WorldWideScience

Sample records for early detection markers

  1. Early Detection of Markers for Synaesthesia in Childhood Populations

    Science.gov (United States)

    Simner, Julia; Harrold, Jenny; Creed, Harriet; Monro, Louise; Foulkes, Louise

    2009-01-01

    We show that the neurological condition of synaesthesia--which causes fundamental differences in perception and cognition throughout a lifetime--is significantly represented within the childhood population, and that it manifests behavioural markers as young as age 6 years. Synaesthesia gives rise to a merging of cognitive and/or sensory functions…

  2. Markers for prediction and early detection of Pneumoconiosis

    CSIR Research Space (South Africa)

    Murray, J

    2004-03-01

    Full Text Available /or specificity in detecting changes in response to silica exposure, or susceptibility to silicosis? A prospective cohort study is necessary to answer this question, with annual follow up for at least five years. The biomarkers chosen can be measured in serum...

  3. New Markers: Urine Xanthine Oxidase and Myeloperoxidase in the Early Detection of Urinary Tract Infection

    Directory of Open Access Journals (Sweden)

    Pınar Ciragil

    2014-01-01

    Full Text Available Objectives. The aim of this study was to evaluate if xanthine oxidase and myeloperoxidase levels quantitation method may alternate routine culture method, which takes more time in the diagnosis of urinary tract infections. Material and Methods. Five hundred and forty-nine outpatients who had admitted to Clinic Microbiology Laboratory were included in the study. The microorganisms were identified by using VITEK System. The urine specimens that were negative from the quantitative urine culture were used as controls. The activities of MPO and XO in spot urine were measured by spectrophotometric method. Results. Through the urine cultures, 167 bacteria were isolated from 163 urine specimens; 386 cultures yielded no bacterial growth. E. coli was the most frequent pathogen. In infection with E. coli both XO and MPO levels were increased the most. The sensitivity, specificity, positive predictive value, and negative predictive value for XO were 100%, 100%, 100%, and 100%, respectively. These values for MPO were 87%, 100%, 100%, and 94%, respectively. Conclusion. These data obtained suggest that urine XO and MPO levels may be new markers in the early detection of UTI.

  4. Comparison of breast cancer to healthy control tissue discovers novel markers with potential for prognosis and early detection.

    Science.gov (United States)

    Schummer, Michèl; Green, Ann; Beatty, J David; Karlan, Beth Y; Karlan, Scott; Gross, Jenny; Thornton, Sean; McIntosh, Martin; Urban, Nicole

    2010-02-09

    This study was initiated to identify biomarkers with potential value for the early detection of poor-outcome breast cancer. Two sets of well-characterized tissues were utilized: one from breast cancer patients with favorable vs. poor outcome and the other from healthy women undergoing reduction mammaplasty. Over 46 differentially expressed genes were identified from a large list of potential targets by a) mining publicly available expression data (identifying 134 genes for quantitative PCR) and b) utilizing a commercial PCR array. Three genes show elevated expression in cancers with poor outcome and low expression in all other tissues, warranting further investigation as potential blood markers for early detection of cancers with poor outcome. Twelve genes showed lower expression in cancers with poor outcome than in cancers with favorable outcome but no differential expression between aggressive cancers and most healthy controls. These genes are more likely to be useful as prognostic tissue markers than as serum markers for early detection of aggressive disease. As a secondary finding was that, when histologically normal breast tissue was removed from a distant site in a breast with cancer, 7 of 38 specimens displayed a cancer-like expression profile, while the remaining 31 were genetically similar to the reduction mammaplasty control group. This finding suggests that some regions of ipsilateral histologically 'normal' breast tissue are predisposed to becoming malignant and that normal-appearing tissue with malignant signature might warrant treatment to prevent new primary tumors.

  5. Label-free nonlinear optical microscopy detects early markers for osteogenic differentiation of human stem cells

    Science.gov (United States)

    Hofemeier, Arne D.; Hachmeister, Henning; Pilger, Christian; Schürmann, Matthias; Greiner, Johannes F. W.; Nolte, Lena; Sudhoff, Holger; Kaltschmidt, Christian; Huser, Thomas; Kaltschmidt, Barbara

    2016-05-01

    Tissue engineering by stem cell differentiation is a novel treatment option for bone regeneration. Most approaches for the detection of osteogenic differentiation are invasive or destructive and not compatible with live cell analysis. Here, non-destructive and label-free approaches of Raman spectroscopy, coherent anti-Stokes Raman scattering (CARS) and second harmonic generation (SHG) microscopy were used to detect and image osteogenic differentiation of human neural crest-derived inferior turbinate stem cells (ITSCs). Combined CARS and SHG microscopy was able to detect markers of osteogenesis within 14 days after osteogenic induction. This process increased during continued differentiation. Furthermore, Raman spectroscopy showed significant increases of the PO43‑ symmetric stretch vibrations at 959 cm‑1 assigned to calcium hydroxyapatite between days 14 and 21. Additionally, CARS microscopy was able to image calcium hydroxyapatite deposits within 14 days following osteogenic induction, which was confirmed by Alizarin Red-Staining and RT- PCR. Taken together, the multimodal label-free analysis methods Raman spectroscopy, CARS and SHG microscopy can monitor osteogenic differentiation of adult human stem cells into osteoblasts with high sensitivity and spatial resolution in three dimensions. Our findings suggest a great potential of these optical detection methods for clinical applications including in vivo observation of bone tissue–implant-interfaces or disease diagnosis.

  6. Circulating micro-RNAs as potential blood-based markers for early stage breast cancer detection.

    Directory of Open Access Journals (Sweden)

    Michael G Schrauder

    Full Text Available INTRODUCTION: MicroRNAs (miRNAs, miRs are a class of small, non-coding RNA molecules with relevance as regulators of gene expression thereby affecting crucial processes in cancer development. MiRNAs offer great potential as biomarkers for cancer detection due to their remarkable stability in blood and their characteristic expression in many different diseases. We investigated whether microarray-based miRNA profiling on whole blood could discriminate between early stage breast cancer patients and healthy controls. METHODS: We performed microarray-based miRNA profiling on whole blood of 48 early stage breast cancer patients at diagnosis along with 57 healthy individuals as controls. This was followed by a real-time semi-quantitative Polymerase Chain Reaction (RT-qPCR validation in a separate cohort of 24 early stage breast cancer patients from a breast cancer screening unit and 24 age matched controls using two differentially expressed miRNAs (miR-202, miR-718. RESULTS: Using the significance level of p<0.05, we found that 59 miRNAs were differentially expressed in whole blood of early stage breast cancer patients compared to healthy controls. 13 significantly up-regulated miRNAs and 46 significantly down-regulated miRNAs in our microarray panel of 1100 miRNAs and miRNA star sequences could be detected. A set of 240 miRNAs that was evaluated by radial basis function kernel support vector machines and 10-fold cross validation yielded a specificity of 78.8%, and a sensitivity of 92.5%, as well as an accuracy of 85.6%. Two miRNAs were validated by RT-qPCR in an independent cohort. The relative fold changes of the RT-qPCR validation were in line with the microarray data for both miRNAs, and statistically significant differences in miRNA-expression were found for miR-202. CONCLUSIONS: MiRNA profiling in whole blood has potential as a novel method for early stage breast cancer detection, but there are still challenges that need to be addressed to

