Constraints upon the spectral indices of relic gravitational waves by LIGO S5
International Nuclear Information System (INIS)
Zhang, Y.; Tong, M. L.; Fu, Z. W.
2010-01-01
With LIGO having achieved its design sensitivity and the LIGO S5 strain data being available, constraints on the relic gravitational waves (RGWs) become realistic. The analytical spectrum of RGWs generated during inflation depends sensitively on the initial condition, which is generically described by the index β, the running index α t , and the tensor-to-scalar ratio r. By the LIGO S5 data of the cross-correlated two detectors, we obtain constraints on the parameters (β,α t ,r). As a main result, we have computed the theoretical signal-to-noise ratio of RGWs for various values of (β,α t ,r), using the cross-correlation for the given pair of LIGO detectors. The constraints by the indirect bound on the energy density of RGWs by big bang nucleosynthesis and cosmic microwave background have been obtained, which turn out to be still more stringent than LIGO S5.
International Nuclear Information System (INIS)
Dwyer, S
2015-01-01
Advanced LIGO is currently in the final stages of installation and early commissioning. In the design of Advanced LIGO a key goal was the ability to detect gravitational waves from compact object binary inspirals, as these are thought to be the most likely candidates for early detections with ground based interferometers. Special emphasis has been placed on improving the low frequency sensitivity relative to the first generations of LIGO, in addition to improving the high frequency sensitivity by increasing the laser power. The interferometer in Livingston Louisiana has been locked (continuously held within the linear operating range) and noise investigations have begun, and the major installation activities for the interferometer at Hanford, Washington are completed. (paper)
Directional limits on persistent gravitational waves using LIGO S5 science data.
Abadie, J; Abbott, B P; Abbott, R; Abernathy, M; Accadia, T; Acernese, F; Adams, C; Adhikari, R; Ajith, P; Allen, B; Allen, G S; Ceron, E Amador; Amin, R S; Anderson, S B; Anderson, W G; Antonucci, F; Arain, M A; Araya, M C; Aronsson, M; Arun, K G; Aso, Y; Aston, S M; Astone, P; Atkinson, D; Aufmuth, P; Aulbert, C; Babak, S; Baker, P; Ballardin, G; Ballmer, S; Barker, D; Barnum, S; Barone, F; Barr, B; Barriga, P; Barsotti, L; Barsuglia, M; Barton, M A; Bartos, I; Bassiri, R; Bastarrika, M; Bauchrowitz, J; Bauer, Th S; Behnke, B; Beker, M G; Belletoile, A; Benacquista, M; Bertolini, A; Betzwieser, J; Beveridge, N; Beyersdorf, P T; Bigotta, S; Bilenko, I A; Billingsley, G; Birch, J; Birindelli, S; Biswas, R; Bitossi, M; Bizouard, M A; Black, E; Blackburn, J K; Blackburn, L; Blair, D; Bland, B; Blom, M; Boccara, C; Bock, O; Bodiya, T P; Bondarescu, R; Bondu, F; Bonelli, L; Bonnand, R; Bork, R; Born, M; Bose, S; Bosi, L; Bouhou, B; Boyle, M; Braccini, S; Bradaschia, C; Brady, P R; Braginsky, V B; Brau, J E; Breyer, J; Bridges, D O; Brillet, A; Brinkmann, M; Brisson, V; Britzger, M; Brooks, A F; Brown, D A; Budzyński, R; Bulik, T; Bulten, H J; Buonanno, A; Burguet-Castell, J; Burmeister, O; Buskulic, D; Buy, C; Byer, R L; Cadonati, L; Cagnoli, G; Cain, J; Calloni, E; Camp, J B; Campagna, E; Campsie, P; Cannizzo, J; Cannon, K; Canuel, B; Cao, J; Capano, C; Carbognani, F; Caride, S; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Cella, G; Cepeda, C; Cesarini, E; Chalermsongsak, T; Chalkley, E; Charlton, P; Chassande-Mottin, E; Chelkowski, S; Chen, Y; Chincarini, A; Christensen, N; Chua, S S Y; Chung, C T Y; Clark, D; Clark, J; Clayton, J H; Cleva, F; Coccia, E; Colacino, C N; Colas, J; Colla, A; Colombini, M; Conte, R; Cook, D; Corbitt, T R; Cornish, N; Corsi, A; Costa, C A; Coulon, J-P; Coward, D M; Coyne, D C; Creighton, J D E; Creighton, T D; Cruise, A M; Culter, R M; Cumming, A; Cunningham, L; Cuoco, E; Dahl, K; Danilishin, S L; Dannenberg, R; D'Antonio, S; Danzmann, K; Das, K; Dattilo, V; Daudert, B; Davier, M; Davies, G; Davis, A; Daw, E J; Day, R; Dayanga, T; De Rosa, R; DeBra, D; Degallaix, J; del Prete, M; Dergachev, V; DeRosa, R; DeSalvo, R; Devanka, P; Dhurandhar, S; Di Fiore, L; Di Lieto, A; Di Palma, I; Di Paolo Emilio, M; Di Virgilio, A; Díaz, M; Dietz, A; Donovan, F; Dooley, K L; Doomes, E E; Dorsher, S; Douglas, E S D; Drago, M; Drever, R W P; Driggers, J C; Dueck, J; Dumas, J-C; Eberle, T; Edgar, M; Edwards, M; Effler, A; Ehrens, P; Engel, R; Etzel, T; Evans, M; Evans, T; Fafone, V; Fairhurst, S; Fan, Y; Farr, B F; Fazi, D; Fehrmann, H; Feldbaum, D; Ferrante, I; Fidecaro, F; Finn, L S; Fiori, I; Flaminio, R; Flanigan, M; Flasch, K; Foley, S; Forrest, C; Forsi, E; Fotopoulos, N; Fournier, J-D; Franc, J; Frasca, S; Frasconi, F; Frede, M; Frei, M; Frei, Z; Freise, A; Frey, R; Fricke, T T; Friedrich, D; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Galimberti, M; Gammaitoni, L; Garofoli, J A; Garufi, F; Gemme, G; Genin, E; Gennai, A; Gholami, I; Ghosh, S; Giaime, J A; Giampanis, S; Giardina, K D; Giazotto, A; Gill, C; Goetz, E; Goggin, L M; González, G; Gorodetsky, M L; Gossler, S; Gouaty, R; Graef, C; Granata, M; Grant, A; Gras, S; Gray, C; Greenhalgh, R J S; Gretarsson, A M; Greverie, C; Grosso, R; Grote, H; Grunewald, S; Guidi, G M; Gustafson, E K; Gustafson, R; Hage, B; Hall, P; Hallam, J M; Hammer, D; Hammond, G; Hanks, J; Hanna, C; Hanson, J; Harms, J; Harry, G M; Harry, I W; Harstad, E D; Haughian, K; Hayama, K; Hayau, J-F; Hayler, T; Heefner, J; Heitmann, H; Hello, P; Heng, I S; Heptonstall, A W; Hewitson, M; Hild, S; Hirose, E; Hoak, D; Hodge, K A; Holt, K; Hosken, D J; Hough, J; Howell, E J; Hoyland, D; Huet, D; Hughey, B; Husa, S; Huttner, S H; Huynh-Dinh, T; Ingram, D R; Inta, R; Isogai, T; Ivanov, A; Jaranowski, P; Johnson, W W; Jones, D I; Jones, G; Jones, R; Ju, L; Kalmus, P; Kalogera, V; Kandhasamy, S; Kanner, J B; Katsavounidis, E; Kawabe, K; Kawamura, S; Kawazoe, F; Kells, W; Keppel, D G; Khalaidovski, A; Khalili, F Y; Khazanov, E A; Kim, H; King, P J; Kinzel, D L; Kissel, J S; Klimenko, S; Kondrashov, V; Kopparapu, R; Koranda, S; Kowalska, I; Kozak, D; Krause, T; Kringel, V; Krishnamurthy, S; Krishnan, B; Królak, A; Kuehn, G; Kullman, J; Kumar, R; Kwee, P; Landry, M; Lang, M; Lantz, B; Lastzka, N; Lazzarini, A; Leaci, P; Leong, J; Leonor, I; Leroy, N; Letendre, N; Li, J; Li, T G F; Liguori, N; Lin, H; Lindquist, P E; Lockerbie, N A; Lodhia, D; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lu, P; Luan, J; Lubinski, M; Lucianetti, A; Lück, H; Lundgren, A D; Machenschalk, B; MacInnis, M; Mageswaran, M; Mailand, K; Majorana, E; Mak, C; Maksimovic, I; Man, N; Mandel, I; Mandic, V; Mantovani, M; Marchesoni, F; Marion, F; Márka, S; Márka, Z; Maros, E; Marque, J; Martelli, F; Martin, I W; Martin, R M; Marx, J N; Mason, K; Masserot, A; Matichard, F; Matone, L; Matzner, R A; Mavalvala, N; McCarthy, R; McClelland, D E; McGuire, S C; McIntyre, G; McIvor, G; McKechan, D J A; Meadors, G; Mehmet, M; Meier, T; Melatos, A; Melissinos, A C; Mendell, G; Menéndez, D F; Mercer, R A; Merill, L; Meshkov, S; Messenger, C; Meyer, M S; Miao, H; Michel, C; Milano, L; Miller, J; Minenkov, Y; Mino, Y; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Moe, B; Mohan, M; Mohanty, S D; Mohapatra, S R P; Moraru, D; Moreau, J; Moreno, G; Morgado, N; Morgia, A; Morioka, T; Mors, K; Mosca, S; Moscatelli, V; Mossavi, K; Mours, B; Mow-Lowry, C M; Mueller, G; Mukherjee, S; Mullavey, A; Müller-Ebhardt, H; Munch, J; Murray, P G; Nash, T; Nawrodt, R; Nelson, J; Neri, I; Newton, G; Nishizawa, A; Nocera, F; Nolting, D; Ochsner, E; O'Dell, J; Ogin, G H; Oldenburg, R G; O'Reilly, B; O'Shaughnessy, R; Osthelder, C; Ottaway, D J; Ottens, R S; Overmier, H; Owen, B J; Page, A; Pagliaroli, G; Palladino, L; Palomba, C; Pan, Y; Pankow, C; Paoletti, F; Papa, M A; Pardi, S; Pareja, M; Parisi, M; Pasqualetti, A; Passaquieti, R; Passuello, D; Patel, P; Pathak, D; Pedraza, M; Pekowsky, L; Penn, S; Peralta, C; Perreca, A; Persichetti, G; Pichot, M; Pickenpack, M; Piergiovanni, F; Pietka, M; Pinard, L; Pinto, I M; Pitkin, M; Pletsch, H J; Plissi, M V; Poggiani, R; Postiglione, F; Prato, M; Predoi, V; Price, L R; Prijatelj, M; Principe, M; Prix, R; Prodi, G A; Prokhorov, L; Puncken, O; Punturo, M; Puppo, P; Quetschke, V; Raab, F J; Rabeling, D S; Radke, T; Radkins, H; Raffai, P; Rakhmanov, M; Rankins, B; Rapagnani, P; Raymond, V; Re, V; Reed, C M; Reed, T; Regimbau, T; Reid, S; Reitze, D H; Ricci, F; Riesen, R; Riles, K; Roberts, P; Robertson, N A; Robinet, F; Robinson, C; Robinson, E L; Rocchi, A; Roddy, S; Röver, C; Rolland, L; Rollins, J; Romano, J D; Romano, R; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Sakata, S; Sakosky, M; Salemi, F; Sammut, L; de la Jordana, L Sancho; Sandberg, V; Sannibale, V; Santamaría, L; Santostasi, G; Saraf, S; Sassolas, B; Sathyaprakash, B S; Sato, S; Satterthwaite, M; Saulson, P R; Savage, R; Schilling, R; Schnabel, R; Schofield, R M S; Schulz, B; Schutz, B F; Schwinberg, P; Scott, J; Scott, S M; Searle, A C; Seifert, F; Sellers, D; Sengupta, A S; Sentenac, D; Sergeev, A; Shaddock, D A; Shapiro, B; Shawhan, P; Shoemaker, D H; Sibley, A; Siemens, X; Sigg, D; Singer, A; Sintes, A M; Skelton, G; Slagmolen, B J J; Slutsky, J; Smith, J R; Smith, M R; Smith, N D; Somiya, K; Sorazu, B; Speirits, F C; Sperandio, L; Stein, A J; Stein, L C; Steinlechner, S; Steplewski, S; Stochino, A; Stone, R; Strain, K A; Strigin, S; Stroeer, A S; Sturani, R; Stuver, A L; Summerscales, T Z; Sung, M; Susmithan, S; Sutton, P J; Swinkels, B; Szokoly, G P; Talukder, D; Tanner, D B; Tarabrin, S P; Taylor, J R; Taylor, R; Thomas, P; Thorne, K A; Thorne, K S; Thrane, E; Thüring, A; Titsler, C; Tokmakov, K V; Toncelli, A; Tonelli, M; Torre, O; Torres, C; Torrie, C I; Tournefier, E; Travasso, F; Traylor, G; Trias, M; Trummer, J; Tseng, K; Turner, L; Ugolini, D; Urbanek, K; Vahlbruch, H; Vaishnav, B; Vajente, G; Vallisneri, M; van den Brand, J F J; Van Den Broeck, C; van der Putten, S; van der Sluys, M V; van Veggel, A A; Vass, S; Vaulin, R; Vavoulidis, M; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Veltkamp, C; Verkindt, D; Vetrano, F; Viceré, A; Villar, A E; Vinet, J-Y; Vocca, H; Vorvick, C; Vyachanin, S P; Waldman, S J; Wallace, L; Wanner, A; Ward, R L; Was, M; Wei, P; Weinert, M; Weinstein, A J; Weiss, R; Wen, L; Wen, S; Wessels, P; West, M; Westphal, T; Wette, K; Whelan, J T; Whitcomb, S E; White, D; Whiting, B F; Wilkinson, C; Willems, P A; Williams, L; Willke, B; Winkelmann, L; Winkler, W; Wipf, C C; Wiseman, A G; Woan, G; Wooley, R; Worden, J; Yakushin, I; Yamamoto, H; Yamamoto, K; Yeaton-Massey, D; Yoshida, S; Yu, P; Yvert, M; Zanolin, M; Zhang, L; Zhang, Z; Zhao, C; Zotov, N; Zucker, M E; Zweizig, J
2011-12-30
The gravitational-wave (GW) sky may include nearby pointlike sources as well as stochastic backgrounds. We perform two directional searches for persistent GWs using data from the LIGO S5 science run: one optimized for pointlike sources and one for arbitrary extended sources. Finding no evidence to support the detection of GWs, we present 90% confidence level (C.L.) upper-limit maps of GW strain power with typical values between 2-20×10(-50) strain(2) Hz(-1) and 5-35×10(-49) strain(2) Hz(-1) sr(-1) for pointlike and extended sources, respectively. The latter result is the first of its kind. We also set 90% C.L. limits on the narrow-band root-mean-square GW strain from interesting targets including Sco X-1, SN 1987A and the Galactic center as low as ≈7×10(-25) in the most sensitive frequency range near 160 Hz.
All-sky LIGO search for periodic gravitational waves in the early fifth-science-run data.
Abbott, B P; Abbott, R; Adhikari, R; Ajith, P; Allen, B; Allen, G; Amin, R S; Anderson, S B; Anderson, W G; Arain, M A; Araya, M; Armandula, H; Armor, P; Aso, Y; Aston, S; Aufmuth, P; Aulbert, C; Babak, S; Baker, P; Ballmer, S; Bantilan, H; Barish, B C; Barker, C; Barker, D; Barr, B; Barriga, P; Barsotti, L; Barton, M A; Bartos, I; Bassiri, R; Bastarrika, M; Behnke, B; Benacquista, M; Betzwieser, J; Beyersdorf, P T; Bilenko, I A; Billingsley, G; Biswas, R; Black, E; Blackburn, J K; Blackburn, L; Blair, D; Bland, B; Bodiya, T P; Bogue, L; Bork, R; Boschi, V; Bose, S; Brady, P R; Braginsky, V B; Brau, J E; Brinkmann, M; Brooks, A F; Brown, D A; Brunet, G; Bullington, A; Buonanno, A; Burmeister, O; Byer, R L; Cadonati, L; Cagnoli, G; Camp, J B; Cannizzo, J; Cannon, K C; Cao, J; Cardenas, L; Cardoso, V; Caride, S; Casebolt, T; Castaldi, G; Caudill, S; Cavaglià, M; Cepeda, C; Chalkley, E; Charlton, P; Chatterji, S; Chelkowski, S; Chen, Y; Christensen, N; Clark, D; Clark, J; Clayton, J H; Cokelaer, T; Conte, R; Cook, D; Corbitt, T R C; Cornish, N; Coyne, D C; Creighton, J D E; Creighton, T D; Cruise, A M; Cumming, A; Cunningham, L; Cutler, R M; Danzmann, K; Daudert, B; Davies, G; Debra, D; Degallaix, J; Dergachev, V; Desai, S; Desalvo, R; Dhurandhar, S; Díaz, M; Dickson, J; Dietz, A; Donovan, F; Dooley, K L; Doomes, E E; Drever, R W P; Duke, I; Dumas, J-C; Dwyer, J; Echols, C; Edgar, M; Effler, A; Ehrens, P; Ely, G; Espinoza, E; Etzel, T; Evans, M; Evans, T; Fairhurst, S; Faltas, Y; Fan, Y; Fazi, D; Fejer, M M; Finn, L S; Flasch, K; Foley, S; Forrest, C; Fotopoulos, N; Franzen, A; Frei, Z; Freise, A; Frey, R; Fricke, T T; Fritschel, P; Frolov, V V; Fyffe, M; Garofoli, J A; Gholami, I; Giaime, J A; Giampanis, S; Giardina, K D; Goda, K; Goetz, E; Goggin, L M; González, G; Gossler, S; Gouaty, R; Grant, A; Gras, S; Gray, C; Gray, M; Greenhalgh, R J S; Gretarsson, A M; Grimaldi, F; Grosso, R; Grote, H; Grunewald, S; Guenther, M; Gustafson, E K; Gustafson, R; Hage, B; Hallam, J M; Hanna, C; Hanson, J; Harms, J; Harry, G M; Harstad, E D; Haughian, E; Hayama, K; Hayler, T; Heefner, J; Heng, I S; Heptonstall, A; Hewitson, M; Hild, S; Hirose, E; Hoak, D; Holt, K; Hosken, D; Hough, J; Huttner, S H; Ingram, D; Ito, M; Ivanov, A; Johnson, B; Johnson, W W; Jones, D I; Jones, G; Jones, R; Ju, L; Kalmus, P; Kalogera, V; Kamat, S; Kanner, J; Kasprzyk, D; Katsavounidis, E; Kawabe, K; Kawamura, S; Kawazoe, F; Kells, W; Keppel, D G; Khalaidovski, A; Khalili, F Ya; Khan, R; Khazanov, E; King, P; Kissel, J S; Klimenko, S; Kocsis, B; Kokeyama, K; Kondrashov, V; Kopparapu, R; Koranda, S; Kozak, D; Kozhevatov, I; Krishnan, B; Kwee, P; Landry, M; Lantz, B; Lazzarini, A; Lei, M; Leonor, I; Li, C; Lin, H; Lindquist, P E; Littenberg, T B; Lockerbie, N A; Lodhia, D; Lormand, M; Lu, P; Lubinski, M; Lucianetti, A; Lück, H; Machenschalk, B; Macinnis, M; Mageswaran, M; Mailand, K; Mandel, I; Mandic, V; Márka, S; Márka, Z; Markosyan, A; Markowitz, J; Maros, E; Martin, I W; Martin, R M; Marx, J N; Mason, K; Matichard, F; Matone, L; Matzner, R; Mavalvala, N; McCarthy, R; McClelland, D E; McGuire, S C; McHugh, M; McIntyre, G; McKechan, D; McKenzie, K; Mehmet, M; Melissinos, A; Mendell, G; Mercer, R A; Meshkov, S; Messenger, C J; Meyers, D; Miller, A; Miller, J; Minelli, J; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Miyakawa, O; Moe, B; Mohanty, S D; Moreno, G; Mors, K; Mossavi, K; Mowlowry, C; Mueller, G; Muhammad, D; Mukherjee, S; Mukhopadhyay, H; Mullavey, A; Müller-Ebhardt, H; Munch, J; Murray, P G; Myers, E; Myers, J; Nash, T; Nelson, J; Newton, G; Nishizawa, A; Numata, K; Ochsner, E; O'Dell, J; Ogin, G; O'Reilly, B; O'Shaughnessy, R; Ottaway, D J; Ottens, R S; Overmier, H; Owen, B J; Pan, Y; Pankow, C; Papa, M A; Parameshwaraiah, V; Patel, P; Pedraza, M; Penn, S; Perraca, A; Petrie, T; Pinto, I M; Pitkin, M; Pletsch, H J; Plissi, M V; Postiglione, F; Principe, M; Prix, R; Quetschke, V; Raab, F J; Rabeling, D S; Radkins, H; Raffai, P; Rainer, N; Rakhmanov, M; Ramsunder, M; Reed, T; Rehbein, H; Reid, S; Reitze, D H; Riesen, R; Riles, K; Rivera, B; Robertson, N A; Robinson, C; Robinson, E L; Roddy, S; Rogan, A M; Rollins, J; Romano, J D; Romie, J H; Rowan, S; Rüdiger, A; Ruet, L; Russell, P; Ryan, K; Sakata, S; Sancho de la Jordana, L; Sandberg, V; Sannibale, V; Santamaria, L; Saraf, S; Sarin, P; Sathyaprakash, B S; Sato, S; Saulson, P R; Savage, R; Savov, P; Scanlan, M; Schediwy, S W; Schilling, R; Schnabel, R; Schofield, R; Schutz, B F; Schwinberg, P; Scott, J; Scott, S M; Searle, A C; Sears, B; Seifert, F; Sellers, D; Sengupta, A S; Sergeev, A; Shapiro, B; Shawhan, P; Shoemaker, D H; Sibley, A; Siemens, X; Sigg, D; Sinha, S; Sintes, A M; Slagmolen, B J J; Slutsky, J; Smith, J R; Smith, M R; Smith, N D; Somiya, K; Sorazu, B; Stein, L C; Strain, K A; Stuver, A; Summerscales, T Z; Sun, K-X; Sung, M; Sutton, P J; Takahashi, H; Tanner, D B; Taylor, R; Taylor, R; Thacker, J; Thorne, K A; Thorne, K S; Thüring, A; Tokmakov, K V; Torres, C; Torrie, C; Traylor, G; Trias, M; Ugolini, D; Urbanek, K; Vahlbruch, H; Van Den Broeck, C; van der Sluys, M V; van Veggel, A A; Vass, S; Vaulin, R; Vecchio, A; Veitch, J D; Veitch, P; Villar, A; Vorvick, C; Vyachanin, S P; Waldman, S J; Wallace, L; Ward, H; Ward, R L; Weinert, M; Weinstein, A J; Weiss, R; Wen, L; Wen, S; Wette, K; Whelan, J T; Whitcomb, S E; Whiting, B F; Wilkinson, C; Willems, P A; Williams, H R; Williams, L; Willke, B; Wilmut, I; Winkler, W; Wipf, C C; Wiseman, A G; Woan, G; Wooley, R; Worden, J; Wu, W; Yakushin, I; Yamamoto, H; Yan, Z; Yoshida, S; Zanolin, M; Zhang, J; Zhang, L; Zhao, C; Zotov, N; Zucker, M E; Zur Mühlen, H; Zweizig, J
2009-03-20
We report on an all-sky search with the LIGO detectors for periodic gravitational waves in the frequency range 50-1100 Hz and with the frequency's time derivative in the range -5 x 10{-9}-0 Hz s{-1}. Data from the first eight months of the fifth LIGO science run (S5) have been used in this search, which is based on a semicoherent method (PowerFlux) of summing strain power. Observing no evidence of periodic gravitational radiation, we report 95% confidence-level upper limits on radiation emitted by any unknown isolated rotating neutron stars within the search range. Strain limits below 10{-24} are obtained over a 200-Hz band, and the sensitivity improvement over previous searches increases the spatial volume sampled by an average factor of about 100 over the entire search band. For a neutron star with nominal equatorial ellipticity of 10{-6}, the search is sensitive to distances as great as 500 pc.
Antonella Del Rosso
2016-01-01
Twenty years of designing, building and testing a number of innovative technologies, with the strong belief that the endeavour would lead to a historic breakthrough. The Bulletin publishes an abstract of the Courier’s interview with Barry Barish, one of the founding fathers of LIGO. The plots show the signals of gravitational waves detected by the twin LIGO observatories at Livingston, Louisiana, and Hanford, Washington. (Image: Caltech/MIT/LIGO Lab) On 11 February, the Laser Interferometer Gravitational-Wave Observatory (LIGO) and Virgo collaborations published a historic paper in which they showed a gravitational signal emitted by the merger of two black holes. These results come after 20 years of hard work by a large collaboration of scientists operating the two LIGO observatories in the US. Barry Barish, Linde Professor of Physics, Emeritus at the California Institute of Technology and former Director of the Global Design Effort for the Internat...
Report on the search for binary black holes inspiral in S3 LIGO data
International Nuclear Information System (INIS)
Cokelaer, Thomas
2006-01-01
We report on the search for gravitational waves emitted by non-spinning binary black hole inspirals in the data taken during the third LIGO science run (S3). We give an overview of the data acquired during S3 and the target waveforms that we are searching for in this analysis. We briefly describe how the data was filtered using a BCV detection template family (using an hexagonal template bank placement in the mass parameter plane). Finally, we report on preliminary estimates of the sensitivity of the three LIGO detectors using software injections of effective one-body waveforms with component masses in the range 3-40 M o-dot and total mass M ≤ 40 M o-dot . We show that during S3, the three LIGO detectors have a detection efficiency of 50% up to several Mpc for L1 and H2, and up to 30 Mpc for H1
LIGO Finds Lightest Black-Hole Binary
Kohler, Susanna
2017-11-01
Wednesdayevening the Laser Interferometer Gravitational-wave Observatory (LIGO) collaboration quietly mentioned that theyd found gravitational waves from yet another black-hole binary back in June. This casual announcement reveals what is so far the lightest pair of black holes weve watched merge opening the door for comparisons to the black holes weve detected by electromagnetic means.A Routine DetectionThe chirp signal of GW170608 detected by LIGO Hanford and LIGO Livingston. [LIGO collaboration 2017]After the fanfare of the previous four black-hole-binary merger announcements over the past year and a half as well as the announcement of the one neutron-star binary merger in August GW170608 marks our entry into the era in which gravitational-wave detections are officially routine.GW170608, a gravitational-wave signal from the merger of two black holes roughly a billion light-years away, was detected in June of this year. This detection occurred after wed already found gravitational waves from several black-hole binaries with the two LIGO detectors in the U.S., but before the Virgo interferometer came online in Europe and increased the joint ability of the detectors to localize sources.Mass estimates for the two components of GW170608 using different models. [LIGO collaboration 2017]Overall, GW170608 is fairly unremarkable: it was detected by both LIGO Hanford and LIGO Livingston some 7 ms apart, and the signal looks not unlike those of the previous LIGO detections. But because were still in the early days of gravitational-wave astronomy, every discovery is still remarkable in some way! GW170608 stands out as being the lightest pair of black holes weve yet to see merge, with component masses before the merger estimated at 12 and 7 times the mass of the Sun.Why Size MattersWith the exception of GW151226, the gravitational-wave signal discovered on Boxing Day last year, all of the black holes that have been discovered by LIGO/Virgo have been quite large: the masses
Fermi Observations of the LIGO Event GW170104
Energy Technology Data Exchange (ETDEWEB)
Goldstein, A.; Cleveland, W. H.; Connaughton, V. [Science and Technology Institute, Universities Space Research Association, Huntsville, AL 35805 (United States); Veres, P.; Briggs, M. S.; Hamburg, R.; Jenke, P. A.; Bhat, N. [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, 320 Sparkman Drive, Huntsville, AL 35899 (United States); Burns, E.; Canton, T. Dal [NASA Postdoctoral Program Fellow, Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Blackburn, L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Christensen, N. [Physics and Astronomy, Carleton College, MN, 55057 (United States); Hui, C. M.; Kocevski, D.; Wilson-Hodge, C. A. [Astrophysics Office, ST12, NASA/Marshall Space Flight Center, Huntsville, AL 35812 (United States); Preece, R. D. [Department of Space Science, University of Alabama in Huntsville, 320 Sparkman Drive, Huntsville, AL 35899 (United States); Siellez, K. [Center for Relativistic Astrophysics and School of Physics, Georgia Institute of Technology, Atlanta, GA 30332 (United States); Veitch, J. [University of Birmingham, Birmingham B15 2TT (United Kingdom); Bissaldi, E. [Istituto Nazionale di Fisica Nucleare, Sezione di Bari, I-70126 Bari (Italy); Gibby, M. H., E-mail: kocevski@slac.stanford.edu, E-mail: melissa.pesce.rollins@pi.infn.it, E-mail: nicola.omodei@stanford.edu, E-mail: giacomov@slac.stanford.edu [Jacobs Technology, Inc., Huntsville, AL (United States); Collaboration: (Fermi-LAT Collaboration); and others
2017-09-01
We present the Fermi Gamma-ray Burst Monitor (GBM) and Large Area Telescope (LAT) observations of the LIGO binary black hole merger (BBH) event GW170104. No candidate electromagnetic counterpart was detected by either GBM or LAT. A detailed analysis of the GBM and LAT data over timescales from seconds to days covering the Laser Interferometer Gravitational-wave Observatory (LIGO) localization region is presented. The resulting flux upper bound from the GBM is (5.2–9.4) × 10{sup −7} erg cm{sup −2} s{sup −1} in the 10–1000 keV range and from the LAT is (0.2–90) × 10{sup −9} erg cm{sup −2} s{sup −1} in the 0.1–1 GeV range. We also describe the improvements to our automated pipelines and analysis techniques for searching for and characterizing the potential electromagnetic counterparts for future gravitational-wave events from Advanced LIGO/Virgo.
Accessibility of the pre-big-bang models to LIGO
International Nuclear Information System (INIS)
Mandic, Vuk; Buonanno, Alessandra
2006-01-01
The recent search for a stochastic background of gravitational waves with LIGO interferometers has produced a new upper bound on the amplitude of this background in the 100 Hz region. We investigate the implications of the current and future LIGO results on pre-big-bang models of the early Universe, determining the exclusion regions in the parameter space of the minimal pre-big-bang scenario. Although the current LIGO reach is still weaker than the indirect bound from big bang nucleosynthesis, future runs by LIGO, in the coming year, and by Advanced LIGO (∼2009) should further constrain the parameter space, and in some parts surpass the Big Bang nucleosynthesis bound. It will be more difficult to constrain the parameter space in nonminimal pre-big bang models, which are characterized by multiple cosmological phases in the yet not well understood stringy phase, and where the higher-order curvature and/or quantum-loop corrections in the string effective action should be included
Indian Academy of Sciences (India)
IAS Admin
up to a much wider community of young scientists and engi- neers, in building and .... three detectors were upgraded in the Advanced LIGO project funded by NSF, it was clear .... The LIGO Lab USA is committed to share and provide detailed ...
Control strategy to limit duty cycle impact of earthquakes on the LIGO gravitational-wave detectors
Biscans, S.; Warner, J.; Mittleman, R.; Buchanan, C.; Coughlin, M.; Evans, M.; Gabbard, H.; Harms, J.; Lantz, B.; Mukund, N.; Pele, A.; Pezerat, C.; Picart, P.; Radkins, H.; Shaffer, T.
2018-03-01
Advanced gravitational-wave detectors such as the laser interferometer gravitational-wave observatories (LIGO) require an unprecedented level of isolation from the ground. When in operation, they measure motion of less than 10‑19 m. Strong teleseismic events like earthquakes disrupt the proper functioning of the detectors, and result in a loss of data. An earthquake early-warning system, as well as a prediction model, have been developed to understand the impact of earthquakes on LIGO. This paper describes a control strategy to use this early-warning system to reduce the LIGO downtime by ∼30%. It also presents a plan to implement this new earthquake configuration in the LIGO automation system.
Effectively Using Social Media for Research: A LIGO Detection Case Study
Stuver, Amber
The Laser Interferometer Gravitational-Wave Observatory (LIGO) made the first direct detection of gravitational waves on 14 Sep. 2015 and publically announced its findings on 11 Feb. 2016 in a press conference that coincided with the publication of the referred result. In the intervening 5 months, while the detection was being vetted and the paper written, the LIGO Laboratory and the LIGO Education and Public Outreach working group put together a multifaceted media campaign to explain the science and significance of the event to the public. Social media played a vital role in disseminating the news and educational products of the campaign. In the days leading up to the announcement, social media (Twitter and Facebook) was used to build buzz for the announcement. On the day of the announcement, original posts were carefully planned every 10-15 minutes to promote continued interest and prevent information overload. This campaign continued until the end of the month, with decreasing post frequency. Ultimately, over 70 million aggregated Twitter posts were made with at least one of the following hashtags: #gravitationalwaves, #LIGO, or #EinsteinWasRight. In the month following the announcement, the LIGO Facebook page reached 1.5 million people who shared information from the page over 7000 times. LIGO also made use of other forms of social media such as blog articles contributed by LIGO Scientific Collaboration members discussing different aspects of the discovery (from the science to personal experience), a Reddit ``Ask Me Anything'' (AMA) session where LIGO scientists were able to answer 90% of the 923 submitted questions in the allotted time, by collaborating with the Astronomy Picture of the Day (APOD) to feature an educational image and caption on the detection, and an open, and still active, email address (question@ligo.org) where hundreds of questions submitted by the public have already been personally addressed. On behalf of the LIGO Scientific Collaboration.
Stochastic background search correlating ALLEGRO with LIGO engineering data
Energy Technology Data Exchange (ETDEWEB)
Whelan, John T [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Daw, Edward [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Heng, Ik Siong [Max-Planck-Institut fuer Gravitationsphysik, Albert-Einstein-Institut, Aussenstelle Hannover, D-30167 Hannover (Germany); McHugh, Martin P [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Lazzarini, Albert [LIGO Laboratory, California Institute of Technology, Pasadena, CA 91125 (United States)
2003-09-07
We describe the role of correlation measurements between the LIGO interferometer in Livingston, LA, and the ALLEGRO resonant bar detector in Baton Rouge, LA, in searches for a stochastic background of gravitational waves. Such measurements provide a valuable complement to correlations between interferometers at the two LIGO sites, since they are sensitive in a different, higher, frequency band. Additionally, the variable orientation of the ALLEGRO detector provides a means to distinguish gravitational wave correlations from correlated environmental noise. We describe the analysis underway to set a limit on the strength of a stochastic background at frequencies near 900 Hz using ALLEGRO data and data from LIGO's E7 Engineering Run.
The LSC glitch group: monitoring noise transients during the fifth LIGO science run
Energy Technology Data Exchange (ETDEWEB)
Blackburn, L; Katsavounidis, E [LIGO-Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Cadonati, L [University of Massachusetts, Amherst, MA 01003 (United States); Caride, S; Christensen, N; Ely, G; Isogai, T [Carleton College, Northfield, MN 55057 (United States); Caudill, S; Gonzalez, G; Gouaty, R; Kissel, J [Louisiana State University, Baton Rouge, LA 70803 (United States); Chatterji, S; Goggin, L [LIGO-California Institute of Technology, Pasadena, CA 91125 (United States); Dalrymple, J; Credico, A Di [Syracuse University, Syracuse, NY 13244 (United States); Desai, S [The Pennsylvania State University, University Park, PA 16802 (United States); Garofoli, J; Gray, C [LIGO Hanford Observatory, Richland, WA 99352 (United States); Gretarsson, A [Embry-Riddle Aeronautical University, Prescott, AZ 86301 (United States); Hoak, D [LIGO Livingston Observatory, Livingston, LA 70754 (United States)], E-mail: desai@gravity.psu.edu (and others)
2008-09-21
The LIGO Scientific Collaboration (LSC) glitch group is part of the LIGO detector characterization effort. It consists of data analysts and detector experts who, during and after science runs, collaborate for a better understanding of noise transients in the detectors. Goals of the glitch group during the fifth LIGO science run (S5) included (1) offline assessment of the detector data quality, with focus on noise transients, (2) veto recommendations for astrophysical analysis and (3) feedback to the commissioning team on anomalies seen in gravitational wave and auxiliary data channels. Other activities included the study of auto-correlation of triggers from burst searches, stationarity of the detector noise and veto studies. The group identified causes for several noise transients that triggered false alarms in the gravitational wave searches; the times of such transients were identified and vetoed from the data generating the LSC astrophysical results.
Advanced LIGO: sources and astrophysics
International Nuclear Information System (INIS)
Creighton, Teviet
2003-01-01
Second-generation detectors in LIGO will take us from the discovery phase of gravitational-wave observations to the phase of true gravitational-wave astrophysics, with hundreds or thousands of potential sources. This paper surveys the most likely and interesting potential sources for Advanced LIGO, and the astrophysical processes that each one will probe. I conclude that binary inspiral signals are expected, while continuous signals from pulsars are plausible but not guaranteed. Other sources, such as core-collapse bursts, cosmic strings and primordial stochastic backgrounds, are speculative sources for Advanced LIGO, but also potentially the most interesting, since they push the limits of our theoretical knowledge
The path to the enhanced and advanced LIGO gravitational-wave detectors
International Nuclear Information System (INIS)
Smith, J R
2009-01-01
We report on the status of the Laser Interferometric Gravitational-Wave Observatory (LIGO) and the plans and progress toward Enhanced and Advanced LIGO. The initial LIGO detectors have finished a two-year long data run during which a full year of triple-coincidence data was collected at design sensitivity. Much of this run was also coincident with the data runs of interferometers in Europe, GEO600 and Virgo. The joint analysis of data from this international network of detectors is ongoing. No gravitational wave signals have been detected in analyses completed to date. Currently two of the LIGO detectors are being upgraded to increase their sensitivity in a program called Enhanced LIGO. The Enhanced LIGO detectors will start another roughly one-year long data run with increased sensitivity in 2009. In parallel, construction of Advanced LIGO, a major upgrade to LIGO, has begun. Installation and commissioning of Advanced LIGO hardware at the LIGO sites will commence at the end of the Enhanced LIGO data run in 2011. When fully commissioned, the Advanced LIGO detectors will be ten times as sensitive as the initial LIGO detectors. Advanced LIGO is expected to make several gravitational-wave detections per year.
Advanced LIGO: the next generation of gravitational wave detectors
International Nuclear Information System (INIS)
Harry, Gregory M
2010-01-01
The Advanced LIGO gravitational wave detectors are next generation instruments which will replace the existing initial LIGO detectors. They are currently being constructed and installed. Advanced LIGO strain sensitivity is designed to be about a factor 10 better than initial LIGO over a broad band and usable to 10 Hz, in contrast to 40 Hz for initial LIGO. This is expected to allow for detections and significant astrophysics in most categories of gravitational waves. To achieve this sensitivity, all hardware subsystems are being replaced with improvements. Designs and expected performance are presented for the seismic isolation, suspensions, optics and laser subsystems. Possible enhancements to Advanced LIGO, either to resolve problems that may arise and/or to allow for improved performance, are now being researched. Some of these enhancements are discussed along with some potential technology being considered for detectors beyond Advanced LIGO.
The Advanced LIGO timing system
International Nuclear Information System (INIS)
Bartos, Imre; Factourovich, Maxim; Marka, Szabolcs; Marka, Zsuzsa; Raics, Zoltan; Bork, Rolf; Heefner, Jay; Schwinberg, Paul; Sigg, Daniel
2010-01-01
Gravitational wave detection using a network of detectors relies upon the precise time stamping of gravitational wave signals. The relative arrival times between detectors are crucial, e.g. in recovering the source direction, an essential step in using gravitational waves for multi-messenger astronomy. Due to the large size of gravitational wave detectors, timing at different parts of a given detector also needs to be highly synchronized. In general, the requirement toward the precision of timing is determined such that, upon detection, the deduced (astro-) physical results should not be limited by the precision of timing. The Advanced LIGO optical timing distribution system is designed to provide UTC-synchronized timing information for the Advanced LIGO detectors that satisfies the above criterium. The Advanced LIGO timing system has modular structure, enabling quick and easy adaptation to the detector frame as well as possible changes or additions of components. It also includes a self-diagnostics system that enables the remote monitoring of the status of timing. After the description of the Advanced LIGO timing system, several tests are presented that demonstrate its precision and robustness.
All-sky search for long-duration gravitational wave transients with initial LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Amariutei, D. V.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Belczynski, C.; Bell, A. S.; Bell, J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, C. D.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Bork, R.; Boschi, V.; Bose, S.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J. M.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunwald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Namjun; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Pereira, R.R.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, M.; Pitkin, M.; Poggiani, R.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toeyrae, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; van der Schaaf, L.; van der Sluys, M. V.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
We present the results of a search for long-duration gravitational wave transients in two sets of data collected by the LIGO Hanford and LIGO Livingston detectors between November 5, 2005 and September 30, 2007, and July 7, 2009 and October 20, 2010, with a total observational time of 283.0 days and
Alignment sensing and control in advanced LIGO
International Nuclear Information System (INIS)
Barsotti, L; Evans, M; Fritschel, P
2010-01-01
The advanced LIGO detectors are currently in their final design stage, and the installation phase will start at the end of 2010: they will have about 10 times better sensitivity than initial LIGO, with a sensitive band ranging from 10 Hz to 10 kHz. As compared with previous LIGO detectors, there will be increased complexity in the optical configuration, improved seismic isolation system and significantly higher power circulating in the arm cavities. In the new detectors, the control of the angular orientation of the mirrors will be particularly challenging. The advanced LIGO (aLIGO) mirrors need to have a residual angular motion of the order of 1 nrad RMS in order to achieve high sensitivity. In the high power regime, the torque induced by radiation pressure effects will be comparable with the restoring torque of the mirror suspension, such that we must think of the opto-mechanical response, instead of just the mechanical response. These modifications have to be considered in order to design the control strategy for keeping the mirrors well aligned. Moreover, to meet the sensitivity target the alignment control noise coupled to the gravitational-wave channel must be well below 6x10 -18 m/√Hz at 10 Hz. We developed a model of the alignment sensing and control scheme of aLIGO which takes into account radiation pressure effects and meets the noise target.
LIGO sensing system performance
Landry, M
2002-01-01
The optical sensing subsystem of a LIGO interferometer is described. The system includes two complex interferometric sensing schemes to control test masses in length and alignment. The length sensing system is currently employed on all LIGO interferometers to lock coupled cavities on resonance. Auto-alignment is to be accomplished by a wavefront-sensing scheme which automatically corrects for angular fluctuations of the test masses. Improvements in lock stability and duration are noted when the wavefront auto-alignment system is employed. Preliminary results from the commissioning of the 2 km detector in Washington are shown.
Limits on runaway growth of intermediate mass black holes from advanced LIGO
Kovetz, Ely D.; Cholis, Ilias; Kamionkowski, Marc; Silk, Joseph
2018-06-01
There is growing evidence that intermediate-mass black holes (IMBHs), defined here as having a mass in the range M =500 -105 M⊙ , are present in the dense centers of certain globular clusters (GCs). Gravitational waves from their mergers with other IMBHs or with stellar BHs in the cluster are mostly emitted in frequencies ≲10 Hz , which unfortunately is out of reach for current ground-based observatories such as advanced LIGO (aLIGO). Nevertheless, we show that aLIGO measurements can be used to efficiently probe one of the possible formation mechanisms of IMBHs in GCs, namely a runaway merger process of stellar seed BHs. In this case, aLIGO will be sensitive to the lower-mass rungs of the merger ladder, ranging from the seed BH mass to masses ≳50 - 300 M⊙ , where the background from standard mergers is expected to be very low. Assuming this generic IMBH formation scenario, we calculate the mass functions that correspond to the limiting cases of possible merger trees. Based on estimates for the number density of GCs and taking into account the instrumental sensitivity, we show that current observations do not effectively limit the occupation fraction focc of IMBHs formed by runaway mergers of stellar BHs in GCs. However, we find that if runaway mergers occur steadily throughout the lifetimes of GCs (as opposed to happening mainly early in their lifetimes), then a six-year run of aLIGO at design sensitivity will be able to probe down to focc≲3 % at a 99.9% confidence level, either finding evidence for this formation mechanism, or necessitating others if the fraction of GCs that harbor IMBHs is higher.
Progress on stochastic background search codes for LIGO
International Nuclear Information System (INIS)
Whelan, John T; Anderson, Warren G; Casquette, Martha; Diaz, Mario C; Heng, Ik Siong; McHugh, Martin; Romano, Joseph D; Jr, Charlie W Torres; Trejo, Rosa M; Vecchio, Alberto
2002-01-01
One of the types of signals for which the LIGO interferometric gravitational wave detectors will search is a stochastic background of gravitational radiation. We review the technique of searching for a background using the optimally filtered cross-correlation statistic, and describe the state of plans to perform such cross-correlations between the two LIGO interferometers as well as between LIGO and other gravitational-wave detectors, in particular the preparation of software to perform such data analysis
Where are LIGO's Big Black Holes?
Fishbach, Maya; Holz, Daniel E.
2018-01-01
In LIGO's O1 and O2 observational runs, the detectors were sensitive to stellar mass binary black hole coalescences with component masses up to 100 M⊙, with binaries with primary masses above 40 M⊙ representing over 90% of the total accessible sensitive volume. Nonetheless, of the first 3.9 LIGO detections (GW150914, GW151226, GW170104, and LVT151012), the most massive binary detected was GW150914 with a primary component mass of ~ 36 M⊙ far below the detection mass limit. Furthermore, there are theoretical arguments in favor of an upper mass gap, predicting an absence of black holes in the mass range 50 constraints on the shape of the underlying mass distribution of LIGO's binary black holes. We fit a power-law distribution with an upper mass cutoff to real and simulated BBH mass measurements, finding that the first four detections favor shallow power law slopes α < 3 and an upper mass cutoff Mmax ~ 40 M⊙. We show that with ~10 additional LIGO BBH detections, fitting the BH mass distribution will provide strong evidence for an upper mass gap if one exists.
Increasing LIGO sensitivity by feedforward subtraction of auxiliary length control noise
International Nuclear Information System (INIS)
Meadors, Grant David; Riles, Keith; Kawabe, Keita
2014-01-01
LIGO, the Laser Interferometer Gravitational-wave Observatory, has been designed and constructed to measure gravitational wave strain via differential arm length. The LIGO 4 km Michelson arms with Fabry–Perot cavities have auxiliary length control servos for suppressing Michelson motion of the beam-splitter and arm cavity input mirrors, which degrades interferometer sensitivity. We demonstrate how a post facto pipeline improves a data sample from LIGO Science Run 6 with feedforward subtraction. Dividing data into 1024 s windows, we numerically fit filter functions representing the frequency-domain transfer functions from Michelson length channels into the gravitational-wave strain data channel for each window, then subtract the filtered Michelson channel noise (witness) from the strain channel (target). In this paper we describe the algorithm, assess achievable improvements in sensitivity to astrophysical sources, and consider relevance to future interferometry. (paper)
Joint LIGO and TAMA300 search for gravitational waves from inspiralling neutron star binaries
International Nuclear Information System (INIS)
Abbott, B.; Abbott, R.; Adhikari, R.; Agresti, J.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bork, R.; Brown, D.A.; Busby, D.; Cardenas, L.; Chandler, A.
2006-01-01
We search for coincident gravitational wave signals from inspiralling neutron star binaries using LIGO and TAMA300 data taken during early 2003. Using a simple trigger exchange method, we perform an intercollaboration coincidence search during times when TAMA300 and only one of the LIGO sites were operational. We find no evidence of any gravitational wave signals. We place an observational upper limit on the rate of binary neutron star coalescence with component masses between 1 and 3M · of 49 per year per Milky Way equivalent galaxy at a 90% confidence level. The methods developed during this search will find application in future network inspiral analyses
Searches for gravitational waves from known pulsars with Science Run 5 LIGO data
Abbott, B.P.; et al., [Unknown; Hessels, J.W.T.
2010-01-01
We present a search for gravitational waves from 116 known millisecond and young pulsars using data from the fifth science run of the LIGO detectors. For this search, ephemerides overlapping the run period were obtained for all pulsars using radio and X-ray observations. We demonstrate an updated
Zevin, M; Coughlin, S; Bahaadini, S; Besler, E; Rohani, N; Allen, S; Cabero, M; Crowston, K; Katsaggelos, A K; Larson, S L; Lee, T K; Lintott, C; Littenberg, T B; Lundgren, A; Østerlund, C; Smith, J R; Trouille, L; Kalogera, V
2018-01-01
classifier. The resulting classification and characterization should help LIGO scientists to identify causes of glitches and subsequently eliminate them from the data or the detector entirely, thereby improving the rate and accuracy of gravitational-wave observations. We demonstrate these methods using a small subset of data from LIGO’s first observing run. PMID:29722360
International Nuclear Information System (INIS)
Zevin, M; Coughlin, S; Larson, S L; Trouille, L; Kalogera, V; Bahaadini, S; Besler, E; Rohani, N; Katsaggelos, A K; Allen, S; Cabero, M; Lundgren, A; Crowston, K; Østerlund, C; Lee, T K; Lintott, C; Littenberg, T B; Smith, J R
2017-01-01
classifier. The resulting classification and characterization should help LIGO scientists to identify causes of glitches and subsequently eliminate them from the data or the detector entirely, thereby improving the rate and accuracy of gravitational-wave observations. We demonstrate these methods using a small subset of data from LIGO’s first observing run. (paper)
Advanced LIGO low-latency searches
Kanner, Jonah; LIGO Scientific Collaboration, Virgo Collaboration
2016-06-01
Advanced LIGO recently made the first detection of gravitational waves from merging binary black holes. The signal was first identified by a low-latency analysis, which identifies gravitational-wave transients within a few minutes of data collection. More generally, Advanced LIGO transients are sought with a suite of automated tools, which collectively identify events, evaluate statistical significance, estimate source position, and attempt to characterize source properties. This low-latency effort is enabling a broad multi-messenger approach to the science of compact object mergers and other transients. This talk will give an overview of the low-latency methodology and recent results.
Identification of long-duration noise transients in LIGO and Virgo
International Nuclear Information System (INIS)
Coughlin, Michael W
2011-01-01
The LIGO and Virgo detectors are sensitive to a variety of noise sources, such as instrumental artifacts and environmental disturbances. The Stochastic Transient Analysis Multi-detector Pipeline has been developed to search for long-duration (t ≥ 1 s) gravitational-wave (GW) signals. This pipeline can also be used to identify environmental noise transients. Here, we present an algorithm to determine when long-duration noise sources couple into the interferometers, as well as identify what these noise sources are. We analyze the cross-power between a GW strain channel and an environmental sensor, using pattern recognition tools to identify statistically significant structure in cross-power time-frequency maps. We identify interferometer noise from airplanes, helicopters, thunderstorms and other sources. Examples from LIGO's sixth science run, S6, and Virgo's third scientific run, VSR3, are presented. (paper)
Gravity Spy - Integrating LIGO detector characterization, citizen science, and machine learning
Zevin, Michael; Gravity Spy
2016-06-01
On September 14th 2015, the Advanced Laser Interferometer Gravitational-wave Observatory (aLIGO) made the first direct observation of gravitational waves and opened a new field of observational astronomy. However, being the most complicated and sensitve experiment ever undertaken in gravitational physics, aLIGO is susceptible to various sources of environmental and instrumental noise that hinder the search for more gravitational waves.Of particular concern are transient, non-Gaussian noise features known as glitches. Glitches can mimic true astrophysical gravitational waves, occur at a high enough frequency to be coherent between the two detectors, and generally worsen aLIGO's detection capabilities. The proper classification and charaterization of glitches is paramount in optimizing aLIGO's ability to detect gravitational waves. However, teaching computers to identify and morphologically classify these artifacts is exceedingly difficult.Human intuition has proven to be a useful tool in classifcation probelms such as this. Gravity Spy is an innovative, interdisciplinary project hosted by Zooniverse that combines aLIGO detector characterization, citizen science, machine learning, and social science. In this project, citizen scientists and computers will work together in a sybiotic relationship that leverages human pattern recognition and the ability of machine learning to process large amounts of data systematically: volunteers classify triggers from the aLIGO data steam that are constantly updated as aLIGO takes in new data, and these classifications are used to train machine learning algorithms which proceed to classify the bulk of aLIGO data and feed questionable glithces back to the users.In this talk, I will discuss the workflow and initial results of the Gravity Spy project with regard to aLIGO's future observing runs and highlight the potential of such citizen science projects in promoting nascent fields such as gravitational wave astrophysics.
Quadruple suspension design for Advanced LIGO
International Nuclear Information System (INIS)
Robertson, N A; Cagnoli, G; Crooks, D R M; Elliffe, E; Faller, J E; Fritschel, P; Gossler, S; Grant, A; Heptonstall, A; Hough, J; Lueck, H; Mittleman, R; Perreur-Lloyd, M; Plissi, M V; Rowan, S; Shoemaker, D H; Sneddon, P H; Strain, K A; Torrie, C I; Ward, H; Willems, P
2002-01-01
In this paper, we describe the conceptual design for the suspension system for the test masses for Advanced LIGO, the planned upgrade to LIGO, the US laser interferometric gravitational-wave observatory. The design is based on the triple pendulum design developed for GEO 600 - the German/UK interferometric gravitational wave detector. The GEO design incorporates fused silica fibres of circular cross-section attached to the fused silica mirror (test mass) in the lowest pendulum stage, in order to minimize the thermal noise from the pendulum modes. The damping of the low-frequency modes of the triple pendulum is achieved by using co-located sensors and actuators at the highest mass of the triple pendulum. Another feature of the design is that global control forces acting on the mirrors, used to maintain the output of the interferometer on a dark fringe, are applied via a triple reaction pendulum, so that these forces can be implemented via a seismically isolated platform. These techniques have been extended to meet the more stringent noise levels planned for in Advanced LIGO. In particular, the Advanced LIGO baseline design requires a quadruple pendulum with a final stage consisting of a 40 kg sapphire mirror, suspended on fused silica ribbons or fibres. The design is chosen to aim to reach a target noise contribution from the suspension corresponding to a displacement sensitivity of 10 -19 m Hz -1/2 at 10 Hz at each of the test masses
Kijbunchoo, Nutsinee
2017-12-01
In this exclusive comic drawn by physicist Nutsinee Kijbunchoo, the LIGO Collaboration gets a surprise visit and an unexpected gravitational-wave signal. We invite you to fill in the blank speech bubble in the last frame. Merry Christmas!
Used percentage veto for LIGO and virgo binary inspiral searches
International Nuclear Information System (INIS)
Isogai, Tomoki
2010-01-01
A challenge for ground-based gravitational wave detectors such as LIGO and Virgo is to understand the origin of non-astrophysical transients that contribute to the background noise, obscuring real astrophysically produced signals. To help this effort, there are a number of environmental and instrumental sensors around the site, recording data in 'channels'. We developed a method called the used percentage veto to eliminate corrupted data based on the statistical correlation between transients in the gravitational wave channel and in the auxiliary channels. The results are used to improve inspiral binary searches on LIGO and Virgo data. We also developed a way to apply this method to help find the physical origin of such transients for detector characterization. After identifying statistically correlated channels, a follow-up code clusters coincident events between the gravitational wave channel and auxiliary channels, and thereby classifies noise by correlated channels. For each selected event, the code also gathers and creates information that is helpful for further investigations. The method is contributing to identifying problems and improving data quality for the LIGO S6 and Virgo VSR2 science runs.
The first two years of electromagnetic follow-up with advanced LIGO and Virgo
International Nuclear Information System (INIS)
Singer, Leo P.; Price, Larry R.; Farr, Ben; Urban, Alex L.; Pankow, Chris; Downes, Tom; Vitale, Salvatore; Veitch, John; Farr, Will M.; Haster, Carl-Johan; Mandel, Ilya; Sidery, Trevor; Vecchio, Alberto; Hanna, Chad; Cannon, Kipp; Graff, Philip
2014-01-01
We anticipate the first direct detections of gravitational waves (GWs) with Advanced LIGO and Virgo later this decade. Though this groundbreaking technical achievement will be its own reward, a still greater prize could be observations of compact binary mergers in both gravitational and electromagnetic channels simultaneously. During Advanced LIGO and Virgo's first two years of operation, 2015 through 2016, we expect the global GW detector array to improve in sensitivity and livetime and expand from two to three detectors. We model the detection rate and the sky localization accuracy for binary neutron star (BNS) mergers across this transition. We have analyzed a large, astrophysically motivated source population using real-time detection and sky localization codes and higher-latency parameter estimation codes that have been expressly built for operation in the Advanced LIGO/Virgo era. We show that for most BNS events, the rapid sky localization, available about a minute after a detection, is as accurate as the full parameter estimation. We demonstrate that Advanced Virgo will play an important role in sky localization, even though it is anticipated to come online with only one-third as much sensitivity as the Advanced LIGO detectors. We find that the median 90% confidence region shrinks from ∼500 deg 2 in 2015 to ∼200 deg 2 in 2016. A few distinct scenarios for the first LIGO/Virgo detections emerge from our simulations.
Stochastic background search correlating ALLEGRO with LIGO engineering data
International Nuclear Information System (INIS)
Whelan, John T; Daw, Edward; Heng, Ik Siong; McHugh, Martin P; Lazzarini, Albert
2003-01-01
We describe the role of correlation measurements between the LIGO interferometer in Livingston, LA, and the ALLEGRO resonant bar detector in Baton Rouge, LA, in searches for a stochastic background of gravitational waves. Such measurements provide a valuable complement to correlations between interferometers at the two LIGO sites, since they are sensitive in a different, higher, frequency band. Additionally, the variable orientation of the ALLEGRO detector provides a means to distinguish gravitational wave correlations from correlated environmental noise. We describe the analysis underway to set a limit on the strength of a stochastic background at frequencies near 900 Hz using ALLEGRO data and data from LIGO's E7 Engineering Run
LIGO Discovers the Merger of Two Black Holes
Kohler, Susanna
2016-02-01
Big news: the Laser Interferometer Gravitational-Wave Observatory (LIGO) has detected its first gravitational-wave signal! Not only is the detection of this signal a major technical accomplishment and an exciting confirmation of general relativity, but it also has huge implications for black-hole astrophysics.What did LIGO see?LIGO is designed to detect the ripples in space-time created by two massive objects orbiting each other. These waves can reach observable amplitudes when a binary system consisting of two especially massive objects i.e., black holes or neutron stars reach the end of their inspiral and merge.LIGO has been unsuccessfully searching for gravitational waves since its initial operations in 2002, but a recent upgrade in its design has significantly increased its sensitivity and observational range. The first official observing run of Advanced LIGO began 18 September 2015, but the instruments were up and running in engineering mode several weeks before that. And it was in this time frame before official observing even began! that LIGO spotted its first gravitational wave signal: GW150914.One of LIGOs two detection sites, located near Hanford in eastern Washington. [LIGO]The signal, detected on 14 September, 2015, provides astronomers with a remarkable amount of information about the merger that caused it. From the detection, the LIGO team has extracted the masses of the two black holes that merged, 36+5-4 and 29+4-4 solar masses, as well as the mass of the final black hole formed by the merger, ~62 solar masses. The team also determined that the merger happened roughly a billion light-years away (at a redshift of z~0.1), and the direction of the signal was localized to an area of ~600 square degrees (roughly 1% of the sky).Why is this detection a big deal?This is the firstdirect detection of gravitational waves, providing spectacular further confirmation of Einsteins theory of general relativity. But the implications of GW150914 go far beyond this
Fermi GBM Observations of LIGO Gravitational-Wave Event Gw150914
Connaughton, V.; Burns, E.; Goldstein, A.; Blackburn, L.; Briggs, M. S.; Zhang, B.-B.; Camp, J.; Christensen, N.; Hui, C. M.; Jenke, P.;
2016-01-01
With an instantaneous view of 70% of the sky, the Fermi Gamma-ray Burst Monitor (GBM) is an excellent partner in the search for electromagnetic counterparts to gravitational-wave (GW) events. GBM observations at the time of the Laser Interferometer Gravitational-wave Observatory (LIGO) event GW150914 reveal the presence of a weak transient above 50 keV, 0.4 s after the GW event, with a false-alarm probability of 0.0022 (2.9(sigma)). This weak transient lasting 1 s was not detected by any other instrument and does not appear to be connected with other previously known astrophysical, solar, terrestrial, or magnetospheric activity. Its localization is ill-constrained but consistent with the direction of GW150914. The duration and spectrum of the transient event are consistent with a weak short gamma-ray burst (GRB) arriving at a large angle to the direction in which Fermi was pointing where the GBM detector response is not optimal. If the GBM transient is associated with GW150914, then this electromagnetic signal from a stellar mass black hole binary merger is unexpected. We calculate a luminosity in hard X-ray emission between 1 keV and 10 MeV of 1.8(sup +1.5, sub -1.0) x 10(exp 49) erg/s. Future joint observations of GW events by LIGO/Virgo and Fermi GBM could reveal whether the weak transient reported here is a plausible counterpart to GW150914 or a chance coincidence, and will further probe the connection between compact binary mergers and short GRBs.
Abadie, J.; Abbott, B.; Abbott, R.; Abbott, T.; Abernathy, M.; Accadia, T.; Acernese, F.; Adams, C.; Adhikari, R.; Affeldt, C.; Agathos, M.; Ajith, P.; Allen, B.; Allen, G.; Amador Ceron, E.
2012-01-01
We summarize the sensitivity achieved by the LIGO and Virgo gravitational wave detectors for low-mass compact binary coalescence (CBC) searches during LIGO's sixth science run and Virgo's second and third science runs. We present strain noise power spectral densities (PSDs) which are representative of the typical performance achieved by the detectors in these science runs. The data presented here and in the accompanying web-accessible data files are intended to be released to the public as a ...
Tracking down the origins of Advanced LIGO noise: 2 examples
Berger, Beverly K.; LIGO Scientific Collaboration Collaboration
2016-03-01
For Advanced LIGO to reach design sensitivity various sources of instrumental and environmental noise must be identified and ameliorated. We discuss 2 efforts to search for the origin of noise bursts (glitches) at LIGO Hanford. Advanced LIGO monitors thousands of channels in addition to the gravitational wave channel. These can be studied to find correlations between the gravitational wave channel and other sensor signals. The first type of glitch had a frequency of 50 Hz and a rate of 1 per minute. It was found that the glitches were correlated with ground motion in the end station of the X-arm where the offending air compressor was tracked down and turned off. The second example manifests itself as a sudden, but brief, drop in the range occurring, typically, several times per day at LIGO Hanford and less frequently at LIGO Livingston. These range-drop glitches appear in the gravitational-wave channel. Although correlations with these glitches can be seen in many channels, it cannot be easily determined whether these channels are responding as an effect of this type of very strong glitch or whether they might be related to their cause or causes. To date, the cause of the range-drop glitches is not known.
ELECTROMAGNETIC COUNTERPARTS TO BLACK HOLE MERGERS DETECTED BY LIGO
Energy Technology Data Exchange (ETDEWEB)
Loeb, Abraham, E-mail: aloeb@cfa.harvard.edu [Department of Astronomy, Harvard University, 60 Garden St., Cambridge, MA 02138 (United States)
2016-03-10
Mergers of stellar-mass black holes (BHs), such as GW150914 observed by Laser Interferometer Gravitational Wave Observatory (LIGO), are not expected to have electromagnetic counterparts. However, the Fermi GBM detector identified a γ-ray transient 0.4 s after the gravitational wave (GW) signal GW150914 with consistent sky localization. I show that the two signals might be related if the BH binary detected by LIGO originated from two clumps in a dumbbell configuration that formed when the core of a rapidly rotating massive star collapsed. In that case, the BH binary merger was followed by a γ-ray burst (GRB) from a jet that originated in the accretion flow around the remnant BH. A future detection of a GRB afterglow could be used to determine the redshift and precise localization of the source. A population of standard GW sirens with GRB redshifts would provide a new approach for precise measurements of cosmological distances as a function of redshift.
Thermal modelling of Advanced LIGO test masses
International Nuclear Information System (INIS)
Wang, H; Dovale Álvarez, M; Mow-Lowry, C M; Freise, A; Blair, C; Brooks, A; Kasprzack, M F; Ramette, J; Meyers, P M; Kaufer, S; O’Reilly, B
2017-01-01
High-reflectivity fused silica mirrors are at the epicentre of today’s advanced gravitational wave detectors. In these detectors, the mirrors interact with high power laser beams. As a result of finite absorption in the high reflectivity coatings the mirrors suffer from a variety of thermal effects that impact on the detectors’ performance. We propose a model of the Advanced LIGO mirrors that introduces an empirical term to account for the radiative heat transfer between the mirror and its surroundings. The mechanical mode frequency is used as a probe for the overall temperature of the mirror. The thermal transient after power build-up in the optical cavities is used to refine and test the model. The model provides a coating absorption estimate of 1.5–2.0 ppm and estimates that 0.3 to 1.3 ppm of the circulating light is scattered onto the ring heater. (paper)
Galaxy Strategy for Ligo-Virgo Gravitational Wave Counterpart Searches
Gehrels, Neil; Cannizzo, John K.; Kanner, Jonah; Kasliwal, Mansi M.; Nissanke, Samaya; Singer, Leo P.
2016-01-01
In this work we continue a line of inquiry begun in Kanner et al. which detailed a strategy for utilizing telescopes with narrow fields of view, such as the Swift X-Ray Telescope (XRT), to localize gravity wave (GW) triggers from LIGO (Laser Interferometer Gravitational-Wave Observatory) / Virgo. If one considers the brightest galaxies that produce 50 percent of the light, then the number of galaxies inside typical GW error boxes will be several tens. We have found that this result applies both in the early years of Advanced LIGO when the range is small and the error boxes large, and in the later years when the error boxes will be small and the range large. This strategy has the beneficial property of reducing the number of telescope pointings by a factor 10 to 100 compared with tiling the entire error box. Additional galaxy count reduction will come from a GW rapid distance estimate which will restrict the radial slice in search volume. Combining the bright galaxy strategy with a convolution based on anticipated GW localizations, we find that the searches can be restricted to about 18 plus or minus 5 galaxies for 2015, about 23 plus or minus 4 for 2017, and about 11 plus or minus for 2020. This assumes a distance localization at the putative neutron star-neutron star (NS-NS) merger range mu for each target year, and these totals are integrated out to the range. Integrating out to the horizon would roughly double the totals. For localizations with r (rotation) greatly less than mu the totals would decrease. The galaxy strategy we present in this work will enable numerous sensitive optical and X-ray telescopes with small fields of view to participate meaningfully in searches wherein the prospects for rapidly fading afterglow place a premium on a fast response time.
Infrared observations of gravitational-wave sources in Advanced LIGO's second observing run
Pound Singer, Leo; Kasliwal, Mansi; Lau, Ryan; Cenko, Bradley; Global Relay of Observatories Watching Transients Happen (GROWTH)
2018-01-01
Advanced LIGO observed gravitational waves (GWs) from a binary black hole merger in its first observing run (O1) in September 2015. It is anticipated that LIGO and Virgo will soon detect the first binary neutron star mergers. The most promising electromagnetic counterparts to such events are kilonovae: fast, faint transients powered by the radioactive decay of the r-process ejecta. Joint gravitational-wave and electromagnetic observations of such transients hold the key to many longstanding problems, from the nature of short GRBS to the cosmic production sites of the r-process elements to "standard siren" cosmology. Due to the large LIGO/Virgo error regions of 100 deg2, synoptic survey telescopes have dominated the search for LIGO counterparts. Due to the paucity of infrared instruments with multi-deg2 fields of view, infrared observations have been lacking. Near-infrared emission should not only be a more robust signature of kilonovae than optical emission (independent of viewing angle), but should also be several magnitudes brighter and be detectable for much longer, weeks after merger rather than days. In Advanced LIGO's second observing run, we used the FLAMINGOS-2 instrument on Gemini-South to hunt for the near-infrared emission from GW sources by targeted imaging of the most massive galaxies in the LIGO/Virgo localization volumes. We present the results of this campaign, rates, and interpretation of our near-infrared imaging and spectroscopy. We show that leveraging large-scale structure and targeted imaging of the most massive ~10 galaxies in a LIGO/Virgo localization volume may be a surprisingly effective strategy to find the electromagnetic counterpart.
Einstein's Gift: Stellar Mass Black Holes in the LIGO Era
Cadonati, Laura; Georgia Institute of Technology, LIGO-Virgo Collaboration
2017-01-01
The discovery of gravitational waves from the coalescence of black hole binary systems in LIGO has provided the first evidence for heavy stellar mass black holes. In this talk, I will review the observational evidence for black holes in LIGO data, its astrophysical implications and the plans for the near and long term future of ground based gravitational wave detection of black hole binary coalescences.
Eliminating thermal violin spikes from LIGO noise
Energy Technology Data Exchange (ETDEWEB)
Santamore, D. H.; Levin, Yuri
2001-08-15
We have developed a scheme for reducing LIGO suspension thermal noise close to violin-mode resonances. The idea is to monitor directly the thermally induced motion of a small portion of (a 'point' on) each suspension fiber, thereby recording the random forces driving the test-mass motion close to each violin-mode frequency. One can then suppress the thermal noise by optimally subtracting the recorded fiber motions from the measured motion of the test mass, i.e., from the LIGO output. The proposed method is a modification of an analogous but more technically difficult scheme by Braginsky, Levin and Vyatchanin for reducing broad-band suspension thermal noise. The efficiency of our method is limited by the sensitivity of the sensor used to monitor the fiber motion. If the sensor has no intrinsic noise (i.e. has unlimited sensitivity), then our method allows, in principle, a complete removal of violin spikes from the thermal-noise spectrum. We find that in LIGO-II interferometers, in order to suppress violin spikes below the shot-noise level, the intrinsic noise of the sensor must be less than {approx}2 x 10{sup -13} cm/Hz. This sensitivity is two orders of magnitude greater than that of currently available sensors.
Eliminating thermal violin spikes from LIGO noise
International Nuclear Information System (INIS)
Santamore, D. H.; Levin, Yuri
2001-01-01
We have developed a scheme for reducing LIGO suspension thermal noise close to violin-mode resonances. The idea is to monitor directly the thermally induced motion of a small portion of (a 'point' on) each suspension fiber, thereby recording the random forces driving the test-mass motion close to each violin-mode frequency. One can then suppress the thermal noise by optimally subtracting the recorded fiber motions from the measured motion of the test mass, i.e., from the LIGO output. The proposed method is a modification of an analogous but more technically difficult scheme by Braginsky, Levin and Vyatchanin for reducing broad-band suspension thermal noise. The efficiency of our method is limited by the sensitivity of the sensor used to monitor the fiber motion. If the sensor has no intrinsic noise (i.e. has unlimited sensitivity), then our method allows, in principle, a complete removal of violin spikes from the thermal-noise spectrum. We find that in LIGO-II interferometers, in order to suppress violin spikes below the shot-noise level, the intrinsic noise of the sensor must be less than ∼2 x 10 -13 cm/Hz. This sensitivity is two orders of magnitude greater than that of currently available sensors
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acemese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwa, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Arker, Bd.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bejger, M.; Be, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitoss, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bond, C.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Boutfanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, O.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, C.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Dreyer, R. W. P.; Driggers, J. C.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Egizenstein, H. -B.; Ehrens, P.; Eichholel, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, O.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farinon, S.; Farr, B.; Far, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fenyvesi, E.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.M.; Fournier, J. -D.; Frasca, J. -D; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fritsche, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garuti, F.; Gaur, G.; Gehrels, N.; Gemme, G.; Geng, P.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gi, K.; Glaetke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Graff, P. B.; Granata, M.; Granta, A.; Gras, S.; Cray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, S.; Hennig, J.; Henry, J.A.; Heptonsta, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howel, E. J.; Hu, Y. M.; Huang, O.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Lyer, B. R.; Fzumi, K.; Jaccimin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jian, L.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jones, R.; Jonker, R. J. G.; Ju, L.; Wads, k; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keh, M. S.; Keite, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chi-Woong; Kim, Chunglee; Kim, J.; Kim, K.; Kim, Namjun; Kim, W.; Kimbre, S. J.; King, E. J.; King, P. J.; Kisse, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringe, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Laxen, M.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Lewis, J. B.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Liick, H.; Lundgren, A. P.; Lynch, R.; Ivia, Y.; Machenschalk, B.; Maclnnis, M.; Macleod, D. M.; Magafia-Sandoval, F.; Zertuche, L. Magafia; Magee, R. M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Manse, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matiehard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mende, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Miche, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecehia, I.; Naticchioni, L.; Nayak, R. K.; Nedkova, K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Hang, S.; Ohme, F.; Oliver, M.; Oppermann, P.; Ram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Perri, L. M.; Phelps, M.; Piccinni, . J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powel, J.; Prasad, J.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, .; Punturo, M.; Purrer, PuppoM.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rowan, RosiliskaS.; Ruggi, RiidigerP.; Ryan, K.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, E. S.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabe, R.; Schofield, R. M. S.; Schonbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Sielleez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazus, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sunil, Suns; Sutton, P. J.; Swinkels, B. L.; Szczepariczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tomasi, Z.; Torres, C. V.; Tome, C.; Tot, D.; Travasso, F.; Traylor, G.; Trifire, D.; Tringali, M. C.; Trozz, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Valente, G.; Valdes, G.; van Bake, N.; Van Beuzekom, Martin; Van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; Van Heilningen, J. V.; Van Vegge, A. A.; Vardaro, M.; Vass, S.; Vaslith, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Vvang, G.; Wang, O.; Wang, X.; Wiang, Y.; Ward, R. L.; Wiarner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Weliels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; WilIke, B.; Wimmer, M. H.; Whinkler, W.; Wipf, C. C.; De Witte, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D. S.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S.J.; Zhu, X.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
We report results of a deep all-sky search for periodic gravitational waves from isolated neutron stars in data from the S6 LIGO science run. The search was possible thanks to the computing power provided by the volunteers of the Einstein@Home distributed computing project. We find no significant
Characterizing transient noise in the LIGO detectors
Nuttall, L. K.
2018-05-01
Data from the LIGO detectors typically contain many non-Gaussian noise transients which arise due to instrumental and environmental conditions. These non-Gaussian transients can be an issue for the modelled and unmodelled transient gravitational-wave searches, as they can mask or mimic a true signal. Data quality can change quite rapidly, making it imperative to track and find new sources of transient noise so that data are minimally contaminated. Several examples of transient noise and the tools used to track them are presented. These instances serve to highlight the diverse range of noise sources present at the LIGO detectors during their second observing run. This article is part of a discussion meeting issue `The promises of gravitational-wave astronomy'.
LIGO: The instruments that launched gravitational-wave astronomy
Fritschel, Peter; LIGO Scientific Collaboration
2018-01-01
After decades of development, the advanced gravitational wave detectors are now in the business of making detections of the types of astrophysical sources they were designed for. And yet these detectors still have a ways to go to reach their designed sensitivity levels. This talk will cover the design and performance of these advanced detectors, with emphasis on Advanced LIGO. I will lay out the path to reaching design sensitivity, and then turn to plans for future improvements to the existing LIGO detectors’ sensitivity. Looking even further into the future, I will discuss concepts for a new generation of detectors that will be needed to probe much deeper into the cosmos.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Becsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Deelman, E.; Degallaix, J.; De Laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; Gonzalez, G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J. -M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, W. S.; Kim, Y. -M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kraemer, C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lueck, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Hernandez, I. Magana; Magana-Sandoval, F.; Zertuche, L. Magana; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mayani, R.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosinska, D.; Ross, M. P.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Rynge, M.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, J. A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahi, K.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y. -F.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, K. W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zanolin, M.; Zelenova, T.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y. -H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Anderson, D. P.
2017-01-01
We report results of a deep all-sky search for periodic gravitational waves from isolated neutron stars in data from the first Advanced LIGO observing run. This search investigates the low frequency range of Advanced LIGO data, between 20 and 100 Hz, much of which was not explored in initial LIGO.
Regression of environmental noise in LIGO data
International Nuclear Information System (INIS)
Tiwari, V; Klimenko, S; Mitselmakher, G; Necula, V; Drago, M; Prodi, G; Frolov, V; Yakushin, I; Re, V; Salemi, F; Vedovato, G
2015-01-01
We address the problem of noise regression in the output of gravitational-wave (GW) interferometers, using data from the physical environmental monitors (PEM). The objective of the regression analysis is to predict environmental noise in the GW channel from the PEM measurements. One of the most promising regression methods is based on the construction of Wiener–Kolmogorov (WK) filters. Using this method, the seismic noise cancellation from the LIGO GW channel has already been performed. In the presented approach the WK method has been extended, incorporating banks of Wiener filters in the time–frequency domain, multi-channel analysis and regulation schemes, which greatly enhance the versatility of the regression analysis. Also we present the first results on regression of the bi-coherent noise in the LIGO data. (paper)
GW150914: First results from the search for binary black hole coalescence with Advanced LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, G.; Bogan, C.; Bohe, A.; Bohémier, K.; Bojtos, P.; Bond, C.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y.; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, S.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Clayton, J. H.; Cleva, F.; Coccia, E.; Cohadon, P.-F.; Cokelaer, T.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.; DeRosa, R. T.; De Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Díaz, M. C.; Dietz, A.; Di Fiore, L.; Di Giovanni, M.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fotopoulos, N.; Fournier, J.-D.; Franco, S.; Frasca, S.; Frasconi, F.; Frei, M.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; Goggin, L. M.; Gondan, L.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J.-M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, G.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kéfélian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Kennedy, R.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Królak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lück, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McKechan, D. J. A.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E.; Merzougui, M.; Meshkov, S.; Messaritaki, E.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P. G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Neri, M.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pan, Y.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Robinson, C.; Rocchi, A.; Rodriguez, A. C.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosińska, D.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Santamaría, L.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, A. D.; Simakov, D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, J. R.; Smith, N. D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tápai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasúth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Viceré, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Weßels, P.; West, M.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Wiesner, K.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wiseman, A. G.; Wittel, H.; Woan, G.; Worden, J.; Wright, J. L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; ZadroŻny, A.; Zangrando, L.; Zanolin, M.; Zendri, J.-P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration
2016-06-01
On September 14, 2015, at 09∶50:45 UTC the two detectors of the Laser Interferometer Gravitational-Wave Observatory (LIGO) simultaneously observed the binary black hole merger GW150914. We report the results of a matched-filter search using relativistic models of compact-object binaries that recovered GW150914 as the most significant event during the coincident observations between the two LIGO detectors from September 12 to October 20, 2015 GW150914 was observed with a matched-filter signal-to-noise ratio of 24 and a false alarm rate estimated to be less than 1 event per 203000 years, equivalent to a significance greater than 5.1 σ .
