required individual SR proteins for nuclear export in vivo. To address the mechanism, transcriptome-wide RNA-binding profiles of NXF1 and SRSF1-7 were determined in parallel by individual-nucleotide-resolution UV cross-linking and immunoprecipitation (iCLIP). Quantitative comparisons of RNA-binding sites showed that NXF1 and SR proteins bind mRNA targets at adjacent sites, indicative of cobinding. SRSF3 emerged as the most potent NXF1 adaptor, conferring sequence specificity to RNA binding by NXF1 in last exons. Interestingly, SRSF3 and SRSF7 were shown to bind different sites in last exons and regulate 3' untranslated region length in an opposing manner. Both SRSF3 and SRSF7 promoted NXF1 recruitment to mRNA. Thus, SRSF3 and SRSF7 couple alternative splicing and polyadenylation to NXF1-mediated mRNA export, thereby controlling the cytoplasmic abundance of transcripts with alternative 3' ends. © 2016 Müller-McNicoll et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  13. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

    Science.gov (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

    2017-09-01

    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  14. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  15. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  16. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

    Science.gov (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

    2017-08-01

    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  18. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  19. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  20. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  1. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  2. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  3. An in vitro system from Plasmodium falciparum active in endogenous mRNA translation

    Directory of Open Access Journals (Sweden)

    Ferreras Ana

    2000-01-01

    Full Text Available An in vitro translation system has been prepared from Plasmodium falciparum by saponin lysis of infected-erythrocytes to free parasites which were homogeneized with glass beads, centrifuged to obtain a S-30 fraction followed by Sephadex G-25 gel filtration. This treatment produced a system with very low contamination of host proteins (<1%. The system, optimized for Mg2+ and K+, translates endogenous mRNA and is active for 80 min which suggests that their protein factors and mRNA are quite stable.

  4. Interactions between mRNA export commitment, 3'-end quality control, and nuclear degradation

    DEFF Research Database (Denmark)

    Libri, Domenico; Dower, Ken; Boulay, Jocelyne

    2002-01-01

    Several aspects of eukaryotic mRNA processing are linked to transcription. In Saccharomyces cerevisiae, overexpression of the mRNA export factor Sub2p suppresses the growth defect of hpr1 null cells, yet the protein Hpr1p and the associated THO protein complex are implicated in transcriptional el...... results show that several classes of defective RNPs are subject to a quality control step that impedes release from transcription site foci and suggest that suboptimal messenger ribonucleoprotein assembly leads to RNA degradation by Rrp6p....

  5. Expression of galectin-9 mRNA in obese children with polymorphism of the lactase gene

    Directory of Open Access Journals (Sweden)

    A.E. Abaturov

    2018-02-01

    Full Text Available Background. The aim of the study is to investigate the association of expression of galectin-9 (Gal-9 mRNA and lactose malabsorption in obese children with polymorphism (SNP of the lactase gene (LCT and to study the efficacy of lactase deficiency therapy using exogenous lactase preparations. Materials and methods. Seventy obese children (BMI > 95th percentile and 16 children without obesity aged 6–18 years were examined. There was studied SNP LCT (material for investigation venous blood by real-time PCR, expression of Gal-9 mRNA (study material buccal epithelium by real-time PCR with reverse transcription, malabsorption of lactose by hydrogen breath test (HBT. Among obese children, 38 children with genotype C/C 13910 presented the first observation group, 32 children with phenotype identical genotypes C/T 13910 and T/T 13910, p > 0.05, presented the second group. Children from the first observation group also determined the level of expression of Gal-9 mRNA and lactose malabsorption after using exogenous lactase preparations. Results. The genotype C/C 13910 was determined in 38 (54.3 %, genotype C/T 13910 in 22 (31.4 % and genotype T/T in 10 (14.3 % patients. Malabsorption of lactose in children with genotype C/C 13910 averaged 32.7 ± 10.4 pmm, in children with genotypes C/T 13910 — 26.3 ± 4.9 pmm (p > 0.05 and with genotype T/T 13910 and was absent in children without obesity (p < 0.05. The average level of expression of Gal-9 mRNA in children with genotype C/C 13910 was 564.3 ± 32.8 RU DmRNA Gal-9/mRNA actin, in children with genotypes C/T and T/T 13910 — 61.04 ± 15.30 RU DmRNA Gal-9/mRNA actin, p < 0.01. It is of great importance that the children with genotype C/C 13910 and lactose malabsorption (n = 20 had the lowest average level of expression of Gal-9 mRNA (42.47 ± 13.30 RU DmRNA Gal-9/mRNA actin whereas the children with genotype C/C 13910 and without lactose malabsorption (n =18 had the largest level (1086

  6. Expression and significance of cyclooxygenase-2 mRNA in benign and malignant ascites

    Science.gov (United States)

    Lu, Jing; Li, Xiao-Feng; Kong, Li-Xia; Ma, Lin; Liao, Su-Huan; Jiang, Chang-You

    2013-01-01

    AIM: To investigate the mRNA expression of cyclooxygensae-2 (COX-2) in benign and malignant ascites, and to explore the difference in COX-2 mRNA expression among different diseases. METHODS: A total of 36 samples were collected from the Fifth Affiliated Hospital of Sun Yat-Sen University and divided into two experimental groups: benign ascites (n = 21) and malignant ascites (n = 15). Benign ascites included cirrhotic ascites (n = 10) and tuberculous ascites (n = 5). Malignant ascites included oophoroma (n = 7), cancer of colon (n = 5), cancer of the liver (n = 6), gastric cancer (n = 2), and bladder carcinoma (n = 1). The mRNA expression of COX-2 in ascites was examined with reverse transcriptase polymerase chain reaction (RT-PCR) technology, and the positive rate of COX-2 mRNA was compared between different diseases. RESULTS: The positive rate of COX-2 mRNA in malignant ascites was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15), difference being significant between these two groups (χ2 = 4.051, P = 0.044). The proportion of the positive rate in the malignant ascites was as follows: ovarian cancers 57.1% (4/7), colon cancer 40.0% (2/5), liver cancer 33.3% (2/6), gastric cancer 50.0% (1/2), and bladder cancer 0.00% (0/1). However, there was no significant difference in COX-2 mRNA expression among various tumors with malignant ascites (χ2 = 1.614, P = 0.806). Among the benign ascites, COX-2 mRNA levels were different between the tuberculous ascites (0/5) and cirrhotic ascites (1/10), but there was no significant difference (P = 1.000). CONCLUSION: COX-2 mRNA, detected by RT-PCR, is useful in the differential diagnosis of benign and malignant ascites, which also has potential value in the clinical diagnosis of tumors. PMID:24187465

  7. mRNA profiling for the identification of blood-Results of a collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Haas, Cordula; Hanson, E; Bär, W

    2010-01-01

    of the laboratories had no prior experience with RNA. Despite some expected variation in sensitivity between laboratories, the method proved to be reproducible and sensitive using different analysis strategies. The results of this collaborative exercise support the potential use of mRNA profiling as an alternative......A collaborative exercise on mRNA profiling for the identification of blood was organized by the European DNA Profiling Group (EDNAP). Seven blood samples and one blood dilution series were analyzed by the participating laboratories for the reportedly blood-specific markers HBB, SPTB and PBGD, using...

  8. mRNA profiling for the identification of blood--Results of a collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Haas, C.; Hanson, E.; Bär, W.

    2011-01-01

    of the laboratories had no prior experience with RNA. Despite some expected variation in sensitivity between laboratories, the method proved to be reproducible and sensitive using different analysis strategies. The results of this collaborative exercise support the potential use of mRNA profiling as an alternative......A collaborative exercise on mRNA profiling for the identification of blood was organized by the European DNA Profiling Group (EDNAP). Seven blood samples and one blood dilution series were analyzed by the participating laboratories for the reportedly blood-specific markers HBB, SPTB and PBGD, using...

  9. MRN1 implicates chromatin remodeling complexes and architectural factors in mRNA maturation

    DEFF Research Database (Denmark)

    Düring, Louis; Thorsen, Michael; Petersen, Darima

    2012-01-01

    A functional relationship between chromatin structure and mRNA processing events has been suggested, however, so far only a few involved factors have been characterized. Here we show that rsc nhp6¿¿ mutants, deficient for the function of the chromatin remodeling factor RSC and the chromatin....... Genetic interactions are observed between 2 µm-MRN1 and the splicing deficient mutants snt309¿, prp3, prp4, and prp22, and additional genetic analyses link MRN1, SNT309, NHP6A/B, SWI/SNF, and RSC supporting the notion of a role of chromatin structure in mRNA processing....

  10. Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

    Science.gov (United States)

    Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

    2014-08-28

    Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we

  11. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

    OpenAIRE

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

    2015-01-01

    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we sh...

  12. A RNA transcript (Heg) in mononuclear cells is negatively correlated with CD14 mRNA and TSH receptor autoantibodies

    DEFF Research Database (Denmark)

    Habekost, G.; Bratholm, P.; Christensen, Niels Juel

    2008-01-01

    of the poly A(-) transcript (designated Heg) in mononuclear cells was correlated with CD14 mRNA in normal subjects and with CD14 mRNA and TSH receptor autoantibodies in patients with acute and untreated Graves' disease. mRNA was expressed in amol/mu g DNA. The main study groups were: (i) normal subjects; (ii......) patients with early and untreated Graves' disease; and (iii) patients with Graves' disease studied after treatment. In 18 normal subjects and in 20 patients with treated Graves' disease CD14 mRNA was negatively correlated with Heg (P Graves' disease Heg and thyroid...

  13. Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes.

    Science.gov (United States)

    Pardi, Norbert; Tuyishime, Steven; Muramatsu, Hiromi; Kariko, Katalin; Mui, Barbara L; Tam, Ying K; Madden, Thomas D; Hope, Michael J; Weissman, Drew

    2015-11-10

    In recent years, in vitro transcribed messenger RNA (mRNA) has emerged as a potential therapeutic platform. To fulfill its promise, effective delivery of mRNA to specific cell types and tissues needs to be achieved. Lipid nanoparticles (LNPs) are efficient carriers for short-interfering RNAs and have entered clinical trials. However, little is known about the potential of LNPs to deliver mRNA. Here, we generated mRNA-LNPs by incorporating HPLC purified, 1-methylpseudouridine-containing mRNA comprising codon-optimized firefly luciferase into stable LNPs. Mice were injected with 0.005-0.250mg/kg doses of mRNA-LNPs by 6 different routes and high levels of protein translation could be measured using in vivo imaging. Subcutaneous, intramuscular and intradermal injection of the LNP-encapsulated mRNA translated locally at the site of injection for up to 10days. For several days, high levels of protein production could be achieved in the lung from the intratracheal administration of mRNA. Intravenous and intraperitoneal and to a lesser extent intramuscular and intratracheal deliveries led to trafficking of mRNA-LNPs systemically resulting in active translation of the mRNA in the liver for 1-4 days. Our results demonstrate that LNPs are appropriate carriers for mRNA in vivo and have the potential to become valuable tools for delivering mRNA encoding therapeutic proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes

    OpenAIRE

    Pardi, Norbert; Tuyishime, Steven; Muramatsu, Hiromi; Kariko, Katalin; Mui, Barbara L; Tam, Ying K; Madden, Thomas D; Hope, Michael J; Weissman, Drew

    2015-01-01

    In recent years, in vitro transcribed messenger RNA (mRNA) has emerged as a potential therapeutic platform. To fulfill its promise, effective delivery of mRNA to specific cell types and tissues needs to be achieved. Lipid nanoparticles (LNPs) are efficient carriers for short-interfering RNAs and have entered clinical trials. However, little is known about the potential of LNPs to deliver mRNA. Here, we generated mRNA-LNPs by incorporating HPLC purified, 1-methylpseudouridine-containing mRNA c...

  15. Seasonal relationship between gonadotropin, growth hormone, and estrogen receptor mRNA expression in the pituitary gland of largemouth bass.

    Science.gov (United States)

    Martyniuk, Christopher J; Kroll, Kevin J; Porak, Wesley F; Steward, Cheree; Grier, Harry J; Denslow, Nancy D

    2009-09-15

    The objectives of this study were to investigate the seasonal changes in pituitary gonadotropins, growth hormone (GH), and estrogen receptor (ER) isoform mRNA in wild female and male largemouth bass (LMB) (Micropterus salmoides) from an unpolluted habitat to better understand reproductive physiology in this ecologically important species. Female pituitary luteinizing hormone (LH) beta subunit and follicle stimulating hormone (FSH) beta subunit mRNA showed significant seasonal variation with levels peaking from January to April and were lowest from May to August. Male LMB showed more variation in gonadotropin subunit expression from month to month. Females had approximately 2-3 times higher gonadotropin mRNA levels in the pituitary when compared to males. All three gonadotropin mRNAs in females were positively correlated to gonadosomatic index (GSI), but only LHbeta mRNA was correlated to GSI in males. Gonadotropin mRNA expression also increased with increasing oocyte and sperm maturation. Gonadotropin beta subunit mRNA expression was positively correlated to GH mRNA in both sexes. The expression of all three ER isoforms was significantly correlated to each other in both sexes. The concurrent increase in all three ER mRNA isoforms with increasing gonadotropin mRNA in females and males suggests a prominent role for E2 feedback on pituitary gonadotropin synthesis in both sexes and that each of the three ER isoforms are likely to play a role in the pituitary during teleost reproduction.

  16. Transcription pattern of UL131A-128 mRNA in clinical strains of ...

    Indian Academy of Sciences (India)

    Human cytomegalovirus (HCMV) mRNA was obtained from human embryonic lung fibroblast cells infected by HCMV clinical strains from urine samples of infants at different kinetic periods. The cDNA of UL131A-128 mRNAs was amplified using reverse transcription-polymerase chain reaction (RT-PCR) and analysed by ...

  17. Effect of dietary betaine supplementation on mRNA level of ...

    African Journals Online (AJOL)

    Yomi

    2012-03-22

    Mar 22, 2012 ... of China. Accepted 3 January, 2012. Our aims are to determine the ... percentage of abdominal fat, ratio of liver to body weight, mRNA ... four diet groups with supplemented betaine of 0, 0.04, 0.06 and 0.08%, respectively.

  18. VDR mRNA overexpression is associated with worse prognostic factors in papillary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    June Young Choi

    2017-03-01

    Full Text Available The purpose of this study was to assess the relationship between vitamin D receptor gene (VDR expression and prognostic factors in papillary thyroid cancer (PTC. mRNA sequencing and somatic mutation data from The Cancer Genome Atlas (TCGA were analyzed. VDR mRNA expression was compared to clinicopathologic variables by linear regression. Tree-based classification was applied to find cutoff and patients were split into low and high VDR group. Logistic regression, Kaplan–Meier analysis, differentially expressed gene (DEG test and pathway analysis were performed to assess the differences between two VDR groups. VDR mRNA expression was elevated in PTC than that in normal thyroid tissue. VDR expressions were high in classic and tall-cell variant PTC and lateral neck node metastasis was present. High VDR group was also associated with classic and tall cell subtype, AJCC stage IV and lower recurrence-free survival. DEG test reveals that 545 genes were upregulated in high VDR group. Thyroid cancer-related pathways were enriched in high VDR group in pathway analyses. VDR mRNA overexpression was correlated with worse prognostic factors such as subtypes of papillary thyroid carcinoma that are known to be worse prognosis, lateral neck node metastasis, advanced stage and recurrence-free survival.

  19. Sheep oocyte expresses leptin and functional leptin receptor mRNA

    Directory of Open Access Journals (Sweden)

    Seyyed Jalil Taheri

    2016-09-01

    Conclusions: The result of present study reveals that leptin and its functional receptor (Ob-Rb mRNA are expressed in sheep oocyte and further studies should investigate the role(s of leptin on sheep oocyte physiology and embryo development.

  20. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    Directory of Open Access Journals (Sweden)

    Jones Sophie

    2012-08-01

    Full Text Available Abstract Background Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Methods Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA and reverse-transcriptase PCR (RT-PCR. Results Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (p  Conclusions This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.

  1. Decreased alternative splicing of estrogen receptor-α mRNA in the Alzheimer's disease brain

    NARCIS (Netherlands)

    Ishunina, Tatjana A.; Swaab, Dick F.

    2012-01-01

    In this study we identified 62 estrogen receptor alpha (ERα) mRNA splice variants in different human brain areas of Alzheimer's disease (AD) and control cases and classified them into 12 groups. Forty-eight of these splice forms were identified for the first time. The distribution of alternatively

  2. Semi-quantitative analysis of endometrial receptivity marker mRNA ...

    African Journals Online (AJOL)

    Yomi

    2012-03-20

    Mar 20, 2012 ... endometrium of patients with uterine fibromas. Naser Shokrzadeh1 and ... 3Department of Anatomical Sciences, Hamadan University of Medical Sciences, Hamadan, Iran. Accepted 1 March ... with lower pregnancy, implantation and delivery rates in ... humans, LIF mRNA and protein levels are low in the.

  3. mRNA Expression of Ovine Angiopoietin-like Protein 4 Gene in Adipose Tissues

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2016-05-01

    Full Text Available Angiopoietin-like protein 4 (ANGPTL4 is involved in a variety of functions, including lipoprotein metabolism and angiogenesis. To reveal the role of ANGPTL4 in fat metabolism of sheep, ovine ANGPTL4 mRNA expression was analyzed in seven adipose tissues from two breeds with distinct tail types. Forty-eight animals with the gender ratio of 1:1 for both Guangling Large Tailed (GLT and Small Tailed Han (STH sheep were slaughtered at 2, 4, 6, 8, 10, and 12 months of age, respectively. Adipose tissues were collected from greater and lesser omental, subcutaneous, retroperitoneal, perirenal, mesenteric, and tail fats. Ontogenetic mRNA expression of ANGPTL4 in these adipose tissues from GTL and STH was studied by quantitative real time polymerase chain reaction. The results showed that ANGPTL4 mRNA expressed in all adipose tissues studied with the highest in subcutaneous and the lowest in mesenteric fat depots. Months of age, tissue and breed are the main factors that significantly influence the mRNA expression. These results provide new insights into ovine ANGPTL4 gene expression and clues for its function mechanism.

  4. Alternative splicing of cyclooxygenase-1 mRNA in the human iris

    NARCIS (Netherlands)

    Dröge, M.J; van Sorge, A.A; van Haeringen, N.J; Quax, Wim; Zaagsma, Hans; Droge, MJ

    2003-01-01

    dIn homogenates of the human iris, the nonsteroidal antiinflammatory drug (NSAID) S(+)flurbiprofen has been reported to inhibit cyclooxygenase-1 (COX-1) 70-fold more potently than in human whole blood. We hypothesized that this difference may be due to alternative splicing of COX-1 mRNA in the human

  5. Generation of human induced pluripotent stem cells using non-synthetic mRNA

    Directory of Open Access Journals (Sweden)

    L. Rohani

    2016-05-01

    Reprogramming with non-synthetic mRNA holds great promise for safe generation of iPSCs of human origin. Using the protocols described herein we hope to make this method more accessible to other groups as a fast, inexpensive, and non-viral reprogramming approach.

  6. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

    Science.gov (United States)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

    2018-05-01

    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  7. Peripheral mononuclear cell resistin mRNA expression is increased in type 2 diabetic women.

    Science.gov (United States)

    Tsiotra, Panayoula C; Tsigos, Constantine; Anastasiou, Eleni; Yfanti, Eleni; Boutati, Eleni; Souvatzoglou, Emmanouil; Kyrou, Ioannis; Raptis, Sotirios A

    2008-01-01

    Resistin has been shown to cause insulin resistance and to impair glucose tolerance in rodents, but in humans its physiological role still remains elusive. The aim of this study was to examine whether resistin mRNA expression in human peripheral mononuclear cells (PBMCs) and its corresponding plasma levels are altered in type 2 diabetes. Resistin mRNA levels were easily detectable in human PBMC, and found to be higher in DM2 compared to healthy women (P = .05). Similarly, mononuclear mRNA levels of the proinflammatory cytokines IL-1beta, TNF-alpha, and IL-6 were all significantly higher in DM2 compared to control women (P DM2 women (P = .051), and overall, they correlated significantly with BMI (r = 0.406, P = .010) and waist circumference (r = 0.516, P = .003), but not with fasting insulin levels or HOMA-IR. Resistin mRNA expression is increased in PBMC from DM2 women, together with increased expression of the inflammatory cytokines IL-1beta, TNF-alpha, and IL-6, independent of obesity. These results suggest that resistin and cytokines might contribute to the low-grade inflammation and the increased atherogenic risk observed in these patients.