  7. Sirtuin1: a promising serum protein marker for early detection of Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Rahul Kumar

    Full Text Available Sirtuin (SIRT pathway has a crucial role in Alzheimer's disease (AD. The present study evaluated the alterations in serum sirtuin1 (SIRT1 concentration in healthy individuals (young and old and patients with AD and mild cognitive impairment (MCI. Blood samples were collected from 40 AD and 9 MCI patients as cases and 22 young healthy adults and 22 healthy elderly individuals as controls. Serum SIRT1 was estimated by Surface Plasmon Resonance (SPR, Western Blot and Enzyme Linked Immunosorbent Assay (ELISA. A significant (p<0.0001 decline in SIRT1 concentration was observed in patients with AD (2.27 ± 0.46 ng/µl and MCI (3.64 ± 0.15 ng/µl compared to healthy elderly individuals (4.82 ± 0.4 ng/µl. The serum SIRT1 concentration in healthy elderly was also significantly lower (p<0.0001 compared to young healthy controls (8.16 ± 0.87 ng/µl. This study, first of its kind, has demonstrated, decline in serum concentration of SIRT1 in healthy individuals as they age. In patients with AD and MCI the decline was even more pronounced, which provides an opportunity to develop this protein as a predictive marker of AD in early stages with suitable cut off values.

  8. Statistical Methods for Evaluating DNA Methylation as a Marker for Early Detection or Prognosis

    Directory of Open Access Journals (Sweden)

    Todd A. Alonzo

    2007-01-01

    Full Text Available We summarize standard and novel statistical methods for evaluating the classification accuracy of DNA methylation markers. The choice of method will depend on the type of marker studied (qualitative/quantitative, the number of markers, and the type of outcome (time-invariant/time-varying. A minimum of two error rates are needed for assessing marker accuracy: the true-positive fraction and the false-positive fraction. Measures of association that are computed from the combination of these error rates, such as the odds ratio or relative risk, are not informative about classification accuracy. We provide an example of a DNA methylation marker that is strongly associated with time to death (logrank p = 0.0003 that is not a good classifier as evaluated by the true-positive and false-positive fractions. Finally, we would like to emphasize the importance of study design. Markers can behave differently in different groups of individuals. It is important to know what factors may affect the accuracy of a marker and in which subpopulations the marker may be more accurate. Such an understanding is extremely important when comparing marker accuracy in two groups of subjects.

  9. Assessment of TPS tumor marker with ELISA for early detection and monitoring of gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Salehi Nodeh A.R

    2007-05-01

    Full Text Available Background: TPS is one of the tumor markers which has specially been considered due to its exclusive physiological characteristics like its easy measurement in serum of cancer patients. This study has been due to evaluate the efficiency of this tumor marker in the prognosis, treatment control and follow up of patients with gastrointestinal cancers including esophagus, stomach and colorectal. Methods: TPS has been measured in 109 persons including 28 healthy people and 81 patients with different gastrointestinal malignancies which were composed of 38 patients with esophageal cancer, 20 ones with stomach cancer and 23 ones with colorectal cancer. Sampling has been done in three times depending on treatment methods. TPS has been measured with ELISA in samples which contend of 2 to 3 ml of serum from patients and the health. Results: The obtained results, demonstrate the obvious changes in TPS serum level in patients underwent various treatment procedures. Conclusion: The results have revealed that the serum TPS is not only as a measure of prognosis but also would be helpful in follow up and treatment control of the disease. Moreover the results has shown that serological analysis can be settled in the diagnosis and follow up with production of polyclonal antibody against TPS gene family and planning appropriate pattern.

  10. Validation of Serological Antibody Profiles Against Human Papillomavirus Type 16 Antigens as Markers for Early Detection of Cervical Cancer

    Science.gov (United States)

    Salazar-Piña, Dolores Azucena; Pedroza-Saavedra, Adolfo; Cruz-Valdez, Aurelio; Ortiz-Panozo, Eduardo; Maldonado-Gama, Minerva; Chihu-Amparan, Lilia; Rodriguez-Ocampo, Angelica Nallelhy; Orozco-Fararoni, Emilia; Esquivel-Guadarrama, Fernando; Gutierrez-Xicotencatl, Lourdes

    2016-01-01

    (TSA), which suggests they can be biomarkers for the early detection of CC. The sensitivity of anti-E4 antibodies was low (<10%) when the TSA was <10 years, and it increased up to 100% in relation to the TSA, suggesting that anti-E4 antibodies can be useful as HPV exposure markers at early stages of the disease. PMID:26871830

  11. Validation of Serological Antibody Profiles Against Human Papillomavirus Type 16 Antigens as Markers for Early Detection of Cervical Cancer.

    Science.gov (United States)

    Salazar-Piña, Dolores Azucena; Pedroza-Saavedra, Adolfo; Cruz-Valdez, Aurelio; Ortiz-Panozo, Eduardo; Maldonado-Gama, Minerva; Chihu-Amparan, Lilia; Rodriguez-Ocampo, Angelica Nallelhy; Orozco-Fararoni, Emilia; Esquivel-Guadarrama, Fernando; Gutierrez-Xicotencatl, Lourdes

    2016-02-01

    ), which suggests they can be biomarkers for the early detection of CC. The sensitivity of anti-E4 antibodies was low (<10%) when the TSA was <10 years, and it increased up to 100% in relation to the TSA, suggesting that anti-E4 antibodies can be useful as HPV exposure markers at early stages of the disease.

  12. [Markers for early detection of alterations in carbohydrate metabolism after acute myocardial infarction].

    Science.gov (United States)

    de Gea-García, J H; Benali, L; Galcerá-Tomás, J; Padilla-Serrano, A; Andreu-Soler, E; Melgarejo-Moreno, A; Alonso-Fernández, N

    2014-03-01

    Undiagnosed abnormal glucose metabolism is often seen in patients admitted with acute myocardial infarction, although there is no consensus on which patients should be studied with a view to establishing an early diagnosis. The present study examines the potential of certain variables obtained upon admission to diagnose abnormal glucose metabolism. A prospective cohort study was carried out. The Intensive Care Unit of Arrixaca University Hospital (Murcia), Spain. A total of 138 patients admitted to the Intensive Care Unit with acute myocardial infarction and without known or de novo diabetes mellitus. After one year, oral glucose tolerance testing was performed. Clinical and laboratory test parameters were recorded upon admission and one year after discharge. Additionally, after one year, oral glucose tolerance tests were made, and a study was made of the capacity of the variables obtained at admission to diagnose diabetes, based on the ROC curves and multivariate analysis. Of the 138 patients, 112 (72.5%) had glucose metabolic alteration, including 16.7% with diabetes. HbA1c was independently associated with a diagnosis of diabetes (RR: 7.28, 95%CI 1.65 to 32.05, P = .009), and showed the largest area under the ROC curve for diabetes (0.81, 95%CI 0.69 to 0.92, P = .001). In patients with acute myocardial infarction, HbA1c helps identify those individuals with abnormal glucose metabolism after one year. Thus, its determination in this group of patients could be used to identify those subjects requiring a more exhaustive study in order to establish an early diagnosis. Copyright © 2012 Elsevier España, S.L. and SEMICYUC. All rights reserved.