GW150914: First Results from the Search for Binary Black Hole Coalescence with Advanced LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.;
2016-01-01
On September 14, 2015, at 09:50:45 UTC the two detectors of the Laser Interferometer Gravitational-Wave Observatory (LIGO) simultaneously observed the binary black hole merger GW150914. We report the results of a matched-filter search using relativistic models of compact-object binaries that recovered GW150914 as the most significant event during the coincident observations between the two LIGO detectors from September 12 to October 20, 2015 GW150914 was observed with a matched-filter signal-to-noise ratio of 24 and a false alarm rate estimated to be less than 1 event per 203000 years, equivalent to a significance greater than 5.1 sigma.
International Nuclear Information System (INIS)
Boyle, Michael; Brown, Duncan A; Pekowsky, Larne
2009-01-01
We study the effectiveness of stationary-phase approximated post-Newtonian waveforms currently used by ground-based gravitational-wave detectors to search for the coalescence of binary black holes by comparing them to an accurate waveform obtained from numerical simulation of an equal-mass non-spinning binary black hole inspiral, merger and ringdown. We perform this study for the initial- and advanced-LIGO detectors. We find that overlaps between the templates and signal can be improved by integrating the match filter to higher frequencies than used currently. We propose simple analytic frequency cutoffs for both initial and advanced LIGO, which achieve nearly optimal matches, and can easily be extended to unequal-mass, spinning systems. We also find that templates that include terms in the phase evolution up to 3.5 post-Newtonian (pN) order are nearly always better, and rarely significantly worse, than 2.0 pN templates currently in use. For initial LIGO we recommend a strategy using templates that include a recently introduced pseudo-4.0 pN term in the low-mass (M ≤ 35 M o-dot ) region, and 3.5 pN templates allowing unphysical values of the symmetric reduced mass η above this. This strategy always achieves overlaps within 0.3% of the optimum, for the data used here. For advanced LIGO we recommend a strategy using 3.5 pN templates up to M = 12 M o-dot , 2.0 pN templates up to M = 21 M o-dot , pseudo-4.0 pN templates up to 65 M o-dot , and 3.5 pN templates with unphysical η for higher masses. This strategy always achieves overlaps within 0.7% of the optimum for advanced LIGO.
LIGO: the Laser Interferometer Gravitational-Wave Observatory
International Nuclear Information System (INIS)
Abbott, B P; Abbott, R; Adhikari, R; Anderson, S B; Araya, M; Armandula, H; Aso, Y; Ballmer, S; Ajith, P; Allen, B; Aulbert, C; Allen, G; Amin, R S; Anderson, W G; Armor, P; Arain, M A; Aston, S; Aufmuth, P; Babak, S; Baker, P
2009-01-01
The goal of the Laser Interferometric Gravitational-Wave Observatory (LIGO) is to detect and study gravitational waves (GWs) of astrophysical origin. Direct detection of GWs holds the promise of testing general relativity in the strong-field regime, of providing a new probe of exotic objects such as black holes and neutron stars and of uncovering unanticipated new astrophysics. LIGO, a joint Caltech-MIT project supported by the National Science Foundation, operates three multi-kilometer interferometers at two widely separated sites in the United States. These detectors are the result of decades of worldwide technology development, design, construction and commissioning. They are now operating at their design sensitivity, and are sensitive to gravitational wave strains smaller than one part in 10 21 . With this unprecedented sensitivity, the data are being analyzed to detect or place limits on GWs from a variety of potential astrophysical sources.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H.-P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Deelman, E.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J.-M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, W. S.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lück, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña Hernandez, I.; Magaña-Sandoval, F.; Magaña Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mayani, R.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosińska, D.; Ross, M. P.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Rynge, M.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tápai, M.; Taracchini, A.; Taylor, J. A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahi, K.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y.-F.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, K. W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; ZadroŻny, A.; Zanolin, M.; Zelenova, T.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.-H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Anderson, D. P.; LIGO Scientific Collaboration; Virgo Collaboration
2017-12-01
We report results of a deep all-sky search for periodic gravitational waves from isolated neutron stars in data from the first Advanced LIGO observing run. This search investigates the low frequency range of Advanced LIGO data, between 20 and 100 Hz, much of which was not explored in initial LIGO. The search was made possible by the computing power provided by the volunteers of the Einstein@Home project. We find no significant signal candidate and set the most stringent upper limits to date on the amplitude of gravitational wave signals from the target population, corresponding to a sensitivity depth of 48.7 [1 /√{Hz }] . At the frequency of best strain sensitivity, near 100 Hz, we set 90% confidence upper limits of 1.8 ×1 0-25. At the low end of our frequency range, 20 Hz, we achieve upper limits of 3.9 ×1 0-24. At 55 Hz we can exclude sources with ellipticities greater than 1 0-5 within 100 pc of Earth with fiducial value of the principal moment of inertia of 1038 kg m2 .
Seismic isolation of Advanced LIGO: Review of strategy, instrumentation and performance
International Nuclear Information System (INIS)
Matichard, F; Mittleman, R; Mason, K; Biscans, S; Barnum, S; Evans, M; Foley, S; Lantz, B; Celerier, C; Clark, D; DeBra, D; Kissel, J; Allwine, E; Abbott, B; Abbott, R; Abbott, S; Coyne, D; McIver, J; Birch, J; DeRosa, R
2015-01-01
The new generation of gravitational waves detectors require unprecedented levels of isolation from seismic noise. This article reviews the seismic isolation strategy and instrumentation developed for the Advanced LIGO observatories. It summarizes over a decade of research on active inertial isolation and shows the performance recently achieved at the Advanced LIGO observatories. The paper emphasizes the scientific and technical challenges of this endeavor and how they have been addressed. An overview of the isolation strategy is given. It combines multiple layers of passive and active inertial isolation to provide suitable rejection of seismic noise at all frequencies. A detailed presentation of the three active platforms that have been developed is given. They are the hydraulic pre-isolator, the single-stage internal isolator and the two-stage internal isolator. The architecture, instrumentation, control scheme and isolation results are presented for each of the three systems. Results show that the seismic isolation sub-system meets Advanced LIGO’s stringent requirements and robustly supports the operation of the two detectors. (paper)
Accuracy of Binary Black Hole waveforms for Advanced LIGO searches
Kumar, Prayush; Barkett, Kevin; Bhagwat, Swetha; Chu, Tony; Fong, Heather; Brown, Duncan; Pfeiffer, Harald; Scheel, Mark; Szilagyi, Bela
2015-04-01
Coalescing binaries of compact objects are flagship sources for the first direct detection of gravitational waves with LIGO-Virgo observatories. Matched-filtering based detection searches aimed at binaries of black holes will use aligned spin waveforms as filters, and their efficiency hinges on the accuracy of the underlying waveform models. A number of gravitational waveform models are available in literature, e.g. the Effective-One-Body, Phenomenological, and traditional post-Newtonian ones. While Numerical Relativity (NR) simulations provide for the most accurate modeling of gravitational radiation from compact binaries, their computational cost limits their application in large scale searches. In this talk we assess the accuracy of waveform models in two regions of parameter space, which have only been explored cursorily in the past: the high mass-ratio regime as well as the comparable mass-ratio + high spin regime.s Using the SpEC code, six q = 7 simulations with aligned-spins and lasting 60 orbits, and tens of q ∈ [1,3] simulations with high black hole spins were performed. We use them to study the accuracy and intrinsic parameter biases of different waveform families, and assess their viability for Advanced LIGO searches.
Bird, Simeon; Cholis, Ilias; Muñoz, Julian B; Ali-Haïmoud, Yacine; Kamionkowski, Marc; Kovetz, Ely D; Raccanelli, Alvise; Riess, Adam G
2016-05-20
We consider the possibility that the black-hole (BH) binary detected by LIGO may be a signature of dark matter. Interestingly enough, there remains a window for masses 20M_{⊙}≲M_{bh}≲100M_{⊙} where primordial black holes (PBHs) may constitute the dark matter. If two BHs in a galactic halo pass sufficiently close, they radiate enough energy in gravitational waves to become gravitationally bound. The bound BHs will rapidly spiral inward due to the emission of gravitational radiation and ultimately will merge. Uncertainties in the rate for such events arise from our imprecise knowledge of the phase-space structure of galactic halos on the smallest scales. Still, reasonable estimates span a range that overlaps the 2-53 Gpc^{-3} yr^{-1} rate estimated from GW150914, thus raising the possibility that LIGO has detected PBH dark matter. PBH mergers are likely to be distributed spatially more like dark matter than luminous matter and have neither optical nor neutrino counterparts. They may be distinguished from mergers of BHs from more traditional astrophysical sources through the observed mass spectrum, their high ellipticities, or their stochastic gravitational wave background. Next-generation experiments will be invaluable in performing these tests.
A data analysis technique for the LIGO-ALLEGRO stochastic background search
International Nuclear Information System (INIS)
Whelan, John T; Bose, Sukanta; Hanson, Jonathan; Heng, Ik Siong; Johnson, Warren W; McHugh, Martin P; Zhang, Peter
2005-01-01
We describe the cross-correlation measurements being carried out on data from the LIGO Livingston Observatory and the ALLEGRO resonant bar detector. The LIGO data are sampled at 16 384 Hz while the ALLEGRO data are base-banded, i.e., heterodyned at 899 Hz and then sampled at 250 Hz. We handle these different sampling parameters by working in the Fourier domain, and demonstrate the approximate equivalence of this measurement to a hypothetical time-domain method in which both data streams are upsampled
A data analysis technique for the LIGO-ALLEGRO stochastic background search
Energy Technology Data Exchange (ETDEWEB)
Whelan, John T [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Bose, Sukanta [Washington State University, Pullman, Washington 99164 (United States); Hanson, Jonathan [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Heng, Ik Siong [Department of Physics and Astronomy, University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Johnson, Warren W [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); McHugh, Martin P [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Zhang, Peter [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)
2005-09-21
We describe the cross-correlation measurements being carried out on data from the LIGO Livingston Observatory and the ALLEGRO resonant bar detector. The LIGO data are sampled at 16 384 Hz while the ALLEGRO data are base-banded, i.e., heterodyned at 899 Hz and then sampled at 250 Hz. We handle these different sampling parameters by working in the Fourier domain, and demonstrate the approximate equivalence of this measurement to a hypothetical time-domain method in which both data streams are upsampled.
Implications of the Low Binary Black Hole Aligned Spins Observed by LIGO
Energy Technology Data Exchange (ETDEWEB)
Hotokezaka, Kenta [Center for Computational Astrophysics, Flatiron Institute, 162 5th Avenue, New York, NY 10010 (United States); Piran, Tsvi [Racah Institute of Physics, The Hebrew University of Jerusalem, Jerusalem 91904 (Israel)
2017-06-20
We explore the implications of the low-spin components along the orbital axis observed in an Advanced LIGO O1 run on binary black hole (BBH) merger scenarios in which the merging BBHs have evolved from field binaries. The coalescence time determines the initial orbital separation of BBHs. This, in turn, determines whether the stars are synchronized before collapse, and hence determines their projected spins. Short coalescence times imply synchronization and large spins. Among known stellar objects, Wolf–Rayet (WR) stars seem to be the only progenitors consistent with the low aligned spins observed in LIGO’s O1, provided that the orbital axis maintains its direction during the collapse. We calculate the spin distribution of BBH mergers in the local universe, and its redshift evolution for WR progenitors. Assuming that the BBH formation rate peaks around a redshift of ∼2–3, we show that BBH mergers in the local universe are dominated by low-spin events. The high-spin population starts to dominate at a redshift of ∼0.5–1.5. WR stars are also progenitors of long gamma-ray bursts that take place at a comparable rate to BBH mergers. We discuss the possible connection between the two phenomena. Additionally, we show that hypothetical Population III star progenitors are also possible. Although WR and Population III progenitors are consistent with the current data, both models predict a non-vanishing fraction of high positive values of the BBHs’ aligned spin. If those are not detected within the coming LIGO/Virgo runs, it will be unlikely that the observed BBHs formed via field binaries.
The influence of dual-recycling on parametric instabilities at Advanced LIGO
International Nuclear Information System (INIS)
Green, A C; Brown, D D; Dovale-Álvarez, M; Collins, C; Miao, H; Mow-Lowry, C M; Freise, A
2017-01-01
Laser interferometers with high circulating power and suspended optics, such as the LIGO gravitational wave detectors, experience an optomechanical coupling effect known as a parametric instability : the runaway excitation of a mechanical resonance in a mirror driven by the optical field. This can saturate the interferometer sensing and control systems and limit the observation time of the detector. Current mitigation techniques at the LIGO sites are successfully suppressing all observed parametric instabilities, and focus on the behaviour of the instabilities in the Fabry–Perot arm cavities of the interferometer, where the instabilities are first generated. In this paper we model the full dual-recycled Advanced LIGO design with inherent imperfections. We find that the addition of the power- and signal-recycling cavities shapes the interferometer response to mechanical modes, resulting in up to four times as many peaks. Changes to the accumulated phase or Gouy phase in the signal-recycling cavity have a significant impact on the parametric gain, and therefore which modes require suppression. (paper)
Regression of non-linear coupling of noise in LIGO detectors
Da Silva Costa, C. F.; Billman, C.; Effler, A.; Klimenko, S.; Cheng, H.-P.
2018-03-01
In 2015, after their upgrade, the advanced Laser Interferometer Gravitational-Wave Observatory (LIGO) detectors started acquiring data. The effort to improve their sensitivity has never stopped since then. The goal to achieve design sensitivity is challenging. Environmental and instrumental noise couple to the detector output with different, linear and non-linear, coupling mechanisms. The noise regression method we use is based on the Wiener–Kolmogorov filter, which uses witness channels to make noise predictions. We present here how this method helped to determine complex non-linear noise couplings in the output mode cleaner and in the mirror suspension system of the LIGO detector.
Recent results of a seismically isolated optical table prototype designed for advanced LIGO
International Nuclear Information System (INIS)
Sannibale, V; Abbott, B; Boschi, V; Coyne, D; DeSalvo, R; Aso, Y; Marka, S; Ottaway, D; Stochino, A
2008-01-01
The Horizontal Access Module Seismic Attenuation System (HAM-SAS) is a mechanical device expressly designed to isolate a multipurpose optical table and fit in the tight space of the LIGO HAM Ultra-High-Vacuum chamber. Seismic attenuation in the detectors' sensitivity frequency band is achieved with state of the art passive mechanical attenuators. These devices should provide an attenuation factor of about 70dB above 10Hz at the suspension point of the Advanced LIGO triple pendulum suspension. Automatic control techniques are used to position the optical table and damp rigid body modes. Here, we report the main results obtained from the full scale prototype installed at the MIT LIGO Advanced System Test Interferometer (LASTI) facility. Seismic attenuation performance, control strategies, improvements and limitations are also discussed
What if LIGO's gravitational wave detections are strongly lensed by massive galaxy clusters?
Smith, Graham P.; Jauzac, Mathilde; Veitch, John; Farr, Will M.; Massey, Richard; Richard, Johan
2018-04-01
Motivated by the preponderance of so-called `heavy black holes' in the binary black hole (BBH) gravitational wave (GW) detections to date, and the role that gravitational lensing continues to play in discovering new galaxy populations, we explore the possibility that the GWs are strongly lensed by massive galaxy clusters. For example, if one of the GW sources were actually located at z = 1, then the rest-frame mass of the associated BHs would be reduced by a factor of ˜2. Based on the known populations of BBH GW sources and strong-lensing clusters, we estimate a conservative lower limit on the number of BBH mergers detected per detector year at LIGO/Virgo's current sensitivity that are multiply-imaged, of Rdetect ≃ 10-5 yr-1. This is equivalent to rejecting the hypothesis that one of the BBH GWs detected to date was multiply-imaged at ≲4σ. It is therefore unlikely, but not impossible, that one of the GWs is multiply-imaged. We identify three spectroscopically confirmed strong-lensing clusters with well-constrained mass models within the 90 per cent credible sky localizations of the BBH GWs from LIGO's first observing run. In the event that one of these clusters multiply-imaged one of the BBH GWs, we predict that 20-60 per cent of the putative next appearances of the GWs would be detectable by LIGO, and that they would arrive at Earth within 3yr of first detection.
Explaining LIGO's observations via isolated binary evolution with natal kicks
Wysocki, Daniel; Gerosa, Davide; O'Shaughnessy, Richard; Belczynski, Krzysztof; Gladysz, Wojciech; Berti, Emanuele; Kesden, Michael; Holz, Daniel E.
2018-02-01
We compare binary evolution models with different assumptions about black-hole natal kicks to the first gravitational-wave observations performed by the LIGO detectors. Our comparisons attempt to reconcile merger rate, masses, spins, and spin-orbit misalignments of all current observations with state-of-the-art formation scenarios of binary black holes formed in isolation. We estimate that black holes (BHs) should receive natal kicks at birth of the order of σ ≃200 (50 ) km /s if tidal processes do (not) realign stellar spins. Our estimate is driven by two simple factors. The natal kick dispersion σ is bounded from above because large kicks disrupt too many binaries (reducing the merger rate below the observed value). Conversely, the natal kick distribution is bounded from below because modest kicks are needed to produce a range of spin-orbit misalignments. A distribution of misalignments increases our models' compatibility with LIGO's observations, if all BHs are likely to have natal spins. Unlike related work which adopts a concrete BH natal spin prescription, we explore a range of possible BH natal spin distributions. Within the context of our models, for all of the choices of σ used here and within the context of one simple fiducial parameterized spin distribution, observations favor low BH natal spin.
Upper limits from the LIGO and TAMA detectors on the rate of gravitational-wave bursts
International Nuclear Information System (INIS)
Abbott, B.; Abbott, R.; Adhikari, R.; Agresti, J.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bork, R.; Brown, D. A.; Busby, D.; Cardenas, L.; Chandler, A.
2005-01-01
We report on the first joint search for gravitational waves by the TAMA and LIGO collaborations. We looked for millisecond-duration unmodeled gravitational-wave bursts in 473 hr of coincident data collected during early 2003. No candidate signals were found. We set an upper limit of 0.12 events per day on the rate of detectable gravitational-wave bursts, at 90% confidence level. From software simulations, we estimate that our detector network was sensitive to bursts with root-sum-square strain amplitude above approximately 1-3x10 -19 Hz -1/2 in the frequency band 700-2000 Hz. We describe the details of this collaborative search, with particular emphasis on its advantages and disadvantages compared to searches by LIGO and TAMA separately using the same data. Benefits include a lower background and longer observation time, at some cost in sensitivity and bandwidth. We also demonstrate techniques for performing coincidence searches with a heterogeneous network of detectors with different noise spectra and orientations. These techniques include using coordinated software signal injections to estimate the network sensitivity, and tuning the analysis to maximize the sensitivity and the livetime, subject to constraints on the background
On the time lags of the LIGO signals
Energy Technology Data Exchange (ETDEWEB)
Creswell, James; Von Hausegger, Sebastian; Liu, Hao; Naselsky, Pavel [The Niels Bohr Institute and Discovery Center, Blegdamsvej 17, DK-2100 Copenhagen (Denmark); Jackson, Andrew D., E-mail: dgz764@alumni.ku.dk, E-mail: s.vonhausegger@nbi.dk, E-mail: jackson@nbi.dk, E-mail: liuhao@nbi.dk, E-mail: naselsky@nbi.dk [Niels Bohr International Academy, Blegdamsvej 17, DK-2100 Copenhagen (Denmark)
2017-08-01
To date, the LIGO collaboration has detected three gravitational wave (GW) events appearing in both its Hanford and Livingston detectors. In this article we reexamine the LIGO data with regard to correlations between the two detectors. With special focus on GW150914, we report correlations in the detector noise which, at the time of the event, happen to be maximized for the same time lag as that found for the event itself. Specifically, we analyze correlations in the calibration lines in the vicinity of 35 Hz as well as the residual noise in the data after subtraction of the best-fit theoretical templates. The residual noise for the other two events, GW151226 and GW170104, exhibits similar behavior. A clear distinction between signal and noise therefore remains to be established in order to determine the contribution of gravitational waves to the detected signals.
On the time lags of the LIGO signals
International Nuclear Information System (INIS)
Creswell, James; Von Hausegger, Sebastian; Liu, Hao; Naselsky, Pavel; Jackson, Andrew D.
2017-01-01
To date, the LIGO collaboration has detected three gravitational wave (GW) events appearing in both its Hanford and Livingston detectors. In this article we reexamine the LIGO data with regard to correlations between the two detectors. With special focus on GW150914, we report correlations in the detector noise which, at the time of the event, happen to be maximized for the same time lag as that found for the event itself. Specifically, we analyze correlations in the calibration lines in the vicinity of 35 Hz as well as the residual noise in the data after subtraction of the best-fit theoretical templates. The residual noise for the other two events, GW151226 and GW170104, exhibits similar behavior. A clear distinction between signal and noise therefore remains to be established in order to determine the contribution of gravitational waves to the detected signals.
First test of high frequency Gravity Waves from inflation using Advanced LIGO
International Nuclear Information System (INIS)
Lopez, Alejandro; Freese, Katherine
2015-01-01
Inflation models ending in a first order phase transition produce gravitational waves (GW) via bubble collisions of the true vacuum phase. We demonstrate that these bubble collisions can leave an observable signature in Advanced LIGO, an upcoming ground-based GW experiment. These GW are dependent on two parameters of the inflationary model: ε represents the energy difference between the false vacuum and the true vacuum of the inflaton potential, and χ measures how fast the phase transition ends (χ ∼ the number of e-folds during the actual phase transition). Advanced LIGO will be able to test the validity of single-phase transition models within the parameter space 10 7 GeV∼< ε 1/4 ∼< 10 10 GeV and 0.19 ∼< χ ∼< 1. If inflation occurred through a first order phase transition, then Advanced LIGO could be the first to discover high frequency GW from inflation
Fermi GBM Observations During the Second Observing Run of LIGO/Virgo
Goldstein, Adam; Fermi-GBM
2018-01-01
The Fermi Gamma-ray Burst Monitor (GBM) is a prolific detector of gamma-ray bursts (GRBs) and detects more short duration GRBs than any other instrument currently in operation. Short GRBs are thought to be associated with the mergers of binary neutron star systems (or neutron star-black hole systems), and are therefore considered likely counterparts to gravitational-wave detections from LIGO/Virgo. We report on the GBM observations during the second observing run of LIGO/Virgo and detail the physical and astrophysical insights that might be gleaned from a joint detection of a short GRB and a gravitational-wave source.
Accurate calibration of test mass displacement in the LIGO interferometers
Energy Technology Data Exchange (ETDEWEB)
Goetz, E [University of Michigan, Ann Arbor, MI 48109 (United States); Savage, R L Jr; Garofoli, J; Kawabe, K; Landry, M [LIGO Hanford Observatory, Richland, WA 99352 (United States); Gonzalez, G; Kissel, J; Sung, M [Louisiana State University, Baton Rouge, LA 70803 (United States); Hirose, E [Syracuse University, Syracuse, NY 13244 (United States); Kalmus, P [Columbia University, New York, NY 10027 (United States); O' Reilly, B; Stuver, A [LIGO Livingston Observatory, Livingston, LA 70754 (United States); Siemens, X, E-mail: egoetz@umich.ed, E-mail: savage_r@ligo-wa.caltech.ed [University of Wisconsin-Milwaukee, Milwaukee, WI 53201 (United States)
2010-04-21
We describe three fundamentally different methods we have applied to calibrate the test mass displacement actuators to search for systematic errors in the calibration of the LIGO gravitational-wave detectors. The actuation frequencies tested range from 90 Hz to 1 kHz and the actuation amplitudes range from 10{sup -6} m to 10{sup -18} m. For each of the four test mass actuators measured, the weighted mean coefficient over all frequencies for each technique deviates from the average actuation coefficient for all three techniques by less than 4%. This result indicates that systematic errors in the calibration of the responses of the LIGO detectors to differential length variations are within the stated uncertainties.
Accurate calibration of test mass displacement in the LIGO interferometers
International Nuclear Information System (INIS)
Goetz, E; Savage, R L Jr; Garofoli, J; Kawabe, K; Landry, M; Gonzalez, G; Kissel, J; Sung, M; Hirose, E; Kalmus, P; O'Reilly, B; Stuver, A; Siemens, X
2010-01-01
We describe three fundamentally different methods we have applied to calibrate the test mass displacement actuators to search for systematic errors in the calibration of the LIGO gravitational-wave detectors. The actuation frequencies tested range from 90 Hz to 1 kHz and the actuation amplitudes range from 10 -6 m to 10 -18 m. For each of the four test mass actuators measured, the weighted mean coefficient over all frequencies for each technique deviates from the average actuation coefficient for all three techniques by less than 4%. This result indicates that systematic errors in the calibration of the responses of the LIGO detectors to differential length variations are within the stated uncertainties.
Parametrized tests of post-Newtonian theory using Advanced LIGO and Einstein Telescope
International Nuclear Information System (INIS)
Mishra, Chandra Kant; Arun, K. G.; Iyer, Bala R.; Sathyaprakash, B. S.
2010-01-01
General relativity has very specific predictions for the gravitational waveforms from inspiralling compact binaries obtained using the post-Newtonian (PN) approximation. We investigate the extent to which the measurement of the PN coefficients, possible with the second generation gravitational-wave detectors such as the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO) and the third generation gravitational-wave detectors such as the Einstein Telescope (ET), could be used to test post-Newtonian theory and to put bounds on a subclass of parametrized-post-Einstein theories which differ from general relativity in a parametrized sense. We demonstrate this possibility by employing the best inspiralling waveform model for nonspinning compact binaries which is 3.5PN accurate in phase and 3PN in amplitude. Within the class of theories considered, Advanced LIGO can test the theory at 1.5PN and thus the leading tail term. Future observations of stellar mass black hole binaries by ET can test the consistency between the various PN coefficients in the gravitational-wave phasing over the mass range of 11-44M · . The choice of the lower frequency cutoff is important for testing post-Newtonian theory using the ET. The bias in the test arising from the assumption of nonspinning binaries is indicated.
Update on quadruple suspension design for Advanced LIGO
International Nuclear Information System (INIS)
Aston, S M; Carbone, L; Cutler, R M; Hoyland, D; Barton, M A; Bland, B; Bell, A S; Beveridge, N; Cagnoli, G; Cantley, C A; Cumming, A V; Cunningham, L; Hammond, G D; Haughian, K; Hough, J; Brummitt, A J; Greenhalgh, R J S; Hayler, T M; Heptonstall, A; Heefner, J
2012-01-01
We describe the design of the suspension systems for the major optics for Advanced LIGO, the upgrade to LIGO—the Laser Interferometric Gravitational-Wave Observatory. The design is based on that used in GEO600—the German/UK interferometric gravitational wave detector, with further development to meet the more stringent noise requirements for Advanced LIGO. The test mass suspensions consist of a four-stage or quadruple pendulum for enhanced seismic isolation. To minimize suspension thermal noise, the final stage consists of a silica mirror, 40 kg in mass, suspended from another silica mass by four silica fibres welded to silica ears attached to the sides of the masses using hydroxide-catalysis bonding. The design is chosen to achieve a displacement noise level for each of the seismic and thermal noise contributions of 10 −19 m/√Hz at 10 Hz, for each test mass. We discuss features of the design which has been developed as a result of experience with prototypes and associated investigations. (paper)
Constraints on cosmic strings using data from the first Advanced LIGO observing run
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H.-P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Fitz-Axen, M.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J.-M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, W. S.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Lück, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña Hernandez, I.; Magaña-Sandoval, F.; Magaña Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosińska, D.; Ross, M. P.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steer, D. A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tápai, M.; Taracchini, A.; Taylor, J. A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y.-F.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, K. W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; ZadroŻny, A.; Zanolin, M.; Zelenova, T.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.-H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration
2018-05-01
Cosmic strings are topological defects which can be formed in grand unified theory scale phase transitions in the early universe. They are also predicted to form in the context of string theory. The main mechanism for a network of Nambu-Goto cosmic strings to lose energy is through the production of loops and the subsequent emission of gravitational waves, thus offering an experimental signature for the existence of cosmic strings. Here we report on the analysis conducted to specifically search for gravitational-wave bursts from cosmic string loops in the data of Advanced LIGO 2015-2016 observing run (O1). No evidence of such signals was found in the data, and as a result we set upper limits on the cosmic string parameters for three recent loop distribution models. In this paper, we initially derive constraints on the string tension G μ and the intercommutation probability, using not only the burst analysis performed on the O1 data set but also results from the previously published LIGO stochastic O1 analysis, pulsar timing arrays, cosmic microwave background and big-bang nucleosynthesis experiments. We show that these data sets are complementary in that they probe gravitational waves produced by cosmic string loops during very different epochs. Finally, we show that the data sets exclude large parts of the parameter space of the three loop distribution models we consider.
Classification and unsupervised clustering of LIGO data with Deep Transfer Learning
George, Daniel; Shen, Hongyu; Huerta, E. A.
2018-05-01
Gravitational wave detection requires a detailed understanding of the response of the LIGO and Virgo detectors to true signals in the presence of environmental and instrumental noise. Of particular interest is the study of anomalous non-Gaussian transients, such as glitches, since their occurrence rate in LIGO and Virgo data can obscure or even mimic true gravitational wave signals. Therefore, successfully identifying and excising these anomalies from gravitational wave data is of utmost importance for the detection and characterization of true signals and for the accurate computation of their significance. To facilitate this work, we present the first application of deep learning combined with transfer learning to show that knowledge from pretrained models for real-world object recognition can be transferred for classifying spectrograms of glitches. To showcase this new method, we use a data set of twenty-two classes of glitches, curated and labeled by the Gravity Spy project using data collected during LIGO's first discovery campaign. We demonstrate that our Deep Transfer Learning method enables an optimal use of very deep convolutional neural networks for glitch classification given small and unbalanced training data sets, significantly reduces the training time, and achieves state-of-the-art accuracy above 98.8%, lowering the previous error rate by over 60%. More importantly, once trained via transfer learning on the known classes, we show that our neural networks can be truncated and used as feature extractors for unsupervised clustering to automatically group together new unknown classes of glitches and anomalous signals. This novel capability is of paramount importance to identify and remove new types of glitches which will occur as the LIGO/Virgo detectors gradually attain design sensitivity.
GCN CIRCULAR 21507, LIGO/Virgo G298048: INTEGRAL detection of a prompt gamma-ray counterpart
DEFF Research Database (Denmark)
Savchenko, V.; Mereghetti, S.; Ferrigno, C.
2017-01-01
We investigated serendipitous INTEGRAL observations carried out at thetime of the LIGO/Virgo burst candidate G298048. The satellite was covering a fraction of the probability of the LIGO-Virgo localization. The best sensitivity depends on the source location. We investigated the SPI-ACS light...... analysis is ongoing, and will be reported in the coming circulars....
International Nuclear Information System (INIS)
Conforto, Gianni; De Salvo, Riccardo
2004-01-01
Recent X-ray observations of many galaxies, combined with optical observations of Galactic globular clusters, provide evidence for a population of Black Holes (BH) with masses of hundreds to thousands of solar masses. These candidate intermediate-mass BHs are often found in high density stellar clusters, where dynamical braking is rapid and hence massive stars are expected to sink to the center of the clusters within a few million years. In this same timescale, heavy star binary systems are expected to undergo numerous three-body interactions, tightening them and causing massive BHs to undergo multiple coalescences. At the BH masses implied by observations, these coalescences will take place below 100 Hz. There are advances in technology that make instruments to observe these events feasible. For example, new measurements of fused silica quality factors, as well as new wide beam technologies, can drive the thermal noise of large mirrors sufficiently low to allow monitoring of these low frequency BH-BH inspirals. It is possible to suspend an additional LF interferometer in the advanced LIGO beam pipes and within the existing LIGO facilities. This additional interferometer could be operated simultaneously with the advanced LIGO ones, thus providing both matching companions for the LF Virgo GW interferometer, and suitable triggers for higher frequency merging and ring-down signals to be measured in advanced LIGO
Einstein's Equivalence Principle and Invalidity of Thorne's Theory for LIGO
Directory of Open Access Journals (Sweden)
Lo C. Y.
2006-04-01
Full Text Available The theoretical foundation of LIGO's design is based on the equation of motion derived by Thorne. His formula, motivated by Einstein's theory of measurement, shows that the gravitational wave-induced displacement of a mass with respect to an object is proportional to the distance from the object. On the other hand, based on the observed bending of light and Einstein's equivalence principle, it is concluded that such induced displacement has nothing to do with the distance from another object. It is shown that the derivation of Thorne's formula has invalid assumptions that make it inapplicable to LIGO. This is a good counter example for those who claimed that Einstein's equivalence principle is not important or even irrelevant.
GW150914: The Advanced LIGO Detectors in the Era of First Discoveries.
Abbott, B P; Abbott, R; Abbott, T D; Abernathy, M R; Acernese, F; Ackley, K; Adams, C; Adams, T; Addesso, P; Adhikari, R X; Adya, V B; Affeldt, C; Agathos, M; Agatsuma, K; Aggarwal, N; Aguiar, O D; Aiello, L; Ain, A; Ajith, P; Allen, B; Allocca, A; Altin, P A; Anderson, S B; Anderson, W G; Arai, K; Araya, M C; Arceneaux, C C; Areeda, J S; Arnaud, N; Arun, K G; Ascenzi, S; Ashton, G; Ast, M; Aston, S M; Astone, P; Aufmuth, P; Aulbert, C; Babak, S; Bacon, P; Bader, M K M; Baker, P T; Baldaccini, F; Ballardin, G; Ballmer, S W; Barayoga, J C; Barclay, S E; Barish, B C; Barker, D; Barone, F; Barr, B; Barsotti, L; Barsuglia, M; Barta, D; Bartlett, J; Bartos, I; Bassiri, R; Basti, A; Batch, J C; Baune, C; Bavigadda, V; Bazzan, M; Behnke, B; Bejger, M; Bell, A S; Bell, C J; Berger, B K; Bergman, J; Bergmann, G; Berry, C P L; Bersanetti, D; Bertolini, A; Betzwieser, J; Bhagwat, S; Bhandare, R; Bilenko, I A; Billingsley, G; Birch, J; Birney, R; Biscans, S; Bisht, A; Bitossi, M; Biwer, C; Bizouard, M A; Blackburn, J K; Blair, C D; Blair, D G; Blair, R M; Bloemen, S; Bock, O; Bodiya, T P; Boer, M; Bogaert, G; Bogan, C; Bohe, A; Bojtos, P; Bond, C; Bondu, F; Bonnand, R; Boom, B A; Bork, R; Boschi, V; Bose, S; Bouffanais, Y; Bozzi, A; Bradaschia, C; Brady, P R; Braginsky, V B; Branchesi, M; Brau, J E; Briant, T; Brillet, A; Brinkmann, M; Brisson, V; Brockill, P; Brooks, A F; Brown, D A; Brown, D D; Brown, N M; Buchanan, C C; Buikema, A; Bulik, T; Bulten, H J; Buonanno, A; Buskulic, D; Buy, C; Byer, R L; Cadonati, L; Cagnoli, G; Cahillane, C; Calderón Bustillo, J; Callister, T; Calloni, E; Camp, J B; Cannon, K C; Cao, J; Capano, C D; Capocasa, E; Carbognani, F; Caride, S; Casanueva Diaz, J; Casentini, C; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Cella, G; Cepeda, C B; Cerboni Baiardi, L; Cerretani, G; Cesarini, E; Chakraborty, R; Chalermsongsak, T; Chamberlin, S J; Chan, M; Chao, S; Charlton, P; Chassande-Mottin, E; Chen, H Y; Chen, Y; Cheng, C; Chincarini, A; Chiummo, A; Cho, H S; Cho, M; Chow, J H; Christensen, N; Chu, Q; Chua, S; Chung, S; Ciani, G; Clara, F; Clark, J A; Cleva, F; Coccia, E; Cohadon, P-F; Colla, A; Collette, C G; Cominsky, L; Constancio, M; Conte, A; Conti, L; Cook, D; Corbitt, T R; Cornish, N; Corsi, A; Cortese, S; Costa, C A; Coughlin, M W; Coughlin, S B; Coulon, J-P; Countryman, S T; Couvares, P; Cowan, E E; Coward, D M; Cowart, M J; Coyne, D C; Coyne, R; Craig, K; Creighton, J D E; Cripe, J; Crowder, S G; Cumming, A; Cunningham, L; Cuoco, E; Dal Canton, T; Danilishin, S L; D'Antonio, S; Danzmann, K; Darman, N S; Dattilo, V; Dave, I; Daveloza, H P; Davier, M; Davies, G S; Daw, E J; Day, R; DeBra, D; Debreczeni, G; Degallaix, J; De Laurentis, M; Deléglise, S; Del Pozzo, W; Denker, T; Dent, T; Dereli, H; Dergachev, V; DeRosa, R T; De Rosa, R; DeSalvo, R; Dhurandhar, S; Díaz, M C; Di Fiore, L; Di Giovanni, M; Di Lieto, A; Di Pace, S; Di Palma, I; Di Virgilio, A; Dojcinoski, G; Dolique, V; Donovan, F; Dooley, K L; Doravari, S; Douglas, R; Downes, T P; Drago, M; Drever, R W P; Driggers, J C; Du, Z; Ducrot, M; Dwyer, S E; Edo, T B; Edwards, M C; Effler, A; Eggenstein, H-B; Ehrens, P; Eichholz, J; Eikenberry, S S; Engels, W; Essick, R C; Etzel, T; Evans, M; Evans, T M; Everett, R; Factourovich, M; Fafone, V; Fair, H; Fairhurst, S; Fan, X; Fang, Q; Farinon, S; Farr, B; Farr, W M; Favata, M; Fays, M; Fehrmann, H; Fejer, M M; Ferrante, I; Ferreira, E C; Ferrini, F; Fidecaro, F; Fiori, I; Fiorucci, D; Fisher, R P; Flaminio, R; Fletcher, M; Fournier, J-D; Franco, S; Frasca, S; Frasconi, F; Frei, Z; Freise, A; Frey, R; Frey, V; Fricke, T T; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Gabbard, H A G; Gair, J R; Gammaitoni, L; Gaonkar, S G; Garufi, F; Gatto, A; Gaur, G; Gehrels, N; Gemme, G; Gendre, B; Genin, E; Gennai, A; George, J; Gergely, L; Germain, V; Ghosh, Archisman; Ghosh, S; Giaime, J A; Giardina, K D; Giazotto, A; Gill, K; Glaefke, A; Goetz, E; Goetz, R; Gondan, L; González, G; Gonzalez Castro, J M; Gopakumar, A; Gordon, N A; Gorodetsky, M L; Gossan, S E; Gosselin, M; Gouaty, R; Graef, C; Graff, P B; Granata, M; Grant, A; Gras, S; Gray, C; Greco, G; Green, A C; Groot, P; Grote, H; Grunewald, S; Guidi, G M; Guo, X; Gupta, A; Gupta, M K; Gushwa, K E; Gustafson, E K; Gustafson, R; Hacker, J J; Hall, B R; Hall, E D; Hammond, G; Haney, M; Hanke, M M; Hanks, J; Hanna, C; Hannam, M D; Hanson, J; Hardwick, T; Haris, K; Harms, J; Harry, G M; Harry, I W; Hart, M J; Hartman, M T; Haster, C-J; Haughian, K; Heidmann, A; Heintze, M C; Heitmann, H; Hello, P; Hemming, G; Hendry, M; Heng, I S; Hennig, J; Heptonstall, A W; Heurs, M; Hild, S; Hoak, D; Hodge, K A; Hofman, D; Hollitt, S E; Holt, K; Holz, D E; Hopkins, P; Hosken, D J; Hough, J; Houston, E A; Howell, E J; Hu, Y M; Huang, S; Huerta, E A; Huet, D; Hughey, B; Husa, S; Huttner, S H; Huynh-Dinh, T; Idrisy, A; Indik, N; Ingram, D R; Inta, R; Isa, H N; Isac, J-M; Isi, M; Islas, G; Isogai, T; Iyer, B R; Izumi, K; Jacqmin, T; Jang, H; Jani, K; Jaranowski, P; Jawahar, S; Jiménez-Forteza, F; Johnson, W W; Jones, D I; Jones, R; Jonker, R J G; Ju, L; Kalaghatgi, C V; Kalogera, V; Kandhasamy, S; Kang, G; Kanner, J B; Karki, S; Kasprzack, M; Katsavounidis, E; Katzman, W; Kaufer, S; Kaur, T; Kawabe, K; Kawazoe, F; Kéfélian, F; Kehl, M S; Keitel, D; Kelley, D B; Kells, W; Kennedy, R; Key, J S; Khalaidovski, A; Khalili, F Y; Khan, I; Khan, S; Khan, Z; Khazanov, E A; Kijbunchoo, N; Kim, C; Kim, J; Kim, K; Kim, Nam-Gyu; Kim, Namjun; Kim, Y-M; King, E J; King, P J; Kinzel, D L; Kissel, J S; Kleybolte, L; Klimenko, S; Koehlenbeck, S M; Kokeyama, K; Koley, S; Kondrashov, V; Kontos, A; Korobko, M; Korth, W Z; Kowalska, I; Kozak, D B; Kringel, V; Królak, A; Krueger, C; Kuehn, G; Kumar, P; Kuo, L; Kutynia, A; Lackey, B D; Landry, M; Lange, J; Lantz, B; Lasky, P D; Lazzarini, A; Lazzaro, C; Leaci, P; Leavey, S; Lebigot, E O; Lee, C H; Lee, H K; Lee, H M; Lee, K; Lenon, A; Leonardi, M; Leong, J R; Leroy, N; Letendre, N; Levin, Y; Levine, B M; Li, T G F; Libson, A; Littenberg, T B; Lockerbie, N A; Logue, J; Lombardi, A L; Lord, J E; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lough, J D; Lück, H; Lundgren, A P; Luo, J; Lynch, R; Ma, Y; MacDonald, T; Machenschalk, B; MacInnis, M; Macleod, D M; Magaña-Sandoval, F; Magee, R M; Mageswaran, M; Majorana, E; Maksimovic, I; Malvezzi, V; Man, N; Mandel, I; Mandic, V; Mangano, V; Mansell, G L; Manske, M; Mantovani, M; Marchesoni, F; Marion, F; Márka, S; Márka, Z; Markosyan, A S; Maros, E; Martelli, F; Martellini, L; Martin, I W; Martin, R M; Martynov, D V; Marx, J N; Mason, K; Masserot, A; Massinger, T J; Masso-Reid, M; Matichard, F; Matone, L; Mavalvala, N; Mazumder, N; Mazzolo, G; McCarthy, R; McClelland, D E; McCormick, S; McGuire, S C; McIntyre, G; McIver, J; McManus, D J; McWilliams, S T; Meacher, D; Meadors, G D; Meidam, J; Melatos, A; Mendell, G; Mendoza-Gandara, D; Mercer, R A; Merilh, E; Merzougui, M; Meshkov, S; Messenger, C; Messick, C; Meyers, P M; Mezzani, F; Miao, H; Michel, C; Middleton, H; Mikhailov, E E; Milano, L; Miller, J; Millhouse, M; Minenkov, Y; Ming, J; Mirshekari, S; Mishra, C; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Moggi, A; Mohan, M; Mohapatra, S R P; Montani, M; Moore, B C; Moore, C J; Moraru, D; Moreno, G; Morriss, S R; Mossavi, K; Mours, B; Mow-Lowry, C M; Mueller, C L; Mueller, G; Muir, A W; Mukherjee, Arunava; Mukherjee, D; Mukherjee, S; Mukund, N; Mullavey, A; Munch, J; Murphy, D J; Murray, P G; Mytidis, A; Nardecchia, I; Naticchioni, L; Nayak, R K; Necula, V; Nedkova, K; Nelemans, G; Neri, M; Neunzert, A; Newton, G; Nguyen, T T; Nielsen, A B; Nissanke, S; Nitz, A; Nocera, F; Nolting, D; Normandin, M E; Nuttall, L K; Oberling, J; Ochsner, E; O'Dell, J; Oelker, E; Ogin, G H; Oh, J J; Oh, S H; Ohme, F; Oliver, M; Oppermann, P; Oram, Richard J; O'Reilly, B; O'Shaughnessy, R; Ottaway, D J; Ottens, R S; Overmier, H; Owen, B J; Pai, A; Pai, S A; Palamos, J R; Palashov, O; Palomba, C; Pal-Singh, A; Pan, H; Pankow, C; Pannarale, F; Pant, B C; Paoletti, F; Paoli, A; Papa, M A; Paris, H R; Parker, W; Pascucci, D; Pasqualetti, A; Passaquieti, R; Passuello, D; Patricelli, B; Patrick, Z; Pearlstone, B L; Pedraza, M; Pedurand, R; Pekowsky, L; Pele, A; Penn, S; Perreca, A; Phelps, M; Piccinni, O; Pichot, M; Piergiovanni, F; Pierro, V; Pillant, G; Pinard, L; Pinto, I M; Pitkin, M; Poggiani, R; Popolizio, P; Post, A; Powell, J; Prasad, J; Predoi, V; Premachandra, S S; Prestegard, T; Price, L R; Prijatelj, M; Principe, M; Privitera, S; Prodi, G A; Prokhorov, L; Puncken, O; Punturo, M; Puppo, P; Pürrer, M; Qi, H; Qin, J; Quetschke, V; Quintero, E A; Quitzow-James, R; Raab, F J; Rabeling, D S; Radkins, H; Raffai, P; Raja, S; Rakhmanov, M; Rapagnani, P; Raymond, V; Razzano, M; Re, V; Read, J; Reed, C M; Regimbau, T; Rei, L; Reid, S; Reitze, D H; Rew, H; Reyes, S D; Ricci, F; Riles, K; Robertson, N A; Robie, R; Robinet, F; Rocchi, A; Rolland, L; Rollins, J G; Roma, V J; Romano, R; Romanov, G; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Sachdev, S; Sadecki, T; Sadeghian, L; Salconi, L; Saleem, M; Salemi, F; Samajdar, A; Sammut, L; Sanchez, E J; Sandberg, V; Sandeen, B; Sanders, J R; Sassolas, B; Sathyaprakash, B S; Saulson, P R; Sauter, O; Savage, R L; Sawadsky, A; Schale, P; Schilling, R; Schmidt, J; Schmidt, P; Schnabel, R; Schofield, R M S; Schönbeck, A; Schreiber, E; Schuette, D; Schutz, B F; Scott, J; Scott, S M; Sellers, D; Sengupta, A S; Sentenac, D; Sequino, V; Sergeev, A; Serna, G; Setyawati, Y; Sevigny, A; Shaddock, D A; Shah, S; Shahriar, M S; Shaltev, M; Shao, Z; Shapiro, B; Shawhan, P; Sheperd, A; Shoemaker, D H; Shoemaker, D M; Siellez, K; Siemens, X; Sigg, D; Silva, A D; Simakov, D; Singer, A; Singer, L P; Singh, A; Singh, R; Singhal, A; Sintes, A M; Slagmolen, B J J; Smith, J R; Smith, N D; Smith, R J E; Son, E J; Sorazu, B; Sorrentino, F; Souradeep, T; Srivastava, A K; Staley, A; Steinke, M; Steinlechner, J; Steinlechner, S; Steinmeyer, D; Stephens, B C; Stone, R; Strain, K A; Straniero, N; Stratta, G; Strauss, N A; Strigin, S; Sturani, R; Stuver, A L; Summerscales, T Z; Sun, L; Sutton, P J; Swinkels, B L; Szczepańczyk, M J; Tacca, M; Talukder, D; Tanner, D B; Tápai, M; Tarabrin, S P; Taracchini, A; Taylor, R; Theeg, T; Thirugnanasambandam, M P; Thomas, E G; Thomas, M; Thomas, P; Thorne, K A; Thorne, K S; Thrane, E; Tiwari, S; Tiwari, V; Tokmakov, K V; Tomlinson, C; Tonelli, M; Torres, C V; Torrie, C I; Töyrä, D; Travasso, F; Traylor, G; Trifirò, D; Tringali, M C; Trozzo, L; Tse, M; Turconi, M; Tuyenbayev, D; Ugolini, D; Unnikrishnan, C S; Urban, A L; Usman, S A; Vahlbruch, H; Vajente, G; Valdes, G; van Bakel, N; van Beuzekom, M; van den Brand, J F J; Van Den Broeck, C; Vander-Hyde, D C; van der Schaaf, L; van Heijningen, J V; van Veggel, A A; Vardaro, M; Vass, S; Vasúth, M; Vaulin, R; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Venkateswara, K; Verkindt, D; Vetrano, F; Viceré, A; Vinciguerra, S; Vine, D J; Vinet, J-Y; Vitale, S; Vo, T; Vocca, H; Vorvick, C; Voss, D; Vousden, W D; Vyatchanin, S P; Wade, A R; Wade, L E; Wade, M; Walker, M; Wallace, L; Walsh, S; Wang, G; Wang, H; Wang, M; Wang, X; Wang, Y; Ward, R L; Warner, J; Was, M; Weaver, B; Wei, L-W; Weinert, M; Weinstein, A J; Weiss, R; Welborn, T; Wen, L; Weßels, P; Westphal, T; Wette, K; Whelan, J T; Whitcomb, S E; White, D J; Whiting, B F; Williams, R D; Williamson, A R; Willis, J L; Willke, B; Wimmer, M H; Winkler, W; Wipf, C C; Wittel, H; Woan, G; Worden, J; Wright, J L; Wu, G; Yablon, J; Yam, W; Yamamoto, H; Yancey, C C; Yap, M J; Yu, H; Yvert, M; Zadrożny, A; Zangrando, L; Zanolin, M; Zendri, J-P; Zevin, M; Zhang, F; Zhang, L; Zhang, M; Zhang, Y; Zhao, C; Zhou, M; Zhou, Z; Zhu, X J; Zucker, M E; Zuraw, S E; Zweizig, J
2016-04-01
Following a major upgrade, the two advanced detectors of the Laser Interferometer Gravitational-wave Observatory (LIGO) held their first observation run between September 2015 and January 2016. With a strain sensitivity of 10^{-23}/sqrt[Hz] at 100 Hz, the product of observable volume and measurement time exceeded that of all previous runs within the first 16 days of coincident observation. On September 14, 2015, the Advanced LIGO detectors observed a transient gravitational-wave signal determined to be the coalescence of two black holes [B. P. Abbott et al., Phys. Rev. Lett. 116, 061102 (2016)], launching the era of gravitational-wave astronomy. The event, GW150914, was observed with a combined signal-to-noise ratio of 24 in coincidence by the two detectors. Here, we present the main features of the detectors that enabled this observation. At full sensitivity, the Advanced LIGO detectors are designed to deliver another factor of 3 improvement in the signal-to-noise ratio for binary black hole systems similar in mass to GW150914.
Prospects for Detecting Gravitational Waves at 5 Hz with Ground-Based Detectors
Yu, Hang; Martynov, Denis; Vitale, Salvatore; Evans, Matthew; Shoemaker, David; Barr, Bryan; Hammond, Giles; Hild, Stefan; Hough, James; Huttner, Sabina; Rowan, Sheila; Sorazu, Borja; Carbone, Ludovico; Freise, Andreas; Mow-Lowry, Conor; Dooley, Katherine L.; Fulda, Paul; Grote, Hartmut; Sigg, Daniel
2018-04-01
We propose an upgrade to Advanced LIGO (aLIGO), named LIGO-LF, that focuses on improving the sensitivity in the 5-30 Hz low-frequency band, and we explore the upgrade's astrophysical applications. We present a comprehensive study of the detector's technical noises and show that with technologies currently under development, such as interferometrically sensed seismometers and balanced-homodyne readout, LIGO-LF can reach the fundamental limits set by quantum and thermal noises down to 5 Hz. These technologies are also directly applicable to the future generation of detectors. We go on to consider this upgrade's implications for the astrophysical output of an aLIGO-like detector. A single LIGO-LF can detect mergers of stellar-mass black holes (BHs) out to a redshift of z ≃6 and would be sensitive to intermediate-mass black holes up to 2000 M⊙. The detection rate of merging BHs will increase by a factor of 18 compared to aLIGO. Additionally, for a given source the chirp mass and total mass can be constrained 2 times better than aLIGO and the effective spin 3-5 times better than aLIGO. Furthermore, LIGO-LF enables the localization of coalescing binary neutron stars with an uncertainty solid angle 10 times smaller than that of aLIGO at 30 Hz and 4 times smaller when the entire signal is used. LIGO-LF also significantly enhances the probability of detecting other astrophysical phenomena including the tidal excitation of neutron star r modes and the gravitational memory effects.
DEFF Research Database (Denmark)
Aartsen, M.G.; Ackermann, M.; Adams, J.
2014-01-01
We report the results of a multimessenger search for coincident signals from the LIGO and Virgo gravitational-wave observatories and the partially completed IceCube high-energy neutrino detector, including periods of joint operation between 2007–2010. These include parts of the 2005–2007 run...... and the 2009–2010 run for LIGO-Virgo, and IceCube’s observation periods with 22, 59 and 79 strings. We find no significant coincident events, and use the search results to derive upper limits on the rate of joint sources for a range of source emission parameters. For the optimistic assumption of gravitational-wave...... waves and neutrinos will aid discovery in the advanced gravitational-wave detector era....
International Nuclear Information System (INIS)
Barish, B.C.
2001-01-01
One of the most important consequences of the Theory of General Relativity is the concept of gravitational waves. As we enter the new millennium, a new generation of detectors sensitive enough to directly detect such waves will become operational. Detectable events could originate from a variety of catastrophic events in the distant universe, such as the gravitational collapse of stars or the coalescence of compact binary systems. In this talk, I review the detection technique of suspended mass interferometry, including the status and plans for the Laser Interferometry Gravitational-wave Observatory (LIGO). I also discuss the astrophysical sources of gravitational waves and the preparations for data analysis to search for signals of gravitational waves. (author)
Improving LIGO calibration accuracy by tracking and compensating for slow temporal variations
International Nuclear Information System (INIS)
Tuyenbayev, D; Karki, S; Goetz, E; Izumi, K; Kissel, J S; Mendell, G; Savage, R L; Betzwieser, J; Kandhasamy, S; Cahillane, C; Weinstein, A J; Wade, M
2017-01-01
Calibration of the second-generation LIGO interferometric gravitational-wave detectors employs a method that uses injected periodic modulations to track and compensate for slow temporal variations in the differential length response of the instruments. These detectors utilize feedback control loops to maintain resonance conditions by suppressing differential arm length variations. We describe how the sensing and actuation functions of these servo loops are parameterized and how the slow variations in these parameters are quantified using the injected modulations. We report the results of applying this method to the LIGO detectors and show that it significantly reduces systematic errors in their calibrated outputs. (paper)
Prospects for Detecting Gravitational Waves at 5 Hz with Ground-Based Detectors.
Yu, Hang; Martynov, Denis; Vitale, Salvatore; Evans, Matthew; Shoemaker, David; Barr, Bryan; Hammond, Giles; Hild, Stefan; Hough, James; Huttner, Sabina; Rowan, Sheila; Sorazu, Borja; Carbone, Ludovico; Freise, Andreas; Mow-Lowry, Conor; Dooley, Katherine L; Fulda, Paul; Grote, Hartmut; Sigg, Daniel
2018-04-06
We propose an upgrade to Advanced LIGO (aLIGO), named LIGO-LF, that focuses on improving the sensitivity in the 5-30 Hz low-frequency band, and we explore the upgrade's astrophysical applications. We present a comprehensive study of the detector's technical noises and show that with technologies currently under development, such as interferometrically sensed seismometers and balanced-homodyne readout, LIGO-LF can reach the fundamental limits set by quantum and thermal noises down to 5 Hz. These technologies are also directly applicable to the future generation of detectors. We go on to consider this upgrade's implications for the astrophysical output of an aLIGO-like detector. A single LIGO-LF can detect mergers of stellar-mass black holes (BHs) out to a redshift of z≃6 and would be sensitive to intermediate-mass black holes up to 2000 M_{⊙}. The detection rate of merging BHs will increase by a factor of 18 compared to aLIGO. Additionally, for a given source the chirp mass and total mass can be constrained 2 times better than aLIGO and the effective spin 3-5 times better than aLIGO. Furthermore, LIGO-LF enables the localization of coalescing binary neutron stars with an uncertainty solid angle 10 times smaller than that of aLIGO at 30 Hz and 4 times smaller when the entire signal is used. LIGO-LF also significantly enhances the probability of detecting other astrophysical phenomena including the tidal excitation of neutron star r modes and the gravitational memory effects.
THE INTERPLANETARY NETWORK RESPONSE TO LIGO GW150914
Energy Technology Data Exchange (ETDEWEB)
Hurley, K. [University of California, Berkeley, Space Sciences Laboratory, 7 Gauss Way, Berkeley, CA 94720-7450 (United States); Svinkin, D. S.; Aptekar, R. L.; Golenetskii, S. V.; Frederiks, D. D. [Ioffe Physical Technical Institute, Politekhnicheskaya 26, St. Petersburg 194021 (Russian Federation); Boynton, W. [University of Arizona, Department of Planetary Sciences, Tucson, AZ 85721 (United States); Mitrofanov, I. G.; Golovin, D. V.; Kozyrev, A. S.; Litvak, M. L.; Sanin, A. B. [Space Research Institute, 84/32, Profsoyuznaya, Moscow 117997 (Russian Federation); Rau, A.; Kienlin, A. von; Zhang, X. [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstrasse, Postfach 1312, Garching, D-85748 Germany (Germany); Connaughton, V.; Meegan, C. [University of Alabama in Huntsville, NSSTC, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Cline, T.; Gehrels, N., E-mail: khurley@ssl.berkeley.edu [NASA Goddard Space Flight Center, Code 661, Greenbelt, MD 20771 (United States)
2016-09-20
We have performed a blind search for a gamma-ray transient of arbitrary duration and energy spectrum around the time of the LIGO gravitational-wave event GW150914 with the six-spacecraft interplanetary network (IPN). Four gamma-ray bursts were detected between 30 hr prior to the event and 6.1 hr after it, but none could convincingly be associated with GW150914. No other transients were detected down to limiting 15–150 keV fluences of roughly 5 ×10{sup −8}–5 × 10{sup −7} erg cm{sup −2}. We discuss the search strategies and temporal coverage of the IPN on the day of the event and compare the spatial coverage to the region where GW150914 originated. We also report the negative result of a targeted search for the Fermi -GBM event reported in conjunction with GW150914.
Listening for the music of gravity [TAMA and LIGO detectors
DeSalvo, R
2001-01-01
The latest generation of high-precision experiments is bringing observers one step closer to detecting the elusive song of gravity waves. The authors discuss the progress of Japan's TAMA project and the LIGO detector. (0 refs).
RATIR Follow-up of LIGO/Virgo Gravitational Wave Events
Golkhou, V. Zach; Butler, Nathaniel R.; Strausbaugh, Robert; Troja, Eleonora; Kutyrev, Alexander; Lee, William H.; Román-Zúñiga, Carlos G.; Watson, Alan M.
2018-04-01
We have recently witnessed the first multi-messenger detection of colliding neutron stars through gravitational waves (GWs) and electromagnetic (EM) waves (GW 170817) thanks to the joint efforts of LIGO/Virgo and Space/Ground-based telescopes. In this paper, we report on the RATIR follow-up observation strategies and show the results for the trigger G194575. This trigger is not of astrophysical interest; however, it is of great interest to the robust design of a follow-up engine to explore large sky-error regions. We discuss the development of an image-subtraction pipeline for the six-color, optical/NIR imaging camera RATIR. Considering a two-band (i and r) campaign in the fall of 2015, we find that the requirement of simultaneous detection in both bands leads to a factor ∼10 reduction in false alarm rate, which can be further reduced using additional bands. We also show that the performance of our proposed algorithm is robust to fluctuating observing conditions, maintaining a low false alarm rate with a modest decrease in system efficiency that can be overcome utilizing repeat visits. Expanding our pipeline to search for either optical or NIR detections (three or more bands), considering separately the optical riZ and NIR YJH bands, should result in a false alarm rate ≈1% and an efficiency ≈90%. RATIR’s simultaneous optical/NIR observations are expected to yield about one candidate transient in the vast 100 deg2 LIGO error region for prioritized follow-up with larger aperture telescopes.
Achieving resonance in the Advanced LIGO gravitational-wave interferometer
International Nuclear Information System (INIS)
Staley, A; Martynov, D; Abbott, R; Adhikari, R X; Arai, K; Brooks, A F; Ballmer, S; Barsotti, L; Evans, M; Fritschel, P; DeRosa, R T; Effler, A; Dwyer, S; Gray, C; Izumi, K; Frolov, V V; Guido, C J; Heintze, M; Gustafson, R; Hoak, D
2014-01-01
Interferometric gravitational-wave detectors are complex instruments comprised of a Michelson interferometer enhanced by multiple coupled cavities. Active feedback control is required to operate these instruments and keep the cavities locked on resonance. The optical response is highly nonlinear until a good operating point is reached. The linear operating range is between 0.01% and 1% of a fringe for each degree of freedom. The resonance lock has to be achieved in all five degrees of freedom simultaneously, making the acquisition difficult. Furthermore, the cavity linewidth seen by the laser is only ∼1 Hz, which is four orders of magnitude smaller than the linewidth of the free running laser. The arm length stabilization system is a new technique used for arm cavity locking in Advanced LIGO. Together with a modulation technique utilizing third harmonics to lock the central Michelson interferometer, the Advanced LIGO detector has been successfully locked and brought to an operating point where detecting gravitational-waves becomes feasible. (paper)
A comparison of methods for gravitational wave burst searches from LIGO and Virgo
International Nuclear Information System (INIS)
Beauville, F; Buskulic, D; Grosjean, D; Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P; Blackburn, L; Katsavounidis, E; Bosi, L; Brocco, L; Brown, D A; Chatterji, S; Christensen, N; Knight, M; Fairhurst, S; Guidi, G; Heng, S; Hewitson, M; Klimenko, S
2008-01-01
The search procedure for burst gravitational waves has been studied using 24 h of simulated data in a network of three interferometers (Hanford 4 km, Livingston 4 km and Virgo 3 km are the example interferometers). Several methods to detect burst events developed in the LIGO Scientific Collaboration (LSC) and Virgo Collaboration have been studied and compared. We have performed coincidence analysis of the triggers obtained in the different interferometers with and without simulated signals added to the data. The benefits of having multiple interferometers of similar sensitivity are demonstrated by comparing the detection performance of the joint coincidence analysis with LSC and Virgo only burst searches. Adding Virgo to the LIGO detector network can increase by 50% the detection efficiency for this search. Another advantage of a joint LIGO-Virgo network is the ability to reconstruct the source sky position. The reconstruction accuracy depends on the timing measurement accuracy of the events in each interferometer, and is displayed in this paper with a fixed source position example
A comparison of methods for gravitational wave burst searches from LIGO and Virgo
Energy Technology Data Exchange (ETDEWEB)
Beauville, F; Buskulic, D; Grosjean, D [Laboratoire d' Annecy-le-Vieux de Physique des Particules, Chemin de Bellevue, BP 110, 74941 Annecy-le-Vieux Cedex (France); Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P [Laboratoire de l' Accelerateur Lineaire, IN2P3/CNRS-Universite de Paris XI, BP 34, 91898 Orsay Cedex (France); Blackburn, L; Katsavounidis, E [LIGO-Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Bosi, L [INFN Sezione di Perugia and/or Universita di Perugia, Via A Pascoli, I-06123 Perugia (Italy); Brocco, L [INFN Sezione di Roma and/or Universita ' La Sapienza' , P le A Moro 2, I-00185 Roma (Italy); Brown, D A; Chatterji, S [LIGO-California Institute of Technology, Pasadena, CA 91125 (United States); Christensen, N; Knight, M [Carleton College, Northfield, MN 55057 (United States); Fairhurst, S [University of Wisconsin-Milwaukee, Milwaukee, WI 53201 (United States); Guidi, G [INFN Sezione Firenze/Urbino Via G Sansone 1, I-50019 Sesto Fiorentino (Italy); and/or Universita di Firenze, Largo E Fermi 2, I-50125 Firenze and/or Universita di Urbino, Via S Chiara 27, I-61029 Urbino (Italy); Heng, S; Hewitson, M [University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Klimenko, S [University of Florida-Gainesville, FL 32611 (United States)] (and others)
2008-02-21
The search procedure for burst gravitational waves has been studied using 24 h of simulated data in a network of three interferometers (Hanford 4 km, Livingston 4 km and Virgo 3 km are the example interferometers). Several methods to detect burst events developed in the LIGO Scientific Collaboration (LSC) and Virgo Collaboration have been studied and compared. We have performed coincidence analysis of the triggers obtained in the different interferometers with and without simulated signals added to the data. The benefits of having multiple interferometers of similar sensitivity are demonstrated by comparing the detection performance of the joint coincidence analysis with LSC and Virgo only burst searches. Adding Virgo to the LIGO detector network can increase by 50% the detection efficiency for this search. Another advantage of a joint LIGO-Virgo network is the ability to reconstruct the source sky position. The reconstruction accuracy depends on the timing measurement accuracy of the events in each interferometer, and is displayed in this paper with a fixed source position example.
Wang, Sai; Wang, Yi-Fan; Huang, Qing-Guo; Li, Tjonnie G. F.
2018-05-01
Advanced LIGO's discovery of gravitational-wave events is stimulating extensive studies on the origin of binary black holes. Assuming that the gravitational-wave events can be explained by binary primordial black hole mergers, we utilize the upper limits on the stochastic gravitational-wave background given by Advanced LIGO as a new observational window to independently constrain the abundance of primordial black holes in dark matter. We show that Advanced LIGO's first observation run gives the best constraint on the primordial black hole abundance in the mass range 1 M⊙≲MPBH≲100 M⊙, pushing the previous microlensing and dwarf galaxy dynamics constraints tighter by 1 order of magnitude. Moreover, we discuss the possibility to detect the stochastic gravitational-wave background from primordial black holes, in particular from subsolar mass primordial black holes, by Advanced LIGO in the near future.
Wang, Sai; Wang, Yi-Fan; Huang, Qing-Guo; Li, Tjonnie G F
2018-05-11
Advanced LIGO's discovery of gravitational-wave events is stimulating extensive studies on the origin of binary black holes. Assuming that the gravitational-wave events can be explained by binary primordial black hole mergers, we utilize the upper limits on the stochastic gravitational-wave background given by Advanced LIGO as a new observational window to independently constrain the abundance of primordial black holes in dark matter. We show that Advanced LIGO's first observation run gives the best constraint on the primordial black hole abundance in the mass range 1M_{⊙}≲M_{PBH}≲100M_{⊙}, pushing the previous microlensing and dwarf galaxy dynamics constraints tighter by 1 order of magnitude. Moreover, we discuss the possibility to detect the stochastic gravitational-wave background from primordial black holes, in particular from subsolar mass primordial black holes, by Advanced LIGO in the near future.
Adrian-Martinez, S.; Samarai, Al; Albert, A.; Andre, M.; Anghinolfi, M.; Anton, G.; Anvar, S.; Ardid, M; Astraatmadja, T.; Aubert, J.-J.;
2013-01-01
We present the results of the first search for gravitational wave bursts associated with high energy neutrinos. Together, these messengers could reveal new, hidden sources that are not observed by conventional photon astronomy, particularly at high energy. Our search uses neutrinos detected by the underwater neutrino telescope ANTARES in its 5 line configuration during the period January - September 2007, which coincided with the fifth and first science runs of LIGO and Virgo, respectively. The LIGO-Virgo data were analysed for candidate gravitational-wave signals coincident in time and direction with the neutrino events. No significant coincident events were observed. We place limits on the density of joint high energy neutrino - gravitational wave emission events in the local universe, and compare them with densities of merger and core-collapse events.
Detailed comparison of LIGO and Virgo inspiral pipelines in preparation for a joint search
International Nuclear Information System (INIS)
Beauville, F; Buskulic, D; Grosjean, D; Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P; Blackburn, L; Katsavounidis, E; Bosi, L; Brocco, L; Brown, D A; Chatterji, S; Christensen, N; Knight, M; Fairhurst, S; Guidi, G; Heng, S; Hewitson, M; Klimenko, S
2008-01-01
Presented in this paper is a detailed and direct comparison of the detection pipelines used by LIGO and Virgo in their attempt to observe gravitational waves from binary neutron star systems. In order to test the search programs, numerous inspiral signals were added to 24 h of simulated detector data. The efficiencies of the different pipelines were tested, and found to be very similar. Parameter estimation routines were also tested. We demonstrate that there are definite benefits if LIGO and Virgo conduct a joint coincident analysis; these advantages include increased detection efficiency and information on source sky location
Characterization of Transient Noise in Advanced LIGO Relevant to Gravitational Wave Signal GW150914
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adamo, M.; Adams, C.; Adams, T.; Camp, Jordan B.
2016-01-01
On 14 September 2015, a gravitational wave signal from a coalescing black hole binary system was observed by the Advanced LIGO detectors. This paper describes the transient noise backgrounds used to determine the significance of the event (designated GW150914) and presents the results of investigations into potential correlated or uncorrelated sources of transient noise in the detectors around the time of the event. The detectors were operating nominally at the time of GW150914. We have ruled out environmental influences and non-Gaussian instrument noise at either LIGO detector as the cause of the observed gravitational wave signal.
Detailed comparison of LIGO and Virgo inspiral pipelines in preparation for a joint search
Energy Technology Data Exchange (ETDEWEB)
Beauville, F; Buskulic, D; Grosjean, D [Laboratoire d' Annecy-le-Vieux de Physique des Particules, Chemin de Bellevue, BP 110, 74941 Annecy-le-Vieux Cedex (France); Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P [Laboratoire de l' Accelerateur Lineaire, IN2P3/CNRS-Universite de Paris XI, BP 34, 91898 Orsay Cedex (France); Blackburn, L; Katsavounidis, E [LIGO-Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Bosi, L [INFN Sezione di Perugia and/or Universita di Perugia, Via A Pascoli, I-06123 Perugia (Italy); Brocco, L [INFN Sezione di Roma and/or Universita ' La Sapienza' , P.le A Moro 2, I-00185, Roma (Italy); Brown, D A; Chatterji, S [LIGO-California Institute of Technology, Pasadena, CA 91125 (United States); Christensen, N; Knight, M [Carleton College, Northfield, MN 55057 (United States); Fairhurst, S [University of Wisconsin-Milwaukee, Milwaukee, WI 53201 (United States); Guidi, G [INFN Sezione Firenze/Urbino Via G Sansone 1, I-50019 Sesto Fiorentino (Italy) and/or Universita di Firenze, Largo E.Fermi 2, I-50125 Firenze and/or Universita di Urbino, Via S Chiara 27, I-61029 Urbino (Italy); Heng, S; Hewitson, M [University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Klimenko, S [University of Florida-Gainesville, FL 32611 (United States)] (and others)
2008-02-21
Presented in this paper is a detailed and direct comparison of the detection pipelines used by LIGO and Virgo in their attempt to observe gravitational waves from binary neutron star systems. In order to test the search programs, numerous inspiral signals were added to 24 h of simulated detector data. The efficiencies of the different pipelines were tested, and found to be very similar. Parameter estimation routines were also tested. We demonstrate that there are definite benefits if LIGO and Virgo conduct a joint coincident analysis; these advantages include increased detection efficiency and information on source sky location.
All-sky search for gravitational-wave bursts in the first joint LIGO-GEO-Virgo run
International Nuclear Information System (INIS)
Abadie, J.; Abbott, B. P.; Abbott, R.; Adhikari, R.; Ajith, P.; Anderson, S. B.; Araya, M.; Aso, Y.; Ballmer, S.; Betzwieser, J.; Billingsley, G.; Black, E.; Blackburn, J. K.; Bork, R.; Brooks, A. F.; Cannon, K. C.; Cardenas, L.; Cepeda, C.; Chalermsongsak, T.; Chatterji, S.
2010-01-01
We present results from an all-sky search for unmodeled gravitational-wave bursts in the data collected by the LIGO, GEO 600 and Virgo detectors between November 2006 and October 2007. The search is performed by three different analysis algorithms over the frequency band 50-6000 Hz. Data are analyzed for times with at least two of the four LIGO-Virgo detectors in coincident operation, with a total live time of 266 days. No events produced by the search algorithms survive the selection cuts. We set a frequentist upper limit on the rate of gravitational-wave bursts impinging on our network of detectors. When combined with the previous LIGO search of the data collected between November 2005 and November 2006, the upper limit on the rate of detectable gravitational-wave bursts in the 64-2048 Hz band is 2.0 events per year at 90% confidence. We also present event rate versus strength exclusion plots for several types of plausible burst waveforms. The sensitivity of the combined search is expressed in terms of the root-sum-squared strain amplitude for a variety of simulated waveforms and lies in the range 6x10 -22 Hz -1/2 to 2x10 -20 Hz -1/2 . This is the first untriggered burst search to use data from the LIGO and Virgo detectors together, and the most sensitive untriggered burst search performed so far.
George, Daniel; Huerta, E. A.
2018-03-01
The recent Nobel-prize-winning detections of gravitational waves from merging black holes and the subsequent detection of the collision of two neutron stars in coincidence with electromagnetic observations have inaugurated a new era of multimessenger astrophysics. To enhance the scope of this emergent field of science, we pioneered the use of deep learning with convolutional neural networks, that take time-series inputs, for rapid detection and characterization of gravitational wave signals. This approach, Deep Filtering, was initially demonstrated using simulated LIGO noise. In this article, we present the extension of Deep Filtering using real data from LIGO, for both detection and parameter estimation of gravitational waves from binary black hole mergers using continuous data streams from multiple LIGO detectors. We demonstrate for the first time that machine learning can detect and estimate the true parameters of real events observed by LIGO. Our results show that Deep Filtering achieves similar sensitivities and lower errors compared to matched-filtering while being far more computationally efficient and more resilient to glitches, allowing real-time processing of weak time-series signals in non-stationary non-Gaussian noise with minimal resources, and also enables the detection of new classes of gravitational wave sources that may go unnoticed with existing detection algorithms. This unified framework for data analysis is ideally suited to enable coincident detection campaigns of gravitational waves and their multimessenger counterparts in real-time.
DESGW: Optical Follow-up of BBH LIGO-Virgo Events with DECam
Energy Technology Data Exchange (ETDEWEB)
Butler, Robert E. [Indiana U.; Soares-Santos, M. [Brandeis U.; Annis, j. [Fermilab; Herner, K. [Fermilab
2017-12-14
The DESGW program is a collaboration between members of the Dark Energy Survey, the wider astronomical community, and the LIGO-Virgo Collaboration to search for optical counterparts of gravitational wave events, such as those expected from binary neutron star mergers or neutron star-black hole mergers. While binary black hole (BBH) events are not expected to produce an electromagnetic (EM) signature, emission is certainly not impossible. The DESGW program has performed follow-up observations of four BBH events detected by LIGO in order to search for any possible EM counterpart. Failure to nd such counterparts is still relevant in that it produces limits on optical emission from such events. This is a review of follow-up results from O1 BBH events and a discussion of the status of ongoing uniform re-analysis of all BBH events that DESGW has followed up to date.
International Nuclear Information System (INIS)
Izumi, Kiwamu; Sigg, Daniel
2017-01-01
Length sensing and control is vital for Advanced LIGO and its goal of performing astrophysical searches. The current kilometer scale gravitational wave antennae are dual recycled Michelson interferometers enhanced with Fabry–Perot resonators in the arms. Observation requires the lengths of all optical cavities to be precisely servoed in the vicinity of a resonance using feedback controls. Simultaneously achieving robustness and low-noise is challenging due to cross-couplings between the multiple coupled optical resonators. We analytically derive the Advanced LIGO sensing and control scheme, calculate the effects of radiation pressure forces and review the current strategies of minimizing the coupling of noise into the gravitational wave readout. (paper)
Towards a first design of a Newtonian-noise cancellation system for Advanced LIGO
International Nuclear Information System (INIS)
Coughlin, M; Mukund, N; Mitra, S; Harms, J; Driggers, J; Adhikari, R
2016-01-01
Newtonian gravitational noise from seismic fields is predicted to be a limiting noise source at low frequency for second generation gravitational-wave detectors. Mitigation of this noise will be achieved by Wiener filtering using arrays of seismometers deployed in the vicinity of all test masses. In this work, we present optimized configurations of seismometer arrays using a variety of simplified models of the seismic field based on seismic observations at LIGO Hanford. The model that best fits the seismic measurements leads to noise reduction limited predominantly by seismometer self-noise. A first simplified design of seismic arrays for Newtonian-noise cancellation at the LIGO sites is presented, which suggests that it will be sufficient to monitor surface displacement inside the buildings. (paper)
First Search for Gravitational Waves from Known Pulsars with Advanced LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, M.J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, A. J. K.; Chua, S. S. Y.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Galiana, A. Fernandez; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, Whansun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kraemer, H.C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Lueck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath Hoareau, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meador, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A. L.; Miller, B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P.G.; Mytidis, A.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Castro-Perez, J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, D.M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toeyrae, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S.J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Buchner, S.; Cognard, I.; Corongiu, A.; Freire, P. C.C.; Guillemot, L.; Hobbs, G. B.; Kerr, M.; Lyne, A. G.; Possenti, A.; Ridolfi, A.; Shannon, R. M.; Stappers, B. W.; Weltevrede, P.
2017-01-01
We present the result of searches for gravitational waves from 200 pulsars using data from the first observing run of the Advanced LIGO detectors. We find no significant evidence for a gravitational-wave signal from any of these pulsars, but we are able to set the most constraining upper limits yet
Binary Black Hole Mergers in the First Advanced LIGO Observing Run
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bejger, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fenyvesi, E.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gehrels, N.; Gemme, G.; Geng, P.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, R.G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hamilton-Ayers, M.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jian, L.; Jimenez-Forteza, F.; Johnson, W.; Johnson-McDaniel, N. K.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chi-Woong; Kim, Chunglee; Kim, J.; Kim, K.; Kim, Namjun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Lewis, J. B.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C.; Lueck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Zertuche, L. Magana; Magee, R. M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A. L.; Miller, B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nedkova, K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pan, Y.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Rizzo, D.M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O. E. S.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.G.; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
The first observational run of the Advanced LIGO detectors, from September 12, 2015 to January 19, 2016, saw the first detections of gravitational waves from binary black hole mergers. In this paper, we present full results from a search for binary black hole merger signals with total masses up to
A first comparison of SLOPE and other LIGO burst event trigger generators
International Nuclear Information System (INIS)
Stuver, Amber L; Finn, Lee Samuel
2006-01-01
A number of different methods have been proposed to identify unanticipated burst sources of gravitational waves in data arising from LIGO and other gravitational wave detectors. When confronted with such a wide variety of methods one is moved to ask if they are all necessary, i.e. given detector data that is assumed to have no gravitational wave signals present, do they generally identify the same events with the same efficiency, or do they each 'see' different things in the detector? Here we consider three different methods, which have been used within the LIGO Scientific Collaboration as part of its search for unanticipated gravitational wave bursts. We find that each of these three different methods developed for identifying candidate gravitational wave burst sources are, in fact, attuned to significantly different features in detector data, suggesting that they may provide largely independent lists of candidate gravitational wave burst events
LIGO GW150914 and GW151226 gravitational wave detection and generalized gravitation theory (MOG
Directory of Open Access Journals (Sweden)
J.W. Moffat
2016-12-01
Full Text Available The nature of gravitational waves in a generalized gravitation theory is investigated. The linearized field equations and the metric tensor quadrupole moment power and the decrease in radius of an inspiralling binary system of two compact objects are derived. The generalized Kerr metric describing a spinning black hole is determined by its mass M and the spin parameter a=cS/GM2. The LIGO-Virgo collaboration data is fitted with smaller binary black hole masses in agreement with the current electromagnetic, observed X-ray binary upper bound for a black hole mass, M≲10M⊙.