  8. Peripheral Mononuclear Cell Resistin mRNA Expression Is Increased in Type 2 Diabetic Women

    Directory of Open Access Journals (Sweden)

    Panayoula C. Tsiotra

    2008-01-01

    Full Text Available Resistin has been shown to cause insulin resistance and to impair glucose tolerance in rodents, but in humans its physiological role still remains elusive. The aim of this study was to examine whether resistin mRNA expression in human peripheral mononuclear cells (PBMCs and its corresponding plasma levels are altered in type 2 diabetes. Resistin mRNA levels were easily detectable in human PBMC, and found to be higher in DM2 compared to healthy women (P=.05. Similarly, mononuclear mRNA levels of the proinflammatory cytokines IL-1β, TNF-α, and IL-6 were all significantly higher in DM2 compared to control women (P<.001. The corresponding plasma resistin levels were slightly, but not significantly, increased in DM2 women (P=.051, and overall, they correlated significantly with BMI (r=0.406, P=.010 and waist circumference (r=0.516, P=.003, but not with fasting insulin levels or HOMA-IR. Resistin mRNA expression is increased in PBMC from DM2 women, together with increased expression of the inflammatory cytokines IL-1β, TNF-α, and IL-6, independent of obesity. These results suggest that resistin and cytokines might contribute to the low-grade inflammation and the increased atherogenic risk observed in these patients.

  9. Regulation of elastin synthesis in developing sheep nuchal ligament by elastin mRNA levels

    International Nuclear Information System (INIS)

    Davidson, J.M.; Smith, K.; Shibahara, S.; Tolstoshev, P.; Crystal, R.G.

    1982-01-01

    Levels of elastin production in explant culture of fetal sheep nuchal ligament and corresponding levels of translatable elastin mRNA were determined in parallel studies during a period of rapid growth of the embryo. The identity of the explant culture and cell-free proucts was confirmed by peptide mapping, immunoprecipitation, and the characteristic lack of histidine and methionine. Elastin production was quantitated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and radioimmune precipitation. The translation products could be labeled with methionine only when NH 2 -terminally donated as f-Met-tRNA/sup Met//sub f/. Explant cultures showed a large rise in elastin production from 70 days after conception to 150 days after conception. Cell free translation of RNA demonstrated a parallel in elastin mRNA levels and in elastin mRNA per cell. It appears, therefore, that the marked emphasis the differentiating muchal ligament places on elastin production is modulated, at least in part, by the quantities of available elastin in mRNA

  10. The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet

    Science.gov (United States)

    Dunlap, Dacey; Patrick, Patricia

    2012-01-01

    During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…

  11. Group II intron inhibits conjugative relaxase expression in bacteria by mRNA targeting

    Science.gov (United States)

    Piazza, Carol Lyn; Smith, Dorie

    2018-01-01

    Group II introns are mobile ribozymes that are rare in bacterial genomes, often cohabiting with various mobile elements, and seldom interrupting housekeeping genes. What accounts for this distribution has not been well understood. Here, we demonstrate that Ll.LtrB, the group II intron residing in a relaxase gene on a conjugative plasmid from Lactococcus lactis, inhibits its host gene expression and restrains the naturally cohabiting mobile element from conjugative horizontal transfer. We show that reduction in gene expression is mainly at the mRNA level, and results from the interaction between exon-binding sequences (EBSs) in the intron and intron-binding sequences (IBSs) in the mRNA. The spliced intron targets the relaxase mRNA and reopens ligated exons, causing major mRNA loss. Taken together, this study provides an explanation for the distribution and paucity of group II introns in bacteria, and suggests a potential force for those introns to evolve into spliceosomal introns. PMID:29905149

  12. Neurotrophin-3 mRNA a putative target of miR21 following status epilepticus.

    Science.gov (United States)

    Risbud, Rashmi M; Lee, Carolyn; Porter, Brenda E

    2011-11-18

    Status epilepticus induces a cascade of protein expression changes contributing to the subsequent development of epilepsy. By identifying the cascade of molecular changes that contribute to the development of epilepsy we hope to be able to design therapeutics for preventing epilepsy. MicroRNAs influence gene expression by altering mRNA stability and/or translation and have been implicated in the pathology of multiple diseases. MiR21 and its co-transcript miR21, microRNAs produced from either the 5' or 3' ends of the same precursor RNA strand, are increased in the hippocampus following status epilepticus. We have identified a miR21 binding site, in the 3' UTR of neurotrophin-3 that inhibits translation. Neurotrophin-3 mRNA levels decrease in the hippocampus following SE concurrent with the increase in miR21. MiR21 levels in cultured hippocampal neurons inversely correlate with neurotrophin-3 mRNA levels. Treatment of hippocampal neuronal cultures with excess K(+)Cl(-), a depolarizing agent mimicking the episode of status epilepticus, also results in an increase in miR21 and a decrease in neurotrophin-3 mRNA. MiR21 is a candidate for regulating neurotrophin-3 signaling in the hippocampus following status epilepticus. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Expression of IL-1β mRNA in mice after whole body X-irradiation

    International Nuclear Information System (INIS)

    Nemoto, Kumie; Ishihara, Hiroshi; Tanaka, Izumi; Suzuki, Gen; Tsuneoka, Kazuko; Yoshida, Kazuko; Ohtsu, Hiroshi

    1995-01-01

    IL-1β is a stimulator of hematopoietic and inflammatory systems, and also acts as a radioprotector. After whole-body exposure to sublethal doses of ionizing radiation, the IL-1β mRNA level in spleen cells increases for a short time prior to regeneration of the spleen. We analyzed spleen cells of C3H/He mice after whole-body irradiation with 3 Gy x-rays to determine the cause of this short-term increase in the transcription level. An increase in the level of the message in spleen cells, found by Northern blot hybridization, reached its peak 5 to 7 days after irradiation. There was a low correlation between the curves of the mRNA level and the ratio of monocyte/macrophage lineage cells; a typical source of the message. Spleen macrophages that produce a large amount of the message were found 7 days after irradiation in an in situ hybridization experiment in which heterogeneous spleen cell populations were used. In contrast, spleen cells had no detectable levels of macrophages rich in IL-1β mRNA before and 17 days after irradiation. Additionally, the population of message-rich cells was 9.4% of the total number of monocytes/macrophages in the spleen. These results suggest that the short-term increase in IL-1β mRNA is a result of the heterogeneous differentiation of a subpopulation of spleen macrophages before regeneration of the spleen. (author)

  14. Differential distribution of calcineurin Aα isoenzyme mRNA's in rat brain

    NARCIS (Netherlands)

    Buttini, M.; Limonta, S.; Luyten, M.; Boddeke, H.

    1993-01-01

    Specific antisense oligonucleotide probes for the α isoforms of the catalytic subunit (A-subunit) of calcineurin were prepared and the distribution of Aα1 and Aα2 mRNA's has been studied in rat brain using in situ hybridization histochemistry. Clear regional differences have been observed for the

  15. Quantitation of the mRNA expression of the epidermal growth factor system

    DEFF Research Database (Denmark)

    Sørensen, B S; Tørring, N; Bor, M V

    2000-01-01

    ) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...

  16. A small RNA activates CFA synthase by isoform-specific mRNA stabilization.

    Science.gov (United States)

    Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg

    2013-11-13

    Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.

  17. Binding of NUFIP2 to Roquin promotes recognition and regulation of ICOS mRNA.

    Science.gov (United States)

    Rehage, Nina; Davydova, Elena; Conrad, Christine; Behrens, Gesine; Maiser, Andreas; Stehklein, Jenny E; Brenner, Sven; Klein, Juliane; Jeridi, Aicha; Hoffmann, Anne; Lee, Eunhae; Dianzani, Umberto; Willemsen, Rob; Feederle, Regina; Reiche, Kristin; Hackermüller, Jörg; Leonhardt, Heinrich; Sharma, Sonia; Niessing, Dierk; Heissmeyer, Vigo

    2018-01-19

    The ubiquitously expressed RNA-binding proteins Roquin-1 and Roquin-2 are essential for appropriate immune cell function and postnatal survival of mice. Roquin proteins repress target mRNAs by recognizing secondary structures in their 3'-UTRs and by inducing mRNA decay. However, it is unknown if other cellular proteins contribute to target control. To identify cofactors of Roquin, we used RNA interference to screen ~1500 genes involved in RNA-binding or mRNA degradation, and identified NUFIP2 as a cofactor of Roquin-induced mRNA decay. NUFIP2 binds directly and with high affinity to Roquin, which stabilizes NUFIP2 in cells. Post-transcriptional repression of human ICOS by endogenous Roquin proteins requires two neighboring non-canonical stem-loops in the ICOS 3'-UTR. This unconventional cis-element as well as another tandem loop known to confer Roquin-mediated regulation of the Ox40 3'-UTR, are bound cooperatively by Roquin and NUFIP2. NUFIP2 therefore emerges as a cofactor that contributes to mRNA target recognition by Roquin.

  18. Mutagenic effect of the decay of 32P incorporated in mRNA

    International Nuclear Information System (INIS)

    Zakharov, I.A.; Korolev, V.G.; Gracheva, L.M.

    1978-01-01

    32 P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac - mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown

  19. Differential regulation of renal cyclooxygenase mRNA by dietary salt intake

    DEFF Research Database (Denmark)

    Jensen, B L; Kurtz, A

    1997-01-01

    RNA correlated directly with salt intake. We conclude that dietary salt intake influences renal cyclooxygenase mRNAs zone-specifically with opposite responses between cortex and medulla. Cortical COX II-mediated prostaglandin formation is probably important in low salt states whereas medullary COX I......Experiments were done to investigate the influence of dietary salt intake on renal cyclooxygenase (COX) I and II mRNA levels. To this end rats were fed either a low NaCl diet (LS; 0.02% NaCl wt/wt) or a high NaCl diet (HS diet; 4% NaCl wt/wt) for 5, 10 and 20 days. After 10 days Na excretion...... differed 760-fold, plasma renin activity and renin mRNA were increased eight- and threefold in LS compared to HS animals. Total renal COX I mRNA decreased 50% following the LS diet and did not change after the HS diet. Conversely, COX II mRNA declined after HS intake and transiently increased after salt...

  20. Targeting Poxvirus Decapping Enzymes and mRNA Decay to Generate an Effective Oncolytic Virus

    Directory of Open Access Journals (Sweden)

    Hannah Burgess

    2018-03-01

    Full Text Available Through the action of two virus-encoded decapping enzymes (D9 and D10 that remove protective caps from mRNA 5′-termini, Vaccinia virus (VACV accelerates mRNA decay and limits activation of host defenses. D9- or D10-deficient VACV are markedly attenuated in mice and fail to counter cellular double-stranded RNA-responsive innate immune effectors, including PKR. Here, we capitalize upon this phenotype and demonstrate that VACV deficient in either decapping enzyme are effective oncolytic viruses. Significantly, D9- or D10-deficient VACV displayed anti-tumor activity against syngeneic mouse tumors of different genetic backgrounds and human hepatocellular carcinoma xenografts. Furthermore, D9- and D10-deficient VACV hyperactivated the host anti-viral enzyme PKR in non-tumorigenic cells compared to wild-type virus. This establishes a new genetic platform for oncolytic VACV development that is deficient for a major pathogenesis determinant while retaining viral genes that support robust productive replication like those required for nucleotide metabolism. It further demonstrates how VACV mutants unable to execute a fundamental step in virus-induced mRNA decay can be unexpectedly translated into a powerful anti-tumor therapy. Keywords: oncolytic virus, mRNA decay, decapping

  1. Expression of connexin 37, 40, and 43 mRNA and protein in renal preglomerular arterioles

    DEFF Research Database (Denmark)

    Arensbak, B; Mikkelsen, Hanne Birte; Gustafsson, F

    2001-01-01

    arterioles in frozen sections was evaluated. SMC were isolated from kidneys using an iron oxide sieve method and explant technique. Total RNA from these cultures was tested by RT-PCR analysis for the expression of the three connexins mRNA. Using immunofluorescence we examined whether the expression pattern...

  2. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    Science.gov (United States)

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  3. Interleukin-6 modifies mRNA expression in mouse skeletal muscle

    DEFF Research Database (Denmark)

    Hassing, Helle Adser; Wojtaszewski, Jørgen; Jakobsen, Anne Hviid

    2011-01-01

    Aim: The aim of the present study was to test the hypothesis that interleukin-6 plays a role in exercise-induced PGC-1a and TNFa mRNA responses in skeletal muscle and to examine the potential IL-6 mediated AMPK regulation in these responses. Methods: Whole body IL-6 knockout and wildtype (WT) mal...

  4. Imaging translation dynamics of single mRNA molecules in live cells

    NARCIS (Netherlands)

    Ruijtenberg, Suzan; Hoek, Tim A.; Yan, Xiaowei; Tanenbaum, Marvin E.

    2018-01-01

    mRNA translation is a key step in decoding the genetic information stored in DNA. Regulation of translation efficiency contributes to gene expression control and is therefore important for cell fate and function. Here, we describe a recently developed microscopy-based method that allows for

  5. Elevation of D4 dopamine receptor mRNA in postmortem schizophrenic brain.

    Science.gov (United States)

    Stefanis, N C; Bresnick, J N; Kerwin, R W; Schofield, W N; McAllister, G

    1998-01-01

    The D4 dopamine (DA) receptor has been proposed to be a target for the development of a novel antipsychotic drug based on its pharmacological and distribution profile. There is much interest in whether D4 DA receptor levels are altered in schizophrenia, but the lack of an available receptor subtype-specific radioligand made this difficult to quantitate. In this study, we examined whether D4 mRNA levels are altered in different brain regions of schizophrenics compared to controls. Ribonuclease protection assays were carried out on total RNA samples isolated postmortem from frontal cortex and caudate brain regions of schizophrenics and matched controls. 32P-labelled RNA probes to the D4 DA receptor and to the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), were hybridised with the RNA samples, digested with ribonucleases to remove unhybridised probe, and separated on 6% sequencing gels. Densitometer analysis on the subsequent autoradiogams was used to calculate the relative optical density of D4 mRNA compared to G3PDH mRNA. Statistical analysis of the data revealed a 3-fold higher level (P<0.011) of D4 mRNA in the frontal cortex of schizophrenics compared to controls. No increase was seen in caudate. D4 receptors could play a role in mediating dopaminergic activity in frontal cortex, an activity which may be malfunctioning in schizophrenia.

  6. A possible contribution of mRNA secondary structure to translation initiation efficiency in Lactococcus lactis

    NARCIS (Netherlands)

    Guchte, Maarten van de; Lende, Ted van der; Kok, Jan; Venema, Gerard

    1991-01-01

    Gene expression signals derived from Lactococcus lactis were linked to lacZ-fused genes with different 5'-nucleotide sequences. Computer predictions of mRNA secondary structure were combined with lacZ expression studies to direct base-substitutions that could possibly influence gene expression.

  7. Influence of mRNA decay rates on the computational prediction of ...

    Indian Academy of Sciences (India)

    SEARCHU

    To understand the influences, we present a systematic method based on a gene dynamic ... data). The results indicate that mRNA decay rates do not significantly influence the .... For instance, k for a cubic B-spline equals 4 and the fitting.

  8. PAX5α and PAX5β mRNA expression in breast Cancer: Relation to ...

    African Journals Online (AJOL)

    Background: Many studies evaluated the role of paired box gene 5 (PAX5) in breast cancer. However, few investigated PAX5α and PAX5β isoforms individually. Objective: The aim of the present study is to evaluate mRNA expression of PAX5α and PAX5β in breast cancer and assessing their underlying pathological roles ...

  9. The potential lipolysis function of musclin and its mRNA expression ...

    African Journals Online (AJOL)

    Musclin is a newly discovered factor and its functions remain to be defined. This study investigated the tissue expression pattern of musclin gene and its potential effect on lipid metabolism. Musclin mRNA levels in adipose, muscle tissues and primary adipocytes were examined by quantitative PCR. The musclin gene ...

  10. The effects of valproic acid on the mRNA expression of Natriuretic ...

    African Journals Online (AJOL)

    Mona Hajikazemi

    2017-04-28

    Apr 28, 2017 ... Real Time RT-PCR was used to quantify differential mRNA expression of NPR-A and KCNQ1 genes. Two-way ANOVA and bonferroni post-tests were used to analyze data statistically. Results: We showed that VPA treatment inhibits the growth of SW-480 cells more efficiently compared to. HT-29. NPR-A ...

  11. Kinetin improves IKBKAP mRNA splicing in patients with familial dysautonomia

    Science.gov (United States)

    Axelrod, Felicia B.; Liebes, Leonard; Gold-von Simson, Gabrielle; Mendoza, Sandra; Mull, James; Leyne, Maire; Norcliffe-Kaufmann, Lucy; Kaufmann, Horacio; Slaugenhaupt, Susan A.

    2011-01-01

    Familial dysautonomia (FD) is caused by an intronic splice mutation in the IKBKAP gene that leads to partial skipping of exon 20 and tissue-specific reduction in I-κ-B kinase complex associated protein/ elongation protein 1 (IKAP/ELP-1) expression. Kinetin (6-furfurylaminopurine) has been shown to improve splicing and increase wild-type IKBKAP mRNA and IKAP protein expression in FD cell lines and carriers. To determine if oral kinetin treatment could alter mRNA splicing in FD subjects and was tolerable, we administered kinetin to eight FD individuals homozygous for the splice mutation. Subjects received 23.5 mg/Kg/day for 28 days. An increase in wild-type IKBKAP mRNA expression in leukocytes was noted after eight days in six of eight individuals; after 28 days the mean increase as compared to baseline was significant (p=0.002). We have demonstrated that kinetin is tolerable in this medically fragile population. Not only did kinetin produce the desired effect on splicing in FD patients, but also that effect appears to improve with time despite lack of dose change. This is the first report of a drug that produces in vivo mRNA splicing changes in individuals with FD and supports future long-term trials to determine if kinetin will prove therapeutic in FD patients. PMID:21775922

  12. Mutagenic effect of the decay of /sup 32/P incorporated in mRNA

    Energy Technology Data Exchange (ETDEWEB)

    Zakharov, I A; Korolev, V G; Gracheva, L M [AN SSSR, Leningrad. Inst. Yadernoj Fiziki

    1978-10-01

    /sup 32/P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac/sup -/ mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown.

  13. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    NARCIS (Netherlands)

    Jones, S.; Sutherland, C.J.; Hermsen, C.C.; Arens, T.; Teelen, K.A.E.M.; Hallett, R.; Corran, P.; van der Vegte-Bolmer, M.; Sauerwein, R.; Drakeley, C.; Bousema, J.T.

    2012-01-01

    ABSTRACT: BACKGROUND: Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be

  14. Induction of interleukin-1β mRNA after focal cerebral ischaemia in the rat

    NARCIS (Netherlands)

    Buttini, M.; Sauter, A.; Boddeke, H.W.G.M.

    1994-01-01

    The expression of interleukin-1β (IL-1β) mRNA in the brain in response to cerebral ischaemia in rats was examined using in situ hybridization histochemistry. Focal cerebral ischaemia was induced in spontaneously hypertensive rats by permanent occlusion of the left middle cerebral artery (MCAO).

  15. Dissecting mechanisms of nuclear mRNA surveillance in THO/sub2 complex mutants

    DEFF Research Database (Denmark)

    Rougemaille, Mathieu; Gudipati, Rajani Kanth; Olesen, Jens Raabjerg

    2007-01-01

    by appending oligo(A)-tails onto structured substrates. Another role of the nuclear exosome is that of mRNA surveillance. In strains harboring a mutated THO/Sub2p system, involved in messenger ribonucleoprotein particle biogenesis and nuclear export, the exosome-associated 3' 5' exonuclease Rrp6p is required...

  16. Lipoprotein Lipase mRNA expression in different tissues of farm ...

    African Journals Online (AJOL)

    Lipoprotein lipase (LPL) controls triacylglycerol partitioning between adipose tissues and muscles, so it is important enzyme for fattening of animals .The present work was planned to clarify the use of polymerase chain reaction (PCR) for detection of LPL mRNA expression in different tissues representing internal organs of ...

  17. Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

    Science.gov (United States)

    Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

    1980-01-01

    The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246

  18. The decapping activator Edc3 and the Q/N-rich domain of Lsm4 function together to enhance mRNA stability and alter mRNA decay pathway dependence in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Susanne Huch

    2016-10-01

    Full Text Available The rate and regulation of mRNA decay are major elements in the proper control of gene expression. Edc3 and Lsm4 are two decapping activator proteins that have previously been shown to function in the assembly of RNA granules termed P bodies. Here, we show that deletion of edc3, when combined with a removal of the glutamine/asparagine rich region of Lsm4 (edc3Δ lsm4ΔC reduces mRNA stability and alters pathways of mRNA degradation. Multiple tested mRNAs exhibited reduced stability in the edc3Δ lsm4ΔC mutant. The destabilization was linked to an increased dependence on Ccr4-mediated deadenylation and mRNA decapping. Unlike characterized mutations in decapping factors that either are neutral or are able to stabilize mRNA, the combined edc3Δ lsm4ΔC mutant reduced mRNA stability. We characterized the growth and activity of the major mRNA decay systems and translation in double mutant and wild-type yeast. In the edc3Δ lsm4ΔC mutant, we observed alterations in the levels of specific mRNA decay factors as well as nuclear accumulation of the catalytic subunit of the decapping enzyme Dcp2. Hence, we suggest that the effects on mRNA stability in the edc3Δ lsm4ΔC mutant may originate from mRNA decay protein abundance or changes in mRNPs, or alternatively may imply a role for P bodies in mRNA stabilization.