  13. The use of ultrasound and other markers for early detection of preeclampsia.

    Science.gov (United States)

    O'Gorman, Neil; Nicolaides, Kypros H; Poon, Liona C Y

    2016-01-01

    Preeclampsia (PE) is a multisystem disorder of pregnancy classically characterized with the onset of hypertension after 20 weeks gestation in the presence of proteinuria. PE typically affects 2-8% of pregnancies and is a leading cause of maternal and perinatal morbidity and mortality. This article reviews the most effective biomarkers used in first trimester screening for PE. It explores their use both in isolation and as part of an algorithm to yield the best detection rates. Screening by a combination of maternal risk factors, uterine artery Doppler, mean arterial pressure, maternal serum PAPP-A and PlGF can identify about 75% of cases of preterm PE for a false-positive rate of 10%. By identifying these patients at high risk for PE, appropriately tailored antenatal surveillance can be instigated and prophylactic pharmacological interventions can be prescribed to improve placentation and ultimately, the outcome for both the mother and fetus.

  14. Serum bone turnover markers (PINP and ICTP) for the early detection of bone metastases in patients with prostate cancer : A longitudinal approach

    NARCIS (Netherlands)

    Koopmans, N.; de Jong, I. J.; van der Veer, E.; Breeuwsma, J.

    2007-01-01

    Purpose: An increase in bone turnover markers in patients with prostate cancer may predict bone metastases but it can also reflect the effects of androgen deprivation treatment. To assess the diagnostic efficacy of early detection of skeletal metastases we retrospectively performed serial measuremen

  15. САР1 AS A SERUM MARKER FOR EARLY DETECTION OF LARYNGEAL AND HYPOPHARYNGEAL CANCERS

    Directory of Open Access Journals (Sweden)

    G. V. Kakurina

    2017-01-01

    Full Text Available Squamous cell carcinoma of head and neck (SCCHN is often asymptomatic until it reaches the advanced stage. Currently, there are no available markers that can accurately predict the risk of progression of epithelial dysplasia to squamous cell carcinoma. The purpose of the study was to evaluate the feasibility of using the level of adenylyl cyclase-associated protein 1 (CAP-1 in the blood serum to identify groups of increased risk of cancer in patients with chronic laryngeal and hypopharyngeal hyperplasia associated with epithelial dysplasia. Material and methods. The blood serums from 45 patients with SCCHN (T1–4N0–3M0, 12 patients  with chronic inflammatory laryngeal and hypopharyngeal diseases and 15 heath subjects were examined. The blood analysis was performed using the CAP1 ELISA kit (Cusabio on the Biochrom Anthos 2020 Microplate IEA Reader. Results. The serum level of САР1 was higher by 75 % in patients with SCCHN (Т1N0M0 than in patients with chronic hyperplastic laryngitis. Moreover, differences in the serum level of САР1 were observed between healthy subjects and patients with chronic laryngeal hyperplasia. In SCCHN patients with regional metastases, CAP1 concentration in the blood serum was 2 times higher compared to that observed in SCCHN patients without regional metastases (p≤0.01. Conclusion. The study results showed the feasibility of using the level of CAP1 for distinguishing patients with chronic hyperplastic laryngitis from those with laryngeal cancer, as well as for early detection of SCCHN and the development of new method for prediction of disease.

  16. Non-pungent Capsicum contains a deletion in the capsaicinoid synthetase gene, which allows early detection of pungency with SCAR markers.

    Science.gov (United States)

    Lee, Choong-Jae; Yoo, Eunyoung; Shin, Juhyun; Shin, Joo Hyun; Lee, Jemin; Hwang, Hee-Sook; Kim, Byung-Dong

    2005-04-30

    The capsaicinoid synthetase (CS) gene cosegregated perfectly with the C locus, which controls the presence of pungency, in 121 F2 individuals from a cross between 'ECW123R' and 'CM334', both of Capsicum annuum. We concluded that CS and C are tightly linked. Sequence analysis of the genes of four pungent and four non-pungent pepper lines showed that the non-pungent peppers had a 2,529 bp-deletion in the 5' upstream region of CS. We have developed molecular markers of the C locus to detect pungency at the seedling stage. Based on the deleted sequence, we developed five SCAR markers, two of them being codominant. These SCAR markers will be useful for easy, accurate, and early detection of non-pungent individuals in breeding programs.

  17. Marker Detection in Aerial Images

    KAUST Repository

    Alharbi, Yazeed

    2017-04-09

    The problem that the thesis is trying to solve is the detection of small markers in high-resolution aerial images. Given a high-resolution image, the goal is to return the pixel coordinates corresponding to the center of the marker in the image. The marker has the shape of two triangles sharing a vertex in the middle, and it occupies no more than 0.01% of the image size. An improvement on the Histogram of Oriented Gradients (HOG) is proposed, eliminating the majority of baseline HOG false positives for marker detection. The improvement is guided by the observation that standard HOG description struggles to separate markers from negatives patches containing an X shape. The proposed method alters intensities with the aim of altering gradients. The intensity-dependent gradient alteration leads to more separation between filled and unfilled shapes. The improvement is used in a two-stage algorithm to achieve high recall and high precision in detection of markers in aerial images. In the first stage, two classifiers are used: one to quickly eliminate most of the uninteresting parts of the image, and one to carefully select the marker among the remaining interesting regions. Interesting regions are selected by scanning the image with a fast classifier trained on the HOG features of markers in all rotations and scales. The next classifier is more precise and uses our method to eliminate the majority of the false positives of standard HOG. In the second stage, detected markers are tracked forward and backward in time. Tracking is needed to detect extremely blurred or distorted markers that are missed by the previous stage. The algorithm achieves 94% recall with minimal user guidance. An average of 30 guesses are given per image; the user verifies for each whether it is a marker or not. The brute force approach would return 100,000 guesses per image.

  18. Immunohistochemical detection of early-stage carcinogenesis of oral leukoplakia by increased DNA-instability and various malignancy markers

    Directory of Open Access Journals (Sweden)

    M Iwasa

    2009-12-01

    Full Text Available The degree of DNA instability as determined by immunohistochemical staining with anti-singlestranded DNA antibody after acid hydrolysis (the DNAinstability test was used as a marker of malignancy. The test was applied to tissues of oral leukoplakia assessed histopathologically as hyperplasia (38 cases, mild (12 cases, moderate (11 cases and severe (8 cases dysplasia, and invasive squamous cell carcinoma (SCC, 20 cases. Tissues were subjected to immunohistochemical staining for proliferating cell nuclear antigen (PCNA, p53, DNA-fragmentation factor 45 (DFF45, analysis of various AgNORs parameters, and triple immunostaining for vascular endothelial growth factor (VEGF, CD34, and PCNA. The DNA instability test was positive in 20 (100% SCC cases, 8 (100% severe dysplasia cases, 8 (72.7% moderate dysplasia cases, 6 (50.0% mild dysplasia cases, and 9 (23.7% hyperplasia cases, indicating malignancy. The proportion of lesions positive for PCNA, p53, DFF45, and values of AgNORs parameters steadily increased from hyperplasia to mild, moderate and severe dysplasia, and SCC, especially in those showing positive DNA instability test, indicative of malignancy. Based on these results, 44.9% of leukoplakia were malignant tissues, namely carcinoma in situ. The proportion of PCNA-positive vascular endothelial cells in the vicinity of VEGF-positive epithelial lesion was significantly higher than that of negative DNA instability lesions, as revealed by immunohistochemical triple staining for VEGF, CD34, and PCNA. Our results suggest that increased DNA instability, enhanced proliferative activity, p53 mutation, and induction of DFF45 and VEGF may allow cancer cell proliferation, enhance their survival by escaping apoptosis, and provide abundant nutrients during early-stage carcinogenesis of oral leukoplakia.