GW150914: The Advanced LIGO Detectors in the Era of First Discoveries
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Haris, K.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toeyrae, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
Following a major upgrade, the two advanced detectors of the Laser Interferometer Gravitational-wave Observatory (LIGO) held their first observation run between September 2015 and January 2016. With a strain sensitivity of 10−23/√Hz at 100 Hz, the product of observable volume and measurement time
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.;
2016-01-01
We present a possible observing scenario for the Advanced LIGO and Advanced Virgo gravitational-wave detectors over the next decade, with the intention of providing information to the astronomy community to facilitate planning for multi-messenger astronomy with gravitational waves. We determine the expected sensitivity of the network to transient gravitational-wave signals, and study the capability of the network to determine the sky location of the source. We report our findings for gravitational-wave transients, with particular focus on gravitational-wave signals from the inspiral of binary neutron-star systems, which are considered the most promising for multi-messenger astronomy. The ability to localize the sources of the detected signals depends on the geographical distribution of the detectors and their relative sensitivity, and 90% credible regions can be as large as thousands of square degrees when only two sensitive detectors are operational. Determining the sky position of a significant fraction of detected signals to areas of 5 sq. deg to 20 sq. deg will require at least three detectors of sensitivity within a factor of approximately 2 of each other and with a broad frequency bandwidth. Should the third LIGO detector be relocated to India as expected, a significant fraction of gravitational-wave signals will be localized to a few square degrees by gravitational-wave observations alone.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Amariutei, D. V.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Belczynski, C.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D.; Blair, R. M.; Bloemen, S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, C.; Bondu, F.; Bonnand, R.; Bork, R.; Boschi, V.; Bose, S.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y.; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, S.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Collette, C. G.; Constancio, M.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.; DeRosa, R.; De Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Lieto, A.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J. M.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fournier, J.-D.; Franco, S.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J.-M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; K, Haris; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kéfélian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, N.; Kim, N.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Królak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lück, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P. G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Neri, M.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Pereira, R.; Perreca, A.; Phelps, M.; Piccinni, O.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosińska, D.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, A. D.; Simakov, D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, J. R.; Smith, N. D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tápai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; van den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van der Sluys, M. V.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasúth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Viceré, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J. L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrożny, A.; Zangrando, L.; Zanolin, M.; Zendri, J.-P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration
2016-02-01
We present a possible observing scenario for the Advanced LIGO and Advanced Virgo gravitational-wave detectors over the next decade, with the intention of providing information to the astronomy community to facilitate planning for multi-messenger astronomy with gravitational waves. We determine the expected sensitivity of the network to transient gravitational-wave signals, and study the capability of the network to determine the sky location of the source. We report our findings for gravitational-wave transients, with particular focus on gravitational-wave signals from the inspiral of binary neutron-star systems, which are considered the most promising for multi-messenger astronomy. The ability to localize the sources of the detected signals depends on the geographical distribution of the detectors and their relative sensitivity, and 90% credible regions can be as large as thousands of square degrees when only two sensitive detectors are operational. Determining the sky position of a significant fraction of detected signals to areas of 5 deg2 to 20 deg2 will require at least three detectors of sensitivity within a factor of ˜ 2 of each other and with a broad frequency bandwidth. Should the third LIGO detector be relocated to India as expected, a significant fraction of gravitational-wave signals will be localized to a few square degrees by gravitational-wave observations alone.
International Nuclear Information System (INIS)
Mohanty, S D; Marka, Sz; Rahkola, R; Mukherjee, S; Leonor, I; Frey, R; Cannizzo, J; Camp, J
2004-01-01
One of the brightest gamma ray bursts ever recorded, GRB030329, occurred during the second science run of the LIGO detectors. At that time, both interferometers at the Hanford, WA LIGO site were in lock and were acquiring data. The data collected from the two Hanford detectors were analysed for the presence of a gravitational wave signal associated with this GRB. This paper presents a detailed description of the search algorithm implemented in the current analysis
Detection of relic gravitational waves in thermal case by using Adv.LIGO data of GW150914
International Nuclear Information System (INIS)
Ghayour, Basem; Khodagholizadeh, Jafar
2017-01-01
The thermal spectrum of relic gravitational waves enhances the usual spectrum. Our analysis shows that there exist some chances for detection of the thermal spectrum in addition to the usual spectrum by comparison with sensitivity of Adv.LIGO of GW150914 and detector based on the maser light. The behavior of the inflation and reheating stages are often known as power law expansion like S(η) ∝ η"1"+"β, S(η) ∝ η"1"+"β"_s, respectively, with constraints 1 + β 0. The β and β_s have an unique effect on the shape of the spectrum. We find some values of the β and β_s by considering the mentioned comparison. As obtained, the results give us more information as regards the evolution of inflation and reheating stages. (orig.)
Mirrors used in the LIGO interferometers for first detection of gravitational waves.
Pinard, L; Michel, C; Sassolas, B; Balzarini, L; Degallaix, J; Dolique, V; Flaminio, R; Forest, D; Granata, M; Lagrange, B; Straniero, N; Teillon, J; Cagnoli, G
2017-02-01
For the first time, direct detection of gravitational waves occurred in the Laser Interferometer Gravitational-wave Observatory (LIGO) interferometers. These advanced detectors require large fused silica mirrors with optical and mechanical properties and have never been reached until now. This paper details the main achievements of these ion beam sputtering coatings.
Aasi, J.; Abbott, B.; Abbott, R.; Abbott, T.; Abernathy, M.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R.; Affeldt, C.; Agathos, M.; Aggarwal, N.; Aguiar, O.
2014-01-01
We report results from a search for gravitational waves produced by perturbed intermediate mass black holes (IMBH) in data collected by LIGO and Virgo between 2005 and 2010. The search was sensitive to astrophysical sources that produced damped sinusoid gravitational wave signals, also known as ringdowns, with frequency $50\\le f_{0}/\\mathrm{Hz} \\le 2000$ and decay timescale $0.0001\\lesssim \\tau/\\mathrm{s} \\lesssim 0.1$ characteristic of those produced in mergers of IMBH pairs. No significant ...
Recent results on the search for continuous sources with LIGO and GEO 600
International Nuclear Information System (INIS)
Sintes, Alicia M
2006-01-01
An overview of the searches for continuous gravitational wave signals in LIGO and GEO 600 performed on different recent science runs and results are presented. This includes both searching for gravitational waves from known pulsars as well as blind searches over a wide parameter space
Detection of relic gravitational waves in thermal case by using Adv.LIGO data of GW150914
Energy Technology Data Exchange (ETDEWEB)
Ghayour, Basem [University of Hyderabad, School of Physics, Hyderabad (India); Khodagholizadeh, Jafar [Farhangian University, Tehran (Iran, Islamic Republic of)
2017-08-15
The thermal spectrum of relic gravitational waves enhances the usual spectrum. Our analysis shows that there exist some chances for detection of the thermal spectrum in addition to the usual spectrum by comparison with sensitivity of Adv.LIGO of GW150914 and detector based on the maser light. The behavior of the inflation and reheating stages are often known as power law expansion like S(η) ∝ η{sup 1+β}, S(η) ∝ η{sup 1+β{sub s}}, respectively, with constraints 1 + β < 0, 1 + β{sub s} > 0. The β and β{sub s} have an unique effect on the shape of the spectrum. We find some values of the β and β{sub s} by considering the mentioned comparison. As obtained, the results give us more information as regards the evolution of inflation and reheating stages. (orig.)
Cheung, Chi C. Teddy; Hogan, Jason; Graham, Peter; Kasevich, Mark; Rajendran, Surjeet; Saif, Babak; Kerr, Matthew T.; Lovellette, Michael; Wood, Kent S.; Michelson, Peter; MAGIS Team
2018-01-01
We consider the scientific potential of gravitational wave (GW) observations in the ~30 mHz to 3 Hz frequency range with the Mid-band Atomic Gravitational-wave Interferometric Sensor (MAGIS). MAGIS is a probe-class space-mission concept, using an atom-based gravitational wave detector, that will provide all-sky strain sensitivities of ~10^-21 sqrt(Hz) and better (1-year) in the GW-frequency mid-band between the LISA/L3 detector (planned 2034 launch) and ground-based Advanced LIGO/Virgo interferometers. Primary gravitational wave astrophysics science in the mid-band include GW observations of the binary black hole population discovered by Advanced LIGO/Virgo at higher-frequencies, prior to their merger stage. For such systems, MAGIS will observe the binaries in their inspiral phase, where system parameters such as eccentricities are most easily constrained, and will provide advanced, degree-scale localizations that would enable electromagnetic observations of possible precursor emission 1-week to 1-month prior to their mergers as well as prompt post-merger transient emission. Joint GW-observations with MAGIS and Advanced LIGO/Virgo covering all stages of binary coalescence will further reduce uncertainties in the GW- localizations and distances, and will be powerful paired with galaxy catalogs, to enable unique galaxy counterpart identifications in the case black hole binary mergers are completely absent of detectable electromagnetic precursor or transient signals. These possibilities for MAGIS extend to neutron star binary systems (black hole - neutron star, neutron star - neutron star), and mid-band prospects for such systems will also be considered.The MAGIS team is a collaboration between institutes in the U.S. including Stanford, AOSense, Harvard, NASA/GSFC, NASA/JPL, NIST, NRL, and UC Berkeley, and international partners at Birmingham, Bordeaux, CNRS, Dusseldorf, Ecole Normale Superieure, Florence, Hannover, and Ulm University.
Advanced LIGO constraints on neutron star mergers and r-process sites
International Nuclear Information System (INIS)
Côté, Benoit; Belczynski, Krzysztof; Fryer, Chris L.; Ritter, Christian
2017-01-01
The role of compact binary mergers as the main production site of r-process elements is investigated by combining stellar abundances of Eu observed in the Milky Way, galactic chemical evolution (GCE) simulations, and binary population synthesis models, and gravitational wave measurements from Advanced LIGO. We compiled and reviewed seven recent GCE studies to extract the frequency of neutron star–neutron star (NS–NS) mergers that is needed in order to reproduce the observed [Eu/Fe] versus [Fe/H] relationship. We used our simple chemical evolution code to explore the impact of different analytical delay-time distribution functions for NS–NS mergers. We then combined our metallicity-dependent population synthesis models with our chemical evolution code to bring their predictions, for both NS–NS mergers and black hole–neutron star mergers, into a GCE context. Finally, we convolved our results with the cosmic star formation history to provide a direct comparison with current and upcoming Advanced LIGO measurements. When assuming that NS–NS mergers are the exclusive r-process sites, and that the ejected r-process mass per merger event is 0.01 M_⊙, the number of NS–NS mergers needed in GCE studies is about 10 times larger than what is predicted by standard population synthesis models. Here, these two distinct fields can only be consistent with each other when assuming optimistic rates, massive NS–NS merger ejecta, and low Fe yields for massive stars. For now, population synthesis models and GCE simulations are in agreement with the current upper limit (O1) established by Advanced LIGO during their first run of observations. Upcoming measurements will provide an important constraint on the actual local NS–NS merger rate, will provide valuable insights on the plausibility of the GCE requirement, and will help to define whether or not compact binary mergers can be the dominant source of r-process elements in the universe.
Abbott, B P; Abbott, R; Abbott, T D; Abernathy, M R; Acernese, F; Ackley, K; Adams, C; Adams, T; Addesso, P; Adhikari, R X; Adya, V B; Affeldt, C; Agathos, M; Agatsuma, K; Aggarwal, N; Aguiar, O D; Aiello, L; Ain, A; Ajith, P; Akutsu, T; Allen, B; Allocca, A; Altin, P A; Ananyeva, A; Anderson, S B; Anderson, W G; Ando, M; Appert, S; Arai, K; Araya, A; Araya, M C; Areeda, J S; Arnaud, N; Arun, K G; Asada, H; Ascenzi, S; Ashton, G; Aso, Y; Ast, M; Aston, S M; Astone, P; Atsuta, S; Aufmuth, P; Aulbert, C; Avila-Alvarez, A; Awai, K; Babak, S; Bacon, P; Bader, M K M; Baiotti, L; Baker, P T; Baldaccini, F; Ballardin, G; Ballmer, S W; Barayoga, J C; Barclay, S E; Barish, B C; Barker, D; Barone, F; Barr, B; Barsotti, L; Barsuglia, M; Barta, D; Bartlett, J; Barton, M A; Bartos, I; Bassiri, R; Basti, A; Batch, J C; Baune, C; Bavigadda, V; Bazzan, M; Bécsy, B; Beer, C; Bejger, M; Belahcene, I; Belgin, M; Bell, A S; Berger, B K; Bergmann, G; Berry, C P L; Bersanetti, D; Bertolini, A; Betzwieser, J; Bhagwat, S; Bhandare, R; Bilenko, I A; Billingsley, G; Billman, C R; Birch, J; Birney, R; Birnholtz, O; Biscans, S; Bisht, A; Bitossi, M; Biwer, C; Bizouard, M A; Blackburn, J K; Blackman, J; Blair, C D; Blair, D G; Blair, R M; Bloemen, S; Bock, O; Boer, M; Bogaert, G; Bohe, A; Bondu, F; Bonnand, R; Boom, B A; Bork, R; Boschi, V; Bose, S; Bouffanais, Y; Bozzi, A; Bradaschia, C; Brady, P R; Braginsky, V B; Branchesi, M; Brau, J E; Briant, T; Brillet, A; Brinkmann, M; Brisson, V; Brockill, P; Broida, J E; Brooks, A F; Brown, D A; Brown, D D; Brown, N M; Brunett, S; Buchanan, C C; Buikema, A; Bulik, T; Bulten, H J; Buonanno, A; Buskulic, D; Buy, C; Byer, R L; Cabero, M; Cadonati, L; Cagnoli, G; Cahillane, C; Calderón Bustillo, J; Callister, T A; Calloni, E; Camp, J B; Cannon, K C; Cao, H; Cao, J; Capano, C D; Capocasa, E; Carbognani, F; Caride, S; Casanueva Diaz, J; Casentini, C; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Cella, G; Cepeda, C B; Cerboni Baiardi, L; Cerretani, G; Cesarini, E; Chamberlin, S J; Chan, M; Chao, S; Charlton, P; Chassande-Mottin, E; Cheeseboro, B D; Chen, H Y; Chen, Y; Cheng, H-P; Chincarini, A; Chiummo, A; Chmiel, T; Cho, H S; Cho, M; Chow, J H; Christensen, N; Chu, Q; Chua, A J K; Chua, S; Chung, S; Ciani, G; Clara, F; Clark, J A; Cleva, F; Cocchieri, C; Coccia, E; Cohadon, P-F; Colla, A; Collette, C G; Cominsky, L; Constancio, M; Conti, L; Cooper, S J; Corbitt, T R; Cornish, N; Corsi, A; Cortese, S; Costa, C A; Coughlin, M W; Coughlin, S B; Coulon, J-P; Countryman, S T; Couvares, P; Covas, P B; Cowan, E E; Coward, D M; Cowart, M J; Coyne, D C; Coyne, R; Creighton, J D E; Creighton, T D; Cripe, J; Crowder, S G; Cullen, T J; Cumming, A; Cunningham, L; Cuoco, E; Canton, T Dal; Danilishin, S L; D'Antonio, S; Danzmann, K; Dasgupta, A; Da Silva Costa, C F; Dattilo, V; Dave, I; Davier, M; Davies, G S; Davis, D; Daw, E J; Day, B; Day, R; De, S; DeBra, D; Debreczeni, G; Degallaix, J; De Laurentis, M; Deléglise, S; Del Pozzo, W; Denker, T; Dent, T; Dergachev, V; De Rosa, R; DeRosa, R T; DeSalvo, R; Devine, R C; Dhurandhar, S; Díaz, M C; Fiore, L Di; Giovanni, M Di; Girolamo, T Di; Lieto, A Di; Pace, S Di; Palma, I Di; Virgilio, A Di; Doctor, Z; Doi, K; Dolique, V; Donovan, F; Dooley, K L; Doravari, S; Dorrington, I; Douglas, R; Dovale Álvarez, M; Downes, T P; Drago, M; Drever, R W P; Driggers, J C; Du, Z; Ducrot, M; Dwyer, S E; Eda, K; Edo, T B; Edwards, M C; Effler, A; Eggenstein, H-B; Ehrens, P; Eichholz, J; Eikenberry, S S; Eisenstein, R A; Essick, R C; Etienne, Z; Etzel, T; Evans, M; Evans, T M; Everett, R; Factourovich, M; Fafone, V; Fair, H; Fairhurst, S; Fan, X; Farinon, S; Farr, B; Farr, W M; Fauchon-Jones, E J; Favata, M; Fays, M; Fehrmann, H; Fejer, M M; Fernández Galiana, A; Ferrante, I; Ferreira, E C; Ferrini, F; Fidecaro, F; Fiori, I; Fiorucci, D; Fisher, R P; Flaminio, R; Fletcher, M; Fong, H; Forsyth, S S; Fournier, J-D; Frasca, S; Frasconi, F; Frei, Z; Freise, A; Frey, R; Frey, V; Fries, E M; Fritschel, P; Frolov, V V; Fujii, Y; Fujimoto, M-K; Fulda, P; Fyffe, M; Gabbard, H; Gadre, B U; Gaebel, S M; Gair, J R; Gammaitoni, L; Gaonkar, S G; Garufi, F; Gaur, G; Gayathri, V; Gehrels, N; Gemme, G; Genin, E; Gennai, A; George, J; Gergely, L; Germain, V; Ghonge, S; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S; Giaime, J A; Giardina, K D; Giazotto, A; Gill, K; Glaefke, A; Goetz, E; Goetz, R; Gondan, L; González, G; Gonzalez Castro, J M; Gopakumar, A; Gorodetsky, M L; Gossan, S E; Gosselin, M; Gouaty, R; Grado, A; Graef, C; Granata, M; Grant, A; Gras, S; Gray, C; Greco, G; Green, A C; Groot, P; Grote, H; Grunewald, S; Guidi, G M; Guo, X; Gupta, A; Gupta, M K; Gushwa, K E; Gustafson, E K; Gustafson, R; Hacker, J J; Hagiwara, A; Hall, B R; Hall, E D; Hammond, G; Haney, M; Hanke, M M; Hanks, J; Hanna, C; Hannam, M D; Hanson, J; Hardwick, T; Harms, J; Harry, G M; Harry, I W; Hart, M J; Hartman, M T; Haster, C-J; Haughian, K; Hayama, K; Healy, J; Heidmann, A; Heintze, M C; Heitmann, H; Hello, P; Hemming, G; Hendry, M; Heng, I S; Hennig, J; Henry, J; Heptonstall, A W; Heurs, M; Hild, S; Hirose, E; Hoak, D; Hofman, D; Holt, K; Holz, D E; Hopkins, P; Hough, J; Houston, E A; Howell, E J; Hu, Y M; Huerta, E A; Huet, D; Hughey, B; Husa, S; Huttner, S H; Huynh-Dinh, T; Indik, N; Ingram, D R; Inta, R; Ioka, K; Isa, H N; Isac, J-M; Isi, M; Isogai, T; Itoh, Y; Iyer, B R; Izumi, K; Jacqmin, T; Jani, K; Jaranowski, P; Jawahar, S; Jiménez-Forteza, F; Johnson, W W; Jones, D I; Jones, R; Jonker, R J G; Ju, L; Junker, J; Kagawa, T; Kajita, T; Kakizaki, M; Kalaghatgi, C V; Kalogera, V; Kamiizumi, M; Kanda, N; Kandhasamy, S; Kanemura, S; Kaneyama, M; Kang, G; Kanner, J B; Karki, S; Karvinen, K S; Kasprzack, M; Kataoka, Y; Katsavounidis, E; Katzman, W; Kaufer, S; Kaur, T; Kawabe, K; Kawai, N; Kawamura, S; Kéfélian, F; Keitel, D; Kelley, D B; Kennedy, R; Key, J S; Khalili, F Y; Khan, I; Khan, S; Khan, Z; Khazanov, E A; Kijbunchoo, N; Kim, C; Kim, H; Kim, J C; Kim, J; Kim, W; Kim, Y-M; Kimbrell, S J; Kimura, N; King, E J; King, P J; Kirchhoff, R; Kissel, J S; Klein, B; Kleybolte, L; Klimenko, S; Koch, P; Koehlenbeck, S M; Kojima, Y; Kokeyama, K; Koley, S; Komori, K; Kondrashov, V; Kontos, A; Korobko, M; Korth, W Z; Kotake, K; Kowalska, I; Kozak, D B; Krämer, C; Kringel, V; Krishnan, B; Królak, A; Kuehn, G; Kumar, P; Kumar, Rahul; Kumar, Rakesh; Kuo, L; Kuroda, K; Kutynia, A; Kuwahara, Y; Lackey, B D; Landry, M; Lang, R N; Lange, J; Lantz, B; Lanza, R K; Lartaux-Vollard, A; Lasky, P D; Laxen, M; Lazzarini, A; Lazzaro, C; Leaci, P; Leavey, S; Lebigot, E O; Lee, C H; Lee, H K; Lee, H M; Lee, H W; Lee, K; Lehmann, J; Lenon, A; Leonardi, M; Leong, J R; Leroy, N; Letendre, N; Levin, Y; Li, T G F; Libson, A; Littenberg, T B; Liu, J; Lockerbie, N A; Lombardi, A L; London, L T; Lord, J E; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lough, J D; Lousto, C O; Lovelace, G; Lück, H; Lundgren, A P; Lynch, R; Ma, Y; Macfoy, S; Machenschalk, B; MacInnis, M; Macleod, D M; Magaña-Sandoval, F; Majorana, E; Maksimovic, I; Malvezzi, V; Man, N; Mandic, V; Mangano, V; Mano, S; Mansell, G L; Manske, M; Mantovani, M; Marchesoni, F; Marchio, M; Marion, F; Márka, S; Márka, Z; Markosyan, A S; Maros, E; Martelli, F; Martellini, L; Martin, I W; Martynov, D V; Mason, K; Masserot, A; Massinger, T J; Masso-Reid, M; Mastrogiovanni, S; Matichard, F; Matone, L; Matsumoto, N; Matsushima, F; Mavalvala, N; Mazumder, N; McCarthy, R; McClelland, D E; McCormick, S; McGrath, C; McGuire, S C; McIntyre, G; McIver, J; McManus, D J; McRae, T; McWilliams, S T; Meacher, D; Meadors, G D; Meidam, J; Melatos, A; Mendell, G; Mendoza-Gandara, D; Mercer, R A; Merilh, E L; Merzougui, M; Meshkov, S; Messenger, C; Messick, C; Metzdorff, R; Meyers, P M; Mezzani, F; Miao, H; Michel, C; Michimura, Y; Middleton, H; Mikhailov, E E; Milano, L; Miller, A L; Miller, A; Miller, B B; Miller, J; Millhouse, M; Minenkov, Y; Ming, J; Mirshekari, S; Mishra, C; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Miyakawa, O; Miyamoto, A; Miyamoto, T; Miyoki, S; Moggi, A; Mohan, M; Mohapatra, S R P; Montani, M; Moore, B C; Moore, C J; Moraru, D; Moreno, G; Morii, W; Morisaki, S; Moriwaki, Y; Morriss, S R; Mours, B; Mow-Lowry, C M; Mueller, G; Muir, A W; Mukherjee, Arunava; Mukherjee, D; Mukherjee, S; Mukund, N; Mullavey, A; Munch, J; Muniz, E A M; Murray, P G; Mytidis, A; Nagano, S; Nakamura, K; Nakamura, T; Nakano, H; Nakano, Masaya; Nakano, Masayuki; Nakao, K; Napier, K; Nardecchia, I; Narikawa, T; Naticchioni, L; Nelemans, G; Nelson, T J N; Neri, M; Nery, M; Neunzert, A; Newport, J M; Newton, G; Nguyen, T T; Ni, W-T; Nielsen, A B; Nissanke, S; Nitz, A; Noack, A; Nocera, F; Nolting, D; Normandin, M E N; Nuttall, L K; Oberling, J; Ochsner, E; Oelker, E; Ogin, G H; Oh, J J; Oh, S H; Ohashi, M; Ohishi, N; Ohkawa, M; Ohme, F; Okutomi, K; Oliver, M; Ono, K; Ono, Y; Oohara, K; Oppermann, P; Oram, Richard J; O'Reilly, B; O'Shaughnessy, R; Ottaway, D J; Overmier, H; Owen, B J; Pace, A E; Page, J; Pai, A; Pai, S A; Palamos, J R; Palashov, O; Palomba, C; Pal-Singh, A; Pan, H; Pankow, C; Pannarale, F; Pant, B C; Paoletti, F; Paoli, A; Papa, M A; Paris, H R; Parker, W; Pascucci, D; Pasqualetti, A; Passaquieti, R; Passuello, D; Patricelli, B; Pearlstone, B L; Pedraza, M; Pedurand, R; Pekowsky, L; Pele, A; Peña Arellano, F E; Penn, S; Perez, C J; Perreca, A; Perri, L M; Pfeiffer, H P; Phelps, M; Piccinni, O J; Pichot, M; Piergiovanni, F; Pierro, V; Pillant, G; Pinard, L; Pinto, I M; Pitkin, M; Poe, M; Poggiani, R; Popolizio, P; Post, A; Powell, J; Prasad, J; Pratt, J W W; Predoi, V; Prestegard, T; Prijatelj, M; Principe, M; Privitera, S; Prodi, G A; Prokhorov, L G; Puncken, O; Punturo, M; Puppo, P; Pürrer, M; Qi, H; Qin, J; Qiu, S; Quetschke, V; Quintero, E A; Quitzow-James, R; Raab, F J; Rabeling, D S; Radkins, H; Raffai, P; Raja, S; Rajan, C; Rakhmanov, M; Rapagnani, P; Raymond, V; Razzano, M; Re, V; Read, J; Regimbau, T; Rei, L; Reid, S; Reitze, D H; Rew, H; Reyes, S D; Rhoades, E; Ricci, F; Riles, K; Rizzo, M; Robertson, N A; Robie, R; Robinet, F; Rocchi, A; Rolland, L; Rollins, J G; Roma, V J; Romano, R; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Sachdev, S; Sadecki, T; Sadeghian, L; Sago, N; Saijo, M; Saito, Y; Sakai, K; Sakellariadou, M; Salconi, L; Saleem, M; Salemi, F; Samajdar, A; Sammut, L; Sampson, L M; Sanchez, E J; Sandberg, V; Sanders, J R; Sasaki, Y; Sassolas, B; Sathyaprakash, B S; Sato, S; Sato, T; Saulson, P R; Sauter, O; Savage, R L; Sawadsky, A; Schale, P; Scheuer, J; Schmidt, E; Schmidt, J; Schmidt, P; Schnabel, R; Schofield, R M S; Schönbeck, A; Schreiber, E; Schuette, D; Schutz, B F; Schwalbe, S G; Scott, J; Scott, S M; Sekiguchi, T; Sekiguchi, Y; Sellers, D; Sengupta, A S; Sentenac, D; Sequino, V; Sergeev, A; Setyawati, Y; Shaddock, D A; Shaffer, T J; Shahriar, M S; Shapiro, B; Shawhan, P; Sheperd, A; Shibata, M; Shikano, Y; Shimoda, T; Shoda, A; Shoemaker, D H; Shoemaker, D M; Siellez, K; Siemens, X; Sieniawska, M; Sigg, D; Silva, A D; Singer, A; Singer, L P; Singh, A; Singh, R; Singhal, A; Sintes, A M; Slagmolen, B J J; Smith, B; Smith, J R; Smith, R J E; Somiya, K; Son, E J; Sorazu, B; Sorrentino, F; Souradeep, T; Spencer, A P; Srivastava, A K; Staley, A; Steinke, M; Steinlechner, J; Steinlechner, S; Steinmeyer, D; Stephens, B C; Stevenson, S P; Stone, R; Strain, K A; Straniero, N; Stratta, G; Strigin, S E; Sturani, R; Stuver, A L; Sugimoto, Y; Summerscales, T Z; Sun, L; Sunil, S; Sutton, P J; Suzuki, T; Swinkels, B L; Szczepańczyk, M J; Tacca, M; Tagoshi, H; Takada, S; Takahashi, H; Takahashi, R; Takamori, A; Talukder, D; Tanaka, H; Tanaka, K; Tanaka, T; Tanner, D B; Tápai, M; Taracchini, A; Tatsumi, D; Taylor, R; Telada, S; Theeg, T; Thomas, E G; Thomas, M; Thomas, P; Thorne, K A; Thrane, E; Tippens, T; Tiwari, S; Tiwari, V; Tokmakov, K V; Toland, K; Tomaru, T; Tomlinson, C; Tonelli, M; Tornasi, Z; Torrie, C I; Töyrä, D; Travasso, F; Traylor, G; Trifirò, D; Trinastic, J; Tringali, M C; Trozzo, L; Tse, M; Tso, R; Tsubono, K; Tsuzuki, T; Turconi, M; Tuyenbayev, D; Uchiyama, T; Uehara, T; Ueki, S; Ueno, K; Ugolini, D; Unnikrishnan, C S; Urban, A L; Ushiba, T; Usman, S A; Vahlbruch, H; Vajente, G; Valdes, G; van Bakel, N; van Beuzekom, M; van den Brand, J F J; Van Den Broeck, C; Vander-Hyde, D C; van der Schaaf, L; van Heijningen, J V; van Putten, M H P M; van Veggel, A A; Vardaro, M; Varma, V; Vass, S; Vasúth, M; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Venkateswara, K; Venugopalan, G; Verkindt, D; Vetrano, F; Viceré, A; Viets, A D; Vinciguerra, S; Vine, D J; Vinet, J-Y; Vitale, S; Vo, T; Vocca, H; Vorvick, C; Voss, D V; Vousden, W D; Vyatchanin, S P; Wade, A R; Wade, L E; Wade, M; Wakamatsu, T; Walker, M; Wallace, L; Walsh, S; Wang, G; Wang, H; Wang, M; Wang, Y; Ward, R L; Warner, J; Was, M; Watchi, J; Weaver, B; Wei, L-W; Weinert, M; Weinstein, A J; Weiss, R; Wen, L; Weßels, P; Westphal, T; Wette, K; Whelan, J T; Whiting, B F; Whittle, C; Williams, D; Williams, R D; Williamson, A R; Willis, J L; Willke, B; Wimmer, M H; Winkler, W; Wipf, C C; Wittel, H; Woan, G; Woehler, J; Worden, J; Wright, J L; Wu, D S; Wu, G; Yam, W; Yamamoto, H; Yamamoto, K; Yamamoto, T; Yancey, C C; Yano, K; Yap, M J; Yokoyama, J; Yokozawa, T; Yoon, T H; Yu, Hang; Yu, Haocun; Yuzurihara, H; Yvert, M; Zadrożny, A; Zangrando, L; Zanolin, M; Zeidler, S; Zendri, J-P; Zevin, M; Zhang, L; Zhang, M; Zhang, T; Zhang, Y; Zhao, C; Zhou, M; Zhou, Z; Zhu, S J; Zhu, X J; Zucker, M E; Zweizig, J
2018-01-01
We present possible observing scenarios for the Advanced LIGO, Advanced Virgo and KAGRA gravitational-wave detectors over the next decade, with the intention of providing information to the astronomy community to facilitate planning for multi-messenger astronomy with gravitational waves. We estimate the sensitivity of the network to transient gravitational-wave signals, and study the capability of the network to determine the sky location of the source. We report our findings for gravitational-wave transients, with particular focus on gravitational-wave signals from the inspiral of binary neutron star systems, which are the most promising targets for multi-messenger astronomy. The ability to localize the sources of the detected signals depends on the geographical distribution of the detectors and their relative sensitivity, and [Formula: see text] credible regions can be as large as thousands of square degrees when only two sensitive detectors are operational. Determining the sky position of a significant fraction of detected signals to areas of 5-[Formula: see text] requires at least three detectors of sensitivity within a factor of [Formula: see text] of each other and with a broad frequency bandwidth. When all detectors, including KAGRA and the third LIGO detector in India, reach design sensitivity, a significant fraction of gravitational-wave signals will be localized to a few square degrees by gravitational-wave observations alone.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Akutsu, T.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Ando, M.; Appert, S.; Arai, K.; Araya, A.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Asada, H.; Ascenzi, S.; Ashton, G.; Aso, Y.; Ast, M.; Aston, S. M.; Astone, P.; Atsuta, S.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Awai, K.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baiotti, L.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Barton, M. A.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H.-P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Canton, T. Dal; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Díaz, M. C.; Fiore, L. Di; Giovanni, M. Di; Girolamo, T. Di; Lieto, A. Di; Pace, S. Di; Palma, I. Di; Virgilio, A. Di; Doctor, Z.; Doi, K.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Eda, K.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fernández Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fujii, Y.; Fujimoto, M.-K.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hagiwara, A.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Hayama, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hirose, E.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Ioka, K.; Isa, H. N.; Isac, J.-M.; Isi, M.; Isogai, T.; Itoh, Y.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kagawa, T.; Kajita, T.; Kakizaki, M.; Kalaghatgi, C. V.; Kalogera, V.; Kamiizumi, M.; Kanda, N.; Kandhasamy, S.; Kanemura, S.; Kaneyama, M.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Kataoka, Y.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawai, N.; Kawamura, S.; Kéfélian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, H.; Kim, J. C.; Kim, J.; Kim, W.; Kim, Y.-M.; Kimbrell, S. J.; Kimura, N.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Kojima, Y.; Kokeyama, K.; Koley, S.; Komori, K.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kotake, K.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, Rahul; Kumar, Rakesh; Kuo, L.; Kuroda, K.; Kutynia, A.; Kuwahara, Y.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Lück, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mano, S.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marchio, M.; Marion, F.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Matsumoto, N.; Matsushima, F.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Michimura, Y.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Miyakawa, O.; Miyamoto, A.; Miyamoto, T.; Miyoki, S.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morii, W.; Morisaki, S.; Moriwaki, Y.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Mytidis, A.; Nagano, S.; Nakamura, K.; Nakamura, T.; Nakano, H.; Nakano, Masaya; Nakano, Masayuki; Nakao, K.; Napier, K.; Nardecchia, I.; Narikawa, T.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Nguyen, T. T.; Ni, W.-T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohashi, M.; Ohishi, N.; Ohkawa, M.; Ohme, F.; Okutomi, K.; Oliver, M.; Ono, K.; Ono, Y.; Oohara, K.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Peña Arellano, F. E.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosińska, D.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sago, N.; Saijo, M.; Saito, Y.; Sakai, K.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sasaki, Y.; Sassolas, B.; Sathyaprakash, B. S.; Sato, S.; Sato, T.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Sekiguchi, T.; Sekiguchi, Y.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shibata, M.; Shikano, Y.; Shimoda, T.; Shoda, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Somiya, K.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson, S. P.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Sugimoto, Y.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Suzuki, T.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Tagoshi, H.; Takada, S.; Takahashi, H.; Takahashi, R.; Takamori, A.; Talukder, D.; Tanaka, H.; Tanaka, K.; Tanaka, T.; Tanner, D. B.; Tápai, M.; Taracchini, A.; Tatsumi, D.; Taylor, R.; Telada, S.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomaru, T.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Tsubono, K.; Tsuzuki, T.; Turconi, M.; Tuyenbayev, D.; Uchiyama, T.; Uehara, T.; Ueki, S.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Ushiba, T.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Putten, M. H. P. M.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Wakamatsu, T.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yamamoto, K.; Yamamoto, T.; Yancey, C. C.; Yano, K.; Yap, M. J.; Yokoyama, J.; Yokozawa, T.; Yoon, T. H.; Yu, Hang; Yu, Haocun; Yuzurihara, H.; Yvert, M.; Zadrożny, A.; Zangrando, L.; Zanolin, M.; Zeidler, S.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.
2018-04-01
We present possible observing scenarios for the Advanced LIGO, Advanced Virgo and KAGRA gravitational-wave detectors over the next decade, with the intention of providing information to the astronomy community to facilitate planning for multi-messenger astronomy with gravitational waves. We estimate the sensitivity of the network to transient gravitational-wave signals, and study the capability of the network to determine the sky location of the source. We report our findings for gravitational-wave transients, with particular focus on gravitational-wave signals from the inspiral of binary neutron star systems, which are the most promising targets for multi-messenger astronomy. The ability to localize the sources of the detected signals depends on the geographical distribution of the detectors and their relative sensitivity, and 90% credible regions can be as large as thousands of square degrees when only two sensitive detectors are operational. Determining the sky position of a significant fraction of detected signals to areas of 5-20 deg^2 requires at least three detectors of sensitivity within a factor of ˜ 2 of each other and with a broad frequency bandwidth. When all detectors, including KAGRA and the third LIGO detector in India, reach design sensitivity, a significant fraction of gravitational-wave signals will be localized to a few square degrees by gravitational-wave observations alone.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Amariutei, D. V.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Belczynski, C.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, C. D.; Blair, R. M.; Bloernen, S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Bork, R.; Boschi, V.; Bose, S.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Coila, A.; Collette, C. G.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J. M.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etze, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Garnrnaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keite, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kirmo, J.; Kina, K.; Kim, Namjun; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; MaIlga, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'De, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Pereira, R.R.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Sillgh, A.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toeyrae, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bake, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van der Sluys, M. V.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizigl, J.
2016-01-01
We present a possible observing scenario for the Advanced LIGO and Advanced Virgo gravitational-wave detectors over the next decade, with the intention of providing information to the astronomy community to facilitate planning for multi-messenger astronomy with gravitational waves. We determine the
The effect of a laser beam displacement on parametric oscillatory instabilities for Advanced LIGO
International Nuclear Information System (INIS)
Heinert, D.; Strigin, S.E.
2011-01-01
The arm cavities of real gravitational wave detectors can show small deviations like a tilt or a spatial shift between the cavity mirrors. These deviations lead to a separation of the optical mode centres with respect to the mirror's centre. In this Letter we perform the computation of parametric instable modes considering the described displacement. We further analyse the possibility of parametric oscillatory instability in the Advanced LIGO interferometer for the case of a displaced arm cavity. Our results reveal an additional number of optical and elastic mode combinations due to a displacement that can give rise to the undesirable effect of parametric oscillatory instability. -- Highlights: → We analyse the possibility of parametric oscillatory instability in the Advanced LIGO interferometer. → We perform the computation of parametric instable modes considering the mirror displacement. → Our results reveal an additional number of optical and elastic mode unstable combinations.
Full band all-sky search for periodic gravitational waves in the O1 LIGO data
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Angelova, S. V.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Atallah, D. V.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Austin, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barkett, K.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Bawaj, M.; Bayley, J. C.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Bero, J. J.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Biscoveanu, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonilla, E.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bossie, K.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderón; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerdá-Durán, P.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chase, E.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, X.; Chen, Y.; Cheng, H.-P.; Chia, H. Y.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciecielag, P.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Clearwater, P.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Cohen, D.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Cordero-Carrión, I.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, E. T.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Canton, T. Dal; Dálya, G.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Demos, N.; Denker, T.; Dent, T.; De Pietri, R.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; De Rossi, C.; DeSalvo, R.; de Varona, O.; Devenson, J.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorosh, O.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Dreissigacker, C.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dupej, P.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Estevez, D.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fee, C.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Finstad, D.; Fiori, I.; Fiorucci, D.; Fishbach, M.; Fisher, R. P.; Fitz-Axen, M.; Flaminio, R.; Fletcher, M.; Fong, H.; Font, J. A.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garcia-Quiros, C.; Garufi, F.; Gateley, B.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; Goncharov, B.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Gretarsson, E. M.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Halim, O.; Hall, B. R.; Hall, E. D.; Hamilton, E. Z.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hinderer, T.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hreibi, A.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J.-M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kamai, B.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, K.; Kim, W.; Kim, W. S.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kinley-Hanlon, M.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Knowles, T. D.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Linker, S. D.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lück, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macas, R.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña Hernandez, I.; Magaña-Sandoval, F.; Magaña Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markakis, C.; Markosyan, A. S.; Markowitz, A.; Maros, E.; Marquina, A.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Mason, K.; Massera, E.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McNeill, L.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Mehmet, M.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, B. B.; Miller, J.; Millhouse, M.; Milovich-Goff, M. C.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moffa, D.; Moggi, A.; Mogushi, K.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muñiz, E. A.; Muratore, M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Neilson, J.; Nelemans, G.; Nelson, T. J. N.; Nery, M.; Neunzert, A.; Nevin, L.; Newport, J. M.; Newton, G.; Ng, K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; North, C.; Nuttall, L. K.; Oberling, J.; O'Dea, G. D.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Okada, M. A.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ossokine, S.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, Howard; Pan, Huang-Wei; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Parida, A.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patil, M.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pirello, M.; Pisarski, A.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Pratten, G.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rajbhandari, B.; Rakhmanov, M.; Ramirez, K. E.; Ramos-Buades, A.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Ren, W.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosińska, D.; Ross, M. P.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Rutins, G.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sanchez, L. E.; Sanchis-Gual, N.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheel, M.; Scheuer, J.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shaner, M. B.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, L. P.; Singh, A.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Somala, S.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staats, K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stevenson, S. P.; Stone, R.; Stops, D. J.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Strunk, A.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Suresh, J.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Tait, S. C.; Talbot, C.; Talukder, D.; Tanner, D. B.; Tao, D.; Tápai, M.; Taracchini, A.; Tasson, J. D.; Taylor, J. A.; Taylor, R.; Tewari, S. V.; Theeg, T.; Thies, F.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torres-Forné, A.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tsukada, L.; Tsuna, D.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, W. H.; Wang, Y. F.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Weßels, P.; Westerweck, J.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Wilken, D.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wysocki, D. M.; Xiao, S.; Yamamoto, H.; Yancey, C. C.; Yang, L.; Yap, M. J.; Yazback, M.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadroźny, A.; Zanolin, M.; Zelenova, T.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.-H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration
2018-05-01
We report on a new all-sky search for periodic gravitational waves in the frequency band 475-2000 Hz and with a frequency time derivative in the range of [-1.0 ,+0.1 ] ×1 0-8 Hz /s . Potential signals could be produced by a nearby spinning and slightly nonaxisymmetric isolated neutron star in our Galaxy. This search uses the data from Advanced LIGO's first observational run O1. No gravitational-wave signals were observed, and upper limits were placed on their strengths. For completeness, results from the separately published low-frequency search 20-475 Hz are included as well. Our lowest upper limit on worst-case (linearly polarized) strain amplitude h0 is ˜4 ×1 0-25 near 170 Hz, while at the high end of our frequency range, we achieve a worst-case upper limit of 1.3 ×1 0-24. For a circularly polarized source (most favorable orientation), the smallest upper limit obtained is ˜1.5 ×1 0-25.
First low-latency LIGO plus Virgo search for binary inspirals and their electromagnetic counterparts
Abadie, J.; van den Brand, J.F.J.; Bulten, H.J.; Rabeling, D.S.
2013-01-01
Aims. The detection and measurement of gravitational-waves from coalescing neutron-star binary systems is an important science goal for ground-based gravitational-wave detectors. In addition to emitting gravitational-waves at frequencies that span the most sensitive bands of the LIGO and Virgo
Characterization of transient noise in Advanced LIGO relevant to gravitational wave signal GW150914
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adamo, M.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackburn, L.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Charlton, P.; Chassande-Mottin, E.; Chatterji, S.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Ghosh, V. Germain Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzlez, G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Slutsky, J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zotov, N.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
On 14 September 2015, a gravitational wave signal from a coalescing black hole binary system was observed by the Advanced LIGO detectors. This paper describes the transient noise backgrounds used to determine the significance of the event (designated GW150914) and presents the results of
International Nuclear Information System (INIS)
Raymond, V; Mandel, I; Kalogera, V; Van der Sluys, M V; Roever, C; Christensen, N
2010-01-01
Gravitational-wave signals from inspirals of binary compact objects (black holes and neutron stars) are primary targets of the ongoing searches by ground-based gravitational-wave (GW) interferometers (LIGO, Virgo and GEO-600). We present parameter estimation results from our Markov-chain Monte Carlo code SPINspiral on signals from binaries with precessing spins. Two data sets are created by injecting simulated GW signals either into synthetic Gaussian noise or into LIGO detector data. We compute the 15-dimensional probability-density functions (PDFs) for both data sets, as well as for a data set containing LIGO data with a known, loud artefact ('glitch'). We show that the analysis of the signal in detector noise yields accuracies similar to those obtained using simulated Gaussian noise. We also find that while the Markov chains from the glitch do not converge, the PDFs would look consistent with a GW signal present in the data. While our parameter estimation results are encouraging, further investigations into how to differentiate an actual GW signal from noise are necessary.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Becsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, M.J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Dalya, G.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Galiana, A. Fernandez; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, A.; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, Whansun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kaermer, C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lueck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath Hoareau, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P.G.; Mytidis, A.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Castro-Perez, J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Szolgyen, A.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Aptekar, R. L.; Frederiks, D. D.; Golenetskii, S. V.; Golovin, D. V.; Hurley, K.; Litvak, M. L.; Mitrofanov, I. G.; Rau, A.; Sanin, A. B.; Svinkin, D. S.; von Kienlin, A.; Zhang, X.
2017-01-01
We present the results of the search for gravitational waves (GWs) associated with gamma-ray bursts detected during the first observing run of the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO). We find no evidence of a GW signal for any of the 41 gamma-ray bursts for which LIGO
Chen, Frances R; Stroud, Catherine B; Vrshek-Schallhorn, Suzanne; Doane, Leah D; Granger, Douglas A
2017-10-01
The present study aimed to examine the interaction of 5-HTTLPR and early adversity on trait-like levels of cortisol. A community sample of 117 early adolescent girls (M age=12.39years) provided DNA samples for 5-HTTLPR genotyping, and saliva samples for assessing cortisol 3 times a day (waking, 30min post-waking, and bedtime) over a three-day period. Latent trait cortisol (LTC) was modeled using the first 2 samples of each day. Early adversity was assessed with objective contextual stress interviews with adolescents and their mothers. A significant 5-HTTLPR×early adversity interaction indicated that greater early adversity was associated with lower LTC levels, but only among individuals with either L/L or S/L genotype. Findings suggest that serotonergic genetic variation may influence the impact of early adversity on individual differences in HPA-axis regulation. Future research should explore whether this interaction contributes to the development of psychopathology through HPA axis functioning. Copyright © 2017 Elsevier B.V. All rights reserved.
Search for intermediate mass black hole binaries in the first observing run of Advanced LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allen, G; Allocca, A.; Almoubayyed, H.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Becsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, D J; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, J.G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S. S. Y.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; De, S.; Debra, D.; Deelman, E; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.J.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, A.S.P.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J. -M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.E.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, S.W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kraemer, H.C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang-Cheol, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, W. H.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Lueck, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Hernandez, I. Magana; Magana-Sandoval, F.; Zertuche, L. Magana; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mayani, R.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P.G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Castro-Perez, J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosinska, D.; Ross, M. P.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Rynge, M.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A.; Shahriar, M. S.; Shao, L.P.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, J. A.; Taylor, W.R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahi, K.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y. -F.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, G.W.K.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zanolin, M.; Zelenova, T.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y. -H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.
2017-01-01
During their first observational run, the two Advanced LIGO detectors attained an unprecedented sensitivity, resulting in the first direct detections of gravitational-wave signals produced by stellar-mass binary black hole systems. This paper reports on an all-sky search for gravitational waves
All-sky search for short gravitational-wave bursts in the first Advanced LIGO run
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, M.J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, A. J. K.; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, M.C.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Galiana, A. Fernandez; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, R.G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, Whansun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kraemer, H.C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Luck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath Hoareau, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, F.A.; Miller, B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P.G.; Mytidis, A.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton-Howes, G.; Nguyen, T. T.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Castro-Perez, J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerner, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, D.M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J.R.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Torya, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.G.; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S.J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.
2017-01-01
We present the results from an all-sky search for short-duration gravitational waves in the data of the first run of the Advanced LIGO detectors between September 2015 and January 2016. The search algorithms use minimal assumptions on the signal morphology, so they are sensitive to a wide range of
International Nuclear Information System (INIS)
Bouhou, B.
2012-01-01
The aim of this work is the joint detection of gravitational waves and high energy neutrinos in a multi-messengers context. The neutrino and gravitational waves astronomies are still in the phase of development, but they are expected to play a fundamental role in the future. In fact, these messengers can travel big distances because of their weak interaction with matter (contrary to photons that at high energy are rapidly absorbed) without being affected by magnetic fields (contrary to charged cosmic rays). They can also escape dense media and provide information on the processes taking place in the heart of astrophysics sources. Particularly, GW+HEN multi-messenger astronomy may open a new observational window on the Universe. ANTARES collaboration has built a telescope of area 0.1 km 2 in the Mediterranean Sea for the detection of high energy neutrinos. This is the most sensitive telescope for the observed part of the sky. LIGO and VIRGO interferometers are ground-based detector for direct observation of gravitational waves, installed in Europe and the USA respectively. Instruments ANTARES, VIRGO and LIGO offer unrivaled sensitivity in the area of joint observation. The first chapter of this thesis introduces the theoretical motivations for GW+HEN search by developing different emission scenarios. The second and third chapters we give an overview of the experiments and review the data analysis tools. The fourth and fifth chapters of this work present the results of the analysis of the combined data from ANTARES, VIRGO and LIGO taken separately in 2007 and 2009-2010. (author)
International Nuclear Information System (INIS)
Abbott, B. P.; Abbott, R.; Adhikari, R.; Anderson, S. B.; Araya, M.; Armandula, H.; Aso, Y.; Ballmer, S.; Barton, M. A.; Betzwieser, J.; Billingsley, G.; Black, E.; Blackburn, J. K.; Bork, R.; Boschi, V.; Brooks, A. F.; Cannon, K. C.; Cardenas, L.; Cepeda, C.; Chalermsongsak, T.
2009-01-01
We report on a search for gravitational waves from coalescing compact binaries, of total mass between 2 and 35M · , using LIGO observations between November 14, 2006 and May 18, 2007. No gravitational-wave signals were detected. We report upper limits on the rate of compact binary coalescence as a function of total mass. The LIGO cumulative 90%-confidence rate upper limits of the binary coalescence of neutron stars, black holes and black hole-neutron star systems are 1.4x10 -2 , 7.3x10 -4 and 3.6x10 -3 yr -1 L 10 -1 , respectively, where L 10 is 10 10 times the blue solar luminosity.
GW150914: First results from the search for binary black hole coalescence with Advanced LIGO
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bohemier, K.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Clayton, J. H.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Cokelaer, T.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Dietz, A.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fotopoulos, N.; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, M.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Goggin, L. M.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, G.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McKechan, D. J. A.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messaritaki, E.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pan, Y.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Robinson, C.; Rocchi, A.; Rodriguez, A. C.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Santamaria, L.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Sehreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbnich, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Henningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welbom, T.; Wen, L.M.; Wessels, P.; West, M.E.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Wiesner, K.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wiseman, A. G.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
On September 14, 2015, at 09∶50:45 UTC the two detectors of the Laser Interferometer Gravitational-Wave Observatory (LIGO) simultaneously observed the binary black hole merger GW150914. We report the results of a matched-filter search using relativistic models of compact-object binaries that
Constraints on cosmic strings from the LIGO-Virgo gravitational-wave detectors
Aasi, J.; Abadie, J.; Abbott, B.; Abbott, R.; Abbott, T.; Abernathy, M.; Accadia, T.; Acernese, F.; Adams, C.; Adams, T.; Adhikari, R.; Affeldt, C.; Agathos, M.; Aggarwal, N.; Aguiar, O.
2014-01-01
Cosmic strings can give rise to a large variety of interesting astrophysical phenomena. Among them, powerful bursts of gravitational waves (GWs) produced by cusps are a promising observational signature. In this Letter we present a search for GWs from cosmic string cusps in data collected by the LIGO and Virgo gravitational wave detectors between 2005 and 2010, with over 625 days of live time. We find no evidence of GW signals from cosmic strings. From this result, we derive new constraints o...
International Nuclear Information System (INIS)
Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.
1989-01-01
The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig
Use of Emerging Grid Computing Technologies for the Analysis of LIGO Data
Koranda, Scott
2004-03-01
The LIGO Scientific Collaboration (LSC) today faces the challenge of enabling analysis of terabytes of LIGO data by hundreds of scientists from institutions all around the world. To meet this challenge the LSC is developing tools, infrastructure, applications, and expertise leveraging Grid Computing technologies available today, and making available to LSC scientists compute resources at sites across the United States and Europe. We use digital credentials for strong and secure authentication and authorization to compute resources and data. Building on top of products from the Globus project for high-speed data transfer and information discovery we have created the Lightweight Data Replicator (LDR) to securely and robustly replicate data to resource sites. We have deployed at our computing sites the Virtual Data Toolkit (VDT) Server and Client packages, developed in collaboration with our partners in the GriPhyN and iVDGL projects, providing uniform access to distributed resources for users and their applications. Taken together these Grid Computing technologies and infrastructure have formed the LSC DataGrid--a coherent and uniform environment across two continents for the analysis of gravitational-wave detector data. Much work, however, remains in order to scale current analyses and recent lessons learned need to be integrated into the next generation of Grid middleware.
Fisher, Ryan Patrick; Hughey, Brennan; Howell, Eric; LIGO Collaboration
2018-01-01
Although Fast Radio Bursts (FRB) are being detected with increasing frequency, their progenitor systems are still mostly a mystery. We present the plan to conduct targeted searches for gravitational-wave counterparts to these FRB events in the data from the first and second observing runs of the Advanced Laser Interferometer Gravitational-wave Observatory (LIGO).
Abbott, B P; Abbott, R; Abbott, T D; Abernathy, M R; Acernese, F; Ackley, K; Adams, C; Adams, T; Addesso, P; Adhikari, R X; Adya, V B; Affeldt, C; Agathos, M; Agatsuma, K; Aggarwal, N; Aguiar, O D; Aiello, L; Ain, A; Ajith, P; Allen, B; Allocca, A; Altin, P A; Ananyeva, A; Anderson, S B; Anderson, W G; Appert, S; Arai, K; Araya, M C; Areeda, J S; Arnaud, N; Arun, K G; Ascenzi, S; Ashton, G; Ast, M; Aston, S M; Astone, P; Aufmuth, P; Aulbert, C; Avila-Alvarez, A; Babak, S; Bacon, P; Bader, M K M; Baker, P T; Baldaccini, F; Ballardin, G; Ballmer, S W; Barayoga, J C; Barclay, S E; Barish, B C; Barker, D; Barone, F; Barr, B; Barsotti, L; Barsuglia, M; Barta, D; Bartlett, J; Bartos, I; Bassiri, R; Basti, A; Batch, J C; Baune, C; Bavigadda, V; Bazzan, M; Beer, C; Bejger, M; Belahcene, I; Belgin, M; Bell, A S; Berger, B K; Bergmann, G; Berry, C P L; Bersanetti, D; Bertolini, A; Betzwieser, J; Bhagwat, S; Bhandare, R; Bilenko, I A; Billingsley, G; Billman, C R; Birch, J; Birney, R; Birnholtz, O; Biscans, S; Biscoveanu, A S; Bisht, A; Bitossi, M; Biwer, C; Bizouard, M A; Blackburn, J K; Blackman, J; Blair, C D; Blair, D G; Blair, R M; Bloemen, S; Bock, O; Boer, M; Bogaert, G; Bohe, A; Bondu, F; Bonnand, R; Boom, B A; Bork, R; Boschi, V; Bose, S; Bouffanais, Y; Bozzi, A; Bradaschia, C; Brady, P R; Braginsky, V B; Branchesi, M; Brau, J E; Briant, T; Brillet, A; Brinkmann, M; Brisson, V; Brockill, P; Broida, J E; Brooks, A F; Brown, D A; Brown, D D; Brown, N M; Brunett, S; Buchanan, C C; Buikema, A; Bulik, T; Bulten, H J; Buonanno, A; Buskulic, D; Buy, C; Byer, R L; Cabero, M; Cadonati, L; Cagnoli, G; Cahillane, C; Calderón Bustillo, J; Callister, T A; Calloni, E; Camp, J B; Campbell, W; Canepa, M; Cannon, K C; Cao, H; Cao, J; Capano, C D; Capocasa, E; Carbognani, F; Caride, S; Casanueva Diaz, J; Casentini, C; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Cella, G; Cepeda, C B; Cerboni Baiardi, L; Cerretani, G; Cesarini, E; Chamberlin, S J; Chan, M; Chao, S; Charlton, P; Chassande-Mottin, E; Cheeseboro, B D; Chen, H Y; Chen, Y; Cheng, H-P; Chincarini, A; Chiummo, A; Chmiel, T; Cho, H S; Cho, M; Chow, J H; Christensen, N; Chu, Q; Chua, A J K; Chua, S; Chung, S; Ciani, G; Clara, F; Clark, J A; Cleva, F; Cocchieri, C; Coccia, E; Cohadon, P-F; Colla, A; Collette, C G; Cominsky, L; Constancio, M; Conti, L; Cooper, S J; Corbitt, T R; Cornish, N; Corsi, A; Cortese, S; Costa, C A; Coughlin, E; Coughlin, M W; Coughlin, S B; Coulon, J-P; Countryman, S T; Couvares, P; Covas, P B; Cowan, E E; Coward, D M; Cowart, M J; Coyne, D C; Coyne, R; Creighton, J D E; Creighton, T D; Cripe, J; Crowder, S G; Cullen, T J; Cumming, A; Cunningham, L; Cuoco, E; Dal Canton, T; Danilishin, S L; D'Antonio, S; Danzmann, K; Dasgupta, A; Da Silva Costa, C F; Dattilo, V; Dave, I; Davier, M; Davies, G S; Davis, D; Daw, E J; Day, B; Day, R; De, S; DeBra, D; Debreczeni, G; Degallaix, J; De Laurentis, M; Deléglise, S; Del Pozzo, W; Denker, T; Dent, T; Dergachev, V; De Rosa, R; DeRosa, R T; DeSalvo, R; Devenson, J; Devine, R C; Dhurandhar, S; Díaz, M C; Di Fiore, L; Di Giovanni, M; Di Girolamo, T; Di Lieto, A; Di Pace, S; Di Palma, I; Di Virgilio, A; Doctor, Z; Dolique, V; Donovan, F; Dooley, K L; Doravari, S; Dorrington, I; Douglas, R; Dovale Álvarez, M; Downes, T P; Drago, M; Drever, R W P; Driggers, J C; Du, Z; Ducrot, M; Dwyer, S E; Edo, T B; Edwards, M C; Effler, A; Eggenstein, H-B; Ehrens, P; Eichholz, J; Eikenberry, S S; Essick, R C; Etienne, Z; Etzel, T; Evans, M; Evans, T M; Everett, R; Factourovich, M; Fafone, V; Fair, H; Fairhurst, S; Fan, X; Farinon, S; Farr, B; Farr, W M; Fauchon-Jones, E J; Favata, M; Fays, M; Fehrmann, H; Fejer, M M; Fernández Galiana, A; Ferrante, I; Ferreira, E C; Ferrini, F; Fidecaro, F; Fiori, I; Fiorucci, D; Fisher, R P; Flaminio, R; Fletcher, M; Fong, H; Forsyth, S S; Fournier, J-D; Frasca, S; Frasconi, F; Frei, Z; Freise, A; Frey, R; Frey, V; Fries, E M; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Gabbard, H; Gadre, B U; Gaebel, S M; Gair, J R; Gammaitoni, L; Gaonkar, S G; Garufi, F; Gaur, G; Gayathri, V; Gehrels, N; Gemme, G; Genin, E; Gennai, A; George, J; Gergely, L; Germain, V; Ghonge, S; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S; Giaime, J A; Giardina, K D; Giazotto, A; Gill, K; Glaefke, A; Goetz, E; Goetz, R; Gondan, L; González, G; Gonzalez Castro, J M; Gopakumar, A; Gorodetsky, M L; Gossan, S E; Gosselin, M; Gouaty, R; Grado, A; Graef, C; Granata, M; Grant, A; Gras, S; Gray, C; Greco, G; Green, A C; Groot, P; Grote, H; Grunewald, S; Guidi, G M; Guo, X; Gupta, A; Gupta, M K; Gushwa, K E; Gustafson, E K; Gustafson, R; Hacker, J J; Hall, B R; Hall, E D; Hammond, G; Haney, M; Hanke, M M; Hanks, J; Hanna, C; Hannam, M D; Hanson, J; Hardwick, T; Harms, J; Harry, G M; Harry, I W; Hart, M J; Hartman, M T; Haster, C-J; Haughian, K; Healy, J; Heidmann, A; Heintze, M C; Heitmann, H; Hello, P; Hemming, G; Hendry, M; Heng, I S; Hennig, J; Henry, J; Heptonstall, A W; Heurs, M; Hild, S; Hoak, D; Hofman, D; Holt, K; Holz, D E; Hopkins, P; Hough, J; Houston, E A; Howell, E J; Hu, Y M; Huerta, E A; Huet, D; Hughey, B; Husa, S; Huttner, S H; Huynh-Dinh, T; Indik, N; Ingram, D R; Inta, R; Isa, H N; Isac, J-M; Isi, M; Isogai, T; Iyer, B R; Izumi, K; Jacqmin, T; Jani, K; Jaranowski, P; Jawahar, S; Jiménez-Forteza, F; Johnson, W W; Jones, D I; Jones, R; Jonker, R J G; Ju, L; Junker, J; Kalaghatgi, C V; Kalogera, V; Kandhasamy, S; Kang, G; Kanner, J B; Karki, S; Karvinen, K S; Kasprzack, M; Katsavounidis, E; Katzman, W; Kaufer, S; Kaur, T; Kawabe, K; Kéfélian, F; Keitel, D; Kelley, D B; Kennedy, R; Key, J S; Khalili, F Y; Khan, I; Khan, S; Khan, Z; Khazanov, E A; Kijbunchoo, N; Kim, Chunglee; Kim, J C; Kim, Whansun; Kim, W; Kim, Y-M; Kimbrell, S J; King, E J; King, P J; Kirchhoff, R; Kissel, J S; Klein, B; Kleybolte, L; Klimenko, S; Koch, P; Koehlenbeck, S M; Koley, S; Kondrashov, V; Kontos, A; Korobko, M; Korth, W Z; Kowalska, I; Kozak, D B; Krämer, C; Kringel, V; Królak, A; Kuehn, G; Kumar, P; Kumar, R; Kuo, L; Kutynia, A; Lackey, B D; Landry, M; Lang, R N; Lange, J; Lantz, B; Lanza, R K; Lartaux-Vollard, A; Lasky, P D; Laxen, M; Lazzarini, A; Lazzaro, C; Leaci, P; Leavey, S; Lebigot, E O; Lee, C H; Lee, H K; Lee, H M; Lee, K; Lehmann, J; Lenon, A; Leonardi, M; Leong, J R; Leroy, N; Letendre, N; Levin, Y; Li, T G F; Libson, A; Littenberg, T B; Liu, J; Lockerbie, N A; Lombardi, A L; London, L T; Lord, J E; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lough, J D; Lovelace, G; Lück, H; Lundgren, A P; Lynch, R; Ma, Y; Macfoy, S; Machenschalk, B; MacInnis, M; Macleod, D M; Magaña-Sandoval, F; Majorana, E; Maksimovic, I; Malvezzi, V; Man, N; Mandic, V; Mangano, V; Mansell, G L; Manske, M; Mantovani, M; Marchesoni, F; Marion, F; Márka, S; Márka, Z; Markosyan, A S; Maros, E; Martelli, F; Martellini, L; Martin, I W; Martynov, D V; Mason, K; Masserot, A; Massinger, T J; Masso-Reid, M; Mastrogiovanni, S; Matas, A; Matichard, F; Matone, L; Mavalvala, N; Mazumder, N; McCarthy, R; McClelland, D E; McCormick, S; McGrath, C; McGuire, S C; McIntyre, G; McIver, J; McManus, D J; McRae, T; McWilliams, S T; Meacher, D; Meadors, G D; Meidam, J; Melatos, A; Mendell, G; Mendoza-Gandara, D; Mercer, R A; Merilh, E L; Merzougui, M; Meshkov, S; Messenger, C; Messick, C; Metzdorff, R; Meyers, P M; Mezzani, F; Miao, H; Michel, C; Middleton, H; Mikhailov, E E; Milano, L; Miller, A L; Miller, A; Miller, B B; Miller, J; Millhouse, M; Minenkov, Y; Ming, J; Mirshekari, S; Mishra, C; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Moggi, A; Mohan, M; Mohapatra, S R P; Montani, M; Moore, B C; Moore, C J; Moraru, D; Moreno, G; Morriss, S R; Mours, B; Mow-Lowry, C M; Mueller, G; Muir, A W; Mukherjee, Arunava; Mukherjee, D; Mukherjee, S; Mukund, N; Mullavey, A; Munch, J; Muniz, E A M; Murray, P G; Mytidis, A; Napier, K; Nardecchia, I; Naticchioni, L; Nelemans, G; Nelson, T J N; Neri, M; Nery, M; Neunzert, A; Newport, J M; Newton, G; Nguyen, T T; Nielsen, A B; Nissanke, S; Nitz, A; Noack, A; Nocera, F; Nolting, D; Normandin, M E N; Nuttall, L K; Oberling, J; Ochsner, E; Oelker, E; Ogin, G H; Oh, J J; Oh, S H; Ohme, F; Oliver, M; Oppermann, P; Oram, Richard J; O'Reilly, B; O'Shaughnessy, R; Ottaway, D J; Overmier, H; Owen, B J; Pace, A E; Page, J; Pai, A; Pai, S A; Palamos, J R; Palashov, O; Palomba, C; Pal-Singh, A; Pan, H; Pankow, C; Pannarale, F; Pant, B C; Paoletti, F; Paoli, A; Papa, M A; Paris, H R; Parker, W; Pascucci, D; Pasqualetti, A; Passaquieti, R; Passuello, D; Patricelli, B; Pearlstone, B L; Pedraza, M; Pedurand, R; Pekowsky, L; Pele, A; Penn, S; Perez, C J; Perreca, A; Perri, L M; Pfeiffer, H P; Phelps, M; Piccinni, O J; Pichot, M; Piergiovanni, F; Pierro, V; Pillant, G; Pinard, L; Pinto, I M; Pitkin, M; Poe, M; Poggiani, R; Popolizio, P; Post, A; Powell, J; Prasad, J; Pratt, J W W; Predoi, V; Prestegard, T; Prijatelj, M; Principe, M; Privitera, S; Prodi, G A; Prokhorov, L G; Puncken, O; Punturo, M; Puppo, P; Pürrer, M; Qi, H; Qin, J; Qiu, S; Quetschke, V; Quintero, E A; Quitzow-James, R; Raab, F J; Rabeling, D S; Radkins, H; Raffai, P; Raja, S; Rajan, C; Rakhmanov, M; Rapagnani, P; Raymond, V; Razzano, M; Re, V; Read, J; Regimbau, T; Rei, L; Reid, S; Reitze, D H; Rew, H; Reyes, S D; Rhoades, E; Ricci, F; Riles, K; Rizzo, M; Robertson, N A; Robie, R; Robinet, F; Rocchi, A; Rolland, L; Rollins, J G; Roma, V J; Romano, J D; Romano, R; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Sachdev, S; Sadecki, T; Sadeghian, L; Sakellariadou, M; Salconi, L; Saleem, M; Salemi, F; Samajdar, A; Sammut, L; Sampson, L M; Sanchez, E J; Sandberg, V; Sanders, J R; Sassolas, B; Sathyaprakash, B S; Saulson, P R; Sauter, O; Savage, R L; Sawadsky, A; Schale, P; Scheuer, J; Schlassa, S; Schmidt, E; Schmidt, J; Schmidt, P; Schnabel, R; Schofield, R M S; Schönbeck, A; Schreiber, E; Schuette, D; Schutz, B F; Schwalbe, S G; Scott, J; Scott, S M; Sellers, D; Sengupta, A S; Sentenac, D; Sequino, V; Sergeev, A; Setyawati, Y; Shaddock, D A; Shaffer, T J; Shahriar, M S; Shapiro, B; Shawhan, P; Sheperd, A; Shoemaker, D H; Shoemaker, D M; Siellez, K; Siemens, X; Sieniawska, M; Sigg, D; Silva, A D; Singer, A; Singer, L P; Singh, A; Singh, R; Singhal, A; Sintes, A M; Slagmolen, B J J; Smith, B; Smith, J R; Smith, R J E; Son, E J; Sorazu, B; Sorrentino, F; Souradeep, T; Spencer, A P; Srivastava, A K; Staley, A; Steinke, M; Steinlechner, J; Steinlechner, S; Steinmeyer, D; Stephens, B C; Stevenson, S P; Stone, R; Strain, K A; Straniero, N; Stratta, G; Strigin, S E; Sturani, R; Stuver, A L; Summerscales, T Z; Sun, L; Sunil, S; Sutton, P J; Swinkels, B L; Szczepańczyk, M J; Tacca, M; Talukder, D; Tanner, D B; Tao, D; Tápai, M; Taracchini, A; Taylor, R; Theeg, T; Thomas, E G; Thomas, M; Thomas, P; Thorne, K A; Thrane, E; Tippens, T; Tiwari, S; Tiwari, V; Tokmakov, K V; Toland, K; Tomlinson, C; Tonelli, M; Tornasi, Z; Torrie, C I; Töyrä, D; Travasso, F; Traylor, G; Trifirò, D; Trinastic, J; Tringali, M C; Trozzo, L; Tse, M; Tso, R; Turconi, M; Tuyenbayev, D; Ugolini, D; Unnikrishnan, C S; Urban, A L; Usman, S A; Vahlbruch, H; Vajente, G; Valdes, G; van Bakel, N; van Beuzekom, M; van den Brand, J F J; Van Den Broeck, C; Vander-Hyde, D C; van der Schaaf, L; van Heijningen, J V; van Veggel, A A; Vardaro, M; Varma, V; Vass, S; Vasúth, M; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Venkateswara, K; Venugopalan, G; Verkindt, D; Vetrano, F; Viceré, A; Viets, A D; Vinciguerra, S; Vine, D J; Vinet, J-Y; Vitale, S; Vo, T; Vocca, H; Vorvick, C; Voss, D V; Vousden, W D; Vyatchanin, S P; Wade, A R; Wade, L E; Wade, M; Walker, M; Wallace, L; Walsh, S; Wang, G; Wang, H; Wang, M; Wang, Y; Ward, R L; Warner, J; Was, M; Watchi, J; Weaver, B; Wei, L-W; Weinert, M; Weinstein, A J; Weiss, R; Wen, L; Weßels, P; Westphal, T; Wette, K; Whelan, J T; Whiting, B F; Whittle, C; Williams, D; Williams, R D; Williamson, A R; Willis, J L; Willke, B; Wimmer, M H; Winkler, W; Wipf, C C; Wittel, H; Woan, G; Woehler, J; Worden, J; Wright, J L; Wu, D S; Wu, G; Yam, W; Yamamoto, H; Yancey, C C; Yap, M J; Yu, Hang; Yu, Haocun; Yvert, M; Zadrożny, A; Zangrando, L; Zanolin, M; Zendri, J-P; Zevin, M; Zhang, L; Zhang, M; Zhang, T; Zhang, Y; Zhao, C; Zhou, M; Zhou, Z; Zhu, S J; Zhu, X J; Zucker, M E; Zweizig, J
2017-03-24
A wide variety of astrophysical and cosmological sources are expected to contribute to a stochastic gravitational-wave background. Following the observations of GW150914 and GW151226, the rate and mass of coalescing binary black holes appear to be greater than many previous expectations. As a result, the stochastic background from unresolved compact binary coalescences is expected to be particularly loud. We perform a search for the isotropic stochastic gravitational-wave background using data from Advanced Laser Interferometer Gravitational Wave Observatory's (aLIGO) first observing run. The data display no evidence of a stochastic gravitational-wave signal. We constrain the dimensionless energy density of gravitational waves to be Ω_{0}<1.7×10^{-7} with 95% confidence, assuming a flat energy density spectrum in the most sensitive part of the LIGO band (20-86 Hz). This is a factor of ∼33 times more sensitive than previous measurements. We also constrain arbitrary power-law spectra. Finally, we investigate the implications of this search for the background of binary black holes using an astrophysical model for the background.
Li, Bohua; Shapiro, Paul R.; Rindler-Daller, Tanja
2017-09-01
Treheat. This SGWB is then maximally detectable for values of Treheat for which modes that reenter the horizon when reheating ended have frequencies today that lie within the LIGO sensitive band. For example, for the family of marginally allowed models with r =0.01 and λ /(m c2)2=10-18 eV-1 cm3 , the maximally detectable Λ SFDM model has Treheat≃2 ×104 GeV and m ≃1.6 ×10-19 eV /c2, for which we predict an aLIGO O1 run detection with signal-to-noise ratio of ˜10 . We show that the null detection of the SGWB recently reported by the aLIGO O1 run excludes the parameter range 8.75 ×103≲Treheat(GeV )≲1.7 ×105 for this illustrative family at 95% confidence, thereby demonstrating that GW detection experiments can already place a new kind of cosmological constraint on SFDM. A wider range of SFDM parameters and reheat temperatures should be accessible to aLIGO/Virgo O5, with the potential to detect this unique signature of the Λ SFDM model. For this same illustrative family, for example, a 3 σ detection is predicted for 600 ≲Treheat(GeV )≲107.
The rate of binary Black Hole mergers inferred from Advanced LIGO observations surrounding GW150914
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, C.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, A.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; Maclnnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; Mclntyre, G.; Mclver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Wesels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
A transient gravitational-wave signal, GW150914, was identified in the twin Advanced LIGO detectors on 2015 September 2015 at 09: 50: 45 UTC. To assess the implications of this discovery, the detectors remained in operation with unchanged configurations over a period of 39 days around the time of
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
Search for gravitational waves from binary black hole inspirals in LIGO data
International Nuclear Information System (INIS)
Abbott, B.; Abbott, R.; Adhikari, R.; Agresti, J.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bork, R.; Brown, D.A.; Busby, D.; Cardenas, L.; Chandler, A.
2006-01-01
We report on a search for gravitational waves from binary black hole inspirals in the data from the second science run of the LIGO interferometers. The search focused on binary systems with component masses between 3 and 20M · . Optimally oriented binaries with distances up to 1 Mpc could be detected with efficiency of at least 90%. We found no events that could be identified as gravitational waves in the 385.6 hours of data that we searched
Upper limits on gravitational wave bursts in LIGO's second science run
International Nuclear Information System (INIS)
Abbott, B.; Adhikari, R.; Agresti, J.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bork, R.; Brown, D.A.; Busby, D.; Cardenas, L.; Chandler, A.; Chapsky, J.
2005-01-01
We perform a search for gravitational wave bursts using data from the second science run of the LIGO detectors, using a method based on a wavelet time-frequency decomposition. This search is sensitive to bursts of duration much less than a second and with frequency content in the 100-1100 Hz range. It features significant improvements in the instrument sensitivity and in the analysis pipeline with respect to the burst search previously reported by LIGO. Improvements in the search method allow exploring weaker signals, relative to the detector noise floor, while maintaining a low false alarm rate, O(0.1) μHz. The sensitivity in terms of the root-sum-square (rss) strain amplitude lies in the range of h rss ∼10 -20 -10 -19 Hz -1/2 . No gravitational wave signals were detected in 9.98 days of analyzed data. We interpret the search result in terms of a frequentist upper limit on the rate of detectable gravitational wave bursts at the level of 0.26 events per day at 90% confidence level. We combine this limit with measurements of the detection efficiency for selected waveform morphologies in order to yield rate versus strength exclusion curves as well as to establish order-of-magnitude distance sensitivity to certain modeled astrophysical sources. Both the rate upper limit and its applicability to signal strengths improve our previously reported limits and reflect the most sensitive broad-band search for untriggered and unmodeled gravitational wave bursts to date
Optimizing the regimes of the Advanced LIGO gravitational wave detector for multiple source types
International Nuclear Information System (INIS)
Kondrashov, I. S.; Simakov, D. A.; Khalili, F. Ya.; Danilishin, S. L.
2008-01-01
We developed algorithms which allow us to find regimes of the signal-recycled Fabry-Perot-Michelson interferometer [for example, the Advanced Laser Interferometric Gravitational Wave Observatory (LIGO)], optimized concurrently for two (binary inspirals + bursts) and three (binary inspirals + bursts + millisecond pulsars) types of gravitational wave sources. We show that there exists a relatively large area in the interferometer parameters space where the detector sensitivity to the first two kinds of sources differs only by a few percent from the maximal ones for each kind of source. In particular, there exists a specific regime where this difference is ≅0.5% for both of them. Furthermore, we show that even more multipurpose regimes are also possible that provide significant sensitivity gain for millisecond pulsars with only minor sensitivity degradation for binary inspirals and bursts.
International Nuclear Information System (INIS)
Abbott, B.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bogue, L.; Bork, R.; Busby, D.; Cardenas, L.; Chandler, A.; Chapsky, J.; Charlton, P.; Coyne, D.