  19. Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle.

    Science.gov (United States)

    Shock, Jennifer L; Fischer, Kael F; DeRisi, Joseph L

    2007-01-01

    The rate of mRNA decay is an essential element of post-transcriptional regulation in all organisms. Previously, studies in several organisms found that the specific half-life of each mRNA is precisely related to its physiologic role, and plays an important role in determining levels of gene expression. We used a genome-wide approach to characterize mRNA decay in Plasmodium falciparum. We found that, globally, rates of mRNA decay increase dramatically during the asexual intra-erythrocytic developmental cycle. During the ring stage of the cycle, the average mRNA half-life was 9.5 min, but this was extended to an average of 65 min during the late schizont stage of development. Thus, a major determinant of mRNA decay rate appears to be linked to the stage of intra-erythrocytic development. Furthermore, we found specific variations in decay patterns superimposed upon the dominant trend of progressive half-life lengthening. These variations in decay pattern were frequently enriched for genes with specific cellular functions or processes. Elucidation of Plasmodium mRNA decay rates provides a key element for deciphering mechanisms of genetic control in this parasite, by complementing and extending previous mRNA abundance studies. Our results indicate that progressive stage-dependent decreases in mRNA decay rate function are a major determinant of mRNA accumulation during the schizont stage of intra-erythrocytic development. This type of genome-wide change in mRNA decay rate has not been observed in any other organism to date, and indicates that post-transcriptional regulation may be the dominant mechanism of gene regulation in P. falciparum.

  20. Tissue-specific mRNA expression profiling in grape berry tissues

    Science.gov (United States)

    Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

    2007-01-01

    Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and

  1. Tissue-specific mRNA expression profiling in grape berry tissues

    Directory of Open Access Journals (Sweden)

    Cramer Grant R

    2007-06-01

    Full Text Available Abstract Background Berries of grape (Vitis vinifera contain three major tissue types (skin, pulp and seed all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin and mesocarp (pulp, not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell

  2. ErbB3 mRNA leukocyte levels as a biomarker for major depressive disorder

    Directory of Open Access Journals (Sweden)

    Milanesi Elena

    2012-09-01

    Full Text Available Abstract Background In recent years, the identification of peripheral biomarkers that are associated with psychiatric diseases, such as Major Depressive Disorder (MDD, has become relevant because these biomarkers may improve the efficiency of the differential diagnosis process and indicate targets for new antidepressant drugs. Two recent candidate genes, ErbB3 and Fgfr1, are growth factors whose mRNA levels have been found to be altered in the leukocytes of patients that are affected by bipolar disorder in a depressive state. On this basis, the aim of the study was to determine if ErbB3 and Fgfr1 mRNA levels could be a biomarkers of MDD. Methods We measured by Real Time PCR ErbB3 and Fgfr1 mRNA expression levels in leukocytes of MDD patients compared with controls. Successively, to assess whether ErbB3 mRNA levels were influenced by previous antidepressant treatment we stratified our patients sample in two cohorts, comparing drug-naive versus drug-free patients. Moreover, we evaluated the levels of the transcript in MDD patients after 12 weeks of antidepressant treatment, and in prefrontal cortex of rats stressed and treated with an antidepressant drug of the same class. Results These results showed that ErbB3 but not Fgfr1 mRNA levels were reduced in leukocytes of MDD patients compared to healthy subjects. Furthermore, ErbB3 levels were not affected by antidepressant treatment in either human or animal models Conclusions Our data suggest that ErbB3 might be considered as a biomarker for MDD and that its deficit may underlie the pathopsysiology of the disease and is not a consequence of treatment. Moreover the study supports the usefulness of leukocytes as a peripheral system for identifying biomarkers in psychiatric diseases.

  3. Regulation and dysregulation of vitellogenin mRNA accumulation in daphnids (Daphnia magna)

    Energy Technology Data Exchange (ETDEWEB)

    Hannas, Bethany R.; Wang, Ying H.; Thomson, Susanne; Kwon, Gwijun; Hong, Li [Department of Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC 27695-7633 (United States); LeBlanc, Gerald A., E-mail: Gerald_LeBlanc@ncsu.edu [Department of Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC 27695-7633 (United States)

    2011-01-25

    The induction of vitellogenin in oviparous vertebrates has become the gold standard biomarker of exposure to estrogenic chemicals in the environment. This biomarker of estrogen exposure also has been used in arthropods, however, little is known of the factors that regulate the expression of vitellogenin in these organisms. We investigated changes in accumulation of mRNA products of the vitellogenin gene Vtg2 in daphnids (Daphnia magna) exposed to a diverse array of chemicals. We further evaluated the involvement of hormonal factors in the regulation of vitellogenin expression that may be targets of xenobiotic chemicals. Expression of the Vtg2 gene was highly responsive to exposure to various chemicals with an expression range spanning approximately four orders of magnitude. Chemicals causing the greatest induction were piperonyl butoxide, chlordane, 4-nonylphenol, cadmium, and chloroform. Among these, only 4-nonylphenol is recognized to be estrogenic. Exposure to several chemicals also suppressed Vtg2 mRNA levels, as much as 100-fold. Suppressive chemicals included cyproterone acetate, acetone, triclosan, and atrazine. Exposure to the estrogens diethylstilbestrol and bisphenol A had little effect on vitellogenin mRNA levels further substantiating that these genes are not induced by estrogen exposure. Exposure to the potent ecdysteroids 20-hydroxyecdysone and ponasterone A revealed that Vtg2 was subject to strong suppressive control by these hormones. Vtg2 mRNA levels were not significantly affected from exposure to several juvenoid hormones. Results indicate that ecdysteroids are suppressors of vitellogenin gene expression and that vitellogenin mRNA levels can be elevated or suppressed in daphnids by xenobiotics that elicit antiecdysteroidal or ecdysteroidal activity, respectively. Importantly, daphnid Vtg2 is not elevated in response to estrogenic activity.

  4. Regulation and dysregulation of vitellogenin mRNA accumulation in daphnids (Daphnia magna)

    International Nuclear Information System (INIS)

    Hannas, Bethany R.; Wang, Ying H.; Thomson, Susanne; Kwon, Gwijun; Li Hong; LeBlanc, Gerald A.

    2011-01-01

    The induction of vitellogenin in oviparous vertebrates has become the gold standard biomarker of exposure to estrogenic chemicals in the environment. This biomarker of estrogen exposure also has been used in arthropods, however, little is known of the factors that regulate the expression of vitellogenin in these organisms. We investigated changes in accumulation of mRNA products of the vitellogenin gene Vtg2 in daphnids (Daphnia magna) exposed to a diverse array of chemicals. We further evaluated the involvement of hormonal factors in the regulation of vitellogenin expression that may be targets of xenobiotic chemicals. Expression of the Vtg2 gene was highly responsive to exposure to various chemicals with an expression range spanning approximately four orders of magnitude. Chemicals causing the greatest induction were piperonyl butoxide, chlordane, 4-nonylphenol, cadmium, and chloroform. Among these, only 4-nonylphenol is recognized to be estrogenic. Exposure to several chemicals also suppressed Vtg2 mRNA levels, as much as 100-fold. Suppressive chemicals included cyproterone acetate, acetone, triclosan, and atrazine. Exposure to the estrogens diethylstilbestrol and bisphenol A had little effect on vitellogenin mRNA levels further substantiating that these genes are not induced by estrogen exposure. Exposure to the potent ecdysteroids 20-hydroxyecdysone and ponasterone A revealed that Vtg2 was subject to strong suppressive control by these hormones. Vtg2 mRNA levels were not significantly affected from exposure to several juvenoid hormones. Results indicate that ecdysteroids are suppressors of vitellogenin gene expression and that vitellogenin mRNA levels can be elevated or suppressed in daphnids by xenobiotics that elicit antiecdysteroidal or ecdysteroidal activity, respectively. Importantly, daphnid Vtg2 is not elevated in response to estrogenic activity.

  5. Cyclic-AMP mediated regulation of ABCB mRNA expression in mussel haemocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Franzellitti

    Full Text Available BACKGROUND: The multixenobiotic resistance system (MXR allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp. In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. METHODOLOGY/PRINCIPAL FINDINGS: cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX alone or in combination with 0.3 ng/L propranolol (PROP. FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin and pharmacological modulators (PROP, forskolin, dbcAMP, and H89 of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. CONCLUSIONS: This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels.

  6. Photobiomodulation effects on mRNA levels from genomic and chromosome stabilization genes in injured muscle.

    Science.gov (United States)

    da Silva Neto Trajano, Larissa Alexsandra; Trajano, Eduardo Tavares Lima; da Silva Sergio, Luiz Philippe; Teixeira, Adilson Fonseca; Mencalha, Andre Luiz; Stumbo, Ana Carolina; de Souza da Fonseca, Adenilson

    2018-04-26

    Muscle injuries are the most prevalent type of injury in sports. A great number of athletes have relapsed in muscle injuries not being treated properly. Photobiomodulation therapy is an inexpensive and safe technique with many benefits in muscle injury treatment. However, little has been explored about the infrared laser effects on DNA and telomeres in muscle injuries. Thus, the aim of this study was to evaluate photobiomodulation effects on mRNA relative levels from genes related to telomere and genomic stabilization in injured muscle. Wistar male rats were randomly divided into six groups: control, laser 25 mW, laser 75 mW, injury, injury laser 25 mW, and injury laser 75 mW. Photobiomodulation was performed with 904 nm, 3 J/cm 2 at 25 or 75 mW. Cryoinjury was induced by two applications of a metal probe cooled in liquid nitrogen directly on the tibialis anterior muscle. After euthanasia, skeletal muscle samples were withdrawn and total RNA extracted for evaluation of mRNA levels from genomic (ATM and p53) and chromosome stabilization (TRF1 and TRF2) genes by real-time quantitative polymerization chain reaction. Data show that photobiomodulation reduces the mRNA levels from ATM and p53, as well reduces mRNA levels from TRF1 and TRF2 at 25 and 75 mW in injured skeletal muscle. In conclusion, photobiomodulation alters mRNA relative levels from genes related to genomic and telomere stabilization in injured skeletal muscle.

  7. Region specific regulation of glutamic acid decarboxylase mRNA expression by dopamine neurons in rat brain.

    Science.gov (United States)

    Lindefors, N; Brene, S; Herrera-Marschitz, M; Persson, H

    1989-01-01

    In situ hybridization histochemistry and RNA blots were used to study the expression of glutamic acid decarboxylase (GAD) mRNA in rats with or without a unilateral lesion of midbrain dopamine neurons. Two populations of GAD mRNA positive neurons were found in the intact caudate-putamen, substantia nigra and fronto-parietal cortex. In caudate-putamen, only one out of ten of the GAD mRNA positive neurons expressed high levels, while in substantia nigra every second of the positive neurons expressed high levels of GAD mRNA. Relatively few, but intensively labelled neurons were found in the intact fronto-parietal cerebral cortex. In addition, one out of six of the GAD mRNA positive neurons in the fronto-parietal cortex showed a low labeling. On the ipsilateral side, the forebrain dopamine deafferentation induced an increase in the number of neurons expressing high levels of GAD mRNA in caudate-putamen, and a decrease in fronto-parietal cortex. A smaller decrease was also seen in substantia nigra. However, the total number of GAD mRNA positive neurons were not significantly changed in any of these brain regions. The changes in the levels of GAD mRNA after the dopamine lesion were confirmed by RNA blot analysis. Hence, midbrain dopamine neurons appear to control neuronal expression of GAD mRNA by a tonic down-regulation in a fraction of GAD mRNA positive neurons in caudate-putamen, and a tonic up-regulation in a fraction of GAD mRNA positive neurons in fronto-parietal cortex and substantia nigra.

  8. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  9. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  10. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  11. The development of clinical activity in relapsing-remitting MS is associated with a decrease of FasL mRNA and an increase of Fas mRNA in peripheral blood

    NARCIS (Netherlands)

    Lopatinskaya, L.; Boxel van-Dezaire, A.H.H.; Barkhof, F.; Polman, C.H.; Lucas, C.J.; Nagelkerken, L.

    2003-01-01

    In this longitudinal study, we examined the expression of Fas, FasL, CCR3, CCR5 and CXCR3 mRNA in peripheral blood mononuclear cells (PBMCs) of secondary progressive (SP) and relapsing-remitting (RR) multiple sclerosis (MS) patients. In RR patients, FasL, CCR3 and CCR5 mRNA levels were increased

  12. Icaritin opposes the development of social aversion after defeat stress via increases of GR mRNA and BDNF mRNA in mice.

    Science.gov (United States)

    Wu, Xiao; Wu, Jinfeng; Xia, Shijin; Li, Bei; Dong, Jingcheng

    2013-11-01

    Icariin is a major constituent of flavonoids isolated from Herba Epimedii. Several previous studies have demonstrated the antidepressant-like effects of icariin. After oral administration of icariin, 19 metabolites of icariin were detected in rat plasma. Icaritin is one such of metabolite of icariin. In this study, a chronic social defeat protocol is used as a mouse model for depression, and the effects of icaritin administration on social avoidance are investigated. The data indicates that icaritin (5mg/kg and 10mg/kg) oral administration opposes the development of social aversion after defeat stress. In vitro corticosterone sensitivity assay demonstrated that icaritin partially restored social defeat-induced impairment of glucocorticoid sensitivity. The expressions of GR mRNA and BDNFmRNA in the hippocampus were increased after icaritin treatment. Meanwhile, the social defeat-induced increases in CRH mRNA in hypothalamus were restored by icaritin administration. Our data also suggests that icaritin administration remarkably attenuated the increases in serum IL-6 and TNF-α level that occur following exposure to social defeat. In conclusion, icaritin is a novel antidepressant. It partially restored social defeat-induced impairment of glucocorticoid sensitivity, HPA axis hyperactivity. These effects are at least partially attributed to normalization of the GR function and increases in BDNF expression. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  14. Crimean-Congo Hemorrhagic Fever Virus Nucleocapsid Protein Augments mRNA Translation.

    Science.gov (United States)

    Jeeva, Subbiah; Cheng, Erdong; Ganaie, Safder S; Mir, Mohammad A

    2017-08-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-borne Nairovirus of the Bunyaviridae family, causing severe illness with high mortality rates in humans. Here, we demonstrate that CCHFV nucleocapsid protein (CCHFV-NP) augments mRNA translation. CCHFV-NP binds to the viral mRNA 5' untranslated region (UTR) with high affinity. It facilitates the translation of reporter mRNA both in vivo and in vitro with the assistance of the viral mRNA 5' UTR. CCHFV-NP equally favors the translation of both capped and uncapped mRNAs, demonstrating the independence of this translation strategy on the 5' cap. Unlike the canonical host translation machinery, inhibition of eIF4F complex, an amalgam of three initiation factors, eIF4A, eIF4G, and eIF4E, by the chemical inhibitor 4E1RCat did not impact the CCHFV-NP-mediated translation mechanism. However, the proteolytic degradation of eIF4G alone by the human rhinovirus 2A protease abrogated this translation strategy. Our results demonstrate that eIF4F complex formation is not required but eIF4G plays a critical role in this translation mechanism. Our results suggest that CCHFV has adopted a unique translation mechanism to facilitate the translation of viral mRNAs in the host cell cytoplasm where cellular transcripts are competing for the same translation apparatus. IMPORTANCE Crimean-Congo hemorrhagic fever, a highly contagious viral disease endemic to more than 30 countries, has limited treatment options. Our results demonstrate that NP favors the translation of a reporter mRNA harboring the viral mRNA 5' UTR. It is highly likely that CCHFV uses an NP-mediated translation strategy for the rapid synthesis of viral proteins during the course of infection. Shutdown of this translation mechanism might selectively impact viral protein synthesis, suggesting that an NP-mediated translation strategy is a target for therapeutic intervention against this viral disease. Copyright © 2017 American Society for Microbiology.

  15. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of mRNA

  16. Mucin gene mRNA levels in broilers challenged with eimeria and/or Clostridium perfringens.

    Science.gov (United States)

    Kitessa, Soressa M; Nattrass, Gregory S; Forder, Rebecca E A; McGrice, Hayley A; Wu, Shu-Biao; Hughes, Robert J

    2014-09-01

    The effects of Eimeria (EM) and Clostridium perfringens (CP) challenges on the mRNA levels of genes involved in mucin (Muc) synthesis (Muc2, Muc5ac, Muc13, and trefoil family factor-2 [TFF2]), inflammation (tumor necrosis factor alpha [TNF-alpha] and interleukin-18 [IL-18]), and metabolic processes (cluster of differentiation [CD]36) in the jejunum of broilers were investigated. Two parallel experiments involving 1) EM challenge and 2) EM and CP challenges were conducted. The first experiment was a 2 X 2 study with 12 birds per treatment (N = 48) involving fishmeal substitution (25%) in the diet (FM) and EM challenge. The treatments were: Control (FM-, EM-), Fishmeal (FM+, EM-), EM challenge (FM-, EM+), and fishmeal substitution and EM challenge (FM+, EM+). The second experiment was a 2 X 2 X 2 experiment with six birds per treatment (N = 48) involving fishmeal (FM-, FM+), Eimeria (EM-, EM+), and C perfringens (CP-, CP+). In both arms of the study, male broilers were given a starter diet for the whole period of 16 days, except those assigned to FM+, where 25% of the starter ration was replaced with fishmeal from days 8 to 14. EM inoculation was performed on day 9 and CP inoculation on days 14 and 15. The EM challenge birds were euthanatized for sampling on day 13; postmortem examination and sampling for the Eimeria plus C perfringens challenge arm of the study were on day 16. In the Eimeria challenge arm of the study, fishmeal supplementation significantly suppressed the mRNA levels of TNF-alpha, TFF2, and IL-18 pre-CP inoculation but simultaneously increased the levels of Muc13 and CD36 mRNAs. Birds challenged with Eimeria exhibited increased mRNA levels of Muc13, Muc5ac, TNF-alpha, and IL-18. In the Eimeria and C. perfringens challenge arm, birds exposed to EM challenge exhibited significantly lower mRNA levels of Muc2 and CD36. The mRNA levels of CD36 were also significantly suppressed by CP challenge. Our results showed that the transcription of mucin synthesis

  17. Correlation of mRNA Expression and Signal Variability in Chronic Intracortical Electrodes.

    Science.gov (United States)

    Falcone, Jessica D; Carroll, Sheridan L; Saxena, Tarun; Mandavia, Dev; Clark, Alexus; Yarabarla, Varun; Bellamkonda, Ravi V

    2018-01-01

    The goal for this research was to identify molecular mechanisms that explain animal-to-animal variability in chronic intracortical recordings. Microwire electrodes were implanted into Sprague Dawley rats at an acute (1 week) and a chronic (14 weeks) time point. Weekly recordings were conducted, and action potentials were evoked in the barrel cortex by deflecting the rat's whiskers. At 1 and 14 weeks, tissue was collected, and mRNA was extracted. mRNA expression was compared between 1 and 14 weeks using a high throughput multiplexed qRT-PCR. Pearson correlation coefficients were calculated between mRNA expression and signal-to-noise ratios at 14 weeks. At 14 weeks, a positive correlation between signal-to-noise ratio (SNR) and NeuN and GFAP mRNA expression was observed, indicating a relationship between recording strength and neuronal population, as well as reactive astrocyte activity. The inflammatory state around the electrode interface was evaluated using M1-like and M2-like markers. Expression for both M1-like and M2-like mRNA markers remained steady from 1 to 14 weeks. Anti-inflammatory markers, CD206 and CD163, however, demonstrated a significant positive correlation with SNR quality at 14 weeks. VE-cadherin, a marker for adherens junctions, and PDGFR-β, a marker for pericytes, both partial representatives of blood-brain barrier health, had a positive correlation with SNR at 14 weeks. Endothelial adhesion markers revealed a significant increase in expression at 14 weeks, while CD45, a pan-leukocyte marker, significantly decreased at 14 weeks. No significant correlation was found for either the endothelial adhesion or pan-leukocyte markers. A positive correlation between anti-inflammatory and blood-brain barrier health mRNA markers with electrophysiological efficacy of implanted intracortical electrodes has been demonstrated. These data reveal potential mechanisms for further evaluation to determine potential target mechanisms to improve

  18. Engineering intranasal mRNA vaccines to enhance lymph node trafficking and immune responses.

    Science.gov (United States)

    Li, Man; Li, You; Peng, Ke; Wang, Ying; Gong, Tao; Zhang, Zhirong; He, Qin; Sun, Xun

    2017-12-01

    Intranasal mRNA vaccination provides immediate immune protection against pandemic diseases. Recent studies have shown that diverse forms of polyethyleneimine (PEI) have potent mucosal adjuvant activity, which could significantly facilitate the delivery of intranasal mRNA vaccines. Nevertheless, optimizing the chemical structure of PEI to maximize its adjuvanticity and decrease its toxicity remains a challenge. Here we show that the chemical structure of PEI strongly influences how well nanocomplexes of PEI and mRNA migrate to the lymph nodes and elicit immune responses. Conjugating cyclodextrin (CD) with PEI600 or PEI2k yielded CP (CD-PEI) polymers with different CD/PEI ratios. We analyzed the delivery efficacy of CP600, CP2k, and PEI25k as intranasal mRNA vaccine carriers by evaluating the lymph nodes migration and immune responses. Among these polymers, CP2k/mRNA showed significantly higher in vitro transfection efficiency, stronger abilities to migrate to lymph nodes and stimulate dendritic cells maturation in vivo, which further led to potent humoral and cellular immune responses, and showed lower local and systemic toxicity than PEI25k/mRNA. These results demonstrate the potential of CD-PEI2k/mRNA nanocomplex as a self-adjuvanting vaccine delivery vehicle that traffics to lymph nodes with high efficiency. As we face outbreaks of pandemic diseases such as Zika virus, intranasal mRNA vaccination provides instant massive protection against highly variant viruses. Various polymer-based delivery systems have been successfully applied in intranasal vaccine delivery. However, the influence of molecular structure of the polymeric carriers on the lymph node trafficking and dendritic cell maturation is seldom studied for intranasal vaccination. Therefore, engineering polymer-based vaccine delivery system and elucidating the relationship between molecular structure and the intranasal delivery efficiency are essential for maximizing the immune responses. We hereby

  19. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  20. Rift Valley fever virus NS{sub S} gene expression correlates with a defect in nuclear mRNA export

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Anna Maria; Van Deusen, Nicole M.; Schmaljohn, Connie S., E-mail: Connie.s.schmaljohn.civ@mail.mil

    2015-12-15

    We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NS{sub S} gene, but not the N, G{sub N} or NS{sub M} genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NS{sub S}, confirming that expression of NS{sub S} is likely responsible for this phenomenon. - Highlights: • Rift Valley fever virus (RVFV) infection alters the localization of host mRNA. • mRNA accumulates in the nuclei of RVFV-infected but not mock-infected cells. • NS{sub S} is likely responsible for mRNA relocalization to the nucleus.