  19. The value of chest CT scan and tumor markers detection in sputum for early diagnosis of peripheral lung cancer

    Institute of Scientific and Technical Information of China (English)

    WANG Xu; CAO Aihong; PENG Mengqing; HU Chunfeng; LIU Delin; GU Tao; LIU Hui

    2004-01-01

    Objective To investigate the diagnostic value of chest CT scan combined with telomerase activity and p16 gene methylation from exfoliated cells of sputum in 55 cases of solitary pulmonary nodules (SPN; ≤30 mm)suspected early peripheral lung cancer. Methods The sputum specimens from 34 cases of cancer nodules and 21 cases of benign lesion were detected for telomerase activity by TRAP-PCR-ELISA and p16 gene methylation by PCR-based methylation analysis. Results The qualitative diagnostic accuracy of CT scan was 61.8%(34/55) for SPN provided by pathology. Cytology analysis of sputum was positive in 13 cases (38.2%). Telomerase activity was positive in 29 cases: sensitivity was 79.4%, specificity was 90.5%, accuracy was 83.6%; p16 gene methylation was found in 11 cases: sensitivity was 32.4%, specificity was 100.0%, and accuracy was 58.2%. The sensitivity was increased to 86.1% by combination of telomerase activity and p16 gene methylation. Compared with nodules without malignant CT signs, expression of telomerase activity and p16 methylation of SPN with malignant CT signs (lobulation or spiculate protuberance or spicule sign) had a significant difference (P<0.01). Conclusion The results suggest that chest CT scan combined with telomerase activity and p16 gene methylation detection in sputum for patients with peripheral lung cancer may enhance the diagnostic value of radiology and conventional cytology.

  20. Urinary Markers of Tubular Injury in Early Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Temesgen Fiseha

    2016-01-01

    Full Text Available Diabetic nephropathy (DN is a common and serious complication of diabetes associated with adverse outcomes of renal failure, cardiovascular disease, and premature mortality. Early and accurate identification of DN is therefore of critical importance to improve patient outcomes. Albuminuria, a marker of glomerular involvement in early renal damage, cannot always detect early DN. Thus, more sensitive and specific markers in addition to albuminuria are needed to predict the early onset and progression of DN. Tubular injury, as shown by the detection of tubular injury markers in the urine, is a critical component of the early course of DN. These urinary tubular markers may increase in diabetic patients, even before diagnosis of microalbuminuria representing early markers of normoalbuminuric DN. In this review we summarized some new and important urinary markers of tubular injury, such as neutrophil gelatinase associated lipocalin (NGAL, kidney injury molecule-1 (KIM-1, liver-type fatty acid binding protein (L-FABP, N-acetyl-beta-glucosaminidase (NAG, alpha-1 microglobulin (A1M, beta 2-microglobulin (B2-M, and retinol binding protein (RBP associated with early DN.

  1. Urinary Markers of Tubular Injury in Early Diabetic Nephropathy

    Science.gov (United States)

    Fiseha, Temesgen; Tamir, Zemenu

    2016-01-01

    Diabetic nephropathy (DN) is a common and serious complication of diabetes associated with adverse outcomes of renal failure, cardiovascular disease, and premature mortality. Early and accurate identification of DN is therefore of critical importance to improve patient outcomes. Albuminuria, a marker of glomerular involvement in early renal damage, cannot always detect early DN. Thus, more sensitive and specific markers in addition to albuminuria are needed to predict the early onset and progression of DN. Tubular injury, as shown by the detection of tubular injury markers in the urine, is a critical component of the early course of DN. These urinary tubular markers may increase in diabetic patients, even before diagnosis of microalbuminuria representing early markers of normoalbuminuric DN. In this review we summarized some new and important urinary markers of tubular injury, such as neutrophil gelatinase associated lipocalin (NGAL), kidney injury molecule-1 (KIM-1), liver-type fatty acid binding protein (L-FABP), N-acetyl-beta-glucosaminidase (NAG), alpha-1 microglobulin (A1M), beta 2-microglobulin (B2-M), and retinol binding protein (RBP) associated with early DN. PMID:27293888

  2. Etiology and Early Marker Studies (EEMS) | Division of Cancer Prevention

    Science.gov (United States)

    The Etiology and Early Marker Studies (EEMS) is a component of the PLCO Trial. By collecting biologic materials and risk factor information from trial participants before the diagnosis of disease, PLCO EEMS adds substantial value to the trial, providing a resource for cancer research, focused, in particular, on cancer etiology and early markers. Etiologic studies investigate the environmental, biochemical and genetic risk factors for cancer. Early detection studies aim to develop reproducible, diagnostics-ready biomarkers of early disease. | Risk factor data and biospecimens collected before the diagnosis of disease from participants in the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial.

  3. Detection of early behavioral markers of Huntington's disease in R6/2 mice employing an automated social home cage

    DEFF Research Database (Denmark)

    Rudenko, Olga; Tkach, Vadim; Berezin, Vladimir;

    2009-01-01

    developed behavior screening system, the IntelliCage, allows automated testing of mouse behavior in the home cage employing individual recognition of animals living in social groups. The present study validates the ability of the IntelliCage system to detect behavioral and cognitive dysfunction in R6/2 mice......Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder, for which no known cure or effective treatment exists. To facilitate the search for new potential treatments of HD, an automated system for analyzing the behavior of transgenic HD mice is urgently needed. A recently...

  4. Artificial neural networks allow the use of simultaneous measurements of Alzheimer Disease markers for early detection of the disease

    Directory of Open Access Journals (Sweden)

    Gardoni Fabrizio

    2005-07-01

    Full Text Available Abstract Background Previous studies have shown that in platelets of mild Alzheimer Disease (AD patients there are alterations of specific APP forms, paralleled by alteration in expression level of both ADAM 10 and BACE when compared to control subjects. Due to the poor linear relation among each key-element of beta-amyloid cascade and the target diagnosis, the use of systems able to afford non linear tasks, like artificial neural networks (ANNs, should allow a better discriminating capacity in comparison with classical statistics. Objective To evaluate the accuracy of ANNs in AD diagnosis. Methods 37 mild-AD patients and 25 control subjects were enrolled, and APP, ADM10 and BACE measures were performed. Fifteen different models of feed-forward and complex-recurrent ANNs (provided by Semeion Research Centre, based on different learning laws (back propagation, sine-net, bi-modal were compared with the linear discriminant analysis (LDA. Results The best ANN model correctly identified mild AD patients in the 94% of cases and the control subjects in the 92%. The corresponding diagnostic performance obtained with LDA was 90% and 73%. Conclusion This preliminary study suggests that the processing of biochemical tests related to beta-amyloid cascade with ANNs allows a very good discrimination of AD in early stages, higher than that obtainable with classical statistics methods.

  5. Early detection of tubular dysfunction.

    Science.gov (United States)

    Piscator, M

    1991-11-01

    The determination of low-molecular-weight proteins in urine as a tool for early detection of damage to the proximal tubules is briefly discussed. Beta 2-microglobulin, retinol-binding protein and alpha 1-microglobulin are at present the most widely used markers for tubular dysfunction. The determination of beta 2-microglobulin has earlier been the method of choice, but due to its instability at low pH there are certain disadvantages. Available data indicate that alpha 1-microglobulin may replace beta 2-microglobulin for screening purposes. The low-molecular-weight proteins are at present the best markers for early detection of tubular dysfunction; other constituents are not as well suited for this, even if the determination of urine enzymes has its supporters.