2005-01-01
We have performed a search for bursts of gravitational waves associated with the very bright gamma ray burst GRB030329, using the two detectors at the LIGO Hanford Observatory. Our search covered the most sensitive frequency range of the LIGO detectors (approximately 80--2048 Hz), and we specifically targeted signals shorter than ≅150 ms. Our search algorithm looks for excess correlated power between the two interferometers and thus makes minimal assumptions about the gravitational waveform. We observed no candidates with gravitational-wave signal strength larger than a predetermined threshold. We report frequency-dependent upper limits on the strength of the gravitational waves associated with GRB030329. Near the most sensitive frequency region, around ≅250 Hz, our root-sum-square (RSS) gravitational-wave strain sensitivity for optimally polarized bursts was better than h RSS ≅6x10 -21 Hz -1/2 . Our result is comparable to the best published results searching for association between gravitational waves and gamma ray bursts
Aasi, J.; Abadie, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Accadia, T.; Acernese, F.; Adams, C.; Adams, T.;
2014-01-01
Searches for a stochastic gravitational-wave background (SGWB) using terrestrial detectors typically involve cross-correlating data from pairs of detectors. The sensitivity of such cross-correlation analyses depends, among other things, on the separation between the two detectors: the smaller the separation, the better the sensitivity. Hence, a co-located detector pair is more sensitive to a gravitational-wave background than a nonco- located detector pair. However, co-located detectors are also expected to suffer from correlated noise from instrumental and environmental effects that could contaminate the measurement of the background. Hence, methods to identify and mitigate the effects of correlated noise are necessary to achieve the potential increase in sensitivity of co-located detectors. Here we report on the first SGWB analysis using the two LIGO Hanford detectors and address the complications arising from correlated environmental noise. We apply correlated noise identification and mitigation techniques to data taken by the two LIGO Hanford detectors, H1 and H2, during LIGO's fifth science run. At low frequencies, 40-460Hz, we are unable to sufficiently mitigate the correlated noise to a level where we may confidently measure or bound the stochastic gravitational-wave signal. However, at high frequencies, 460 - 1000Hz, these techniques are sufficient to set a 95% confidence level (C.L.) upper limit on the gravitational-wave energy density of Omega(f) < 7.7 × 10(exp -4)(f/900Hz)(sup 3), which improves on the previous upper limit by a factor of approx. 180. In doing so, we demonstrate techniques that will be useful for future searches using advanced detectors, where correlated noise (e.g., from global magnetic fields) may affect even widely separated detectors.
Environmentally induced nonstationarity in LIGO science run data
International Nuclear Information System (INIS)
Stone, Robert; Mukherjee, Soma
2009-01-01
NoiseFloorMon is a data monitoring tool (DMT) implemented at the LIGO sites to monitor instances of non-stationarity in the gravitational-wave data that are correlated with physical environmental monitors. An analysis of the fifth science run is nearly complete, and test runs preceding the sixth science run have also been analyzed. These analyses have identified time intervals in the gravitational-wave channel that indicate non-stationarity due to seismic activity, and these intervals are referred to as data quality flags. In the analyses conducted to date the majority of time segments identified as non-stationary were due to seismic activity at the corner station and the x-arm end station. We present the algorithm and its performance, and discuss the potential for an on-site pipeline that automatically generates data quality flags for use in future data runs.
Energy Technology Data Exchange (ETDEWEB)
Abbott, B.; Abbott, R.; Adhikari, R.; Ageev, A.; Allen, B.; Amin, R.; Anderson, S.B.; Anderson, W.G.; Araya, M.; Armandula, H.; Ashley, M.; Asiri, F.; Aufmuth, P.; Aulbert, C.; Babak, S.; Balasubramanian, R.; Ballmer, S.; Barish, B.C.; Barker, C.; Barker, D.; Barnes, M.; /Potsdam, Max Planck Inst. /Hannover, Max Planck Inst. Grav. /Australian
2005-01-01
We have performed a search for bursts of gravitational waves associated with the very bright Gamma Ray Burst GRB030329, using the two detectors at the LIGO Hanford Observatory. Our search covered the most sensitive frequency range of the LIGO detectors (approximately 80-2048 Hz), and we specifically targeted signals shorter than {approx_equal}150 ms. Our search algorithm looks for excess correlated power between the two interferometers and thus makes minimal assumptions about the gravitational waveform. We observed no candidates with gravitational wave signal strength larger than a pre-determined threshold. We report frequency dependent upper limits on the strength of the gravitational waves associated with GRB030329. Near the most sensitive frequency region, around {approx_equal}250 Hz, our root-sum-square (RSS) gravitational wave strain sensitivity for optimally polarized bursts was better than h{sub RSS} {approx_equal} 6 x 10{sup -21} Hz{sup -1/2}. Our result is comparable to the best published results searching for association between gravitational waves and GRBs.
International Nuclear Information System (INIS)
Leonor, I; Frey, R; Sutton, P J; Jones, G; Marka, S; Marka, Z
2009-01-01
One of the ongoing searches performed using the LIGO-Virgo network of gravitational-wave interferometers is the search for gravitational-wave burst (GWB) counterparts to gamma-ray bursts (GRBs). This type of analysis makes use of GRB time and position information from gamma-ray satellite detectors to trigger the GWB search, and the GWB detection rates possible for such an analysis thus strongly depend on the GRB detection efficiencies of the satellite detectors. Using local GRB rate densities inferred from observations which are found in the science literature, we calculate estimates of the GWB detection rates for different configurations of the LIGO-Virgo network for this type of analysis.
Balazs, Csaba; Fowlie, Andrew; Mazumdar, Anupam; White, Graham A.
2017-01-01
A new gauge singlet scalar field can undergo a strongly first-order phase transition (PT) leading to gravitational waves (GW) potentially observable at aLIGO and stabilizes the electroweak vacuum at the same time by ensuring that the Higgs quartic coupling remains positive up to at least the grand
International Nuclear Information System (INIS)
DeSalvo, Riccardo
2004-01-01
Recent x-ray and optical observations provide evidence for a population of intermediate mass black holes with masses of tens to thousands of solar masses. Dynamical braking in high stellar density regions may 'catalyze' the inspiral of heavy mass objects down to the million-year time scale. Black-hole binaries, with the masses implied by the observations, will plunge below 100 Hz. It may be technologically possible to build ground-based low frequency gravitational wave interferometric detectors optimized to detect these events and install them next to Advanced LIGO (AdL), within the existing LIGO facilities. This additional interferometer, operated coherently with AdL and Virgo, would greatly enhance the effectiveness of the existing interferometers by generating a wealth of triggers for potentially frequent but otherwise undetectable heavy mass inspirals. AdL would study, at higher frequency, the triggered, ultra-relativistic phases (merging and ringdown) of these inspirals. Comparisons are made between the expected detection performances of AdL in its proposed wide band tuning, as well as AdL in its best low frequency tuning, with a low frequency gravitational wave interferometric detector that is mechanically and optically optimized for operation at the lowest possible frequency. Finally, the synergies of tandem operation of AdL and the proposed low frequency interferometer have been considered
Directional Limits on Persistent Gravitational Waves from Advanced LIGO's First Observing Run.
Abbott, B P; Abbott, R; Abbott, T D; Abernathy, M R; Acernese, F; Ackley, K; Adams, C; Adams, T; Addesso, P; Adhikari, R X; Adya, V B; Affeldt, C; Agathos, M; Agatsuma, K; Aggarwal, N; Aguiar, O D; Aiello, L; Ain, A; Ajith, P; Allen, B; Allocca, A; Altin, P A; Ananyeva, A; Anderson, S B; Anderson, W G; Appert, S; Arai, K; Araya, M C; Areeda, J S; Arnaud, N; Arun, K G; Ascenzi, S; Ashton, G; Ast, M; Aston, S M; Astone, P; Aufmuth, P; Aulbert, C; Avila-Alvarez, A; Babak, S; Bacon, P; Bader, M K M; Baker, P T; Baldaccini, F; Ballardin, G; Ballmer, S W; Barayoga, J C; Barclay, S E; Barish, B C; Barker, D; Barone, F; Barr, B; Barsotti, L; Barsuglia, M; Barta, D; Bartlett, J; Bartos, I; Bassiri, R; Basti, A; Batch, J C; Baune, C; Bavigadda, V; Bazzan, M; Beer, C; Bejger, M; Belahcene, I; Belgin, M; Bell, A S; Berger, B K; Bergmann, G; Berry, C P L; Bersanetti, D; Bertolini, A; Betzwieser, J; Bhagwat, S; Bhandare, R; Bilenko, I A; Billingsley, G; Billman, C R; Birch, J; Birney, R; Birnholtz, O; Biscans, S; Biscoveanu, A S; Bisht, A; Bitossi, M; Biwer, C; Bizouard, M A; Blackburn, J K; Blackman, J; Blair, C D; Blair, D G; Blair, R M; Bloemen, S; Bock, O; Boer, M; Bogaert, G; Bohe, A; Bondu, F; Bonnand, R; Boom, B A; Bork, R; Boschi, V; Bose, S; Bouffanais, Y; Bozzi, A; Bradaschia, C; Brady, P R; Braginsky, V B; Branchesi, M; Brau, J E; Briant, T; Brillet, A; Brinkmann, M; Brisson, V; Brockill, P; Broida, J E; Brooks, A F; Brown, D A; Brown, D D; Brown, N M; Brunett, S; Buchanan, C C; Buikema, A; Bulik, T; Bulten, H J; Buonanno, A; Buskulic, D; Buy, C; Byer, R L; Cabero, M; Cadonati, L; Cagnoli, G; Cahillane, C; Calderón Bustillo, J; Callister, T A; Calloni, E; Camp, J B; Campbell, W; Canepa, M; Cannon, K C; Cao, H; Cao, J; Capano, C D; Capocasa, E; Carbognani, F; Caride, S; Casanueva Diaz, J; Casentini, C; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Cella, G; Cepeda, C B; Cerboni Baiardi, L; Cerretani, G; Cesarini, E; Chamberlin, S J; Chan, M; Chao, S; Charlton, P; Chassande-Mottin, E; Cheeseboro, B D; Chen, H Y; Chen, Y; Cheng, H-P; Chincarini, A; Chiummo, A; Chmiel, T; Cho, H S; Cho, M; Chow, J H; Christensen, N; Chu, Q; Chua, A J K; Chua, S; Chung, S; Ciani, G; Clara, F; Clark, J A; Cleva, F; Cocchieri, C; Coccia, E; Cohadon, P-F; Colla, A; Collette, C G; Cominsky, L; Constancio, M; Conti, L; Cooper, S J; Corbitt, T R; Cornish, N; Corsi, A; Cortese, S; Costa, C A; Coughlin, E; Coughlin, M W; Coughlin, S B; Coulon, J-P; Countryman, S T; Couvares, P; Covas, P B; Cowan, E E; Coward, D M; Cowart, M J; Coyne, D C; Coyne, R; Creighton, J D E; Creighton, T D; Cripe, J; Crowder, S G; Cullen, T J; Cumming, A; Cunningham, L; Cuoco, E; Dal Canton, T; Danilishin, S L; D'Antonio, S; Danzmann, K; Dasgupta, A; Da Silva Costa, C F; Dattilo, V; Dave, I; Davier, M; Davies, G S; Davis, D; Daw, E J; Day, B; Day, R; De, S; DeBra, D; Debreczeni, G; Degallaix, J; De Laurentis, M; Deléglise, S; Del Pozzo, W; Denker, T; Dent, T; Dergachev, V; De Rosa, R; DeRosa, R T; DeSalvo, R; Devenson, J; Devine, R C; Dhurandhar, S; Díaz, M C; Di Fiore, L; Di Giovanni, M; Di Girolamo, T; Di Lieto, A; Di Pace, S; Di Palma, I; Di Virgilio, A; Doctor, Z; Dolique, V; Donovan, F; Dooley, K L; Doravari, S; Dorrington, I; Douglas, R; Dovale Álvarez, M; Downes, T P; Drago, M; Drever, R W P; Driggers, J C; Du, Z; Ducrot, M; Dwyer, S E; Edo, T B; Edwards, M C; Effler, A; Eggenstein, H-B; Ehrens, P; Eichholz, J; Eikenberry, S S; Essick, R C; Etienne, Z; Etzel, T; Evans, M; Evans, T M; Everett, R; Factourovich, M; Fafone, V; Fair, H; Fairhurst, S; Fan, X; Farinon, S; Farr, B; Farr, W M; Fauchon-Jones, E J; Favata, M; Fays, M; Fehrmann, H; Fejer, M M; Fernández Galiana, A; Ferrante, I; Ferreira, E C; Ferrini, F; Fidecaro, F; Fiori, I; Fiorucci, D; Fisher, R P; Flaminio, R; Fletcher, M; Fong, H; Forsyth, S S; Fournier, J-D; Frasca, S; Frasconi, F; Frei, Z; Freise, A; Frey, R; Frey, V; Fries, E M; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Gabbard, H; Gadre, B U; Gaebel, S M; Gair, J R; Gammaitoni, L; Gaonkar, S G; Garufi, F; Gaur, G; Gayathri, V; Gehrels, N; Gemme, G; Genin, E; Gennai, A; George, J; Gergely, L; Germain, V; Ghonge, S; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S; Giaime, J A; Giardina, K D; Giazotto, A; Gill, K; Glaefke, A; Goetz, E; Goetz, R; Gondan, L; González, G; Gonzalez Castro, J M; Gopakumar, A; Gorodetsky, M L; Gossan, S E; Gosselin, M; Gouaty, R; Grado, A; Graef, C; Granata, M; Grant, A; Gras, S; Gray, C; Greco, G; Green, A C; Groot, P; Grote, H; Grunewald, S; Guidi, G M; Guo, X; Gupta, A; Gupta, M K; Gushwa, K E; Gustafson, E K; Gustafson, R; Hacker, J J; Hall, B R; Hall, E D; Hammond, G; Haney, M; Hanke, M M; Hanks, J; Hanna, C; Hannam, M D; Hanson, J; Hardwick, T; Harms, J; Harry, G M; Harry, I W; Hart, M J; Hartman, M T; Haster, C-J; Haughian, K; Healy, J; Heidmann, A; Heintze, M C; Heitmann, H; Hello, P; Hemming, G; Hendry, M; Heng, I S; Hennig, J; Henry, J; Heptonstall, A W; Heurs, M; Hild, S; Hoak, D; Hofman, D; Holt, K; Holz, D E; Hopkins, P; Hough, J; Houston, E A; Howell, E J; Hu, Y M; Huerta, E A; Huet, D; Hughey, B; Husa, S; Huttner, S H; Huynh-Dinh, T; Indik, N; Ingram, D R; Inta, R; Isa, H N; Isac, J-M; Isi, M; Isogai, T; Iyer, B R; Izumi, K; Jacqmin, T; Jani, K; Jaranowski, P; Jawahar, S; Jiménez-Forteza, F; Johnson, W W; Jones, D I; Jones, R; Jonker, R J G; Ju, L; Junker, J; Kalaghatgi, C V; Kalogera, V; Kandhasamy, S; Kang, G; Kanner, J B; Karki, S; Karvinen, K S; Kasprzack, M; Katsavounidis, E; Katzman, W; Kaufer, S; Kaur, T; Kawabe, K; Kéfélian, F; Keitel, D; Kelley, D B; Kennedy, R; Key, J S; Khalili, F Y; Khan, I; Khan, S; Khan, Z; Khazanov, E A; Kijbunchoo, N; Kim, Chunglee; Kim, J C; Kim, Whansun; Kim, W; Kim, Y-M; Kimbrell, S J; King, E J; King, P J; Kirchhoff, R; Kissel, J S; Klein, B; Kleybolte, L; Klimenko, S; Koch, P; Koehlenbeck, S M; Koley, S; Kondrashov, V; Kontos, A; Korobko, M; Korth, W Z; Kowalska, I; Kozak, D B; Krämer, C; Kringel, V; Królak, A; Kuehn, G; Kumar, P; Kumar, R; Kuo, L; Kutynia, A; Lackey, B D; Landry, M; Lang, R N; Lange, J; Lantz, B; Lanza, R K; Lartaux-Vollard, A; Lasky, P D; Laxen, M; Lazzarini, A; Lazzaro, C; Leaci, P; Leavey, S; Lebigot, E O; Lee, C H; Lee, H K; Lee, H M; Lee, K; Lehmann, J; Lenon, A; Leonardi, M; Leong, J R; Leroy, N; Letendre, N; Levin, Y; Li, T G F; Libson, A; Littenberg, T B; Liu, J; Lockerbie, N A; Lombardi, A L; London, L T; Lord, J E; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lough, J D; Lousto, C O; Lovelace, G; Lück, H; Lundgren, A P; Lynch, R; Ma, Y; Macfoy, S; Machenschalk, B; MacInnis, M; Macleod, D M; Magaña-Sandoval, F; Majorana, E; Maksimovic, I; Malvezzi, V; Man, N; Mandic, V; Mangano, V; Mansell, G L; Manske, M; Mantovani, M; Marchesoni, F; Marion, F; Márka, S; Márka, Z; Markosyan, A S; Maros, E; Martelli, F; Martellini, L; Martin, I W; Martynov, D V; Mason, K; Masserot, A; Massinger, T J; Masso-Reid, M; Mastrogiovanni, S; Matas, A; Matichard, F; Matone, L; Mavalvala, N; Mazumder, N; McCarthy, R; McClelland, D E; McCormick, S; McGrath, C; McGuire, S C; McIntyre, G; McIver, J; McManus, D J; McRae, T; McWilliams, S T; Meacher, D; Meadors, G D; Meidam, J; Melatos, A; Mendell, G; Mendoza-Gandara, D; Mercer, R A; Merilh, E L; Merzougui, M; Meshkov, S; Messenger, C; Messick, C; Metzdorff, R; Meyers, P M; Mezzani, F; Miao, H; Michel, C; Middleton, H; Mikhailov, E E; Milano, L; Miller, A L; Miller, A; Miller, B B; Miller, J; Millhouse, M; Minenkov, Y; Ming, J; Mirshekari, S; Mishra, C; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Moggi, A; Mohan, M; Mohapatra, S R P; Montani, M; Moore, B C; Moore, C J; Moraru, D; Moreno, G; Morriss, S R; Mours, B; Mow-Lowry, C M; Mueller, G; Muir, A W; Mukherjee, Arunava; Mukherjee, D; Mukherjee, S; Mukund, N; Mullavey, A; Munch, J; Muniz, E A M; Murray, P G; Mytidis, A; Napier, K; Nardecchia, I; Naticchioni, L; Nelemans, G; Nelson, T J N; Neri, M; Nery, M; Neunzert, A; Newport, J M; Newton, G; Nguyen, T T; Nielsen, A B; Nissanke, S; Nitz, A; Noack, A; Nocera, F; Nolting, D; Normandin, M E N; Nuttall, L K; Oberling, J; Ochsner, E; Oelker, E; Ogin, G H; Oh, J J; Oh, S H; Ohme, F; Oliver, M; Oppermann, P; Oram, Richard J; O'Reilly, B; O'Shaughnessy, R; Ottaway, D J; Overmier, H; Owen, B J; Pace, A E; Page, J; Pai, A; Pai, S A; Palamos, J R; Palashov, O; Palomba, C; Pal-Singh, A; Pan, H; Pankow, C; Pannarale, F; Pant, B C; Paoletti, F; Paoli, A; Papa, M A; Paris, H R; Parker, W; Pascucci, D; Pasqualetti, A; Passaquieti, R; Passuello, D; Patricelli, B; Pearlstone, B L; Pedraza, M; Pedurand, R; Pekowsky, L; Pele, A; Penn, S; Perez, C J; Perreca, A; Perri, L M; Pfeiffer, H P; Phelps, M; Piccinni, O J; Pichot, M; Piergiovanni, F; Pierro, V; Pillant, G; Pinard, L; Pinto, I M; Pitkin, M; Poe, M; Poggiani, R; Popolizio, P; Post, A; Powell, J; Prasad, J; Pratt, J W W; Predoi, V; Prestegard, T; Prijatelj, M; Principe, M; Privitera, S; Prodi, G A; Prokhorov, L G; Puncken, O; Punturo, M; Puppo, P; Pürrer, M; Qi, H; Qin, J; Qiu, S; Quetschke, V; Quintero, E A; Quitzow-James, R; Raab, F J; Rabeling, D S; Radkins, H; Raffai, P; Raja, S; Rajan, C; Rakhmanov, M; Rapagnani, P; Raymond, V; Razzano, M; Re, V; Read, J; Regimbau, T; Rei, L; Reid, S; Reitze, D H; Rew, H; Reyes, S D; Rhoades, E; Ricci, F; Riles, K; Rizzo, M; Robertson, N A; Robie, R; Robinet, F; Rocchi, A; Rolland, L; Rollins, J G; Roma, V J; Romano, J D; Romano, R; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Sachdev, S; Sadecki, T; Sadeghian, L; Sakellariadou, M; Salconi, L; Saleem, M; Salemi, F; Samajdar, A; Sammut, L; Sampson, L M; Sanchez, E J; Sandberg, V; Sanders, J R; Sassolas, B; Sathyaprakash, B S; Saulson, P R; Sauter, O; Savage, R L; Sawadsky, A; Schale, P; Scheuer, J; Schlassa, S; Schmidt, E; Schmidt, J; Schmidt, P; Schnabel, R; Schofield, R M S; Schönbeck, A; Schreiber, E; Schuette, D; Schutz, B F; Schwalbe, S G; Scott, J; Scott, S M; Sellers, D; Sengupta, A S; Sentenac, D; Sequino, V; Sergeev, A; Setyawati, Y; Shaddock, D A; Shaffer, T J; Shahriar, M S; Shapiro, B; Shawhan, P; Sheperd, A; Shoemaker, D H; Shoemaker, D M; Siellez, K; Siemens, X; Sieniawska, M; Sigg, D; Silva, A D; Singer, A; Singer, L P; Singh, A; Singh, R; Singhal, A; Sintes, A M; Slagmolen, B J J; Smith, B; Smith, J R; Smith, R J E; Son, E J; Sorazu, B; Sorrentino, F; Souradeep, T; Spencer, A P; Srivastava, A K; Staley, A; Steinke, M; Steinlechner, J; Steinlechner, S; Steinmeyer, D; Stephens, B C; Stevenson, S P; Stone, R; Strain, K A; Straniero, N; Stratta, G; Strigin, S E; Sturani, R; Stuver, A L; Summerscales, T Z; Sun, L; Sunil, S; Sutton, P J; Swinkels, B L; Szczepańczyk, M J; Tacca, M; Talukder, D; Tanner, D B; Tao, D; Tápai, M; Taracchini, A; Taylor, R; Theeg, T; Thomas, E G; Thomas, M; Thomas, P; Thorne, K A; Thrane, E; Tippens, T; Tiwari, S; Tiwari, V; Tokmakov, K V; Toland, K; Tomlinson, C; Tonelli, M; Tornasi, Z; Torrie, C I; Töyrä, D; Travasso, F; Traylor, G; Trifirò, D; Trinastic, J; Tringali, M C; Trozzo, L; Tse, M; Tso, R; Turconi, M; Tuyenbayev, D; Ugolini, D; Unnikrishnan, C S; Urban, A L; Usman, S A; Vahlbruch, H; Vajente, G; Valdes, G; van Bakel, N; van Beuzekom, M; van den Brand, J F J; Van Den Broeck, C; Vander-Hyde, D C; van der Schaaf, L; van Heijningen, J V; van Veggel, A A; Vardaro, M; Varma, V; Vass, S; Vasúth, M; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Venkateswara, K; Venugopalan, G; Verkindt, D; Vetrano, F; Viceré, A; Viets, A D; Vinciguerra, S; Vine, D J; Vinet, J-Y; Vitale, S; Vo, T; Vocca, H; Vorvick, C; Voss, D V; Vousden, W D; Vyatchanin, S P; Wade, A R; Wade, L E; Wade, M; Walker, M; Wallace, L; Walsh, S; Wang, G; Wang, H; Wang, M; Wang, Y; Ward, R L; Warner, J; Was, M; Watchi, J; Weaver, B; Wei, L-W; Weinert, M; Weinstein, A J; Weiss, R; Wen, L; Weßels, P; Westphal, T; Wette, K; Whelan, J T; Whiting, B F; Whittle, C; Williams, D; Williams, R D; Williamson, A R; Willis, J L; Willke, B; Wimmer, M H; Winkler, W; Wipf, C C; Wittel, H; Woan, G; Woehler, J; Worden, J; Wright, J L; Wu, D S; Wu, G; Yam, W; Yamamoto, H; Yancey, C C; Yap, M J; Yu, Hang; Yu, Haocun; Yvert, M; Zadrożny, A; Zangrando, L; Zanolin, M; Zendri, J-P; Zevin, M; Zhang, L; Zhang, M; Zhang, T; Zhang, Y; Zhao, C; Zhou, M; Zhou, Z; Zhu, S J; Zhu, X J; Zucker, M E; Zweizig, J
2017-03-24
We employ gravitational-wave radiometry to map the stochastic gravitational wave background expected from a variety of contributing mechanisms and test the assumption of isotropy using data from the Advanced Laser Interferometer Gravitational Wave Observatory's (aLIGO) first observing run. We also search for persistent gravitational waves from point sources with only minimal assumptions over the 20-1726 Hz frequency band. Finding no evidence of gravitational waves from either point sources or a stochastic background, we set limits at 90% confidence. For broadband point sources, we report upper limits on the gravitational wave energy flux per unit frequency in the range F_{α,Θ}(f)<(0.1-56)×10^{-8} erg cm^{-2} s^{-1} Hz^{-1}(f/25 Hz)^{α-1} depending on the sky location Θ and the spectral power index α. For extended sources, we report upper limits on the fractional gravitational wave energy density required to close the Universe of Ω(f,Θ)<(0.39-7.6)×10^{-8} sr^{-1}(f/25 Hz)^{α} depending on Θ and α. Directed searches for narrowband gravitational waves from astrophysically interesting objects (Scorpius X-1, Supernova 1987 A, and the Galactic Center) yield median frequency-dependent limits on strain amplitude of h_{0}<(6.7,5.5, and 7.0)×10^{-25}, respectively, at the most sensitive detector frequencies between 130-175 Hz. This represents a mean improvement of a factor of 2 across the band compared to previous searches of this kind for these sky locations, considering the different quantities of strain constrained in each case.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K.M.; Baker, P. T.; Bulten, H. J.; Cheng, C.; Del Pozzo, W.; Jonker, R. J.G.; Li, T. G.F.; Meidam, J.; Rabeling, D. S.; Van Bakel, N.; Van Den Brand, J. F.J.; Veitch, J.
2018-01-01
The first observing run of Advanced LIGO spanned 4 months, from 12 September 2015 to 19 January 2016, during which gravitational waves were directly detected from two binary black hole systems, namely GW150914 and GW151226. Confident detection of gravitational waves requires an understanding of
First results from the 'Violin-Mode' tests on an advanced LIGO suspension at MIT
International Nuclear Information System (INIS)
Lockerbie, N A; Tokmakov, K V; Carbone, L; Shapiro, B; Bell, A; Strain, K A
2011-01-01
This paper describes the first results from 'Violin-Mode' measurements made on the four suspension fibres of a fully suspended 40 kg test mass. These measurements were made at the LIGO lab, Gravitational Wave Observatory test facility, at MIT. Here, an aluminium-alloy (dummy) test mass, simulating an advanced LIGO (Laser Interferometer Gravitational Wave Observatory) test mass/mirror, had been suspended in air from a test suspension by four fused-silica suspension fibres, each measuring 400 μm in diameter x 600 mm long. Violin-Mode measurements were made on these highly tensioned fibres by retrofitting a prototype system of four novel shadow sensors to the test suspension, one per fibre, these sensors having, collectively, a displacement sensitivity of (6.9 ± 1.3) x 10 -11 m (rms) Hz -1/2 , at 500 Hz, over a measuring span of ±0.1 mm. Violin-Mode fundamental resonances were detected in all four fibres: with frequencies ∼ 485 Hz when the test mass was supported lightly from below, and at ∼500 Hz when it was fully suspended. In the latter case the Violin-Mode detection took place whilst the test mass, together with its suspension fibres, was undergoing relatively large-amplitude 'pendulum-mode' motion, at ∼0.6 Hz. This motion was measured to have a peak-peak amplitude at one of the suspension fibres of up to ∼140 μm (35 μm, rms) the shadow sensors each having subsidiary outputs for monitoring such low-frequency, large amplitude, motion. Under fully suspended conditions, a calibrated Violin-Mode 'free-oscillation' amplitude of 430 ± 20 picometres, rms, was measured at 500.875 Hz, in the same suspension fibre which was found to be undergoing, simultaneously, the ∼140 μm peak-peak motion. Over the bandwidth monitored (dc to 3.2 kHz), Violin-Mode harmonics up to the sixth were recorded in an evoked response. It was concluded that the prototype system had demonstrated amply its practical viability as a detector of Violin-Mode resonances in the test
Aasi, J; Abbott, B P; Abbott, R; Abbott, T; Abernathy, M R; Accadia, T; Acernese, F; Ackley, K; Adams, C; Adams, T; Addesso, P; Adhikari, R X; Affeldt, C; Agathos, M; Aggarwal, N; Aguiar, O D; Ain, A; Ajith, P; Alemic, A; Allen, B; Allocca, A; Amariutei, D; Andersen, M; Anderson, R; Anderson, S B; Anderson, W G; Arai, K; Araya, M C; Arceneaux, C; Areeda, J; Aston, S M; Astone, P; Aufmuth, P; Aulbert, C; Austin, L; Aylott, B E; Babak, S; Baker, P T; Ballardin, G; Ballmer, S W; Barayoga, J C; Barbet, M; Barish, B C; Barker, D; Barone, F; Barr, B; Barsotti, L; Barsuglia, M; Barton, M A; Bartos, I; Bassiri, R; Basti, A; Batch, J C; Bauchrowitz, J; Bauer, Th S; Behnke, B; Bejger, M; Beker, M G; Belczynski, C; Bell, A S; Bell, C; Bergmann, G; Bersanetti, D; Bertolini, A; Betzwieser, J; Beyersdorf, P T; Bilenko, I A; Billingsley, G; Birch, J; Biscans, S; Bitossi, M; Bizouard, M A; Black, E; Blackburn, J K; Blackburn, L; Blair, D; Bloemen, S; Blom, M; Bock, O; Bodiya, T P; Boer, M; Bogaert, G; Bogan, C; Bond, C; Bondu, F; Bonelli, L; Bonnand, R; Bork, R; Born, M; Boschi, V; Bose, Sukanta; Bosi, L; Bradaschia, C; Brady, P R; Braginsky, V B; Branchesi, M; Brau, J E; Briant, T; Bridges, D O; Brillet, A; Brinkmann, M; Brisson, V; Brooks, A F; Brown, D A; Brown, D D; Brückner, F; Buchman, S; Bulik, T; Bulten, H J; Buonanno, A; Burman, R; Buskulic, D; Buy, C; Cadonati, L; Cagnoli, G; Bustillo, J Calderón; Calloni, E; Camp, J B; Campsie, P; Cannon, K C; Canuel, B; Cao, J; Capano, C D; Carbognani, F; Carbone, L; Caride, S; Castiglia, A; Caudill, S; Cavaglià, M; Cavalier, F; Cavalieri, R; Celerier, C; Cella, G; Cepeda, C; Cesarini, E; Chakraborty, R; Chalermsongsak, T; Chamberlin, S J; Chao, S; Charlton, P; Chassande-Mottin, E; Chen, X; Chen, Y; Chincarini, A; Chiummo, A; Cho, H S; Chow, J; Christensen, N; Chu, Q; Chua, S S Y; Chung, S; Ciani, G; Clara, F; Clark, J A; Cleva, F; Coccia, E; Cohadon, P-F; Colla, A; Collette, C; Colombini, M; Cominsky, L; Constancio, M; Conte, A; Cook, D; Corbitt, T R; Cordier, M; Cornish, N; Corpuz, A; Corsi, A; Costa, C A; Coughlin, M W; Coughlin, S; Coulon, J-P; Countryman, S; Couvares, P; Coward, D M; Cowart, M; Coyne, D C; Coyne, R; Craig, K; Creighton, J D E; Crowder, S G; Cumming, A; Cunningham, L; Cuoco, E; Dahl, K; Canton, T Dal; Damjanic, M; Danilishin, S L; D'Antonio, S; Danzmann, K; Dattilo, V; Daveloza, H; Davier, M; Davies, G S; Daw, E J; Day, R; Dayanga, T; Debreczeni, G; Degallaix, J; Deléglise, S; Del Pozzo, W; Denker, T; Dent, T; Dereli, H; Dergachev, V; De Rosa, R; DeRosa, R T; DeSalvo, R; Dhurandhar, S; Díaz, M; Di Fiore, L; Di Lieto, A; Di Palma, I; Di Virgilio, A; Donath, A; Donovan, F; Dooley, K L; Doravari, S; Dossa, S; Douglas, R; Downes, T P; Drago, M; Drever, R W P; Driggers, J C; Du, Z; Dwyer, S; Eberle, T; Edo, T; Edwards, M; Effler, A; Eggenstein, H; Ehrens, P; Eichholz, J; Eikenberry, S S; Endrőczi, G; Essick, R; Etzel, T; Evans, M; Evans, T; Factourovich, M; Fafone, V; Fairhurst, S; Fang, Q; Farinon, S; Farr, B; Farr, W M; Favata, M; Fehrmann, H; Fejer, M M; Feldbaum, D; Feroz, F; Ferrante, I; Ferrini, F; Fidecaro, F; Finn, L S; Fiori, I; Fisher, R P; Flaminio, R; Fournier, J-D; Franco, S; Frasca, S; Frasconi, F; Frede, M; Frei, Z; Freise, A; Frey, R; Fricke, T T; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Gair, J; Gammaitoni, L; Gaonkar, S; Garufi, F; Gehrels, N; Gemme, G; Genin, E; Gennai, A; Ghosh, S; Giaime, J A; Giardina, K D; Giazotto, A; Gill, C; Gleason, J; Goetz, E; Goetz, R; Gondan, L; González, G; Gordon, N; Gorodetsky, M L; Gossan, S; Gossler, S; Gouaty, R; Gräf, C; Graff, P B; Granata, M; Grant, A; Gras, S; Gray, C; Greenhalgh, R J S; Gretarsson, A M; Groot, P; Grote, H; Grover, K; Grunewald, S; Guidi, G M; Guido, C; Gushwa, K; Gustafson, E K; Gustafson, R; Hammer, D; Hammond, G; Hanke, M; Hanks, J; Hanna, C; Hanson, J; Harms, J; Harry, G M; Harry, I W; Harstad, E D; Hart, M; Hartman, M T; Haster, C-J; Haughian, K; Heidmann, A; Heintze, M; Heitmann, H; Hello, P; Hemming, G; Hendry, M; Heng, I S; Heptonstall, A W; Heurs, M; Hewitson, M; Hild, S; Hoak, D; Hodge, K A; Holt, K; Hooper, S; Hopkins, P; Hosken, D J; Hough, J; Howell, E J; Hu, Y; Huerta, E; Hughey, B; Husa, S; Huttner, S H; Huynh, M; Huynh-Dinh, T; Ingram, D R; Inta, R; Isogai, T; Ivanov, A; Iyer, B R; Izumi, K; Jacobson, M; James, E; Jang, H; Jaranowski, P; Ji, Y; Jiménez-Forteza, F; Johnson, W W; Jones, D I; Jones, R; Jonker, R J G; Ju, L; K, Haris; Kalmus, P; Kalogera, V; Kandhasamy, S; Kang, G; Kanner, J B; Karlen, J; Kasprzack, M; Katsavounidis, E; Katzman, W; Kaufer, H; Kawabe, K; Kawazoe, F; Kéfélian, F; Keiser, G M; Keitel, D; Kelley, D B; Kells, W; Khalaidovski, A; Khalili, F Y; Khazanov, E A; Kim, C; Kim, K; Kim, N; Kim, N G; Kim, Y-M; King, E J; King, P J; Kinzel, D L; Kissel, J S; Klimenko, S; Kline, J; Koehlenbeck, S; Kokeyama, K; Kondrashov, V; Koranda, S; Korth, W Z; Kowalska, I; Kozak, D B; Kremin, A; Kringel, V; Królak, A; Kuehn, G; Kumar, A; Kumar, P; Kumar, R; Kuo, L; Kutynia, A; Kwee, P; Landry, M; Lantz, B; Larson, S; Lasky, P D; Lawrie, C; Lazzarini, A; Lazzaro, C; Leaci, P; Leavey, S; Lebigot, E O; Lee, C-H; Lee, H K; Lee, H M; Lee, J; Leonardi, M; Leong, J R; Le Roux, A; Leroy, N; Letendre, N; Levin, Y; Levine, B; Lewis, J; Li, T G F; Libbrecht, K; Libson, A; Lin, A C; Littenberg, T B; Litvine, V; Lockerbie, N A; Lockett, V; Lodhia, D; Loew, K; Logue, J; Lombardi, A L; Lorenzini, M; Loriette, V; Lormand, M; Losurdo, G; Lough, J; Lubinski, M J; Lück, H; Luijten, E; Lundgren, A P; Lynch, R; Ma, Y; Macarthur, J; Macdonald, E P; MacDonald, T; Machenschalk, B; MacInnis, M; Macleod, D M; Magana-Sandoval, F; Mageswaran, M; Maglione, C; Mailand, K; Majorana, E; Maksimovic, I; Malvezzi, V; Man, N; Manca, G M; Mandel, I; Mandic, V; Mangano, V; Mangini, N; Mantovani, M; Marchesoni, F; Marion, F; Márka, S; Márka, Z; Markosyan, A; Maros, E; Marque, J; Martelli, F; Martin, I W; Martin, R M; Martinelli, L; Martynov, D; Marx, J N; Mason, K; Masserot, A; Massinger, T J; Matichard, F; Matone, L; Matzner, R A; Mavalvala, N; Mazumder, N; Mazzolo, G; McCarthy, R; McClelland, D E; McGuire, S C; McIntyre, G; McIver, J; McLin, K; Meacher, D; Meadors, G D; Mehmet, M; Meidam, J; Meinders, M; Melatos, A; Mendell, G; Mercer, R A; Meshkov, S; Messenger, C; Meyers, P; Miao, H; Michel, C; Mikhailov, E E; Milano, L; Milde, S; Miller, J; Minenkov, Y; Mingarelli, C M F; Mishra, C; Mitra, S; Mitrofanov, V P; Mitselmakher, G; Mittleman, R; Moe, B; Moesta, P; Mohan, M; Mohapatra, S R P; Moraru, D; Moreno, G; Morgado, N; Morriss, S R; Mossavi, K; Mours, B; Mow-Lowry, C M; Mueller, C L; Mueller, G; Mukherjee, S; Mullavey, A; Munch, J; Murphy, D; Murray, P G; Mytidis, A; Nagy, M F; Kumar, D Nanda; Nardecchia, I; Naticchioni, L; Nayak, R K; Necula, V; Nelemans, G; Neri, I; Neri, M; Newton, G; Nguyen, T; Nitz, A; Nocera, F; Nolting, D; Normandin, M E N; Nuttall, L K; Ochsner, E; O'Dell, J; Oelker, E; Oh, J J; Oh, S H; Ohme, F; Oppermann, P; O'Reilly, B; O'Shaughnessy, R; Osthelder, C; Ottaway, D J; Ottens, R S; Overmier, H; Owen, B J; Padilla, C; Pai, A; Palashov, O; Palomba, C; Pan, H; Pan, Y; Pankow, C; Paoletti, F; Paoletti, R; Paris, H; Pasqualetti, A; Passaquieti, R; Passuello, D; Pedraza, M; Penn, S; Perreca, A; Phelps, M; Pichot, M; Pickenpack, M; Piergiovanni, F; Pierro, V; Pinard, L; Pinto, I M; Pitkin, M; Poeld, J; Poggiani, R; Poteomkin, A; Powell, J; Prasad, J; Premachandra, S; Prestegard, T; Price, L R; Prijatelj, M; Privitera, S; Prodi, G A; Prokhorov, L; Puncken, O; Punturo, M; Puppo, P; Qin, J; Quetschke, V; Quintero, E; Quiroga, G; Quitzow-James, R; Raab, F J; Rabeling, D S; Rácz, I; Radkins, H; Raffai, P; Raja, S; Rajalakshmi, G; Rakhmanov, M; Ramet, C; Ramirez, K; Rapagnani, P; Raymond, V; Re, V; Read, J; Reed, C M; Regimbau, T; Reid, S; Reitze, D H; Rhoades, E; Ricci, F; Riles, K; Robertson, N A; Robinet, F; Rocchi, A; Rodruck, M; Rolland, L; Rollins, J G; Romano, J D; Romano, R; Romanov, G; Romie, J H; Rosińska, D; Rowan, S; Rüdiger, A; Ruggi, P; Ryan, K; Salemi, F; Sammut, L; Sandberg, V; Sanders, J R; Sannibale, V; Santiago-Prieto, I; Saracco, E; Sassolas, B; Sathyaprakash, B S; Saulson, P R; Savage, R; Scheuer, J; Schilling, R; Schnabel, R; Schofield, R M S; Schreiber, E; Schuette, D; Schutz, B F; Scott, J; Scott, S M; Sellers, D; Sengupta, A S; Sentenac, D; Sequino, V; Sergeev, A; Shaddock, D; Shah, S; Shahriar, M S; Shaltev, M; Shapiro, B; Shawhan, P; Shoemaker, D H; Sidery, T L; Siellez, K; Siemens, X; Sigg, D; Simakov, D; Singer, A; Singer, L; Singh, R; Sintes, A M; Slagmolen, B J J; Slutsky, J; Smith, J R; Smith, M; Smith, R J E; Smith-Lefebvre, N D; Son, E J; Sorazu, B; Souradeep, T; Sperandio, L; Staley, A; Stebbins, J; Steinlechner, J; Steinlechner, S; Stephens, B C; Steplewski, S; Stevenson, S; Stone, R; Stops, D; Strain, K A; Straniero, N; Strigin, S; Sturani, R; Stuver, A L; Summerscales, T Z; Susmithan, S; Sutton, P J; Swinkels, B; Tacca, M; Talukder, D; Tanner, D B; Tarabrin, S P; Taylor, R; Ter Braack, A P M; Thirugnanasambandam, M P; Thomas, M; Thomas, P; Thorne, K A; Thorne, K S; Thrane, E; Tiwari, V; Tokmakov, K V; Tomlinson, C; Toncelli, A; Tonelli, M; Torre, O; Torres, C V; Torrie, C I; Travasso, F; Traylor, G; Tse, M; Ugolini, D; Unnikrishnan, C S; Urban, A L; Urbanek, K; Vahlbruch, H; Vajente, G; Valdes, G; Vallisneri, M; van den Brand, J F J; Van Den Broeck, C; van der Putten, S; van der Sluys, M V; van Heijningen, J; van Veggel, A A; Vass, S; Vasúth, M; Vaulin, R; Vecchio, A; Vedovato, G; Veitch, J; Veitch, P J; Venkateswara, K; Verkindt, D; Verma, S S; Vetrano, F; Viceré, A; Vincent-Finley, R; Vinet, J-Y; Vitale, S; Vo, T; Vocca, H; Vorvick, C; Vousden, W D; Vyachanin, S P; Wade, A; Wade, L; Wade, M; Walker, M; Wallace, L; Wang, M; Wang, X; Ward, R L; Was, M; Weaver, B; Wei, L-W; Weinert, M; Weinstein, A J; Weiss, R; Welborn, T; Wen, L; Wessels, P; West, M; Westphal, T; Wette, K; Whelan, J T; White, D J; Whiting, B F; Wiesner, K; Wilkinson, C; Williams, K; Williams, L; Williams, R; Williams, T; Williamson, A R; Willis, J L; Willke, B; Wimmer, M; Winkler, W; Wipf, C C; Wiseman, A G; Wittel, H; Woan, G; Worden, J; Yablon, J; Yakushin, I; Yamamoto, H; Yancey, C C; Yang, H; Yang, Z; Yoshida, S; Yvert, M; Zadrożny, A; Zanolin, M; Zendri, J-P; Zhang, Fan; Zhang, L; Zhao, C; Zhu, X J; Zucker, M E; Zuraw, S; Zweizig, J
2014-12-05
Gravitational waves from a variety of sources are predicted to superpose to create a stochastic background. This background is expected to contain unique information from throughout the history of the Universe that is unavailable through standard electromagnetic observations, making its study of fundamental importance to understanding the evolution of the Universe. We carry out a search for the stochastic background with the latest data from the LIGO and Virgo detectors. Consistent with predictions from most stochastic gravitational-wave background models, the data display no evidence of a stochastic gravitational-wave signal. Assuming a gravitational-wave spectrum of Ω_{GW}(f)=Ω_{α}(f/f_{ref})^{α}, we place 95% confidence level upper limits on the energy density of the background in each of four frequency bands spanning 41.5-1726 Hz. In the frequency band of 41.5-169.25 Hz for a spectral index of α=0, we constrain the energy density of the stochastic background to be Ω_{GW}(f)waves.
VizieR Online Data Catalog: Gravitational waves from known pulsars (Aasi+, 2014)
Aasi, J.; Abadie, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Accadia, T.; Acernese, F.; Adams, C.; Adams, T.; Adhikari, R. X.; Affeldt, C.; Agathos, M.; Aggarwal, N.; Aguiar, O. D.; Ajith, P.; Allen, B.; Allocca, A.; Ceron, E. A.; Amariutei, D.; Anderson, R. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C.; Areeda, J.; Ast, S.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Austin, L.; Aylott, B. E.; Babak, S.; Baker, P. T.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barker, D.; Barnum, S. H.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barton, M. A.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J.; Bauchrowitz, J.; Bauer, Th. S.; Bebronne, M.; Behnke, B.; Bejger, M.; Beker, M. G.; Bell, A. S.; Bell, C.; Belopolski, I.; Bergmann, G.; Berliner, J. M.; Bersanetti, D.; Bertolini, A.; Bessis, D.; Betzwieser, J.; Beyersdorf, P. T.; Bhadbhade, T.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Bitossi, M.; Bizouard, M. A.; Black, E.; Blackburn, J. K.; Blackburn, L.; Blair, D.; Blom, M.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogan, C.; Bo, Nd C.; Bondu, F.; Bonelli, L.; Bonnand, R.; Bork, R.; Born, M.; Boschi, V.; Bose, S.; Bosi, L.; Bowers, J.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brannen, C. A.; Brau, J. E.; Breyer, J.; Briant, T.; Bridges, D. O.; Brillet, A.; Brinkmann, M.; Brisson, V.; Britzger, M.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Bruckner, F.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Calderon Bustillo, J.; Calloni, E.; Camp, J. B.; Campsie, P.; Cannon, K. C.; Canuel, B.; Cao, J.; Capano, C. D.; Carbognani, F.; Carbone, L.; Caride, S.; Castiglia, A.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chen, X.; Chen, Y.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Chow, J.; Christensen, N.; Chu, Q.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, D. E.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Colombini, M.; Constancio, M. Jr; Conte, A.; Conte, R.; Cook, D.; Corbitt, T. R.; Cordier, M.; Cornish, N.; Corsi, A.; Costa, C. A.; Coughlin, M. W.; Coulon, J.-P.; Countryman, S.; Couvares, P.; Coward, D. M.; Cowart, M.; Coyne, D. C.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dahl, K.; Dal Canton, T.; Damjanic, M.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dattilo, V.; Daudert, B.; Daveloza, H.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Dayanga, T.; De Rosa, R.; Debreczeni, G.; Degallaix, J.; Del Pozzo, W.; Deleeuw, E.; Deleglise, S.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.; Derosa, R.; Desalvo, R.; Dhurandhar, S.; di Fiore, L.; di Lieto, A.; di Palma, I.; di, Virgilio A.; Diaz, M.; Dietz, A.; Dmitry, K.; Donovan, F.; Dooley, K. L.; Doravari, S.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Dumas, J.-C.; Dwyer, S.; Eberle, T.; Edwards, M.; Effler, A.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Endroczi, G.; Essick, R.; Etzel, T.; Evans, K.; Evans, M.; Evans, T.; Factourovich, M.; Fafone, V.; Fairhurst, S.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W.; Favata, M.; Fazi, D.; Fehrmann, H.; Feldbaum, D.; Ferrante, I.; Ferrini, F.; Fidecaro, F.; Finn, L. S.; Fiori, I.; Fisher, R.; Flaminio, R.; Foley, E.; Foley, S.; Forsi, E.; Fotopoulos, N.; Fournier, J.-D.; Franco, S.; Frasca, S.; Frasconi, F.; Frede, M.; Frei, M.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fujimoto, M.-K.; Fulda, P.; Fyffe, M.; Gair, J.; Gammaitoni, L.; Garcia, J.; Garufi, F.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; Gergely, L.; Ghosh, S.; Giaime, J. A.; Giampanis, S.; Giardina, K. D.; Giazotto, A.; Gil-Casanova, S.; Gill, C.; Gleason, J.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, G.; Gordon, N.; Gorodetsky, M. L.; Gossan, S.; Gossler, S.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greenhalgh, R. J. S.; Gretarsson, A. M.; Griffo, C.; Groot, P.; Grote, H.; Grover, K.; Grunewald, S.; Guidi, G. M.; Guido, C.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B.; Hall, E.; Hammer, D.; Hammond, G.; Hanke, M.; Hanks, J.; Hanna, C.; Hanson, J.; Harms, J.; Harry, G. M.; Harry, I. W.; Harstad, E. D.; Hartman, M. T.; Haughian, K.; Hayama, K.; Heefner, J.; Heidmann, A.; Heintze, M.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Holt, K.; Holtrop, M.; Hong, T.; Hooper, S.; Horrom, T.; Hosken, D. J.; Hough, J.; Howell, E. J.; Hu, Y.; Hua, Z.; Huang, V.; Huerta, E. A.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh, M.; Huynh-Dinh, T.; Iafrate, J.; Ingram, D. R.; Inta, R.; Isogai, T.; Ivanov, A.; Iyer, B. R.; Izumi, K.; Jacobson, M.; James, E.; Jang, H.; Jang, Y. J.; Jaranowski, P.; Jimenez-Forteza, F.; Johnson, W. W.; Jones, D.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; K, H.; Kalmus, P.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kasprzack, M.; Kasturi, R.; Katsavounidis, E.; Katzman, W.; Kaufer, H.; Kaufman, K.; Kawabe, K.; Kawamura, S.; Kawazoe, F.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Khalaidovski, A.; Khalili, F. Y.; Khazanov, E. A.; Kim, B. K.; Kim, C.; Kim, K.; Kim, N.; Kim, W.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Klimen, Ko S.; Kline, J.; Koehlenbeck, S.; Kokeyama, K.; Kondrashov, V.; Koranda, S.; Korth, W. Z.; Kowalska, I.; Kozak, D.; Kremin, A.; Kringel, V.; Krishnan, B.; Krolak, A.; Kucharczyk, C.; Kudla, S.; Kuehn, G.; Kumar, A.; Kumar, P.; Kumar, R.; Kurdyumov, R.; Kwee, P.; Landry, M.; Lantz, B.; Larson, S.; Lasky, P. D.; Lawrie, C.; Lazzarini, A.; Le Roux, A.; Leaci, P.; Lebigot, E. O.; Lee, C.-H.; Lee, H. K.; Lee, H. M.; Lee, J.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levine, B.; Lewis, J. B.; Lhuillier, V.; Li, T. G. F.; Lin, A. C.; Littenberg, T. B.; Litvine, V.; Liu, F.; Liu, H.; Liu, Y.; Liu, Z.; Lloyd, D.; Lockerbie, N. A.; Lockett, V.; Lodhia, D.; Loew, K.; Logue, J.; Lombardi, A. L.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J.; Luan, J.; Lubinski, M. J.; Luck, H.; Lundgren, A. P.; MacArthur, J.; MacDonald, E.; Machenschalk, B.; Macinnis, M.; MacLeod, D. M.; Magana-Sandoval, F.; Mageswaran, M.; Mailand, K.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Manca, G. M.; Mandel, I.; Mandic, V.; Mangano, V.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A.; Maros, E.; Marque, J.; Martelli, F.; Martin, I. W.; Martin, R. M.; Martinelli, L.; Martynov, D.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Matichard, F.; Matone, L.; Matzner, R. A.; Mavalvala, N.; May, G.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McGuire, S. C.; McIntyre, G.; McIver, J.; Meacher, D.; Meadors, G. D.; Mehmet, M.; Meidam, J.; Meier, T.; Melatos, A.; Mendell, G.; Mercer, R. A.; Meshkov, S.; Messenger, C.; Meyer, M. S.; Miao, H.; Michel, C.; Mikhailov, E. E.; Milano, L.; Miller, J.; Minenkov, Y.; Mingarelli, C. M. F.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moe, B.; Mohan, M.; Mohapatra, S. R. P.; Mokler, F.; Moraru, D.; Moreno, G.; Morgado, N.; Mori, T.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D.; Murray, P. G.; Mytidis, A.; Nagy, M. F.; Nanda, Kumar D.; Nardecchia, I.; Nash, T.; Naticchioni, L.; Nayak, R.; Necula, V.; Nelemans, G.; Neri, I.; Neri, M.; Newton, G.; Nguyen, T.; Nishida, E.; Nishizawa, A.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E.; Nuttall, L. K.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oppermann, P.; O'Reilly, B.; Ortega Larcher, W.; O'Shaughnessy, R.; Osthelder, C.; Ottaway, D. J.; Ottens, R. S.; Ou, J.; Overmier, H.; Owen, B. J.; Padilla, C.; Pai, A.; Palomba, C.; Pan, Y.; Pankow, C.; Paoletti, F.; Paoletti, R.; Papa, M. A.; Paris, H.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Pedraza, M.; Peiris, P.; Penn, S.; Perreca, A.; Phelps, M.; Pichot, M.; Pickenpack, M.; Piergiovanni, F.; Pierro, V.; Pinard, L.; Pindor, B.; Pinto, I. M.; Pitkin, M.; Poeld, J.; Poggiani, R.; Poole, V.; Poux, C.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L.; Puncken, O.; Punturo, M.; Puppo, P.; Quetschke, V.; Quintero, E.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Racz, I.; Radkins, H.; Raffai, P.; Raja, S.; Rajalakshmi, G.; Rakhmanov, M.; Ramet, C.; Rapagnani, P.; Raymond, V.; Re, V.; Reed, C. M.; Reed, T.; Regimbau, T.; Reid, S.; Reitze, D. H.; Ricci, F.; Riesen, R.; Riles, K.; Robertson, N. A.; Robinet, F.; Rocchi, A.; Roddy, S.; Rodriguez, C.; Rodruck, M.; Roever, C.; Rolland, L.; Rollins, J. G.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Rudiger, A.; Ruggi, P.; Ryan, K.; Salemi, F.; Sammut, L.; Sandberg, V.; Sanders, J.; Sannibale, V.; Santiago-Prieto, I.; Saracco, E.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Savage, R.; Schilling, R.; Schnabel, R.; Schofield, R. M. S.; Schreiber, E.; Schuette, D.; Schulz, B.; Schutz, B. F.; Schwinberg, P.; Scott, J.; Scott, S. M.; Seifert, F.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sergeev, A.; Shaddock, D.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sidery, T. L.; Siellez, K.; Siemens, X.; Sigg, D.; Simakov, D.; Singer, A.; Singer, L.; Sintes, A. M.; Skelton, G. R.; Slagmolen, B. J. J.; Slutsky, J.; Smith, J. R.; Smith, M. R.; Smith, R. J. E.; Smith-Lefebvre, N. D.; Soden, K.; Son, E. J.; Sorazu, B.; Souradeep, T.; Sperandio, L.; Staley, A.; Steinert, E.; Steinlechner, J.; Steinlechner, S.; Steplewski, S.; Stevens, D.; Stochino, A.; Stone, R.; Strain, K. A.; Straniero, N.; Strigin, S.; Stroeer, A. S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Susmithan, S.; Sutton, P. J.; Swinkels, B.; Szeifert, G.; Tacca, M.; Talukder, D.; Tang, L.; Tanner, D. B.; Tarabrin, S. P.; Taylor, R.; Ter Braack, A. P. M.; Thirugnanasambandam, M. P.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Toncelli, A.; Tonelli, M.; Torre, O.; Torres, C. V.; Torrie, C. I.; Travasso, F.; Traylor, G.; Tse, M.; Ugolini, D.; Unnikrishnan, C. S.; Vahlbruch, H.; Vajente, G.; Vallisneri, M.; van den Brand, J. F. J.; van den Broeck, C.; van der Putten, S.; van der Sluys, M. V.; van Heijningen, J.; van Veggel, A. A.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Verkindt, D.; Verma, S.; Vetrano, F.; Vicere, A.; Vincent-Finley, R.; Vinet, J.-Y.; Vitale, S.; Vlcek, B.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vrinceanu, D.; Vyachanin, S. P.; Wade, A.; Wade, L.; Wade, M.; Waldman, S. J.; Walker, M.; Wallace, L.; Wan, Y.; Wang, J.; Wang, M.; Wang, X.; Wanner, A.; Ward, R. L.; Was, M.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Wessels, P.; West, M.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Wibowo, S.; Wiesner, K.; Wilkinson, C.; Williams, L.; Williams, R.; Williams, T.; Willis, J. L.; Willke, B.; Wimmer, M.; Winkelmann, L.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Yablon, J.; Yakushin, I.; Yamamoto, H.; Yancey, C. C.; Yang, H.; Yeaton-Massey, D.; Yoshida, S.; Yum, H.; Yvert, M.; Zadrozny, A.; Zanolin, M.; Zendri, J.-P.; Zhang, F.; Zhang, L.; Zhao, C.; Zhu, H.; Zhu, X. J.; Zotov, N.; Zucker, M. E.; Zweizig, J.; Buchner, S.; Cognard, I.; Corongiu, A.; D'Amico, N.; Espinoza, C. M.; Freire, P. C. C.; Gotthelf, E. V.; Guillemot, L.; Hessels, J. W. T.; Hobbs, G. B.; Kramer, M.; Lyne, A. G.; Marshall, F. E.; Possenti, A.; Ransom, S. M.; Ray, P. S.; Roy, J.; Stappers, B. W.; VIRGO Collaboration
2017-06-01
In this paper we have used calibrated data from the Virgo second (Aasi et al. 2012CQGra..29o5002A) and fourth science runs (VSR2 and VSR4) and the LIGO sixth science run (S6). Virgo's third science run (VSR3) was relatively insensitive in comparison with VSR4 and has not been included in this analysis. This was partially because Virgo introduced monolithic mirror suspensions prior to VSR4 which improved sensitivity in the low-frequency range. During S6, the two LIGO 4 km detectors at Hanford, Washington (LHO/H1), and Livingston, Louisiana (LLO/L1), were running in an enhanced configuration (Adhikari et al. 2006, Enhanced LIGO, Tech. Rep. LIGO-T060156-v01, California Institute of Technology, Massachusetts Institute of Technology, https://dcc.ligo.org/LIGO-T060156-v1/public) over that from the previous S5 run (Abbott et al. 2009RPPh...72g6901A). (1 data file).
Suppression of thermal transients in advanced LIGO interferometers using CO2 laser preheating
Jaberian Hamedan, V.; Zhao, C.; Ju, L.; Blair, C.; Blair, D. G.
2018-06-01
In high optical power interferometric gravitational wave detectors, such as Advanced LIGO, the thermal effects due to optical absorption in the mirror coatings and the slow thermal response of fused silica substrate cause time dependent changes in the mirror profile. After locking, high optical power builds up in the arm cavities. Absorption induced heating causes optical cavity transverse mode frequencies to drift over a period of hours, relative to the fundamental mode. At high optical power this can cause time dependent transient parametric instability, which can lead to interferometer disfunction. In this paper, we model the use of CO2 laser heating designed to enable the interferometer to be maintained in a thermal condition such that transient changes in the mirrors are greatly reduced. This can minimize transient parametric instability and compensate dark port power fluctuations. Modeling results are presented for both single compensation where a CO2 laser acting on one test mass per cavity, and double compensation using one CO2 laser for each test mass. Using parameters of the LIGO Hanford Observatory X-arm as an example, single compensation allows the maximum mode frequency shift to be limited to 6% of its uncompensated value. However, single compensation causes transient degradation of the contrast defect. Double compensation minimise contrast defect degradation and reduces transients to less than 1% if the CO2 laser spot is positioned within 2 mm of the cavity beam position.
Effects of transients in LIGO suspensions on searches for gravitational waves.
Walker, M; Abbott, T D; Aston, S M; González, G; Macleod, D M; McIver, J; Abbott, B P; Abbott, R; Adams, C; Adhikari, R X; Anderson, S B; Ananyeva, A; Appert, S; Arai, K; Ballmer, S W; Barker, D; Barr, B; Barsotti, L; Bartlett, J; Bartos, I; Batch, J C; Bell, A S; Betzwieser, J; Billingsley, G; Birch, J; Biscans, S; Biwer, C; Blair, C D; Bork, R; Brooks, A F; Ciani, G; Clara, F; Countryman, S T; Cowart, M J; Coyne, D C; Cumming, A; Cunningham, L; Danzmann, K; Da Silva Costa, C F; Daw, E J; DeBra, D; DeRosa, R T; DeSalvo, R; Dooley, K L; Doravari, S; Driggers, J C; Dwyer, S E; Effler, A; Etzel, T; Evans, M; Evans, T M; Factourovich, M; Fair, H; Fernández Galiana, A; Fisher, R P; Fritschel, P; Frolov, V V; Fulda, P; Fyffe, M; Giaime, J A; Giardina, K D; Goetz, E; Goetz, R; Gras, S; Gray, C; Grote, H; Gushwa, K E; Gustafson, E K; Gustafson, R; Hall, E D; Hammond, G; Hanks, J; Hanson, J; Hardwick, T; Harry, G M; Heintze, M C; Heptonstall, A W; Hough, J; Izumi, K; Jones, R; Kandhasamy, S; Karki, S; Kasprzack, M; Kaufer, S; Kawabe, K; Kijbunchoo, N; King, E J; King, P J; Kissel, J S; Korth, W Z; Kuehn, G; Landry, M; Lantz, B; Lockerbie, N A; Lormand, M; Lundgren, A P; MacInnis, M; Márka, S; Márka, Z; Markosyan, A S; Maros, E; Martin, I W; Martynov, D V; Mason, K; Massinger, T J; Matichard, F; Mavalvala, N; McCarthy, R; McClelland, D E; McCormick, S; McIntyre, G; Mendell, G; Merilh, E L; Meyers, P M; Miller, J; Mittleman, R; Moreno, G; Mueller, G; Mullavey, A; Munch, J; Nuttall, L K; Oberling, J; Oliver, M; Oppermann, P; Oram, Richard J; O'Reilly, B; Ottaway, D J; Overmier, H; Palamos, J R; Paris, H R; Parker, W; Pele, A; Penn, S; Phelps, M; Pierro, V; Pinto, I; Principe, M; Prokhorov, L G; Puncken, O; Quetschke, V; Quintero, E A; Raab, F J; Radkins, H; Raffai, P; Reid, S; Reitze, D H; Robertson, N A; Rollins, J G; Roma, V J; Romie, J H; Rowan, S; Ryan, K; Sadecki, T; Sanchez, E J; Sandberg, V; Savage, R L; Schofield, R M S; Sellers, D; Shaddock, D A; Shaffer, T J; Shapiro, B; Shawhan, P; Shoemaker, D H; Sigg, D; Slagmolen, B J J; Smith, B; Smith, J R; Sorazu, B; Staley, A; Strain, K A; Tanner, D B; Taylor, R; Thomas, M; Thomas, P; Thorne, K A; Thrane, E; Torrie, C I; Traylor, G; Tuyenbayev, D; Vajente, G; Valdes, G; van Veggel, A A; Vecchio, A; Veitch, P J; Venkateswara, K; Vo, T; Vorvick, C; Ward, R L; Warner, J; Weaver, B; Weiss, R; Weßels, P; Willke, B; Wipf, C C; Worden, J; Wu, G; Yamamoto, H; Yancey, C C; Yu, Hang; Yu, Haocun; Zhang, L; Zucker, M E; Zweizig, J
2017-12-01
This paper presents an analysis of the transient behavior of the Advanced LIGO (Laser Interferometer Gravitational-wave Observatory) suspensions used to seismically isolate the optics. We have characterized the transients in the longitudinal motion of the quadruple suspensions during Advanced LIGO's first observing run. Propagation of transients between stages is consistent with modeled transfer functions, such that transient motion originating at the top of the suspension chain is significantly reduced in amplitude at the test mass. We find that there are transients seen by the longitudinal motion monitors of quadruple suspensions, but they are not significantly correlated with transient motion above the noise floor in the gravitational wave strain data, and therefore do not present a dominant source of background noise in the searches for transient gravitational wave signals. Using the suspension transfer functions, we compared the transients in a week of gravitational wave strain data with transients from a quadruple suspension. Of the strain transients between 10 and 60 Hz, 84% are loud enough that they would have appeared above the sensor noise in the top stage quadruple suspension monitors if they had originated at that stage at the same frequencies. We find no significant temporal correlation with the suspension transients in that stage, so we can rule out suspension motion originating at the top stage as the cause of those transients. However, only 3.2% of the gravitational wave strain transients are loud enough that they would have been seen by the second stage suspension sensors, and none of them are above the sensor noise levels of the penultimate stage. Therefore, we cannot eliminate the possibility of transient noise in the detectors originating in the intermediate stages of the suspension below the sensing noise.
Search for intermediate mass black hole binaries in the first observing run of Advanced LIGO
Abbott, B. P.; Abbott, R.; Adhikari, R. X.; Ananyeva, A.; Anderson, S. B.; Appert, S.; Arai, K.; Araya, M. C.; Barayoga, J. C.; Barish, B. C.; Berger, B. K.; Billingsley, G.; Blackburn, J. K.; Bork, R.; Brooks, A. F.
2017-01-01
During their first observational run, the two Advanced LIGO detectors attained an unprecedented sensitivity, resulting in the first direct detections of gravitational-wave signals produced by stellar-mass binary black hole systems. This paper reports on an all-sky search for gravitational waves (GWs) from merging intermediate mass black hole binaries (IMBHBs). The combined results from two independent search techniques were used in this study: the first employs a matched-filter algorithm that...
Aartsen, M.G.; Agathos, M.; Bertolini, A.; Bulten, H.J.; Del Pozzo, W.; Jonker, R.; Meidam, J.; van den Brand, J.F.J.; LIGO Sci Collaboration, Virgo Colla; IceCube, Collaboration
2014-01-01
We report the results of a multimessenger search for coincident signals from the LIGO and Virgo gravitational-wave observatories and the partially completed IceCube high-energy neutrino detector, including periods of joint operation between 2007-2010. These include parts of the 2005-2007 run and the
Merging Black Hole Binaries in Galactic Nuclei: Implications for Advanced-LIGO Detections
Antonini, Fabio; Rasio, Frederic A.
2016-11-01
Motivated by the recent detection of gravitational waves from the black hole binary merger GW150914, we study the dynamical evolution of (stellar-mass) black holes in galactic nuclei, where massive star clusters reside. With masses of ˜ {10}7 {M}⊙ and sizes of only a few parsecs, nuclear star clusters (NSCs) are the densest stellar systems observed in the local universe and represent a robust environment where black hole binaries can dynamically form, harden, and merge. We show that due to their large escape speeds, NSCs can retain a large fraction of their merger remnants. Successive mergers can then lead to significant growth and produce black hole mergers of several tens of solar masses similar to GW150914 and up to a few hundreds of solar masses, without the need to invoke extremely low metallicity environments. We use a semi-analytical approach to describe the dynamics of black holes in massive star clusters. Our models give a black hole binary merger rate of ≈ 1.5 {{Gpc}}-3 {{yr}}-1 from NSCs, implying up to a few tens of possible detections per year with Advanced LIGO. Moreover, we find a local merger rate of ˜ 1 {{Gpc}}-3 {{yr}}-1 for high mass black hole binaries similar to GW150914; a merger rate comparable to or higher than that of similar binaries assembled dynamically in globular clusters (GCs). Finally, we show that if all black holes receive high natal kicks, ≳ 50 {km} {{{s}}}-1, then NSCs will dominate the local merger rate of binary black holes compared to either GCs or isolated binary evolution.
First results from the ‘Violin-Mode’ tests on an advanced LIGO suspension at MIT
Lockerbie, N. A.; Carbone, L.; Shapiro, B.; Tokmakov, K. V.; Bell, A.; Strain, K. A.
2011-12-01
This paper describes the first results from ‘Violin-Mode’ measurements made on the four suspension fibres of a fully suspended 40 kg test mass. These measurements were made at the LIGO lab, Gravitational Wave Observatory test facility, at MIT. Here, an aluminium-alloy (dummy) test mass, simulating an advanced LIGO (Laser Interferometer Gravitational Wave Observatory) test mass/mirror, had been suspended in air from a test suspension by four fused-silica suspension fibres, each measuring 400 µm in diameter × 600 mm long. Violin-Mode measurements were made on these highly tensioned fibres by retrofitting a prototype system of four novel shadow sensors to the test suspension, one per fibre, these sensors having, collectively, a displacement sensitivity of (6.9 ± 1.3) × 10-11 m (rms) Hz-1/2, at 500 Hz, over a measuring span of ±0.1 mm. Violin-Mode fundamental resonances were detected in all four fibres: with frequencies ˜ 485 Hz when the test mass was supported lightly from below, and at ˜500 Hz when it was fully suspended. In the latter case the Violin-Mode detection took place whilst the test mass, together with its suspension fibres, was undergoing relatively large-amplitude ‘pendulum-mode’ motion, at ˜0.6 Hz. This motion was measured to have a peak-peak amplitude at one of the suspension fibres of up to ˜140 µm (35 µm, rms)—the shadow sensors each having subsidiary outputs for monitoring such low-frequency, large amplitude, motion. Under fully suspended conditions, a calibrated Violin-Mode ‘free-oscillation’ amplitude of 430 ± 20 picometres, rms, was measured at 500.875 Hz, in the same suspension fibre which was found to be undergoing, simultaneously, the ˜140 µm peak-peak motion. Over the bandwidth monitored (dc to 3.2 kHz), Violin-Mode harmonics up to the sixth were recorded in an evoked response. It was concluded that the prototype system had demonstrated amply its practical viability as a detector of Violin-Mode resonances in the
A low loss Faraday isolator for squeezed vacuum injection in Advanced LIGO
Goetz, Ryan; Tanner, David; Mueller, Guido
2016-03-01
Using conventional interferometry, the strain sensitivity of Advanced LIGO is limited by a quantum noise floor known as the standard quantum limit (SQL). Injecting squeezed vacuum states into the output port of the interferometer allows for detector sensitivities below the SQL at frequencies within a band of observational interest. The effectiveness of squeezing in reducing quantum noise is strongly dependent upon the optical loss in the squeezed path. Thus, to combine the squeezed vacuum state with the interferometer output we require a Faraday isolator with both high power-throughput efficiency and high isolation ratio. A prototype isolator is currently being developed, and we will discuss the design goals and current status.
Effects of Transcranial Direct Current Stimulation on Expression of Immediate Early Genes (IEG’s)
2015-12-01
TRANSCRANIAL DIRECT CURRENT STIMULATION OF EXPRESSION OF IMMEDIATE EARLY GENES (IEG’S) Jessica...AND SUBTITLE Effects of Transcranial Direct Current Stimulation on Expression of Immediate Early Genes (IEG’s) 5a. CONTRACT NUMBER In-House 5b...community in better understanding what is occurring biologically during tDCS. 15. SUBJECT TERMS Transcranial direct current stimulation
Abbott, B. P.; Abbott, R.; Abbott, D.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allen, G; Allocca, A.; Almoubayyed, H.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Becsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Etienne, Z. B.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, D J; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blari, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, J.G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S. S. Y.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; De, S.; Debra, D.; Deelman, E; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.J.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, A.S.P.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J. -M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.E.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, S.W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kramer, C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang-Cheol, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, W. H.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Luck, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana Hernandez, I.; Magana-Sandoval, F.; Magana Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mayani, R.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P.G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Castro-Perez, J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Purrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosinska, D.; Ross, M. P.; Rowan, S.; Rudiger, A.; Ruggi, P.; Ryan, K.; Rynge, M.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schonbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A.; Shahriar, M. S.; Shao, L.P.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, J. A.; Taylor, W.R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahi, K.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y. -F.; Wang, Y. -F.; Ward, L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, G.W.K.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zanolin, M.; Zelenova, T.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y. -H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Suvorova, S.; Moran, W.; Evans, J.R.
2017-01-01
Results are presented from a semicoherent search for continuous gravitational waves from the brightest low-mass X-ray binary, Scorpius X-1, using data collected during the first Advanced LIGO observing run. The search combines a frequency domain matched filter (Bessel-weighted F-statistic) with a
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bawaj, M.; Bazzan, M.; Becsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chatterjee, D.; Chatziioannou, K.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; Debra, D.; Deelman, E.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Duncan, J.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gabel, M.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Galloway, D. K.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garufi, F.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; Gonzlez, G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J. -M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, W.; Kim, W. S.; Kim, Y. -M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krmer, C.; Kringel, V.; Krishnan, B.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Luck, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Hernandez, I. Magana; Magana-Sandoval, F.; Zertuche, L. Magaa; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markakis, C.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mayani, R.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Prrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Ramirez, K. E.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosinska, D.; Ross, M. P.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Rynge, M.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schoenbeck, A.; Schoenbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Taracchini, A.; Taylor, J. A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Tayra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahi, K.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; Van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasuth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, M.; Wang, Y. -F.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, K. W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zanolin, M.; Zelenova, T.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y. -H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; Steeghs, D.; Wang, L.
2017-01-01
We present the results of a semicoherent search for continuous gravitational waves from the low-mass X-ray binary Scorpius X-1, using data from the first Advanced LIGO observing run. The search method uses details of the modeled, parametrized continuous signal to combine coherently data separated by
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, E.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, E.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bejger, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Chen, Y; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, E.; Clark, J. A.; Cleva, E.; Coccia, E.; Cohadon, P. -E; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fenyvesi, E.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garunfi, E.; Gaur, G.; Gehrels, N.; Gemme, G.; Geng, P.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, R.G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jian, L.; Jimenez-Forteza, E.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kusunchoo, N.; Kim, Chi-Woong; Kim, Chunglee; Kim, J.; Kim, K.; Kim, Namjun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzar, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Lewis, J. B.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Luck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Zertuche, L. Magana; Magee, R. M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, E.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, E.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A. L.; Miller, B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nedkova, K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Deill, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, E.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passahieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Perri, L. M.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Proxhorov, L.; Puncken, O.; Punturo, M.; Puppo, P.; Purrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, E. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Rizzo, D.M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Rudiger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O. E. S.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schonbecx, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shaltevi, M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Toxmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.G.; van den Brand, J. E. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heuningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, E.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yablong, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.
2016-01-01
We report here the non-detection of gravitational waves from the merger of binary-neutron star systems and neutron star-black hole systems during the first observing run of the Advanced Laser Interferometer Gravitational-wave Observatory (LIGO). In particular, we searched for gravitational-wave
5-HTTLPR polymorphism and anxious preoccupation in early breast cancer patients
International Nuclear Information System (INIS)
Schillani, Giulia; Era, Daniel; Cristante, Tania; Mustacchi, Giorgio; Richiardi, Martina; Grassi, Luigi; Giraldi, Tullio
2012-01-01
Difficulties in coping with cancer, and the accompanying anxious and depressive symptoms, have been shown to affect the mood and the quality of life in breast cancer patients. 5-Hydroxytryptamine Transporter Gene-linked Polymorphic Region (5-HTTLPR) functional polymorphism of serotonin transporter has been shown to influence the adaptation to stressful life events. The aim of this prospective study was therefore to examine the association of 5-HTTLPR with the mental adaptation to cancer diagnosis and treatment. Forty eight consecutive patients with early mammary carcinoma were evaluated at enrolment and at follow up after one and three months. The patients were characterized psychometrically using the Hospital Anxiety and Depression Scale (HADS) and the Mini-Mental Adjustment to Cancer Scale (Mini-MAC); 5-HTTLPR allelic variants were determined using PCR-based techniques. In women with early breast cancer, the mental adaptation to the disease was associated with high scores of avoidance and anxious preoccupation of Mini-MAC, which decreased with time at follow up. Anxious preoccupation decreased with time less in patients with the S/S and S/L genetic variant of 5-HTTLPR as compared with the L/L carriers (p=0.023), indicating gene - environment interactions. These results indicate that the characterization of 5-HTTLPR allows the identification of breast cancer patients in greater risk of mental suffering, for which specific intervention may be focused; in case of drug therapy, they provide indications for the choice of most appropriate agent in a pharmacogenetic perspective
First Search for Gravitational Waves from Known Pulsars with Advanced LIGO
Energy Technology Data Exchange (ETDEWEB)
Abbott, B. P.; Abbott, R.; Adhikari, R. X. [LIGO, California Institute of Technology, Pasadena, CA 91125 (United States); Abbott, T. D. [Louisiana State University, Baton Rouge, LA 70803 (United States); Abernathy, M. R. [American University, Washington, DC 20016 (United States); Acernese, F. [Università di Salerno, Fisciano, I-84084 Salerno (Italy); Ackley, K. [University of Florida, Gainesville, FL 32611 (United States); Adams, C. [LIGO Livingston Observatory, Livingston, LA 70754 (United States); Adams, T. [Laboratoire d’Annecy-le-Vieux de Physique des Particules (LAPP), Université Savoie Mont Blanc, CNRS/IN2P3, F-74941 Annecy-le-Vieux (France); Addesso, P. [University of Sannio at Benevento, I-82100 Benevento, Italy and INFN, Sezione di Napoli, I-80100 Napoli (Italy); Adya, V. B.; Affeldt, C.; Allen, B. [Albert-Einstein-Institut, Max-Planck-Institut für Gravitationsphysik, D-30167 Hannover (Germany); Agathos, M.; Agatsuma, K. [Nikhef, Science Park, 1098 XG Amsterdam (Netherlands); Aggarwal, N. [LIGO, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Aguiar, O. D. [Instituto Nacional de Pesquisas Espaciais, 12227-010 São José dos Campos, São Paulo (Brazil); Aiello, L. [INFN, Gran Sasso Science Institute, I-67100 L’Aquila (Italy); Ain, A. [Inter-University Centre for Astronomy and Astrophysics, Pune 411007 (India); Ajith, P. [International Centre for Theoretical Sciences, Tata Institute of Fundamental Research, Bengaluru 560089 (India); Collaboration: LIGO Scientific Collaboration and Virgo Collaboration; and others
2017-04-10
We present the result of searches for gravitational waves from 200 pulsars using data from the first observing run of the Advanced LIGO detectors. We find no significant evidence for a gravitational-wave signal from any of these pulsars, but we are able to set the most constraining upper limits yet on their gravitational-wave amplitudes and ellipticities. For eight of these pulsars, our upper limits give bounds that are improvements over the indirect spin-down limit values. For another 32, we are within a factor of 10 of the spin-down limit, and it is likely that some of these will be reachable in future runs of the advanced detector. Taken as a whole, these new results improve on previous limits by more than a factor of two.
First Search for Gravitational Waves from Known Pulsars with Advanced LIGO
International Nuclear Information System (INIS)
Abbott, B. P.; Abbott, R.; Adhikari, R. X.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adya, V. B.; Affeldt, C.; Allen, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.