  1. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability

    NARCIS (Netherlands)

    Fernandez, J.; Yaman, I.; Mishra, R.; Merrick, W. C.; Snider, M. D.; Lamers, W. H.; Hatzoglou, M.

    2001-01-01

    The cationic amino acid transporter, Cat-1, facilitates the uptake of the essential amino acids arginine and lysine. Amino acid starvation causes accumulation and increased translation of cat-1 mRNA, resulting in a 58-fold increase in protein levels and increased arginine uptake. A bicistronic mRNA

  2. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  3. Inhibition of Xenograft tumor growth by gold nanoparticle-DNA oligonucleotide conjugates-assisted delivery of BAX mRNA.

    Directory of Open Access Journals (Sweden)

    Ji-Hyun Yeom

    Full Text Available Use of non-biological agents for mRNA delivery into living systems in order to induce heterologous expression of functional proteins may provide more advantages than the use of DNA and/or biological vectors for delivery. However, the low efficiency of mRNA delivery into live animals, using non-biological systems, has hampered the use of mRNA as a therapeutic molecule. Here, we show that gold nanoparticle-DNA oligonucleotide (AuNP-DNA conjugates can serve as universal vehicles for more efficient delivery of mRNA into human cells, as well as into xenograft tumors generated in mice. Injections of BAX mRNA loaded on AuNP-DNA conjugates into xenograft tumors resulted in highly efficient mRNA delivery. The delivered mRNA directed the efficient production of biologically functional BAX protein, a pro-apoptotic factor, consequently inhibiting tumor growth. These results demonstrate that mRNA delivery by AuNP-DNA conjugates can serve as a new platform for the development of safe and efficient gene therapy.

  4. Identification and quantification of mRNA for nerve growth factor in histological preparations

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, P A; Rush, R A; Scott, J; Penschow, J; Coghlan, J

    1986-03-14

    Hybridization histochemistry has been used to detect mRNA for nerve growth factor (NGF) in histological preparations of mouse salivary glands and rat iris using a /sup 32/P-labelled cDNA probe and autoradiography. Label was visible over the tubular cells of the male mouse submaxillary gland but not the sublingual gland. A much lower label density was found over the tubular cells of the female submaxillary gland, whereas sections of liver and pancreas were negative. Quantitative autoradiography allowed the detection of low levels of mRNA for NGF in the rat iris which was elevated by prior culture of the tissue. The results provide direct histological evidence for the presence of specific NGF-mRNA in the mouse submaxillary gland and rat iris, with increased levels following culture. 15 refs.

  5. Tentative mapping of transcription-induced interchromosomal interaction using chimeric EST and mRNA data.

    Directory of Open Access Journals (Sweden)

    Per Unneberg

    Full Text Available Recent studies on chromosome conformation show that chromosomes colocalize in the nucleus, bringing together active genes in transcription factories. This spatial proximity of actively transcribing genes could provide a means for RNA interaction at the transcript level. We have screened public databases for chimeric EST and mRNA sequences with the intent of mapping transcription-induced interchromosomal interactions. We suggest that chimeric transcripts may be the result of close encounters of active genes, either as functional products or "noise" in the transcription process, and that they could be used as probes for chromosome interactions. We have found a total of 5,614 chimeric ESTs and 587 chimeric mRNAs that meet our selection criteria. Due to their higher quality, the mRNA findings are of particular interest and we hope that they may serve as food for thought for specialists in diverse areas of molecular biology.

  6. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  7. Predictive biophysical modeling and understanding of the dynamics of mRNA translation and its evolution

    Science.gov (United States)

    Zur, Hadas; Tuller, Tamir

    2016-01-01

    mRNA translation is the fundamental process of decoding the information encoded in mRNA molecules by the ribosome for the synthesis of proteins. The centrality of this process in various biomedical disciplines such as cell biology, evolution and biotechnology, encouraged the development of dozens of mathematical and computational models of translation in recent years. These models aimed at capturing various biophysical aspects of the process. The objective of this review is to survey these models, focusing on those based and/or validated on real large-scale genomic data. We consider aspects such as the complexity of the models, the biophysical aspects they regard and the predictions they may provide. Furthermore, we survey the central systems biology discoveries reported on their basis. This review demonstrates the fundamental advantages of employing computational biophysical translation models in general, and discusses the relative advantages of the different approaches and the challenges in the field. PMID:27591251

  8. Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns

    DEFF Research Database (Denmark)

    Weischenfeldt, Joachim Lütken; Waage, Johannes Eichler; Tian, Geng

    2012-01-01

    ABSTRACT: BACKGROUND: Nonsense-mediated mRNA decay (NMD) affects the outcome of alternative splicing by degrading mRNA isoforms with premature termination codons. Splicing regulators constitute important NMD targets; however, the extent to which loss of NMD causes extensive deregulation...... of alternative splicing has not previously been assayed in a global, unbiased manner. Here, we combine mouse genetics and RNA-seq to provide the first in vivo analysis of the global impact of NMD on splicing patterns in two primary mouse tissues ablated for the NMD factor UPF2. RESULTS: We developed...... importance, the latter events are associated with high intronic conservation. CONCLUSIONS: Our data demonstrate that NMD regulates alternative splicing outcomes through an intricate web of splicing regulators and that its loss leads to the deregulation of a panoply of splicing events, providing novel...

  9. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  10. High ALK mRNA expression has a negative prognostic significance in rhabdomyosarcoma

    OpenAIRE

    Bonvini, P; Zin, A; Alaggio, R; Pawel, B; Bisogno, G; Rosolen, A

    2013-01-01

    Background: Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase aberrantly expressed in cancer, but its clinical and functional importance remain controversial. Mutation or amplification of ALK, as well as its expression levels assessed by conventional immunohistochemistry methods, has been linked to prognosis in cancer, although with potential bias because of the semi-quantitative approaches. Herein, we measured ALK mRNA expression in rhabdomyosarcoma (RMS) and determined its clin...

  11. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

    Science.gov (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  12. UCP2 mRNA expression is dependent on glucose metabolism in pancreatic islets

    DEFF Research Database (Denmark)

    Dalgaard, Louise Torp

    2012-01-01

    Uncoupling Protein 2 (UCP2) is expressed in the pancreatic β-cell, where it partially uncouples the mitochondrial proton gradient, decreasing both ATP-production and glucose-stimulated insulin secretion (GSIS). Increased glucose levels up-regulate UCP2 mRNA and protein levels, but the mechanism f...... down-regulation of UCP2 is involved in preserving the insulin secretory capacity of GK mutant mice and might also be implicated in limiting disease progression in MODY2 patients....

  13. Axonal Transport of TDP-43 mRNA Granules Is Impaired by ALS-Causing Mutations

    OpenAIRE

    Alami, Nael H.; Smith, Rebecca B.; Carrasco, Monica A.; Williams, Luis A.; Winborn, Christina S.; Han, Steve S.W.; Kiskinis, Evangelos; Winborn, Brett; Freibaum, Brian D.; Kanagaraj, Anderson; Clare, Alison J.; Badders, Nisha M.; Bilican, Bilada; Chaum, Edward; Chandran, Siddharthan

    2014-01-01

    The RNA binding protein TDP-43 regulates RNA metabolism at multiple levels, including transcription, RNA splicing, and mRNA stability. TDP-43 is a major component of the cytoplasmic inclusions characteristic of amyotrophic lateral sclerosis and some types of frontotemporal lobar degeneration. The importance of TDP-43 in disease is underscored by the fact that dominant missense mutations are sufficient to cause disease, although the role of TDP-43 in pathogenesis is unknown. ...

  14. Tumor necrosis factor-alpha regulates the Hypocretin system via mRNA degradation and ubiquitination.

    Science.gov (United States)

    Zhan, Shuqin; Cai, Guo-Qiang; Zheng, Anni; Wang, Yuping; Jia, Jianping; Fang, Haotian; Yang, Youfeng; Hu, Meng; Ding, Qiang

    2011-04-01

    Recent studies recognize that Hypocretin system (also known as Orexin) plays a critical role in sleep/wake disorders and feeding behaviors. However, little is known about the regulation of the Hypocretin system. It is also known that tumor necrosis factor alpha (TNF-α) is involved in the regulation of sleep/wake cycle. Here, we test our hypothesis that the Hypocretin system is regulated by TNF-α. Prepro-Hypocretin and Hypocretin receptor 2 (HcrtR2) can be detected at a very low level in rat B35 neuroblastoma cells. In response to TNF-α, Prepro-Hypocretin mRNA and protein levels are down-regulated, and also HcrtR2 protein level is down-regulated in B35 cells. To investigate the mechanism, exogenous rat Prepro-Hypocretin and rat HcrtR2 were overexpressed in B35 cells. In response to TNF-α, protein and mRNA of Prepro-Hypocretin are significantly decreased (by 93% and 94%, respectively), and the half-life of Prepro-Hypocretin mRNA is decreased in a time- and dose-dependent manner. The level of HcrtR2 mRNA level is not affected by TNF-α treatment; however, HcrtR2 protein level is significantly decreased (by 86%) through ubiquitination in B35 cells treated with TNF-α. Downregulation of cellular inhibitor of apoptosis protein-1 and -2 (cIAP-1 and -2) abrogates the HcrtR2 ubiquitination induced by TNF-α. The control green fluorescent protein (GFP) expression is not affected by TNF-α treatment. These studies demonstrate that TNF-α can impair the function of the Hypocretin system by reducing the levels of both Prepro-Hypocretin and HcrtR2. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Simultaneous detection of mRNA and protein stem cell markers in live cells

    Directory of Open Access Journals (Sweden)

    Bao Gang

    2009-04-01

    Full Text Available Abstract Background Biological studies and medical application of stem cells often require the isolation of stem cells from a mixed cell population, including the detection of cancer stem cells in tumor tissue, and isolation of induced pluripotent stem cells after eliciting the expression of specific genes in adult cells. Here we report the detection of Oct-4 mRNA and SSEA-1 protein in live carcinoma stem cells using respectively molecular beacon and dye-labeled antibody, aiming to establish a new method for stem cells detection and isolation. Results Quantification of Oct-4 mRNA and protein in P19 mouse carcinoma stem cells using respectively RT-PCR and immunocytochemistry confirmed that their levels drastically decreased after differentiation. To visualize Oct-4 mRNA in live stem cells, molecular beacons were designed, synthesized and validated, and the detection specificity was confirmed using control studies. We found that the fluorescence signal from Oct-4-targeting molecular beacons provides a clear discrimination between undifferentiated and retinoic acid-induced differentiated cells. Using deconvolution fluorescence microscopy, Oct-4 mRNAs were found to reside on one side of the cytosol. We demonstrated that, using a combination of Oct-4 mRNA-targeting molecular beacon with SSEA-1 antibody in flow cytometric analysis, undifferentiated stem cells can be clearly distinguished from differentiated cells. We revealed that Oct-4 targeting molecular beacons do not seem to affect stem cell biology. Conclusion Molecular beacons have the potential to provide a powerful tool for highly specific detection and isolation of stem cells, including cancer stem cells and induced pluripotent stem (iPS cells without disturbing cell physiology. It is advantageous to perform simultaneous detection of intracellular (mRNA and cell-surface (protein stem cell markers in flow cytometric analysis, which may lead to high detection sensitivity and efficiency.

  16. Local IGFBP-3 mRNA expression, apoptosis and risk of colorectal adenomas

    Directory of Open Access Journals (Sweden)

    Omofoye Oluwaseun

    2008-05-01

    Full Text Available Abstract Background IGF binding protein-3 (IGFBP-3 regulates the bioavailability of insulin-like growth factors I and II, and has both anti-proliferative and pro-apoptotic properties. Elevated plasma IGFBP-3 has been associated with reduced risk of colorectal cancer (CRC, but the role of tissue IGFBP-3 is not well defined. We evaluated the association between tissue or plasma IGFBP-3 and risk of colorectal adenomas or low apoptosis. Methods Subjects were consenting patients who underwent a clinically indicated colonoscopy at UNC Hospitals and provided information on diet and lifestyle. IGFBP-3 mRNA in normal colon was assessed by real time RT-PCR. Plasma IGFBP-3 was measured by ELISA and apoptosis was determined by morphology on H & E slides. Logistic regression was used to compute odds ratio (OR and 95% confidence intervals. Results We observed a modest correlation between plasma IGFBP-3 and tissue IGFBP-3 expression (p = 0.007. There was no significant association between plasma IGFBP-3 and adenomas or apoptosis. Tissue IGFBP-3 mRNA expression was significantly lower in cases than controls. Subjects in the lowest three quartiles of tissue IGFBP-3 gene expression were more likely to have adenomas. Consistent with previous reports, low apoptosis was significantly associated with increased risk of adenomas (p = 0.003. Surprisingly, local IGFBP-3 mRNA expression was inversely associated with apoptosis. Conclusion Low expression of IGFBP-3 mRNA in normal colonic mucosa predicts increased risk of adenomas. Our findings suggest that local IGFBP-3 in the colon may directly increase adenoma risk but IGFBP-3 may act through a pathway other than apoptosis to influence adenoma risk.

  17. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    OpenAIRE

    Jones, Sophie; Sutherland, Colin J.; Hermsen, Cornelus; Arens, Theo; Teelen, Karina; Hallett, Rachel; Corran, Patrick; van der Vegte-Bolmer, Marga; Sauerwein, Robert; Drakeley, Chris J.; Bousema, Teun

    2012-01-01

    Abstract Background Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Methods Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL ...

  18. Genetic Modification of Human Pancreatic Progenitor Cells Through Modified mRNA.

    Science.gov (United States)

    Lu, Song; Chow, Christie C; Zhou, Junwei; Leung, Po Sing; Tsui, Stephen K; Lui, Kathy O

    2016-01-01

    In this chapter, we describe a highly efficient genetic modification strategy for human pancreatic progenitor cells using modified mRNA-encoding GFP and Neurogenin-3. The properties of modified mRNA offer an invaluable platform to drive protein expression, which has broad applicability in pathway regulation, directed differentiation, and lineage specification. This approach can also be used to regulate expression of other pivotal transcription factors during pancreas development and might have potential therapeutic values in regenerative medicine.

  19. Assessment of flhDC mRNA levels in Serratia liquefaciens swarm cells

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim; Christensen, Allan Beck; Holmstrøm, K.

    2000-01-01

    We reported previously that artificial overexpression of the flhDC operon in liquid-grown Serratia liquefaciens resulted in the formation of filamentous, multinucleated, and hyperflagellated cells that were indistinguishable from surface-induced swarm cells (L. Eberl, G. Christiansen, S. Molin, a......, vegetative cells. This suggests that surface-induced S. liquefaciens swarm cell differentiation, although dependent on flhDC gene expression, does not occur through elevated flhDC mRNA levels....

  20. BAY11 enhances OCT4 synthetic mRNA expression in adult human skin cells.

    Science.gov (United States)

    Awe, Jason P; Crespo, Agustin Vega; Li, You; Kiledjian, Megerditch; Byrne, James A

    2013-02-06

    The OCT4 transcription factor is involved in many cellular processes, including development, reprogramming, maintaining pluripotency and differentiation. Synthetic OCT4 mRNA was recently used (in conjunction with other reprogramming factors) to generate human induced pluripotent stem cells. Here, we discovered that BAY 11-7082 (BAY11), at least partially through an NF-κB-inhibition based mechanism, could significantly increase the expression of OCT4 following transfection of synthetic mRNA (synRNA) into adult human skin cells. We tested various chemical and molecular small molecules on their ability to suppress the innate immune response seen upon synthetic mRNA transfection. Three molecules - B18R, BX795, and BAY11 - were used in immunocytochemical and proliferation-based assays. We also utilized global transcriptional meta-analysis coupled with quantitative PCR to identify relative gene expression downstream of OCT4. We found that human skin cells cultured in the presence of BAY11 resulted in reproducible increased expression of OCT4 that did not inhibit normal cell proliferation. The increased levels of OCT4 resulted in significantly increased expression of genes downstream of OCT4, including the previously identified SPP1, DUSP4 and GADD45G, suggesting the expressed OCT4 was functional. We also discovered a novel OCT4 putative downstream target gene SLC16A9 which demonstrated significantly increased expression following elevation of OCT4 levels. For the first time we have shown that small molecule-based stabilization of synthetic mRNA expression can be achieved with use of BAY11. This small molecule-based inhibition of innate immune responses and subsequent robust expression of transfected synthetic mRNAs may have multiple applications for future cell-based research and therapeutics.

  1. Connecting protein and mRNA burst distributions for stochastic models of gene expression

    International Nuclear Information System (INIS)

    Elgart, Vlad; Jia, Tao; Fenley, Andrew T; Kulkarni, Rahul

    2011-01-01

    The intrinsic stochasticity of gene expression can lead to large variability in protein levels for genetically identical cells. Such variability in protein levels can arise from infrequent synthesis of mRNAs which in turn give rise to bursts of protein expression. Protein expression occurring in bursts has indeed been observed experimentally and recent studies have also found evidence for transcriptional bursting, i.e. production of mRNAs in bursts. Given that there are distinct experimental techniques for quantifying the noise at different stages of gene expression, it is of interest to derive analytical results connecting experimental observations at different levels. In this work, we consider stochastic models of gene expression for which mRNA and protein production occurs in independent bursts. For such models, we derive analytical expressions connecting protein and mRNA burst distributions which show how the functional form of the mRNA burst distribution can be inferred from the protein burst distribution. Additionally, if gene expression is repressed such that observed protein bursts arise only from single mRNAs, we show how observations of protein burst distributions (repressed and unrepressed) can be used to completely determine the mRNA burst distribution. Assuming independent contributions from individual bursts, we derive analytical expressions connecting means and variances for burst and steady-state protein distributions. Finally, we validate our general analytical results by considering a specific reaction scheme involving regulation of protein bursts by small RNAs. For a range of parameters, we derive analytical expressions for regulated protein distributions that are validated using stochastic simulations. The analytical results obtained in this work can thus serve as useful inputs for a broad range of studies focusing on stochasticity in gene expression

  2. Radiation-induced alternative transcripts as detected in total and polysome-bound mRNA.

    Science.gov (United States)

    Wahba, Amy; Ryan, Michael C; Shankavaram, Uma T; Camphausen, Kevin; Tofilon, Philip J

    2018-01-02

    Alternative splicing is a critical event in the posttranscriptional regulation of gene expression. To investigate whether this process influences radiation-induced gene expression we defined the effects of ionizing radiation on the generation of alternative transcripts in total cellular mRNA (the transcriptome) and polysome-bound mRNA (the translatome) of the human glioblastoma stem-like cell line NSC11. For these studies, RNA-Seq profiles from control and irradiated cells were compared using the program SpliceSeq to identify transcripts and splice variations induced by radiation. As compared to the transcriptome (total RNA) of untreated cells, the radiation-induced transcriptome contained 92 splice events suggesting that radiation induced alternative splicing. As compared to the translatome (polysome-bound RNA) of untreated cells, the radiation-induced translatome contained 280 splice events of which only 24 were overlapping with the radiation-induced transcriptome. These results suggest that radiation not only modifies alternative splicing of precursor mRNA, but also results in the selective association of existing mRNA isoforms with polysomes. Comparison of radiation-induced alternative transcripts to radiation-induced gene expression in total RNA revealed little overlap (about 3%). In contrast, in the radiation-induced translatome, about 38% of the induced alternative transcripts corresponded to genes whose expression level was affected in the translatome. This study suggests that whereas radiation induces alternate splicing, the alternative transcripts present at the time of irradiation may play a role in the radiation-induced translational control of gene expression and thus cellular radioresponse.