  6. Early Detection of Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Donna Badgwell

    2007-01-01

    Full Text Available Despite advances in therapy, ovarian cancer remains the most deadly of the gynecological cancers. Less than 30% of women with advanced stage disease survive long-term. When diagnosed in stage I, up to 90% of patients can be cured with conventional surgery and chemotherapy. At present, only 25% of ovarian cancers are detected in stage I due, in part, to the absence of specific symptoms and to lack of an effective screening strategy. Early detection of ovarian cancer might significantly improve the overall survival rate of women with ovarian cancer if 1 most cancers are clonal and unifocal, arising in the ovary rather than in the peritoneum, 2 metastatic disease results from progression of clinically detectable stage I lesions, and 3 cancers remain localized for a sufficient interval to permit cost-effective screening. Given the prevalence of ovarian cancer, strategies for early detection must have high sensitivity for early stage disease (> 75%, but must have extremely high specificity (99.6% to attain a positive predictive value of at least 10%. Transvaginal sonography (TVS, serum markers and a combination of the two modalities have been evaluated for early detection of ovarian cancer. Among the serum markers, CA125 has received the most attention, but lacks the sensitivity or specificity to function alone as a screening test. Greater specificity can be achieved by combining CA125 and TVS and/or by monitoring CA125 over time. Two stage screening strategies promise to be cost effective, where abnormal serum assays prompt TVS to detect lesions that require laparotomy. Accrual has been completed for a 200,000 woman trial in the United Kingdom that will test the ability of a rising CA125 to trigger TVS and subsequent exploratory surgery. Given the heterogeneity of ovarian cancer, it is unlikely that any single marker will be sufficiently sensitive to provide an effective initial screen. Sensitivity of serum assays might be enhanced by utilizing a

  7. Early detection of psychosis

    DEFF Research Database (Denmark)

    Larsen, T. K.; Melle, I.; Auestad, B.

    2011-01-01

    Background During the last decades we have seen a new focus on early treatment of psychosis. Several reviews have shown that duration of untreated psychosis (DUP) is correlated to better outcome. However, it is still unknown whether early treatment will lead to a better long-term outcome....... This study reports the effects of reducing DUP on 5-year course and outcome.Method During 1997â€"2000 a total of 281 consecutive patients aged >17 years with first episode non-affective psychosis were recruited, of which 192 participated in the 5-year follow-up. A comprehensive early detection (ED) programme...... with public information campaigns and low-threshold psychosis detection teams was established in one healthcare area (ED-area), but not in a comparable area (no-ED area). Both areas ran equivalent treatment programmes during the first 2 years and need-adapted treatment thereafter.Results At the start...

  8. Evaluation on the Use of β-Lactamase and Aminoglycoside Modifying Enzyme Gene Sequences as Markers for the Early Detection of Antibiotic Resistance Profile of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Victor A. Doss

    2004-01-01

    Full Text Available Pseudomonas aeruginosa is one of the major causes of infections including the hospital acquired (Nosocomial infections. Detection of them and their antibiotic resistance profile by conventional method takes about three days. Recently, DNA based diagnostic methods are being used for the identification of the pathogens. Hence we have tested a rapid and sensitive method using DNA sequences as markers for detecting the presence of three genes coding for the enzymes that inactivate the two most commonly used Anti-pseudomonadal drugs such as β-lactam antibiotics (Penicillin, and its derivatives and Aminoglycosides such as Gentamicin, Tobramycin, Amikacin, Streptomycin. The internal region of these genes were used for designing and synthesizing primers and these primers were used in Polymerase Chain Reaction (PCR to screen for the presence of these genes in the clinical isolates and to label them non-radioactively with Biotin. They in turn were used to detect the presence of the antibiotic resistance genes in the clinical isolates by hybridization. The specificity (ratio of positive results obtained in both methods and the sensitivity (the minimum amount of sample DNA and the labeled probe required for the tests were evaluated.

  9. Early Detection Of Cancer

    Directory of Open Access Journals (Sweden)

    V B Bhatnagar

    1987-04-01

    Full Text Available Farly detection of cancer is based upon three fundamental assumptions, firstly that the trea'ment of benign and precancerous lesions reduces the incidence of cancer, secondly, that the treatment of in situ cancers is conducive to total cure and thirdly that early diagnosis and management of invasive cancer ensures be.ter survival. When patient seeks medical advice for vague symptoms, which could however be due to a possible malignant tumour at a particular site, the alert clinician should investigate the patient immediately to exclude cancer. At this stage cancer is usually not significantly advanced.Currently the U. I. C. C. (International Union for Cancer Control} is studying the epidemiology of cancers in various countries The importance of this is two folds : Firstly by focussing attention on a section of population vulnerable to a particular cancer an early detection is facilitated Secondly by changing the causative factors responsible to a particular cancer, the incidence of that cancer can be reduced e. g. reduction in lung cancer following campaigns against ciguette smoking and reductioi in breast cancer after campaigns for advocating breast feeding of infants, lowering fat consumption and encouraging self palpation of breast regularly.Indeed early diagnosis of cancer implies diagnosis of cancer in almost a symptomatic stage It involves motiva’ion of the population towards acquisitio : of knowledge, attitude and practice.. Epidemiologies and clinicians should be able to recognise high risk cases exposed to particular neoplasia and knowledge of alarming symptoms should be pro- pogated for wide publicity through common available media and means. Probable cases should have regular clhrcal examination periodically and relevant investigations including radiological, imaging techniques and Bio-Chemical examination should be undertaken as and when desired Suspicious lesions should be investigated by specific tests including smear cytology

  10. Inflammatory markers in cord blood or maternal serum for early detection of neonatal sepsis-a systemic review and meta-analysis.

    Science.gov (United States)

    Su, H; Chang, S-S; Han, C-M; Wu, K-Y; Li, M-C; Huang, C-Y; Lee, C-L; Wu, J-Y; Lee, C-C

    2014-04-01

    To perform a quantitative review of the evidence on the diagnostic value of inflammatory markers in maternal serum or umbilical cord blood for the diagnosis of early-onset neonatal sepsis (EONS). We searched multiple databases for studies published through March 2013 that evaluated the diagnostic performance of procalcitonin (PCT), C-reactive protein (CRP) and interleukin-6 (IL-6), and leukocyte count (white blood cell, WBC) in either umbilical cord blood or maternal serum for diagnosis of EONS. We summarized test performance characteristics with the use of forest plots, hierarchical summary receiver operating characteristic curves and bivariate random effects models. Our search identified 3874 citations, of which 15 studies evaluating 2178 episodes of suspected neonatal infection were included for analysis. IL-6 in cord blood with a pooled-positive likelihood ratio (LR+) of 9.47 (95% confidence interval: 3.86 to 23.3), PCT in cord blood with a LR+ of 5.72 (1.56 to 21.0) and IL-6 in maternal serum with a LR+ of 5.47 (2.10 to 14.2) can be qualified as a valid rule-in test. IL-6 in cord blood with a LR- of 0.10 (0.05 to 0.21) and PCT in cord blood with a LR- of 0.20 (0.12-0.37) can be qualified as a useful rule-out test. Either CRP or WBC was inadequate for diagnosis of EONS. For cord blood sample, IL-6 or PCT can be used as reliable rule-in and rule-out tool. For maternal serum, only IL-6 appeared to be sufficient for rule-in diagnosis. An interventional study may be needed to answer whether the addition of these tests will improve the outcome of patients with EONS.