2017-01-01
We present the result of searches for gravitational waves from 200 pulsars using data from the first observing run of the Advanced LIGO detectors. We find no significant evidence for a gravitational-wave signal from any of these pulsars, but we are able to set the most constraining upper limits yet on their gravitational-wave amplitudes and ellipticities. For eight of these pulsars, our upper limits give bounds that are improvements over the indirect spin-down limit values. For another 32, we are within a factor of 10 of the spin-down limit, and it is likely that some of these will be reachable in future runs of the advanced detector. Taken as a whole, these new results improve on previous limits by more than a factor of two.
Aasi, J.; Abadie, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Accadia, T.; Adams, C.; Adams, T.; Adhikari, R. X.;
2014-01-01
We report on an all-sky search for periodic gravitational waves in the frequency range 50-1000 Hertz with the first derivative of frequency in the range -8.9 × 10(exp -10) Hertz per second to zero in two years of data collected during LIGO's fifth science run. Our results employ a Hough transform technique, introducing a chi(sup 2) test and analysis of coincidences between the signal levels in years 1 and 2 of observations that offers a significant improvement in the product of strain sensitivity with compute cycles per data sample compared to previously published searches. Since our search yields no surviving candidates, we present results taking the form of frequency dependent, 95% confidence upper limits on the strain amplitude h(sub 0). The most stringent upper limit from year 1 is 1.0 × 10(exp -24) in the 158.00-158.25 Hertz band. In year 2, the most stringent upper limit is 8.9 × 10(exp -25) in the 146.50-146.75 Hertz band. This improved detection pipeline, which is computationally efficient by at least two orders of magnitude better than our flagship Einstein@Home search, will be important for 'quicklook' searches in the Advanced LIGO and Virgo detector era.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fong, H.; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, R.G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, A; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Nam-Gyu; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson-Moore, P.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Bakel, N.; van Beuzekom, M.G.; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wesels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.
2016-01-01
This article provides supplemental information for a Letter reporting the rate of (BBH) coalescences inferred from 16 days of coincident Advanced LIGO observations surrounding the transient (GW) signal GW150914. In that work we reported various rate estimates whose 90% confidence intervals fell in
Directory of Open Access Journals (Sweden)
Molin Liu
2017-07-01
Full Text Available About 0.4 s after the Laser Interferometer Gravitational-Wave Observatory (LIGO detected a transient gravitational-wave (GW signal GW150914, the Fermi Gamma-ray Burst Monitor (GBM also found a weak electromagnetic transient (GBM transient 150914. Time and location coincidences favor a possible association between GW150904 and GBM transient 150914. Under this possible association, we adopt Fermi's electromagnetic (EM localization and derive constraints on possible violations of the Weak Equivalence Principle (WEP from the observations of two events. Our calculations are based on four comparisons: (1 The first is the comparison of the initial GWs detected at the two LIGO sites. From the different polarizations of these initial GWs, we obtain a limit on any difference in the parametrized post-Newtonian (PPN parameter Δγ≲10−10. (2 The second is a comparison of GWs and possible EM waves. Using a traditional super-Eddington accretion model for GBM transient 150914, we again obtain an upper limit Δγ≲10−10. Compared with previous results for photons and neutrinos, our limits are five orders of magnitude stronger than those from PeV neutrinos in blazar flares, and seven orders stronger than those from MeV neutrinos in SN1987A. (3 The third is a comparison of GWs with different frequencies in the range [35 Hz, 250 Hz]. (4 The fourth is a comparison of EM waves with different energies in the range [1 keV, 10 MeV]. These last two comparisons lead to an even stronger limit, Δγ≲10−8. Our results highlight the potential of multi-messenger signals exploiting different emission channels to strengthen existing tests of the WEP.
Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions
International Nuclear Information System (INIS)
Churilov, S.S.; Joshi, Y.N.
2001-01-01
The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)
Binary Black Hole Mergers from Globular Clusters: Implications for Advanced LIGO.
Rodriguez, Carl L; Morscher, Meagan; Pattabiraman, Bharath; Chatterjee, Sourav; Haster, Carl-Johan; Rasio, Frederic A
2015-07-31
The predicted rate of binary black hole mergers from galactic fields can vary over several orders of magnitude and is extremely sensitive to the assumptions of stellar evolution. But in dense stellar environments such as globular clusters, binary black holes form by well-understood gravitational interactions. In this Letter, we study the formation of black hole binaries in an extensive collection of realistic globular cluster models. By comparing these models to observed Milky Way and extragalactic globular clusters, we find that the mergers of dynamically formed binaries could be detected at a rate of ∼100 per year, potentially dominating the binary black hole merger rate. We also find that a majority of cluster-formed binaries are more massive than their field-formed counterparts, suggesting that Advanced LIGO could identify certain binaries as originating from dense stellar environments.
International Nuclear Information System (INIS)
D'Anna, J.A.; Tobey, R.A.
1989-01-01
Previous investigations showed that inhibition of DNA synthesis by hydroxyurea, aphidicolin, or 5-fluorodeoxyuridine produced large changes in the composition and nucleosome repeat lengths of bulk chromatin. There the authors report results of investigations to determine whether the changes in nucleosome repeat lengths might be localized in the initiated replicons, as postulated. In most experiments, Chinese hamster (line CHO) cells were synchronized in G1, or they were synchronized in early S phase by allowing G1 cells to enter S phase in medium containing 1 mM hydroxyurea or 5 μg mL -1 aphidicolin, a procedure believed to produce an accumulation of initiated replicons that arise from normally early replicating DNA. Measurements of nucleosome repeat lengths of bulk chromatin, the early replicating unexpressed metallothionein II (MTII) gene region, and a later replicating repeated sequence indicate that the changes in repeat lengths occur preferentially in the early replicating MTII gene region as G1 cells enter and become synchronized in early S phase. During that time, the MTII gene region is not replicated nor is there any evidence for induction of MTII messenger RNA. Thus, the results are consistent with the hypothesis that changes in chromatin structure occur preferentially in the early replicating (presumably initiated) replicons at initiation or that changes in chromatin structure can precede replication during inhibition of DNA synthesis. The shortened repeat lengths that precede MTII replication are, potentially, reversible, because they become elongated when the synchronized early S-phase cells are released to resume cell cycle progression
Accuracy of Binary Black Hole Waveform Models for Advanced LIGO
Kumar, Prayush; Fong, Heather; Barkett, Kevin; Bhagwat, Swetha; Afshari, Nousha; Chu, Tony; Brown, Duncan; Lovelace, Geoffrey; Pfeiffer, Harald; Scheel, Mark; Szilagyi, Bela; Simulating Extreme Spacetimes (SXS) Team
2016-03-01
Coalescing binaries of compact objects, such as black holes and neutron stars, are the primary targets for gravitational-wave (GW) detection with Advanced LIGO. Accurate modeling of the emitted GWs is required to extract information about the binary source. The most accurate solution to the general relativistic two-body problem is available in numerical relativity (NR), which is however limited in application due to computational cost. Current searches use semi-analytic models that are based in post-Newtonian (PN) theory and calibrated to NR. In this talk, I will present comparisons between contemporary models and high-accuracy numerical simulations performed using the Spectral Einstein Code (SpEC), focusing at the questions: (i) How well do models capture binary's late-inspiral where they lack a-priori accurate information from PN or NR, and (ii) How accurately do they model binaries with parameters outside their range of calibration. These results guide the choice of templates for future GW searches, and motivate future modeling efforts.
Optimally setting up directed searches for continuous gravitational waves in Advanced LIGO O1 data
Ming, Jing; Papa, Maria Alessandra; Krishnan, Badri; Prix, Reinhard; Beer, Christian; Zhu, Sylvia J.; Eggenstein, Heinz-Bernd; Bock, Oliver; Machenschalk, Bernd
2018-02-01
In this paper we design a search for continuous gravitational waves from three supernova remnants: Vela Jr., Cassiopeia A (Cas A) and G347.3. These systems might harbor rapidly rotating neutron stars emitting quasiperiodic gravitational radiation detectable by the advanced LIGO detectors. Our search is designed to use the volunteer computing project Einstein@Home for a few months and assumes the sensitivity and duty cycles of the advanced LIGO detectors during their first science run. For all three supernova remnants, the sky positions of their central compact objects are well known but the frequency and spin-down rates of the neutron stars are unknown which makes the searches computationally limited. In a previous paper we have proposed a general framework for deciding on what target we should spend computational resources and in what proportion, what frequency and spin-down ranges we should search for every target, and with what search setup. Here we further expand this framework and apply it to design a search directed at detecting continuous gravitational wave signals from the most promising three supernova remnants identified as such in the previous work. Our optimization procedure yields broad frequency and spin-down searches for all three objects, at an unprecedented level of sensitivity: The smallest detectable gravitational wave strain h0 for Cas A is expected to be 2 times smaller than the most sensitive upper limits published to date, and our proposed search, which was set up and ran on the volunteer computing project Einstein@Home, covers a much larger frequency range.
Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton
International Nuclear Information System (INIS)
Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing
2003-01-01
The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)
Binary Black Hole Mergers in the First Advanced LIGO Observing Run
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, F.; Camp, J. B.;
2016-01-01
The first observational run of the Advanced LIGO detectors, from September 12, 2015 to January 19, 2016, saw the first detections of gravitational waves from binary black hole mergers. In this paper we present full results from a search for binary black hole merger signals with total masses up to 100M solar mass and detailed implications from our observations of these systems. Our search, based on general-relativistic models of gravitational wave signals from binary black hole systems, unambiguously identified two signals, GW150914 and GW151226, with a significance of greater than 5 alpha over the observing period. It also identified a third possible signal, LVT151012, with substantially lower significance, which has a 87 probability of being of astrophysical origin. We provide detailed estimates of the parameters of the observed systems. Both GW150914 and GW151226 provide an unprecedented opportunity to study the two-body motion of a compact-object binary in the large velocity, highly nonlinear regime. We do not observe any deviations from general relativity, and place improved empirical bounds on several high-order post-Newtonian coefficients. From our observations we infer stellar-mass binary black hole merger rates lying in the range 9-240 Gpc-3 yr-1. These observations are beginning to inform astrophysical predictions of binary black hole formation rates, and indicate that future observing runs of the Advanced detector network will yield many more gravitational wave detections.
Binary Black Hole Mergers in the First Advanced LIGO Observing Run
Directory of Open Access Journals (Sweden)
2016-10-01
Full Text Available The first observational run of the Advanced LIGO detectors, from September 12, 2015 to January 19, 2016, saw the first detections of gravitational waves from binary black hole mergers. In this paper, we present full results from a search for binary black hole merger signals with total masses up to 100M_{⊙} and detailed implications from our observations of these systems. Our search, based on general-relativistic models of gravitational-wave signals from binary black hole systems, unambiguously identified two signals, GW150914 and GW151226, with a significance of greater than 5σ over the observing period. It also identified a third possible signal, LVT151012, with substantially lower significance and with an 87% probability of being of astrophysical origin. We provide detailed estimates of the parameters of the observed systems. Both GW150914 and GW151226 provide an unprecedented opportunity to study the two-body motion of a compact-object binary in the large velocity, highly nonlinear regime. We do not observe any deviations from general relativity, and we place improved empirical bounds on several high-order post-Newtonian coefficients. From our observations, we infer stellar-mass binary black hole merger rates lying in the range 9–240 Gpc^{-3} yr^{-1}. These observations are beginning to inform astrophysical predictions of binary black hole formation rates and indicate that future observing runs of the Advanced detector network will yield many more gravitational-wave detections.
Energy Technology Data Exchange (ETDEWEB)
Blackburn, L.; Camp, J. [NASA/Goddard Space Flight Center, Greenbelt, MD (United States); Briggs, M. S.; Connaughton, V.; Jenke, P. [University of Alabama in Huntsville, Huntsville, AL (United States); Christensen, N. [Carleton College, Northfield, MN (United States); Remillard, R. A. [Massachussetts Institute of Technology, Cambridge, MA (United States); Veitch, J. [University of Birmingham, Birmingham (United Kingdom)
2015-03-15
We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15–20%.
Blackburn, L.; Briggs, M. S.; Camp, J.; Christensen, N.; Connaughton, V.; Jenke, P.; Remillard, R. A.; Veitch, J.
2015-01-01
We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15-20 percent.
International Nuclear Information System (INIS)
Powell, Jade; Heng, Ik Siong; Torres-Forné, Alejandro; Font, José A; Lynch, Ryan; Trifirò, Daniele; Cuoco, Elena; Cavaglià, Marco
2017-01-01
The data taken by the advanced LIGO and Virgo gravitational-wave detectors contains short duration noise transients that limit the significance of astrophysical detections and reduce the duty cycle of the instruments. As the advanced detectors are reaching sensitivity levels that allow for multiple detections of astrophysical gravitational-wave sources it is crucial to achieve a fast and accurate characterization of non-astrophysical transient noise shortly after it occurs in the detectors. Previously we presented three methods for the classification of transient noise sources. They are Principal Component Analysis for Transients (PCAT), Principal Component LALInference Burst (PC-LIB) and Wavelet Detection Filter with Machine Learning (WDF-ML). In this study we carry out the first performance tests of these algorithms on gravitational-wave data from the Advanced LIGO detectors. We use the data taken between the 3rd of June 2015 and the 14th of June 2015 during the 7th engineering run (ER7), and outline the improvements made to increase the performance and lower the latency of the algorithms on real data. This work provides an important test for understanding the performance of these methods on real, non stationary data in preparation for the second advanced gravitational-wave detector observation run, planned for later this year. We show that all methods can classify transients in non stationary data with a high level of accuracy and show the benefits of using multiple classifiers. (paper)
A novel concept for increasing the peak sensitivity of LIGO by detuning the arm cavities
International Nuclear Information System (INIS)
Hild, S; Freise, A
2007-01-01
We introduce a concept that uses detuned arm cavities to increase the shot-noise-limited sensitivity of LIGO without increasing the light power inside the arm cavities. Numerical simulations show an increased sensitivity between 125 and 400 Hz, with a maximal improvement of about 80% around 225 Hz, while the sensitivity above 400 Hz is decreased. Furthermore, our concept is found to give a sensitivity similar to that of a conventional RSE configuration with a signal-recycling mirror of moderate reflectivity. In the near future detuned arm cavities might be a beneficial alternative to RSE, due to the potentially less hardware-intensive implementation of the proposed concept
Localized AdS_{5}×S^{5} Black Holes.
Dias, Óscar J C; Santos, Jorge E; Way, Benson
2016-10-07
According to heuristic arguments, global AdS_{5}×S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.
Folded three-spin string solutions in AdS5 x S5
International Nuclear Information System (INIS)
Ryang Shijong
2004-01-01
We construct a spinning closed string solution in AdS 5 x S 5 which is folded in the radial direction and has two equal spins in AdS 5 and a spin in S 5 . The energy expression of the three-spin solution specified by the folding and winding numbers for the small S 5 spin shows a logarithmic behavior and a one-third power behavior of the large total AdS 5 spin, in the long string and in the short string located near the boundary of AdS 5 respectively. It exhibits the non-regular expansion in the 't Hooft coupling constant, while it takes the regular one when the S 5 spin becomes large. (author)
Calderón Bustillo, Juan; Salemi, Francesco; Dal Canton, Tito; Jani, Karan P.
2018-01-01
The sensitivity of gravitational wave searches for binary black holes is estimated via the injection and posterior recovery of simulated gravitational wave signals in the detector data streams. When a search reports no detections, the estimated sensitivity is then used to place upper limits on the coalescence rate of the target source. In order to obtain correct sensitivity and rate estimates, the injected waveforms must be faithful representations of the real signals. Up to date, however, injected waveforms have neglected radiation modes of order higher than the quadrupole, potentially biasing sensitivity and coalescence rate estimates. In particular, higher-order modes are known to have a large impact in the gravitational waves emitted by intermediate-mass black holes binaries. In this work, we evaluate the impact of this approximation in the context of two search algorithms run by the LIGO Scientific Collaboration in their search for intermediate-mass black hole binaries in the O1 LIGO Science Run data: a matched filter-based pipeline and a coherent unmodeled one. To this end, we estimate the sensitivity of both searches to simulated signals for nonspinning binaries including and omitting higher-order modes. We find that omission of higher-order modes leads to biases in the sensitivity estimates which depend on the masses of the binary, the search algorithm, and the required level of significance for detection. In addition, we compare the sensitivity of the two search algorithms across the studied parameter space. We conclude that the most recent LIGO-Virgo upper limits on the rate of coalescence of intermediate-mass black hole binaries are conservative for the case of highly asymmetric binaries. However, the tightest upper limits, placed for nearly equal-mass sources, remain unchanged due to the small contribution of higher modes to the corresponding sources.
MASTER Optical Detection of the First LIGO/Virgo Neutron Star Binary Merger GW170817
Lipunov, V. M.; Gorbovskoy, E.; Kornilov, V. G.; . Tyurina, N.; Balanutsa, P.; Kuznetsov, A.; Vlasenko, D.; Kuvshinov, D.; Gorbunov, I.; Buckley, D. A. H.; Krylov, A. V.; Podesta, R.; Lopez, C.; Podesta, F.; Levato, H.; Saffe, C.; Mallamachi, C.; Potter, S.; Budnev, N. M.; Gress, O.; Ishmuhametova, Yu.; Vladimirov, V.; Zimnukhov, D.; Yurkov, V.; Sergienko, Yu.; Gabovich, A.; Rebolo, R.; Serra-Ricart, M.; Israelyan, G.; Chazov, V.; Wang, Xiaofeng; Tlatov, A.; Panchenko, M. I.
2017-11-01
Following the discovery of the gravitational-wave source GW170817 by three Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo antennae (Abbott et al., 2017a), the MASTER Global Robotic Net telescopes obtained the first image of the NGC 4993 host galaxy. An optical transient, MASTER OTJ130948.10-232253.3/SSS17a was later found, which appears to be a kilonova resulting from the merger of two neutron stars (NSs). Here we describe this independent detection and photometry of the kilonova made in white light, and in B, V, and R filters. We note that the luminosity of this kilonova in NGC 4993 is very close to those measured for other kilonovae possibly associated with gamma-ray burst (GRB) 130603 and GRB 080503.
The Transient High-Energy Sky and Early Universe Surveyor (THESEUS)
Amati, L.; O'Brien, P.; Goetz, D.; Tenzer, C.; Bozzo, E.
2017-10-01
The Transient High Energy Sky and Early Universe Surveyor (THESEUS) is a mission concept developed by a large international collaboration aimed at exploiting Gamma-Ray Bursts for investigating the early Universe. The main scientic objectives of THESEUS, currently under evaluation by ESA within the selection process for next M5 mission, include: investigating the star formation rate and metallicity evolution of the ISM and IGM up to redshift 10, detecting the first generation (pop III) of stars, studying the sources and physics of re-ionization, detecting the faint end of galaxies luminosity function. These goals will be achieved through a unique combination of instruments allowing GRB detection and arcmin localization over a broad FOV (more than 1sr) and an energy band extending from several MeVs down to 0.3 keV with unprecedented sensitivity, as well as on-board prompt (few minutes) follow-up with a 0.7m class IR telescope with both imaging and spectroscopic capabilities. Such instrumentation will also allow THESEUS to perform a monitoring of the X-ray sky with unprecedented sensitivity, which will provide a perfect service and sinergy to next generation multi-wavalength (e.g., E-ELT, SKA, CTA, ATHENA) and multi-messenger (aLIGO, aVIRGO, eLISA, ET, neutrino detectors, ...) facilities.
Soares-Santos, M.; Kessler, R.; Burger, E.; Annis, J.; Brout, D.; Buckley-Geer, E.; Chen, H.; Cowperthwaite, P. S.; Diehl, H.T.; Doctor, Z.;
2016-01-01
We report the results of a deep search for an optical counterpart to the gravitational wave (GW) event GW150914, the first trigger from the Advanced LIGO GW detectors. We used the Dark Energy Camera (DECam) to image a 102 deg(exp 2) area, corresponding to 38% of the initial trigger high-probability sky region and to 11% of the revised high-probability region. We observed in the i and z bands at 4-5, 7, and 24 days after the trigger. The median 5(sigma) point-source limiting magnitudes of our search images are i = 22.5 and z = 21.8 mag. We processed the images through a difference-imaging pipeline using templates from pre-existing Dark Energy Survey data and publicly available DECam data. Due to missing template observations and other losses, our effective search area subtends 40 deg(exp 2), corresponding to a 12% total probability in the initial map and 3% in the final map. In this area, we search for objects that decline significantly between days 4-5 and day 7, and are undetectable by day 24, finding none to typical magnitude limits of i = 21.5, 21.1, 20.1 for object colors (i-z)= 1, 0, -1, respectively. Our search demonstrates the feasibility of a dedicated search program with DECam and bodes well for future research in this emerging field.
Foundations of the AdS5 x S5 superstring: I
International Nuclear Information System (INIS)
Arutyunov, Gleb; Frolov, Sergey
2009-01-01
We review the recent advances towards finding the spectrum of the AdS 5 x S 5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing literature. The present part I deals with foundations of classical string theory in AdS 5 x S 5 , light-cone perturbative quantization and the derivation of the exact light-cone world-sheet scattering matrix
The AdS5xS5 superstring worldsheet S matrix and crossing symmetry
International Nuclear Information System (INIS)
Janik, Romuald A.
2006-01-01
An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS 5 xS 5 superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS 5 xS 5 superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of the parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane
GCN capabilities and status, and the incorporation of LIGO/Virgo
Barthelmy, Scott
2016-03-01
The Gamma-ray Coordinates Network / Transient Astronomy Network (GCN/TAN) is a single-point source for all transient astronomy notification. It collects the astrophysical transients from the missions (space-based and nearly all ground-based), puts them into a standard format, and distributes them to whomever wants to receive them. This is all done autonomously (completely autonomous within GCN/TAN, and almost always autonomously within the producer end of operations). This automation means minimal time delays (dependent on the internet email protocol and the number of hops, both of which are out of the control of GCN/TAN). The LIGO-VIRGO Collaboration (LVC) Notices are now implemented in the GCN/TAN system. During the proprietary phase, the recipients must have an MoU with LVC and LVC must authorize GCN to distribute LVC Notices to each given MoU follow-up observer. In addition to Notices, there are the GCN Circulars, which are prose-style reports of follow-up observations made and results obtains. During the LVC Proprietary phase there are also the GCN LVC Circulars, which also require authorization from LVC to join the LVC Circulars.
A Multi-Step Approach to Assessing LIGO Test Mass Coatings
Glover, Lamar; Goff, Michael; Linker, Seth; Neilson, Joshua; Patel, Jignesh; Pinto, Innocenzo; Principe, Maria; Villarama, Ethan; Arriaga, Eddy; Barragan, Erik; Chao, Shiuh; Daneshgaran, Lara; DeSalvo, Riccardo; Do, Eric; Fajardo, Cameron
2018-02-01
Photographs of the LIGO Gravitational Wave detector mirrors illuminated by the standing beam were analyzed with an astronomical software tool designed to identify stars within images, which extracted hundreds of thousands of point-like scatterers uniformly distributed across the mirror surface, likely distributed through the depth of the coating layers. The sheer number of the observed scatterers implies a fundamental, thermodynamic origin during deposition or processing. If identified as crystallites, these scatterers would be a possible source of the mirror dissipation and thermal noise, which limit the sensitivity of observatories to Gravitational Waves. In order to learn more about the composition and location of the detected scatterers, a feasibility study is underway to develop a method that determines the location of the scatterers by producing a complete mapping of scatterers within test samples, including their depth distribution, optical amplitude distribution, and lateral distribution. Also, research is underway to accurately identify future materials and/or coating methods that possess the largest possible mechanical quality factor (Q). Current efforts propose a new experimental approach that will more precisely measure the Q of coatings by depositing them onto 100 nm Silicon Nitride membranes.
Jordanian deformations of the AdS5×S5 superstring
Kawaguchi, I.; Matsumoto, T.; Yoshida, K
2014-01-01
We consider Jordanian deformations of the AdS_5xS^5 superstring action. The deformations correspond to non-standard q-deformation. In particular, it is possible to perform partial deformations, for example, only for the S^5 part. Then the classical action and the Lax pair are constructed with a
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Searching for gravitational waves associated with gamma-ray bursts int 2009-2010 LIGO-Virgo data
International Nuclear Information System (INIS)
Was, M.
2011-01-01
In this thesis we present the results of the search for gravitational wave bursts associated with gamma-ray bursts in the 2009-2010 data from the LIGO-Virgo gravitational wave interferometer network. The study of gamma-ray bursts progenitors, both from the gamma-ray emission and the gravitational wave emission point of view, yields the characteristic of the sought signal: polarization, time delays, etc... This knowledge allows the construction of a data analysis method which includes the astrophysical priors on joint gravitational wave and gamma-ray emission, and moreover which is robust to non-stationary transient noises, which are present in the data. The lack of detection in the analyzed data yields novel observational limits on the gamma-ray burst population. (author)
Early-Years Swimming: Creating Opportunities for Adding Mathematical Capital to Under 5s
Jorgensen, Robyn
2013-01-01
Drawing on survey data from over 2000 parents, this paper explores the possibility of early-years swimming to add mathematical capital to young children. Using developmental milestones as the basis, it was found that parents reported significantly earlier achievement on many of these milestones. Such data suggest that the early years swim…
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.;
2016-01-01
This article provides supplemental information for a Letter reporting the rate of (BBH) coalescences inferred from 16 days of coincident Advanced LIGO observations surrounding the transient (GW) signal GW150914. In that work wereported various rate estimates whose 90% confidence intervals fell in the range 2600 Gpc(exp -3) yr(exp -1). Here we givedetails on our method and computations, including information about our search pipelines, a derivation of ourlikelihood function for the analysis, a description of the astrophysical search trigger distribution expected frommerging BBHs, details on our computational methods, a description of the effects and our model for calibrationuncertainty, and an analytic method for estimating our detector sensitivity, which is calibrated to our measurements.
International Nuclear Information System (INIS)
Arun, K.G.; Iyer, Bala R; Sathyaprakash, B.S.; Sundararajan, Pranesh A
2005-01-01
We revisit the problem of parameter estimation of gravitational-wave chirp signals from inspiralling nonspinning compact binaries in the light of the recent extension of the post-Newtonian (PN) phasing formula to order (v/c) 7 beyond the leading Newtonian order. We study in detail the implications of higher post-Newtonian orders from 1PN up to 3.5PN in steps of 0.5PN (∼v/c), and examine their convergence. In both initial and advanced detectors the estimation of the chirp mass (M) and symmetric mass ratio (η) improve at higher PN orders but oscillate with every half-a-PN order. In initial LIGO, for a 10M · -10M · binary at a signal-to-noise ratio (SNR) of 10, the improvement in the estimation of M (η) at 3.5PN relative to 2PN is ∼19% (52%). We compare parameter estimation in different detectors and assess their relative performance in two different ways: at a fixed SNR, with the aim of understanding how the bandwidth improves parameter estimation, and for a fixed source, to gauge the importance of sensitivity. Errors in parameter estimation at a fixed SNR are smaller for VIRGO than for both initial and advanced LIGO. This is because of the larger bandwidth over which it observes the signals. However, for sources at a fixed distance it is advanced LIGO that achieves the lowest errors owing to its greater sensitivity. Finally, we compute the amplitude corrections due to the 'frequency-sweep' in the Fourier domain representation of the waveform within the stationary phase approximation and discuss its implication on parameter estimation. We find that the amplitude corrections change the errors in M and η by less than 10% for initial LIGO at a signal-to-noise ratio of 10. Our analysis makes explicit the significance of higher PN order modeling of the inspiralling compact binary on parameter estimation
Quantum spectral curve for the η-deformed AdS5 × S5 superstring
Klabbers, Rob; van Tongeren, Stijn J.
2017-12-01
The spectral problem for the AdS5 ×S5 superstring and its dual planar maximally supersymmetric Yang-Mills theory can be efficiently solved through a set of functional equations known as the quantum spectral curve. We discuss how the same concepts apply to the η-deformed AdS5 ×S5 superstring, an integrable deformation of the AdS5 ×S5 superstring with quantum group symmetry. This model can be viewed as a trigonometric version of the AdS5 ×S5 superstring, like the relation between the XXZ and XXX spin chains, or the sausage and the S2 sigma models for instance. We derive the quantum spectral curve for the η-deformed string by reformulating the corresponding ground-state thermodynamic Bethe ansatz equations as an analytic Y system, and map this to an analytic T system which upon suitable gauge fixing leads to a Pμ system - the quantum spectral curve. We then discuss constraints on the asymptotics of this system to single out particular excited states. At the spectral level the η-deformed string and its quantum spectral curve interpolate between the AdS5 ×S5 superstring and a superstring on "mirror" AdS5 ×S5, reflecting a more general relationship between the spectral and thermodynamic data of the η-deformed string. In particular, the spectral problem of the mirror AdS5 ×S5 string, and the thermodynamics of the undeformed AdS5 ×S5 string, are described by a second rational limit of our trigonometric quantum spectral curve, distinct from the regular undeformed limit.
Children’s early helping in action: Piagetian developmental theory and early prosocial behavior
Hammond, Stuart I.
2014-01-01
After a brief overview of recent research on early helping, outlining some central problems, and issues, this paper examines children’s early helping through the lens of Piagetian moral and developmental theory, drawing on Piaget’s “Moral Judgment of the Child” (Piaget, 1932/1997), “Play, Dreams, and Imitation in Childhood” (Piaget, 1945/1951), and the “Grasp of Consciousness” (Piaget, 1976). Piaget refers to a level of moral development in action that precedes heteronomous and autonomous moral reasoning. This action level allows children to begin to interact with people and objects. In his later work, Piaget explores the gradual construction of understanding from this activity level. Taken together, these elements of Piagetian theory provide a promising conceptual framework for understanding the development of early helping. PMID:25101027
Adenovirus type 5 DNA-protein complexes from formaldehyde cross-linked cells early after infection
International Nuclear Information System (INIS)
Spector, David J.; Johnson, Jeffrey S.; Baird, Nicholas L.; Engel, Daniel A.
2003-01-01
We report here the properties of viral DNA-protein complexes that purify with cellular chromatin following formaldehyde cross-linking of intact cells early after infection. The cross-linked viral DNA fractionated into shear-sensitive (S) and shear- resistant (R) components that were separable by sedimentation, which allowed independent characterization. The R component had the density and sedimentation properties expected for DNA-protein complexes and contained intact viral DNA. It accounted for about 50% of the viral DNA recovered at 1.5 h after infection but less than 20% by 4.5 h. The proportion of R component was independent of multiplicity of infection, even at less than one particle per cell. Viral hexon and protein VII, but not protein VI, were detected in the fractions containing the R component. These properties are consistent with those of partially uncoated virions associated with the nuclear envelope. A substantial proportion of the S component viral DNA had the same density as cellular chromatin. Protein VII was the most abundant viral protein present in gradient fractions that contained the S component. Complexes containing USF transcription factor cross-linked to the adenovirus major late promoter were detected by viral chromatin immunoprecipitation of the fractions containing S component. The S component probably contained uncoated nuclear viral DNA that assembles into early viral transcription complexes
Cao, Liang; Lu, Youjun; Zhao, Yuetong
2018-03-01
Understanding the host galaxy properties of stellar binary black hole (SBBH) mergers is important for revealing the origin of the SBBH gravitational wave sources detected by advanced LIGO and helpful for identifying their electromagnetic counterparts. Here, we present a comprehensive analysis of the host galaxy properties of SBBHs by implementing semi-analytical recipes for SBBH formation and merger into cosmological galaxy formation model. If the time delay between SBBH formation and merger ranges from ≲ Gyr to the Hubble time, SBBH mergers at redshift z ≲ 0.3 occur preferentially in big galaxies with stellar mass M* ≳ 2 × 1010 M⊙ and metallicities Z peaking at ˜0.6 Z⊙. However, the host galaxy stellar mass distribution of heavy SBBH mergers (M•• ≳ 50 M⊙) is bimodal with one peak at ˜109 M⊙ and the other peak at ˜2 × 1010 M⊙. The contribution fraction from host galaxies with Z ≲ 0.2 Z⊙ to heavy mergers is much larger than that to less heavy mergers. If SBBHs were formed in the early Universe (e.g. z > 6), their mergers detected at z ≲ 0.3 occur preferentially in even more massive galaxies with M* > 3 × 1010 M⊙ and in galaxies with metallicities mostly ≳ 0.2 Z⊙ and peaking at Z ˜ 0.6 Z⊙, due to later cosmic assembly and enrichment of their host galaxies. SBBH mergers at z ≲ 0.3 mainly occur in spiral galaxies, but the fraction of SBBH mergers that occur in elliptical galaxies can be significant if those SBBHs were formed in the early Universe; and about two-thirds of those mergers occur in the central galaxies of dark matter haloes. We also present results on the host galaxy properties of SBBH mergers at higher redshift.
Inhibition of Early Stages of HIV-1 Assembly by INI1/hSNF5 Transdominant Negative Mutant S6 ▿
Cano, Jennifer; Kalpana, Ganjam V.
2011-01-01
INI1/hSNF5 is an HIV-1 integrase (IN) binding protein specifically incorporated into virions. A truncated mutant of INI1 (S6, amino acids 183 to 294) harboring the minimal IN binding Rpt1 domain potently inhibits HIV-1 particle production in a transdominant manner. The inhibition requires interaction of S6 with IN within Gag-Pol. While INI1 is a nuclear protein and harbors a masked nuclear export signal (NES), the transdominant negative mutant S6 is cytoplasmic, due to the unmasking of NES. Here, we examined the effects of subcellular localization of S6 on HIV-1 inhibition and further investigated the stages of assembly that are affected. We found that targeting a nuclear localization signal-containing S6 variant [NLS-S6(Rpt1)] to the nucleoplasm (but not to the nucleolus) resulted in complete reversal of inhibition of particle production. Electron microscopy indicated that although no electron-dense particles at any stage of assembly were seen in cells expressing S6, virions were produced in cells expressing the rescue mutant NLS-S6(Rpt1) to wild-type levels. Immunofluorescence analysis revealed that p24 exhibited a diffuse pattern of localization within the cytoplasm in cells expressing S6 in contrast to accumulation along the membrane in controls. Pulse-chase analysis indicated that in S6-expressing cells, although Gag(Pr55gag) protein translation was unaffected, processing and release of p24 were defective. Together, these results indicate that expression of S6 in the cytoplasm interferes with trafficking of Gag-Pol/Gag to the membrane and causes a defective processing leading to inhibition of assembly at an early stage prior to particle formation and budding. PMID:21159874
CDKL5 and ARX mutations in males with early-onset epilepsy.
Mirzaa, Ghayda M; Paciorkowski, Alex R; Marsh, Eric D; Berry-Kravis, Elizabeth M; Medne, Livija; Alkhateeb, Asem; Grix, Art; Wirrell, Elaine C; Powell, Berkley R; Nickels, Katherine C; Burton, Barbara; Paras, Andrea; Kim, Katherine; Chung, Wendy; Dobyns, William B; Das, Soma
2013-05-01
Mutations in CDKL5 and ARX are known causes of early-onset epilepsy and severe developmental delay in males and females. Although numerous males with ARX mutations associated with various phenotypes have been reported in the literature, the majority of CDKL5 mutations have been identified in females with a phenotype characterized by early-onset epilepsy, severe global developmental delay, absent speech, and stereotypic hand movements. To date, only 10 males with CDKL5 mutations have been reported. Our retrospective study reports on the clinical, neuroimaging, and molecular findings of 18 males with early-onset epilepsy caused by either CDKL5 or ARX mutations. These 18 patients include eight new males with CDKL5 mutations and 10 with ARX mutations identified through sequence analysis of 266 and 346 males, respectively, at our molecular diagnostic laboratory. Our large dataset therefore expands on the number of reported males with CDKL5 mutations and highlights that aberrations of CDKL5 and ARX combined are an important consideration in the genetic forms of early-onset epilepsy in boys. Copyright © 2013 Elsevier Inc. All rights reserved.
2017-11-01
SABR) for Early Lung Cancer PRINCIPAL INVESTIGATOR: Billy W Loo Jr, MD PhD CONTRACTING ORGANIZATION: The Leland Stanford Junior University...Response to Stereotactic Ablative Radiotherapy (SABR) for Early Lung Cancer 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Billy W Loo Jr, MD...for early stage lung cancer in patients who are not candidates for surgery because of excessive surgical risk, and will be an important treatment option
Gravitational Waveforms in the Early Inspiral of Binary Black Hole Systems
Barkett, Kevin; Kumar, Prayush; Bhagwat, Swetha; Brown, Duncan; Scheel, Mark; Szilagyi, Bela; Simulating eXtreme Spacetimes Collaboration
2015-04-01
The inspiral, merger and ringdown of compact object binaries are important targets for gravitational wave detection by aLIGO. Detection and parameter estimation will require long, accurate waveforms for comparison. There are a number of analytical models for generating gravitational waveforms for these systems, but the only way to ensure their consistency and correctness is by comparing with numerical relativity simulations that cover many inspiral orbits. We've simulated a number of binary black hole systems with mass ratio 7 and a moderate, aligned spin on the larger black hole. We have attached these numerical waveforms to analytical waveform models to generate long hybrid gravitational waveforms that span the entire aLIGO frequency band. We analyze the robustness of these hybrid waveforms and measure the faithfulness of different hybrids with each other to obtain an estimate on how long future numerical simulations need to be in order to ensure that waveforms are accurate enough for use by aLIGO.
Zakharov, A. F.; Jovanović, P.; Borka, D.; Borka Jovanović, V.
2018-04-01
Recently, the LIGO-Virgo collaboration discovered gravitational waves and in their first publication on the subject the authors also presented a graviton mass constraint as mg advance for general relativity and Yukawa potential are different functions on eccentricity and semimajor axis, it gives an opportunity to improve current estimates of graviton mass with future observational facilities. In our considerations of an improvement potential for a graviton mass estimate we adopt a conservative strategy and assume that trajectories of bright stars and their apocenter advance will be described with general relativity expressions and it gives opportunities to improve graviton mass constraints. In contrast with our previous studies, where we present current constraints on parameters of Yukawa gravity [5] and graviton mass [6] from observations of S2 star, in the paper we express expectations to improve current constraints for graviton mass, assuming the GR predictions about apocenter shifts will be confirmed with future observations. We concluded that if future observations of bright star orbits during around fifty years will confirm GR predictions about apocenter shifts of bright star orbits it give an opportunity to constrain a graviton mass at a level around 5 × 10‑23 eV or slightly better than current estimates obtained with LIGO observations.
Lumpy AdS5× S5 black holes and black belts
International Nuclear Information System (INIS)
Dias, Óscar J.C.; Santos, Jorge E.; Way, Benson
2015-01-01
Sufficiently small Schwarzschild black holes in global AdS 5 ×S 5 are Gregory-Laflamme unstable. We construct new families of black hole solutions that bifurcate from the onset of this instability and break the full SO(6) symmetry group of the S 5 down to SO(5). These new “lumpy" solutions are labelled by the harmonics ℓ. We find evidence that the ℓ=1 branch never dominates the microcanonical/canonical ensembles and connects through a topology-changing merger to a localised black hole solution with S 8 topology. We argue that these S 8 black holes should become the dominant phase in the microcanonical ensemble for small enough energies, and that the transition to Schwarzschild black holes is first order. Furthermore, we find two branches of solutions with ℓ=2. We expect one of these branches to connect to a solution containing two localised black holes, while the other branch connects to a black hole solution with horizon topology S 4 ×S 4 which we call a “black belt”.
International Nuclear Information System (INIS)
Davis, Jonathan H.; Fairbairn, Malcolm
2017-01-01
We make projections for measuring the black hole birth rate from the diffuse supernova neutrino background (DSNB) by future neutrino experiments, and constrain the black hole merger fraction ε, when combined with information on the black hole merger rate from gravitational wave experiments such as LIGO. The DSNB originates from neutrinos emitted by all the supernovae in the Universe, and is expected to be made up of two components: neutrinos from neutron-star-forming supernovae, and a sub-dominant component at higher energies from black-hole-forming 'unnovae'. We perform a Markov Chain Monte Carlo analysis of simulated data of the DSNB in an experiment similar to Hyper-Kamiokande, focusing on this second component. Since all knowledge of the neutrino emission from unnovae comes from simulations of collapsing stars, we choose two sets of priors: one where the unnovae are well-understood and one where their neutrino emission is poorly known. By combining the black hole birth rate from the DSNB with projected measurements of the black hole merger rate from LIGO, we show that the fraction of black holes which lead to binary mergers observed today ε could be constrained to be within the range 2 ⋅ 10 −4 ≤ ε ≤ 3 ⋅ 10 −2 at 3 σ confidence, after ten years of running an experiment like Hyper-Kamiokande.
Energy Technology Data Exchange (ETDEWEB)
Davis, Jonathan H.; Fairbairn, Malcolm, E-mail: jonathan.davis@kcl.ac.uk, E-mail: malcolm.fairbairn@kcl.ac.uk [Theoretical Particle Physics and Cosmology, Department of Physics, King' s College London, London WC2R 2LS (United Kingdom)
2017-07-01
We make projections for measuring the black hole birth rate from the diffuse supernova neutrino background (DSNB) by future neutrino experiments, and constrain the black hole merger fraction ε, when combined with information on the black hole merger rate from gravitational wave experiments such as LIGO. The DSNB originates from neutrinos emitted by all the supernovae in the Universe, and is expected to be made up of two components: neutrinos from neutron-star-forming supernovae, and a sub-dominant component at higher energies from black-hole-forming 'unnovae'. We perform a Markov Chain Monte Carlo analysis of simulated data of the DSNB in an experiment similar to Hyper-Kamiokande, focusing on this second component. Since all knowledge of the neutrino emission from unnovae comes from simulations of collapsing stars, we choose two sets of priors: one where the unnovae are well-understood and one where their neutrino emission is poorly known. By combining the black hole birth rate from the DSNB with projected measurements of the black hole merger rate from LIGO, we show that the fraction of black holes which lead to binary mergers observed today ε could be constrained to be within the range 2 ⋅ 10{sup −4} ≤ ε ≤ 3 ⋅ 10{sup −2} at 3 σ confidence, after ten years of running an experiment like Hyper-Kamiokande.
Park, Jung-Ho; Chi, Heon-Cheol; Lim, In-Seub; Seong, Yun-Jeong; Park, Jihwan
2017-04-01
EEW(Earthquake Early Warning) service to the public has been officially operated by KMA (Korea Meteorological Administration) from 2015 in Korea. For the KMA's official EEW service, KIGAM has adopted ElarmS from UC Berkeley BSL and modified local magnitude relation, 1-D travel time curves and association procedures with real time waveform from about 201 seismic stations of KMA, KIGAM, KINS and KEPRI. There were two moderate size earthquakes with magnitude Ml 5.1 and Ml 5.8 close to Gyeongju city located at the southeastern part of Korea on Sep. 12. 2016. We have checked the performance of EEWS(Earthquake Early Warning System) named as TrigDB by KIGAM reviewing of these two Gyeongju earthquakes. The nearest station to epicenters of two earthquakes Ml 5.1(35.7697 N, 129.1904 E) and Ml 5.8(35.7632 N, 129.1898 E) was MKL which detected P phases in about 2.1 and 3.6 seconds after the origin times respectively. The first events were issued in 6.3 and 7.0 seconds from each origin time. Because of the unstable results on the early steps due to very few stations and unexpected automated analysis, KMA has the policy to wait for more 20 seconds for confirming the reliability. For these events KMA published EEW alarms in about 26 seconds after origin times with M 5.3 and M 5.9 respectively.
Total synthesis of (3S, 5R, 3'S, 5'R)-capsorubin
International Nuclear Information System (INIS)
Frederico, Daniel; Constantino, Mauricio G.; Donate, Paulo M.
2009-01-01
The total synthesis of enantiomerically enriched (3S, 5R, 3'S, 5'R)-capsorubin (1) by aldol condensation of (1R, 4S)-1-(4-hydroxy-1,2,2-trimethyl-cyclopentyl)ethanone (2a) and crocetindial (3) is described. An alternative, short eight-step synthesis of the optically active compound 2a (ee 89%) is also reported. (author)
Interleukin-6 inhibits early differentiation of ATDC5 chondrogenic progenitor cells.
Nakajima, Shoko; Naruto, Takuya; Miyamae, Takako; Imagawa, Tomoyuki; Mori, Masaaki; Nishimaki, Shigeru; Yokota, Shumpei
2009-08-01
Interleukin (IL)-6 is a causative agent of systemic juvenile idiopathic arthritis (sJIA), a chronic inflammatory disease complicated with severe growth impairment. Recent trials of anti-IL-6 receptor monoclonal antibody, tocilizumab, indicated that tocilizumab blocks IL-6/IL-6 receptor-mediated inflammation, and induces catch-up growth in children with sJIA. This study evaluates the effects of IL-6 on chondrogenesis by ATDC5 cells, a clonal murine chondrogenic cell line that provides an excellent model for studying endochondral ossification at growth plate. ATDC5 cells were examined for the expression of IL-6 receptor and gp130 by fluorescence-activated cell sorting analysis. Recombinant murine IL-6 was added to ATDC5 cultures to observe cell differentiation, using a quantitative RT-PCR for the chondrogenic differentiation markers type II collagen, aggrecan, and type X collagen. To block IL-6, the anti-mouse IL-6 receptor monoclonal antibody MR16-1 was added. As a result, the cells expressed IL-6 receptor and gp130. The expression of chondrogenic differentiation marker gene was reduced by IL-6, but this was abrogated by MR16-1. We conclude that IL-6 inhibits early chondrogenesis of ATDC5 cells suggesting that IL-6 may affect committed stem cells at a cellular level during chondrogenic differentiation of growth plate chondrocytes, and that IL-6 may be a cellular-level factor in growth impairment in sJIA.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...
Energy Technology Data Exchange (ETDEWEB)
Annis, J.; Soares-Santos, M.; Diehl, H. T.; Drlica-Wagner, A.; Finley, D. A.; Flaugher, B.; Frieman, J.; Herner, K. [Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Berger, E.; Cowperthwaite, P. S.; Drout, M. R. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Brout, D. [Department of Physics and Astronomy, University of Pennsylvania, Philadelphia, PA 19104 (United States); Chen, H.; Doctor, Z.; Farr, B.; Holz, D.; Kessler, R. [Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Chornock, R. [Astrophysical Institute, Department of Physics and Astronomy, Ohio University, 251B Clippinger Lab, Athens, OH 45701 (United States); Foley, R. J.; Gruendl, R. A. [Department of Astronomy, University of Illinois, 1002 W. Green Street, Urbana, IL 61801 (United States); Collaboration: DES Collaboration; and others
2016-06-01
The collapse of a stellar core is expected to produce gravitational waves (GWs), neutrinos, and in most cases a luminous supernova. Sometimes, however, the optical event could be significantly less luminous than a supernova and a direct collapse to a black hole, where the star just disappears, is possible. The GW event GW150914 was detected by the LIGO Virgo Collaboration via a burst analysis that gave localization contours enclosing the Large Magellanic Cloud (LMC). Shortly thereafter, we used DECam to observe 102 deg{sup 2} of the localization area, including 38 deg{sup 2} on the LMC for a missing supergiant search. We construct a complete catalog of LMC luminous red supergiants, the best candidates to undergo invisible core collapse, and collected catalogs of other candidates: less luminous red supergiants, yellow supergiants, blue supergiants, luminous blue variable stars, and Wolf–Rayet stars. Of the objects in the imaging region, all are recovered in the images. The timescale for stellar disappearance is set by the free-fall time, which is a function of the stellar radius. Our observations at 4 and 13 days after the event result in a search sensitive to objects of up to about 200 solar radii. We conclude that it is unlikely that GW150914 was caused by the core collapse of a relatively compact supergiant in the LMC, consistent with the LIGO Collaboration analyses of the gravitational waveform as best interpreted as a high mass binary black hole merger. We discuss how to generalize this search for future very nearby core-collapse candidates.
Annis, J.; Soares-Santos, M.; Berger, E.; Brout, D.; Chen, H.; Chornock, R.; Cowperthwaite, P. S.; Diehl, H. T.; Doctor, Z.; Cenko, S. B.
2016-01-01
The collapse of a stellar core is expected to produce gravitational waves (GWs), neutrinos, and in most cases a luminous supernova. Sometimes, however, the optical event could be significantly less luminous than a supernova and a direct collapse to a black hole, where the star just disappears, is possible. The GW event GW150914 was detected by the LIGO Virgo Collaboration via a burst analysis that gave localization contours enclosing the Large Magellanic Cloud (LMC). Shortly thereafter, we used DECam to observe 102 deg(exp.2) of the localization area,including 38 deg(exp. 2) on the LMC for a missing supergiant search. We construct a complete catalog of LMC luminous red supergiants, the best candidates to undergo invisible core collapse, and collected catalogs of other candidates:less luminous red supergiants, yellow supergiants, blue supergiants, luminous blue variable stars, and Wolf-Rayet stars. Of the objects in the imaging region, all are recovered in the images. The timescale for stellar disappearance is set by the free-fall time, which is a function of the stellar radius. Our observations at 4 and 13 days after the event result in a search sensitive to objects of up to about 200 solar radii. We conclude that it is unlikely that GW150914 was caused by the core collapse of a relatively compact supergiant in the LMC, consistent with the LIGO Collaboration analyses of the gravitational waveform as best interpreted as a high mass binary black hole merger. We discuss how to generalize this search for future very nearby core-collapse candidates.
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Directory of Open Access Journals (Sweden)
Ye W
2014-05-01
Full Text Available Wenyu Ye,1 William Montgomery,2 Zbigniew Kadziola,3 Li Liu,4 Haibo Xue,4 Michael D Stensland,5 Tamas Treuer61Real World Analytics, Eli Lilly and Company, Indianapolis, IN, USA; 2Global Patient Outcomes and Real World Evidence, Eli Lilly Australia Pty Ltd, West Ryde, Australia; 3Real World Analytics Capabilities, Eli Lilly GmbH, Vienna, Austria; 4Lilly Suzhou Pharmaceutical Co, Ltd, Shanghai Branch, People’s Republic of China; 5Agile Outcomes Research, Inc., Rochester, MN, USA; 6Neuroscience Research, Eli Lilly and Company, Budapest, HungaryBackground: The aims of this analysis were to identify factors associated with early response (at 4 weeks to olanzapine treatment and to assess whether early response is associated with better longer-term outcomes for patients with schizophrenia in the People’s Republic of China.Methods: A post hoc analysis of a multi-country, 6-month, prospective, observational study of outpatients with schizophrenia or bipolar mania who initiated or switched to treatment with oral olanzapine was conducted using data from the Chinese schizophrenia subgroup (n=330. Factors associated with early response were identified using a stepwise logistic regression with baseline clinical characteristics, baseline participation in a weight control program, and adherence with antipsychotics during the first 4 weeks of treatment. Mixed models for repeated measures with baseline covariates were used to compare outcomes over time between early responders and early nonresponders to olanzapine.Results: One hundred and thirty patients (40% achieved an early response. Early response was independently predicted by higher baseline Clinical Global Impressions-Severity score (odds ratio [OR] 1.51, 95% confidence interval [CI] 1.15–1.97, fewer years since first diagnosis (OR 0.94, CI 0.90–0.98, a greater number of social activities (OR 1.22, CI 1.05–1.40, participation in a weight control program (OR 1.81, CI 1.04–3.15, and high adherence
Pre-potential in the AdS{sub 5}×S{sup 5} type IIB superspace
Energy Technology Data Exchange (ETDEWEB)
Poláček, Martin; Siegel, Warren [C.N. Yang Institute for Theoretical Physics, State University of New York,100 Nicolls Rd., Stony Brook, NY 11794-3840 (United States)
2017-01-16
We found the pre-potential in the superspace with AdS{sub 5} × S{sup 5} background. The pre-potential appears as part of the vielbeins, without derivatives. In both subspaces (AdS{sub 5} and S{sup 5}) we used Poincaré coordinates. We picked one bulk coordinate in AdS{sub 5} and one bulk coordinate in S{sup 5} to define the space-cone gauge. Such space-cone gauge destroys the bulk Lorentz covariance. However, it still preserves boundary Lorentz covariance (and gives projective superspace) SO(3,1)⊗SO(4) and so symmetries of boundary CFT are manifest.
Abadie, J.; Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M.; Accadia, T.; Acernese, F.; Adams, C.; Adhikari, R.; Affeldt, C.;
2012-01-01
A stochastic background of gravitational waves is expected to arise from a superposition of many incoherent sources of gravitational waves, of either cosmological or astrophysical origin. This background is a target for the current generation of ground-based detectors. In this article we present the first joint search for a stochastic background using data from the LIGO and Virgo interferometers. In a frequency band of 600-1000 Hz, we obtained a 95% upper limit on the amplitude of omega(sub GW)(f) = omega(sub 3) (f/900Hz)3, of omega(sub 3) < 0.33, assuming a value of the Hubble parameter of h(sub 100) = 0.72. These new limits are a factor of seven better than the previous best in this frequency band.
Directory of Open Access Journals (Sweden)
Muhammad Luthfi
2015-12-01
Full Text Available Karies gigi pada anak usia dini merupakan masalah kesehatan yang sangat serius karena merupakan penyakit infeksi kronis yang menular. Dalam beberapa tahun terakhir pandangan tentang neutrofil telah berubah secara dramatis. Neutrofil tidak hanya berperan sebagai pembunuh mikroba melalui proses fagositosis, pelepasan reactive oxigen species (ROS dan peptida antimikrobialnya tetapi neutrofil turut mengatur aktifasi respon imun. Interleukin-8 (IL-8 berfungsi sebagai aktivator kuat dan kemoatraktan neutrofil oleh karena itu IL-8 merupakan mediator kunci dalam migrasi neutrofil ke lokasi peradangan dan infeksi. Untuk menganalisis hubungan dari jumlah S. mutans dan ekspresi IL-8 neutrofil saliva pada anak usia dini bebas karies dan severe early childhood caries (S-ECC. Perlakuan dilakukan pada dua kelompok yaitu isolasi dan menghitung jumlah S. mutans pada sampel saliva dan sampel hasil kumur dengan NaCl 1,5% yang diisolasi neutrofilnya kemudian dianalisis ekspresi IL-8 menggunakan flow cytometry dari 20 anak bebas karies dan 20 anak severe early childhood caries. Hasil nilai rata-rata diketahui bahwa jumlah S. mutans anak usia dini bebas karies lebih rendah (513.500,00±185.565,28 CFU/ml dibandingkan dengan S-ECC (977.000,00±222.500,15 CFU/ml, sedangkan ekspresi IL-8 neutrofil saliva anak usia dini bebas karies lebih tinggi (3,31±0,50 dibandingkan dengan S-ECC (2,95+0,56. Penurunan ekspresi IL-8 neutrofil saliva kemungkinan sebagai penyebab meningkatnya jumlah S. mutans pada S-ECC. Correlation of Streptococcus mutans (S. mutans Level and Interleukin 8 (IL-8 Expressions of Salivary Neutrophils in Severe Early Childhood Caries. Early childhood caries is a very serious health problem because it is a chronic infectious disease that is contagious. Dental caries begins after the primary teeth grow and develop on the tooth surface very quickly and progressively. In recent years the views of neutrophils have changed dramatically. Neutrophils
Where Are LIGO’s Big Black Holes?
Fishbach, Maya; Holz, Daniel E.
2017-12-01
In LIGO’s O1 and O2 observational runs, the detectors were sensitive to stellar-mass binary black hole (BBH) coalescences with component masses up to 100 {M}ȯ , with binaries with primary masses above 40 {M}ȯ representing ≳90% of the total accessible sensitive volume. Nonetheless, of the 5.9 detections (GW150914, LVT151012, GW151226, GW170104, GW170608, and GW170814) reported by LIGO-Virgo, the most massive binary detected was GW150914 with a primary component mass of ∼ 36 {M}ȯ , far below the detection mass limit. Furthermore, there are theoretical arguments in favor of an upper mass gap, predicting an absence of black holes in the mass range 50≲ M≲ 135 {M}ȯ . We argue that the absence of detected binary systems with component masses heavier than ∼ 40 {M}ȯ may be preliminary evidence for this upper mass gap. By allowing for the presence of a mass gap, we find weaker constraints on the shape of the underlying mass distribution of BBHs. We fit a power-law distribution with an upper mass cutoff to real and simulated BBH mass measurements, finding that the first 3.9 BBHs favor shallow power-law slopes α ≲ 3 and an upper mass cutoff {M}\\max ∼ 40 {M}ȯ . This inferred distribution is entirely consistent with the two recently reported detections, GW170608 and GW170814. We show that with ∼10 additional LIGO-Virgo BBH detections, fitting the BH mass distribution will provide strong evidence for an upper mass gap if one exists.
Early Detection of Aβ Deposition in the 5xFAD Mouse by Amyloid PET
Directory of Open Access Journals (Sweden)
Se Jong Oh
2018-01-01
Full Text Available Purpose. 18F-FC119S is a positron emission tomography (PET tracer for imaging β-amyloid (Aβ plaques in Alzheimer’s disease (AD. The aim of this study is to evaluate the efficacy of 18F-FC119S in quantitating Aβ deposition in a mouse model of early amyloid deposition (5xFAD by PET. Method. Dynamic 18F-FC119S PET images were obtained in 5xFAD (n=5 and wild-type (WT mice (n=7. The brain PET images were spatially normalized to the M. Mirrione T2-weighted mouse brain MR template, and the volumes of interest were then automatically drawn on the cortex, hippocampus, thalamus, and cerebellum. The specific binding of 18F-FC119S to Aβ was quantified as the distribution volume ratio using Logan graphical analysis with the cerebellum as a reference tissue. The Aβ levels in the brain were also confirmed by immunohistochemical analysis. Result. For the 5xFAD group, radioactivity levels in the cortex, the hippocampus, and the thalamus were higher than those for the WT group. In these regions, specific binding was approximately 1.2-fold higher in 5xFAD mice than in WT. Immunohistochemistry supported these findings; the 5xFAD showed severe Aβ deposition in the cortex and hippocampus in contrast to the WT group. Conclusion. These results demonstrated that 18F-FC119S PET can successfully distinguish Aβ depositions in 5xFAD mice from WT.
Primordial black holes from scalar field evolution in the early universe
Cotner, Eric; Kusenko, Alexander
2017-11-01
Scalar condensates with large expectation values can form in the early universe, for example, in theories with supersymmetry. The condensate can undergo fragmentation into Q-balls before decaying. If the Q-balls dominate the energy density for some period of time, statistical fluctuations in their number density can lead to formation of primordial black holes (PBH). In the case of supersymmetry the mass range is limited from above by 1 023 g . For a general charged scalar field, this robust mechanism can generate black holes over a much broader mass range, including the black holes with masses of 1-100 solar masses, which is relevant for LIGO observations of gravitational waves. Topological defects can lead to formation of PBH in a similar fashion.
Three spin string configuration in γ-Deformed AdS5xS5 background
International Nuclear Information System (INIS)
Bobev, N.; Rashkov, R.; Dimov, H.
2006-01-01
The aim of this paper is to investigate semiclassical rotating string configurations in the recently found Lunin-Maldacena background. This background is conjectured to be dual to the Leigh-Strassler β-deformation of N = 4 SYM and therefore a good laboratory for tests of the AdS/CFT correspondence beyond the well explored AdS 5 xS 5 case. We consider different multispin configurations of rotating strings by allowing the strings to move in both the AdS 5 and the deformed S 5 part of the Lunin-Maldacena background. For all of these configurations we compute the string energy in terms of the angular momenta and the string winding numbers and thus provide the possibility of reproducing our results from a computation of the anomalous dimension of the corresponding dilatation operator. This can be achieved by means of the Bethe ansatz techniques for the relevant sectors of the corresponding Yang-Mills theory. We also compare our results to those for multispin rotating strings on AdS 5 xS 5 . (authors)
Exercise and Early-Onset Alzheimer’s Disease: Theoretical Considerations
Directory of Open Access Journals (Sweden)
Astrid M. Hooghiemstra
2012-04-01
Full Text Available Background/Aims: Although studies show a negative relationship between physical activity and the risk for cognitive impairment and late-onset Alzheimer’s disease, studies concerning early-onset Alzheimer’s disease (EOAD are lacking. This review aims to justify the value of exercise interventions in EOAD by providing theoretical considerations that include neurobiological processes. Methods: A literature search on key words related to early-onset dementia, exercise, imaging, neurobiological mechanisms, and cognitive reserve was performed. Results/Conclusion: Brain regions and neurobiological processes contributing to the positive effects of exercise are affected in EOAD and, thus, provide theoretical support for exercise interventions in EOAD. Finally, we present the design of a randomized controlled trial currently being conducted in early-onset dementia patients.
A radiometer for stochastic gravitational waves
International Nuclear Information System (INIS)
Ballmer, Stefan W
2006-01-01
The LIGO Scientific Collaboration recently reported a new upper limit on an isotropic stochastic background of gravitational waves obtained based on the data from the third LIGO science run (S3). Here I present a new method for obtaining directional upper limits on stochastic gravitational waves that essentially implements a gravitational wave radiometer. The LIGO Scientific Collaboration intends to use this method for future LIGO science runs
Incidence of EMILY’S multimedia software and its impact on early childhood education
Directory of Open Access Journals (Sweden)
Nelson Eduardo Mariscal Huacon
2016-08-01
Full Text Available The multimedia software for teaching logical-mathematical relationships in early childhood education today has achieved significant changes in teaching, leaving using traditional methods and teaching techniques to apply information technology and communications - ICT within the teaching-learning process, and that is where the imperative of using a multimedia software using it as a central focus for early childhood education arises. The main objective of this research was to apply a multimedia software to improve the teaching-learning process in logical relationships - math children early education Early Education Center .El Mamey”. It is noted that the factors influencing the teaching of children aged between 3 and 5 years are: habits, motivation, methodology, family and emotional intelligence, all this leading to use of a multimedia software to improve cognitive, psychomotor and even more so when you learn playing skills. The above is based on surveys of parents i / or legal representatives of children of early childhood education, where the use of multimedia software Emily’s are considered feasible.
The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions
International Nuclear Information System (INIS)
Li Guangyuan
1998-01-01
The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given
Foundations of the AdS5 × S5 Superstring Part I
Arutyunov, G.E.; Frolov, S.
2009-01-01
We review the recent advances towards finding the spectrum of the AdS_5 x S^5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing
The Early Warning System and the EU’s subsidiarity principle: the Basque Parliament’s application
Directory of Open Access Journals (Sweden)
José Luis de Castro Ruano
2012-09-01
Full Text Available This article analyses and evaluates the Basque Parliament’s participation in the EU’s Early Warning System (EWS for checking the application of the subsidiarity principle in the EU’s legislative process. The Early Warning System is an instrument created by the Lisbon Treaty (signed in 2007 and in force since 2009 to safeguard the subsidiarity principle. One of its most interesting innovations is that it facilitates the participation of regional parliaments in the control of the subsidiarity principle. Two years after its introduction, the Basque Parliament is one of the most active regional actors in this regard.
International Nuclear Information System (INIS)
Abbott, B.; Adhikari, R.; Agresti, J.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bork, R.; Brown, D.A.; Busby, D.; Cardenas, L.; Chandler, A.; Chapsky, J.
2005-01-01
We perform a wide parameter-space search for continuous gravitational waves over the whole sky and over a large range of values of the frequency and the first spin-down parameter. Our search method is based on the Hough transform, which is a semicoherent, computationally efficient, and robust pattern recognition technique. We apply this technique to data from the second science run of the LIGO detectors and our final results are all-sky upper limits on the strength of gravitational waves emitted by unknown isolated spinning neutron stars on a set of narrow frequency bands in the range 200-400 Hz. The best upper limit on the gravitational-wave strain amplitude that we obtain in this frequency range is 4.43x10 -23
Three-spin Strings on AdS_5 x S^5 from N=4 SYM
DEFF Research Database (Denmark)
Kristjansen, C.
2004-01-01
Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate the anal......Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate...... the analyticity structure encoded in the Bethe equations for various distributions of Bethe roots. In a certain region of the parameter space our operators reduce to the gauge theory duals of the folded string with two large angular momenta and in another region to the duals of the circular string with angular...... momentum assignment (J,J',J'), J>J'. In between we locate a critical line. We propose that the operators above the critical line are the gauge theory duals of the circular elliptic string with three different spins and support this by a perturbative calculation....
Dunphy, Elizabeth
2012-01-01
This position article argues that educators’ knowledge of young children’s perspectives on aspects of early learning, including literacy learning, and subsequent interpretations of the ways that these perspectives can inform and shape pedagogy are key to promoting children’s participation rights in early childhood education and care. Drawing on ideas such as guided participation and Bruner’s notion of a pedagogy of mutuality, it is argued that pedagogy, as it is now understood, implies that c...
Predicting Early Maladaptive Schemas Using Baumrind’s Parenting Styles
Esmali Kooraneh, Ahmad; Amirsardari, Leili
2015-01-01
Background: Families play an essential role in maintaining children’s mental, social, and physical health. The family provides the first and the most important social context for human development. Objectives: The present study aimed to predict early maladaptive schemas using Baumrind’s parenting styles (root development). Patients and Methods: A total of 357 undergraduate students of Islamic Azad University, Urmia Branch, Iran, were selected through random cluster sampling during 2013 and 2014. The students were assessed using the Schema Questionnaire-Short Form (SQ-SF) and the Baumrind’s parenting styles inventories. Results: The result of regression analysis showed that Baumrind’s parenting styles are significant predictors of early maladaptive schemas (P parenting style has some features such as showing high levels of warmth or encouraging kids to express their own possibly divergent opinions. The authoritarian parenting style, however, possesses traits such as heartlessness, impassiveness, strictness, and lack of attention to the children’s developmental needs, which is not acceptable. PMID:26288648
Variables and Values in Children’s Early Word-Combinations
Directory of Open Access Journals (Sweden)
Ninio Anat
2014-08-01
Full Text Available A model of syntactic development proposes that children’s very first word-combinations are already generated via productive rules that express in syntactic form the relation between a predicate word and its semantic argument. An alternative hypothesis is that they learn frozen chunks. In Study 1 we analyzed a large sample of young children’s early two-word sentences comprising of verbs with direct objects. A majority of objects were generated by pronouns but a third of children’s sentences used bare common nouns as objects. We checked parents’ twoword long sentences of verbs with objects and found almost no bare common nouns. Children cannot have copied sentences with bare noun objects from parents’ two-word long sentences as frozen chunks. In Study 2 we raised the possibility that children’s early sentences with bare nouns are rote-learned ‘telegraphic speech’, acquired as unanalyzed frozen chunks from longer input sentences due to perceptual problem to hear the unstressed determiners. To test this explanation, we tested the children’s speech corpus for evidence that they avoid determiners in their word-combinations. The results showed that they do not; in fact they generate very many determiner-common noun combinations as two-word utterances. The findings suggest that children produce their early word-combinations of the core-grammar type by a productive rule that maps the predicate-argument relations of verbs and their semantic arguments to headdependent syntax, and not as frozen word-combinations. Children mostly learn to use indexical expressions such as pronouns to express the variable semantic arguments of verbs as context dependent; they also employ bare common nouns to express specific values of the arguments. The earliest word-combinations demonstrate that children understand that syntax is built on the predicate-argument relations of words and use this insight to produce their early sentences.
Witten's loop in the flipped SU(5) unification
Energy Technology Data Exchange (ETDEWEB)
Malinský, Michal, E-mail: malinsky@ipnp.troja.mff.cuni.cz [Institute of Particle and Nuclear Physics, Faculty of Mathematics and Physics, Charles University in Prague, V Holešovičkách 2, 180 00 Praha 8 (Czech Republic); Rodríguez, Carolina Arbeláez [Centro de Física Teórica de Partículas, Instituto Superior Técnico, Universidade Técnica de Lisboa, Av. Rovisco Pais 1, 1049-001, Lisboa Portugal and AHEP Group, Instituto de Física Corpuscular - C.S.I.C./Uni (Spain); Kolešová, Helena [Institute of Particle and Nuclear Physics, Faculty of Mathematics and Physics, Charles University in Prague, V Holešovičkách 2, 180 00 Praha 8, Czech Republic and Faculty of Nuclear Sciences and Physical Engineering, Czech Techni (Czech Republic)
2014-06-24
We study a very simple, yet potentially realistic renormalizable flipped SU(5) scenario in which the right-handed neutrino masses are generated at very high energies by means of a two-loop diagram similar to that identified by E. Witten in the early 1980's in the SO(10) GUT framework. This mechanism leaves its traces in the baryon number violating signals such as the proton decay, especially in the 'clean' channels with a charged lepton and a neutral meson in the final state.
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
CDKL5 mutations in boys with severe encephalopathy and early-onset intractable epilepsy.
Elia, M; Falco, M; Ferri, R; Spalletta, A; Bottitta, M; Calabrese, G; Carotenuto, M; Musumeci, S A; Lo Giudice, M; Fichera, M
2008-09-23
To search for CDKL5 gene mutations in boys presenting with severe early-onset encephalopathy and intractable epilepsy, a clinical picture very similar to that already described in girls with CDKL5 mutations. Eight boys (age range 3-16 years, mean age 8.5 years, SD 4.38) with severe or profound mental retardation and early-onset intractable seizures were selected for CDKL5 gene mutation screening by denaturing high-performance liquid chromatography analysis. We found three unrelated boys carrying three different missense mutations of the CDKL5 gene: c.872G>A (p.C291Y), c.863C>T (p.T288I), and c.533G>C (p.R178P). They presented early-onset, polymorphous, and drug-resistant seizures, mostly myoclonic and tonic or spasms. EEG showed epileptiform abnormalities which were multifocal during wakefulness, and pseudoperiodic bisynchronous during sleep. This study describes three boys carrying CDKL5 missense mutations and their detailed clinical and EEG data, and indicates that CDKL5 gene mutations may represent a cause of severe or profound mental retardation and early-onset intractable seizures, also in boys. Screening for CDKL5 mutations is strongly recommended in individuals with these clinical features.
Simplified TBA equations of the AdS5 × S5 mirror model
Arutyunov, G.E.; Frolov, S.
2009-01-01
We use the recently found integral representation for the dressing phase in the kinematic region of the mirror theory to simplify the TBA equations for the AdS5 × S5 mirror model. The resulting set of equations provides an efficient starting point for both analytic and numerical studies.
Ortega, Veronica Inez
2017-01-01
Using Brinkerhoff’s success case methodology, this multi-site case study examined early models of MakerSpace implementation in K–5 schools in a single district. Specifically, this study examined the early use of MakerSpaces as well as the supports and barriers affecting teacher use of these spaces. The study also examined curricular connections and MakerSpace use as a conduit for purveying instruction in the soon-to-be-implemented Next Generation Science Standards. The findings of this stud...
Spectrum and quantum symmetries of the AdS{sub 5} x S{sup 5} superstring
Energy Technology Data Exchange (ETDEWEB)
Heinze, Martin
2014-12-18
The initial AdS/CFT duality pair, the duality between N=4 SYM and the AdS{sub 5} x S{sup 5} superstring, appears to enjoy quantum integrability in the planar limit, which allowed to devise powerful methods ostensibly solving the spectral problem. However, quantization of the AdS{sub 5} x S{sup 5} superstring from first principles is still an open question and especially the spectrum of short string states has previously been derived only at leading order in large 't Hooft coupling. In this thesis we investigate possible routes to quantize short string states perturbatively beyond the leading order, where equally our aim is to gain better appreciation of the quantum symmetries at play. A prominent role is played by the lowest excited string states, dual to the Konishi supermultiplet, and we start by reviewing critically an asserted derivation of the Konishi anomalous dimension in the setup of pure spinor string theory. Next, we constrain ourselves to bosonic AdS{sub 5} x S{sup 5} String in static gauge, where we construct a so-called single-mode string solution, a generalization of the pulsating string allowing for unconstrained zero-modes. This solution shows classical integrability and invariance under the isometries SO(2,4) x SO(6) at the quantum level. Arguing heuristically about the effects of supersymmetry, we indeed recover the first non-trivial quantum correction to the Konishi anomalous dimension. We continue by implementing static gauge for the full AdS{sub 5} x S{sup 5} superstring and find elegant expressions for the Lagrangian density and the supercharges. We then constrain our interest to the superparticle and, using two different methods, find canonical coordinates at quadratic order in fermions. We conclude by exploring another quantization scheme: As the single-mode string is nothing but the SO(2,4) x SO(6) orbit of the pulsating string, we apply orbit method quantization to the particle and spinning string solutions in bosonic AdS{sub 3} x S
Aasi, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Acernese, F.; Blackburn, Lindy L.; Camp, J. B.; Gehrels, N.; Graff, P. B.
2014-01-01
We report results from a search for gravitational waves produced by perturbed intermediate mass black holes (IMBH) in data collected by LIGO and Virgo between 2005 and 2010. The search was sensitive to astrophysical sources that produced damped sinusoid gravitational wave signals, also known as ringdowns, with frequency 50 less than or equal to italic f0/Hz less than or equal to 2000 and decay timescale 0.0001 approximately less than t/s approximately less than 0.1 characteristic of those produced in mergers of IMBH pairs. No significant gravitational wave candidate was detected. We report upper limits on the astrophysical coalescence rates of IMBHs with total binary mass 50 less than or equal to M/solar mass less than or equal to 450 and component mass ratios of either 1:1 or 4:1. For systems with total mass 100 less than or equal to M/solar mass 150, we report a 90%-confidence upper limit on the rate of binary IMBH mergers with non-spinning and equal mass components of 6:9 x 10(exp 8) Mpc(exp -3)yr(exp -1). We also report a rate upper limit for ringdown waveforms from perturbed IMBHs, radiating 1% of their mass as gravitational waves in the fundamental, l=m=2, oscillation mode, that is nearly three orders of magnitude more stringent than previous results.
Puzzles of η-deformed AdS_5×S"5
International Nuclear Information System (INIS)
Arutyunov, Gleb; Borsato, Riccardo; Frolov, Sergey
2015-01-01
We derive the part of the Lagrangian for the sigma model on the η-deformed AdS_5×S"5 space which is quadratic in fermions and has the full dependence on bosons. We then show that there exists a field redefinition which brings the corresponding Lagrangian to the standard form of type IIB Green-Schwarz superstring. Reading off the corresponding RR couplings, we observe that they fail to satisfy the supergravity equations of motion, despite the presence of κ-symmetry. However, in a special scaling limit our solution reproduces the supergravity background found by Maldacena and Russo. Further, using the fermionic Lagrangian, we compute a number of new matrix elements of the tree level world-sheet scattering matrix. We then show that after a unitary transformation on the basis of two-particle states which is not one-particle factorisable, the corresponding T-matrix factorises into two equivalent parts. Each part satisfies the classical Yang-Baxter equation and coincides with the large tension limit of the q-deformed S-matrix.
DMITRY KITSENKO’S EARLY CREATION FOR ORGHAN
Directory of Open Access Journals (Sweden)
BEREZOVICOVA TATIANA
2017-06-01
Full Text Available The article deals with two works by Dmitry Kitsenko’s for organ solo, created at the early stage of his work: the Prelude and Fugue to the Memory of D. Shostakovich (1979 and the Suite for Organ (1980 which are analyzed from the point of view of form, musical language and performance.
Endoscopic submucosal dissection for early Barrett’s neoplasia
Barret, Maximilien; Cao, Dalhia Thao; Beuvon, Frédéric; Leblanc, Sarah; Terris, Benoit; Camus, Marine; Coriat, Romain; Chaussade, Stanislas
2015-01-01
Introduction The possible benefit of endoscopic submucosal dissection (ESD) for early neoplasia arising in Barrett’s esophagus remains controversial. We aimed to assess the efficacy and safety of ESD for the treatment of early Barrett’s neoplasia. Methods All consecutive patients undergoing ESD for the resection of a visible lesion in a Barrett’s esophagus, either suspicious of submucosal infiltration or exceeding 10 mm in size, between February 2012 and January 2015 were prospectively included. The primary endpoint was the rate of curative resection of carcinoma, defined as histologically complete resection of adenocarcinomas without poor histoprognostic factors. Results Thirty-five patients (36 lesions) with a mean age of 66.2 ± 12 years, a mean ASA score of 2.1 ± 0.7, and a mean C4M6 Barrett’s segment were included. The mean procedure time was 191 ± 79 mn, and the mean size of the resected specimen was 51.3 ± 23 mm. En bloc resection rate was 89%. Lesions were 12 ± 15 mm in size, and 81% (29/36) were invasive adenocarcinomas, six of which with submucosal invasion. Although R0 resection of carcinoma was 72.4%, the curative resection rate was 66% (19/29). After a mean follow-up of 12.9 ± 9 months, 16 (45.7%) patients had required additional treatment, among whom nine underwent surgical resection, and seven further endoscopic treatments. Metachronous lesions or recurrence of cancer developed during the follow-up period in 17.2% of the patients. The overall complication rate was 16.7%, including 8.3% perforations, all conservatively managed, and no bleeding. The 30-day mortality was 0%. Conclusion In this early experience, ESD yielded a moderate curative resection rate in Barrett’s neoplasia. At present, improvements are needed if ESD is to replace piecemeal endoscopic mucosal resection in the management of Barrett’s neoplasia. PMID:27087948
DEFF Research Database (Denmark)
Bräuner-Osborne, Hans; Krogsgaard-Larsen, P
1998-01-01
1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
D = 4 Yang-Mills correlators from NSR strings on AdS5 x S5
International Nuclear Information System (INIS)
Polyakov, D.
1999-07-01
In our previous work (hep-th/9812044) we have proposed the sigma-model action, conjectured to be the NSR analogue of superstring theory on AdS 5 x S 5 . This sigma-model is the NSR superstring action with potential term corresponding to the exotic 5-form vertex operator (branelike state). This 5-form potential plays the role of cosmological term, effectively curving the flat space-time geometry to that of AdS 5 x S 5 . In this paper we study this ansatz in more detail and provide the derivation of the correlators of the four-dimensional super Yang-Mills theory from the above mentioned sigma-model. In particular, we show that the correlation function of two dilaton vertex operators in such a model reproduces the well-known result for the two-point function in N = 4 four-dimensional super Yang-Mills theory. (author)
Stochastic and Resolvable Gravitational Waves from Ultralight Bosons.
Brito, Richard; Ghosh, Shrobana; Barausse, Enrico; Berti, Emanuele; Cardoso, Vitor; Dvorkin, Irina; Klein, Antoine; Pani, Paolo
2017-09-29
Ultralight scalar fields around spinning black holes can trigger superradiant instabilities, forming a long-lived bosonic condensate outside the horizon. We use numerical solutions of the perturbed field equations and astrophysical models of massive and stellar-mass black hole populations to compute, for the first time, the stochastic gravitational-wave background from these sources. In optimistic scenarios the background is observable by Advanced LIGO and LISA for field masses m_{s} in the range ∼[2×10^{-13},10^{-12}] and ∼5×[10^{-19},10^{-16}] eV, respectively, and it can affect the detectability of resolvable sources. Our estimates suggest that an analysis of the stochastic background limits from LIGO O1 might already be used to marginally exclude axions with mass ∼10^{-12.5} eV. Semicoherent searches with Advanced LIGO (LISA) should detect ∼15(5) to 200(40) resolvable sources for scalar field masses 3×10^{-13} (10^{-17}) eV. LISA measurements of massive BH spins could either rule out bosons in the range ∼[10^{-18},2×10^{-13}] eV, or measure m_{s} with 10% accuracy in the range ∼[10^{-17},10^{-13}] eV.