  3. ZmbZIP60 mRNA is spliced in maize in response to ER stress

    Directory of Open Access Journals (Sweden)

    Li Yanjie

    2012-03-01

    Full Text Available Abstract Background Adverse environmental conditions produce ER stress and elicit the unfolded protein response (UPR in plants. Plants are reported to have two "arms" of the ER stress signaling pathway-one arm involving membrane-bound transcription factors and the other involving a membrane-associated RNA splicing factor, IRE1. IRE1 in yeast to mammals recognizes a conserved twin loop structure in the target RNA. Results A segment of the mRNA encoding ZmbZIP60 in maize can be folded into a twin loop structure, and in response to ER stress this mRNA is spliced, excising a 20b intron. Splicing converts the predicted protein from a membrane-associated transcription factor to one that is targeted to the nucleus. Splicing of ZmbZIP60 can be elicited in maize seedlings by ER stress agents such as dithiothreitol (DTT or tunicamycin (TM or by heat treatment. Younger, rather than older seedlings display a more robust splicing response as do younger parts of leaf, along a developmental gradient in a leaf. The molecular signature of an ER stress response in plants includes the upregulation of Binding Protein (BIP genes. Maize has numerous BIP-like genes, and ER stress was found to upregulate one of these, ZmBIPb. Conclusions The splicing of ZmbZIP60 mRNA is an indicator of ER stress in maize seedlings resulting from adverse environmental conditions such as heat stress. ZmbZIP60 mRNA splicing in maize leads predictively to the formation of active bZIP transcription factor targeted to the nucleus to upregulate stress response genes. Among the genes upregulated by ER stress in maize is one of 22 BIP-like genes, ZmBIPb.

  4. Combining miRNA and mRNA Expression Profiles in Wilms Tumor Subtypes

    Directory of Open Access Journals (Sweden)

    Nicole Ludwig

    2016-03-01

    Full Text Available Wilms tumor (WT is the most common childhood renal cancer. Recent findings of mutations in microRNA (miRNA processing proteins suggest a pivotal role of miRNAs in WT genesis. We performed miRNA expression profiling of 36 WTs of different subtypes and four normal kidney tissues using microarrays. Additionally, we determined the gene expression profile of 28 of these tumors to identify potentially correlated target genes and affected pathways. We identified 85 miRNAs and 2107 messenger RNAs (mRNA differentially expressed in blastemal WT, and 266 miRNAs and 1267 mRNAs differentially expressed in regressive subtype. The hierarchical clustering of the samples, using either the miRNA or mRNA profile, showed the clear separation of WT from normal kidney samples, but the miRNA pattern yielded better separation of WT subtypes. A correlation analysis of the deregulated miRNA and mRNAs identified 13,026 miRNA/mRNA pairs with inversely correlated expression, of which 2844 are potential interactions of miRNA and their predicted mRNA targets. We found significant upregulation of miRNAs-183, -301a/b and -335 for the blastemal subtype, and miRNAs-181b, -223 and -630 for the regressive subtype. We found marked deregulation of miRNAs regulating epithelial to mesenchymal transition, especially in the blastemal subtype, and miRNAs influencing chemosensitivity, especially in regressive subtypes. Further research is needed to assess the influence of preoperative chemotherapy and tumor infiltrating lymphocytes on the miRNA and mRNA patterns in WT.

  5. Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.

    Science.gov (United States)

    Beverly, Michael; Hagen, Caitlin; Slack, Olga

    2018-02-01

    The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.

  6. Conceptual modeling in systems biology fosters empirical findings: the mRNA lifecycle.

    Directory of Open Access Journals (Sweden)

    Dov Dori

    Full Text Available One of the main obstacles to understanding complex biological systems is the extent and rapid evolution of information, way beyond the capacity individuals to manage and comprehend. Current modeling approaches and tools lack adequate capacity to model concurrently structure and behavior of biological systems. Here we propose Object-Process Methodology (OPM, a holistic conceptual modeling paradigm, as a means to model both diagrammatically and textually biological systems formally and intuitively at any desired number of levels of detail. OPM combines objects, e.g., proteins, and processes, e.g., transcription, in a way that is simple and easily comprehensible to researchers and scholars. As a case in point, we modeled the yeast mRNA lifecycle. The mRNA lifecycle involves mRNA synthesis in the nucleus, mRNA transport to the cytoplasm, and its subsequent translation and degradation therein. Recent studies have identified specific cytoplasmic foci, termed processing bodies that contain large complexes of mRNAs and decay factors. Our OPM model of this cellular subsystem, presented here, led to the discovery of a new constituent of these complexes, the translation termination factor eRF3. Association of eRF3 with processing bodies is observed after a long-term starvation period. We suggest that OPM can eventually serve as a comprehensive evolvable model of the entire living cell system. The model would serve as a research and communication platform, highlighting unknown and uncertain aspects that can be addressed empirically and updated consequently while maintaining consistency.

  7. Effect of physical training on glucose transporter protein and mRNA levels in rat adipocytes

    DEFF Research Database (Denmark)

    Stallknecht, B; Andersen, P H; Vinten, J

    1993-01-01

    Physical training increases insulin-stimulated glucose transport and the number of glucose transporters in adipocytes measured by cytochalasin B binding. In the present study we used immunoblotting to measure the abundance of two glucose transporters (GLUT-4, GLUT-1) in white adipocytes from....../or intrinsic activity). GLUT-1 protein and mRNA levels/adipocyte volume did not change with age or training....

  8. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes.

    Science.gov (United States)

    Jones, Sophie; Sutherland, Colin J; Hermsen, Cornelus; Arens, Theo; Teelen, Karina; Hallett, Rachel; Corran, Patrick; van der Vegte-Bolmer, Marga; Sauerwein, Robert; Drakeley, Chris J; Bousema, Teun

    2012-08-08

    Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA) and reverse-transcriptase PCR (RT-PCR). Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (pFTA Classic Card but not the 903 Protein Saver Card or Whatman 3MM filter paper. The sensitivity of gametocyte detection was decreased when papers were stored at high humidity. This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.

  9. Local IGFBP-3 mRNA expression, apoptosis and risk of colorectal adenomas

    International Nuclear Information System (INIS)

    Keku, Temitope O; Sandler, Robert S; Simmons, James G; Galanko, Joseph; Woosley, John T; Proffitt, Michelle; Omofoye, Oluwaseun; McDoom, Maya; Lund, Pauline K

    2008-01-01

    IGF binding protein-3 (IGFBP-3) regulates the bioavailability of insulin-like growth factors I and II, and has both anti-proliferative and pro-apoptotic properties. Elevated plasma IGFBP-3 has been associated with reduced risk of colorectal cancer (CRC), but the role of tissue IGFBP-3 is not well defined. We evaluated the association between tissue or plasma IGFBP-3 and risk of colorectal adenomas or low apoptosis. Subjects were consenting patients who underwent a clinically indicated colonoscopy at UNC Hospitals and provided information on diet and lifestyle. IGFBP-3 mRNA in normal colon was assessed by real time RT-PCR. Plasma IGFBP-3 was measured by ELISA and apoptosis was determined by morphology on H & E slides. Logistic regression was used to compute odds ratio (OR) and 95% confidence intervals. We observed a modest correlation between plasma IGFBP-3 and tissue IGFBP-3 expression (p = 0.007). There was no significant association between plasma IGFBP-3 and adenomas or apoptosis. Tissue IGFBP-3 mRNA expression was significantly lower in cases than controls. Subjects in the lowest three quartiles of tissue IGFBP-3 gene expression were more likely to have adenomas. Consistent with previous reports, low apoptosis was significantly associated with increased risk of adenomas (p = 0.003). Surprisingly, local IGFBP-3 mRNA expression was inversely associated with apoptosis. Low expression of IGFBP-3 mRNA in normal colonic mucosa predicts increased risk of adenomas. Our findings suggest that local IGFBP-3 in the colon may directly increase adenoma risk but IGFBP-3 may act through a pathway other than apoptosis to influence adenoma risk

  10. Inner nuclear envelope protein SUN1 plays a prominent role in mammalian mRNA export.

    Science.gov (United States)

    Li, Ping; Noegel, Angelika A

    2015-11-16

    Nuclear export of messenger ribonucleoproteins (mRNPs) through the nuclear pore complex (NPC) can be roughly classified into two forms: bulk and specific export, involving an nuclear RNA export factor 1 (NXF1)-dependent pathway and chromosome region maintenance 1 (CRM1)-dependent pathway, respectively. SUN proteins constitute the inner nuclear envelope component of the l I: nker of N: ucleoskeleton and C: ytoskeleton (LINC) complex. Here, we show that mammalian cells require SUN1 for efficient nuclear mRNP export. The results indicate that both SUN1 and SUN2 interact with heterogeneous nuclear ribonucleoprotein (hnRNP) F/H and hnRNP K/J. SUN1 depletion inhibits the mRNP export, with accumulations of both hnRNPs and poly(A)+RNA in the nucleus. Leptomycin B treatment indicates that SUN1 functions in mammalian mRNA export involving the NXF1-dependent pathway. SUN1 mediates mRNA export through its association with mRNP complexes via a direct interaction with NXF1. Additionally, SUN1 associates with the NPC through a direct interaction with Nup153, a nuclear pore component involved in mRNA export. Taken together, our results reveal that the inner nuclear envelope protein SUN1 has additional functions aside from being a central component of the LINC complex and that it is an integral component of the mammalian mRNA export pathway suggesting a model whereby SUN1 recruits NXF1-containing mRNP onto the nuclear envelope and hands it over to Nup153. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Cellular localization of transforming growth factor-alpha mRNA in rat forebrain.

    Science.gov (United States)

    Seroogy, K B; Lundgren, K H; Lee, D C; Guthrie, K M; Gall, C M

    1993-05-01

    The cellular localization of transforming growth factor-alpha (TGF alpha) mRNA in juvenile and adult rat forebrain was examined using in situ hybridization with a 35S-labeled cRNA probe. TGF alpha cRNA-labeled neuronal perikarya were distributed across many forebrain regions including the olfactory bulb, caudate-putamen, nucleus accumbens, olfactory tubercle, ventral pallidum, amygdala, hippocampal stratum granulosum and CA3 stratum pyramidale, and piriform, entorhinal, and retrosplenial cortices. TGF alpha cRNA-hybridizing cells were also localized to several thalamic nuclei and to the suprachiasmatic, dorsomedial, and ventromedial nuclei of the hypothalamus. In addition, labeled cells were present in regions of white matter including the corpus callosum, anterior commissure, internal and external capsules, optic tract, and lateral olfactory tract. Thus, both neurons and glia appear to synthesize TGF alpha in normal brain. Hybridization densities were greater in neuronal fields at 2 weeks of age compared with the adult, suggesting a role for TGF alpha in the development of several forebrain systems. Our results demonstrating the prominent and wide-spread expression of TGF alpha mRNA in forebrain, combined with the extremely low abundance of epidermal growth factor mRNA in brain, support the argument that TGF alpha is the principal endogenous ligand for the epidermal growth factor receptor in normal brain.

  12. Reprogramming the Dynamin 2 mRNA by Spliceosome-mediated RNA Trans-splicing

    Directory of Open Access Journals (Sweden)

    Delphine Trochet

    2016-01-01

    Full Text Available Dynamin 2 (DNM2 is a large GTPase, ubiquitously expressed, involved in membrane trafficking and regulation of actin and microtubule cytoskeletons. DNM2 mutations cause autosomal dominant centronuclear myopathy which is a rare congenital myopathy characterized by skeletal muscle weakness and histopathological features including nuclear centralization in absence of regeneration. No curative treatment is currently available for the DNM2-related autosomal dominant centronuclear myopathy. In order to develop therapeutic strategy, we evaluated here the potential of Spliceosome-Mediated RNA Trans-splicing technology to reprogram the Dnm2-mRNA in vitro and in vivo in mice. We show that classical 3′-trans-splicing strategy cannot be considered as accurate therapeutic strategy regarding toxicity of the pre-trans-splicing molecules leading to low rate of trans-splicing in vivo. Thus, we tested alternative strategies devoted to prevent this toxicity and enhance frequency of trans-splicing events. We succeeded to overcome the toxicity through a 5′-trans-splicing strategy which also allows detection of trans-splicing events at mRNA and protein levels in vitro and in vivo. These results suggest that the Spliceosome-Mediated RNA Trans-splicing strategy may be used to reprogram mutated Dnm2-mRNA but highlight the potential toxicity linked to the molecular tools which have to be carefully investigated during preclinical development.

  13. Localization of glucocorticoid receptor mRNA in the male rat brain by in situ hybridization

    International Nuclear Information System (INIS)

    Aronsson, M.; Fuxe, K.; Dong, Y.; Agnati, L.F.; Okret, S.; Gustafsson, J.A.

    1988-01-01

    The localization and distribution of mRNA encoding the glucocorticoid receptor (GR) was investigated in tissue sections of the adult male rat brain by in situ hybridization and RNA blot analysis. GR mRNA levels were measured by quantitative autoradiography with 35S- and 32P-labeled RNA probes, respectively. Strong labeling was observed within the pyramidal nerve cells of the CA1 and CA2 areas of the hippocampal formation, in the granular cells of the dentate gyrus, in the parvocellular nerve cells of the paraventricular hypothalamic nucleus, and in the cells of the arcuate nucleus, especially the parvocellular part. Moderate labeling of a large number of nerve cells was observed within layers II, III, and VI of the neocortex and in many thalamic nuclei, especially the anterior and ventral nuclear groups as well as several midline nuclei. Within the cerebellar cortex, strong labeling was observed all over the granular layer. In the lower brainstem, strong labeling was found within the entire locus coeruleus and within the mesencephalic raphe nuclei rich in noradrenaline and 5-hydroxytryptamine cell bodies, respectively. A close correlation was found between the distribution of GR mRNA and the distribution of previously described GR immunoreactivity. These studies open the possibility of obtaining additional information on in vivo regulation of GR synthesis and how the brain may alter its sensitivity to circulating glucocorticoids

  14. Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Norrild, Bodil

    2011-01-01

    Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...

  15. Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

    Science.gov (United States)

    Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

    The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  16. Aging alters mRNA expression of amyloid transporter genes at the blood-brain barrier.

    Science.gov (United States)

    Osgood, Doreen; Miller, Miles C; Messier, Arthur A; Gonzalez, Liliana; Silverberg, Gerald D

    2017-09-01

    Decreased clearance of potentially toxic metabolites, due to aging changes, likely plays a significant role in the accumulation of amyloid-beta (Aβ) peptides and other macromolecules in the brain of the elderly and in the patients with Alzheimer's disease (AD). Aging is the single most important risk factor for AD development. Aβ transport receptor proteins expressed at the blood-brain barrier are significantly altered with age: the efflux transporters lipoprotein receptor-related protein 1 and P-glycoprotein are reduced, whereas the influx transporter receptor for advanced glycation end products is increased. These receptors play an important role in maintaining brain biochemical homeostasis. We now report that, in a rat model of aging, gene transcription is altered in aging, as measured by Aβ receptor gene messenger RNA (mRNA) at 3, 6, 9, 12, 15, 20, 30, and 36 months. Gene mRNA expression from isolated cerebral microvessels was measured by quantitative polymerase chain reaction. Lipoprotein receptor-related protein 1 and P-glycoprotein mRNA were significantly reduced in aging, and receptor for advanced glycation end products was increased, in parallel with the changes seen in receptor protein expression. Transcriptional changes appear to play a role in aging alterations in blood-brain barrier receptor expression and Aβ accumulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. New potential markers of in vitro tomato morphogenesis identified by mRNA differential display.

    Science.gov (United States)

    Torelli, A; Soragni, E; Bolchi, A; Petrucco, S; Ottonello, S; Branca, C

    1996-12-01

    The identification of plant genes involved in early phases of in vitro morphogenesis can not only contribute to our understanding of the processes underlying growth regulator-controlled determination, but also provide novel markers for evaluating the outcome of in vitro regeneration experiments. To search for such genes and to monitor changes in gene expression accompanying in vitro regeneration, we have adapted the mRNA differential display technique to the comparative analysis of a model system of tomato cotyledons that can be driven selectively toward either shoot or callus formation by means of previously determined growth regulator supplementations. Hormone-independent transcriptional modulation (mainly down-regulation) has been found to be the most common event, indicating that a non-specific reprogramming of gene expression quantitatively predominates during the early phases of in vitro culture. However, cDNA fragments representative of genes that are either down-regulated or induced in a programme-specific manner could also be identified, and two of them (G35, G36) were further characterized. One of these cDNA fragments, G35, corresponds to an mRNA that is down-regulated much earlier in callus- (day 2) than in shoot-determined explants (day 6). The other, G36, identifies an mRNA that is transiently expressed in shoot-determined explants only, well before any macroscopic signs of differentiation become apparent, and thus exhibits typical features of a morphogenetic marker.

  18. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

    Science.gov (United States)

    Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

    2015-01-29

    Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Urinary mRNA for the Diagnosis of Renal Allograft Rejection: The Issue of Normalization.

    Science.gov (United States)

    Galichon, P; Amrouche, L; Hertig, A; Brocheriou, I; Rabant, M; Xu-Dubois, Y-C; Ouali, N; Dahan, K; Morin, L; Terzi, F; Rondeau, E; Anglicheau, D

    2016-10-01

    Urinary messenger RNA (mRNA) quantification is a promising method for noninvasive diagnosis of renal allograft rejection (AR), but the quantification of mRNAs in urine remains challenging due to degradation. RNA normalization may be warranted to overcome these issues, but the strategies of gene normalization have been poorly evaluated. Herein, we address this issue in a case-control study of 108 urine samples collected at time of allograft biopsy in kidney recipients with (n = 52) or without (n = 56) AR by comparing the diagnostic value of IP-10 and CD3ε mRNAs-two biomarkers of AR-after normalization by the total amount of RNA, normalization by one of the three widely used reference RNAs-18S, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Hypoxanthine-guanine phosphoribosyltransferase (HPRT)-or normalization using uroplakin 1A (UPK) mRNA as a possible urine-specific reference mRNA. Our results show that normalization based on the total quantity of RNA is not substantially improved by additional normalization and may even be worsened with some classical reference genes that are overexpressed during rejection. However, considering that normalization by a reference gene is necessary to ensure polymerase chain reaction (PCR) quality and reproducibility and to suppress the effect of RNA degradation, we suggest that GAPDH and UPK1A are preferable to 18S or HPRT RNA. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  20. Chromatoid Body Protein TDRD6 Supports Long 3' UTR Triggered Nonsense Mediated mRNA Decay.

    Directory of Open Access Journals (Sweden)

    Grigorios Fanourgakis

    2016-05-01

    Full Text Available Chromatoid bodies (CBs are spermiogenesis-specific organelles of largely unknown function. CBs harbor various RNA species, RNA-associated proteins and proteins of the tudor domain family like TDRD6, which is required for a proper CB architecture. Proteome analysis of purified CBs revealed components of the nonsense-mediated mRNA decay (NMD machinery including UPF1. TDRD6 is essential for UPF1 localization to CBs, for UPF1-UPF2 and UPF1-MVH interactions. Upon removal of TDRD6, the association of several mRNAs with UPF1 and UPF2 is disturbed, and the long 3' UTR-stimulated but not the downstream exon-exon junction triggered pathway of NMD is impaired. Reduced association of the long 3' UTR mRNAs with UPF1 and UPF2 correlates with increased stability and enhanced translational activity. Thus, we identified TDRD6 within CBs as required for mRNA degradation, specifically the extended 3' UTR-triggered NMD pathway, and provide evidence for the requirement of NMD in spermiogenesis. This function depends on TDRD6-promoted assembly of mRNA and decay enzymes in CBs.

  1. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M

    2001-03-01

    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  2. Tristetraprolin regulation of interleukin 23 mRNA stability prevents a spontaneous inflammatory disease.