  11. Glycosyltransferases as Markers for Early Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Ulrich Andergassen

    2015-01-01

    Full Text Available Background. Glycosylation is the most frequent posttranslational modification of proteins and lipids influencing inter- and intracellular communication and cell adhesion. Altered glycosylation patterns are characteristically observed in tumour cells. Normal and altered carbohydrate chains are transferred to their acceptor structures via glycosyltransferases. Here, we present the correlation between the presence of three different glycosyltransferases and tumour characteristics. Methods. 235 breast cancer tissue samples were stained immunohistochemically for the glycosyltransferases N-acetylgalactosaminyltransferase 6 (GALNT6, β-1,6-N-acetylglucosaminyltransferase 2 (GCNT2, and ST6 (α-N-acetyl-neuraminyl-2,3-β-galactosyl-1,3-N-acetylgalactosamine α-2,6-sialyltransferase 1 (ST6GALNac1. Staining was evaluated by light microscopy and was correlated to different tumour characteristics by statistical analysis. Results. We found a statistically significant correlation for the presence of glycosyltransferases and tumour size and grading. Specifically smaller tumours with low grading revealed the highest incidences of glycosyltransferases. Additionally, Her4-expression but not pHer4-expression is correlated with the presence of glycosyltransferases. All other investigated parameters could not uncover any statistically significant reciprocity. Conclusion. Here we show, that glycosyltransferases can identify small tumours with well-differentiated cells; hence, glycosylation patterns could be used as a marker for early tumourigenesis. This assumption is supported by the fact that Her4 is also correlated to glycosylation, whereas the activated form of Her4 does not show such a connection with glycosylation.

  12. Markers of early disease and prognosis in COPD

    DEFF Research Database (Denmark)

    Dahl, Morten; Nordestgaard, Børge G

    2009-01-01

    vary substantially over time. This review explores potential markers of early disease and prognosis in COPD by examining genetic markers in the alpha(1)-antitrypsin, cystic fibrosis transmembrane conductance regulator (CFTR), and MBL-2 genes, and by examining the biochemical markers fibrinogen and C...

  13. Sonographic markers for early diagnosis of fetal malformations

    Institute of Scientific and Technical Information of China (English)

    Maria; Daniela; Renna; Paola; Pisani; Francesco; Conversano; Emanuele; Perrone; Ernesto; Casciaro; Gian; Carlo; Di; Renzo; Marco; Di; Paola; Antonio; Perrone; Sergio; Casciaro

    2013-01-01

    Fetal malformations are very frequent in industrialized countries.Although advanced maternal age may affect pregnancy outcome adversely,80%-90%of fetal malformations occur in the absence of a specific risk factor for parents.The only effective approach for prenatal screening is currently represented by an ultrasound scan.However,ultrasound methods present two important limitations:the substantial absence of quantitative parameters and the dependence on the sonographer experience.In recent years,together with the improvement in transducer technology,quantitative and objective sonographic markers highly predictive of fetal malformations have been developed.These markers can be detected at early gestation(11-14 wk)and generally are not pathological in themselves but have an increased incidence in abnormal fetuses.Thus,prenatal ultrasonography during the second trimester of gestation provides a"genetic sonogram",including,for instance,nuchal translucency,short humeral length,echogenic bowel,echogenic intracardiac focus and choroid plexus cyst,that is used to identify morphological features of fetal Down’s syndrome with a potential sensitivity of more than 90%.Other specific and sensitive markers can be seen in the case of cardiac defects and skeletal anomalies.In the future,sonographic markers could limit even more the use of invasive and dangerous techniques of prenatal diagnosis(amniocentesis,etc.).

  14. Relationship Between Serum Tumor Markers Detection and Early Diagnosis of Lung Cancer%血清中肿瘤标志物检测与肺癌早期诊断的关系

    Institute of Scientific and Technical Information of China (English)

    蒋大勇

    2015-01-01

    目的:探讨血清中肿瘤标志物检测与肺癌早期诊断的关系。方法整群选取该院自2013年2月—2014年2月期间该院呼吸内科所收治的91例肺癌患者,作为肺癌组,选取50例健康者作为健康组,检测两组患者血清中肿瘤标志物血清癌胚抗原(CEA)、糖类抗原-125(CA125)、糖类抗原-153(CA153)和神经元特异性烯醇化酶(NSE)的水平,比较两组患者的肿瘤标志物水平。结果肺癌组的CEA、CA125、CA153和NSE四项水平均明显高于健康组,差异有统计学意义(P<0.05);四项肿瘤标记物联合监测与单独各项肿瘤标记物指标比较能够显著提高诊断肺癌的敏感性,差异有统计学意义(P<0.05);复发患者的CEA、CA125、CA153和NSE四项水平均明显高于未复发患者,差异有统计学意义(P<0.05)。结论血清中肿瘤标志物检测对肺癌早期诊断有重要临床价值,肿瘤标记物联合监测能够显著提高诊断肺癌的敏感性。%Objective Investigate the relationship between serum tumor markers detection and early diagnosis of lung cancer. Methods 91 cases of lung cancer patients were as lung cancer group, the serum of two groups were detected selected in our hospital from February 2013 to February 2014 in respiratory department of our hospital in tumor marker, and selected 50 cases of healthy as healthy group. compared two groups of patients with tumor marker levels, serum carcinoma embryonic antigen (CEA), carbohydrate antigen 125 (CA125), carbohydrate antigen 153 (CA153) and neuron specific enolase (NSE) levels. Results Lung cancer group of CEA, CA125, CA153 and neuron specific enolase (NSE) four level were significantly higher than those of the healthy group, the difference has statistical significance (P<0.05); four tumor markers joint monitoring and separate the tumor markers matter index can significantly improve the sensitivity of diagnosis of lung cancer, the difference was not

  15. Towards a non-invasive method for early detection of testicular neoplasia in semen samples by identification of fetal germ cell-specific markers

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Carlsen, E; Jorgensen, N

    2007-01-01

    was detected in 50% of participants with CIS and in 33.9% of TGCT patients before treatment (non-seminomas: 56.6%, seminomas: 17.4%). OCT-3/4 results were similar to those of AP-2gamma, whereas NANOG and PLAP stainings were unsuitable. Sensitivity was 54.5% for participants harbouring pre-invasive CIS...