New holographic limit of AdS5(multiply-in-circle sign)S5
International Nuclear Information System (INIS)
Hatsuda, Machiko; Siegel, Warren
2003-01-01
We reexamine the projective light cone limit of the gauge-invariant Green-Schwarz action on five-dimensional anti-de Sitter (multiply-in-circle sign) the five-sphere. It implies the usual holography for AdS 5 , but also (a complex) one for S 5 . The result is N=4 projective superspace, which unlike N=4 harmonic superspace can describe N=4 super Yang-Mills theory off shell
Evolution of primary and secondary structures in 5S and 5.8S rRNA
International Nuclear Information System (INIS)
Curtiss, W.C.
1986-01-01
The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented
LIGO and the opening of a unique observational window on the universe.
Kalogera, Vassiliki; Lazzarini, Albert
2017-03-21
A unique window on the universe opened on September 14, 2015, with direct detection of gravitational waves by the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO) detectors. This event culminated a half-century effort around the globe to develop terrestrial detectors of adequate sensitivity to achieve this goal. It also happened appropriately only a few months before the centennial of Einstein's final paper introducing the general theory of relativity. This detection provided the surprising discovery of a coalescing pair of "heavy" black holes (more massive than [Formula: see text] M[Formula: see text]) leading to the formation of a spinning [Formula: see text]62 solar mass black hole. One more binary black-hole detection and a significant candidate event demonstrated that a population of such merging binaries is formed in nature with a broad mass spectrum. This unique observational sample has already provided concrete measurements on the coalescence rates and has allowed us to test the theory of general relativity in the strong-field regime. As this nascent field of gravitational-wave astrophysics is emerging we are looking forward to the detection of binary mergers involving neutron stars and their electromagnetic counterparts, as well as continuous-wave sources, supernovae, a stochastic confusion background of compact-object mergers, known sources detected in unexpected ways, and completely unknown sources.
Search for gravitational-wave bursts in the first year of the fifth LIGO science run
International Nuclear Information System (INIS)
Abbott, B. P.; Abbott, R.; Adhikari, R.; Anderson, S. B.; Araya, M.; Armandula, H.; Aso, Y.; Ballmer, S.; Barton, M. A.; Betzwieser, J.; Billingsley, G.; Black, E.; Blackburn, J. K.; Bork, R.; Boschi, V.; Brooks, A. F.; Cannon, K. C.; Cardenas, L.; Cepeda, C.; Chalermsongsak, T.
2009-01-01
We present the results obtained from an all-sky search for gravitational-wave (GW) bursts in the 64-2000 Hz frequency range in data collected by the LIGO detectors during the first year (November 2005--November 2006) of their fifth science run. The total analyzed live time was 268.6 days. Multiple hierarchical data analysis methods were invoked in this search. The overall sensitivity expressed in terms of the root-sum-square (rss) strain amplitude h rss for gravitational-wave bursts with various morphologies was in the range of 6x10 -22 Hz -1/2 to a fewx10 -21 Hz -1/2 . No GW signals were observed and a frequentist upper limit of 3.75 events per year on the rate of strong GW bursts was placed at the 90% confidence level. As in our previous searches, we also combined this rate limit with the detection efficiency for selected waveform morphologies to obtain event rate versus strength exclusion curves. In sensitivity, these exclusion curves are the most stringent to date.
Early diagnosis of junior school age children’s posture disorders
Directory of Open Access Journals (Sweden)
N.S. Razumeiko
2015-12-01
Full Text Available Purpose: to describe specificities of early diagnosis method for junior school age children’s posture disorders. Material: in pedagogic experiment 156 junior school age children (boys and girls of 7-10 years’ age participated. All children had no experience of training in sport circles. For determination of uniformity of the tested we fulfilled experts’ examination for presence or absence of external signs of posture disorders in frontal plane. The children’s examination was conducted by qualified specialists at the beginning and at the end of experiment. For determination of early signs of muscular asymmetry in torso right and left sides of the tested children we used methodic, based on registration of tonic vibration reflex. Results: the pupils’ examination permitted to form a group of 108 persons, who did not have external signs of posture disorders. It was proved that it would be purposeful to take prophylaxis measures at very early stages of imbalance in muscular system’s work. Traditional approach in the form of prophylaxis examination can not give confident information about initial stage of imbalance in muscular system’s work in child’s organism. Conclusions: it was found that imbalance of motor nervous centers reflex excitability on both sides of backbone (if no purposeful prophylaxis measures are taken can result in muscular tonus asymmetry on right and left sides of torso in lumbar spine area.
Fine structure of the 1s5f and 1s5g levels of He I
International Nuclear Information System (INIS)
Kriescher, Y.; Hilt, O.; Oppen, G. v.
1994-01-01
The fine structure of the 1s 5f and 1s 5g levels of He I was measured using microwave spectroscopy. The helium atoms were excited by ion impact, and the eleven allowed 1s 5f 2S+1 F J -1s 5g 2S'+1 G J , transitions near ν∼15 GHz were induced and detected by measuring the 1s 4d-1s 2p or 1s 3d-1s 2p spectral-line intensities of the impact radiation as a function of the microwave frequency. The measured transition frequencies are in accord with theoretical values and, except for one transition frequency, with earlier experimental data. The existing discrepancy between these earlier data and theory could be solved. (orig.)
Probing Primordial Black Hole Dark Matter with Gravitational Waves.
Kovetz, Ely D
2017-09-29
Primordial black holes (PBHs) have long been suggested as a candidate for making up some or all of the dark matter in the Universe. Most of the theoretically possible mass range for PBH dark matter has been ruled out with various null observations of expected signatures of their interaction with standard astrophysical objects. However, current constraints are significantly less robust in the 20 M_{⊙}≲M_{PBH}≲100 M_{⊙} mass window, which has received much attention recently, following the detection of merging black holes with estimated masses of ∼30 M_{⊙} by LIGO and the suggestion that these could be black holes formed in the early Universe. We consider the potential of advanced LIGO (aLIGO) operating at design sensitivity to probe this mass range by looking for peaks in the mass spectrum of detected events. To quantify the background, which is due to black holes that are formed from dying stars, we model the shape of the stellar-black-hole mass function and calibrate its amplitude to match the O1 results. Adopting very conservative assumptions about the PBH and stellar-black-hole merger rates, we show that ∼5 yr of aLIGO data can be used to detect a contribution of >20 M_{⊙} PBHs to dark matter down to f_{PBH}99.9% confidence level. Combined with other probes that already suggest tension with f_{PBH}=1, the obtainable independent limits from aLIGO will thus enable a firm test of the scenario that PBHs make up all of dark matter.
On the gravitational wave background from black hole binaries after the first LIGO detections
Energy Technology Data Exchange (ETDEWEB)
Cholis, Ilias, E-mail: icholis1@jhu.edu [Department of Physics and Astronomy, The Johns Hopkins University, Baltimore, Maryland, 21218 (United States)
2017-06-01
The detection of gravitational waves from the merger of binary black holes by the LIGO Collaboration has opened a new window to astrophysics. With the sensitivities of ground based detectors in the coming years, we will principally detect local binary black hole mergers. The integrated merger rate can instead be probed by the gravitational-wave background, the incoherent superposition of the released energy in gravitational waves during binary-black-hole coalescence. Through that, the properties of the binary black holes can be studied. In this work we show that by measuring the energy density Ω{sub GW} (in units of the cosmic critical density) of the gravitational-wave background, we can search for the rare ∼ 100 M {sub ⊙} massive black holes formed in the Universe. In addition, we can answer how often the least massive BHs of mass ≳ 3 M {sub ⊙} form. Finally, if there are multiple channels for the formation of binary black holes and if any of them predicts a narrow mass range for the black holes, then the total Ω{sub GW} spectrum may have features that with the future Einstein Telescope can be detected.
Early Family Relationships Predict Children’s Emotion Regulation and Defense Mechanisms
Directory of Open Access Journals (Sweden)
Jallu Lindblom
2016-12-01
Full Text Available Early family relationships have been suggested to influence the development of children’s affect regulation, involving both emotion regulation and defense mechanisms. However, we lack research on the specific family predictors for these two forms of affect regulation, which have been conceptualized to differ in their functions and accessibility to consciousness. Accordingly, we examine how the (a quality and (b timing of family relationships during infancy predict child’s later emotion regulation and defense mechanisms. Parents (N = 703 reported autonomy and intimacy in marital and parenting relationships at the child’s ages of 2 and 12 months, and the child’s use of emotion regulation and immature and neurotic defenses at 7 to 8 years. As hypothesized, the results showed that functional early family relationships predicted children’s efficient emotion regulation, whereas dysfunctional relationships predicted reliance on defense mechanisms in middle childhood. Further, results showed a timing effect for neurotic defenses, partially confirming our hypothesis of early infancy being an especially important period for the development of defense mechanisms. The findings are discussed from the viewpoints of attachment and family dynamics, emotional self-awareness, and sense of security.
1986-01-01
We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...
In The Era of Gravita2onal wave Astronomy:
Indian Academy of Sciences (India)
Sukanta Bose
2016-07-01
band at. (f. 3. =495Hz). e . s. 1. SB, B. Hall, N. Mazumder, S. Dhurandhar, A. Gupta, A Lundgren, published [LIGO-G1500496]. 2. Abbot et al. (LVC), Characteriza2on of transient noise in Advanced LIGO relevant to gravita2onal ...
Finite-size effect of η-deformed AdS5×S5 at strong coupling
Directory of Open Access Journals (Sweden)
Changrim Ahn
2017-04-01
Full Text Available We compute Lüscher corrections for a giant magnon in the η-deformed (AdS5×S5η using the su(2|2q-invariant S-matrix at strong coupling and compare with the finite-size effect of the corresponding string state, derived previously. We find that these two results match and confirm that the su(2|2q-invariant S-matrix is describing world-sheet excitations of the η-deformed background.
International Nuclear Information System (INIS)
Wang, Z.B.; Gou, B.C.; Chen, F.
2006-01-01
The relativistic energies, the oscillator strength, and the lifetimes of high-lying core-excited states 1s2s2pnp 5 P (n=2-5) and 1s2p 2 mp 5 S 0 (m=2-5) of Li - ion are calculated with the saddle-point variational method and restricted variation method. The fine structure and the hyperfine structure of the core-excited states for this system are also explored. The results are compared with other theoretical and experimental data in the literature. The energy obtained in this work are much lower than the others previously published whereas the wavelengths and radiative life-times are in agreement
Finite-size giant magnons on η-deformed AdS5×S5
Directory of Open Access Journals (Sweden)
Changrim Ahn
2014-10-01
Full Text Available We consider strings moving in the Rt×Sη3 subspace of the η-deformed AdS5×S5 and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.
The kinematical AdS{sub 5}×S{sup 5} Neumann coefficient
Energy Technology Data Exchange (ETDEWEB)
Bajnok, Zoltan [MTA Lendület Holographic QFT Group, Wigner Research Centre,P.O.B. 49, Budapest 114, H-1525 (Hungary); Janik, Romuald A. [Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, Kraków, 30-348 (Poland)
2016-02-22
For the case of two particles a solution of the string field theory vertex axioms can be factorized into a standard form factor and a kinematical piece which includes the dependence on the size of the third string. In this paper we construct an exact solution of the kinematical axioms for AdS{sub 5}×S{sup 5} which includes all order wrapping corrections w.r.t. the size of the third string. This solution is expressed in terms of elliptic Gamma functions and ordinary elliptic functions. The solution is valid at any coupling and we analyze its weak coupling, pp-wave and large L limit.
Master symmetry in the AdS{sub 5}×S{sup 5} pure spinor string
Energy Technology Data Exchange (ETDEWEB)
Chandía, Osvaldo [Departamento de Ciencias, Facultad de Artes Liberales & Facultad de Ingeniería y Ciencias, Universidad Adolfo Ibáñez,Diagonal Las Torres 2640, Peñalolén, Santiago (Chile); III, William Divine Linch [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy,Texas A& M University,College Station, TX 77843-4242 (United States); Vallilo, Brenno Carlini [Departamento de Ciencias Físicas, Universidad Andres Bello,Sazie 2212, Santiago (Chile)
2017-01-09
We lift the set of classical non-local symmetries recently studied by Klose, Loebbert, and Münkler in the context of ℤ{sub 2} cosets to the pure spinor description of the superstring in the AdS{sub 5}×S{sup 5} background.
Energy Technology Data Exchange (ETDEWEB)
Jaruga, Pawel, E-mail: pawel.jaruga@nist.gov [Biochemical Science Division, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Department of Clinical Biochemistry, Collegium Medicum, Nicolaus Copernicus University, Bydgoszcz (Poland); Dizdaroglu, Miral [Biochemical Science Division, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)
2010-06-18
Biomarkers of oxidatively induced DNA damage are of great interest and can potentially be used for the early detection of disease, monitoring the progression of disease and determining the efficacy of therapy. The present work deals with the measurement in human urine of (5'R)-8,5'-cyclo-2'-deoxyadenosine (R-cdA) and (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA). These modified nucleosides had hitherto not been considered or investigated to be present in urine as possible biomarkers of oxidatively induced DNA damage. Urine samples were collected from volunteers, purified and analyzed by LC-MS/MS with isotope-dilution. R-cdA and S-cdA were detected in urine and quantified. Creatinine levels were also measured. In addition, we measured 8-hydroxy-2'-deoxyguanosine that is commonly used as a biomarker. This study shows, for the first time, that R-cdA and S-cdA exist in human urine and can be identified and quantified by LC-MS/MS. We propose that R-cdA and S-cdA may be well-suited biomarkers for disease processes such as carcinogenesis.
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
David Hockney’s Early Etchings: Going Transatlantic and Being British
Directory of Open Access Journals (Sweden)
Martin Hammer
2017-05-01
Full Text Available David Hockney’s early autobiographical prints, My Bonnie Lies Over the Ocean 1961 and the series A Rake’s Progress 1961–3, are examined in relation to contemporary developments in American art and literature, the artist’s affinities with his British modernist contemporaries and predecessors, and other aspects of his emerging sense of artistic and sexual identity.
Kaikula, Kari-Marko
2017-01-01
Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...
Hughes, Bill
2014-01-01
Explore Samsung's next generation Galaxy smartphone Do you want an easy-to-follow guide to everything your new Galaxy S5 smartphone can do? From the basics of texting and accessing the Internet to the most advanced features and new software apps, Samsung Galaxy S5 For Dummies makes the need for tech support obsolete. The Galaxy S5 is designed to be faster and more powerful than ever. This latest release in the market-leading line of smartphones is full of new features for you to explore with the help of Samsung Galaxy S5 For Dummies. With over 1 million apps available for the Google Android o
Energy Technology Data Exchange (ETDEWEB)
Cowperthwaite, P. S.; Berger, E.; Villar, V. A.; Metzger, B. D.; Nicholl, M.; Chornock, R.; Blanchard, P. K.; Fong, W.; Margutti, R.; Soares-Santos, M.; Alexander, K. D.; Allam, S.; Annis, J.; Brout, D.; Brown, D. A.; Butler, R. E.; Chen, H. -Y.; Diehl, H. T.; Doctor, Z.; Drout, M. R.; Eftekhari, T.; Farr, B.; Finley, D. A.; Foley, R. J.; Frieman, J. A.; Fryer, C. L.; García-Bellido, J.; Gill, M. S. S.; Guillochon, J.; Herner, K.; Holz, D. E.; Kasen, D.; Kessler, R.; Marriner, J.; Matheson, T.; Neilsen, E. H.; Quataert, E.; Palmese, A.; Rest, A.; Sako, M.; Scolnic, D. M.; Smith, N.; Tucker, D. L.; Williams, P. K. G.; Balbinot, E.; Carlin, J. L.; Cook, E. R.; Durret, F.; Li, T. S.; Lopes, P. A. A.; Lourenço, A. C. C.; Marshall, J. L.; Medina, G. E.; Muir, J.; Muñoz, R. R.; Sauseda, M.; Schlegel, D. J.; Secco, L. F.; Vivas, A. K.; Wester, W.; Zenteno, A.; Zhang, Y.; Abbott, T. M. C.; Banerji, M.; Bechtol, K.; Benoit-Lévy, A.; Bertin, E.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Carnero Rosell, A.; Carrasco Kind, M.; Castander, F. J.; Crocce, M.; Cunha, C. E.; D’Andrea, C. B.; Costa, L. N. da; Davis, C.; DePoy, D. L.; Desai, S.; Dietrich, J. P.; Drlica-Wagner, A.; Eifler, T. F.; Evrard, A. E.; Fernandez, E.; Flaugher, B.; Fosalba, P.; Gaztanaga, E.; Gerdes, D. W.; Giannantonio, T.; Goldstein, D. A.; Gruen, D.; Gruendl, R. A.; Gutierrez, G.; Honscheid, K.; Jain, B.; James, D. J.; Jeltema, T.; Johnson, M. W. G.; Johnson, M. D.; Kent, S.; Krause, E.; Kron, R.; Kuehn, K.; Nuropatkin, N.; Lahav, O.; Lima, M.; Lin, H.; Maia, M. A. G.; March, M.; Martini, P.; McMahon, R. G.; Menanteau, F.; Miller, C. J.; Miquel, R.; Mohr, J. J.; Neilsen, E.; Nichol, R. C.; Ogando, R. L. C.; Plazas, A. A.; Roe, N.; Romer, A. K.; Roodman, A.; Rykoff, E. S.; Sanchez, E.; Scarpine, V.; Schindler, R.; Schubnell, M.; Sevilla-Noarbe, I.; Smith, M.; Smith, R. C.; Sobreira, F.; Suchyta, E.; Swanson, M. E. C.; Tarle, G.; Thomas, D.; Thomas, R. C.; Troxel, M. A.; Vikram, V.; Walker, A. R.; Wechsler, R. H.; Weller, J.; Yanny, B.; Zuntz, J.
2017-10-16
We present UV, optical, and NIR photometry of the first electromagnetic counterpart to a gravitational wave source from Advanced LIGO/Virgo, the binary neutron star merger GW170817. Our data set extends from the discovery of the optical counterpart at $0.47$ days to $18.5$ days post-merger, and includes observations with the Dark Energy Camera (DECam), Gemini-South/FLAMINGOS-2 (GS/F2), and the {\\it Hubble Space Telescope} ({\\it HST}). The spectral energy distribution (SED) inferred from this photometry at $0.6$ days is well described by a blackbody model with $T\\approx 8300$ K, a radius of $R\\approx 4.5\\times 10^{14}$ cm (corresponding to an expansion velocity of $v\\approx 0.3c$), and a bolometric luminosity of $L_{\\rm bol}\\approx 5\\times10^{41}$ erg s$^{-1}$. At $1.5$ days we find a multi-component SED across the optical and NIR, and subsequently we observe rapid fading in the UV and blue optical bands and significant reddening of the optical/NIR colors. Modeling the entire data set we find that models with heating from radioactive decay of $^{56}$Ni, or those with only a single component of opacity from $r$-process elements, fail to capture the rapid optical decline and red optical/NIR colors. Instead, models with two components consistent with lanthanide-poor and lanthanide-rich ejecta provide a good fit to the data, the resulting "blue" component has $M_\\mathrm{ej}^\\mathrm{blue}\\approx 0.01$ M$_\\odot$ and $v_\\mathrm{ej}^\\mathrm{blue}\\approx 0.3$c, and the "red" component has $M_\\mathrm{ej}^\\mathrm{red}\\approx 0.04$ M$_\\odot$ and $v_\\mathrm{ej}^\\mathrm{red}\\approx 0.1$c. These ejecta masses are broadly consistent with the estimated $r$-process production rate required to explain the Milky Way $r$-process abundances, providing the first evidence that BNS mergers can be a dominant site of $r$-process enrichment.
Energy Technology Data Exchange (ETDEWEB)
Lockerbie, N. A.; Tokmakov, K. V. [SUPA (Scottish Universities Physics Alliance) Department of Physics, University of Strathclyde, 107 Rottenrow, Glasgow G4 0NG (United Kingdom)
2016-07-15
The background to this work was a prototype shadow sensor, which was designed for retro-fitting to an advanced LIGO (Laser Interferometer Gravitational wave Observatory) test-mass/mirror suspension, in which 40 kg test-mass/mirrors are each suspended by four approximately 600 mm long by 0.4 mm diameter fused-silica suspension fibres. The shadow sensor comprised a LED source of Near InfraRed (NIR) radiation and a rectangular silicon photodiode detector, which, together, were to bracket the fibre under test. The aim was to detect transverse Violin-Mode resonances in the suspension fibres. Part of the testing procedure involved tensioning a silica fibre sample and translating it transversely through the illuminating NIR beam, so as to measure the DC responsivity of the detection system to fibre displacement. However, an equally important part of the procedure, reported here, was to keep the fibre under test stationary within the beam, whilst trying to detect low-level AC Violin-Mode resonances excited on the fibre, in order to confirm the primary function of the sensor. Therefore, a tensioning system, incorporating a load-cell readout, was built into the test fibre’s holder. The fibre then was excited by a signal generator, audio power amplifier, and distant loudspeaker, and clear resonances were detected. A theory for the expected fundamental resonant frequency as a function of fibre tension was developed and is reported here, and this theory was found to match closely with the detected resonant frequencies as they varied with tension. Consequently, the resonances seen were identified as being proper Violin-Mode fundamental resonances of the fibre, and the operation of the Violin-Mode detection system was validated.
International Nuclear Information System (INIS)
Lockerbie, N. A.; Tokmakov, K. V.
2016-01-01
The background to this work was a prototype shadow sensor, which was designed for retro-fitting to an advanced LIGO (Laser Interferometer Gravitational wave Observatory) test-mass/mirror suspension, in which 40 kg test-mass/mirrors are each suspended by four approximately 600 mm long by 0.4 mm diameter fused-silica suspension fibres. The shadow sensor comprised a LED source of Near InfraRed (NIR) radiation and a rectangular silicon photodiode detector, which, together, were to bracket the fibre under test. The aim was to detect transverse Violin-Mode resonances in the suspension fibres. Part of the testing procedure involved tensioning a silica fibre sample and translating it transversely through the illuminating NIR beam, so as to measure the DC responsivity of the detection system to fibre displacement. However, an equally important part of the procedure, reported here, was to keep the fibre under test stationary within the beam, whilst trying to detect low-level AC Violin-Mode resonances excited on the fibre, in order to confirm the primary function of the sensor. Therefore, a tensioning system, incorporating a load-cell readout, was built into the test fibre’s holder. The fibre then was excited by a signal generator, audio power amplifier, and distant loudspeaker, and clear resonances were detected. A theory for the expected fundamental resonant frequency as a function of fibre tension was developed and is reported here, and this theory was found to match closely with the detected resonant frequencies as they varied with tension. Consequently, the resonances seen were identified as being proper Violin-Mode fundamental resonances of the fibre, and the operation of the Violin-Mode detection system was validated.
Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation
International Nuclear Information System (INIS)
Terao, K.; Uchiumi, T.; Ogata, K.
1980-01-01
After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)
International Nuclear Information System (INIS)
Lockerbie, N. A.; Tokmakov, K. V.
2016-01-01
The background to this work was a prototype shadow sensor, which was designed for retro-fitting to an advanced LIGO (Laser Interferometer Gravitational wave Observatory) test-mass/mirror suspension, in which a 40 kg test-mass/mirror is suspended by four approximately 600 mm long by 0.4 mm diameter fused-silica suspension fibres. The shadow sensor comprised a LED source of Near InfraRed (NIR) radiation, and a “tall-thin” rectangular silicon photodiode detector, which together were to bracket the fibre under test. The photodiode was positioned so as to be sensitive (primarily) to transverse “Violin-Mode” vibrations of such a fibre, via the oscillatory movement of the shadow cast by the fibre, as this moved across the face of the detector. In this prototype shadow sensing system the photodiode was interfaced to a purpose-built transimpedance amplifier, this having both AC and DC outputs. A quasi-static calibration was made of the sensor’s DC responsivity, i.e., incremental rate of change of output voltage versus fibre position, by slowly scanning a fused-silica fibre sample transversely through the illuminating beam. The work reported here concerns the determination of the sensor’s more important AC (Violin-Mode) responsivity. Recognition of the correspondence between direct AC modulation of the source, and actual Violin-Mode signals, and of the transformative role of the AC/DC gain ratio for the amplifier, at any modulation frequency, f, resulted in the construction of the AC/DC calibration source described here. A method for determining in practice the transimpedance AC/DC gain ratio of the photodiode and amplifier, using this source, is illustrated by a specific numerical example, and the gain ratio for the prototype sensing system is reported over the frequency range 1 Hz–300 kHz. In fact, a maximum DC responsivity of 1.26 kV.m"−"1 was measured using the prototype photodiode sensor and amplifier discussed here. Therefore, the measured AC
Energy Technology Data Exchange (ETDEWEB)
Lockerbie, N. A.; Tokmakov, K. V. [SUPA (Scottish Universities Physics Alliance) Department of Physics, University of Strathclyde, 107 Rottenrow, Glasgow G4 0NG (United Kingdom)
2016-07-15
The background to this work was a prototype shadow sensor, which was designed for retro-fitting to an advanced LIGO (Laser Interferometer Gravitational wave Observatory) test-mass/mirror suspension, in which a 40 kg test-mass/mirror is suspended by four approximately 600 mm long by 0.4 mm diameter fused-silica suspension fibres. The shadow sensor comprised a LED source of Near InfraRed (NIR) radiation, and a “tall-thin” rectangular silicon photodiode detector, which together were to bracket the fibre under test. The photodiode was positioned so as to be sensitive (primarily) to transverse “Violin-Mode” vibrations of such a fibre, via the oscillatory movement of the shadow cast by the fibre, as this moved across the face of the detector. In this prototype shadow sensing system the photodiode was interfaced to a purpose-built transimpedance amplifier, this having both AC and DC outputs. A quasi-static calibration was made of the sensor’s DC responsivity, i.e., incremental rate of change of output voltage versus fibre position, by slowly scanning a fused-silica fibre sample transversely through the illuminating beam. The work reported here concerns the determination of the sensor’s more important AC (Violin-Mode) responsivity. Recognition of the correspondence between direct AC modulation of the source, and actual Violin-Mode signals, and of the transformative role of the AC/DC gain ratio for the amplifier, at any modulation frequency, f, resulted in the construction of the AC/DC calibration source described here. A method for determining in practice the transimpedance AC/DC gain ratio of the photodiode and amplifier, using this source, is illustrated by a specific numerical example, and the gain ratio for the prototype sensing system is reported over the frequency range 1 Hz–300 kHz. In fact, a maximum DC responsivity of 1.26 kV.m{sup −1} was measured using the prototype photodiode sensor and amplifier discussed here. Therefore, the measured AC
Ahmad, Waqas; Li, Yingying; Guo, Yidi; Wang, Xinyu; Duan, Ming; Guan, Zhenhong; Liu, Zengshan; Zhang, Maolin
2017-06-01
Rabies virus (RABV) is a highly neurotropic virus that follows clathrin-mediated endocytosis and pH-dependent pathway for trafficking and invasion into endothelial cells. Early (Rab5, EEA1) and late (Rab7, LAMP1) endosomal proteins play critical roles in endosomal sorting, maturity and targeting various molecular cargoes, but their precise functions in the early stage of RABV neuronal infection remain elusive. In this study, the relationship between enigmatic entry of RABV with these endosomal proteins into neuronal and SH-SY5Y cells was investigated. Immunofluorescence, TCID 50 titers, electron microscopy and western blotting were carried out to determine the molecular interaction of the nucleoprotein (N) of RABV with early or late endosomal proteins in these cell lines. The expression of N was also determined by down-regulating Rab5 and Rab7 in both cell lines through RNA interference. The results were indicative that N proficiently colocalized with Rab5/EEA1 and Rab7/LAMP1 in both cell lines at 24 and 48 h post-infection, while N titers significantly decreased in early infection of RABV. Down-regulation of Rab5 and Rab7 did not inhibit N expression, but it prevented productive infection via blocking the normal trafficking of RABV in a low pH environment. Ultrathin sections of cells studied by electron microscope also verified the close association of RABV with Rab5 and Rab7 in neurons. From the data it was concluded that primary entry of RABV strongly correlates with the kinetics of Rab-proteins present on early and late vesicles, which provides helpful clues to explain the early events of RABV in nerve cells.
Mattera, Shira K.; Jacob, Robin; Morris, Pamela A.
2018-01-01
Early math skills are a strong predictor of later achievement for young children, not only in math, but in other domains as well. Exhibiting strong math skills in elementary school is predictive of later high school completion and college attendance. To that end, the Making Pre-K Count and High 5s studies set out to rigorously assess whether…
Resurgence of the dressing phase for AdS5 × S5
Arutyunov, Gleb; Dorigoni, Daniele; Savin, Sergei
2017-01-01
We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS5 × S5 superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.
Finite-size giant magnons on η-deformed AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Ahn, Changrim, E-mail: ahn@ewha.ac.kr; Bozhilov, Plamen, E-mail: bozhilov@inrne.bas.bg
2014-10-07
We consider strings moving in the R{sub t}×S{sub η}{sup 3} subspace of the η-deformed AdS{sub 5}×S{sup 5} and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.
Directory of Open Access Journals (Sweden)
Sarawut Suksuphew
2017-11-01
Full Text Available Background: On diagnosing Alzheimer’s disease (AD, most existing imaging-based schemes have relied on analyzing the hippocampus and its peripheral structures. Recent studies have confirmed that volumetric variations are one of the primary indicators in differentiating symptomatic AD from healthy aging. In this study, we focused on deriving discriminative shape-based parameters that could effectively identify early AD from volumetric computerized tomography (VCT delineation, which was previously almost intangible. Methods: Participants were 63 volunteers of Thai nationality, whose ages were between 40 and 90 years old. Thirty subjects (age 68.51 ± 5.5 were diagnosed with early AD, by using Diagnostic and Statistical Manual of Mental Disorders IV (DSM-IV criteria and the National Institute of Neurological and Communicative Disorders and the Stroke and the Alzheimer’s disease and Related Disorders Association (NINCDS-ADRDA criteria, while the remaining 33 were in the healthy control group (age 67.93 ± 5.5. The structural imaging study was conducted by using VCT. Three uninformed readers were asked to draw left and right hippocampal outlines on a coronal section. The resultant shapes were aligned and then analyzed with statistical shape analysis to obtain the first few dominant variational parameters, residing in hyperplanes. A supervised machine learning, i.e., support vector machine (SVM was then employed to elucidate the proposed scheme. Results: Provided trivial delineations, relatively as low as 5 to 7 implicit model parameters could be extracted and used as discriminants. Clinical verification showed that the model could differentiate early AD from aging, with high sensitivity, specificity, accuracy and F-measure of 0.970, 0.968, 0.983 and 0.983, respectively, with no apparent effect of left-right asymmetry. Thanks to a less laborious task required, yet high discriminating capability, the proposed scheme is expected to be applicable in a
Predicting Early Maladaptive Schemas Using Baumrind?s Parenting Styles
Esmali Kooraneh, Ahmad; Amirsardari, Leili
2015-01-01
Background: Families play an essential role in maintaining children?s mental, social, and physical health. The family provides the first and the most important social context for human development. Objectives: The present study aimed to predict early maladaptive schemas using Baumrind?s parenting styles (root development). Patients and Methods: A total of 357 undergraduate students of Islamic Azad University, Urmia Branch, Iran, were selected through random cluster sampling during 2013 and 20...
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
CDKL5 alterations lead to early epileptic encephalopathy in both genders.
Liang, Jao-Shwann; Shimojima, Keiko; Takayama, Rumiko; Natsume, Jun; Shichiji, Minobu; Hirasawa, Kyoko; Imai, Kaoru; Okanishi, Tohru; Mizuno, Seiji; Okumura, Akihisa; Sugawara, Midori; Ito, Tomoshiro; Ikeda, Hiroko; Takahashi, Yukitoshi; Oguni, Hirokazu; Imai, Katsumi; Osawa, Makiko; Yamamoto, Toshiyuki
2011-10-01
Genetic mutations of the cyclin-dependent kinase-like 5 gene (CDKL5) have been reported in patients with epileptic encephalopathy, which is characterized by intractable seizures and severe-to-profound developmental delay. We investigated the clinical relevance of CDKL5 alterations in both genders. A total of 125 patients with epileptic encephalopathy were examined for genomic copy number aberrations, and 119 patients with no such aberrations were further examined for CDKL5 mutations. Five patients with Rett syndrome, who did not show methyl CpG-binding protein 2 gene (MECP2) mutations, were also examined for CDKL5 mutations. One male and three female patients showed submicroscopic deletions including CDKL5, and two male and six female patients showed CDKL5 nucleotide alterations. Development of early onset seizure was a characteristic clinical feature for the patients with CDKL5 alterations in both genders despite polymorphous seizure types, including myoclonic seizures, tonic seizures, and spasms. Severe developmental delays and mild frontal lobe atrophies revealed by brain magnetic resonance imaging (MRI) were observed in almost all patients, and there was no gender difference in phenotypic features. We observed that 5% of the male patients and 14% of the female patients with epileptic encephalopathy had CDKL5 alterations. These findings indicate that alterations in CDKL5 are associated with early epileptic encephalopathy in both female and male patients. Wiley Periodicals, Inc. © 2011 International League Against Epilepsy.
A girl with early-onset epileptic encephalopathy associated with microdeletion involving CDKL5.
Saitsu, Hirotomo; Osaka, Hitoshi; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Doi, Hiroshi; Miyake, Noriko; Matsumoto, Naomichi
2012-05-01
Recent studies have shown that aberrations of CDKL5 in female patients cause early-onset intractable seizures, severe developmental delay or regression, and Rett syndrome-like features. We report on a Japanese girl with early-onset epileptic encephalopathy, hypotonia, developmental regression, and Rett syndrome-like features. The patient showed generalized tonic seizures, and later, massive myoclonus induced by phone and light stimuli. Brain magnetic resonance imaging showed no structural brain anomalies but cerebral atrophy. Electroencephalogram showed frontal dominant diffuse poly spikes and waves. Through copy number analysis by genomic microarray, we found a microdeletion at Xp22.13. A de novo 137-kb deletion, involving exons 5-21 of CDKL5, RS1, and part of PPEF1 gene, was confirmed by quantitative PCR and breakpoint specific PCR analyses. Our report suggests that the clinical features associated with CDKL5 deletions could be implicated in Japanese patients, and that genetic testing of CDKL5, including both sequencing and deletion analyses, should be considered in girls with early-onset epileptic encephalopathy and RTT-like features. Copyright © 2011 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sonja Stutte
2017-02-01
Full Text Available To evaluate body composition, metabolism and growth as well as their interaction with early nutrition in former extremely low birth weight infants (ELBW, we assessed qualitative and quantitative nutritional intake during initial hospitalization and infantile growth parameters in 61 former ELBW infants with a birth weight <1000 g. In two follow-up exams, physical and biochemical development were measured at 5.7 and at 9.5 years. At the second follow-up, in addition to biochemical reassessment, body composition was analyzed by dual-energy x-ray absorptiometry (DEXA. Protein intake between birth and discharge was associated with weight gain in the first six months of life (r = 0.51; p < 0.01. Weight catch-up preceded height catch-up. Protein intake in early infancy correlated highly significantly with abdominal fat mass (r = 0.49; p < 0.05, but not with lean body mass at 9.5 years (r = 0.30; not significant (n.s.. In contrast to nutrient intake, birth weight was associated with lean body mass (r = 0.433; p < 0.001. Early protein and carbohydrate intake were associated with high-density lipoprotein (HDL-cholesterol, and early catch-up growth correlated with fasting insulin at follow-up. Stepwise linear regression demonstrated that protein intake predicted fat mass (p < 0.05, whereas only gender and birth weight standard deviation score (SDS contributed significantly to lean body mass variation (p < 0.05. Our results suggest an important impact of early nutrient intake on body composition and metabolism in later childhood in ELBW children.
Energy Technology Data Exchange (ETDEWEB)
Chornock, R. [Astrophysical Institute, Department of Physics and Astronomy, 251B Clippinger Lab, Ohio University, Athens, OH 45701 (United States); Berger, E.; Cowperthwaite, P. S.; Nicholl, M.; Villar, V. A.; Alexander, K. D.; Blanchard, P. K.; Eftekhari, T.; Williams, P. K. G. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kasen, D. [Departments of Physics and Astronomy, and Theoretical Astrophysics Center, University of California, Berkeley, CA 94720-7300 (United States); Fong, W.; Margutti, R. [Center for Interdisciplinary Exploration and Research in Astrophysics (CIERA) and Department of Physics and Astronomy, Northwestern University, Evanston, IL 60208 (United States); Annis, J.; Frieman, J. A. [Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Brout, D. [Department of Physics and Astronomy, University of Pennsylvania, Philadelphia, PA 19104 (United States); Brown, D. A. [Department of Physics, Syracuse University, Syracuse NY 13224 (United States); Chen, H.-Y. [Department of Astronomy and Astrophysics, University of Chicago, Chicago, IL 60637 (United States); Drout, M. R. [The Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Farr, B. [Department of Physics, University of Oregon, Eugene, OR 97403 (United States); Foley, R. J., E-mail: chornock@ohio.edu [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); and others
2017-10-20
We present a near-infrared spectral sequence of the electromagnetic counterpart to the binary neutron star merger GW170817 detected by Advanced Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo. Our data set comprises seven epochs of J + H spectra taken with FLAMINGOS-2 on Gemini-South between 1.5 and 10.5 days after the merger. In the initial epoch, the spectrum is dominated by a smooth blue continuum due to a high-velocity, lanthanide-poor blue kilonova component. Starting the following night, all of the subsequent spectra instead show features that are similar to those predicted in model spectra of material with a high concentration of lanthanides, including spectral peaks near 1.07 and 1.55 μ m. Our fiducial model with 0.04 M {sub ⊙} of ejecta, an ejection velocity of v = 0.1 c , and a lanthanide concentration of X {sub lan} = 10{sup −2} provides a good match to the spectra taken in the first five days, although it over-predicts the late-time fluxes. We also explore models with multiple fitting components, in each case finding that a significant abundance of lanthanide elements is necessary to match the broad spectral peaks that we observe starting at 2.5 days after the merger. These data provide direct evidence that binary neutron star mergers are significant production sites of even the heaviest r -process elements.
What’s Papa For?:Paternal Intimacy and Distance in Chekhov’s Early Stories
Doak, Connor
2016-01-01
This article examines father figures in a selection of Chekhov’s early stories, including “Grisha,” “Papasha,” “At Home,” “Oysters,” “Misery,” and “Requiem.” While most existing criticism on Chekhov highlights the role of the tyrannical father in his work, this article finds that these stories evince an anxiety not so much about the father’s tyranny, but rather his distance—both physical and emotional—from his children. In this respect, the article draws on existing historical and sociocultur...
Quantizing String Theory in AdS_5 X S^5: Beyond the pp-Wave
Callan, Jr., Curtis G.; Lee, Hok Kong; McLoughlin, Tristan; Schwarz, John H.; Swanson, Ian; Wu, Xinkai
2003-01-01
In a certain kinematic limit, where the effects of spacetime curvature (and other background fields) greatly simplify, the light-cone gauge world-sheet action for a type IIB superstring on AdS_5 x S^5 reduces to that of a free field theory. It has been conjectured by Berenstein, Maldacena, and Nastase that the energy spectrum of this string theory matches the dimensions of operators in the appropriately defined large R-charge large-N_c sector of N=4 supersymmetric Yang--Mills theory in four d...
The Frequency and Severity of Gastrointestinal Symptoms in Patients with Early Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Hye-Young Sung
2014-04-01
Full Text Available Objective Although gastrointestinal dysfunctions occur in the majority of patients with Parkinson’s disease (PD, they are often unrecognized because many patients remain relatively asymptomatic in the early stage. We investigated the frequency of gastrointestinal symptoms in patients with PD using newly developed gastrointestinal symptom questionnaires. Methods Early PD patients with a symptom duration not exceeding 3 years were included in this study. All PD patients were evaluated using a questionnaire, which consisted of three relevant domains: oropharyngoesophageal (10 items; gastric (3 items; and intestinal-anorectal (7 items. The frequency of symptoms was calculated as a proportion with an item score ≥ 2. Results Of the 54 patients enrolled, 48 patients (88.9% responded that bowel symptoms developed before the onset of Parkinsonian motor symptoms, and four patients reported that the onset of two types of symptoms (i.e., bowel and neurological occurred approximately simultaneously, with only months between them. The frequencies of gastrointestinal symptoms are as follows: speech disturbance (40.7%, drooling (24.1%, sense of getting stuck (31.5%, choking (27.8%, globus pharyngis (16.7%, repetitive deglutition (29.6%, pain during swallowing (5.6%, food regurgitation (3.7%, acid reflux (7.4%, nausea/vomiting (11.1%, early satiety (16.7%, postprandial fullness (14.8%, epigastric soreness (9.3%, abdominal pain (3.7%, constipation (46.3%, excessive strain during defecation (33.3%, fecal incontinence (7.4%, tenesmus (20.4%, loose stool or diarrhea (3.7%, and difficulty in relaxing anal sphincter (11.1%. Two patients were scored at zero. Conclusions Our findings confirm that gastrointestinal dysfunction occurs in early PD in relatively high frequency.
Zhu, Feng; Hu, Xiaofeng; He, Xiaoyuan; Guo, Rui; Li, Kaiming; Yang, Lu
2017-11-01
In the military field, the performance evaluation of early-warning aircraft deployment or construction is always an important problem needing to be explored. As an effective approach of enterprise management and performance evaluation, Balanced Score Card (BSC) attracts more and more attentions and is studied more and more widely all over the world. It can also bring feasible ideas and technical approaches for studying the issue of the performance evaluation of the deployment or construction of early-warning aircraft which is the important component in early-warning detection system of systems (SoS). Therefore, the deep explored researches are carried out based on the previously research works. On the basis of the characteristics of space exploration and aerial detection effectiveness of early-warning detection SoS and the cardinal principle of BSC are analyzed simply, and the performance evaluation framework of the deployment or construction of early-warning aircraft is given, under this framework, aimed at the evaluation issue of aerial detection effectiveness of early-warning detection SoS with the cooperation efficiency factors of the early-warning aircraft and other land based radars, the evaluation indexes are further designed and the relative evaluation model is further established, especially the evaluation radar chart being also drawn to obtain the evaluation results from a direct sight angle. Finally, some practical computer simulations are launched to prove the validity and feasibility of the research thinking and technologic approaches which are proposed in the paper.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerboni Baiardi, L.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H.-P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Dálya, G.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devenson, J.; Devine, R. C.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fernández Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, A.; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J.-M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, Whansun; Kim, W.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lück, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Mytidis, A.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosińska, D.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson, S. P.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Szolgyen, A.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tápai, M.; Taracchini, A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trifirò, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrożny, A.; Zangrando, L.; Zanolin, M.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration; Aptekar, R. L.; Frederiks, D. D.; Golenetskii, S. V.; Golovin, D. V.; Hurley, K.; Litvak, M. L.; Mitrofanov, I. G.; Rau, A.; Sanin, A. B.; Svinkin, D. S.; von Kienlin, A.; Zhang, X.; IPN Collaboration
2017-06-01
We present the results of the search for gravitational waves (GWs) associated with γ-ray bursts detected during the first observing run of the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO). We find no evidence of a GW signal for any of the 41 γ-ray bursts for which LIGO data are available with sufficient duration. For all γ-ray bursts, we place lower bounds on the distance to the source using the optimistic assumption that GWs with an energy of {10}-2{M}⊙ {c}2 were emitted within the 16-500 Hz band, and we find a median 90% confidence limit of 71 Mpc at 150 Hz. For the subset of 19 short/hard γ-ray bursts, we place lower bounds on distance with a median 90% confidence limit of 90 Mpc for binary neutron star (BNS) coalescences, and 150 and 139 Mpc for neutron star-black hole coalescences with spins aligned to the orbital angular momentum and in a generic configuration, respectively. These are the highest distance limits ever achieved by GW searches. We also discuss in detail the results of the search for GWs associated with GRB 150906B, an event that was localized by the InterPlanetary Network near the local galaxy NGC 3313, which is at a luminosity distance of 54 Mpc (z = 0.0124). Assuming the γ-ray emission is beamed with a jet half-opening angle ≤slant 30^\\circ , we exclude a BNS and a neutron star-black hole in NGC 3313 as the progenitor of this event with confidence >99%. Further, we exclude such progenitors up to a distance of 102 Mpc and 170 Mpc, respectively.
Lampela, Saara
2017-01-01
Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...
IL4/PGE2 induction of an enlarged early endosomal compartment in mouse macrophages is Rab5-dependent
International Nuclear Information System (INIS)
Wainszelbaum, Marisa J.; Proctor, Brandon M.; Pontow, Suzanne E.; Stahl, Philip D.; Barbieri, M. Alejandro
2006-01-01
The endosomal compartment and the plasma membrane form a complex partnership that controls signal transduction and trafficking of different molecules. The specificity and functionality of the early endocytic pathway are regulated by a growing number of Rab GTPases, particularly Rab5. In this study, we demonstrate that IL4 (a Th-2 cytokine) and prostaglandin E 2 (PGE 2 ) synergistically induce Rab5 and several Rab effector proteins, including Rin1 and EEA1, and promote the formation of an enlarged early endocytic (EEE) compartment. Endosome enlargement is linked to a substantial induction of the mannose receptor (MR), a well-characterized macrophage endocytic receptor. Both MR levels and MR-mediated endocytosis are enhanced approximately 7-fold. Fluid-phase endocytosis is also elevated in treated cells. Light microscopy and fractionation studies reveal that MR colocalizes predominantly with Rab5a and partially with Rab11, an endosomal recycling pathway marker. Using retroviral expression of Rab5a:S34N, a dominant negative mutant, and siRNA Rab5a silencing, we demonstrate that Rab5a is essential for the large endosome phenotype and for localization of MR in these structures. We speculate that the EEE is maintained by activated Rab5, and that the EEE phenotype is part of some macrophage developmental program such as cell fusion, a characteristic of IL4-stimulated cells
Hu, Lei; Wu, Xuefeng; Andreoni, Igor; Ashley, Michael C. B.; Cooke, Jeff; Cui, Xiangqun; Du, Fujia; Dai, Zigao; Gu, Bozhong; Hu, Yi; Lu, Haiping; Li, Xiaoyan; Li, Zhengyang; Liang, Ensi; Liu, Liangduan; Ma, Bin; Shang, Zhaohui; Sun, Tianrui; Suntzeff, N. B.; Tao, Charling; Udden, Syed A.; Wang, Lifan; Wang, Xiaofeng; Wen, Haikun; Xiao, Di; Su, Jin; Yang, Ji; Yang, Shihai; Yuan, Xiangyan; Zhou, Hongyan; Zhang, Hui; Zhou, Jilin; Zhu, Zonghong
2017-10-01
The LIGO detection of gravitational waves (GW) from merging black holes in 2015 marked the beginning of a new era in observational astronomy. The detection of an electromagnetic signal from a GW source is the critical next step to explore in detail the physics involved. The Antarctic Survey Telescopes (AST3), located at Dome A, Antarctica, is uniquely situated for rapid response time-domain astronomy with its continuous night-time coverage during the austral winter. We report optical observations of the GW source (GW 170817) in the nearby galaxy NGC 4993 using AST3. The data show a rapidly fading transient at around 1 day after the GW trigger, with the i-band magnitude declining from 17.23±0.13 magnitude to 17.72±0.09 magnitude in ˜ 0.8 hour. The brightness and time evolution of the optical transient associated with GW 170817 are broadly consistent with the predictions of models involving merging binary neutron stars. We infer from our data that the merging process ejected about ˜ 10^{-2} solar mass of radioactive material at a speed of up to 30% the speed of light.
Higher conserved charges and integrability for spinning strings in AdS5 x S5
International Nuclear Information System (INIS)
Engquist, Johan
2004-01-01
We demonstrate the existence of an infinite number of local commuting charges for classical solutions of the string sigma model on AdS 5 x S 5 associated with a certain circular three-spin solution spinning with large angular momenta in three orthogonal directions on the five-sphere. Using the AdS/CFT correspondence we find agreement to one-loop with the tower of conserved higher charges in planar N = 4 super Yang-Mills theory associated with the dual composite single-trace operator in the highest weight representation (J 1 ,J 2 ,J 2 ) of SO(6). The agreement can be explained by the presence of integrability on both sides of the duality. (author)
On stringy AdS5 x S5 and higher spin holography
International Nuclear Information System (INIS)
Bianchi, Massimo; Morales, Jose F.; Samtleben, Henning
2003-01-01
We derive the spectrum of Kaluza-Klein descendants of string excitations on AdS 5 x S 5 . String states are organized in long multiplets of the AdS supergroup SU(2,2|4,R) with a rich pattern of shortenings at the higher spin enhancement point λ=0. The string states holographically dual to the higher spin currents of SYM theory in the strict zero coupling limit are identified together with the corresponding Goldstone particles responsible for the Higgsing of the higher spin symmetry at λ≠ 0. Exploiting higher spin symmetry we propose a very simple yet effective mass formula and establish a one-to-one correspondence between the complete spectrum of Δ 0 ≤ 4 string states and relevant/marginal single-trace deformations in N = 4 SYM theory at large N. To this end, we describe how to efficiently enumerate scaling operators in 'free' YM theory, with the inclusion of fermionic 'letters', by resorting to Polya theory. Comparison between the spectra of 1/4-BPS states is also presented. Finally, we discuss how to organize the spectrum of N = 4 SYM theory in SU(2,2|4,R) supermultiplets by means of some kind of 'Eratostenes's sieve'. (author)
Boost-invariant early time dynamics from AdS/CFT
International Nuclear Information System (INIS)
Beuf, Guillaume; Peschanski, Robi; Heller, Michal P.; Janik, Romuald A.
2009-01-01
Boost-invariant dynamics of a strongly-coupled conformal plasma is studied in the regime of early proper-time using the AdS/CFT correspondence. It is shown, in contrast with the late-time expansion, that a scaling solution does not exist. The boundary dynamics in this regime depends on initial conditions encoded in the bulk behavior of a Fefferman-Graham metric coefficient at initial proper-time. The relation between the early-time expansion of the energy density and initial conditions in the bulk of AdS is provided. As a general result it is proven that a singularity of some metric coefficient in Fefferman-Graham frame exists at all times. Requiring that this singularity at τ = 0 is a mere coordinate singularity without the curvature blow-up gives constraints on the possible boundary dynamics. Using a simple Pade resummation for solutions satisfying the regularity constraint, the features of a transition to local equilibrium, and thus to the hydrodynamical late-time regime, have been observed. The impact of this study on the problem of thermalization is discussed.
Rural Earnings Holding Steady in the Early 1990s.
Swaim, Paul
1995-01-01
Current Population Survey data indicate an overall decline in the rural-urban pay gap during the early 1990s (due to declining urban wages, not rising rural wages). In 1993, the earnings of 30 percent of rural full-time workers were below the poverty level. Compares low-income workers by gender, age group, education, and race/ethnicity. (LP)
Dyrbye, Liselotte N; West, Colin P; Satele, Daniel; Boone, Sonja; Tan, Litjen; Sloan, Jeff; Shanafelt, Tait D
2014-03-01
To compare the prevalence of burnout and other forms of distress across career stages and the experiences of trainees and early career (EC) physicians versus those of similarly aged college graduates pursuing other careers. In 2011 and 2012, the authors conducted a national survey of medical students, residents/fellows, and EC physicians (≤ 5 years in practice) and of a probability-based sample of the general U.S. population. All surveys assessed burnout, symptoms of depression and suicidal ideation, quality of life, and fatigue. Response rates were 35.2% (4,402/12,500) for medical students, 22.5% (1,701/7,560) for residents/fellows, and 26.7% (7,288/27,276) for EC physicians. In multivariate models that controlled for relationship status, sex, age, and career stage, being a resident/fellow was associated with increased odds of burnout and being a medical student with increased odds of depressive symptoms, whereas EC physicians had the lowest odds of high fatigue. Compared with the population control samples, medical students, residents/fellows, and EC physicians were more likely to be burned out (all P prevalence of burnout, depressive symptoms, and recent suicidal ideation are relatively small. At each stage, burnout is more prevalent among physicians than among their peers in the U.S. population.
Directory of Open Access Journals (Sweden)
Yimeng Chen
2017-07-01
Full Text Available Parkinson’s disease (PD is the second most common neurodegenerative disorder and has profound impacts on the daily lives of patients. However, there is a lack of effective biomarkers for early diagnosis, and the mechanisms of PD pathogenesis remain obscure. microRNAs (miRNAs are post-transcriptional gene regulators and can be easily detected in plasma, which suggests a promising role as diagnostic markers. Here, we aimed to explore a peripheral biomarker, which not only can be applied for early diagnosis of PD but also has the potential to be a therapeutic target. Through miRNA microarray screening and further validation in plasma from 169 sporadic PD patients, 170 healthy controls, and 60 essential tremor (ET patients, hsa-miR-4639-5p level was identified to be significantly up-regulated in PD patients. Also, it was able to discriminate between early PD patients (disease duration ≤2 years or Hoehn and Yahr stage 1–2.5 and healthy controls. Furthermore, hsa-miR-4639-5p was shown to negatively regulate DJ-1 (PARK7, a well-known PD-related gene, in the post-transcriptional level. Abnormal up-regulation of hsa-miR-4639-5p caused down-regulation of DJ-1 protein level, leading to severe oxidative stress and neuronal death. In conclusion, hsa-miR-4639-5p has the potential to be a peripheral diagnostic biomarker and therapeutic target for early PD.
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
Type IIB supergravity solution for the T-dual of the η-deformed AdS_5×S"5 superstring
International Nuclear Information System (INIS)
Hoare, B.; Tseytlin, A.A.
2015-01-01
We find an exact type IIB supergravity solution that represents a one-parameter deformation of the T-dual of the AdS_5×S"5 background (with T-duality applied in all 6 abelian bosonic isometric directions). The non-trivial fields are the metric, dilaton and RR 5-form only. The latter has remarkably simple “undeformed” form when written in terms of a “deformation-rotated” vielbein basis. An unusual feature of this solution is that the dilaton contains a linear dependence on the isometric coordinates of the metric precluding a straightforward reversal of T-duality. If we still formally dualize back, we find exactly the metric, B-field and product of dilaton with RR field strengths as recently extracted from the η-deformed AdS_5×S"5 superstring action in http://arxiv.org/abs/1507.04239. We also discuss similar solutions for deformed AdS_n×S"n backgrounds with n=2,3. In the η→i limit we demonstrate that all these backgrounds can be interpreted as special limits of gauged WZW models and are also related to (a limit of) the Pohlmeyer-reduced models of the AdS_n×S"n superstrings.
Early Results from TROPOMI on the Copernicus Sentinel 5 Precursor
Veefkind, J. P.; Kleipool, Q.; Ludewig, A.; Stein-Zweers, D.; Aben, I.; De Vries, J.; Loyola, D. G.; Nett, H.; Richter, A.; Van Roozendael, M.; Siddans, R.; Wagner, T.; Dehn, A.; Zehner, C.; Levelt, P.
2017-12-01
The Copernicus Sentinel 5 Precursor (S5P) is the first of the European Sentinels satellites dedicated to monitoring of the atmospheric composition. S5P is planned for launch in the 3rd quarter of 2017. The mission objectives of S5P are to monitor air quality, climate and the ozone layer, in the time period between 2017 and 2023. S5P will fly in a Sun-synchronized polar orbit with a 13:30 hr local equator crossing time. The single payload of the S5P mission is TROPOspheric Monitoring Instrument (TROPOMI), which is developed by The Netherlands in cooperation with the European Space Agency (ESA). TROPOMI is a nadir viewing shortwave spectrometer that measures in the UV-visible wavelength range (267-499 nm), the near infrared (661-775 nm) and the shortwave infrared (2300-2389 nm). With a spatial resolution of better than 7x7 km2 at nadir and almost 20 million measurements per day, TROPOMI will be a major step forward compared to its predecessors OMI (Ozone Monitoring Instrument) and SCIAMACHY (Scanning Imaging Absorption Spectrometer for Atmospheric Chartography). The spatial resolution is combined with a wide swath to allow for daily global coverage. The TROPOMI/S5P geophysical (Level 2) operational data products include nitrogen dioxide, carbon monoxide, ozone (total column, tropospheric column & profile), methane, sulfur dioxide, formaldehyde and aerosol and cloud parameters. The S5P will fly in a so-called loose formation with the U.S. Suomi NPP (National Polar-orbiting Partnership) satellite. The primary objective for this formation flying is to use the cloud clearing capabilities of the VIIRS (Visible Infrared Imager Radiometer Suite). The temporal separation between TROPOMI and VIIRS will be less than 5 minutes. Once this formation has been established, it will enable synergistic data products and scientific research potentials.
The CDKL5 disorder is an independent clinical entity associated with early-onset encephalopathy.
Fehr, Stephanie; Wilson, Meredith; Downs, Jenny; Williams, Simon; Murgia, Alessandra; Sartori, Stefano; Vecchi, Marilena; Ho, Gladys; Polli, Roberta; Psoni, Stavroula; Bao, Xinhua; de Klerk, Nick; Leonard, Helen; Christodoulou, John
2013-03-01
The clinical understanding of the CDKL5 disorder remains limited, with most information being derived from small patient groups seen at individual centres. This study uses a large international data collection to describe the clinical profile of the CDKL5 disorder and compare with Rett syndrome (RTT). Information on individuals with cyclin-dependent kinase-like 5 (CDKL5) mutations (n=86) and females with MECP2 mutations (n=920) was sourced from the InterRett database. Available photographs of CDKL5 patients were examined for dysmorphic features. The proportion of CDKL5 patients meeting the recent Neul criteria for atypical RTT was determined. Logistic regression and time-to-event analyses were used to compare the occurrence of Rett-like features in those with MECP2 and CDKL5 mutations. Most individuals with CDKL5 mutations had severe developmental delay from birth, seizure onset before the age of 3 months and similar non-dysmorphic features. Less than one-quarter met the criteria for early-onset seizure variant RTT. Seizures and sleep disturbances were more common than in those with MECP2 mutations whereas features of regression and spinal curvature were less common. The CDKL5 disorder presents with a distinct clinical profile and a subtle facial, limb and hand phenotype that may assist in differentiation from other early-onset encephalopathies. Although mutations in the CDKL5 gene have been described in association with the early-onset variant of RTT, in our study the majority did not meet these criteria. Therefore, the CDKL5 disorder should be considered separate to RTT, rather than another variant.
Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions
International Nuclear Information System (INIS)
Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.
1996-01-01
The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)
Directory of Open Access Journals (Sweden)
Li Wang
2018-01-01
Full Text Available Precise control of gene expression during development is orchestrated by transcription factors and co-regulators including chromatin modifiers. How particular chromatin-modifying enzymes affect specific developmental processes is not well defined. Here, we report that GCN5, a histone acetyltransferase essential for embryonic development, is required for proper expression of multiple genes encoding components of the fibroblast growth factor (FGF signaling pathway in early embryoid bodies (EBs. Gcn5−/− EBs display deficient activation of ERK and p38, mislocalization of cytoskeletal components, and compromised capacity to differentiate toward mesodermal lineage. Genomic analyses identified seven genes as putative direct targets of GCN5 during early differentiation, four of which are cMYC targets. These findings established a link between GCN5 and the FGF signaling pathway and highlighted specific GCN5-MYC partnerships in gene regulation during early differentiation.
Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr
International Nuclear Information System (INIS)
Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.
1993-01-01
The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Early- versus Late-Onset Alzheimer’s Disease—Differences in Functional Impairment.
Wattmo, Carina; Wallin, Åsa
2016-01-01
Background: Persons with clinical onset of Alzheimer’s disease (AD) before 65 years of age are diagnosed with early-onset AD (EOAD). The prevalence of EOAD is low, but varies among studies from 6% to 16%. Most individuals with EOAD are still working, have an active social life, and might have children living at home. Therefore, the consequences of being diagnosed early with a disease that implies progressive deterioration of cognitive performance and activities of daily living (ADL), and pers...
Early neurovascular dysfunction in a transgenic rat model of Alzheimer?s disease
Joo, Illsung L.; Lai, Aaron Y.; Bazzigaluppi, Paolo; Koletar, Margaret M.; Dorr, Adrienne; Brown, Mary E.; Thomason, Lynsie A. M.; Sled, John G.; McLaurin, JoAnne; Stefanovic, Bojana
2017-01-01
Alzheimer?s disease (AD), pathologically characterized by amyloid-? peptide (A?) accumulation, neurofibrillary tangle formation, and neurodegeneration, is thought to involve early-onset neurovascular abnormalities. Hitherto studies on AD-associated neurovascular injury have used animal models that exhibit only a subset of AD-like pathologies and demonstrated some A?-dependent vascular dysfunction and destabilization of neuronal network. The present work focuses on the early stage of disease p...
Early diagnosis of junior school age children’s posture disorders
N.S. Razumeiko
2015-01-01
Purpose: to describe specificities of early diagnosis method for junior school age children’s posture disorders. Material: in pedagogic experiment 156 junior school age children (boys and girls of 7-10 years’ age) participated. All children had no experience of training in sport circles. For determination of uniformity of the tested we fulfilled experts’ examination for presence or absence of external signs of posture disorders in frontal plane. The children’s examination was conducted by qua...
Resurgence of the dressing phase for AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Arutyunov, Gleb [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany); Dorigoni, Daniele [Centre for Particle Theory & Department of Mathematical Sciences, Durham University, Lower Mountjoy Stockton Road, Durham DH1 3LE (United Kingdom); Savin, Sergei [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany)
2017-01-13
We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS{sub 5}×S{sup 5} superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.
A CTRP5 gene S163R mutation knock-in mouse model for late-onset retinal degeneration.
Chavali, Venkata R M; Khan, Naheed W; Cukras, Catherine A; Bartsch, Dirk-Uwe; Jablonski, Monica M; Ayyagari, Radha
2011-05-15
Late-onset retinal macular degeneration (L-ORD) is an autosomal dominant inherited disorder caused by a single missense mutation (S163R) in the CTRP5/C1QTNF5 protein. Early phenotypic features of L-ORD include: dark adaptation abnormalities, nyctalopia, and drusen deposits in the peripheral macular region. Apart from posterior segment abnormalities, these patients also develop abnormally long anterior lens zonules. In the sixth decade of life the rod and cone function declines, accompanied by electroretinogram (ERG) abnormalities. Some patients also develop choroidal neovascularization and glaucoma. In order to understand the disease pathology and mechanisms involved in retinal dystrophy, we generated a knock-in (Ctrp5(+/-)) mouse model carrying the disease-associated mutation in the mouse Ctrp5/C1QTNF5 gene. These mice develop slower rod-b wave recovery consistent with early dark adaptation abnormalities, accumulation of hyperautofluorescence spots, retinal pigment epithelium abnormalities, drusen, Bruch's membrane abnormalities, loss of photoreceptors, and retinal vascular leakage. The Ctrp5(+/-) mice, which have most of the pathological features of age-related macular degeneration, are unique and may serve as a valuable model both to understand the molecular pathology of late-onset retinal degeneration and to evaluate therapies.
Directory of Open Access Journals (Sweden)
BOCA GRATIELA DANA
2015-07-01
Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.
Development of children’s early understanding of numeric structure
Directory of Open Access Journals (Sweden)
Vasilyeva, Marina
2016-09-01
Full Text Available Understanding of the base-10 structure of multi-digit numbers is one of the critical aspects in early mathematics learning. It has been documented that children from different countries vary in their use of base-10 representations. Questions concerning potential sources of this variability have been debated for decades. One commonly posited explanation is that some languages provide explicit cues about the structure of multi-digit numbers, facilitating the development of base-10 representations. In the present study, we tested this view against an alternative view, positing that variability in children’s learning of numeric structure may reflect differences in their experiences with numbers. The study examined kindergartners and first-graders from four countries: Taiwan, South Korea, the USA, and Russia. Results showed that the use of base-10 representations by American first-graders increased dramatically over the last decades, following changes in curricular guidelines. First-graders across the four countries showed some differences in performance (however, not consistent with the language account, whereas kindergartners performed comparably despite the differences in their languages. The results suggest that the nature of early math instruction may be critical for children’s developing understanding of numeric structure.
Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Ackley, K.; Adams, C.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Aggarwal, N.; Aguiar, O. D.; Ain, A.; Ajith, P.; Allen, B.; Altin, P. A.; Amariutei, D. V.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arun, K. G.; Ashton, G.; Ast, M.; Aston, S. M.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P. T.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barr, B.; Barsotti, L.; Bartlett, J.; Bartos, I.; Bassiri, R.; Batch, J. C.; Baune, C.; Behnke, B.; Bell, A. S.; Bell, C. J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Birney, R.; Biscans, S.; Bisht, A.; Biwer, C.; Blackburn, J. K.; Blair, C. D.; Blair, D.; Blair, R. M.; Bock, O.; Bodiya, T. P.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, C.; Bork, R.; Bose, S.; Brady, P. R.; Braginsky, V. B.; Brau, J. E.; Brinkmann, M.; Brockill, P.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Buonanno, A.; Byer, R. L.; Cadonati, L.; Cahillane, C.; Calderón Bustillo, J.; Callister, T.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Caride, S.; Caudill, S.; Cavaglià, M.; Cepeda, C.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chen, H. Y.; Chen, Y.; Cheng, C.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Collette, C. G.; Cominsky, L.; Constancio, M.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Countryman, S. T.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Dal Canton, T.; Danilishin, S. L.; Danzmann, K.; Darman, N. S.; Dave, I.; Daveloza, H. P.; Davies, G. S.; Daw, E. J.; DeBra, D.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; DeRosa, R.; DeSalvo, R.; Dhurandhar, S.; Díaz, M. C.; Di Palma, I.; Dojcinoski, G.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferreira, E. C.; Fisher, R. P.; Fletcher, M.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gaonkar, S. G.; Gaur, G.; Gehrels, N.; George, J.; Gergely, L.; Ghosh, A.; Giaime, J. A.; Giardina, K. D.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Graef, C.; Graff, P. B.; Grant, A.; Gras, S.; Gray, C.; Green, A. C.; Grote, H.; Grunewald, S.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Heintze, M. C.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jang, H.; Jani, K.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, N.; Kim, N.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kozak, D. B.; Kringel, V.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, K.; Lenon, A.; Leong, J. R.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lormand, M.; Lough, J. D.; Lück, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McWilliams, S. T.; Meadors, G. D.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Miao, H.; Middleton, H.; Mikhailov, E. E.; Mukund, K. N.; Miller, J.; Millhouse, M.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Mohapatra, S. R. P.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P. G.; Mytidis, A.; Nayak, R. K.; Necula, V.; Nedkova, K.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nitz, A.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pekowsky, L.; Pele, A.; Penn, S.; Pereira, R.; Perreca, A.; Phelps, M.; Pierro, V.; Pinto, I. M.; Pitkin, M.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Principe, M.; Privitera, S.; Prokhorov, L.; Puncken, O.; Pürrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Raymond, V.; Read, J.; Reed, C. M.; Reid, S.; Reitze, D. H.; Rew, H.; Riles, K.; Robertson, N. A.; Robie, R.; Rollins, J. G.; Roma, V. J.; Romanov, G.; Romie, J. H.; Rowan, S.; Rüdiger, A.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sergeev, A.; Serna, G.; Sevigny, A.; Shaddock, D. A.; Shahriar, M. S.; Shaltev, M.; Shao, Z.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siemens, X.; Sigg, D.; Silva, A. D.; Simakov, D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, J. R.; Smith, N. D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Strauss, N. A.; Strigin, S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Szczepańczyk, M. J.; Talukder, D.; Tanner, D. B.; Tápai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Torres, C. V.; Torrie, C. I.; Töyrä, D.; Traylor, G.; Trifirò, D.; Tse, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vander-Hyde, D. C.; van Veggel, A. A.; Vass, S.; Vaulin, R.; Vecchio, A.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Vinciguerra, S.; Vine, D. J.; Vitale, S.; Vo, T.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Weaver, B.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Weßels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J. L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, H.; Zanolin, M.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.; LIGO Scientific Collaboration
2017-03-01
In Advanced LIGO, detection and astrophysical source parameter estimation of the binary black hole merger GW150914 requires a calibrated estimate of the gravitational-wave strain sensed by the detectors. Producing an estimate from each detector's differential arm length control loop readout signals requires applying time domain filters, which are designed from a frequency domain model of the detector's gravitational-wave response. The gravitational-wave response model is determined by the detector's opto-mechanical response and the properties of its feedback control system. The measurements used to validate the model and characterize its uncertainty are derived primarily from a dedicated photon radiation pressure actuator, with cross-checks provided by optical and radio frequency references. We describe how the gravitational-wave readout signal is calibrated into equivalent gravitational-wave-induced strain and how the statistical uncertainties and systematic errors are assessed. Detector data collected over 38 calendar days, from September 12 to October 20, 2015, contain the event GW150914 and approximately 16 days of coincident data used to estimate the event false alarm probability. The calibration uncertainty is less than 10% in magnitude and 10° in phase across the relevant frequency band, 20 Hz to 1 kHz.
Energy Technology Data Exchange (ETDEWEB)
Abbott, B. P.; Abbott, R.; Abernathy, M. R.; Adhikari, R. X. [LIGO, California Institute of Technology, Pasadena, CA 91125 (United States); Abbott, T. D. [Louisiana State University, Baton Rouge, LA 70803 (United States); Acernese, F.; Addesso, P. [Università di Salerno, Fisciano, I-84084 Salerno (Italy); Ackley, K. [University of Florida, Gainesville, FL 32611 (United States); Adams, C. [LIGO Livingston Observatory, Livingston, LA 70754 (United States); Adams, T. [Laboratoire d’Annecy-le-Vieux de Physique des Particules (LAPP), Université Savoie Mont Blanc, CNRS/IN2P3, F-74941 Annecy-le-Vieux (France); Adya, V. B.; Affeldt, C.; Allen, B. [Albert-Einstein-Institut, Max-Planck-Institut für Gravitationsphysik, D-30167 Hannover (Germany); Agathos, M.; Agatsuma, K. [Nikhef, Science Park, 1098 XG Amsterdam (Netherlands); Aggarwal, N. [LIGO, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Aguiar, O. D. [Instituto Nacional de Pesquisas Espaciais, 12227-010 São José dos Campos, São Paulo (Brazil); Aiello, L. [INFN, Gran Sasso Science Institute, I-67100 L’Aquila (Italy); Ain, A. [Inter-University Centre for Astronomy and Astrophysics, Pune 411007 (India); Ajith, P. [International Centre for Theoretical Sciences, Tata Institute of Fundamental Research, Bangalore 560012 (India); Collaboration: LIGO Scientific Collaboration and Virgo Collaboration; and others
2016-12-01
This article provides supplemental information for a Letter reporting the rate of (BBH) coalescences inferred from 16 days of coincident Advanced LIGO observations surrounding the transient (GW) signal GW150914. In that work we reported various rate estimates whose 90% confidence intervals fell in the range 2–600 Gpc{sup −3} yr{sup −1}. Here we give details on our method and computations, including information about our search pipelines, a derivation of our likelihood function for the analysis, a description of the astrophysical search trigger distribution expected from merging BBHs, details on our computational methods, a description of the effects and our model for calibration uncertainty, and an analytic method for estimating our detector sensitivity, which is calibrated to our measurements.
Covas, P. B.; Effler, A.; Goetz, E.; Meyers, P. M.; Neunzert, A.; Oliver, M.; Pearlstone, B. L.; Roma, V. J.; Schofield, R. M. S.; Adya, V. B.; Astone, P.; Biscoveanu, S.; Callister, T. A.; Christensen, N.; Colla, A.; Coughlin, E.; Coughlin, M. W.; Crowder, S. G.; Dwyer, S. E.; Eggenstein, H.-B.; Hourihane, S.; Kandhasamy, S.; Liu, W.; Lundgren, A. P.; Matas, A.; McCarthy, R.; McIver, J.; Mendell, G.; Ormiston, R.; Palomba, C.; Papa, M. A.; Piccinni, O. J.; Rao, K.; Riles, K.; Sammut, L.; Schlassa, S.; Sigg, D.; Strauss, N.; Tao, D.; Thorne, K. A.; Thrane, E.; Trembath-Reichert, S.; Abbott, B. P.; Abbott, R.; Abbott, T. D.; Adams, C.; Adhikari, R. X.; Ananyeva, A.; Appert, S.; Arai, K.; Aston, S. M.; Austin, C.; Ballmer, S. W.; Barker, D.; Barr, B.; Barsotti, L.; Bartlett, J.; Bartos, I.; Batch, J. C.; Bejger, M.; Bell, A. S.; Betzwieser, J.; Billingsley, G.; Birch, J.; Biscans, S.; Biwer, C.; Blair, C. D.; Blair, R. M.; Bork, R.; Brooks, A. F.; Cao, H.; Ciani, G.; Clara, F.; Clearwater, P.; Cooper, S. J.; Corban, P.; Countryman, S. T.; Cowart, M. J.; Coyne, D. C.; Cumming, A.; Cunningham, L.; Danzmann, K.; Costa, C. F. Da Silva; Daw, E. J.; DeBra, D.; DeRosa, R. T.; DeSalvo, R.; Dooley, K. L.; Doravari, S.; Driggers, J. C.; Edo, T. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fair, H.; Galiana, A. Fernández; Ferreira, E. C.; Fisher, R. P.; Fong, H.; Frey, R.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gateley, B.; Giaime, J. A.; Giardina, K. D.; Goetz, R.; Goncharov, B.; Gras, S.; Gray, C.; Grote, H.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, E. D.; Hammond, G.; Hanks, J.; Hanson, J.; Hardwick, T.; Harry, G. M.; Heintze, M. C.; Heptonstall, A. W.; Hough, J.; Inta, R.; Izumi, K.; Jones, R.; Karki, S.; Kasprzack, M.; Kaufer, S.; Kawabe, K.; Kennedy, R.; Kijbunchoo, N.; Kim, W.; King, E. J.; King, P. J.; Kissel, J. S.; Korth, W. Z.; Kuehn, G.; Landry, M.; Lantz, B.; Laxen, M.; Liu, J.; Lockerbie, N. A.; Lormand, M.; MacInnis, M.; Macleod, D. M.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Marsh, P.; Martin, I. W.; Martynov, D. V.; Mason, K.; Massinger, T. J.; Matichard, F.; Mavalvala, N.; McClelland, D. E.; McCormick, S.; McCuller, L.; McIntyre, G.; McRae, T.; Merilh, E. L.; Miller, J.; Mittleman, R.; Mo, G.; Mogushi, K.; Moraru, D.; Moreno, G.; Mueller, G.; Mukund, N.; Mullavey, A.; Munch, J.; Nelson, T. J. N.; Nguyen, P.; Nuttall, L. K.; Oberling, J.; Oktavia, O.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ottaway, D. J.; Overmier, H.; Palamos, J. R.; Parker, W.; Pele, A.; Penn, S.; Perez, C. J.; Phelps, M.; Pierro, V.; Pinto, I.; Principe, M.; Prokhorov, L. G.; Puncken, O.; Quetschke, V.; Quintero, E. A.; Radkins, H.; Raffai, P.; Ramirez, K. E.; Reid, S.; Reitze, D. H.; Robertson, N. A.; Rollins, J. G.; Romel, C. L.; Romie, J. H.; Ross, M. P.; Rowan, S.; Ryan, K.; Sadecki, T.; Sanchez, E. J.; Sanchez, L. E.; Sandberg, V.; Savage, R. L.; Sellers, D.; Shaddock, D. A.; Shaffer, T. J.; Shapiro, B.; Shoemaker, D. H.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Sorazu, B.; Spencer, A. P.; Staley, A.; Strain, K. A.; Sun, L.; Tanner, D. B.; Tasson, J. D.; Taylor, R.; Thomas, M.; Thomas, P.; Toland, K.; Torrie, C. I.; Traylor, G.; Tse, M.; Tuyenbayev, D.; Vajente, G.; Valdes, G.; van Veggel, A. A.; Vecchio, A.; Veitch, P. J.; Venkateswara, K.; Vo, T.; Vorvick, C.; Wade, M.; Walker, M.; Ward, R. L.; Warner, J.; Weaver, B.; Weiss, R.; Weßels, P.; Willke, B.; Wipf, C. C.; Wofford, J.; Worden, J.; Yamamoto, H.; Yancey, C. C.; Yu, Hang; Yu, Haocun; Zhang, L.; Zhu, S.; Zucker, M. E.; Zweizig, J.; LSC Instrument Authors
2018-04-01
Searches are under way in Advanced LIGO and Virgo data for persistent gravitational waves from continuous sources, e.g. rapidly rotating galactic neutron stars, and stochastic sources, e.g. relic gravitational waves from the Big Bang or superposition of distant astrophysical events such as mergers of black holes or neutron stars. These searches can be degraded by the presence of narrow spectral artifacts (lines) due to instrumental or environmental disturbances. We describe a variety of methods used for finding, identifying and mitigating these artifacts, illustrated with particular examples. Results are provided in the form of lists of line artifacts that can safely be treated as non-astrophysical. Such lists are used to improve the efficiencies and sensitivities of continuous and stochastic gravitational wave searches by allowing vetoes of false outliers and permitting data cleaning.
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Gender's Effects to the Early Symptoms of Alzheimer's Disease in 5 Asian Countries.
Yang, Yuan-Han; Meguro, Kenichi; Dominguez, Jacqueline; Chen, Christopher Li-Hsian; Wang, Huali; Ong, Paulus Anam
2017-06-01
Asia has the greatest population and more patients with dementia in the world. Early recognition of clinical symptoms of Alzheimer's disease (AD) is crucial for dementia care. In order to foster collaboration in AD care, a uniformed manner to report the early clinical symptoms of AD is necessary. We have recruited clinically diagnosed patients with AD at their very mild stage with Clinical Dementia Rating (CDR) 0.5 in Taiwan, Japan, China, Philippines, and Singapore. Demographic characteristics and psychometrics including Ascertain of Dementia-8 (AD8) questionnaire were administrated to collect and report the clinical presentation in these countries. In total, 713 clinically diagnosed patients with AD at very mild stage, CDR 0.5, have been recruited from these 5 countries. "Repeats questions, stories, or statements" were consistently the frequently reported symptom across these countries. Taiwan, China, and Singapore have the higher AD8 total score compared to that in Japan and Philippines. Japan and Philippines have the gender-related differences in clinical presentation of early AD. Difficulties in using small trouble appliance and in handling complicated financial affairs were frequently reported in Japan female, compared to male, patients with AD. Identifying the clinical symptom of AD and the gender-related issues would be crucial in the dementia care in Asia.