    Science.gov (United States)

    Molle, Céline; Zhang, Tong; Ysebrant de Lendonck, Laure; Gueydan, Cyril; Andrianne, Mathieu; Sherer, Félicie; Van Simaeys, Gaetan; Blackshear, Perry J; Leo, Oberdan; Goriely, Stanislas

    2013-08-26

    Interleukin (IL) 12 and IL23 are two related heterodimeric cytokines produced by antigen-presenting cells. The balance between these two cytokines plays a crucial role in the control of Th1/Th17 responses and autoimmune inflammation. Most studies focused on their transcriptional regulation. Herein, we explored the role of the adenine and uridine-rich element (ARE)-binding protein tristetraprolin (TTP) in influencing mRNA stability of IL12p35, IL12/23p40, and IL23p19 subunits. LPS-stimulated bone marrow-derived dendritic cells (BMDCs) from TTP(-/-) mice produced normal levels of IL12/23p40. Production of IL12p70 was modestly increased in these conditions. In contrast, we observed a strong impact of TTP on IL23 production and IL23p19 mRNA stability through several AREs in the 3' untranslated region. TTP(-/-) mice spontaneously develop an inflammatory syndrome characterized by cachexia, myeloid hyperplasia, dermatitis, and erosive arthritis. We observed IL23p19 expression within skin lesions associated with exacerbated IL17A and IL22 production by infiltrating γδ T cells and draining lymph node CD4 T cells. We demonstrate that the clinical and immunological parameters associated with TTP deficiency were completely dependent on the IL23-IL17A axis. We conclude that tight control of IL23 mRNA stability by TTP is critical to avoid severe inflammation.

  3. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    International Nuclear Information System (INIS)

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  4. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto

    2012-03-01

    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  5. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  6. Alternative Polyadenylation and Nonsense-Mediated Decay Coordinately Regulate the Human HFE mRNA Levels

    Science.gov (United States)

    Martins, Rute; Proença, Daniela; Silva, Bruno; Barbosa, Cristina; Silva, Ana Luísa; Faustino, Paula; Romão, Luísa

    2012-01-01

    Nonsense-mediated decay (NMD) is an mRNA surveillance pathway that selectively recognizes and degrades defective mRNAs carrying premature translation-termination codons. However, several studies have shown that NMD also targets physiological transcripts that encode full-length proteins, modulating their expression. Indeed, some features of physiological mRNAs can render them NMD-sensitive. Human HFE is a MHC class I protein mainly expressed in the liver that, when mutated, can cause hereditary hemochromatosis, a common genetic disorder of iron metabolism. The HFE gene structure comprises seven exons; although the sixth exon is 1056 base pairs (bp) long, only the first 41 bp encode for amino acids. Thus, the remaining downstream 1015 bp sequence corresponds to the HFE 3′ untranslated region (UTR), along with exon seven. Therefore, this 3′ UTR encompasses an exon/exon junction, a feature that can make the corresponding physiological transcript NMD-sensitive. Here, we demonstrate that in UPF1-depleted or in cycloheximide-treated HeLa and HepG2 cells the HFE transcripts are clearly upregulated, meaning that the physiological HFE mRNA is in fact an NMD-target. This role of NMD in controlling the HFE expression levels was further confirmed in HeLa cells transiently expressing the HFE human gene. Besides, we show, by 3′-RACE analysis in several human tissues that HFE mRNA expression results from alternative cleavage and polyadenylation at four different sites – two were previously described and two are novel polyadenylation sites: one located at exon six, which confers NMD-resistance to the corresponding transcripts, and another located at exon seven. In addition, we show that the amount of HFE mRNA isoforms resulting from cleavage and polyadenylation at exon seven, although present in both cell lines, is higher in HepG2 cells. These results reveal that NMD and alternative polyadenylation may act coordinately to control HFE mRNA levels, possibly varying its

  7. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  8. Regulation of mouse hepatic CYP2D9 mRNA expression by growth and adrenal hormones.

    Science.gov (United States)

    Jarukamjorn, Kanokwan; Sakuma, Tsutomu; Jaruchotikamol, Atika; Oguro, Miki; Nemoto, Nobuo

    2006-02-01

    The constitutive expression of CYP2D9 is sexually dimorphic, namely, strong in males, but diminutive in females. Repetition of mimic growth hormone (GH) secretion pattern impressively returned the mRNA expression level to that in intact mice: the GH secretion pattern's regulation of CYP2D9 mRNA expression has been predominantly disrupted by exogenous GH-administration. The extensive decline of CYP2D9 mRNA expression becoming a sexually non-specific P450 in 9-week-old male mice exposed as neonates to monosodium L-glutamate (MSG) suggested that the male GH secretion pattern is a key to the regulation of male-specific CYP2D9 mRNA expression in adult mice. Dexamethasone (Dex) showed possibility to induce CYP2D9 mRNA expression in adult MSG-neonatally treated mice of either sex. However, the antagonism was observed by co-administration of Dex and GH in the males. Dex-administration in adrenalectomized mice significantly elevated CYP2D9 mRNA expression levels. These findings suggest that an adrenal hormone participates in the regulatory mechanism of CYP2D9 mRNA expression in association with GH.

  9. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Directory of Open Access Journals (Sweden)

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  10. Induction of vitellogenin synthesis by estrogen in avian liver: relationship between level of vitellogenin mRNA and vitellogenin synthesis.

    Science.gov (United States)

    Mullinix, K P; Wetekam, W; Deeley, R G; Gordon, J I; Meyers, M; Kent, K A; Goldberger, R F

    1976-01-01

    We have investigated the estrogen-mediated induction of vitellogenin synthesis in rooster liver. We compared the concentrations of vitellogenin messenger RNA (mRNA) in the liver with the concentrations of vitellogenin in the sera of roosters that had recieved various treatments with estrogen. We found no vitellogenin mRNA in the livers of the unstimulated roosters. An initial injection of estrogen was attended by de novo synthesis of vitellogenin mRNA in the liver and accumulation of vitellogenin in the serum. When vitellogenin was no longer present in the serum or liver (the "post-estrogen-serum-negative" state), the liver was found to contain appreciable amounts of vitellogenin mRNA. This mRNA was of the same size as that found in the liver of the rooster actively synthesizing vitellogenin in response to estrogen. Whereas vitellogenin mRNA was in large polysomes in the livers of the roosters actively synthesizing vitellogenin, the vitellogenin mRNA in the liver of the post-estrogen-serum-negative rooster was not associated with polysomes. The possible relevance of these findings to the fact that the rooster responds differently to a primary stimulation with estrogen than to subsequent stimulations is discussed. PMID:1064017

  11. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

    Science.gov (United States)

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

    2015-01-01

    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

  12. Permissive effect of dexamethasone on the increase of proenkephalin mRNA induced by depolarization of chromaffin cells

    International Nuclear Information System (INIS)

    Naranjo, J.R.; Mocchetti, I.; Schwartz, J.P.; Costa, E.

    1986-01-01

    In cultured bovine chromaffin cells, changes in the dynamic state of enkephalin stores elicited experimentally were studied by measuring cellular proenkephalin mRNA, as well as enkephalin precursors and authentic enkephalin content of cells and culture media. In parallel, tyrosine hydroxylase mRNA and catecholamine cell content were also determined. Low concentrations (0.5-100 pM) of dexamethasone increased the cell contents of proenkephalin mRNA and enkephalin-containing peptides. High concentrations of the hormone(1 μM) were required to increase the cell contents of tyrosine hydroxylase mRNA and catecholamines. Depolarization of the cells with 10 μM veratridine resulted in a depletion of enkephalin and catecholamine stores after 24 hr. The enkephalin, but not the catecholamine, content was restored by 48 hr. An increase in proenkephalin mRNA content might account for the recovery; this increase was curtailed by tetrodotoxin and enhanced by 10 pM dexamethasone. Tyrosine hydroxylase mRNA content was not significantly modified by depolarization, even in the presence of 1 μM dexamethasone. Aldosterone, progesterone, testosterone, or estradiol (1 μM) failed to change proenkephalin mRNA. Hence, dexamethasone appears to exert a specific permissive action on the stimulation of the proenkephalin gene elicited by depolarization. Though the catecholamines and enkephalins are localized in the same chromaffin granules and are coreleased by depolarization, the genes coding for the processes that are rate limiting in the production of these neuromodulators can be differentially regulated

  13. Nitric oxide signaling pathway regulates potassium chloride cotransporter-1 mRNA expression in vascular smooth muscle cells.

    Science.gov (United States)

    Di Fulvio, M; Lauf, P K; Adragna, N C

    2001-11-30

    Rat vascular smooth muscle cells (VSMCs) express at least two mRNAs for K-Cl cotransporters (KCC): KCC1 and KCC3. cGMP-dependent protein kinase I regulates KCC3 mRNA expression in these cells. Here, we show evidence implicating the nitric oxide (NO)/cGMP signaling pathway in the expression of KCC1 mRNA, considered to be the major cell volume regulator. VSMCs, expressing soluble guanylyl cyclase (sGC) and PKG-I isoforms showed a time- and concentration-dependent increase in KCC1 mRNA levels after treatment with sodium nitroprusside as demonstrated by semiquantitative RT-PCR. sGC-dependent regulation of KCC1 mRNA expression was confirmed using YC-1, a NO-independent sGC stimulator. The sGC inhibitor LY83583 blocked the effects of sodium nitroprusside and YC-1. Moreover, 8-Br-cGMP increased KCC1 mRNA expression in a concentration- and time-dependent fashion. The 8-Br-cGMP effect was partially blocked by KT5823 but not by actinomycin D. However, actinomycin D and cycloheximide increased basal KCC1 mRNA in an additive manner, suggesting different mechanisms of action for both drugs. These findings suggest that in VSMCs, the NO/cGMP-signaling pathway participates in KCC1 mRNA regulation at the post-transcriptional level.

  14. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  15. Acute Endoplasmic Reticulum Stress-Independent Unconventional Splicing of XBP1 mRNA in the Nucleus of Mammalian Cells

    Directory of Open Access Journals (Sweden)

    Yuanyuan Wang

    2015-06-01

    Full Text Available The regulation of expression of X-box-binding protein-1 (XBP1, a transcriptional factor, involves an unconventional mRNA splicing that removes the 26 nucleotides intron. In contrast to the conventional splicing that exclusively takes place in the nucleus, determining the location of unconventional splicing still remains controversial. This study was designed to examine whether the unconventional spicing of XBP1 mRNA could occur in the nucleus and its possible biological relevance. We use RT-PCR reverse transcription system and the expand high fidelity PCR system to detect spliced XBP1 mRNA, and fraction cells to determine the location of the unconventional splicing of XBP1 mRNA. We employ reporter constructs to show the presence of unconventional splicing machinery in mammal cells independently of acute endoplasmic reticulum (ER stress. Our results reveal the presence of basal unconventional splicing of XBP1 mRNA in the nucleus that also requires inositol-requiring transmembrane kinase and endonuclease 1α (IRE1α and can occur independently of acute ER stress. Furthermore, we confirm that acute ER stress induces the splicing of XBP1 mRNA predominantly occurring in the cytoplasm, but it also promotes the splicing in the nucleus. The deletion of 5′-nucleotides in XBP1 mRNA significantly increases its basal unconventional splicing, suggesting that the secondary structure of XBP1 mRNA may determine the location of unconventional splicing. These results suggest that the unconventional splicing of XBP1 mRNA can take place in the nucleus and/or cytoplasm, which possibly depends on the elaborate regulation. The acute ER stress-independent unconventional splicing in the nucleus is most likely required for the maintaining of day-to-day folding protein homeostasis.

  16. The chicken type III GnRH receptor homologue is predominantly expressed in the pituitary, and exhibits similar ligand selectivity to the type I receptor

    Science.gov (United States)

    Joseph, Nerine T; Morgan, Kevin; Sellar, Robin; McBride, Derek; Millar, Robert P; Dunn, Ian C

    2009-01-01

    Two GnRH isoforms (cGnRH-I and GnRH-II) and two GnRH receptor subtypes (cGnRH-R-I and cGnRH-R-III) occur in chickens. Differential roles for these molecules in regulating gonadotrophin secretion or other functions are unclear. To investigate this we cloned cGnRH-R-III from a broiler chicken and compared its structure, expression and pharmacological properties with cGnRH-R-I. The broiler cGnRH-R-III cDNA was 100% identical to the sequence reported in the red jungle fowl and white leghorn breed. Pituitary cGnRH-R-III mRNA was ∼1400-fold more abundant than cGnRH-R-I mRNA. Northern analysis indicated a single cGnRH-R-III transcript. A pronounced sex and age difference existed, with higher pituitary transcript levels in sexually mature females versus juvenile females. In contrast, higher expression levels occurred in juvenile males versus sexually mature males. Functional studies in COS-7 cells indicated that cGnRH-R-III has a higher binding affinity for GnRH-II than cGnRH-I (Kd: 0·57 vs 19·8 nM) with more potent stimulation of inositol phosphate production (ED50: 0·8 vs 4·38 nM). Similar results were found for cGnRH-R-I, (Kd: 0·51 vs 10·8 nM) and (ED50: 0·7 vs 2·8 nM). The initial rate of internalisation was faster for cGnRH-R-III than cGnRH-R-I (26 vs 15·8%/min). Effects of GnRH antagonists were compared at the two receptors. Antagonist #27 distinguished between cGnRH-R-I and cGnRH-R-III (IC50: 2·3 vs 351 nM). These results suggest that cGnRH-R-III is probably the major mediator of pituitary gonadotroph function, that antagonist #27 may allow delineation of receptor subtype function in vitro and in vivo and that tissue-specific recruitment of cGnRH-R isoforms has occurred during evolution. PMID:19380456

  17. Importance of a 5′ Stem-Loop for Longevity of papA mRNA in Escherichia coli

    OpenAIRE

    Bricker, Angela L.; Belasco, Joel G.

    1999-01-01

    High-level expression of the major pilus subunit (PapA) of uropathogenic strains of Escherichia coli results in part from the unusually long lifetime of the mRNA that encodes this protein. Here we report that the longevity of papA mRNA derives in large measure from the protection afforded by its 5′ untranslated region. This papA RNA segment can prolong the lifetime of an otherwise short-lived mRNA to which it is fused. In vivo alkylation studies indicate that, in its natural milieu, the papA ...

  18. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Science.gov (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  19. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  20. Functional characterisation of the Schizosaccharomyces pombe homologue of the leukaemia-associated translocation breakpoint binding protein translin and its binding partner, TRAX.

    Science.gov (United States)

    Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J

    2008-02-01

    Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.

  1. Clinical values of AFP, GPC3 mRNA in peripheral blood for prediction of hepatocellular carcinoma recurrence following OLT: AFP, GPC3 mRNA for prediction of HCC.

    Science.gov (United States)

    Wang, Yuliang; Shen, Zhongyang; Zhu, Zhijun; Han, Ruifa; Huai, Mingsheng

    2011-03-01

    Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide. Annually, about 200,000 patients died of HCC in China. Liver transplantation (LT) holds great theoretical appeal in treating HCC. However, the high recurrence rate after transplantation is the most important limiting factor for long-term survival. To assess the value of alpha-fetoprotein (AFP) messenger RNA (mRNA), Glypican-3 (GPC3) mRNA-expressing cells in the peripheral blood (PB) for prediction of HCC recurrence following orthotopic liver transplantation (OLT). 29 patients with HCC who underwent OLT with a minimum clinical follow-up of 12 months were included in this retrospective study. We detected AFP mRNA, GPC3 mRNA-expressing cells in the PB by TaqMan real-time reverse transcriptase-polymerase chain reaction (RT-PCR), pre-, intra- and post-operatively. The early recurrence of patients was evaluated. 8 (28%), 15 (52%), and 9 (31%) patients had AFP mRNA detected pre-, intra-, and post-operatively, respectively. With 12 months of follow-up, HCC recurred in 7 (24%) patients. Univariate analysis revealed that positive pre- and post-operative AFP mRNA, TNM stage as well as vascular invasion were significant predictors for the HCC recurrence. Multivariate analysis revealed that being positive for AFP mRNA pre-operatively remained a significant risk factor for HCC recurrence after OLT. GPC3 mRNA was expressed in all PB samples. There was no significant difference in the expression levels of GPC3 mRNA between the HCC and control groups. There were no significant differences in GPC3 mRNA expression values between those patients with and without tumor recurrence. The pre-operative detection of circulating AFP mRNA-expressing cells could be a useful predictor for HCC recurrence following OLT. GPC3 mRNA-expressing cells in PB seem to have no diagnostic value.

  2. [Expression of heat shock protein 70 and its mRNA in career exposure to manganese].

    Science.gov (United States)

    Chen, Wenwen; Shao, Hua; Chi, Mingfeng; Zhang, Zhihu; Shan, Yongle; Zou, Wei

    2015-10-01

    To analyze the expression levels of heat shock protein70 (HSPs70) and HSPs70 mRNA in different exposure to manganese, and research the neuroprotective effect on the career exposure to manganese. From 2008 to 2009, with cross-sectional study design, and in a locomotive and rolling stock works, by stratified random sampling method, the exposed sample consisted of 180 welders from different welding shops and 100 unexposed in the last three years, non-welder controls with age-matched workers of similar socioeconomic status from the same industry. The control workers had not been exposed to neurotoxic chemicals. The mRNA expressions of four different metabolic enzyme were detected by SYBR Green I quantitative real-time polymerase chain reaction. The expression levels of the two enzymes mRNA in different exposure to manganese were analyzed. The expressions of HSPs70 were detected by Western blot. The concentration of air manganese was determined by GFAAS. The average concentration of 8 h time (8h-TWA) was used to express the level of individual exposure to manganese, according to the air manganese workplace occupational exposure limit (8h-TWA=0.15 mg/m3), the exposed group is divided into high exposed group (>0.15 mg/m3) and low exposure group (<0.15 mg/m3). The individuals exposed to manganese dose of exposed group ((0.25±0.31) mg/m3) was higher than the control group ((0.06±0.02) mg/m3) (t=6.15, P=0.001); individuals exposed to manganese dose of high exposure group for (0.42±0.34) mg/m3, which was higher than low exposure group (0.09±0.07) mg/m3 (t=9.80, P=0.001). HSPs70 mRNA and protein of exposure group (5.65±0.21, 3.26±0.15) were higher than the reference group (0.41±0.03, 1.32±0.12) (t=18.91, t=8.68, P=0.001). HSP70 mRNA and protein of high exposure group (6.48±0.37, 3.67±0.26) were higher than the low exposure group (5.15±0.23, 3.02±0.19) (t=3.24, t=2.01, P=0.003, P=0.043). The expression of peripheral blood lymphocytes HSPs70 level and HSPs70 mRNA

  3. Characterization of renin mRNA expression and enzyme activity in rat and mouse mesangial cells

    Directory of Open Access Journals (Sweden)

    Andrade A.Q.

    2002-01-01

    Full Text Available Renin is an enzyme involved in the stepwise generation of angiotensin II. Juxtaglomerular cells are the main source of plasma renin, but renin activity has been detected in other cell types. In the present study we evaluated the presence of renin mRNA in adult male Wistar rat and mouse (C-57 Black/6 mesangial cells (MC and their ability to process, store and release both the active and inactive forms of the enzyme. Active renin and total renin content obtained after trypsin treatment were estimated by angiotensinogen consumption analyzed by SDS-PAGE electrophoresis and quantified by angiotensin I generation by HPLC. Renin mRNA, detected by RT-PCR, was present in both rat and mouse MC under basal conditions. Active renin was significantly higher (P<0.05 in the cell lysate (43.5 ± 5.7 ng h-1 10(6 cells than in the culture medium (12.5 ± 2.5 ng h-1 10(6 cells. Inactive prorenin content was similar for the intra- and extracellular compartments (9.7 ± 3.1 and 3.9 ± 0.9 ng h-1 10(6 cells. Free active renin was the predominant form found in both cell compartments. These results indicate that MC in culture are able to synthesize and translate renin mRNA probably as inactive prorenin which is mostly processed to active renin inside the cell. MC secrete both forms of the enzyme but at a lower level compared with intracellular content, suggesting that the main role of renin synthesized by MC may be the intracellular generation of angiotensin II.

  4. Heritability in the efficiency of nonsense-mediated mRNA decay in humans.

    LENUS (Irish Health Repository)

    Seoighe, Cathal

    2010-01-01

    BACKGROUND: In eukaryotes mRNA transcripts of protein-coding genes in which an intron has been retained in the coding region normally result in premature stop codons and are therefore degraded through the nonsense-mediated mRNA decay (NMD) pathway. There is evidence in the form of selective pressure for in-frame stop codons in introns and a depletion of length three introns that this is an important and conserved quality-control mechanism. Yet recent reports have revealed that the efficiency of NMD varies across tissues and between individuals, with important clinical consequences. PRINCIPAL FINDINGS: Using previously published Affymetrix exon microarray data from cell lines genotyped as part of the International HapMap project, we investigated whether there are heritable, inter-individual differences in the abundance of intron-containing transcripts, potentially reflecting differences in the efficiency of NMD. We identified intronic probesets using EST data and report evidence of heritability in the extent of intron expression in 56 HapMap trios. We also used a genome-wide association approach to identify genetic markers associated with intron expression. Among the top candidates was a SNP in the DCP1A gene, which forms part of the decapping complex, involved in NMD. CONCLUSIONS: While we caution that some of the apparent inter-individual difference in intron expression may be attributable to different handling or treatments of cell lines, we hypothesize that there is significant polymorphism in the process of NMD, resulting in heritable differences in the abundance of intronic mRNA. Part of this phenotype is likely to be due to a polymorphism in a decapping enzyme on human chromosome 3.