  16. Interleukin-6 as an early marker for fat embolism

    Directory of Open Access Journals (Sweden)

    Yoga R

    2009-06-01

    Full Text Available Abstract Background Fat Embolism is a complication of long bone fractures, intramedullary fixation and joint arthroplasty. It may progress to fat embolism syndrome, which is rare but involves significant morbidity and can occasionally be fatal. Fat Embolism can be detected at the time of embolization by transoesophageal echocardiography or atrial blood sampling. Later, a combination of clinical signs and symptoms will point towards fat embolism but there is no specific test to confirm the diagnosis. We investigated serum Interleukin-6 (IL-6 as a possible early marker for fat embolism. Methods An animal study was conducted to simulate a hip replacement in 31 adult male Sprague Dawley rats. The procedure was performed under general anesthesia and the animals divided into 3 groups: control, uncemented and cemented. Following surgery and recovery from anaesthesia, the rats allowed to freely mobilize in their cages. Blood was taken before surgery and at 6 hours, 12 hours and 24 hours to measure serum IL-6 levels. The rats were euthanized at 24 hours and lungs removed and stained for fat. The amount of fat seen was then correlated with serum IL-6 levels. Results No rats in the control group had fat emboli. Numerous fat emboli were seen in both the uncemented and cemented implant groups. The interleukin levels were raised in all groups reaching a peak at 12 hours after surgery reaching 100 pg/ml in the control group and around 250 pg/ml in the uncemented and cemented implant groups. The IL-6 levels in the control group were significantly lower than any of the implant groups at 12 and 24 hours. At these time points, the serum IL-6 correlated with the amount of fat seen on lung histology. Conclusion Serum IL-6 is a possible early marker of fat embolism.

  17. Early pregnancy angiogenic markers and spontaneous abortion

    DEFF Research Database (Denmark)

    Andersen, Louise B; Dechend, Ralf; Karumanchi, S Ananth

    2016-01-01

    BACKGROUND: Spontaneous abortion is the most commonly observed adverse pregnancy outcome. The angiogenic factors soluble Fms-like kinase 1 and placental growth factor are critical for normal pregnancy and may be associated to spontaneous abortion. OBJECTIVE: We investigated the association between...... maternal serum concentrations of soluble Fms-like kinase 1 and placental growth factor, and subsequent spontaneous abortion. STUDY DESIGN: In the prospective observational Odense Child Cohort, 1676 pregnant women donated serum in early pregnancy, gestational week ..., interquartile range 71-103). Concentrations of soluble Fms-like kinase 1 and placental growth factor were determined with novel automated assays. Spontaneous abortion was defined as complete or incomplete spontaneous abortion, missed abortion, or blighted ovum

  18. Early detection of ovarian cancer: preliminary results of the Yale Early Detection Program.

    OpenAIRE

    Schwartz, P. E.; Chambers, J. T.; Taylor, K. J.; Pellerito, J.; Hammers, L.; Cole, L. A.; Yang-Feng, T L; Smith, P; Mayne, S T; Makuch, R.

    1991-01-01

    Eighty-four women at high risk for ovarian cancer by having first-degree relatives with epithelial ovarian cancer participated in a newly established, early ovarian cancer detection program at Yale University. Participants were to be evaluated with physical examinations and circulating tumor markers at entry and every six months thereafter. Endovaginal ultrasound and color Doppler flow studies were to be performed at three and nine months following entry into the program. In addition, women w...

  19. Optimal marker-strategy clinical trial design to detect predictive markers for targeted therapy.

    Science.gov (United States)

    Zang, Yong; Liu, Suyu; Yuan, Ying

    2016-07-01

    In developing targeted therapy, the marker-strategy design (MSD) provides an important approach to evaluate the predictive marker effect. This design first randomizes patients into non-marker-based or marker-based strategies. Patients allocated to the non-marker-based strategy are then further randomized to receive either the standard or targeted treatments, while patients allocated to the marker-based strategy receive treatments based on their marker statuses. Little research has been done on the statistical properties of the MSD, which has led to some widespread misconceptions and placed clinical researchers at high risk of using inefficient designs. In this article, we show that the commonly used between-strategy comparison has low power to detect the predictive effect and is valid only under a restrictive condition that the randomization ratio within the non-marker-based strategy matches the marker prevalence. We propose a Wald test that is generally valid and also uniformly more powerful than the between-strategy comparison. Based on that, we derive an optimal MSD that maximizes the power to detect the predictive marker effect by choosing the optimal randomization ratios between the two strategies and treatments. Our numerical study shows that using the proposed optimal designs can substantially improve the power of the MSD to detect the predictive marker effect. We use a lung cancer trial to illustrate the proposed optimal designs.

  20. Associations between Early Markers of Parkinson's Disease and Sarcopenia

    Science.gov (United States)

    Drey, Michael; Hasmann, Sandra E.; Krenovsky, Jan-Peter; Hobert, Markus A.; Straub, Stefanie; Elshehabi, Morad; von Thaler, Anna-Katharina; Fallgatter, Andreas J.; Eschweiler, Gerhard W.; Suenkel, Ulrike; Berg, Daniela; Maetzler, Walter

    2017-01-01

    Introduction: Sarcopenia and Parkinson's disease (PD) are both common age-related syndromes, and there is preliminary evidence that the probability of the co-occurrence of these syndromes within one individual is higher than expected. However, it is unclear to date whether one of the syndromes induces the other, or whether there may be common underlying causes. This pilot study thus aimed at investigating the association of the features of increased risk for PD with early stage sarcopenia (ESS). Method: Two hundred and fifty-five community-dwelling individuals were recruited from the Tübinger evaluation of Risk factors for Early detection of NeuroDegeneration (TREND) study. The following features that are associated with an increased risk for future PD were evaluated: the motor part of the Unified PD Rating Scale (UPDRS-III), hyperechogenicity of the substantia nigra, prevalence of lifetime depression, hyposmia, REM sleep behavior disorder and the recently introduced probability score for prodromal PD. Sarcopenia was defined according to the European Working Group on Sarcopenia in Older People, which was adapted to this cohort of healthy adults. Multiple linear regression analysis was used to identify associations of PD-related features with ESS. Results: The UPDRS-III score was significantly associated with ESS. The result remained significant after the adjustment for age, gender and physical activity. No association was found between the other PD-related features and ESS. Conclusion: The significant association of the UPDRS-III score with ESS in this cohort might indicate a common and early pathway in both diseases and supports the existence of an “extended neurodegenerative overlap syndrome.” Moreover, the potential of EES to serve as a prodromal marker of PD should be evaluated in future studies. PMID:28326036

  1. Nanotechnology for Early Cancer Detection

    Directory of Open Access Journals (Sweden)

    Joon Won Park

    2010-01-01

    Full Text Available Vast numbers of studies and developments in the nanotechnology area have been conducted and many nanomaterials have been utilized to detect cancers at early stages. Nanomaterials have unique physical, optical and electrical properties that have proven to be very useful in sensing. Quantum dots, gold nanoparticles, magnetic nanoparticles, carbon nanotubes, gold nanowires and many other materials have been developed over the years, alongside the discovery of a wide range of biomarkers to lower the detection limit of cancer biomarkers. Proteins, antibody fragments, DNA fragments, and RNA fragments are the base of cancer biomarkers and have been used as targets in cancer detection and monitoring. It is highly anticipated that in the near future, we might be able to detect cancer at a very early stage, providing a much higher chance of treatment.