Directory of Open Access Journals (Sweden)
Abukari I. Issaka
2014-07-01
Full Text Available This study was conducted to explore and identify factors associated with the practice of early introduction of solid, semi-solid or soft foods among infants aged 3–5 months in four Anglophone West African countries. Data sources for the analyses were the latest Demographic and Health Survey datasets of the 4 countries, namely Ghana (GDHS, 2008, Liberia (LDHS, 2007, Nigeria (NDHS, 2013 and Sierra Leone (SLDHS, 2008. Multiple logistic regression methods were used to analyze the factors associated with early introduction of solid, semi-solid or soft foods among infants aged 3–5 months, using individual-, household- and community-level determinants. The sample consisted of 2447 infants aged 3–5 months from four Anglophone West African countries: 166 in Ghana, 263 in Liberia, 1658 in Nigeria and 360 in Sierra Leone. Multivariable analyses revealed the individual factors associated with early introduction of solid, semi-solid or soft foods in these countries. These included increased infant’s age, diarrhea, acute respiratory infection and newborns perceived to be small by their mothers. Other predictors of early introduction of solid, semi-solid or soft foods were: mothers with no schooling, young mothers and fathers who worked in an agricultural industry. Public health interventions to improve exclusive breastfeeding practices by discouraging early introduction of solid, semi-solid or soft foods are needed in all 4 countries, targeting especially mothers at risk of introducing solid foods to their infants early.
Záhoráková, D; Langová, M; Brožová, K; Laštůvková, J; Kalina, Z; Rennerová, L; Martásek, P
2016-01-01
The X-linked CDKL5 gene, which encodes cyclin-dependent kinase-like 5 protein, has been implicated in early-onset encephalopathy and atypical Rett syndrome with early-onset seizures. The CDKL5 protein is a kinase required for neuronal development and morphogenesis, but its precise functions are still largely unexplored. Individuals with CDKL5 mutations present with severe global developmental delay, intractable epilepsy, and Rett-like features. A clear genotype-phenotype correlation has not been established due to an insufficient number of reported cases. The aim of this study was to analyse the CDKL5 gene in Czech patients with early-onset seizures and Rett-like features. We performed mutation screening in a cohort of 83 individuals using high-resolution melting analysis, DNA sequencing and multiplex ligation- dependent probe amplification. Molecular analyses revealed heterozygous pathogenic mutations in three girls with severe intellectual disability and intractable epilepsy starting at the age of two months. All three identified mutations, c.637G>A, c.902_977+29del105, and c.1757_1758delCT, are novel, thus significantly extending the growing spectrum of known pathogenic CDKL5 sequence variants. Our results support the importance of genetic testing of the CDKL5 gene in patients with early-onset epileptic encephalopathy and Rett-like features with early-onset seizures. This is the first study referring to molecular defects of CDKL5 in Czech cases.
Linking Baecklund and monodromy charges for strings on AdS5 x S5
International Nuclear Information System (INIS)
Arutyunov, Gleb; Zamaklar, Marija
2005-01-01
We find an explicit relation between the two known ways of generating an infinite set of local conserved charges for the string sigma model on AdS 5 x S 5 : the Baecklund and monodromy approaches. We start by constructing the two-parameter family of Baecklund transformations for the string with an arbitrary world-sheet metric. We then show that only for a special value of one of the parameters the solutions generated by this transformation are compatible with the Virasoro constraints. By solving the Baecklund equations in a non-perturbative fashion, we finally show that the generating functional of the Baecklund conservation laws is equal to a certain sum of the quasi-momenta. The positions of the quasi-momenta in the complex spectral plane are uniquely determined by the real parameter of the Baecklund transform
Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite
Yu, Wen; Fang, Pengfei; Wang, Shaojie
2014-12-01
Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.
The blue light indicator in rubidium 5S-5P-5D cascade excitation
Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan
2017-07-01
The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.
Early experience with a 7.5-MHz vaginal scanner in the female pelvis
International Nuclear Information System (INIS)
Bree, R.L.; Edwards, M.G.; Chan, K.M.
1986-01-01
A 7.5-MHz vaginal US probe with a 112 0 sector transducer has been utilized for preliminary evaluation of the usefulness of vaginal scanning in the gynecologic and obstetric patient. The normal uterus and ovaries can be imaged in sagittal and coronal planes. Infertility patients being evaluated for ovarian follicle number and size are easily scanned. Patients with early pregnancy can be evaluated for fetal viability as early as 5 weeks' menstrual age. Four-millimeter crown-rump lengths with fetal heart activity have been observed for which correlative transabdominal scanning did not demonstrate a fetus. Small tubal pregnancies and small amounts of pelvic fluid have also been identified. Vaginal scanning should become an integral part of routine gynecologic and obstetric US
Western public awareness of the Ukrainian famine in the early 1930s
Edvīns Šnore
2013-01-01
Doctoral thesis: Western public awareness of the Ukrainian famine in the early 1930s Doctoral thesis “Western public awareness of the Ukrainian famine in the early 1930s” analyses the reaction of the West to the Ukrainian famine in 1932/33. The thesis chronologically reviews 1932/33 Western press publications about the Ukrainian famine, analyses their content and factors, which influenced it such as the work of Western correspondents in Moscow, their motivations, Soviet censors...
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Noncentral extension of the $AdS_5 x S^5$ superalgebra supermultiplet of brane charges
Lee, S; Lee, Sangmin; Park, Jeong-Hyuck
2004-01-01
We propose an extension of the su(2,2|4) superalgebra to incorporate the F1/D1 string charges in type IIB string theory on the AdS_5 X S^5 background, or the electro-magnetic charges in the dual super Yang-Mills theory. With the charges introduced, the superalgebra inevitably undergoes a noncentral extension, as noted recently in [1]. After developing a group theoretical method of obtaining the noncentral extension, we show that the charges form a certain nonunitary representation of the original unextended superalgebra, subject to some constraints. We solve the constraints completely and show that, apart from the su(2,2|4) generators, there exist 899 complex brane charges in the extended algebra. Explicitly we present all the super-commutators among them.
Impact of star formation inhomogeneities on merger rates and interpretation of LIGO results
International Nuclear Information System (INIS)
O'Shaughnessy, R; Kopparapu, R K; Belczynski, K
2012-01-01
Within the next decade, ground based gravitational-wave detectors are in principle capable of determining the compact object merger rate per unit volume of the local universe to better than 20% with more than 30 detections. These measurements will constrain our models of stellar, binary and star cluster evolution in the nearby present-day and ancient universe. We argue that the stellar models are sensitive to heterogeneities (in age and metallicity at least) in such a way that the predicted merger rates are subject to an additional 30-50% systematic errors unless these heterogeneities are taken into account. Without adding new electromagnetic constraints on massive binary evolution or relying on more information from each merger (e.g., binary masses and spins), as few as the 5 merger detections could exhaust the information available in a naive comparison to merger rate predictions. As a concrete example immediately relevant to analysis of initial and enhanced LIGO results, we use a nearby-universe catalog to demonstrate that no one tracer of stellar content can be consistently used to constrain merger rates without introducing a systematic error of order O(30%) at 90% confidence (depending on the type of binary involved). For example, though binary black holes typically take many Gyr to merge, binary neutron stars often merge rapidly; different tracers of stellar content are required for these two types. More generally, we argue that theoretical binary evolution can depend sufficiently sensitively on star-forming conditions-even assuming no uncertainty in binary evolution model-that the distribution of star-forming conditions must be incorporated to reduce the systematic error in merger rate predictions below roughly 40%. We emphasize that the degree of sensitivity to star-forming conditions depends on the binary evolution model and on the amount of relevant variation in star-forming conditions. For example, if after further comparison with electromagnetic and
Whole Exome Analysis of Early Onset Alzheimer’s Disease
2017-04-01
Alzheimer’s Disease 5a. CONTRACT NUMBER W81XWH-12-1-0013 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Margaret A. Pericak-Vance, Ph.D...Gerald D. Schellenberg, Goldie S . Byrd, Jonathan L. Haines, Margaret A. Pericak-Vance, and the Alzheimer Disease Genetics Consortium. ABCA7 Frameshift...Alzheimer’s & Parkinson’s Diseases (AD/PD), Vienna, Austria, Mar 29-Apr 2, 2017: Cukier HN, Gross SP, Kunkle BW, Rolati S , Hamilton-Nelson KL, Whitehead PL
The early S-matrix theory and its propagation (1942-1952)
International Nuclear Information System (INIS)
Rechenberg, H.
1989-01-01
This paper describes the development of S-matrix theory in the 1940s and 1950s, which described the scattering and emission problems in elementary particle theory. Its chief architect, Werner Heisenberg, worked in Germany all through the Second World War. Communication problems were intense and made discussion of this useful tool very difficult. Werner Heisenberg's collaborative efforts with Hendrik Kramers in Holland and Christian Moeller are noted. The theory had its opponents and their objections are described. As other scientists took up the theory it was used in new ways such as in quantum electrodynamics, and to predict the creation of massive particles by analyzing S-matrix threshold behaviour. Although the theory fell into disfavour in the early 1950s, it was later readopted when ideas such as crossed channels and analytic behaviour in the complex angular-momentum plane needed explanations. (UK)
STRUCTURAL EVOLUTION OF EARLY-TYPE GALAXIES TO z = 2.5 IN CANDELS
Energy Technology Data Exchange (ETDEWEB)
Chang, Yu-Yen; Van der Wel, Arjen; Rix, Hans-Walter [Max-Planck Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany); Holden, Bradford; Faber, S. M.; Mozena, Mark; Guo Yicheng; Kocevski, Dale D. [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Bell, Eric F. [Department of Astronomy, University of Michigan, 500 Church Street, Ann Arbor, MI 48109 (United States); McGrath, Elizabeth J. [Department of Physics and Astronomy, Colby College, Waterville, ME 04901 (United States); Wuyts, Stijn [Max-Planck-Institut fuer Extraterrestrische Physik, Postfach 1312, Giessenbachstr., D-85741 Garching (Germany); Haeussler, Boris [Schools of Physics and Astronomy, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Barden, Marco [Institute of Astro- and Particle Physics, University of Innsbruck, Technikerstrasse 25, A-6020 Innsbruck (Austria); Ferguson, Henry C.; Grogin, Norman A.; Koekemoer, Anton M.; Huang, Kuang-Han [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Galametz, Audrey [INAF-Osservatorio di Roma, Via Frascati 33, I-00040 Monteporzio (Italy); Dekel, Avishai [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Hathi, Nimish P., E-mail: chang@mpia.de [Observatories of the Carnegie Institution for Science, Pasadena, CA (United States); and others
2013-08-20
Projected axis ratio measurements of 880 early-type galaxies at redshifts 1 < z < 2.5 selected from CANDELS are used to reconstruct and model their intrinsic shapes. The sample is selected on the basis of multiple rest-frame colors to reflect low star-formation activity. We demonstrate that these galaxies as an ensemble are dust-poor and transparent and therefore likely have smooth light profiles, similar to visually classified early-type galaxies. Similar to their present-day counterparts, the z > 1 early-type galaxies show a variety of intrinsic shapes; even at a fixed mass, the projected axis ratio distributions cannot be explained by the random projection of a set of galaxies with very similar intrinsic shapes. However, a two-population model for the intrinsic shapes, consisting of a triaxial, fairly round population, combined with a flat (c/a {approx} 0.3) oblate population, adequately describes the projected axis ratio distributions of both present-day and z > 1 early-type galaxies. We find that the proportion of oblate versus triaxial galaxies depends both on the galaxies' stellar mass, and-at a given mass-on redshift. For present-day and z < 1 early-type galaxies the oblate fraction strongly depends on galaxy mass. At z > 1, this trend is much weaker over the mass range explored here (10{sup 10} < M{sub *}/M{sub Sun} < 10{sup 11}), because the oblate fraction among massive (M{sub *} {approx} 10{sup 11} M{sub Sun }) was much higher in the past: 0.59 {+-} 0.10 at z > 1, compared to 0.20 {+-} 0.02 at z {approx} 0.1. When combined with previous findings that the number density and sizes of early-type galaxies substantially increase over the same redshift range, this can be explained by the gradual emergence of merger-produced elliptical galaxies, at the expense of the destruction of pre-existing disks that were common among their high-redshift progenitors. In contrast, the oblate fraction among low-mass early-type galaxies (log (M{sub *}/M{sub Sun }) < 10.5
Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo
2010-04-01
Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.
Strong decays and dipion transitions of Y(5S)
International Nuclear Information System (INIS)
Simonov, Yu.A.; Veselov, A.I.
2009-01-01
Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ
Programme [11. international LISA symposium, Zurich (Switzerland), 5-9 September 2016
International Nuclear Information System (INIS)
2017-01-01
Monday, 5th of September 2016 Chair: M. Colpi S. Vitale The LTP experiment on LISA Pathfinder and its first results K. Dooley Advanced LIGO: news from the dark universe B. Schutz LIGOs Black Holes and Science in the LISA Era P. McNamara LISA Pathfinder: First steps to observing gravitational waves from space M. Hewitson In-flight Performance of the Optical Metrology System on LISA Pathfinder W. Weber Physical model of the LISA Pathfinder differential acceleration measurement and its application to LISA K. Danzmann The Status of LISA Chair: O. Jennrich J. Martino On-flight characterization of Coldgas micro-Newton thrusters for Lisa Pathfinder M. Nofrarias Magnetic force noise in LISA Pathfinder L. Ferraioli The LISA Pathfinder GRS Front-End Electronics D. Vetrugno The Δ g workflow: from measured displacements to the differential external acceleration. A. Wittchen Coupling of relative intensity noise and pathlength noise to the length measurement in the optical metrology system of LISA Pathfinder S. Paczkowski Laser frequency stabilisation and interferometer path length differences on LISA Pathfinder R. Giusteri The free-fall mode experiment on LISA Pathfinder: first results P. Wass Electrostatic test-mass force-noise disturbances as measured by LISA Pathfinder R. Dolesi The contribution of Brownian noise from viscous gas damping to the differential acceleration noise measured in LISA Pathfinder between two nominally free falling test masses C. Trenkel The engineering of LISA Pathfinder – the quietest laboratory ever flown in space W. Klipstein LISA-derived Flight Phasemeter on the GRACE Follow-On Mission P. Laufer MEMS Ion Thruster Chips to Significantly Enhance Cold Gas Thruster Lifetime for LISA M. Tinto Enhanced Gravitational Wave Science with LISA and gLISA Tuesday, 6th of September 2016 Chair: P. McNamara F. Ricci Advanced VIRGO: State of the Art C. Belczynski Evolutionary predictions in the advanced LIGO/Virgo era A. Sesana The promise of multi
Making safety an integral part of 5S in healthcare.
Ikuma, Laura H; Nahmens, Isabelina
2014-01-01
Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.
Energy Technology Data Exchange (ETDEWEB)
Kowalski, K., E-mail: kamil.kowalski@put.poznan.pl [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland); Jurczyk, M.U. [Division of Mother’s and Child’s Health, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Wirstlein, P.K. [Department of Gynecology and Obstetrics, Division of Reproduction, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Jakubowicz, J.; Jurczyk, M. [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland)
2017-05-15
Highlights: • Ultrafine grained composites were formed by consolidating mechanically alloyed powders. • Mechanical properties were sensitive to the content of 45S5 Bioglass in Mg-4Y-5.5Dy-0.5Zr alloy. • Fluoride treated composites displayed superior corrosion resistance in Ringer solution. • Composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material. - Abstract: Bulk samples of an ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-x wt% 45S5 Bioglass (x = 0, 5) and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites have been synthesized by consolidating mechanically alloyed powders. The influence of the chemical composition on the microstructure, mechanical properties and corrosion behavior of bulk composites were studied. The sintering of (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass powders led to the formation of a bulk composite with grain size of approx. 95 nm. The corrosion behavior of Mg-based composites before and after hydrofluoric acid treatment was also investigated. The ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass composite was more corrosion resistant than the bulk Mg-4Y-5.5Dy-0.5Zr alloy after HF treatment. The in vitro biocompatibility of synthesized composites was evaluated and compared with microcrystalline magnesium. Magnesium, (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material.
Mattera, Shira; Morris, Pamela
2017-01-01
Early math ability is one of the best predictors of children's math and reading skills into late elementary school. Children with stronger math proficiency in elementary school, in turn, are more likely to graduate from high school and attend college. However, early math skills have not historically been a major focus of instruction in preschool…
International Nuclear Information System (INIS)
Zhang, Jia-Lin; Cai, Rong-Gen; Yu, Hongwei
2015-01-01
We study the thermodynamics and thermodynamic geometry of a five-dimensional Schwarzschild AdS black hole in AdS_5×S"5 spacetime by treating the cosmological constant as the number of colors in the boundary gauge theory and its conjugate quantity as the associated chemical potential. It is found that the chemical potential is always negative in the stable branch of black hole thermodynamics and it has a chance to be positive, but appears in the unstable branch. We calculate the scalar curvatures of the thermodynamical Weinhold metric, Ruppeiner metric and Quevedo metric, respectively and we find that the scalar curvature in the Weinhold metric is always vanishing, while in the Ruppeiner metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed chemical potential, and in the Quevedo metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed number of colors and to the vanishing of the heat capacity with fixed chemical potential.
Energy Technology Data Exchange (ETDEWEB)
Singer, Leo P.; Cenko, S. Bradley; Gehrels, Neil; Cannizzo, John [Astroparticle Physics Laboratory, NASA Goddard Space Flight Center, Mail Code 661, Greenbelt, MD 20771 (United States); Chen, Hsin-Yu; Holz, Daniel E.; Farr, Ben [Department of Physics, Enrico Fermi Institute, and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Farr, Will M.; Veitch, John; Berry, Christopher P. L.; Mandel, Ilya [School of Physics and Astronomy, University of Birmingham, Birmingham, B15 2TT (United Kingdom); Price, Larry R.; Raymond, Vivien [LIGO Laboratory, California Institute of Technology, Pasadena, CA 91125 (United States); Kasliwal, Mansi M. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Nissanke, Samaya [Institute of Mathematics, Astrophysics and Particle Physics, Radboud University, Heyendaalseweg 135, 6525 AJ Nijmegen (Netherlands); Coughlin, Michael [Department of Physics and Astronomy, Harvard University, Cambridge, MA 02138 (United States); Urban, Alex L. [Leonard E. Parker Center for Gravitation, Cosmology, and Astrophysics, University of Wisconsin–Milwaukee, Milwaukee, WI 53201 (United States); Vitale, Salvatore; Mohapatra, Satya [LIGO Laboratory, Massachusetts Institute of Technology, 185 Albany Street, Cambridge, MA 02139 (United States); Graff, Philip [Department of Physics, University of Maryland, College Park, MD 20742 (United States)
2016-09-20
The Advanced Laser Interferometer Gravitational-wave Observatory (LIGO) discovered gravitational waves (GWs) from a binary black hole merger in 2015 September and may soon observe signals from neutron star mergers. There is considerable interest in searching for their faint and rapidly fading electromagnetic (EM) counterparts, though GW position uncertainties are as coarse as hundreds of square degrees. Because LIGO’s sensitivity to binary neutron stars is limited to the local universe, the area on the sky that must be searched could be reduced by weighting positions by mass, luminosity, or star formation in nearby galaxies. Since GW observations provide information about luminosity distance, combining the reconstructed volume with positions and redshifts of galaxies could reduce the area even more dramatically. A key missing ingredient has been a rapid GW parameter estimation algorithm that reconstructs the full distribution of sky location and distance. We demonstrate the first such algorithm, which takes under a minute, fast enough to enable immediate EM follow-up. By combining the three-dimensional posterior with a galaxy catalog, we can reduce the number of galaxies that could conceivably host the event by a factor of 1.4, the total exposure time for the Swift X-ray Telescope by a factor of 2, the total exposure time for a synoptic optical survey by a factor of 2, and the total exposure time for a narrow-field optical telescope by a factor of 3. This encourages us to suggest a new role for small field of view optical instruments in performing targeted searches of the most massive galaxies within the reconstructed volumes.
International Nuclear Information System (INIS)
Singer, Leo P.; Cenko, S. Bradley; Gehrels, Neil; Cannizzo, John; Chen, Hsin-Yu; Holz, Daniel E.; Farr, Ben; Farr, Will M.; Veitch, John; Berry, Christopher P. L.; Mandel, Ilya; Price, Larry R.; Raymond, Vivien; Kasliwal, Mansi M.; Nissanke, Samaya; Coughlin, Michael; Urban, Alex L.; Vitale, Salvatore; Mohapatra, Satya; Graff, Philip
2016-01-01
The Advanced Laser Interferometer Gravitational-wave Observatory (LIGO) discovered gravitational waves (GWs) from a binary black hole merger in 2015 September and may soon observe signals from neutron star mergers. There is considerable interest in searching for their faint and rapidly fading electromagnetic (EM) counterparts, though GW position uncertainties are as coarse as hundreds of square degrees. Because LIGO’s sensitivity to binary neutron stars is limited to the local universe, the area on the sky that must be searched could be reduced by weighting positions by mass, luminosity, or star formation in nearby galaxies. Since GW observations provide information about luminosity distance, combining the reconstructed volume with positions and redshifts of galaxies could reduce the area even more dramatically. A key missing ingredient has been a rapid GW parameter estimation algorithm that reconstructs the full distribution of sky location and distance. We demonstrate the first such algorithm, which takes under a minute, fast enough to enable immediate EM follow-up. By combining the three-dimensional posterior with a galaxy catalog, we can reduce the number of galaxies that could conceivably host the event by a factor of 1.4, the total exposure time for the Swift X-ray Telescope by a factor of 2, the total exposure time for a synoptic optical survey by a factor of 2, and the total exposure time for a narrow-field optical telescope by a factor of 3. This encourages us to suggest a new role for small field of view optical instruments in performing targeted searches of the most massive galaxies within the reconstructed volumes.
CDKL5 Mutations in Boys With Encephalopathy and Early-Onset Intractable Epilepsy
Directory of Open Access Journals (Sweden)
J Gordon Millichap
2008-10-01
Full Text Available Clinical and EEG data of 3 Italian boys (ages 3, 9, and 13 years with severe early-onset encephalopathy, mental retardation, facial dysmorphisms, and intractable epilepsy were found to carry missense mutations in the CDKL5 gene, in a report from Troina, Italy.
Cognitive rehabilitation for elderly people with early-stage Alzheimer?s disease
Kim, Seyun
2015-01-01
[Purpose] The purpose of this study was to investigate the effect of cognitive rehabilitation including tasks of cognitive training on performance of everyday activities in elderly people with early-stage Alzheimer?s disease. [Subjects and Methods] Forty-three elderly people (15 men, 28 women) with a diagnosis of Alzheimer?s disease who had a Mini-Mental State Examination (MMSE) score of 18 or above were randomly assigned to two groups: the cognitive rehabilitation group (experimental) and co...
Bektik, Emre; Dennis, Adrienne; Pawlowski, Gary; Zhou, Chen; Maleski, Danielle; Takahashi, Satoru; Laurita, Kenneth R; Deschênes, Isabelle; Fu, Ji-Dong
2018-05-04
Direct reprogramming of fibroblasts into induced cardiomyocytes (iCMs) holds a great promise for regenerative medicine and has been studied in several major directions. However, cell-cycle regulation, a fundamental biological process, has not been investigated during iCM-reprogramming. Here, our time-lapse imaging on iCMs, reprogrammed by Gata4, Mef2c, and Tbx5 (GMT) monocistronic retroviruses, revealed that iCM-reprogramming was majorly initiated at late-G1- or S-phase and nearly half of GMT-reprogrammed iCMs divided soon after reprogramming. iCMs exited cell cycle along the process of reprogramming with decreased percentage of 5-ethynyl-20-deoxyuridine (EdU)⁺/α-myosin heavy chain (αMHC)-GFP⁺ cells. S-phase synchronization post-GMT-infection could enhance cell-cycle exit of reprogrammed iCMs and yield more GFP high iCMs, which achieved an advanced reprogramming with more expression of cardiac genes than GFP low cells. However, S-phase synchronization did not enhance the reprogramming with a polycistronic-viral vector, in which cell-cycle exit had been accelerated. In conclusion, post-infection synchronization of S-phase facilitated the early progression of GMT-reprogramming through a mechanism of enhanced cell-cycle exit.
Correlates of Early versus Later Initiation into Sex Work in Two Mexico–U.S. Border Cities
Loza, Oralia; Strathdee, Steffanie A.; Lozada, Remedios; Staines, Hugo; Ojeda, Victoria D.; Martínez, Gustavo A.; Amaro, Hortensia; Patterson, Thomas L.
2009-01-01
Purpose To examine correlates of early initiation into sex work in two Mexico–U.S. border cities. Methods Female sex workers (FSWs) ≥18 years without known HIV infection living in Tijuana and Ciudad Juarez who had recent unprotected sex with clients underwent baseline interviews. Correlates of initiation into sex work before age 18 were identified with logistic regression. Results Of 920 FSWs interviewed in Tijuana (N=474) and Ciudad Juarez (N=446), 9.8% (N=90) were early initiators (<18 years) into sex work. Median age of entry into sex work was 26 years (range: 6–58). After adjusting for age, compared to older initiators, early initiators were more likely to use inhalants (21.1% vs 9.6%, p=0.002), initiate sex work to pay for alcohol (36.7% vs 18.4%, p<.001), report abuse as a child (42.2% vs 18.7%, p<.0001), and they were less likely to be migrants (47.8% vs 62.3%, p=0.02). Factors independently associated with early initiation included inhalant use (adjOR=2.39), initiating sex work to pay for alcohol (adjOR=1.88) and history of child abuse (adjOR=2.92). Factors associated with later initiation included less education (adjOR=0.43 per 5-year increase), migration (adjOR=0.47), and initiating sex work for better pay (adjOR=0.44) or to support children (adjOR=0.03). Conclusions Different pathways for entering sex work are apparent among younger versus older females in the Mexico–U.S. border region. Among girls, interventions are needed to prevent inhalant use and child abuse and to offer coping skills; among older initiators, income-generating strategies, childcare, and services for migrants may help to delay or prevent entry into sex work. PMID:20123256
Limits of Astrophysics with Gravitational-Wave Backgrounds
Directory of Open Access Journals (Sweden)
Thomas Callister
2016-08-01
Full Text Available The recent Advanced LIGO detection of gravitational waves from the binary black hole GW150914 suggests there exists a large population of merging binary black holes in the Universe. Although most are too distant to be individually resolved by advanced detectors, the superposition of gravitational waves from many unresolvable binaries is expected to create an astrophysical stochastic background. Recent results from the LIGO and Virgo Collaborations show that this astrophysical background is within reach of Advanced LIGO. In principle, the binary black hole background encodes interesting astrophysical properties, such as the mass distribution and redshift distribution of distant binaries. However, we show that this information will be difficult to extract with the current configuration of advanced detectors (and using current data analysis tools. Additionally, the binary black hole background also constitutes a foreground that limits the ability of advanced detectors to observe other interesting stochastic background signals, for example, from cosmic strings or phase transitions in the early Universe. We quantify this effect.
Genre and text-type conventions in Early Modern Women´s recipe books
Directory of Open Access Journals (Sweden)
Isabel de la Cruz Cabanillas
2017-07-01
Full Text Available Early Modern recipe books map onto women’s roles in the period. Women were responsible for the health and care of all their household members. This explains the women´s interest in gathering information on the topic, usually put together in manuscripts which circulated in the women´s intellectual and domestic circles to serve this purpose. The manuscript is viewed as an artefact likely to be changed to meet the needs of its users. The article seeks to explore genre and text-type conventions in a corpus of medical and culinary recipes written or compiled by women in the seventeenth and eighteenth centuries of Early Modern Britain. The recipes in this period show patterns of continuity from medieval times but also patterns of variation to foreshadow the shape of modern recipes.
On semiclassical analysis of pure spinor superstring in an AdS{sub 5} x S{sup 5} background
Energy Technology Data Exchange (ETDEWEB)
Aisaka, Yuri [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sao Paulo State Univ. (Brazil). Inst. de Fisica Teorica; Ibiapina Bevilaqua, L. [Univ. Federal do Rio Grande do Norte, Natal (Brazil). Esola de Ciencias e Tecnologia; Vallilo, Brenno C. [Santiago Univ. (Chile). Dept. de Ciencias Fisicas
2012-06-15
Relation between semiclassical analyses of Green-Schwarz and pure spinor formalisms in an AdS{sub 5} x S{sup 5} background is clarified. It is shown that the two formalisms have identical semiclassical partition functions for a simple family of classical solutions. It is also shown that, when the classical string is furthermore rigid, this in turn implies that the two formalisms predict the same one-loop corrections to spacetime energies.
M5-branes, orientifolds, and S-duality
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yoonseok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of); Kim, Joonho [School of Physics, Korea Institute for Advanced Study,85 Hoegiro, Seoul (Korea, Republic of); Kim, Seok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of)
2016-12-29
We study the instanton partition functions of 5d maximal super Yang-Mills theories with all classical gauge groups. They are computed from the ADHM quantum mechanics of the D0-D4-O4 systems. Our partition functions respect S-dualities of the circle compactified Yang-Mills theories and various orientifold backgrounds. We also compute and study the S{sup 5} partition functions that correspond to the 6d (2,0) superconformal indices. Our SO(2N) index takes the form of the vacuum character of W{sub D} algebra in a special limit, supporting the W algebra conjecture. We propose new indices for (2,0) theories with outer automorphism twists along the temporal circle, obtained from non-simply-laced SYMs on S{sup 5}.
Digitized Spiral Drawing: A Possible Biomarker for Early Parkinson’s Disease
San Luciano, Marta; Wang, Cuiling; Ortega, Roberto A.; Yu, Qiping; Boschung, Sarah; Soto-Valencia, Jeannie; Bressman, Susan B.; Lipton, Richard B.; Pullman, Seth; Saunders-Pullman, Rachel
2016-01-01
Introduction Pre-clinical markers of Parkinson’s Disease (PD) are needed, and to be relevant in pre-clinical disease, they should be quantifiably abnormal in early disease as well. Handwriting is impaired early in PD and can be evaluated using computerized analysis of drawn spirals, capturing kinematic, dynamic, and spatial abnormalities and calculating indices that quantify motor performance and disability. Digitized spiral drawing correlates with motor scores and may be more sensitive in detecting early changes than subjective ratings. However, whether changes in spiral drawing are abnormal compared with controls and whether changes are detected in early PD are unknown. Methods 138 PD subjects (50 with early PD) and 150 controls drew spirals on a digitizing tablet, generating x, y, z (pressure) data-coordinates and time. Derived indices corresponded to overall spiral execution (severity), shape and kinematic irregularity (second order smoothness, first order zero-crossing), tightness, mean speed and variability of spiral width. Linear mixed effect adjusted models comparing these indices and cross-validation were performed. Receiver operating characteristic analysis was applied to examine discriminative validity of combined indices. Results All indices were significantly different between PD cases and controls, except for zero-crossing. A model using all indices had high discriminative validity (sensitivity = 0.86, specificity = 0.81). Discriminative validity was maintained in patients with early PD. Conclusion Spiral analysis accurately discriminates subjects with PD and early PD from controls supporting a role as a promising quantitative biomarker. Further assessment is needed to determine whether spiral changes are PD specific compared with other disorders and if present in pre-clinical PD. PMID:27732597
Directory of Open Access Journals (Sweden)
Eleni Papadopoulou
2017-09-01
Full Text Available Abstract Background Cell phone use during pregnancy is a public health concern. We investigated the association between maternal cell phone use in pregnancy and child’s language, communication and motor skills at 3 and 5 years. Methods This prospective study includes 45,389 mother-child pairs, participants of the MoBa, recruited at mid-pregnancy from 1999 to 2008. Maternal frequency of cell phone use in early pregnancy and child language, communication and motor skills at 3 and 5 years, were assessed by questionnaires. Logistic regression was used to estimate the associations. Results No cell phone use in early pregnancy was reported by 9.8% of women, while 39%, 46.9% and 4.3% of the women were categorized as low, medium and high cell phone users. Children of cell phone user mothers had 17% (OR = 0.83, 95% CI: 0.77, 0.89 lower adjusted risk of having low sentence complexity at 3 years, compared to children of non-users. The risk was 13%, 22% and 29% lower by low, medium and high maternal cell phone use. Additionally, children of cell phone users had lower risk of low motor skills score at 3 years, compared to children of non-users, but this association was not found at 5 years. We found no association between maternal cell phone use and low communication skills. Conclusions We reported a decreased risk of low language and motor skills at three years in relation to prenatal cell phone use, which might be explained by enhanced maternal-child interaction among cell phone users. No evidence of adverse neurodevelopmental effects of prenatal cell phone use was reported.
High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.
Baskakov, O I; Civis, S; Kawaguchi, K
2005-03-15
In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.
International Nuclear Information System (INIS)
Zameroski, Nathan D; Hager, Gordon D; Erickson, Christopher J; Burke, John H
2014-01-01
Doppler free two photon absorption spectroscopy was employed to measure the pressure broadening and frequency shift rates of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) (778.105 nm) and the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) (760.126 nm) two photon transitions in 85 Rb by the noble gases and N 2 . To our knowledge, these rates are reported on for the first time. The self-broadening and shift rate of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) transition and self -broadening rate of the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) transition were also measured. The temperature dependence of the self-frequency shift (Rb-Rb collisions) of these transitions is presented. Helium diffusion rates through Quartz and Pyrex cells are also calculated and the implication of helium diffusion through glass vapor cells is discussed in regards to atomic frequency standards based on these transitions. Experimental pressure broadening and shift rates are compared to theoretically calculated rates assuming a 6, 8 or 6, 8, 10 difference potential and pseudo potential model. Reasonable agreement is achieved between experimental and theoretical values. (paper)
Large spin limit of AdS5xS5 string theory and low energy expansion of ferromagnetic spin chains
International Nuclear Information System (INIS)
Kruczenski, M.; Ryzhov, A.V.; Tseytlin, A.A.
2004-01-01
By considering AdS 5 xS 5 string states with large S 5 angular momenta one can provide non-trivial quantitative checks of the AdS/CFT duality. A string rotating in S 5 with two angular momenta J 1 , J 2 is dual to an operator in N=4 SYM theory whose conformal dimension can be computed by diagonalizing a (generalization of) spin 1/2 Heisenberg chain Hamiltonian. It was recently argued and verified to lowest order in a large J=J 1 +J 2 expansion, that the Heisenberg chain can be described using a non-relativistic low energy effective 2d action for a unit vector field n i which exactly matches the corresponding large J limit of the classical AdS 5 xS 5 string action. In this paper we show that this agreement extends to the next order and develop a systematic procedure for computing higher orders in such large angular momentum expansion. This involves several non-trivial steps. On the string side, we need to choose a special gauge with a non-diagonal world-sheet metric which insures that the angular momentum is uniformly distributed along the string, as indeed is the case on the spin chain side. We need also to implement an order by order redefinition of the field n i to get an action linear in the time derivative. On the spin chain side, it turns out to be crucial to include the effects of integrating out short wave-length modes. In this way we gain a better understanding of how (a subsector of) the string sigma model emerges from the dual gauge theory, allowing us to demonstrate the duality beyond comparing particular examples of states with large J
Catherine II’s the early reign of Oleg: Sarti, Canobbio and Pashkevich working towards an ideal
Directory of Open Access Journals (Sweden)
Giust Anna
2016-01-01
Full Text Available This paper focuses on Catherine II’s The Early Reign of Oleg (1790 as a demonstrative performance of the sovereign’s policy. In the context of Catherine’s early nationalistic pride and her ‘Greek project’, the performance is understood as a synthesis embodying in music the vision of Russia as an Empire ready to receive the heritage of Byzantium, thanks to Sarti’s use of modes combined with the Russian folk elements introduced by Canobbio and Pashkevich. In this context, Nikolay L’vov represents the joining link, having theorized that Russian folk music originated from ancient Greek music.
Implementation of 5S Method for Ergonomic Laboratory
Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus
2017-06-01
This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment
The heavy quarkonium spectrum at order $m\\alpha_{s}^{5}\\ln\\alpha_{s}$
Brambilla, Nora; Soto, Joan; Vairo, Antonio
1999-01-01
We compute the complete leading-log terms of the next-to-next-to-next-to-leading-order corrections to potential NRQCD. As a by-product we obtain the leading logs at $O(m\\alpha_s^5)$ in the heavy quarkonium spectrum. These leading logs, when $\\Lambda_{QCD} \\ll m\\alpha_s^2$, give the complete $O(m\\alpha_s^5 \\ln \\alpha_s)$ corrections to the heavy quarkonium spectrum.
The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.
Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo
2017-10-27
The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon
International Nuclear Information System (INIS)
Johnson, W. R.; Cheng, K. T.
2001-01-01
Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled
Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr
Energy Technology Data Exchange (ETDEWEB)
Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)
1993-12-01
The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe
International Nuclear Information System (INIS)
Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.
2007-01-01
The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well
The Brentanist Philosophy of Mathematics in Edmund Husserl’s Early Works
Ierna, Carlo; Centrone, Stefania
2017-01-01
A common analysis of Edmund Husserl’s early works on the philosophy of logic and mathematics presents these writings as the result of a combination of two distinct strands of influence: on the one hand a mathematical influence due to his teachers is Berlin, such as Karl Weierstrass, and on the other
Early Onset Alzheimer’s Disease and Oxidative Stress
Directory of Open Access Journals (Sweden)
Marco Antonio Meraz-Ríos
2014-01-01
Full Text Available Alzheimer’s disease (AD is the most common cause of dementia in elderly adults. It is estimated that 10% of the world’s population aged more than 60–65 years could currently be affected by AD, and that in the next 20 years, there could be more than 30 million people affected by this pathology. One of the great challenges in this regard is that AD is not just a scientific problem; it is associated with major psychosocial and ethical dilemmas and has a negative impact on national economies. The neurodegenerative process that occurs in AD involves a specific nervous cell dysfunction, which leads to neuronal death. Mutations in APP, PS1, and PS2 genes are causes for early onset AD. Several animal models have demonstrated that alterations in these proteins are able to induce oxidative damage, which in turn favors the development of AD. This paper provides a review of many, although not all, of the mutations present in patients with familial Alzheimer’s disease and the association between some of these mutations with both oxidative damage and the development of the pathology.
Attosecond relative delay among xenon 5p, 5s, and 4d photoionization
Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri
2017-04-01
Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.
Is early limited surgery associated with a more benign disease course in Crohn’s disease?
Golovics, Petra Anna; Lakatos, Laszlo; Nagy, Attila; Pandur, Tunde; Szita, Istvan; Balogh, Mihaly; Molnar, Csaba; Komaromi, Erzsebet; Lovasz, Barbara Dorottya; Mandel, Michael; Veres, Gabor; Kiss, Lajos S; Vegh, Zsuzsanna; Lakatos, Peter Laszlo
2013-01-01
AIM: To analyze the difference in disease course and need for surgery in patients with Crohn’s disease (CD). METHODS: Data of 506 patients with incident CD were analyzed (age at diagnosis: 31.5 ± 13.8 years). Both hospital and outpatient records were collected prospectively with a complete clinical follow-up and comprehensively reviewed in the population-based Veszprem province database, which includes incident CD patients diagnosed between January 1, 1977 and December 31, 2008. Follow-up data were collected until December 31, 2009. All patients included had at least 1 year of follow-up available. Patients with indeterminate colitis at diagnosis were excluded from the analysis. RESULTS: Overall, 73 patients (14.4%) required resective surgery within 1 year of diagnosis. Steroid exposure and need for biological therapy were lower in patients with early limited surgery (P < 0.001 and P = 0.09). In addition, surgery rates during follow-up in patients with and without early surgery differed significantly after matching on propensity scores (P < 0.001, HR = 0.23). The need for reoperation was also lower in patients with early limited resective surgery (P = 0.038, HR = 0.42) in a Kaplan-Meier and multivariate Cox regression (P = 0.04) analysis. However, this advantage was not observed after matching on propensity scores (PLogrank = 0.656, PBreslow = 0.498). CONCLUSION: Long-term surgery rates and overall exposure to steroids and biological agents were lower in patients with early limited resective surgery, but reoperation rates did not differ. PMID:24282358
Buchmann, Arlette F; Hellweg, Rainer; Rietschel, Marcella; Treutlein, Jens; Witt, Stephanie H; Zimmermann, Ulrich S; Schmidt, Martin H; Esser, Günter; Banaschewski, Tobias; Laucht, Manfred; Deuschle, Michael
2013-08-01
Recent studies have emphasized an important role for neurotrophins, such as brain-derived neurotrophic factor (BDNF), in regulating the plasticity of neural circuits involved in the pathophysiology of stress-related diseases. The aim of the present study was to examine the interplay of the BDNF Val⁶⁶Met and the serotonin transporter promoter (5-HTTLPR) polymorphisms in moderating the impact of early-life adversity on BDNF plasma concentration and depressive symptoms. Participants were taken from an epidemiological cohort study following the long-term outcome of early risk factors from birth into young adulthood. In 259 individuals (119 males, 140 females), genotyped for the BDNF Val⁶⁶Met and the 5-HTTLPR polymorphisms, plasma BDNF was assessed at the age of 19 years. In addition, participants completed the Beck Depression Inventory (BDI). Early adversity was determined according to a family adversity index assessed at 3 months of age. Results indicated that individuals homozygous for both the BDNF Val and the 5-HTTLPR L allele showed significantly reduced BDNF levels following exposure to high adversity. In contrast, BDNF levels appeared to be unaffected by early psychosocial adversity in carriers of the BDNF Met or the 5-HTTLPR S allele. While the former group appeared to be most susceptible to depressive symptoms, the impact of early adversity was less pronounced in the latter group. This is the first preliminary evidence indicating that early-life adverse experiences may have lasting sequelae for plasma BDNF levels in humans, highlighting that the susceptibility to this effect is moderated by BDNF Val⁶⁶Met and 5-HTTLPR genotype. Copyright © 2013. Published by Elsevier B.V.
TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD
Directory of Open Access Journals (Sweden)
Raluca BRAD
2015-05-01
Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.
Maternal hypothyroxinaemia in early pregnancy and problem behavior in 5-year-old offspring.
Oostenbroek, Maurits H W; Kersten, Remco H J; Tros, Benjamin; Kunst, Anton E; Vrijkotte, Tanja G M; Finken, Martijn J J
2017-07-01
There is evidence, though not consistent, that offspring born to mothers with subtle decreases in thyroid function early in their pregnancies may be at risk of cognitive impairments and attention problems. However, other types of problem behavior have not been addressed thus far. We tested whether maternal thyroid function in early pregnancy is associated with several types of problem behavior in offspring at age 5-6 years. This was a longitudinal study that included the data of 2000 mother-child pairs from the Amsterdam Born Children and their Development study. At a median gestational age of 12.9 (interquartile range: 11.9-14.1) weeks, maternal blood was sampled for assessment of free T4 and TSH. Overall problem behavior, hyperactivity/inattention, conduct problems, emotional problems, peer relationship problems and prosocial behavior were measured at age 5-6 years using the Strengths and Difficulties Questionnaire, which was filled out by both parents and teachers. Maternal hypothyroxinaemia behavior. Our results partially confirm previous observations, showing that early disruptions in the maternal thyroid hormone supply may be associated with ADHD symptoms in offspring. Our study adds that there is no evidence for an effect on other types of problem behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ioannis Ugo eIsaias
2014-08-01
Full Text Available We investigated in vivo brain nicotinic acetylcholine receptor (nAChR distribution in cognitively intact subjects with Parkinson's disease (PD at an early stage of the disease. Fourteen patients and 13 healthy subjects were imaged with single photon emission computed tomography (SPECT and the radiotracer 5-[123I]iodo-3-[2(S-2-azetidinylmethoxy]pyridine ([123I]5IA. Patients were selected according to several criteria, including short duration of motor signs (<7 years and normal scores at an extensive neuropsychological evaluation. In PD patients, nAChR density was significantly higher in the putamen, the insular cortex and the supplementary motor area and lower in the caudate nucleus, the orbitofrontal cortex and the middle temporal gyrus. Disease duration positively correlated with nAChR density in the putamen ipsilateral (ρ=0.56, p<0.05 but not contralateral (ρ=0.49, p=0.07 to the clinically most affected hemibody.We observed, for the first time in vivo, higher nAChR density in brain regions of the motor and limbic basal ganglia circuits of subjects with PD. Our findings support the notion of an up-regulated cholinergic activity at the striatal and possibly cortical level in cognitively intact PD patients at an early stage of disease.
Yee, Nathan K; Dong, Yong; Kapadia, Suresh R; Song, Jinhua J
2002-11-29
A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]-5-[(methanesulfonyloxy)methyl]-2-pyrrolidinone (1) is described. The key transformations involve a highly efficient reaction sequence consisting of ethoxycarbonylation, alkylation, hydrolysis, and decarboxylation to produce compound 10. The process described herein is practical, robust, and cost-effective, and it has been successfully implemented in a pilot plant to produce a multikilogram quantity of mesylate 1.
Crystal structure and optical absorption spectra of Ga0.5Fe0.5InS3 and Ga0.5Fe0.25In1.25S3 crystals
International Nuclear Information System (INIS)
Gusejnov, G.G.; Musaeva, N.N.; Kyazumov, M.G.; Asadova, I.B.; Aliev, O.M.
2003-01-01
Single crystals of Ga 0.5 Fe 0.5 InS 3 are grown by the method of chemical gas-transport reactions and those of Ga 0.5 Fe 0.25 In 1.25 S 3 - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E g = 1.885 eV for Ga 0.5 Fe 0.5 InS 3 and E g 1.843 eV for Ga 0.5 Fe 0.25 In 1.25 S 3 [ru
The THESEUS space mission concept: science case, design and expected performances
DEFF Research Database (Denmark)
Amati, L.; O’Brien, P.; Götz, D.
2018-01-01
THESEUS is a space mission concept aimed at exploiting Gamma-Ray Bursts for investigating the early Universe and at providing a substantial advancement of multi-messenger and time-domain astrophysics. These goals will be achieved through a unique combination of instruments allowing GRB and X...... with both imaging and spectroscopic capabilities. THESEUS will be perfectly suited for addressing the main open issues in cosmology such as, e.g., star formation rate and metallicity evolution of the inter-stellar and intra-galactic medium up to redshift 10, signatures of Pop III stars, sources and physics...... detected in the late ’20s/early ’30s by next generation facilities like aLIGO/ aVirgo, eLISA, KAGRA, and Einstein Telescope. THESEUS will also provide powerful synergies with the next generation of multi-wavelength observatories (e.g., LSST, ELT, SKA, CTA, ATHENA)....
Zeanah, Charles H; Lieberman, Alicia
2016-09-01
Infant mental health is explicitly relational in its focus, and therefore a diagnostic classification system for early childhood disorders should include attention not only to within-the-child psychopathology but also between child and caregiver psychopathology. In this article, we begin by providing a review of previous efforts to introduce this approach that date back more than 30 years. Next, we introduce changes proposed in the Diagnostic Classification of Mental Health and Developmental Disorders of Infancy and Early Childhood DC:0-5 (ZERO TO THREE, in press). In a major change from previous attempts, the DC:0-5 includes an Axis I "Relationship Specific Disorder of Early Childhood." This disorder intends to capture disordered behavior that is limited to one caregiver relationship rather than cross contextually. An axial characterization is continued from the Diagnostic Classification of Mental Health and Developmental Disorders of Infancy and Early Childhood DC:0-3R (ZERO TO THREE, 2005), but two major changes are introduced. First, the DC:0-5 proposes to simplify ratings of relationship adaptation/maladaptation, and to expand what is rated so that in addition to characterizing the child's relationship with his or her primary caregiver, there also is a characterization of the network of family relationships in which the child develops. This includes coparenting relationships and the entire network of close relationships that impinge on the young child's development and adaptation. © 2016 Michigan Association for Infant Mental Health.
Directory of Open Access Journals (Sweden)
Chihiro Iwashita
2017-01-01
Full Text Available Barrett’s adenocarcinoma may occur in multiple sites, and recurrence and metachronous lesions are the major problems with endoscopic resection. Therefore, early detection of such lesions is ideal to achieve complete resection and obtain improved survival rates with minimally invasive treatment. Laser imaging systems allow multiple modalities of endoscopic imaging by using white light laser, flexible spectral imaging color enhancement (FICE, blue laser imaging (BLI, and linked color imaging even at a distant view. However, the usefulness of these modalities has not been sufficiently reported regarding Barrett’s adenocarcinoma. Here, we report on a patient with three synchronous lesions followed by one metachronous lesion in a long segment with changes of Barrett’s esophagus, all diagnosed with this new laser endoscopic imaging system and enhanced by using FICE and/or BLI with high contrast compared with the surrounding mucosa. Laser endoscopic imaging may facilitate the detection of malignancies in patients with early Barrett’s adenocarcinoma.
Organizational design configurations in the early stages of firm’s life cycle
Mosca, Luigi; Gianecchini, Martina; Campagnolo, Diego
2017-01-01
http://ocs.editorial.upv.es/index.php/CARMA/CARMA2016 Mosca, L.; Gianecchini, M.; Campagnolo, D. (2017). Organizational design configurations in the early stages of firm’s life cycle. Editorial Universitat Politècnica de València. doi:10.4995/CARMA2016.2015.3104. OCS
Large Scale Construction Project Innovative Management Through 5-S
Directory of Open Access Journals (Sweden)
Hashim Hj. Abdul Ghani Mohd.
2014-11-01
Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.
de la Monte, Suzanne M.
2012-01-01
Evaluation of Craft S, Baker LD, Montine TJ, Minoshima S, Watson GS, Claxton A, et al. Intranasal Insulin Therapy for Alzheimer Disease and Amnestic Mild Cognitive Impairment: A Pilot Clinical Trial. Arch Neurol. 2011 Sep 12. Alzheimer’s disease is associated with brain insulin deficiency and insulin resistance, similar to the problems in diabetes. If insulin could be supplied to the brain in the early stages of Alzheimer’s, subsequent neurodegeneration might be prevented. ...
Effective Packet Number for 5G IM WeChat Application at Early Stage Traffic Classification
Directory of Open Access Journals (Sweden)
Muhammad Shafiq
2017-01-01
Full Text Available Accurate network traffic classification at early stage is very important for 5G network applications. During the last few years, researchers endeavored hard to propose effective machine learning model for classification of Internet traffic applications at early stage with few packets. Nevertheless, this essential problem still needs to be studied profoundly to find out effective packet number as well as effective machine learning (ML model. In this paper, we tried to solve the above-mentioned problem. For this purpose, five Internet traffic datasets are utilized. Initially, we extract packet size of 20 packets and then mutual information analysis is carried out to find out the mutual information of each packet on n flow type. Thereafter, we execute 10 well-known machine learning algorithms using crossover classification method. Two statistical analysis tests, Friedman and Wilcoxon pairwise tests, are applied for the experimental results. Moreover, we also apply the statistical tests for classifiers to find out effective ML classifier. Our experimental results show that 13–19 packets are the effective packet numbers for 5G IM WeChat application at early stage network traffic classification. We also find out effective ML classifier, where Random Forest ML classifier is effective classifier at early stage Internet traffic classification.
Sociodemographic differences in women’s experience of early labour care: a mixed methods study
Henderson, Jane; Redshaw, Maggie
2017-01-01
Objectives To explore women’s experiences of early labour care focusing on sociodemographic differences, and to examine the effect of antenatal education, using mixed methods. Setting England, 2014. Participants Women who completed postal questionnaires about their experience of maternity care, including questions about antenatal education, early labour and sociodemographic factors, included space for free-text comments. Outcome measures Worries about labour, contact with midwives in early labour and subsequent care. Methods This study was based on secondary analysis of a national maternity survey carried out in England in 2014. Quantitative data were analysed using descriptive statistics and binary logistic regression; qualitative data were analysed using a thematic content analytic approach. Results Completed questionnaires were received from 4578 women (47% response rate). There were significant differences by sociodemographic factors, particularly ethnicity, in women’s worries about early labour. Compared with white women, women from black or minority ethnic groups had an adjusted OR of 1.93 (95% CI 1.56 to 2.39) of feeling worried about not knowing when labour would start. Among women who contacted a midwife at the start of labour, 84% perceived their advice as appropriate, more in older and multiparous women. Overall, 64% of women were asked to come to the hospital at this time, more in multiparous women (adjusted OR 1.63, 95% CI 1.35 to 1.96). Those who did not have access to antenatal education experienced greater worry about early labour. Five themes emerged from the qualitative analysis: ‘Differentiating between early and active labour’, ‘Staff attitudes’, ‘Not being allowed…’, ‘Previous labours’ and ‘Perceived consequences for women’. Conclusion These findings reinforce the importance of providing reassurance to women in early labour, taking care that women do not feel neglected or dismissed. In particular, primiparous and
Probing Models of Dark Matter and the Early Universe
Orlofsky, Nicholas David
This thesis discusses models for dark matter (DM) and their behavior in the early universe. An important question is how phenomenological probes can directly search for signals of DM today. Another topic of investigation is how the DM and other processes in the early universe must evolve. Then, astrophysical bounds on early universe dynamics can constrain DM. We will consider these questions in the context of three classes of DM models--weakly interacting massive particles (WIMPs), axions, and primordial black holes (PBHs). Starting with WIMPs, we consider models where the DM is charged under the electroweak gauge group of the Standard Model. Such WIMPs, if generated by a thermal cosmological history, are constrained by direct detection experiments. To avoid present or near-future bounds, the WIMP model or cosmological history must be altered in some way. This may be accomplished by the inclusion of new states that coannihilate with the WIMP or a period of non-thermal evolution in the early universe. Future experiments are likely to probe some of these altered scenarios, and a non-observation would require a high degree of tuning in some of the model parameters in these scenarios. Next, axions, as light pseudo-Nambu-Goldstone bosons, are susceptible to quantum fluctuations in the early universe that lead to isocurvature perturbations, which are constrained by observations of the cosmic microwave background (CMB). We ask what it would take to allow axion models in the face of these strong CMB bounds. We revisit models where inflationary dynamics modify the axion potential and discuss how isocurvature bounds can be relaxed, elucidating the difficulties in these constructions. Avoiding disruption of inflationary dynamics provides important limits on the parameter space. Finally, PBHs have received interest in part due to observations by LIGO of merging black hole binaries. We ask how these PBHs could arise through inflationary models and investigate the opportunity
Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI
International Nuclear Information System (INIS)
Sharma, M.K.; Tauheed, A.; Rahimullah, K.
2014-01-01
The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated
Early life factors and dental caries in 5-year-old children in China.
Sun, Xiangyu; Bernabé, Eduardo; Liu, Xuenan; Gallagher, Jennifer E; Zheng, Shuguo
2017-09-01
This study aimed to explore the association between early life factors and dental caries among 5-year-old Chinese children. Data from 9722 preschool children who participated in the third National Oral Health Survey of China were analysed. Information on early life (birth weight, breastfeeding and age when toothbrushing started), child (sex, ethnicity, birth order and dental behaviours) and family factors (parental education, household income, place of residence, number of children in the family, respondent's age and relation to the child) were obtained from parental questionnaires. Children were also clinically examined to assess dental caries experience using the decayed, missing and filled teeth (dmft) index. The association of early life factors with dmft was evaluated in negative binomial regression models. We found that birth weight was not associated with dental caries experience; children who were exclusively and predominantly formula-fed had lower dmft values than those exclusively breastfed; and children who started brushing later in life had higher dmft values than those who were brushing within the first year. Only one in seven of all children received regular toothbrushing twice per day, and only 34.7% had commenced toothbrushing by the age of 3 years. This study shows certain early life factors play a role in dental caries among Chinese preschool children and provides important insights to shape public health initiatives on the importance of introducing early toothbrushing. The early environment, especially the age when parents introduce toothbrushing to their children, can be an important factor to prevent childhood dental caries. Copyright © 2017 Elsevier Ltd. All rights reserved.
5S-toimintamallin kehittäminen nostintuotannossa
Laine, Atte
2017-01-01
TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...
A novel CDKL5 mutation in a 47,XXY boy with the early-onset seizure variant of Rett syndrome.
Sartori, Stefano; Di Rosa, Gabriella; Polli, Roberta; Bettella, Elisa; Tricomi, Giovanni; Tortorella, Gaetano; Murgia, Alessandra
2009-02-01
Mutations of the cyclin-dependent kinase-like 5 gene (CDKL5), reported almost exclusively in female subjects, have been recently found to be the cause of a phenotype overlapping Rett syndrome with early-onset epileptic encephalopathy. We describe the first CDKL5 mutation detected in a male individual with 47,XXY karyotype. This previously unreported, de novo, mutation truncates the large CDKL5 COOH-terminal region, thought to be crucial for the proper sub-cellular localization of the CDKL5 protein. The resulting phenotype is characterized by a severe early-onset epileptic encephalopathy, global developmental delay, and profound intellectual and motor impairment with features reminiscent of Rett syndrome. In light of the data presented we discuss the possible phenotypic modulatory effects of the supernumerary wild type X allele and pattern of X chromosome inactivation and stress the importance of considering the causal involvement of CDKL5 in developmentally delayed males with early-onset seizures. (c) 2009 Wiley-Liss, Inc.
Maria Angélica Olivo Francisco Lucas; Maria Cristina Gomes Machado
2012-01-01
This article seeks to analyze the role of Early Childhood education in the period between the end of the Brazilian military dictatorship until the enactment of the current Lei de Diretrizes e Bases da Educação Nacional (National Educational Bases and Guidelines Law – LDB). This period represents a major step in the history of Early Childhood Education due to the development of documents that were essential to the acknowledgment of children’s rights, such as the Constituição Federal (Federal C...
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Review on Implementation of 5S in Various Organization
Vipulkumar C. Patel; Dr. Hemant Thakkar
2014-01-01
This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...
The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron
Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.
1982-01-01
The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.
Directory of Open Access Journals (Sweden)
Rhee CK
2017-02-01
Full Text Available Chin Kook Rhee,1 Kyungjoo Kim,1 Hyoung Kyu Yoon,2 Jee-Ae Kim,3 Sang Hyun Kim,4 Sang Haak Lee,5 Yong Bum Park,6 Ki-Suck Jung,7 Kwang Ha Yoo,8 Yong Il Hwang7 1Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Seoul St Mary’s Hospital, 2Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Yeouido St Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, 3Pharmaceutical Policy Evaluation Research Team, Research Institution, 4Big Data Division, Health Insurance Review and Assessment Service, Wonju, 5Division of Pulmonary, Critical Care and Sleep Medicine, Department of Internal Medicine, St Paul’s Hospital, College of Medicine, The Catholic University of Korea, 6Division of Pulmonary, Allergy, and Critical Care Medicine, Department of Internal Medicine, Hallym University Kangdong Sacred Heart Hospital, Seoul, 7Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, 8Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University School of Medicine, Seoul, Republic of Korea Background and objective: Few studies have examined the natural course of early COPD. The aim of this study was to observe the natural course of early COPD patients. We also aimed to analyze medical utilization and costs for early COPD during a 6-year period. Methods: Patients with early COPD were selected from Korean National Health and Nutrition Examination Survey (KNHANES data. We linked the KNHANES data of patients with early COPD to National Health Insurance data. Results: A total of 2,397 patients were enrolled between 2007 and 2012. The mean forced expiratory volume in 1 second (FEV1 was 78.6%, and the EuroQol five dimensions questionnaire (EQ-5D index value was 0.9. In total, 110 patients utilized health
Directory of Open Access Journals (Sweden)
Maria Angélica Olivo Francisco Lucas
2012-06-01
Full Text Available This article seeks to analyze the role of Early Childhood education in the period between the end of the Brazilian military dictatorship until the enactment of the current Lei de Diretrizes e Bases da Educação Nacional (National Educational Bases and Guidelines Law – LDB. This period represents a major step in the history of Early Childhood Education due to the development of documents that were essential to the acknowledgment of children’s rights, such as the Constituição Federal (Federal Constitution – 1988, the Estatuto da Criança e do Adolescente (Child and Adolescent Statute – ECA (1990 and the Política Nacional de Educação Infantil (National Policy for Early Childhood Education – PNEI (1994. All of these documents were used as basis for this study. The constitutional text recognized children as citizens, while the ECA has strengthened this commitment from the part of the State. Similarly, the PNEI has defi ned the suitable conditions for children’s overall development. However, the universal implementation of a quality service progresses slowly, since the specifi city of this educational modality is yet to be fully recognized.
AdS5 black holes with fermionic hair
International Nuclear Information System (INIS)
Burrington, Benjamin A.; Liu, James T.; Sabra, W. A.
2005-01-01
The study of new Bogomol'nyi-Prasad-Sommerfield (BPS) objects in AdS 5 has led to a deeper understanding of AdS/CFT. To help complete this picture, and to fully explore the consequences of the supersymmetry algebra, it is also important to obtain new solutions with bulk fermions turned on. In this paper we construct superpartners of the 1/2 BPS black hole in AdS 5 using a natural set of fermion zero modes. We demonstrate that these superpartners, carrying fermionic hair, have conserved charges differing from the original bosonic counterpart. To do so, we find the R-charge and dipole moment of the new system, as well as the mass and angular momentum, defined through the boundary stress tensor. The complete set of superpartners fits nicely into a chiral representation of AdS 5 supersymmetry, and the spinning solutions have the expected gyromagnetic ratio, g=1
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
The Y.E.S. Network: An IYPE legacy for engaging future generations of early-career geoscientists
Gonzales, L. M.; Govoni, D.; Micucci, L.; Gaines, S. M.; Venus, J.; Meng, W.
2009-12-01
The Y.E.S. Network, an association of early-career geoscientists who represent professional societies, geoscience companies, and geoscience departments from across the world, was formed as a direct result of the International Year of Planet Earth (IYPE). Currently the Y.E.S. Network has representatives in thirty-five countries from six continents. The goal of the network is to engage early-career representatives from geological associations and institutions, policy-makers, and delegates from administrative bodies to establish a worldwide network of future leaders, policy-makers and geoscientists who will work collaboratively to address the scientific challenges future generations will face. To this end, the Y.E.S. Network, in collaboration with IYPE and with the patronage of UNESCO, organized the first international Y.E.S. Congress which was hosted by the China University of Geosciences in Beijing. The conference focused on scientific and career challenges faced by early-career geoscientists, with a particular emphasis on how the Y.E.S. Network can work collaborative and internationally towards solving these challenges and furthering the IYPE motto of “Earth Sciences for Society”. The conference focused on the ten major themes of the IYPE (e.g. health, climate, groundwater, ocean, soils, deep earth, megacities, hazards, resources, and life) at its poster and oral sessions. Roundtable symposia engaged senior and early-career geoscientists via presentations, panel discussions, and working group sessions where strategies related to scientific challenges (i.e. climate change in the polar regions, natural hazards, natural resource sustainability) and academic and career pathway challenges (i.e. academic-industry linkages, gender parity in the geosciences, geoscience education sustainability, and international licensure issues) were developed. These strategies were then tasked to the Y.E.S. Network for further development and implementation. Future Y.E.S. Network
Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J
1999-11-19
4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
Kholoptseva, Evgenia
2016-01-01
This study examines effects of early childhood education (ECE) programs on children’s language, literacy, and math skills using a meta-analytic database that includes information about evaluations conducted between 1960 and 2007 for children between birth and 5 years of age. The study extends upon prior syntheses by examining treatment effects separately on language, literacy, and math outcomes. Findings indicate that ECE attendance has small-to-moderate impacts of between 1/10th to 1/3rd of...
Isotope composition and volume of Earth´s early oceans
DEFF Research Database (Denmark)
Pope, Emily Catherine; Bird, Dennis K.; Rosing, Minik Thorleif
2012-01-01
Oxygen and hydrogen isotope compositions of Earth´s seawater are controlled by volatile fluxes among mantle, lithospheric (oceanic and continental crust), and atmospheric reservoirs. Throughout geologic time the oxygen mass budget was likely conserved within these Earth system reservoirs, but hyd...... in Earth´s oceans. Our calculations predict that the oceans of early Earth were up to 26% more voluminous, and atmospheric CH4 and CO2 concentrations determined from limits on hydrogen escape to space are consistent with clement conditions on Archaean Earth.......Oxygen and hydrogen isotope compositions of Earth´s seawater are controlled by volatile fluxes among mantle, lithospheric (oceanic and continental crust), and atmospheric reservoirs. Throughout geologic time the oxygen mass budget was likely conserved within these Earth system reservoirs......, but hydrogen´s was not, as it can escape to space. Isotopic properties of serpentine from the approximately 3.8 Ga Isua Supracrustal Belt in West Greenland are used to characterize hydrogen and oxygen isotope compositions of ancient seawater. Archaean oceans were depleted in deuterium [expressed as Î...
International Nuclear Information System (INIS)
Dobranich, D.
1985-11-01
The TRAC-PF1/MOD1 independent assessment project at Sandia is part of an overall effort funded by the NRC to determine the ability of various systems codes to predict the detailed thermal/hydraulic response of LWRs during accident and off-normal conditions. As part of this effort, calculations for Semiscale Mod-2A test S-SF-3, a feedwater-line break test, and S-SF-5, a steam-line break test, were performed with TRAC-PF1/MOD1. Most aspects of both the S-SF-3 and S-SF-5 steady-state calculations were found to be in good agreement with data. However, the need for a better steam separator model was identified from the S-SF-3 calculation. Overall, the qualitative behavior of both transients was calculated reasonably well; however, there were some discrepancies in the prediction of the quantitative behavior. The results for the S-SF-3 transient calculation indicate that the primary-to-secondary heat transfer degradation began too early. This was possibly due to overprediction of entrainment in the steam generator boiler, leading to an incorrect calculation of the secondary-side fluid distribution during the steady state. However, there was insufficient data to verify this. Results for the S-SF-5 transient calculation indicate that the primary-side fluid temperature response to a steam-line break was in reasonable agreement with data but the pressure response did not coincide with the data. Uncertainties in the data are sufficient to prevent us from determining the exact cause of this discrepancy, but there is indirect evidence that the calculated rate of phase change in the pressurizer was incorrect. 16 refs., 73 figs., 13 tabs
Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions
Zhang, Yawei; Li, Gang
2018-01-01
Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.
Progress in the development of a S-RETGEM-based detector for an early forest fire warning system
Charpak, G.; Benaben, P.; Breuil, P.; Martinengo, P.; Nappi, E.; Peskov, V.
2009-12-01
We present a prototype of a Strip Resistive Thick GEM (S-RETGEM) photosensitive gaseous detector filled with Ne and ethylferrocene (EF) vapours at a total pressure of 1 atm for an early forest fire detection system. Measurements show that it is one hundred times more sensitive than the best commercial ultraviolet (UV) flame detectors; and therefore, it is able to reliably detect a flame of ~ 1.5 × 1.5 × 1.5 m3 at a distance of about 1 km. An additional and unique feature of this detector is its imaging capability, which in combination with other techniques, may significantly reduce false fire alarms rate when operating in an automatic mode. Preliminary results conducted with air-filled photosensitive gaseous detectors are also presented. The main advantages of this approach include both the simplicity of manufacturing and affordability of construction materials such as plastics and glues specifically reducing detector production cost. The sensitivity of these air-filled detectors at certain conditions may be as high as those filled with Ne and EF. Long-term tests of such sealed detectors indicate a significant progress in this direction. We believe that our detectors utilized in addition to other flame and smoke sensors will exceptionally increase the capability to detect forest fire at a very early stage of development. Our future efforts will be focused on attempts to commercialize such detectors utilizing our aforementioned findings.
Heyward, C Y; Sones, J L; Lob, H E; Yuen, L C; Abbott, K E; Huang, W; Begun, Z R; Butler, S D; August, A; Leifer, C A; Davisson, R L
2017-04-01
Preeclampsia is a devastating complication of pregnancy characterized by late-gestation hypertension and proteinuria. Because the only definitive treatment is delivery of the fetus and placenta, preeclampsia contributes to increased morbidity and mortality of both mother and fetus. The BPH/5 mouse model, which spontaneously develops a syndrome strikingly similar to preeclampsia, displays excessive inflammation and suppression of inflammation improves pregnancy outcomes. During early pregnancy, decidual macrophages play an important role in promoting maternal tolerance to fetal antigens and regulating tissue remodeling, two functions that are critical for normal placental development. BPH/5 pregnancies are characterized by abnormal placentation; therefore, we hypothesized that macrophage localization and/or function is altered during early pregnancy at the site of placental formation (the decidua) compared to C57BL/6 controls. At early gestation time points, before the onset of maternal hypertension or proteinuria, there was a reduction in the number of macrophages in BPH/5 decidua and a concomitant increase in activated T cells compared with C57BL/6. BPH/5 decidua also exhibited decreased expression of the immunosuppressive cytokine, IL-10, and increased expression of pro-inflammatory, inducible nitric oxide synthase. Together, these data suggest that a reduction in decidual macrophages during pregnancy is associated with immune activation in BPH/5 mice, inadequate placental development and may contribute to adverse pregnancy outcomes in this model. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Verde, Licia; Jimenez, Raul [Institute of Cosmos Sciences, University of Barcelona, IEEC-UB, Martí Franquès, 1, E08028 Barcelona (Spain); Bellini, Emilio [University of Oxford, Denys Wilkinson Building, Keble Road, Oxford, OX1 3RH (United Kingdom); Pigozzo, Cassio [Instituto de Física, Universidade Federal da Bahia, Salvador, BA (Brazil); Heavens, Alan F., E-mail: liciaverde@icc.ub.edu, E-mail: emilio.bellini@physics.ox.ac.uk, E-mail: cpigozzo@ufba.br, E-mail: a.heavens@imperial.ac.uk, E-mail: raul.jimenez@icc.ub.edu [Imperial Centre for Inference and Cosmology (ICIC), Imperial College, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom)
2017-04-01
We investigate our knowledge of early universe cosmology by exploring how much additional energy density can be placed in different components beyond those in the ΛCDM model. To do this we use a method to separate early- and late-universe information enclosed in observational data, thus markedly reducing the model-dependency of the conclusions. We find that the 95% credibility regions for extra energy components of the early universe at recombination are: non-accelerating additional fluid density parameter Ω{sub MR} < 0.006 and extra radiation parameterised as extra effective neutrino species 2.3 < N {sub eff} < 3.2 when imposing flatness. Our constraints thus show that even when analyzing the data in this largely model-independent way, the possibility of hiding extra energy components beyond ΛCDM in the early universe is seriously constrained by current observations. We also find that the standard ruler, the sound horizon at radiation drag, can be well determined in a way that does not depend on late-time Universe assumptions, but depends strongly on early-time physics and in particular on additional components that behave like radiation. We find that the standard ruler length determined in this way is r {sub s} = 147.4 ± 0.7 Mpc if the radiation and neutrino components are standard, but the uncertainty increases by an order of magnitude when non-standard dark radiation components are allowed, to r {sub s} = 150 ± 5 Mpc.
Evans, P. A.; Osborne, J. P.; Kennea, J. A.; Campana, S.; O'Brien, P. T.; Tanvir, N. R.; Racusin, J. L.; Burrows, D. N.; Cenko, S. B.; Gehrels, N.
2015-01-01
One of the most exciting near-term prospects in physics is the potential discovery of gravitational waves by the Advanced LIGO and Virgo detectors. To maximize both the confidence of the detection and the science return, it is essential to identify an electromagnetic counterpart.This is not trivial, as the events are expected to be poorly localized, particularly in the near-term, with error regions covering hundreds or even thousands of square degrees. In this paper, we discuss the prospects for finding an X-ray counterpart to a gravitational wave trigger with the Swift X-ray Telescope, using the assumption that the trigger is caused by a binary neutron star merger which also produces a short gamma-ray burst. We show that it is beneficial to target galaxies within the GW error region, highlighting the need for substantially complete galaxy catalogues out to distances of 300 Mpc. We also show that nearby, on-axis short GRBs are either extremely rare, or are systematically less luminous than those detected to date. We consider the prospects for detecting afterglow emission from an off-axis GRB which triggered the GW facilities, finding that the detectability, and the best time to look,are strongly dependent on the characteristics of the burst such as circumburst density and our viewing angle.
Directory of Open Access Journals (Sweden)
Wong KL
2015-03-01
Full Text Available Keye L Wong,1 Scott E Pautler,2 David J Browning31Retina Associates of Sarasota, Sarasota, FL, USA; 2Retina Vitreous Associates of Florida, Tampa, FL, USA; 3Charlotte Eye Ear Nose and Throat Associates, Charlotte, NC, USAImportance: In some patients, hydroxychloroquine ocular toxicity may progress even following cessation of therapy. Any leverage the clinician may use to allow earlier detection may avert significant vision loss.Observation: We report three cases suggesting that bull’s eye maculopathy seen on near-infrared reflectance with a confocal scanning laser ophthalmoscope could be an early, objective manifestation of hydroxychloroquine ocular toxicity, and with progression of the disease this near-infrared “bull’s eye” change may disappear.Conclusion and relevance: Alerting clinicians to this observation may allow a larger case series to corroborate the hypothesis that bull’s eye maculopathy detected by near-infrared reflectance may represent an early sign of hydroxychloroquine toxicity.Keywords: confocal, scanning laser ophthalmoscope, multifocal ERG
Bischoff, Christian; Schuller, Katherine; Martin, Steve W
2014-04-03
The 0.5Na2S + 0.5[xGeS2 + (1 - x)PS5/2] mixed glass former (MGF) glass system exhibits a nonlinear and nonadditive negative change in the Na(+) ion conductivity as one glass former, PS5/2, is exchanged for the other, GeS2. This behavior, known as the mixed glass former effect (MGFE), is also manifest in a negative deviation from the linear interpolation of the glass transition temperatures (T(g)) of the binary end-member glasses, x = 0 and x = 1. Interestingly, the composition dependence of the densities of these ternary MGF glasses reveals a slightly positive MGFE deviation from a linear interpolation of the densities of the binary end-member glasses, x = 0 and x = 1. From our previous studies of the structures of these glasses using IR, Raman, and NMR spectroscopies, we find that a disproportionation reaction occurs between PS7/2(4-) and GeS3(2-) units into PS4(3-) and GeS5/2(1-) units. This disproportionation combined with the formation of Ge4S10(4-) anions from GeS5/2(1-) groups leads to the negative MGFE in T(g). A best-fit model of the T(g)s of these glasses was developed to quantify the amount of GeS5/2(1-) units that form Ge4S10(4-) molecular anions in the ternary glasses (∼ 5-10%). This refined structural model was used to develop a short-range structural model of the molar volumes, which shows that the slight densification of the ternary glasses is due to the improved packing efficiency of the germanium sulfide species.
GLOBULAR CLUSTER POPULATIONS: FIRST RESULTS FROM S{sup 4}G EARLY-TYPE GALAXIES
Energy Technology Data Exchange (ETDEWEB)
Zaritsky, Dennis [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Aravena, Manuel [Núcleo de Astronomía, Facultad de Ingeniería, Universidad Diego Portales, Avenida Ejército 441, Santiago (Chile); Athanassoula, E.; Bosma, Albert [Aix Marseille Université, CNRS, LAM (Laboratoire d' Astrophysique de Marseille) UMR 7326, F-13388 Marseille (France); Comerón, Sébastien; Laine, Jarkko; Laurikainen, Eija; Salo, Heikki [Astronomy Division, Department of Physics, P.O. Box 3000, FI-90014 University of Oulu (Finland); Elmegreen, Bruce G. [IBM T. J. Watson Research Center, 1101 Kitchawan Road, Yorktown Heights, NY 10598 (United States); Erroz-Ferrer, Santiago; Knapen, Johan H. [Instituto de Astrofísica de Canarias, Vía Lácteas, E-38205 La Laguna (Spain); Gadotti, Dimitri A.; Muñoz-Mateos, Juan Carlos [European Southern Observatory, Casilla 19001, Santiago 19 (Chile); Hinz, Joannah L. [MMT Observatory, P.O. Box 210065, Tucson, AZ 85721 (United States); Ho, Luis C. [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Holwerda, Benne [Leiden Observatory, University of Leiden, Niels Bohrweg 4, NL-2333 Leiden (Netherlands); Sheth, Kartik, E-mail: dennis.zaritsky@gmail.com [National Radio Astronomy Observatory/NAASC, 520 Edgemont Road, Charlottesville, VA 22903 (United States)
2015-02-01
Using 3.6 μm images of 97 early-type galaxies, we develop and verify methodology to measure globular cluster populations from the S{sup 4}G survey images. We find that (1) the ratio, T {sub N}, of the number of clusters, N {sub CL}, to parent galaxy stellar mass, M {sub *}, rises weakly with M {sub *} for early-type galaxies with M {sub *} > 10{sup 10} M {sub ☉} when we calculate galaxy masses using a universal stellar initial mass function (IMF) but that the dependence of T {sub N} on M {sub *} is removed entirely once we correct for the recently uncovered systematic variation of IMF with M {sub *}; and (2) for M {sub *} < 10{sup 10} M {sub ☉}, there is no trend between N {sub CL} and M {sub *}, the scatter in T {sub N} is significantly larger (approaching two orders of magnitude), and there is evidence to support a previous, independent suggestion of two families of galaxies. The behavior of N {sub CL} in the lower-mass systems is more difficult to measure because these systems are inherently cluster-poor, but our results may add to previous evidence that large variations in cluster formation and destruction efficiencies are to be found among low-mass galaxies. The average fraction of stellar mass in clusters is ∼0.0014 for M {sub *} > 10{sup 10} M {sub ☉} and can be as large as ∼0.02 for less massive galaxies. These are the first results from the S{sup 4}G sample of galaxies and will be enhanced by the sample of early-type galaxies now being added to S{sup 4}G and complemented by the study of later-type galaxies within S{sup 4}G.
Early Eruption of Maxillary Pre Molar with Turner's Hypoplasia in a 5-Year-Old Boy.
Rai, Nitya; Mathur, Shivani; Sandhu, Meera; Sachdev, Vinod
2016-08-01
Early eruption of permanent maxillary premolar appears to be a unique finding, at such an early chronological age. Untimely eruption of permanent maxillary premolar is discussed in a 5-year-old male patient. On intra oral examination grossly carious primary maxillary first molar (tooth number 54,64) were reported. The erupting teeth presented with a hypomineralized cusp tip. Extraction following space maintainer in 64 region was given. Pediatric dentist should consider these kinds of rarities in eruption pattern while examining a pediatric patient.
A Case Report of Early Gastric Signet Ring Cell Carcinoma
African Journals Online (AJOL)
2018-02-07
gmail.com. How to cite this article: Akabah PS, Mocan S, Molnar C, Dobru D. Importance of optical diagnosis in early gastric cancer: A case report of early gastric signet ring cell carcinoma. Niger J Clin Pract 2017;20:1342-5.