  5. Heritability in the efficiency of nonsense-mediated mRNA decay in humans

    KAUST Repository

    Seoighe, Cathal

    2010-07-21

    Background: In eukaryotes mRNA transcripts of protein-coding genes in which an intron has been retained in the coding region normally result in premature stop codons and are therefore degraded through the nonsense-mediated mRNA decay (NMD) pathway. There is evidence in the form of selective pressure for in-frame stop codons in introns and a depletion of length three introns that this is an important and conserved quality-control mechanism. Yet recent reports have revealed that the efficiency of NMD varies across tissues and between individuals, with important clinical consequences. Principal Findings: Using previously published Affymetrix exon microarray data from cell lines genotyped as part of the International HapMap project, we investigated whether there are heritable, inter-individual differences in the abundance of intron-containing transcripts, potentially reflecting differences in the efficiency of NMD. We identified intronic probesets using EST data and report evidence of heritability in the extent of intron expression in 56 HapMap trios. We also used a genome-wide association approach to identify genetic markers associated with intron expression. Among the top candidates was a SNP in the DCP1A gene, which forms part of the decapping complex, involved in NMD. Conclusions: While we caution that some of the apparent inter-individual difference in intron expression may be attributable to different handling or treatments of cell lines, we hypothesize that there is significant polymorphism in the process of NMD, resulting in heritable differences in the abundance of intronic mRNA. Part of this phenotype is likely to be due to a polymorphism in a decapping enzyme on human chromosome 3. © 2010 Seoighe, Gehring.

  6. CUP promotes deadenylation and inhibits decapping of mRNA targets

    Science.gov (United States)

    Igreja, Catia; Izaurralde, Elisa

    2011-01-01

    CUP is an eIF4E-binding protein (4E-BP) that represses the expression of specific maternal mRNAs prior to their posterior localization. Here, we show that CUP employs multiple mechanisms to repress the expression of target mRNAs. In addition to inducing translational repression, CUP maintains mRNA targets in a repressed state by promoting their deadenylation and protects deadenylated mRNAs from further degradation. Translational repression and deadenylation are independent of eIF4E binding and require both the middle and C-terminal regions of CUP, which collectively we termed the effector domain. This domain associates with the deadenylase complex CAF1–CCR4–NOT and decapping activators. Accordingly, in isolation, the effector domain is a potent trigger of mRNA degradation and promotes deadenylation, decapping and decay. However, in the context of the full-length CUP protein, the decapping and decay mediated by the effector domain are inhibited, and target mRNAs are maintained in a deadenylated, repressed form. Remarkably, an N-terminal regulatory domain containing a noncanonical eIF4E-binding motif is required to protect CUP-associated mRNAs from decapping and further degradation, suggesting that this domain counteracts the activity of the effector domain. Our findings indicate that the mode of action of CUP is more complex than previously thought and provide mechanistic insight into the regulation of mRNA expression by 4E-BPs. PMID:21937713

  7. Identifying airway sensitizers: cytokine mRNA profiles induced by various anhydrides

    International Nuclear Information System (INIS)

    Plitnick, L.M.; Loveless, S.E.; Ladics, G.S.; Holsapple, M.P.; Smialowicz, R.J.; Woolhiser, M.R.; Anderson, P.K.; Smith, C.; Selgrade, M.J.K.

    2003-01-01

    Exposure to low molecular weight (LMW) chemicals in the workplace has been linked to a variety of respiratory effects. Within the LMW chemicals, one of the major classes involved in these effects are the acid anhydrides. The immunological basis of respiratory hypersensitivity involves CD4+ cells. By virtue of their induction of cytokines typical of CD4+ T-helper type 2 (Th2) cells--interleukin (IL)-4, 10, and 13--respiratory sensitizers may be identified and differentiated from contact sensitizers which induce Th1 cytokines (IL-2 and IFN-γ). Our previous work suggested that the ribonuclease protection assay (RPA) was useful in identifying the respiratory sensitizer, trimellitic anhydride (TMA), based on quantitative differences in Th2 cytokine mRNA as compared to the contact sensitizer dinitrochlorobenzene (DNCB). Therefore, the purpose of the studies described in this report was to expand the chemicals tested in the RPA. To this end, four acid anhydrides with known respiratory sensitization potential, TMA, maleic anhydride (MA), phthalic anhydride (PA) and hexahydrophthalic anhydride (HHPA), were tested. Although previously determined to induce immunologically equivalent responses in a local lymph node assay (LLNA), the initial dose chosen (2.5%) failed to induce Th2 cytokine mRNA expression. To determine if the lack of cytokine expression was related to dose, LLNAs were conducted at higher doses for each of the anhydrides. The highest doses evaluated (four- to six-fold higher than those used in the initial RPA) gave equivalent proliferative responses for the various anhydrides and were used for subsequent RPA testing. At these higher doses, significant increases in Th2 versus Th1 cytokine mRNA were observed for all anhydrides tested. These results suggest that the RPA has the potential to serve as a screen for the detection of LMW airway sensitizing chemicals. However, the basis for selecting immunologically equivalent doses may require some modification

  8. Influence of culture medium composition on relative mRNA abundances in domestic cat embryos.

    Science.gov (United States)

    Hribal, R; Jewgenow, K; Braun, B C; Comizzoli, P

    2013-04-01

    Different culture conditions have been used to produce domestic cat embryos. As part of the in vitro procedures, the medium composition significantly affects the quality of the embryo development also. Quality assessments based on cleavage kinetics and blastomere symmetry are useful, but embryos also can differ in their relative gene expression patterns despite similar morphological characteristics. The aim of this study was to compare cat embryos produced with two different in vitro culture systems routinely used in two different laboratories [Smithsonian Conservation Biology Institute, Washington D.C., USA (SCBI) and Leibniz Institute for Zoo and Wildlife Research, Berlin, Germany (IZW)]. Specifically, relative mRNA expression patterns of critical genes for pre-implantation embryo development were assessed in both conditions. Embryos were produced in parallel in both culture systems by IVF using frozen-thawed ejaculated semen in the United States and fresh epididymal sperm in Germany. Success of embryo development in vitro was recorded as well as relative mRNA abundances [DNA methyltransferases 1 and 3A (DNMT1, DNMT3A), gap junction protein alpha 1 (GJA1), octamer-binding transcription factor 4 [OCT4], insulin-like growth factors 1 and 2 receptors (IGF1R, IGF2R), beta-actin (ACTB)] in pools of days 4-5 morulae by semi-quantitative RT-PCR assay. Percentages of cleaved embryos were similar (p > 0.05) between both culture systems, regardless of the location. OCT4 mRNA abundance was higher (p culture system compared with those from the IZW system when epididymal sperm was used for IVF. No clear correlation between the expression pattern and the culture system could be found for all other genes. It is suggested that OCT4 expression might be affected by the media composition in some conditions and can be the indicator of a better embryo quality. © 2012 Blackwell Verlag GmbH.

  9. Clofibrate-induced increases in peroxisomal proteins: effect on synthesis, degradation, and mRNA activity

    International Nuclear Information System (INIS)

    Mortensen, R.M.

    1983-01-01

    The effect of clofibrate on the polypeptide composition of peroxisomes was determined. A simple method was developed for the isolation of peroxisomes with a purity of 90-95% using sedimentation in a metrizamide gradient. The specific activities of HD did not change with clofibrate treatment so that the increases in enzyme activities are solely due to increases in protein amounts. The hepatic concentration of HD increased 63 times. The HD synthesis rate, as measured by the incorporation of [ 3 H]leucine, increased 74 times, so that the increase in the synthesis was sufficient to account for the increase in protein. Clofibrate caused no discernible change in the degradation rate of HD labeled with [ 14 C]bicarbonate. The half-life of HD was approximately 2 days. The translatable mRBA coding for HD increased 55 times. This value is not significantly different from the increase in HD protein or in HD synthesis. This observation was also true for several other peroxisomal proteins. Therefore, clofibrate causes an increase in the mRNA activity, which increases the synthesis of HD leading to an accumulation of protein and enzyme activity. The kinetics of the clofibrate-induced changes in HD synthesis rate, protein level, and enzymatic activity was analyzed using a simple model which included the half-lives of the drug, mRNA, and protein. The best fit of the model to the data gave an mRNA half-life of 10 hours and a protein half-life of 1.8 days, with no significant change by clofibrate

  10. Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death

    International Nuclear Information System (INIS)

    Ejeskär, Katarina; Krona, Cecilia; Carén, Helena; Zaibak, Faten; Li, Lingli; Martinsson, Tommy; Ioannou, Panayiotis A

    2005-01-01

    Neuroblastoma is a solid tumour of childhood often with an unfavourable outcome. One common genetic feature in aggressive tumours is 1p-deletion. The α-enolase (ENO1) gene is located in chromosome region 1p36.2, within the common region of deletion in neuroblastoma. One alternative translated product of the ENO1 gene, known as MBP-1, acts as a negative regulator of the c-myc oncogene, making the ENO1 gene a candidate as a tumour suppressor gene. Methods used in this study are transfection of cDNA-vectors and in vitro transcribed mRNA, cell growth assay, TUNEL-assay, real-time RT-PCR (TaqMan) for expression studies, genomic sequencing and DHPLC for mutation detection. Here we demonstrate that transfection of ENO1 cDNA into 1p-deleted neuroblastoma cell lines causes' reduced number of viable cells over time compared to a negative control and that it induces apoptosis. Interestingly, a similar but much stronger dose-dependent reduction of cell growth was observed by transfection of in vitro transcribed ENO1 mRNA into neuroblastoma cells. These effects could also be shown in non-neuroblastoma cells (293-cells), indicating ENO1 to have general tumour suppressor activity. Expression of ENO1 is detectable in primary neuroblastomas of all different stages and no difference in the level of expression can be detected between 1p-deleted and 1p-intact tumour samples. Although small numbers (11 primary neuroblastomas), there is some evidence that Stage 4 tumours has a lower level of ENO1-mRNA than Stage 2 tumours (p = 0.01). However, mutation screening of 44 primary neuroblastomas of all different stages, failed to detect any mutations. Our studies indicate that ENO1 has tumour suppressor activity and that high level of ENO1 expression has growth inhibitory effects

  11. Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H

    1988-10-25

    DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.

  12. mRNA expression profile in DLD-1 and MOLT-4 cancer cell lines cultured under Microgravity

    Data.gov (United States)

    National Aeronautics and Space Administration — DLD-1 and MOLT-4 cell lines were cultured in a Rotating cell culture system to simulate microgravity and mRNA expression profile was observed in comparison to Static...

  13. Increase of CTGF mRNA expression by respiratory syncytial virus infection is abrogated by caffeine in lung epithelial cells.

    Science.gov (United States)

    Kunzmann, Steffen; Krempl, Christine; Seidenspinner, Silvia; Glaser, Kirsten; Speer, Christian P; Fehrholz, Markus

    2018-04-16

    Respiratory syncytial virus (RSV) is a leading cause of severe lower respiratory tract infection in early childhood. Underlying pathomechanisms of elevated pulmonary morbidity in later infancy are largely unknown. We found that RSV-infected H441 cells showed increased mRNA expression of connective tissue growth factor (CTGF), a key factor in airway remodeling. Additional dexamethasone treatment led to further elevated mRNA levels, indicating additive effects. Caffeine treatment prevented RSV-mediated increase of CTGF mRNA. RSV may be involved in airway remodeling processes by increasing CTGF mRNA expression. Caffeine might abrogate these negative effects and thereby help to restore lung homeostasis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. The effect of tissue decalcification on mRNA retention within bone for in-situ hybridization studies.

    Science.gov (United States)

    Walsh, L; Freemont, A J; Hoyland, J A

    1993-06-01

    Tissue decalcification is a routine part of the preparation of bone tissue for histological studies. Although in-situ hybridization has been employed to localize mRNA of collagenous and non-collagenous bone related proteins in skeletal tissue, little is known regarding the effects of decalcifying agents on mRNA retention within tissue. In this study in-situ hybridization using an oligonucleotide probe (i.e. a poly d(T) probe) to detect total messenger RNA has been employed to investigate the effects of the decalcifying agents nitric acid, formic acid and EDTA on mRNA retention compared to undeacalcified tissue. The results show that formalin fixation and EDTA decalcification preserve substantial amounts of mRNA within the tissue. In particular, this study illustrates that it is possible to perform in-situ hybridization on formalin fixed decalcified paraffin embedded tissue.

  15. Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2

    DEFF Research Database (Denmark)

    Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie

    2016-01-01

    Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...

  16. Localization of mRNA in vertebrate axonal compartments by in situ hybridization.

    Science.gov (United States)

    Sotelo-Silveira, José Roberto; Calliari, Aldo; Kun, Alejandra; Elizondo, Victoria; Canclini, Lucía; Sotelo, José Roberto

    2011-01-01

    The conclusive demonstration of RNA in vertebrate axons by in situ hybridization (ISH) has been elusive. We review the most important reasons for difficulties, including low concentration of axonal RNAs, localization in specific cortical domains, and the need to isolate axons. We demonstrate the importance of axon micro-dissection to obtain a whole mount perspective of mRNA distribution in the axonal territory. We describe a protocol to perform fluorescent ISH in isolated axons and guidelines for the preservation of structural and molecular integrity of cortical RNA-containing domains (e.g., Periaxoplasmic Ribosomal Plaques, or PARPs) in isolated axoplasm.

  17. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise C...in which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and

  18. Estrogen receptor mRNA in mineralized tissues of rainbow trout: calcium mobilization by estrogen.

    Science.gov (United States)

    Armour, K J; Lehane, D B; Pakdel, F; Valotaire, Y; Graham, R; Russell, R G; Henderson, I W

    1997-07-07

    RT-PCR was undertaken on total RNA extracts from bone and scales of the rainbow trout, Oncorhynchus mykiss. The rainbow trout estrogen receptor (ER)-specific primers used amplified a single product of expected size from each tissue which, using Southern blotting, strongly hybridized with a 32P-labelled rtER probe under stringent conditions. These data provide the first in vivo evidence of ER mRNA in bone and scale tissues of rainbow trout and suggest that the effects of estrogen observed in this study (increased bone mineral and decreased scale mineral contents, respectively) may be mediated directly through ER.

  19. Alterations in Lipoxygenase and Cyclooxygenase-2 Catalytic Activity and mRNA Expression in Prostate Carcinoma

    Directory of Open Access Journals (Sweden)

    Scott B. Shappell

    2001-01-01

    Full Text Available Recent studies in prostate tissues and especially cell lines have suggested roles for arachidonic acid (AA metabolizing enzymes in prostate adenocarcinoma (Pca development or progression. The goal of this study was to more fully characterize lipoxygenase (LOX and cyclooxygenase-2 (COX-2 gene expression and AA metabolism in benign and malignant prostate using snap-frozen tissues obtained intraoperatively and mRNA analyses and enzyme assays. Formation of 15-hydroxyeicosatetraenoic acid (15-HETE was detected in 23/29 benign samples and 15-LOX-2 mRNA was detected in 21/25 benign samples. In pairs of pure benign and Pca from the same patients, 15-HETE production and 15-LOX-2 mRNA were reduced in Pca versus benign in 9/14 (P=.04 and 14/17 (P=.002, respectively. Under the same conditions, neither 5HETE nor 12-HETE formation was detectable in 29 benign and 24 tumor samples; with a more sensitive assay, traces were detected in some samples, but there was no clear association with tumor tissue. COX-2 mRNA was detected by nuclease protection assay in 7/16 benign samples and 5/16 tumors. In benign and tumor pairs from 10 patients, COX-2 was higher in tumor versus benign in only 2, with similar results by in situ hybridization. Paraffin immunoperoxidase for COX2 was performed in whole mount sections from 87 additional radical prostatectomy specimens, with strong expression in ejaculatory duct as a positive control and corroboration with in situ hybridization. No immunostaining was detected in benign prostate or tumor in 45% of cases. Greater immunostaining in tumor versus benign was present in only 17% of cases, and correlated with high tumor grade (Gleason score 8 and 9 vs. 5 to 7. In conclusion, reduced 15-LOX-2 expression and 15-HETE formation is the most characteristic alteration of AA metabolism in Pca. Increased 12-HETE and 5-HETE formation in Pca were not discernible. Increased COX-2 expression is not a typical abnormality in Pca in general, but

  20. Anesthesia for euthanasia influences mRNA expression in healthy mice and after traumatic brain injury.

    Science.gov (United States)

    Staib-Lasarzik, Irina; Kriege, Oliver; Timaru-Kast, Ralph; Pieter, Dana; Werner, Christian; Engelhard, Kristin; Thal, Serge C

    2014-10-01

    Tissue sampling for gene expression analysis is usually performed under general anesthesia. Anesthetics are known to modulate hemodynamics, receptor-mediated signaling cascades, and outcome parameters. The present study determined the influence of anesthetic paradigms typically used for euthanization and tissue sampling on cerebral mRNA expression in mice. Naïve mice and animals with acute traumatic brain injury induced by controlled cortical impact (CCI) were randomized to the following euthanasia protocols (n=10-11/group): no anesthesia (NA), 1 min of 4 vol% isoflurane in room air (ISO), 3 min of a combination of 5 mg/kg midazolam, 0.05 mg/kg fentanyl, and 0.5 mg/kg medetomidine intraperitoneally (COMB), or 3 min of 360 mg/kg chloral hydrate intraperitoneally (CH). mRNA expression of actin-1-related gene (Act1), FBJ murine osteosarcoma viral oncogene homolog B (FosB), tumor necrosis factor alpha (TNFα), heat shock protein beta-1 (HspB1), interleukin (IL)-6, tight junction protein 1 (ZO-1), IL-1ß, cyclophilin A, micro RNA 497 (miR497), and small cajal body-specific RNA 17 were determined by real-time polymerase chain reaction (PCR) in hippocampus samples. In naïve animals, Act1 expression was downregulated in the CH group compared with NA. FosB expression was downregulated in COMB and CH groups compared with NA. CCI reduced Act1 and FosB expression, whereas HspB1 and TNFα expression increased. After CCI, HspB1 expression was significantly higher in ISO, COMB, and CH groups, and TNFα expression was elevated in ISO and COMB groups. MiR497, IL-6, and IL-1ß were upregulated after CCI but not affected by anesthetics. Effects were independent of absolute mRNA copy numbers. The data demonstrate that a few minutes of anesthesia before tissue sampling are sufficient to induce immediate mRNA changes, which seem to predominate in the early-regulated gene cluster. Anesthesia-related effects on gene expression might explain limited reproduciblity of real

  1. Individual microRNAs (miRNAs) display distinct mRNA targeting "rules".

    Science.gov (United States)

    Wang, Wang-Xia; Wilfred, Bernard R; Xie, Kevin; Jennings, Mary H; Hu, Yanling Hu; Stromberg, Arnold J; Nelson, Peter T

    2010-01-01

    MicroRNAs (miRNAs) guide Argonaute (AGO)-containing microribonucleoprotein (miRNP) complexes to target mRNAs.It has been assumed that miRNAs behave similarly to each other with regard to mRNA target recognition. The usual assumptions, which are based on prior studies, are that miRNAs target preferentially sequences in the 3'UTR of mRNAs,guided by the 5' "seed" portion of the miRNAs. Here we isolated AGO- and miRNA-containing miRNPs from human H4 tumor cells by co-immunoprecipitation (co-IP) with anti-AGO antibody. Cells were transfected with miR-107, miR-124,miR-128, miR-320, or a negative control miRNA. Co-IPed RNAs were subjected to downstream high-density Affymetrix Human Gene 1.0 ST microarray analyses using an assay we validated previously-a "RIP-Chip" experimental design. RIP-Chip data provided a list of mRNAs recruited into the AGO-miRNP in correlation to each miRNA. These experimentally identified miRNA targets were analyzed for complementary six nucleotide "seed" sequences within the transfected miRNAs. We found that miR-124 targets tended to have sequences in the 3'UTR that would be recognized by the 5' seed of miR-124, as described in previous studies. By contrast, miR-107 targets tended to have 'seed' sequences in the mRNA open reading frame, but not the 3' UTR. Further, mRNA targets of miR-128 and miR-320 are less enriched for 6-mer seed sequences in comparison to miR-107 and miR-124. In sum, our data support the importance of the 5' seed in determining binding characteristics for some miRNAs; however, the "binding rules" are complex, and individual miRNAs can have distinct sequence determinants that lead to mRNA targeting.

  2. Impact of gastro-esophageal reflux on mucin mRNA expression in the esophageal mucosa.

    Science.gov (United States)

    van Roon, Aafke H C; Mayne, George C; Wijnhoven, Bas P L; Watson, David I; Leong, Mary P; Neijman, Gabriëlle E; Michael, Michael Z; McKay, Andrew R; Astill, David; Hussey, Damian J

    2008-08-01

    Changes in the expression of mucin genes in the esophageal mucosa associated with uncomplicated gastro-esophageal reflux disease have not been evaluated even though such changes could be associated with reflux-induced mucosal damage. We therefore sought to identify reflux-induced changes in mucin gene expression using a cell line and biopsies from the esophageal mucosa in patients with and without reflux. MUC-1, MUC-3, MUC-4, and MUC-5AC gene expressions were investigated in the HET-1A cell line following exposure to acid (pH 4) and/or bile (120 muM of a bile salt milieu), and in esophageal mucosal biopsies from controls, subjects with non-erosive gastro-esophageal reflux, and subjects with reflux associated with ulcerative esophagitis (erosive). The mucosal biopsies were also evaluated for IL-6 mRNA expression (inflammatory marker) and CK-14 mRNA expression (mucosal basal cell layer marker). Gene expression was determined using real-time reverse transcriptase-polymerase chain reaction analysis. In the cell line studies, there were differences in mRNA levels for all of the evaluated mucins following treatment with either acid or the acid and bile combination. In the studies which evaluated tissue specimens, IL-6 and CK-14 mRNA levels increased according to degree of reflux pathology. The expression of MUC-1 and MUC-4 in mucosa from patients with erosive reflux was lower than in subjects without reflux and in patients with non-erosive reflux, whereas the expression of MUC-3 and MUC-5AC was increased (although these differences did not reach significance at p reflux groups. The correlation between IL-6 and MUC-3 was significant within the control and erosive reflux groups, and the correlation between MUC-1 and MUC-5AC was significant within the erosive reflux group. The results of this study suggest that the profile of mucin expression in the esophageal mucosa is influenced by the pH and composition of the gastro-esophageal reflux. Further work should explore the

  3. Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

    Energy Technology Data Exchange (ETDEWEB)

    Cai, X.Z. [Central Laboratory, First Affiliated Hospital, China Medical University, Shenyang (China); Department of Immunology, College of Basic Medical Sciences, China Medical University, Shenyang (China); Huang, W.Y.; Qiao, Y.; Chen, Y.; Du, S.Y.; Chen, D.; Yu, S. [Central Laboratory, First Affiliated Hospital, China Medical University, Shenyang (China); Liu, N. [Department of Nephrology, First Affiliated Hospital, China Medical University, Shenyang (China); Dou, L.Y. [Central Laboratory, First Affiliated Hospital, China Medical University, Shenyang (China); Jiang, Y. [Central Laboratory, First Affiliated Hospital, China Medical University, Shenyang (China); Department of Immunology, College of Basic Medical Sciences, China Medical University, Shenyang (China); Department of Dermatology, First Affiliated Hospital, China Medical University, Shenyang (China)

    2014-10-17

    The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (r{sub s}=0.283, P=0.049) and serum albumin (r{sub s}=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; r{sub s}=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

  4. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  5. Maternal separation induces hippocampal changes in cadherin-1 (CDH-1) mRNA and recognition memory impairment in adolescent mice.

    Science.gov (United States)

    de Azeredo, Lucas Araújo; Wearick-Silva, Luis Eduardo; Viola, Thiago Wendt; Tractenberg, Saulo Gantes; Centeno-Silva, Anderson; Orso, Rodrigo; Schröder, Nadja; Bredy, Timothy William; Grassi-Oliveira, Rodrigo

    2017-05-01

    In rodents, disruption of mother-infant attachment induced by maternal separation (MS) is associated with recognition memory impairment and long-term neurobiological consequences. Particularly stress-induced modifications have been associated to disruption of cadherin (CDH) adhesion function, which plays an important role in remodeling of neuronal connection and synaptic plasticity. This study investigated the sex-dependent effect of MS on recognition memory and mRNA levels of classical type I and type II CDH and the related β -catenin (β -Cat) in the hippocampus and prefrontal cortex of late adolescent mice. We provided evidence that the BALB/c mice exposed to MS present deficit in recognition memory, especially females. Postnatal MS induced higher hippocampal CDH-2 and CDH-8 mRNA levels, as well as an upregulation of CDH-1 in the prefrontal cortex in both males and females. MS-reared female mice presented lower CDH-1 mRNA levels in the hippocampus. In addition, hippocampal CDH-1 mRNA levels were positively correlated with recognition memory performance in females. MS-reared male mice exhibited higher β -Cat mRNA levels in the hippocampus. Considering sex-specific effects on CDH mRNA levels, it has been demonstrated mRNA changes in CDH-1, β -Cat, and CDH-6 in the hippocampus, as well as CDH-1, CDH-8 and CDH-11 in the prefrontal cortex. Overall, these findings suggest a complex interplay among MS, CDH mRNA expression, and sex differences in the PFC and hippocampus of adolescent mice. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Seasonal Relationship between Gonadotropin, Growth Hormone, and Estrogen Receptor mRNA Expression in the Pituitary Gland of Largemouth Bass

    OpenAIRE

    Martyniuk, Christopher J; Kroll, Kevin J.; Porak, Wesley F.; Steward, Cheree; Grier, Harry J.; Denslow, Nancy D.

    2009-01-01

    The objectives of this study were to investigate the seasonal changes in pituitary gonadotropins, growth hormone (GH), and estrogen receptor (ER) isoform mRNA in wild female and male largemouth bass (LMB) (Micropterus salmoides) from an unpolluted habitat to better understand reproductive physiology in this ecologically important species. Female pituitary luteinizing hormone (LH) β subunit and follicle-stimulating hormone (FSH) β subunit mRNA showed significant seasonal variation with levels ...

  7. Multiple correlation analyses revealed complex relationship between DNA methylation and mRNA expression in human peripheral blood mononuclear cells.

    Science.gov (United States)

    Xie, Fang-Fei; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Hong; Wu, Jian; Guo, Yu-Fan; Zeng, Ke-Qin; Wang, Ming-Jun; Zhu, Xiao-Wei; Xia, Wei; Wang, Lan; He, Pei; Bing, Peng-Fei; Lu, Xin; Zhang, Yong-Hong; Lei, Shu-Feng

    2018-01-01

    DNA methylation is an important regulator on the mRNA expression. However, a genome-wide correlation pattern between DNA methylation and mRNA expression in human peripheral blood mononuclear cells (PBMCs) is largely unknown. The comprehensive relationship between mRNA and DNA methylation was explored by using four types of correlation analyses and a genome-wide methylation-mRNA expression quantitative trait locus (eQTL) analysis in PBMCs in 46 unrelated female subjects. An enrichment analysis was performed to detect biological function for the detected genes. Single pair correlation coefficient (r T1 ) between methylation level and mRNA is moderate (-0.63-0.62) in intensity, and the negative and positive correlations are nearly equal in quantity. Correlation analysis on each gene (T4) found 60.1% genes showed correlations between mRNA and gene-based methylation at P correlation (R T4  > 0.8). Methylation sites have regulation effects on mRNA expression in eQTL analysis, with more often observations in region of transcription start site (TSS). The genes under significant methylation regulation both in correlation analysis and eQTL analysis tend to cluster to the categories (e.g., transcription, translation, regulation of transcription) that are essential for maintaining the basic life activities of cells. Our findings indicated that DNA methylation has predictive regulation effect on mRNA with a very complex pattern in PBMCs. The results increased our understanding on correlation of methylation and mRNA and also provided useful clues for future epigenetic studies in exploring biological and disease-related regulatory mechanisms in PBMC.

  8. Suberoylanilide hydroxamic acid (SAHA) inhibits EGF-induced cell transformation via reduction of cyclin D1 mRNA stability

    International Nuclear Information System (INIS)

    Zhang, Jingjie; Ouyang, Weiming; Li, Jingxia; Zhang, Dongyun; Yu, Yonghui; Wang, York; Li, Xuejun; Huang, Chuanshu

    2012-01-01

    Suberoylanilide hydroxamic acid (SAHA) inhibiting cancer cell growth has been associated with its downregulation of cyclin D1 protein expression at transcription level or translation level. Here, we have demonstrated that SAHA inhibited EGF-induced Cl41 cell transformation via the decrease of cyclin D1 mRNA stability and induction of G0/G1 growth arrest. We found that SAHA treatment resulted in the dramatic inhibition of EGF-induced cell transformation, cyclin D1 protein expression and induction of G0/G1 growth arrest. Further studies showed that SAHA downregulation of cyclin D1 was only observed with endogenous cyclin D1, but not with reconstitutionally expressed cyclin D1 in the same cells, excluding the possibility of SAHA regulating cyclin D1 at level of protein degradation. Moreover, SAHA inhibited EGF-induced cyclin d1 mRNA level, whereas it did not show any inhibitory effect on cyclin D1 promoter-driven luciferase reporter activity under the same experimental conditions, suggesting that SAHA may decrease cyclin D1 mRNA stability. This notion was supported by the results that treatment of cells with SAHA decreased the half-life of cyclin D1 mRNA from 6.95 h to 2.57 h. Consistent with downregulation of cyclin D1 mRNA stability, SAHA treatment also attenuated HuR expression, which has been well-characterized as a positive regulator of cyclin D1 mRNA stability. Thus, our study identifies a novel mechanism responsible for SAHA inhibiting cell transformation via decreasing cyclin D1 mRNA stability and induction of G0/G1 growth arrest in Cl41 cells. -- Highlights: ► SAHA inhibits cell transformation in Cl41 cells. ► SAHA suppresses Cyclin D1 protein expression. ► SAHA decreases cyclin D1 mRNA stability.

  9. Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Cai, X.Z.; Huang, W.Y.; Qiao, Y.; Chen, Y.; Du, S.Y.; Chen, D.; Yu, S.; Liu, N.; Dou, L.Y.; Jiang, Y.

    2014-01-01

    The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (r s =0.283, P=0.049) and serum albumin (r s =0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; r s =-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE

  10. Time-course of 5-HT(6) receptor mRNA expression during memory consolidation and amnesia.

    Science.gov (United States)

    Huerta-Rivas, A; Pérez-García, G; González-Espinosa, C; Meneses, A

    2010-01-01

    Growing evidence indicates that antagonists of the 5-hydroxytryptamine (serotonin) receptor(6) (5-HT(6)) improve memory and reverse amnesia although the mechanisms involved are poorly understood. Hence, in this paper RT-PCR was used to evaluate changes in mRNA expression of 5-HT(6) receptor in trained and untrained rats treated with the 5-HT(6) receptor antagonist SB-399885 and amnesic drugs scopolamine or dizocilpine. Changes in mRNA expression of 5-HT(6) receptor were investigated at different times in prefrontal cortex, hippocampus and striatum. Data indicated that memory in the Pavlovian/instrumental autoshaping task was a progressive process associated to reduced mRNA expression of 5-HT(6) receptor in the three structures examined. SB-399885 improved long-term memory at 48h, while the muscarinic receptor antagonist scopolamine or the non-competitive NMDA receptor antagonist dizocilpine impaired it at 24h. Autoshaping training and treatment with SB-399885 increased 5-HT(6) receptor mRNA expression in (maximum increase) prefrontal cortex and striatum, 24 or 48h. The scopolamine-induced amnesia suppressed 5-HT(6) receptor mRNA expression while the dizocilpine-induced amnesia did not modify 5-HT(6) receptor mRNA expression. SB-399885 and scopolamine or dizocilpine were able to reestablish memory and 5-HT(6) receptor mRNA expression. These data confirmed previous memory evidence and of more interest is the observation that training, SB-399885 and amnesic drugs modulated 5-HT(6) receptor mRNA expression in prefrontal cortex, hippocampus and striatum. Further investigation in different memory tasks, times and amnesia models together with more complex control groups might provide further clues. Copyright 2009 Elsevier Inc. All rights reserved.

  11. Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation

    DEFF Research Database (Denmark)

    Chen, C Y; Gherzi, R; Andersen, Jens S.

    2000-01-01

    Regulated mRNA turnover is a highly important process, but its mechanism is poorly understood. Using interleukin-2 (IL-2) mRNA as a model, we described a role for the JNK-signaling pathway in stabilization of IL-2 mRNA during T-cell activation, acting via a JNK response element (JRE) in the 5' un...

  12. Serotonin receptor, SERT mRNA and correlations with symptoms in males with alcohol dependence and suicide.

    Science.gov (United States)

    Thompson, P M; Cruz, D A; Olukotun, D Y; Delgado, P L

    2012-09-01

    This study tested the hypothesis that abnormalities in components of the serotonin (5HT) system in the prefrontal cortex are associated with suicide in alcohol-dependent subjects. Second, we assessed the relationship of lifetime impulsivity and mood symptoms with prefrontal cortex 5-HT measures. Tissue was obtained from Brodmann's areas (BA) 9 and 24 in postmortem samples of individuals who were alcohol dependent with suicide (n = 5), alcohol dependent without suicide (n = 9) and normal controls (n = 5). Serotonin receptor (5HT) and serotonin reuptake transporter (SERT) mRNA were measured. Interviews with next of kin estimated lifetime impulsivity and mood symptoms in the last week of life. Serotonin receptor 1A (5HT1A) mRNA in BA 9 was elevated in the alcohol dependence without suicide group compared with controls. In the alcohol dependence with suicide group, anxiety symptoms were associated with decreased BA 24 SERT mRNA and depressive symptoms with BA 9 5HT1A mRNA expression. In the alcohol dependent only group impulsivity is correlated with increased BA 9, and BA 24 serotonin receptor 2A mRNA. Our data suggest region-specific change, rather than global serotonin blunting is involved in alcohol dependence and suicide. It also suggests that symptoms are differentially influenced by prefrontal cortex serotonin receptor mRNA levels. © 2011 John Wiley & Sons A/S.

  13. TP53 and ATM mRNA expression in skin and skeletal muscle after low-level laser exposure.

    Science.gov (United States)

    Guedes de Almeida, Luciana; Sergio, Luiz Philippe da Silva; de Paoli, Flavia; Mencalha, Andre Luiz; da Fonseca, Adenilson de Souza

    2017-08-01

    Low-level lasers are widespread in regenerative medicine, but the molecular mechanisms involved in their biological effects are not fully understood, particularly those on DNA stability. Therefore, this study aimed to investigate mRNA expression of genes related to DNA genomic stability in skin and skeletal muscle tissue from Wistar rats exposed to low-level red and infrared lasers. For this, TP53 (Tumor Protein 53) and ATM (Ataxia Telangiectasia Mutated gene) mRNA expressions were evaluated by real-time quantitative PCR (RT-qPCR) technique 24 hours after low-level red and infrared laser exposure. Our data showed that relative TP53 mRNA expression was not significantly altered in both tissues exposed to lasers. For ATM, relative mRNA expression in skin tissue was not significantly altered, but in muscle tissue, laser exposure increased relative ATM mRNA expression. Low-level red and infrared laser radiations alter ATM mRNA expression related to DNA stability in skeletal muscle tissue.

  14. Cell-free placental mRNA in maternal plasma to predict placental invasion in patients with placenta accreta.

    Science.gov (United States)

    El Behery, Manal M; Rasha L, Etewa; El Alfy, Yehya

    2010-04-01

    To evaluate whether measuring cell-free placental mRNA in maternal plasma improves the diagnostic accuracy of ultrasound and color Doppler in detecting placental invasion in patients at risk for placenta accreta. Thirty-five singleton pregnant women of more than 28 weeks of gestation and at risk for placenta accreta underwent ultrasound and color Doppler assessment. Cell-free placental mRNA in maternal plasma was measured using real-time reverse-transcription polymerase chain reaction. Patients were classified into 2 groups based on the findings at cesarean delivery and histological examination: women with placenta accreta (n=7) and women without placenta accreta (n=28). The median MoM (multiples of the median) value of cell-free placental mRNA was significantly higher in patients with placenta accreta than in those without placenta accreta (6.50 vs 2.60; Pplacental mRNA was significantly elevated in patients with placenta increta and percreta than in those with simple accreta. Six false-positive results were found on ultrasound, all from patients without placenta accreta and an insignificant rise in cell-free placental mRNA levels. Measuring cell-free placental mRNA in maternal plasma may increase the accuracy of ultrasound and color Doppler in prenatal prediction of placental invasion in patients with suspected placenta accreta. Copyright 2009 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

  15. Molecular evolution of adiponectin in Carnivora and its mRNA expression in relation to hepatic lipidosis.

    Science.gov (United States)

    Nieminen, Petteri; Rouvinen-Watt, Kirsti; Kapiainen, Suvi; Harris, Lora; Mustonen, Anne-Mari

    2010-09-15

    Adiponectin is a novel adipocyte-derived hormone with low circulating concentrations and/or mRNA expression in obesity and non-alcoholic fatty liver disease (NAFLD). The adiponectin mRNA of several Carnivora species was sequenced to enable further gene expression studies in this clade with potential experimental species to examine the connections of hypoadiponectinemia to hepatic lipidosis. In addition, adiponectin mRNA expression was studied in the retroperitoneal fat of the American mink (Neovison vison), as hepatic lipidosis with close similarities to NAFLD can be rapidly induced to the species by fasting. The mRNA expression was determined after overnight-7d of food deprivation and 28d of re-feeding and correlated to the liver fat %. The homologies between the determined carnivoran mRNA sequences and that of the domestic dog were 92.2-99.1%. As the mRNA expression was not affected by short-term fasting and did not correlate with the liver fat %, there seems to be no clear connection between adiponectin and the development of lipidosis in the American mink. In the future, the obtained sequences can be utilized in further studies of adiponectin expression in comparative endocrinology. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  16. The function of the inner nuclear envelope protein SUN1 in mRNA export is regulated by phosphorylation.

    Science.gov (United States)

    Li, Ping; Stumpf, Maria; Müller, Rolf; Eichinger, Ludwig; Glöckner, Gernot; Noegel, Angelika A

    2017-08-22

    SUN1, a component of the LINC (Linker of Nucleoskeleton and Cytoskeleton) complex, functions in mammalian mRNA export through the NXF1-dependent pathway. It associates with mRNP complexes by direct interaction with NXF1. It also binds to the NPC through association with the nuclear pore component Nup153, which is involved in mRNA export. The SUN1-NXF1 association is at least partly regulated by a protein kinase C (PKC) which phosphorylates serine 113 (S113) in the N-terminal domain leading to reduced interaction. The phosphorylation appears to be important for the SUN1 function in nuclear mRNA export since GFP-SUN1 carrying a S113A mutation was less efficient in restoring mRNA export after SUN1 knockdown as compared to the wild type protein. By contrast, GFP-SUN1-S113D resembling the phosphorylated state allowed very efficient export of poly(A)+RNA. Furthermore, probing a possible role of the LINC complex component Nesprin-2 in this process we observed impaired mRNA export in Nesprin-2 knockdown cells. This effect might be independent of SUN1 as expression of a GFP tagged SUN-domain deficient SUN1, which no longer can interact with Nesprin-2, did not affect mRNA export.

  17. FLT3-ITD and MLL-PTD influence the expression of MDR-1, MRP-1, and BCRP mRNA but not LRP mRNA assessed with RQ-PCR method in adult acute myeloid leukemia.

    Science.gov (United States)

    Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof

    2014-04-01

    Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.

  18. The pokeweed leaf mRNA transcriptome and its regulation by jasmonic acid.

    Directory of Open Access Journals (Sweden)

    Kira C.M. Neller

    2016-03-01

    Full Text Available The American pokeweed plant, Phytolacca americana, is recognized for synthesizing pokeweed antiviral protein (PAP, a ribosome inactivating protein (RIP that inhibits the replication of several plant and animal viruses. The plant is also a heavy metal accumulator with applications in soil remediation. However, little is known about pokeweed stress responses, as large-scale sequencing projects have not been performed for this species. Here, we sequenced the mRNA transcriptome of pokeweed in the presence and absence of jasmonic acid (JA, a hormone mediating plant defense. Trinity-based de novo assembly of mRNA from leaf tissue and BLASTx homology searches against public sequence databases resulted in the annotation of 59 096 transcripts. Differential expression analysis identified JA-responsive genes that may be involved in defense against pathogen infection and herbivory. We confirmed the existence of several PAP isoforms and cloned a potentially novel isoform of PAP. Expression analysis indicated that PAP isoforms are differentially responsive to JA, perhaps indicating specialized roles within the plant. Finally, we identified 52 305 natural antisense transcript pairs, four of which comprised PAP isoforms, suggesting a novel form of RIP gene regulation. This transcriptome-wide study of a Phytolaccaceae family member provides a source of new genes that may be involved in stress tolerance in this plant. The sequences generated in our study have been deposited in the SRA database under project # SRP069141.