Lockerbie, N. A.; Tokmakov, K. V.
2016-07-01
The background to this work was a prototype shadow sensor, which was designed for retro-fitting to an advanced LIGO (Laser Interferometer Gravitational wave Observatory) test-mass/mirror suspension, in which 40 kg test-mass/mirrors are each suspended by four approximately 600 mm long by 0.4 mm diameter fused-silica suspension fibres. The shadow sensor comprised a LED source of Near InfraRed (NIR) radiation and a rectangular silicon photodiode detector, which, together, were to bracket the fibre under test. The aim was to detect transverse Violin-Mode resonances in the suspension fibres. Part of the testing procedure involved tensioning a silica fibre sample and translating it transversely through the illuminating NIR beam, so as to measure the DC responsivity of the detection system to fibre displacement. However, an equally important part of the procedure, reported here, was to keep the fibre under test stationary within the beam, whilst trying to detect low-level AC Violin-Mode resonances excited on the fibre, in order to confirm the primary function of the sensor. Therefore, a tensioning system, incorporating a load-cell readout, was built into the test fibre's holder. The fibre then was excited by a signal generator, audio power amplifier, and distant loudspeaker, and clear resonances were detected. A theory for the expected fundamental resonant frequency as a function of fibre tension was developed and is reported here, and this theory was found to match closely with the detected resonant frequencies as they varied with tension. Consequently, the resonances seen were identified as being proper Violin-Mode fundamental resonances of the fibre, and the operation of the Violin-Mode detection system was validated.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Entropy of near-extremal black holes in AdS_5
Balasubramanian, V.; de Boer, J.; Jejjala, V.; Simón, J.
2008-01-01
We construct the microstates of near-extremal black holes in AdS_5 x S^5 as gases of defects distributed in heavy BPS operators in the dual SU(N) Yang-Mills theory. These defects describe open strings on spherical D3-branes in the S^5, and we show that they dominate the entropy by directly
Substorm observations in the early morning sector with Equator-S and Geotail
Directory of Open Access Journals (Sweden)
R. Nakamura
1999-12-01
Full Text Available Data from Equator-S and Geotail are used to study the dynamics of the plasma sheet observed during a substorm with multiple intensifications on 25 April 1998, when both spacecraft were located in the early morning sector (03–04 MLT at a radial distance of 10–11 RE. In association with the onset of a poleward expansion of the aurora and the westward electrojet in the premidnight and midnight sector, both satellites in the morning sector observed plasma sheet thinning and changes toward a more tail-like field configuration. During the subsequent poleward expansion in a wider local time sector (20–04 MLT, on the other hand, the magnetic field configuration at both satellites changed into a more dipolar configuration and both satellites encountered again the hot plasma sheet. High-speed plasma flows with velocities of up to 600 km/s and lasting 2–5 min were observed in the plasma sheet and near its boundary during this plasma sheet expansion. These high-speed flows included significant dawn-dusk flows and had a shear structure. They may have been produced by an induced electric field at the local dipolarization region and/or by an enhanced pressure gradient associated with the injection in the midnight plasma sheet.Key words. Magnetospheric physics (magnetospheric configuration and dynamics; plasma sheet; storms and substorms
Dongen, Els van
2009-01-01
This research has analyzed the topic of “conservatism” (baoshou zhuyi) in early 1990s China from a twofold perspective. Firstly, in the tradition of conceptual history (Begriffsgeschichte), the concrete use of the concept of “conservatism” in Chinese intellectual discourse has been studied in
Early-onset seizures due to mosaic exonic deletions of CDKL5 in a male and two females.
Bartnik, Magdalena; Derwińska, Katarzyna; Gos, Monika; Obersztyn, Ewa; Kołodziejska, Katarzyna E; Erez, Ayelet; Szpecht-Potocka, Agnieszka; Fang, Ping; Terczyńska, Iwona; Mierzewska, Hanna; Lohr, Naomi J; Bellus, Gary A; Reimschisel, Tyler; Bocian, Ewa; Mazurczak, Tadeusz; Cheung, Sau Wai; Stankiewicz, Paweł
2011-05-01
Mutations in the CDKL5 gene have been associated with an X-linked dominant early infantile epileptic encephalopathy-2. The clinical presentation is usually of severe encephalopathy with refractory seizures and Rett syndrome (RTT)-like phenotype. We attempted to assess the role of mosaic intragenic copy number variation in CDKL5. We have used comparative genomic hybridization with a custom-designed clinical oligonucleotide array targeting exons of selected disease and candidate genes, including CDKL5. We have identified mosaic exonic deletions of CDKL5 in one male and two females with developmental delay and medically intractable seizures. These three mosaic changes represent 60% of all deletions detected in 12,000 patients analyzed by array comparative genomic hybridization and involving the exonic portion of CDKL5. We report the first case of an exonic deletion of CDKL5 in a male and emphasize the importance of underappreciated mosaic exonic copy number variation in patients with early-onset seizures and RTT-like features of both genders.
Topics in LIGO-related physics: Interferometric speed meters and tidal work
Purdue, Patricia Marie
In the quest to develop viable designs for third-generation interferometric gravitational-wave detectors (such as the Laser Interferometer Gravitational-Wave Observatory, LIGO), one strategy is monitoring the relative momentum or speed of the test-mass mirrors, rather than monitoring their relative position. The most straightforward design for a speed-meter interferometer that accomplishes this is analyzed in Chapter 2. It is shown that in principle this design can beat the standard quantum limit (SQL) by an arbitrarily large amount, over an arbitrarily wide range of frequencies. However, in practice, this specific speed meter requires exorbitantly high input light power. Chapter 3 proposes a more sophisticated version of a speed meter. This new design requires modest input power and appears to be a fully practical candidate for third-generation detectors. It can beat the SQL over a broad range of frequencies (˜10 to 100 Hz in practice) by a factor h/hSQL ˜ WSQLcirc/Wc irc . Here Wcirc is the light power circulating in the interferometer arms and WSQL ≃ 800 kW is the circulating power required to beat the SQL at 100 Hz. If squeezed vacuum (with a power-squeeze factor e-2 R) is injected into the interferometer's output port, the SQL can be beat with less laser power: h/h SQL ˜ WSQLcirc/Wc irce2R . For realistic parameters (e2 R ≃ 10 and Wcirc ≃ 800 kW), the SQL can be beat by a factor ˜3 from 10 to 100 Hz. By performing frequency-dependent homodyne detection on the output (using two kilometer-scale filter cavities), one can markedly improve the interferometer's sensitivity at frequencies above 100 Hz. Chapter 4 is a contribution to the foundations for analyzing sources of gravitational waves. Specifically, it presents an analysis of the tidal work done on a self-gravitating body in an external tidal field. By examining the change in the mass-energy of the body as a result of the tidal field, it is shown that the work done is gauge invariant, while the body
Energy Technology Data Exchange (ETDEWEB)
Berkovits, Nathan [ICTP South American Institute for Fundamental Research,Instituto de Física Teórica, UNESP - Universidade Estadual Paulista,Rua Dr. Bento T. Ferraz 271, 01140-070, São Paulo, SP (Brazil)
2016-06-21
The pure spinor formalism for the superstring can be formulated as a twisted N=2 worldsheet theory with fermionic generators j{sub BRST} and composite b ghost. After untwisting the formalism to an N=1 worldsheet theory with fermionic stress tensor j{sub BRST}+b, the worldsheet variables combine into N=1 worldsheet superfields X{sup m} and Θ{sup α} together with a superfield constraint relating DX{sup m} and DΘ{sup α}. The constraint implies that the worldsheet superpartner of θ{sup α} is a bosonic twistor variable, and different solutions of the constraint give rise to the pure spinor or extended RNS formalisms, as well as a new twistor-string formalism with manifest N=1 worldsheet supersymmetry. These N=1 worldsheet methods generalize in curved Ramond-Ramond backgrounds, and a manifestly N=1 worldsheet supersymmetric action is proposed for the superstring in an AdS{sub 5}×S{sup 5} background in terms of the twistor superfields. This AdS{sub 5}×S{sup 5} worldsheet action is a remarkably simple fermionic coset model with manifest PSU(2,2|4) symmetry and might be useful for computing AdS{sub 5}×S{sup 5} superstring scattering amplitudes.
Energy Technology Data Exchange (ETDEWEB)
Murguia-Berthier, Ariadna; Ramirez-Ruiz, Enrico; Antoni, Andrea; Macias, Phillip [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); MacLeod, Morgan, E-mail: armurgui@ucsc.edu [School of Natural Sciences, Institute for Advanced Study, 1 Einstein Drive, Princeton, NJ 08540 (United States)
2017-08-20
During a common envelope (CE) episode in a binary system, the engulfed companion spirals to tighter orbital separations under the influence of drag from the surrounding envelope material. As this object sweeps through material with a steep radial gradient of density, net angular momentum is introduced into the flow, potentially leading to the formation of an accretion disk. The presence of a disk would have dramatic consequences for the outcome of the interaction because accretion might be accompanied by strong, polar outflows with enough energy to unbind the entire envelope. Without a detailed understanding of the necessary conditions for disk formation during CE, therefore, it is difficult to accurately predict the population of merging compact binaries. This paper examines the conditions for disk formation around objects embedded within CEs using the “wind tunnel” formalism developed by MacLeod et al. We find that the formation of disks is highly dependent on the compressibility of the envelope material. Disks form only in the most compressible of stellar envelope gas, found in envelopes’ outer layers in zones of partial ionization. These zones are largest in low-mass stellar envelopes, but comprise small portions of the envelope mass and radius in all cases. We conclude that disk formation and associated accretion feedback in CE is rare, and if it occurs, transitory. The implication for LIGO black hole binary assembly is that by avoiding strong accretion feedback, CE interactions should still result in the substantial orbital tightening needed to produce merging binaries.
International Nuclear Information System (INIS)
Cagnazzo, Alessandra; Sorokin, Dmitri; Tseytlin, Arkady A; Wulff, Linus
2013-01-01
We demonstrate the equivalence between the worldsheet one-loop partition functions computed near classical string solutions in the Green–Schwarz and in the pure–spinor formulations of superstrings in AdS 5 × S 5 . While their bosonic sectors are the same in the conformal gauge, their fermionic sectors superficially appear to be very different (first versus second-derivative kinetic terms, presence versus absence of fermionic gauge symmetry). Still, we show that the quadratic fluctuation spectrum of 16 fermionic modes of the pure–spinor formulation is the same as in the Green–Schwarz superstring and the contribution of the extra ‘massless’ fermionic modes cancels against that of the pure–spinor ghosts. We also provide evidence for a similar semiclassical equivalence between the Green–Schwarz and the hybrid formulations of superstrings in AdS 2 × S 2 × T 6 by studying several particular examples of string solutions. (paper)
Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu
2016-02-17
In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.
Directory of Open Access Journals (Sweden)
Soudeh Ghafouri-Fard
2016-02-01
Full Text Available Background The X-linked cyclin-dependent kinase like 5 (CDKL5/STK9 gene has been shown to be responsible for a severe encephalopathy condition characterized by early onset of epilepsy and severe developmental delay. CDKL5 mutations have been shown to be more frequent among female patients. Results Here we report a 6- month male patient, second child of a healthy non consanguineous in the Iranian population. He has been affected by early onset epileptic refractory seizures and developmental delay. Whole-exome sequencing (WES has revealed a base substitution c.173T>A in CDKL5 gene, resulting in the formation of stop codon p.L58X. This mutation resides in the catalytic domain of the corresponding protein and is expected to result in premature RNA break down with no CDKL5 resulting protein. Conclusion The present report highlights the importance of CDKL5 mutation analysis in male patients affected with early onset refractory epilepsy.
Directory of Open Access Journals (Sweden)
Mateus Mondin
2007-01-01
Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.
Directory of Open Access Journals (Sweden)
Greta eSzatloczki
2015-10-01
Full Text Available It is known that Alzheimer’s disease (AD influences the temporal characteristics of spontaneous speech. These phonetical changes are present even in mild AD. Based on this, the question arises whether an examination based on language analysis could help the early diagnosis of AD and if so, which language and speech characteristics can identify AD in its early stage. The purpose of this article is to summarize the relation between prodromal and manifest AD and language functions and language domains. Based on our research we are inclined to claim that AD can be more sensitively detected with the help of a linguistic analysis than with other cognitive examinations. The temporal characteristics of spontaneous speech such as speech tempo, number of pauses in speech and their length are sensitive detectors of the early stage of the disease, which enables an early simple linguistic screening for AD. However, knowledge about the unique features of the language problems associated with different dementia variants still has to be improved and refined.
CDKL5 and ARX mutations are not responsible for early onset severe myoclonic epilepsy in infancy.
Nabbout, Rima; Depienne, Christel; Chipaux, Mathilde; Girard, Benoit; Souville, Isabelle; Trouillard, Oriane; Dulac, Olivier; Chelly, Jamel; Afenjar, Alexandra; Héron, Delphine; Leguern, Eric; Beldjord, Cherif; Bienvenu, Thierry; Bahi-Buisson, Nadia
2009-11-01
Severe myoclonic epilepsy of infancy (SMEI) or Dravet syndrome (DS) is a distinctive epilepsy syndrome often associated with de novo mutations in the SCN1A gene. However, 25-30% patients with SMEI/DS are negative for SCN1A mutation screening, suggesting that other molecular mechanisms may account for these disorders. Given the overlapping and heterogeneous clinical features of CDKL5- and ARX-related epilepsies and SMEI/DS, we postulated that CDKL5 mutations in females and ARX mutations gene in males may be associated with early onset seizures forms of SMEI/DS. Twenty-eight patients with early onset SMEI/DS before 6 months negative for SCN1A mutational screening were selected and screened for mutations in the ARX gene in males (n=14) or the CDKL5 gene in females (n=14). No mutations in either gene were found except one intronic variation of uncertain pathogenicity in the CDKL5 gene. All patients started seizures at mean age of 3.48 months. Thirteen patients had familial history of epilepsy or febrile seizures. Patients evolved toward refractory epilepsy with generalized tonic clonic seizures (18/28) and myoclonia (23/28) and severe neurological impairment with autistic features (13/28), ataxia (14/28) and spasticity (5/28). No patient ever exhibited infantile spasms, dystonia, or Rett-like features. Our results illustrate that mutation screening of ARX and CDKL5 is not effective in patients selected on the basis of clinical signs associated to early onset SMEI/DS. In addition, they might reflect that other phenotypic features associated with CDKL5 mutations (Rett-like features, infantile spasm) or ARX mutations (dystonia, spasticity) are more distinctive. 2009 Elsevier B.V. All rights reserved.
The Validity of the WHO-5 as an Early Screening for Apathy in an Elderly Population
Directory of Open Access Journals (Sweden)
Ramona Lucas-Carrasco
2012-01-01
Full Text Available Aim. The objective of our study has been to evaluate the WHO-5 as a new early screening instrument for apathy in a group of elderly persons. Methods. The WHO-5 was compared to the Geriatric Depression Scale (GDS-15. The GDS contains five items measuring well-being and ten items measuring depression. The internal validity of the WHO-5 (total score being a sufficient statistic was evaluated with both parametric and nonparametric item response theory models. The external validity of the WHO-5 and the GDS was evaluated by ROC using depression as index of validity. Results. The item response theory analyses confirmed that the total score of the WHO-5 is a sufficient statistic. The ROC analysis shows an adequate sensitivity (61% and specificity (84%. The GDS15 and its two subscales obtained low sensitivity (25–42%, but high specificity (90–98%. Conclusion. The WHO-5 was found both internally and externally valid when considering decreased positive well-being to be an early indication of apathy reflecting that the wind has begun to be taken out of the “motivation sail.”
Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas
2015-12-25
Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Early Childhood Education and Care in Austria: Challenges and Education Policies
Smidt, Wilfried
2018-01-01
After a first peak in the late 1960s and early 1970s, early childhood education and care (ECEC) again plays an important role in the educational system in Austria. Over 90% of 3-5-year-old children attend non-familial institutions such as preschools. A consequence of this development is that new challenges arise, which have become the subject of…
PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY
Directory of Open Access Journals (Sweden)
Beata GALA
2013-10-01
Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.
Delgado, Julio C; Pavlov, Igor Y; Shihab, Fuad S
2009-12-01
Levels of sCD30 represent a biomarker for early outcome in kidney transplantation. The purpose of this study was to determine the role of sCD30 levels for prediction of graft loss in the late post-transplant period. Sera were collected immediately pre-transplant and yearly thereafter for up to 5-year post-transplant in 37 primary renal transplant recipients. Levels of serum sCD30 were tested using a fluorescent microsphere assay. Levels of sCD30 significantly decreased after transplantation and remained normal in 34 patients without graft loss up to 5-year post-transplant. Elevated levels of serum sCD30 preceded the increase of serum creatinine in patients with subsequent graft loss. Elevated levels of serum sCD30 post-transplant might be a marker for predicting subsequent graft loss in the post-transplant period.
Theodotou, Evgenia
2010-01-01
Technology in education is considered in empirical and theoretical literature as both beneficial and harmful to children’s development. In the field of the early years settings there is a dilemma whether or not early childhood teachers should use technology as a teaching and learning resource. This paper has a pedagogical focus, discussing the advantages and the potential problems of computer practice to children’s learning and behaviour in the early years settings and also suggests teaching ...
Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser
Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi
2018-06-01
In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.
A proposal of the gauge theory description of the small Schwarzschild black hole in AdS5×S5
International Nuclear Information System (INIS)
Hanada, Masanori; Maltz, Jonathan
2017-01-01
Based on 4d N=4 SYM on ℝ 1 ×S 3 , a gauge theory description of a small black hole in AdS 5 ×S 5 is proposed. The change of the number of dynamical degrees of freedom associated with the emission of the scalar fields’ eigenvalues plays a crucial role in this description. By analyzing the microcanonical ensemble, the Hagedorn behavior of long strings at low energy is obtained. Modulo an assumption based on the AdS/CFT duality for a large black hole, the energy of the small ten-dimensional Schwarzschild black hole E∼1/(G 10,N T 7 ) is derived. A heuristic gauge theory argument supporting this assumption is also given. The same argument applied to the ABJM theory correctly reproduces the relation for the eleven-dimensional Schwarzschild black hole. One of the consequences of our proposal is that the small and large black holes are very similar when seen from the gauge theory point of view.
Energy Technology Data Exchange (ETDEWEB)
Gusejnov, G G; Musaeva, N N; Kyazumov, M G [NAN Azerbajdzhana, Inst. Fiziki, Baku (Azerbaijan); Asadova, I B; Aliev, O M [NAN Azerbajdzhana, Inst. Neorganicheskoj i Fizicheskoj Khimii, Baku (Azerbaijan)
2003-09-01
Single crystals of Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} are grown by the method of chemical gas-transport reactions and those of Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3} - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E{sub g} = 1.885 eV for Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} and E{sub g} 1.843 eV for Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3}.
Early neurovascular dysfunction in a transgenic rat model of Alzheimer’s disease
Joo, Illsung L.; Lai, Aaron Y.; Bazzigaluppi, Paolo; Koletar, Margaret M.; Dorr, Adrienne; Brown, Mary E.; Thomason, Lynsie A. M.; Sled, John G.; McLaurin, JoAnne; Stefanovic, Bojana
2017-01-01
Alzheimer’s disease (AD), pathologically characterized by amyloid-β peptide (Aβ) accumulation, neurofibrillary tangle formation, and neurodegeneration, is thought to involve early-onset neurovascular abnormalities. Hitherto studies on AD-associated neurovascular injury have used animal models that exhibit only a subset of AD-like pathologies and demonstrated some Aβ-dependent vascular dysfunction and destabilization of neuronal network. The present work focuses on the early stage of disease progression and uses TgF344-AD rats that recapitulate a broader repertoire of AD-like pathologies to investigate the cerebrovascular and neuronal network functioning using in situ two-photon fluorescence microscopy and laminar array recordings of local field potentials, followed by pathological analyses of vascular wall morphology, tau hyperphosphorylation, and amyloid plaques. Concomitant to widespread amyloid deposition and tau hyperphosphorylation, cerebrovascular reactivity was strongly attenuated in cortical penetrating arterioles and venules of TgF344-AD rats in comparison to those in non-transgenic littermates. Blood flow elevation to hypercapnia was abolished in TgF344-AD rats. Concomitantly, the phase-amplitude coupling of the neuronal network was impaired, evidenced by decreased modulation of theta band phase on gamma band amplitude. These results demonstrate significant neurovascular network dysfunction at an early stage of AD-like pathology. Our study identifies early markers of pathology progression and call for development of combinatorial treatment plans. PMID:28401931
Valderrama, Jorge; Miranda, Regina
2017-12-01
The present study examined the interaction between early life stress and 5-HTT genotypes in predicting two risk factors for suicidal behavior - the brooding subtype of rumination and impulsivity, in the form of negative urgency - over time. Furthermore, we examined early life stress, brooding, and impulsivity as predictors of suicidal ideation over time. Participants with and without a history of early life stress were genotyped for the 5-HTTLPR polymorphism and completed assessments assessing brooding and negative urgency at baseline and 6-month follow up. Early life emotional abuse was associated with negative urgency at follow-up. We found an indirect effect of early life emotional abuse on negative urgency through brooding among individuals with 5-HTT low expressing genotypes but not among individuals with 5-HTT high expressing genotypes. Further, a logistic regression analysis revealed that negative urgency was associated with higher odds (O.R. = 16.2) of reporting suicide ideation (versus no ideation) at follow-up. Our findings suggest that brooding and negative urgency may result from the interaction between early life emotional abuse and 5-HTT low expressing genotypes. Further research is necessary to understand how early life stress interacts with 5-HTT genotypes to confer risk for suicidal behavior through psychological mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.
Constraining the range of Yukawa gravity interaction from S2 star orbits II: bounds on graviton mass
Energy Technology Data Exchange (ETDEWEB)
Zakharov, A.F. [National Astronomical Observatories of Chinese Academy of Sciences, Datun Road 20A, Beijing, 100012 China (China); Jovanović, P. [Astronomical Observatory, Volgina 7, 11060 Belgrade (Serbia); Borka, D.; Jovanović, V. Borka, E-mail: zakharov@itep.ru, E-mail: pjovanovic@aob.rs, E-mail: dusborka@vin.bg.ac.rs, E-mail: vborka@vin.bg.ac.rs [Atomic Physics Laboratory (040), Vinča Institute of Nuclear Sciences, University of Belgrade, P.O. Box 522, 11001 Belgrade (Serbia)
2016-05-01
Recently LIGO collaboration discovered gravitational waves [1] predicted 100 years ago by A. Einstein. Moreover, in the key paper reporting about the discovery, the joint LIGO and VIRGO team presented an upper limit on graviton mass such as m {sub g} < 1.2 × 10{sup −22} eV [2] (see also more details in another LIGO paper [3] dedicated to a data analysis to obtain such a small constraint on a graviton mass). Since the graviton mass limit is so small the authors concluded that their observational data do not show violations of classical general relativity. We consider another opportunity to evaluate a graviton mass from phenomenological consequences of massive gravity and show that an analysis of bright star trajectories could bound graviton mass with a comparable accuracy with accuracies reached with gravitational wave interferometers and expected with forthcoming pulsar timing observations for gravitational wave detection. It gives an opportunity to treat observations of bright stars near the Galactic Center as a wonderful tool not only for an evaluation specific parameters of the black hole but also to obtain constraints on the fundamental gravity law such as a modifications of Newton gravity law in a weak field approximation. In particular, we obtain bounds on a graviton mass based on a potential reconstruction at the Galactic Center.
Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.
Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera
2017-01-23
Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental
New antiferromagnetic semiconductor CuCr1.5Sb0.5S4
International Nuclear Information System (INIS)
Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.
1993-01-01
New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic
LENUS (Irish Health Repository)
Doherty, Anne
2014-08-01
Early identification of women at risk of developing early-onset severe preeclampsia (sPE) is a key objective in obstetrics. An elevated ratio of serum soluble fms-like tyrosine kinase (sFlt-1) to placenta-like growth factor (PlGF) (sFlt-1\\/PlGF ratio) precedes overt hypertension. The longitudinal relationship between this biomarker, maternal hemodynamics, and maternal serum uric acid during the pre-clinical phase is unknown.
Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons
International Nuclear Information System (INIS)
Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.
2007-01-01
Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%
Therapy of anorexia and Young’s early maladaptive schemas. Longitudinal study
Directory of Open Access Journals (Sweden)
Dorota Mącik
2015-10-01
Full Text Available Background Young’s early maladaptive schemas are defined as convictions about oneself acquired in childhood, formed by a child in response to deprivation of his or her basic needs, especially in the area of relationships. In the case of anorexia, the role of the family and relations is emphasized as crucial for the genesis of this disorder. The aim of the research was to investigate whether Young’s early maladaptive schemas change during the therapy, which would prognosticate higher treatment efficiency. Participants and procedure The study group included 30 women suffering from anorexia, starting their 6-week therapeutic program. The procedure included double measurement: during the administration and discharge. The respondents filled in the Young Schema Questionnaire in its short form (YSQ-S3 (twice, the Acceptance of Illness Scale (AIS adapted by Juczyński (twice, and a demographic chart (once. Results The intensity of all schemas decreased after completion of the therapeutic program; the differences were mostly statistically significant. The composition of the most intense schemas did not change significantly: unrelenting standards and abandonment were the highest during both measurements. What changed were the interrelations between the schemas. They are also connected with the acceptance of the illness (the weaker they are, the greater the acceptance, and the stronger the relations and with psychological well-being, especially during the post-therapy measurement. Conclusions The schemas seem to be significant from the perspective of understanding anorexia. They are susceptible to be changed by integrative therapies. Nevertheless, it seems that in order to achieve a durable change, schema therapy should be applied.
International Nuclear Information System (INIS)
Rahimi, Asal; Thomas, Kimberly; Spangler, Ann; Rao, Roshni; Leitch, Marilyn; Wooldridge, Rachel; Rivers, Aeisha; Seiler, Stephen; Albuquerque, Kevin; Stevenson, Stella; Goudreau, Sally; Garwood, Dan; Haley, Barbara; Euhus, David; Heinzerling, John; Ding, Chuxiong; Gao, Ang; Ahn, Chul; Timmerman, Robert
2017-01-01
Purpose: To evaluate the tolerability of a dose-escalated 5-fraction stereotactic body radiation therapy for partial-breast irradiation (S-PBI) in treating early-stage breast cancer after partial mastectomy; the primary objective was to escalate dose utilizing a robotic stereotactic radiation system treating the lumpectomy cavity without exceeding the maximum tolerated dose. Methods and Materials: Eligible patients included those with ductal carcinoma in situ or invasive nonlobular epithelial histologies and stage 0, I, or II, with tumor size <3 cm. Patients and physicians completed baseline and subsequent cosmesis outcome questionnaires. Starting dose was 30 Gy in 5 fractions and was escalated by 2.5 Gy total for each cohort to 40 Gy. Results: In all, 75 patients were enrolled, with a median age of 62 years. Median follow-up for 5 cohorts was 49.9, 42.5, 25.7, 20.3, and 13.5 months, respectively. Only 3 grade 3 toxicities were experienced. There was 1 dose-limiting toxicity in the overall cohort. Ten patients experienced palpable fat necrosis (4 of which were symptomatic). Physicians scored cosmesis as excellent or good in 95.9%, 100%, 96.7%, and 100% at baseline and 6, 12, and 24 months after S-PBI, whereas patients scored the same periods as 86.5%, 97.1%, 95.1%, and 95.3%, respectively. The disagreement rates between MDs and patients during those periods were 9.4%, 2.9%, 1.6%, and 4.7%, respectively. There have been no recurrences or distant metastases. Conclusion: Dose was escalated to the target dose of 40 Gy in 5 fractions, with the occurrence of only 1 dose-limiting toxicity. Patients felt cosmetic results improved within the first year after surgery and stereotactic body radiation therapy. Our results show minimal toxicity with excellent cosmesis; however, further follow-up is warranted in future studies. This study is the first to show the safety, tolerability, feasibility, and cosmesis results of a 5-fraction dose-escalated S-PBI treatment for
Energy Technology Data Exchange (ETDEWEB)
Rahimi, Asal, E-mail: asal.rahimi@utsouthwestern.edu [University of Texas Southwestern Medical Center, Dallas, Texas (United States); Thomas, Kimberly; Spangler, Ann [University of Texas Southwestern Medical Center, Dallas, Texas (United States); Rao, Roshni; Leitch, Marilyn; Wooldridge, Rachel; Rivers, Aeisha [Department of Surgery, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Seiler, Stephen [Department of Radiology, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Albuquerque, Kevin; Stevenson, Stella [University of Texas Southwestern Medical Center, Dallas, Texas (United States); Goudreau, Sally [Department of Radiology, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Garwood, Dan [University of Texas Southwestern Medical Center, Dallas, Texas (United States); Haley, Barbara [Department of Medical Oncology, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Euhus, David [Department of Surgery, Johns Hopkins University, Baltimore, Maryland (United States); Heinzerling, John [Department of Radiation Oncology, Levine Cancer Institute, Charlotte, North Carolina (United States); Ding, Chuxiong [University of Texas Southwestern Medical Center, Dallas, Texas (United States); Gao, Ang; Ahn, Chul [Department of Statistics, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Timmerman, Robert [University of Texas Southwestern Medical Center, Dallas, Texas (United States)
2017-05-01
Purpose: To evaluate the tolerability of a dose-escalated 5-fraction stereotactic body radiation therapy for partial-breast irradiation (S-PBI) in treating early-stage breast cancer after partial mastectomy; the primary objective was to escalate dose utilizing a robotic stereotactic radiation system treating the lumpectomy cavity without exceeding the maximum tolerated dose. Methods and Materials: Eligible patients included those with ductal carcinoma in situ or invasive nonlobular epithelial histologies and stage 0, I, or II, with tumor size <3 cm. Patients and physicians completed baseline and subsequent cosmesis outcome questionnaires. Starting dose was 30 Gy in 5 fractions and was escalated by 2.5 Gy total for each cohort to 40 Gy. Results: In all, 75 patients were enrolled, with a median age of 62 years. Median follow-up for 5 cohorts was 49.9, 42.5, 25.7, 20.3, and 13.5 months, respectively. Only 3 grade 3 toxicities were experienced. There was 1 dose-limiting toxicity in the overall cohort. Ten patients experienced palpable fat necrosis (4 of which were symptomatic). Physicians scored cosmesis as excellent or good in 95.9%, 100%, 96.7%, and 100% at baseline and 6, 12, and 24 months after S-PBI, whereas patients scored the same periods as 86.5%, 97.1%, 95.1%, and 95.3%, respectively. The disagreement rates between MDs and patients during those periods were 9.4%, 2.9%, 1.6%, and 4.7%, respectively. There have been no recurrences or distant metastases. Conclusion: Dose was escalated to the target dose of 40 Gy in 5 fractions, with the occurrence of only 1 dose-limiting toxicity. Patients felt cosmetic results improved within the first year after surgery and stereotactic body radiation therapy. Our results show minimal toxicity with excellent cosmesis; however, further follow-up is warranted in future studies. This study is the first to show the safety, tolerability, feasibility, and cosmesis results of a 5-fraction dose-escalated S-PBI treatment for
International Nuclear Information System (INIS)
Jelassi, H.; Viaris de Lesegno, B.; Pruvost, L.
2006-01-01
We report on photoassociation of cold 87 Rb atoms providing the spectroscopy of (5s 1/2 +5p 1/2 )0 u + long-range molecular states, in the energy range of [-12.5, -0.7 cm -1 ] below the dissociation limit. A Lu-Fano approach coupled to the LeRoy-Bernstein formula is used to analyze the data. The Lu-Fano graph exhibits the coupling of the molecular series with the (5s 1/2 +5p 3/2 )0 u + one, which is due to spin effects in the molecule. A two-channel model involving an improved LeRoy-Bernstein formula allows us to characterize the molecular series, to localize (5s 1/2 +5p 3/2 )0 u + levels, to evaluate the coupling, and to predict the energy and width of the first predissociated level of (5s 1/2 +5p 3/2 )0 u + series. An experimental spectrum confirms the prediction
The 5S methodology as a tool for improving the organisation
J. Michalska; D. Szewieczek
2007-01-01
Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...
Trust in the early chain of healthcare: lifeworld hermeneutics from the patient’s perspective
Norberg Boysen, Gabriella; Nyström, Maria; Christensson, Lennart; Herlitz, Johan; Wireklint Sundström, Birgitta
2017-01-01
ABSTRACT Purpose: Patients must be able to feel as much trust for caregivers and the healthcare system at the healthcare centre as at the emergency department. The aim of this study is to explain and understand the phenomenon of trust in the early chain of healthcare, when a patient has called an ambulance for a non-urgent condition and been referred to the healthcare centre. Method: A lifeworld hermeneutic approach from the perspective of caring science was used. Ten patients participated: seven female and three male. The setting is the early chain of healthcare in south-western Sweden. Results: The findings show that the phenomenon of trust does not automatically involve medical care. However, attention to the patient’s lifeworld in a professional caring relationship enables the patient to trust the caregiver and the healthcare environment. It is clear that the “voice of the lifeworld” enables the patient to feel trust. Conclusion: Trust in the early chain of healthcare entails caregivers’ ability to pay attention to both medical and existential issues in compliance with the patient’s information and questions. Thus, the patient must be invited to participate in assessments and decisions concerning his or her own healthcare, in a credible manner and using everyday language. PMID:28793852
Directory of Open Access Journals (Sweden)
Fereydoun Farrahi
2010-01-01
Full Text Available Purpose: To compare the hemostatic effect of sulfur hexafluoride 20% (SF6 20% with lactated Ringer′s solution for prevention of early postoperative vitreous hemorrhage following diabetic vitrectomy. Methods: In a prospective randomized clinical trial, 50 eyes undergoing diabetic vitrectomy were divided into two groups. At the conclusion of surgery, in one group the vitreous cavity was filled with SF6 20% while in the other group lactated Ringer′s solution was retained in the vitreous cavity. The two groups were compared for the rate of early postoperative vitreous hemorrhage. Results: The incidence of vitreous hemorrhage was lower in the SF6 group than the Ringer′s group 4 days (20% vs 68%, P=0.001, 7 days (24% vs 60%, P=0.01 and 4 weeks (16% vs 40%, P=0.059 after vitrectomy. Conclusion: In comparison with lactated Ringer′s solution, SF6 20% had a significant hemostatic effect especially in the early postoperative period after diabetic vitrectomy and reduced the incidence of vitreous hemorrhage.
Early cysteine-dependent inactivation of 26S proteasomes does not involve particle disassembly
Directory of Open Access Journals (Sweden)
Martín Hugo
2018-06-01
Full Text Available Under oxidative stress 26S proteasomes suffer reversible disassembly into its 20S and 19S subunits, a process mediated by HSP70. This inhibits the degradation of polyubiquitinated proteins by the 26S proteasome and allows the degradation of oxidized proteins by a free 20S proteasome. Low fluxes of antimycin A-stimulated ROS production caused dimerization of mitochondrial peroxiredoxin 3 and cytosolic peroxiredoxin 2, but not peroxiredoxin overoxidation and overall oxidation of cellular protein thiols. This moderate redox imbalance was sufficient to inhibit the ATP stimulation of 26S proteasome activity. This process was dependent on reversible cysteine oxidation. Moreover, our results show that this early inhibition of ATP stimulation occurs previous to particle disassembly, indicating an intermediate step during the redox regulation of the 26S proteasome with special relevance under redox signaling rather than oxidative stress conditions.
Constraining neutron-star tidal Love numbers with gravitational-wave detectors
International Nuclear Information System (INIS)
Flanagan, Eanna E.; Hinderer, Tanja
2008-01-01
Ground-based gravitational wave detectors may be able to constrain the nuclear equation of state using the early, low frequency portion of the signal of detected neutron star-neutron star inspirals. In this early adiabatic regime, the influence of a neutron star's internal structure on the phase of the waveform depends only on a single parameter λ of the star related to its tidal Love number, namely, the ratio of the induced quadrupole moment to the perturbing tidal gravitational field. We analyze the information obtainable from gravitational wave frequencies smaller than a cutoff frequency of 400 Hz, where corrections to the internal-structure signal are less than 10%. For an inspiral of two nonspinning 1.4M · neutron stars at a distance of 50 Megaparsecs, LIGO II detectors will be able to constrain λ to λ≤2.0x10 37 g cm 2 s 2 with 90% confidence. Fully relativistic stellar models show that the corresponding constraint on radius R for 1.4M · neutron stars would be R≤13.6 km (15.3 km) for a n=0.5 (n=1.0) polytrope with equation of state p∝ρ 1+1/n
Effect of early preoperative 5-fluorouracil on the integrity of colonic anastomoses in rats
Ozel, Leyla; Ozel, M Sefa; Toros, Ahmet Burak; Kara, Melih; Ozkan, Kemal Sırrı; Tellioglu, Gurkan; Krand, Osman; Koyuturk, Meral; Berber, Ibrahim
2009-01-01
AIM: To determine the effect of chemotherapy on wound healing by giving early preoperative 5-fluorouracil (5-FU) to rats with colonic anastomoses. METHODS: Sixty Albino-Wistar male rats (median weight, 235 g) were used in this study. The rats were fed with standard laboratory food and given tap water ad libitum. The animals were divided into three groups: Group 1: Control group (chemotherapy was not administered), Group 2: Intraperitoneally (IP) administered 5-FU group (chemotherapy was administered IP to animals at a dose of 20 mg/kg daily during the 5 d preceeding surgery), Group 3: Intravenously (IV) administered 5-FU group. Chemotherapy was administered via the penil vein, using the same dosing scheme and duration as the second group. After a 3-d rest to minimize the side effects of chemotherapy, both groups underwent surgery. One centimeter of colon was resected 2 cm proximally from the peritoneal reflection, then sutured intermittently and subsequently end-to-end anastomosed. In each group, half the animals were given anaesthesia on the 3rd postoperative (PO) day and the other half on the 7th PO day, for in vivo analytic procedures. The abdominal incisions in the rats were dissected, all the new and old anastomotic segments were clearly seen and bursting pressures of each anastomotic segment, tissue hydroxyproline levels and DNA content were determined to assess the histologic tissue repair process. RESULTS: When the IV group was compared with the IP group, bursting pressures of the anastomotic segments on the 3rd and 7th PO days, were found to be significantly decreased, hydroxyproline levels at the anastomotic segment on the 7th PO day were significantly decreased (P < 0.01). CONCLUSION: In this study, we conclude that early preoperative 5-FU, administered IV, negatively affects wound healing. However, IP administered 5-FU does not negatively affect wound healing. PMID:19725150
International Nuclear Information System (INIS)
English, R.B.; Liddell, R.J.; Whiteley, C.G.
1987-01-01
One pair of diastereomeric bromoamides, (2'R,1S,2S)- and (2'S,1S,2S)-N(2-bromopropanoyl)-2-amino-1-phenylpropane-1,3-diol have been synthesized from ethyl 2-bromopropionate and an optically active amino-diol. The crystal structures of both were determined from single-crystal X-ray analyses. Both compounds are orthorhombic with space group P2 1 2 1 2 1 with Z = 4 in a unit cell of dimensions a 22,124(5),b 12,812(5), and c 4,886(5)A and a 15,510(5), b 9,707(5), and c 9,457(5)A. The proton chemical shifts of the groups attached to the asymmetric centre C(2'), and consequently, the identification of the configuration of the molecules, were resolved with the help of high-resolution nuclear magnetic resonance
Implementacija metode 5S v proces proizvodnje
Directory of Open Access Journals (Sweden)
Alojz Gorše
2016-03-01
Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction
Search for gravitational waves associated with the August 2006 timing glitch of the Vela pulsar
International Nuclear Information System (INIS)
Abadie, J.; Abbott, B. P.; Abbott, R.; Adhikari, R.; Ajith, P.; Anderson, S. B.; Araya, M.; Aso, Y.; Ballmer, S.; Betzwieser, J.; Billingsley, G.; Black, E.; Blackburn, J. K.; Bork, R.; Brooks, A. F.; Cannon, K. C.; Cardenas, L.; Cepeda, C.; Chalermsongsak, T.; Chatterji, S.
2011-01-01
The physical mechanisms responsible for pulsar timing glitches are thought to excite quasinormal mode oscillations in their parent neutron star that couple to gravitational-wave emission. In August 2006, a timing glitch was observed in the radio emission of PSR B0833-45, the Vela pulsar. At the time of the glitch, the two colocated Hanford gravitational-wave detectors of the Laser Interferometer Gravitational-wave observatory (LIGO) were operational and taking data as part of the fifth LIGO science run (S5). We present the first direct search for the gravitational-wave emission associated with oscillations of the fundamental quadrupole mode excited by a pulsar timing glitch. No gravitational-wave detection candidate was found. We place Bayesian 90% confidence upper limits of 6.3x10 -21 to 1.4x10 -20 on the peak intrinsic strain amplitude of gravitational-wave ring-down signals, depending on which spherical harmonic mode is excited. The corresponding range of energy upper limits is 5.0x10 44 to 1.3x10 45 erg.
Age 5 cognitive development in England
Hansen, Kirstine; Jones, Elizabeth
2010-01-01
Children’s development in the early years has been shown to be related to their success in later life in a range of areas including education, employment and crime. Determining why some children do better than others in the early years is a key issue for policy and is crucial in attempts to reduce inequalities. This research examines differences in early child development by examining the factors associated with the cognitive ability of children up to age 5 using cognitive assessments adminis...
Bia, Daniel; Galli, Cintia; Zócalo, Yanina; Valtuille, Rodolfo; Wray, Sandra; Armentano, Ricardo; Cabrera-Fischer, Edmundo
2017-01-01
To analyze the early vascular aging (EVA) in end-stage renal disease (ESRD) patients, attempting to determine a potential association between EVA and the etiology of ESRD, and to investigate the association of hemodialysis and EVA in ESRD patients during a 5-year follow-up period. Carotid-femoral pulse wave velocity (cfPWV) was obtained in 151 chronically hemodialyzed patients (CHP) and 283 control subjects, and in 25 CHP, who were followed-up after a 5-year lapse. cfPWV increased in ESRD patients compared to control subjects. The cfPWV-age relationship was found to have a steeper increase in ESRD patients. The highest cfPWV and EVA values were observed in patients with diabetic nephropathy. Regression analysis demonstrated a significant reduction of the EVA in HD patients on a 5-year follow-up. Patients in ESRD showed higher levels of EVA. cfPWV and EVA differed in ESRD patients depending on their renal failure etiology. CHP showed an EVA reduction after a 5-year follow-up period. © 2016 S. Karger AG, Basel.
Streamlining Collaboration for the Gravitational-wave Astronomy Community
Koranda, S.
2016-12-01
In the morning hours of September 14, 2015 the LaserInterferometer Gravitational-wave Observatory (LIGO) directlydetected gravitational waves from inspiraling and coalescingblack holes, confirming a major prediction of AlbertEinstein's general theory of relativity and beginning the eraof gravitational-wave astronomy. With the LIGO detectors in the United States, the Virgo andGEO detectors in Europe, and the KAGRA detector in Japan thegravitational-wave astrononmy community is opening a newwindow on our Universe. Realizing the full science potentialof LIGO and the other interferometers requires globalcollaboration not only within the gravitational-wave astronomycommunity but also with the astronomers and astrophysicists acrossmultipe disciplines working to realize and leverage the powerof multi-messenger astronomy. Enabling thousands of researchers from around the world andacross multiple projects to efficiently collaborate, share,and analyze data and provide streamlined access to services,computing, and tools requires new and scalable approaches toidentity and access management (IAM). We will discuss LIGO'sIAM journey that began in 2007 and how today LIGO leveragesinternal identity federations like InCommon and eduGAIN toprovide scalable and managed access for the gravitational-waveastronomy community. We will discuss the steps both largeand small research organizations and projects take as theirIAM infrastructure matures from ad-hoc silos of independent services to fully integrated and federated services thatstreamline collaboration so that scientists can focus onresearch and not managing passwords.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Brand, Christopher J.
2009-01-01
Executive Summary: This Surveillance Plan (Plan) describes plans for conducting surveillance of wild birds in the United States and its Territories and Freely-Associated States to provide for early detection of the introduction of the H5N1 Highly Pathogenic Avian Influenza (HPAI) subtype of the influenza A virus by migratory birds during the 2009 surveillance year, spanning the period of April 1, 2009 - March 31, 2010. The Plan represents a continuation of surveillance efforts begun in 2006 under the Interagency Strategic Plan for the Early Detection of H5N1 Highly Pathogenic Avian Influenza in Wild Migratory Birds (U.S. Department of Agriculture and U.S. Department of the Interior, 2006). The Plan sets forth sampling plans by: region, target species or species groups to be sampled, locations of sampling, sample sizes, and sampling approaches and methods. This Plan will be reviewed annually and modified as appropriate for subsequent surveillance years based on evaluation of information from previous years of surveillance, changing patterns and threats of H5N1 HPAI, and changes in funding availability for avian influenza surveillance. Specific sampling strategies will be developed accordingly within each of six regions, defined here as Alaska, Hawaiian/Pacific Islands, Lower Pacific Flyway (Washington, Oregon, California, Idaho, Nevada, Arizona), Central Flyway, Mississippi Flyway, and Atlantic Flyway.
Precision calculation of 1/4-BPS Wilson loops in AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany); Puletti, V. Giangreco M. [Science Institute, University of Iceland,Dunhaga 3, 107 Reykjavik (Iceland); Griguolo, L. [Dipartimento di Fisica e Scienze della Terra, Università di Parma andINFN Gruppo Collegato di Parma,Viale G.P. Usberti 7/A, 43100 Parma (Italy); Seminara, D. [Dipartimento di Fisica, Università di Firenze and INFN Sezione di Firenze,Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany)
2016-02-16
We study the strong coupling behaviour of 1/4-BPS circular Wilson loops (a family of “latitudes') in N=4 Super Yang-Mills theory, computing the one-loop corrections to the relevant classical string solutions in AdS{sub 5}×S{sup 5}. Supersymmetric localization provides an exact result that, in the large ’t Hooft coupling limit, should be reproduced by the sigma-model approach. To avoid ambiguities due to the absolute normalization of the string partition function, we compare the ratio between the generic latitude and the maximal 1/2-BPS circle: any measure-related ambiguity should simply cancel in this way. We use the Gel’fand-Yaglom method with Dirichlet boundary conditions to calculate the relevant functional determinants, that present some complications with respect to the standard circular case. After a careful numerical evaluation of our final expression we still find disagreement with the localization answer: the difference is encoded into a precise “remainder function'. We comment on the possible origin and resolution of this discordance.
Time of action of 4.5 S RNA in Escherichia coli translation
DEFF Research Database (Denmark)
Brown, S
1989-01-01
A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
Decay rate ratios of Υ(5S)→B anti B reactions
International Nuclear Information System (INIS)
Hwang, Dae Sung; Son, Hyungsuk
2010-01-01
We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)
Directory of Open Access Journals (Sweden)
Gotthard G. Tribl
2014-09-01
Full Text Available Objective To describe characteristics of REM sleep behavior disorder in Wilson’s disease. Method Questionnaire-based interviews (patients and relatives, neurological examinations, two-week prospective dream-diary, video-polysomnography, transcranial sonography, MRI. Results Four Wilson’s disease cases with REM sleep behavior disorder were described; three had REM sleep behavior disorder as initial symptom. All showed mesencephalic tegmental/tectal sonographic hyperechogenicities and two presented ponto-mesencephalic tegmental MRI hyperintensities. Conclusion This first description of REM sleep behavior disorder in Wilson’s disease in literature documents REM sleep behavior disorder as a possible presenting symptom of Wilson’s disease and adds further evidence to the parallelism of Parkinson’s disease and Wilson’s disease in phenotype and brainstem topography, which ought to be further studied. REM sleep behavior disorder has prognostic relevance for neurodegeneration in α-synucleinopathies. In Wilson’s disease, usefulness of early diagnosis and treatment are already well established. REM sleep behavior disorder in Wilson’s disease offers a possible theoretical model for potential early treatment in this extrapyramidal and brainstem paradigm syndrome, previewing the possibility of neuroprotective treatment for REM sleep behavior disorder in “pre-clinical” Parkinson’s disease.
AdS5 solutions from M5-branes on Riemann surface and D6-branes sources
Energy Technology Data Exchange (ETDEWEB)
Bah, Ibrahima [Department of Physics and Astronomy, University of Southern California,Los Angeles, CA 90089 (United States); Institut de Physique Théorique, CEA/Saclay,91191 Gif-sur-Yvette (France)
2015-09-24
We describe the gravity duals of four-dimensional N=1 superconformal field theories obtained by wrapping M5-branes on a punctured Riemann surface. The internal geometry, normal to the AdS{sub 5} factor, generically preserves two U(1)s, with generators (J{sup +},J{sup −}), that are fibered over the Riemann surface. The metric is governed by a single potential that satisfies a version of the Monge-Ampère equation. The spectrum of N=1 punctures is given by the set of supersymmetric sources of the potential that are localized on the Riemann surface and lead to regular metrics near a puncture. We use this system to study a class of punctures where the geometry near the sources corresponds to M-theory description of D6-branes. These carry a natural (p,q) label associated to the circle dual to the killing vector pJ{sup +}+qJ{sup −} which shrinks near the source. In the generic case the world volume of the D6-branes is AdS{sub 5}×S{sup 2} and they locally preserve N=2 supersymmetry. When p=−q, the shrinking circle is dual to a flavor U(1). The metric in this case is non-degenerate only when there are co-dimension one sources obtained by smearing M5-branes that wrap the AdS{sub 5} factor and the circle dual the superconformal R-symmetry. The D6-branes are extended along the AdS{sub 5} and on cups that end on the co-dimension one branes. In the special case when the shrinking circle is dual to the R-symmetry, the D6-branes are extended along the AdS{sub 5} and wrap an auxiliary Riemann surface with an arbitrary genus. When the Riemann surface is compact with constant curvature, the system is governed by a Monge-Ampère equation.
Directory of Open Access Journals (Sweden)
Josie Dickerson
2016-08-01
Full Text Available Abstract Background Early interventions are recognised as key to improving life chances for children and reducing inequalities in health and well-being, however there is a paucity of high quality research into the effectiveness of interventions to address childhood health and development outcomes. Planning and implementing standalone RCTs for multiple, individual interventions would be slow, cumbersome and expensive. This paper describes the protocol for an innovative experimental birth cohort: Born in Bradford’s Better Start (BiBBS that will simultaneously evaluate the impact of multiple early life interventions using efficient study designs. Better Start Bradford (BSB has been allocated £49 million from the Big Lottery Fund to implement 22 interventions to improve outcomes for children aged 0–3 in three key areas: social and emotional development; communication and language development; and nutrition and obesity. The interventions will be implemented in three deprived and ethnically diverse inner city areas of Bradford. Method The BiBBS study aims to recruit 5000 babies, their mothers and their mothers’ partners over 5 years from January 2016-December 2020. Demographic and socioeconomic information, physical and mental health, lifestyle factors and biological samples will be collected during pregnancy. Parents and children will be linked to their routine health and local authority (including education data throughout the children’s lives. Their participation in BSB interventions will also be tracked. BiBBS will test interventions using the Trials within Cohorts (TwiCs approach and other quasi-experimental designs where TwiCs are neither feasible nor ethical, to evaluate these early life interventions. The effects of single interventions, and the cumulative effects of stacked (multiple interventions on health and social outcomes during the critical early years will be measured. Discussion The focus of the BiBBS cohort is on
Soto, Timothy; Giserman Kiss, Ivy; Carter, Alice S
2016-09-01
Over the past 5 years, a great deal of information about the early course of autism spectrum disorder (ASD) has emerged from longitudinal prospective studies of infants at high risk for developing ASD based on a previously diagnosed older sibling. The current article describes early ASD symptom presentations and outlines the rationale for defining a new disorder, Early Atypical Autism Spectrum Disorder (EA-ASD) to accompany ASD in the new revision of the ZERO TO THREE Diagnostic Classification of Mental Health and Developmental Disorders of Infancy and Early Childhood (DC:0-5) (in press) alternative diagnostic classification manual. EA-ASD is designed to identify children who are 9 to 36 months of age presenting with a minimum of (a) two social-communication symptoms and (b) one repetitive and restricted behavior symptom as well as (c) evidence of impairment, with the intention of providing these children with appropriately tailored services and improving the likelihood of optimizing their development. © 2016 Michigan Association for Infant Mental Health.
Directory of Open Access Journals (Sweden)
A. O. Schelkunov
2016-10-01
The methodology of this study is based on general principles (historicity, objectivity, scientific historical and scientific methods (historicalgenetic, historical, typological, historical, comparative, chronological. After a detailed historiographical analysis revealed that the origins of the formation of the myth of tens of millions of people convicted for notorious 58th item is the adjustment journalism. Data on the number of victims of repression in the late 1980s early 1990s became paradigmatic significance. Historical themes were an important factor in the separation of political forces, the findings with respect to the magnitude of losses in the USSR during the “Great Terror” in the media has become one of the main arguments in disputes between “Democrats” and “conservative.” Despite the fact that in the early 1990s there were professional historical research, which based on archival sources was established number of repressed 3.8 million people in broad sectors of society take root idea of tens of millions of those arrested for political reasons.
Crosnoe, Robert; Ansari, Arya
2015-12-01
For many immigrants, their children's schools offer their first sustained interaction with the major societal institutions of their new countries, and so exploring the ways in which immigrant parents manage their children's educational experiences offers insight into how they adapt to new cultural norms, customs and expectations and how they are treated in return. This study delved into the involvement of Latin American immigrant parents in U.S. education, shifting the traditional focus down from elementary and secondary school to early childhood education. Statistical analysis of nationally representative data revealed that Latina immigrants had lower frequencies of most home- and community-based involvement behaviours than U.S.-born and foreign-born parents of varying racial/ethnic backgrounds but higher frequencies of involvement behaviours requiring participation in early childhood education programmes. As a window into these national patterns, qualitative data from an early childhood programme in an immigration-heavy state revealed that Latina immigrant mothers and their children's teachers often talked about each other as partners in supporting children's educational experiences but that their actual interactions tended to socialise mothers into being more passive recipients of teachers' directives. © 2015 International Union of Psychological Science.
Directory of Open Access Journals (Sweden)
Luigi Giuliani
2013-05-01
Full Text Available Review of Henry S. Turner, The English Renaissance Stage. Geometry, Poetics, and the Practical Spatial Arts 1580-1630, Oxford University Press, Oxford, 2006, reimpr. 2010, 326 pp. ISBN: 978-0-19-959545-7 y Tim Fitzpatrick, Playwright, Space and Place in Early Modern Performance, Ashgate, Franham, 2011, 314 pp. ISBN: 978-1-4094-2827-5.
Merger rate of primordial black-hole binaries
Ali-Haïmoud, Yacine; Kovetz, Ely D.; Kamionkowski, Marc
2017-12-01
Primordial black holes (PBHs) have long been a candidate for the elusive dark matter (DM), and remain poorly constrained in the ˜20 - 100 M⊙ mass range. PBH binaries were recently suggested as the possible source of LIGO's first detections. In this paper, we thoroughly revisit existing estimates of the merger rate of PBH binaries. We compute the probability distribution of orbital parameters for PBH binaries formed in the early Universe, accounting for tidal torquing by all other PBHs, as well as standard large-scale adiabatic perturbations. We then check whether the orbital parameters of PBH binaries formed in the early Universe can be significantly affected between formation and merger. Our analytic estimates indicate that the tidal field of halos and interactions with other PBHs, as well as dynamical friction by unbound standard DM particles, do not do significant work on nor torque PBH binaries. We estimate the torque due to baryon accretion to be much weaker than previous calculations, albeit possibly large enough to significantly affect the eccentricity of typical PBH binaries. We also revisit the PBH-binary merger rate resulting from gravitational capture in present-day halos, accounting for Poisson fluctuations. If binaries formed in the early Universe survive to the present time, as suggested by our analytic estimates, they dominate the total PBH merger rate. Moreover, this merger rate would be orders of magnitude larger than LIGO's current upper limits if PBHs make a significant fraction of the dark matter. As a consequence, LIGO would constrain ˜10 - 300 M⊙ PBHs to constitute no more than ˜1 % of the dark matter. To make this conclusion fully robust, though, numerical study of several complex astrophysical processes—such as the formation of the first PBH halos and how they may affect PBH binaries, as well as the accretion of gas onto an extremely eccentric binary—is needed.
5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA
Ovaskainen, Tatu-Pekka
2014-01-01
Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...
Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli
DEFF Research Database (Denmark)
Brown, S
1991-01-01
4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....
Properties of the Binary Black Hole Merger GW150914
Abbott, B. P.; Abbott, R.; Abernathy, M. R.; Adhikari, R. X.; Anderson, S. B.; Arai, K.; Araya, M. C.; Barayoga, J. C.; Barish, B. C.; Berger, B. K.; Billingsley, G.; Blackburn, J. K.; Bork, R.; Brooks, A. F.; Cahillane, C.
2016-01-01
On September 14, 2015, the Laser Interferometer Gravitational-Wave Observatory (LIGO) detected a gravitational-wave transient (GW150914); we characterize the properties of the source and its parameters. The data around the time of the event were analyzed coherently across the LIGO network using a suite of accurate waveform models that describe gravitational waves from a compact binary system in general relativity. GW150914 was produced by a nearly equal mass binary black hole of masses 36^(+5...
Beyond the walls of the lunatic asylum: Christopher Hope’s early fiction
Directory of Open Access Journals (Sweden)
F. Wood
2004-07-01
Full Text Available This article examines an under-explored aspect of Christopher Hope’s early fiction: its capacity to suggest the potential for imaginative and psychological freedom through its comic, carnivalesque qualities. Hope produced various novels and stories set in South Africa during the 1950s and 1960s, including A Separate Development (1981, Black Swan (1987 and the short story collection Learning to Fly (1990. It is argued that Hope’s vision in these works tends to be perceived as essentially satirical, ultimately limited by bleakness and pessimism; while the carnivalesque, potentially liberatory aspects of his writing tend to be overlooked. By utilising comic and carnivalesque features Hope’s work indeed offers creative, liberated ways of apprehending reality. Mikhail Bakhtin’s discussion of the ability of the carnivalesque to open up new ways of seeing, through the “nonofficial” versions of reality that it proffers, is particularly relevant in this regard. It is argued that this latter aspect of Hope’s work is especially significant, bearing in mind the sense of constraint and confinement that seemed to dominate much of South African fiction during the apartheid era and that still remains a key concern in many postapartheid novels.
DEFF Research Database (Denmark)
Olesen, Morten S; Yuan, Lei; Liang, Bo
2012-01-01
a mechanistic overlap between LQTS3 and early-onset lone AF. In 9 of 10 identified mutations and rare variants, we observed compromised biophysical properties affecting the transient peak current. CONCLUSIONS: In a cohort of patients with early-onset lone AF, we identified a high prevalence of SCN5A mutations...
Energy Technology Data Exchange (ETDEWEB)
Claus, J.J.; Walstra, G.J.M.; Hijdra, A.; Gool, W.A. van [Department of Neurology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Royen, E.A. van [Department of Nuclear Medicine, Academic Medical Center, University of Amsterdam (Netherlands); Verbeeten, B. Jr. [Department of Radiology, Academic Medical Center, University of Amsterdam (Netherlands)
1999-03-01
We determined the relationship between regional cerebral blood flow (rCBF) measured with single-photon emission tomography (SPET) and decline in cognitive function and survival in Alzheimer`s disease. In a prospective follow-up study, 69 consecutively referred patients with early probable Alzheimer`s disease (NINCDS/ADRDA criteria) underwent SPET performed at the time of initial diagnosis using technetium-99m-labelled hexamethylpropylene amine oxime. Neuropsychological function was assessed at baseline and after 6 months and survival data were available on all patients, extending to 5.5 years of follow-up. Lower left temporal (P<0.01) and lower left parietal (P<0.01) rCBF were statistically significantly related to decline in language function after 6 months. The association between left temporal rCBF and survival was also statistically significant (P<0.05) using Cox proportional hazards regression analysis. Performing analysis with quartiles of the distribution, we found a threshold effect for low left temporal rCBF (rCBF<73.7%, P<0.01) and high risk of mortality. In this lowest quartile, median survival time was 2.7 years (follow-up to 5.2 years), compared with 4.4 years in the other quartiles (follow-up to 5.5 years). Kaplan-Meier survival curves showed statistically significant (P<0.05, log rank test) survival curves for the lowest versus other quartiles of left temporal rCBF. All results were unaffected by adjustment for age, sex, dementia severity, duration of symptoms, education and ratings of local cortical atrophy. We conclude that left temporal rCBF predicts decline in language function and survival in patients with early probable Alzheimer`s disease, with a threshold effect of low rCBF and high risk of mortality. (orig.) With 3 figs., 3 tabs., 44 refs.
Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.
Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A
2017-11-14
The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
Smeenk, Chris
2003-12-01
The study of Einstein's theory of general relativity experienced a renaissance beginning in the early 1960s. Prior to this resurgence of interest, general relativity was isolated from mainstream physics-admired for its elegance, perhaps, but only from a distance. The generation of students who risked their careers by entering this neglected field has now reached the age of festschrifts. In June of 2000, Caltech hosted ;Kipfest,; a conference in honor of Kip Thorne's 60th birthday. Thorne started graduate school at Princeton in 1962 and began research in general relativity under John Wheeler's guidance in the heady early days of the renaissance. Since then, he has played a prominent role in general relativity: as co-author of the influential textbook Gravitation, as a leader in research regarding astrophysical applications of Einstein's theory, and as a co-founder and chief advocate for the Laser Interferometer Gravitational Wave Observatory (LIGO), to mention a few aspects of his far-reaching work. ;Kipfest; included 14 speakers discussing fields to which Thorne has contributed. But the conference also reflected Thorne's long-standing commitment to communicating science to a general audience: Igor Novikov, Stephen Hawking, Timothy Ferris, and Alan Lightman gave popular talks at ;Kipfest,; with Thorne himself tricked into delivering a fifth. The Future of Spacetime gathers adaptations of these five lectures, along with a lengthy introductory essay by Richard Price.
International Nuclear Information System (INIS)
Olsson, T.; Fraenkel, L.; Lindgren, I.; Nyberg, A.; Robertsson, L.; Rosen, A.
1986-01-01
A series of experiments has been performed to determine the hyperfine structure in the metastable 4d 5 5s 5 Dsub(1,2,3,4) states of Mo I by means of the laser radiofrequency double-resonance technique. Furthermore, hyperfine structure splittings and isotope shifts in seven optical transitions connecting the 4d 5 5s 5 Dsub(0,1,2,3,4) and the 4d 4 5s5p 5 Psub(1,2,3) states were resolved with the high-resolution laser spectroscopy technique. Radial hyperfine structure parameters are deduced for the effective operator within the 5 D states using the configurations 4d 4 5s 2 , 4d 5 5s and 4d 6 as a model space. The isotope shifts are also discussed, utilizing an effective operator, with particular emphasis on the J dependence. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Singer, Leo P.; Cenko, S. Bradley; Gehrels, Neil; Cannizzo, John [Astroparticle Physics Laboratory, NASA Goddard Space Flight Center, Mail Code 661, Greenbelt, MD 20771 (United States); Chen, Hsin-Yu; Holz, Daniel E.; Farr, Ben [Department of Physics, Enrico Fermi Institute, and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Farr, Will M.; Veitch, John; Berry, Christopher P. L.; Mandel, Ilya [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Price, Larry R.; Raymond, Vivien [LIGO Laboratory, California Institute of Technology, Pasadena, CA 91125 (United States); Kasliwal, Mansi M. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Nissanke, Samaya [Institute of Mathematics, Astrophysics and Particle Physics, Radboud University, Heyendaalseweg 135, 6525 AJ Nijmegen (Netherlands); Coughlin, Michael [Department of Physics and Astronomy, Harvard University, Cambridge, MA 02138 (United States); Urban, Alex L. [Leonard E. Parker Center for Gravitation, Cosmology, and Astrophysics, University of Wisconsin–Milwaukee, Milwaukee, WI 53201 (United States); Vitale, Salvatore; Mohapatra, Satya [LIGO Laboratory, Massachusetts Institute of Technology, 185 Albany Street, Cambridge, MA 02139 (United States); Graff, Philip [Department of Physics, University of Maryland, College Park, MD 20742 (United States)
2016-09-01
This is a supplement to the Letter of Singer et al., in which we demonstrated a rapid algorithm for obtaining joint 3D estimates of sky location and luminosity distance from observations of binary neutron star mergers with Advanced LIGO and Virgo. We argued that combining the reconstructed volumes with positions and redshifts of possible host galaxies can provide large-aperture but small field of view instruments with a manageable list of targets to search for optical or infrared emission. In this Supplement, we document the new HEALPix-based file format for 3D localizations of gravitational-wave transients. We include Python sample code to show the reader how to perform simple manipulations of the 3D sky maps and extract ranked lists of likely host galaxies. Finally, we include mathematical details of the rapid volume reconstruction algorithm.
Je ne menge poinct de porcq: Orlando di Lasso’s Early Parody Mass
Directory of Open Access Journals (Sweden)
Klemen Grabnar
2013-07-01
Full Text Available One of the most remarkable 16th-century composers was Orlando di Lasso (1530/1532–1594, perhaps the most prominent musician of his time. In the second half of the 16th and the early 17th centuries, his works were widespread across Europe, especially in its central and western part. Some of the surviving contemporary sources of Lasso’s music – both printed and manuscript – are preserved in Slovenian libraries and archives. Among them are two incompletely preserved manuscripts, dating from ca. 1600, today kept at the National and University Library in Ljubljana (Ms 232 and Ms 285. They both contain Lasso’s Missa super Je ne menge poinct de porcq, first published in Lasso’s second book of Masses, Quinque missae, by Claudio Merulo in 1570. Interestingly, this early Munich-period Mass is based on a Parisian chanson by Claudin de Sermisy (ca. 1490–1562, whose content is unequivocally scatological. It was quite common for 16th-century composers to base their settings of the Mass Ordinary on pre-existent polyphonic compositions, whether sacred or secular. One of the rare descriptions of this technique – widely known as parody technique – is given in Pietro Cerone’s El melopeo y maestro (1613. It can serve as the basis for an elementary analysis of how Lasso employed Sermisy’s chanson Je ne menge point de porc. The analysis shows that Lasso, for various reasons, does not always follow the established practices as they can be observed from Cerone’s treatise. Nevertheless he demonstrates significant skill in utilising borrowed material to compose his parody Mass. Lasso’s Missa super Je ne menge poinct de porcq is particularly intriguing due to its use of Sermisy’s chanson; what could be the reason for Lasso’s decision to use Sermisy’s profoundly secular chanson in order to compose a Mass setting? Although the answer can be multifaceted (such as an intention to establish a special textual relation between the Mass and the
The educative prevention of the early stage of educationist’s formation.
Directory of Open Access Journals (Sweden)
Marta Alfonso Nazco
2010-04-01
Full Text Available The article introduces a characterization of the educative prevention stage at the early professional formation process of educacionist in Sancti Spìritus province. The study is done by the indication analysis of assistant, learning, permanence and behavior at youths who course pedagogical carrers, and haven’t expressed a desire stage yet. The main shown results dealt with the assumption of the searching variables and its indicators, the construction of instruments and the definition of aspects concerning the educative prevention at the early stage of educationist’s formation in the selected choosing. Theoretical, empirical and statistical- math, methods were used which were helped by the constructed instruments and the triangulations among them thus arriving to generalizations for the caracterization. The results have better the work at the area project of the educative prevention in adolescents and youths in the territory, witch mainly concern the desing and implementation of actions withing the pedagogical process, foccuse in the integration of institutions, socializer and educative agents functioning to eductive prevention.
A genetic screen of the mutations in the Korean patients with early-onset Alzheimer’s disease
Directory of Open Access Journals (Sweden)
An SS
2016-12-01
Full Text Available Seong Soo An,1,* Sun Ah Park,2,* Eva Bagyinszky,1 Sun Oh Bae,1 Yoon-Jeong Kim,2 Ji Young Im,2 Kyung Won Park,3 Kee Hyung Park,4 Eun-Joo Kim,5 Jee Hyang Jeong,6 Jong Hun Kim,7 Hyun Jeong Han,8 Seong Hye Choi,9 SangYun Kim10 1Department of Bionano Technology, Gachon University, Seongnam-si, 2Department of Neurology, Soonchunhyang University Bucheon Hospital, Bucheon, 3Department of Neurology, Dong-A University College of Medicine and Institute of Convergence Bio-Health, Busan, 4Department of Neurology, Gachon University Gil Medical Center, Incheon, 5Department of Neurology, Pusan National University Hospital, Busan, 6Department of Neurology, Ewha Womans University Mokdong Hospital, Seoul, 7Department of Neurology, Ilsan Hospital, National Health Insurance Corporation, 8Department of Neurology, Myongii Hospital, Goyang, 9Department of Neurology, Inha University School of Medicine, Incheon, 10Department of Neurology, Seoul National University College of Medicine & Neurocognitive Behavior Center, Seoul National University Bundang Hospital, Seongnam-si, Republic of Korea *These authors contributed equally to this work Abstract: Early-onset Alzheimer’s disease (EOAD has distinct clinical characteristics in comparison to late-onset Alzheimer’s disease (LOAD. The genetic contribution is suggested to be more potent in EOAD. However, the frequency of causative mutations in EOAD could be variable depending on studies. Moreover, no mutation screening study has been performed yet employing large population in Korea. Previously, we reported that the rate of family history of dementia in EOAD patients was 18.7% in a nationwide hospital-based cohort study, the Clinical Research Center for Dementia of South Korea (CREDOS study. This rate is much lower than in other countries and is even comparable to the frequency of LOAD patients in our country. To understand the genetic characteristics of EOAD in Korea, we screened the common Alzheimer’s disease (AD
23 CFR 710.501 - Early acquisition.
2010-04-01
... FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RIGHT-OF-WAY AND ENVIRONMENT RIGHT-OF-WAY AND REAL ESTATE Property Acquisition Alternatives § 710.501 Early acquisition. (a) Real property... the Civil Rights Act of 1964 (42 U.S.C. 2000d-2000d-4); (5) The State determined and the FHWA concurs...
Dark-red-emitting CdTe0.5Se0.5/Cd0.5Zn0.5S quantum dots: Effect of chemicals on properties
International Nuclear Information System (INIS)
Yang, Ping; Zhang, Aiyu; Li, Xiaoyu; Liu, Ning; Zhang, Yulan; Zhang, Ruili
2013-01-01
CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S core/shell quantum dots (QDs) with a tunable photoluminescence (PL) range from yellow to dark red (up to a PL peak wavelength of 683 nm) were fabricated using various reaction systems. The core/shell QDs created in the reaction solution of trioctylamine (TOA) and oleic acid (OA) at 300 °C exhibited narrow PL spectra and a related low PL efficiency (38%). In contrast, the core/shell QDs prepared in the solution of 1-octadecene (ODE) and hexadecylamine (HDA) at 200 °C revealed a high PL efficiency (70%) and broad PL spectra. This phenomenon is ascribed that the precursor of Cd, reaction temperature, solvents, and ligands affected the formation process of the shell. The slow growth rate of the shell in the solution of ODE and HDA made QDs with a high PL efficiency. Metal acetate salts without reaction with HDA led to the core/shell QDs with a broad size distribution. - Graphical abstract: CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots (QDs) with tunable photoluminescence, high PL efficiency, and high stability through organic synthesis, in which chemicals affected the properties of the QDs. Display Omitted - Highlights: • CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots created via organic synthesis. • Chemicals affected the properties of the quantum dots. • The quantum dots revealed high photoluminescence efficiency and stability. • The quantum dots with tunable photoluminescence in a range from yellow to dark red. • The QDs are utilizable for various applications such as biological labeling
Wilson lines for AdS5 black strings
International Nuclear Information System (INIS)
Hristov, Kiril; Katmadas, Stefanos
2015-01-01
We describe a simple method of extending AdS 5 black string solutions of 5d gauged supergravity in a supersymmetric way by addition of Wilson lines along a circular direction in space. When this direction is chosen along the string, and due to the specific form of 5d supergravity that features Chern-Simons terms, the existence of magnetic charges automatically generates conserved electric charges in a 5d analogue of the Witten effect. Therefore we find a rather generic, model-independent way of adding electric charges to already existing solutions with no backreaction from the geometry or breaking of any symmetry. We use this method to explicitly write down more general versions of the Benini-Bobev black strings (http://dx.doi.org/10.1103/PhysRevLett.110.061601, http://dx.doi.org/10.1007/JHEP06(2013)005) and comment on the implications for the dual field theory and the similarities with generalizations of the Cacciatori-Klemm black holes (http://dx.doi.org/10.1007/JHEP01(2010)085) in AdS 4 .
Energy Technology Data Exchange (ETDEWEB)
Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Tseytlin, A.A. [Theoretical Physics Group, Blackett Laboratory, Imperial College,London, SW7 2AZ (United Kingdom); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institute of Physics, University of São Paulo,Rua do Matão 1371, 05508-090 São Paulo (Brazil)
2017-03-01
We revisit the computation of the 1-loop string correction to the “latitude' minimal surface in AdS{sub 5}×S{sup 5} representing 1/4 BPS Wilson loop in planar N=4 SYM theory previously addressed in https://arxiv.org/abs/1512.00841 and https://arxiv.org/abs/1601.04708. We resolve the problem of matching with the subleading term in the strong coupling expansion of the exact gauge theory result (derived previously from localization) using a different method to compute determinants of 2d string fluctuation operators. We apply perturbation theory in a small parameter (angle of the latitude) corresponding to an expansion near the AdS{sub 2} minimal surface representing 1/2 BPS circular Wilson loop. This allows us to compute the corrections to the heat kernels and zeta-functions of the operators in terms of the known heat kernels on AdS{sub 2}. We apply the same method also to two other examples of Wilson loop surfaces: generalized cusp and k-wound circle.
Work Values, Early Career Difficulties, and the U.S. Economic Recession
Johnson, Monica Kirkpatrick; Sage, Rayna Amber; Mortimer, Jeylan T.
2012-01-01
We examine how work difficulties in the early career, and the generally deteriorating work conditions associated with the recent U.S. economic recession, shape individuals’ work values. Drawing on panel data from the Youth Development Study, we test whether individuals change their work values in response to concerns about satisfying material needs or the features of jobs that they are able to attain. Results indicate that extrinsic values are weakened in the face of unemployment, as well as reduced job security, income, and advancement. These patterns support a reinforcement and accentuation model in which workers adjust their values to emphasize what they actually obtain from the job. Intrinsic values are weakened by working in a job unrelated to one’s career plans; they are reinforced by the experience of greater intrinsic rewards and advancement opportunities. PMID:23503050
Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng
2016-07-01
Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.
Directory of Open Access Journals (Sweden)
Seyed-Mohammad Fereshtehnejad
2014-01-01
Full Text Available The impact of Parkinson’s disease (PD on psychological status and quality of life (QoL may vary depending on age of disease onset. The aim of this study was to compare psychological symptoms and disease-specific QoL between early onset versus the rest of the PD patients. A total number of 140 PD patients with the mean current age of 61.3 (SD=10.4 yr were recruited in this study. PD patients with the onset age of ≤50 yr were defined as “early-onset” (EOPD group (n=45, while the ones with >50 yr at the time of diagnosis were categorized as the “typical-onset” (TOPD patients (n=95. Different questionnaires and scales were used for between-group comparisons including PDQ39, HADS (hospital anxiety and depression scale, FSS (fatigue severity scale, MNA (mininutritional assessment, and the UPDRS. Depression score was significantly higher in EOPD group (6.3 (SD=4.5 versus 4.5 (SD=4.2, P=0.02. Among different domains of QoL, emotion score was also significantly higher in the EOPD group (32.3 (SD=21.6 versus 24.4 (SD=22.7, P=0.05. Our findings showed more severe depression and more impaired emotional domain of QoL in early-onset PD patients. Depression and anxiety play an important role to worsen QoL among both EOPD and TOPD patients, while no interaction was observed in the efficacy of these two psychiatric symptoms and the onset age of PD patients.
Directory of Open Access Journals (Sweden)
Lilian Calderón-Garcidueñas
2013-01-01
Full Text Available Chronic exposure to particulate matter air pollution is known to cause inflammation leading to respiratory- and cardiovascular-related sickness and death. Mexico City Metropolitan Area children exhibit an early brain imbalance in genes involved in oxidative stress, inflammation, and innate and adaptive immune responses. Early dysregulated neuroinflammation, brain microvascular damage, production of potent vasoconstrictors, and perturbations in the integrity of the neurovascular unit likely contribute to progressive neurodegenerative processes. The accumulation of misfolded proteins coincides with the anatomical distribution observed in the early stages of both Alzheimer’s and Parkinson's diseases. We contend misfolding of hyperphosphorylated tau (HPπ, alpha-synuclein, and beta-amyloid could represent a compensatory early protective response to the sustained systemic and brain inflammation. However, we favor the view that the chronic systemic and brain dysregulated inflammation and the diffuse vascular damage contribute to the establishment of neurodegenerative processes with childhood clinical manifestations. Friend turns Foe early; therefore, implementation of neuroprotective measures to ameliorate or stop the inflammatory and neurodegenerative processes is warranted in exposed children. Epidemiological, cognitive, structural, and functional neuroimaging and mechanistic studies into the association between air pollution exposures and the development of neuroinflammation and neurodegeneration in children are of pressing importance for public health.
Prevalence of early loss of primary teeth in 5-10-year-old school children in Chidambaram town
Directory of Open Access Journals (Sweden)
S. Syed Shaheed Ahamed
2012-01-01
Full Text Available Introduction : The premature loss of primary teeth may reduce arch length required for the succeeding tooth and, hence, predisposes crowding, rotation and impaction of the permanent teeth. There are only limited studies carried out about the prevalence of early loss of primary teeth. Aim : The present study was performed to evaluate the prevalence of early loss of primary teeth in school children in Chidambaram town in Tamilnadu, India. Settings and Design : A total of 1121 school children (561 boys and 560 girls between 5 and 10 years of age were selected for the study. Materials and Methods : An experienced examiner performed all clinical examinations under natural light. Data including age and missing tooth was collected. Statistical Analysis Used : Microsoft Excel/2000 (Microsoft Office XP data spreadsheet was used and later exported to the Statistical Package for Social Science (SPSS for Windows (version 10.0. Descriptive statistics was applied and, from the results, chi-square tests were applied at a level of significance of 5% (P 0.05. The greatest prevalence was found among the 8-year olds (5.08%, and the most commonly missing teeth were the right lower primary first molars (16.82%. It can be concluded that the prevalence of early loss was high and that the lower primary molars were the most commonly missing teeth in the present study