  2. The significance of combining detection tumor markers in early diagnosis of lung cancer%联合检测肿瘤标志物在肺癌早期诊断中的意义

    Institute of Scientific and Technical Information of China (English)

    朱红; 黄祥磊; 蒋冉; 谭业颖

    2013-01-01

    目的:探讨神经元特异性烯醇化酶( NSE)细胞角蛋白19片段( CYF R A21-1)、CA199、CA1254种肿瘤标志物在肺癌诊断中的意义。方法:分别对80例肺癌患者、70例肺部良性患者、65例健康查体人员的血清NSE、CYF R A21-1、CA199、CA125水平进行化学发光法测定分析。并比较三组各指标的阳性率以及4项指标单一或联检的敏感度和特异度。结果:肺癌组NSE、CYF R A21-1、CA199、CA125水平明显高于肺部良性疾病组和健康对照组(P <0.01)。肺癌组各指标阳性率明显高于对照组以及良性肺病组(P <0.05)。结论:联合检测肺癌病人血清NSE、CYF R A21-1、CA199、CA125水平可提高肺癌早期诊断的阳性率。%Objective:To explore the clinical significance of serum tumor markers(neuron specific enolase ( NSE),cytokeratin 19 fragment ( CYFRA21- 1) CA199 and CA125)in diagnosis of lung cancer. Methods:Serum levels of NSE,CYFRA21- 1, CA199 and CA125 were detected by ECLIA in 80 patients with lung cancer,70 patients with benign lung diseases and 65 healthy controls.Positive rate of the four parameters were compared among the three groups,and individualand combined sensitivity and specificity of the six parameters were also compared.Results:The serum levels of NSE,CYFRA21-1,CA199 and CA125 in four patients with lung cancer were significantly higher than those of patients with benign lung diseases and control group ( P < 0.01) .The lung cancer group showed higher positive rate of these indicators than the other groups ( both P < 0.05). Conclusions:Combined detection of these tumor markers' levels can raise the sensitivity in diagnosis of early lung cancer.

  3. Early Markers of Vulnerable Language Skill Development in Galactosaemia

    Science.gov (United States)

    Lewis, Fiona M.; Coman, David J.; Syrmis, Maryanne

    2014-01-01

    There are no known biomedical or genetic markers to identify which infants with galactosaemia (GAL) are most at risk of poor language skill development, yet pre-linguistic communicative "red flag" behaviours are recognised as early identifiers of heightened vulnerability to impaired language development. We report on pre-linguistic…

  4. Early Markers of Vulnerable Language Skill Development in Galactosaemia

    Science.gov (United States)

    Lewis, Fiona M.; Coman, David J.; Syrmis, Maryanne

    2014-01-01

    There are no known biomedical or genetic markers to identify which infants with galactosaemia (GAL) are most at risk of poor language skill development, yet pre-linguistic communicative "red flag" behaviours are recognised as early identifiers of heightened vulnerability to impaired language development. We report on pre-linguistic…

  5. Pediatric Bipolar Disorder: Evidence for Prodromal States and Early Markers

    Science.gov (United States)

    Luby, Joan L.; Navsaria, Neha

    2010-01-01

    Background: Childhood bipolar disorder remains a controversial but increasingly diagnosed disorder that is associated with significant impairment, chronic course and treatment resistance. Therefore, the search for prodromes or early markers of risk for later childhood bipolar disorder may be of great importance for prevention and/or early…

  6. Pediatric Bipolar Disorder: Evidence for Prodromal States and Early Markers

    Science.gov (United States)

    Luby, Joan L.; Navsaria, Neha

    2010-01-01

    Background: Childhood bipolar disorder remains a controversial but increasingly diagnosed disorder that is associated with significant impairment, chronic course and treatment resistance. Therefore, the search for prodromes or early markers of risk for later childhood bipolar disorder may be of great importance for prevention and/or early…

  7. Stromal cell markers are differentially expressed in the synovial tissue of patients with early arthritis.

    Science.gov (United States)

    Choi, Ivy Y; Karpus, Olga N; Turner, Jason D; Hardie, Debbie; Marshall, Jennifer L; de Hair, Maria J H; Maijer, Karen I; Tak, Paul P; Raza, Karim; Hamann, Jörg; Buckley, Christopher D; Gerlag, Danielle M; Filer, Andrew

    2017-01-01

    Previous studies have shown increased expression of stromal markers in synovial tissue (ST) of patients with established rheumatoid arthritis (RA). Here, ST expression of stromal markers in early arthritis in relationship to diagnosis and prognostic outcome was studied. ST from 56 patients included in two different early arthritis cohorts and 7 non-inflammatory controls was analysed using immunofluorescence to detect stromal markers CD55, CD248, fibroblast activation protein (FAP) and podoplanin. Diagnostic classification (gout, psoriatic arthritis, unclassified arthritis (UA), parvovirus associated arthritis, reactive arthritis and RA), disease outcome (resolving vs persistent) and clinical variables were determined at baseline and after follow-up, and related to the expression of stromal markers. We observed expression of all stromal markers in ST of early arthritis patients, independent of diagnosis or prognostic outcome. Synovial expression of FAP was significantly higher in patients developing early RA compared to other diagnostic groups and non-inflammatory controls. In RA FAP protein was expressed in both lining and sublining layers. Podoplanin expression was higher in all early inflammatory arthritis patients than controls, but did not differentiate diagnostic outcomes. Stromal marker expression was not associated with prognostic outcomes of disease persistence or resolution. There was no association with clinical or sonographic variables. Stromal cell markers CD55, CD248, FAP and podoplanin are expressed in ST in the earliest stage of arthritis. Baseline expression of FAP is higher in early synovitis patients who fulfil classification criteria for RA over time. These results suggest that significant fibroblast activation occurs in RA in the early window of disease.

  8. Early gametogenesis in the Pacific oyster: new insights using stem cell and mitotic markers.

    Science.gov (United States)

    Cavelier, Patricia; Cau, Julien; Morin, Nathalie; Delsert, Claude

    2017-08-31

    While our knowledge of bivalve gametogenesis recently progressed, more molecular markers are needed in order to develop tissue imaging. Here, we identified stem cell and mitotic markers to further characterize the oyster early gametogenesis, mainly through immunofluorescence microscopy.Intense alkaline phosphatase activity, a nonspecific marker for stem cells, was detected on the outer edge of the gonad ducts at the post-spawning stage, suggesting the abundance of undifferentiated cells very early during the sexual cycle. This observation was confirmed using Sox2, a transcription factor specific for stem or germline cells, which decorated cells in the gonad duct inner mass and ciliated epithelium, early during the initial oyster sexual cycle. Moreover, Vasa, a cytoplasmic marker for germline cells was also detected in the gonad acini and duct cells, thus confirming that germline cells were already abundant early on.In addition, the binding of the Minichromosome maintenance MCM6 protein to chromatin indicated the gonad acini and duct cells were engaged in cell cycle. DNA replication was indeed confirmed by an abundant in vivo incorporation of BrdU in the duct cell chromatin. Finally, proliferation of acini and duct cells was demonstrated by the chromatin-bound Ser10-phosphorylated histone H3, a mitotic marker.The markers for cell cycle and mitosis used here thus indicate that acini and duct cells were already actively dividing early during the oyster sexual cycle. In addition, altogether with the stem cell markers, these data revealed that the epithelium delimiting the duct outer edge contains a dynamic population of undifferentiated cells. © 2017. Published by The Company of Biologists Ltd.

  9. SERUM AMYLASE: AN EARLY MARKER OF RENAL DAMAGE IN HYPERTENSION

    Directory of Open Access Journals (Sweden)

    Rangaswamy

    2014-08-01

    Full Text Available : INTRODUCTION: Hypertension is one of the risk factors for cardiovascular disease and causes progressive damage to kidney in a long term process. Hypertension impairs glomerular function and also leads to subclinical atherogenesis, there is a excretion of low molecular weight compounds like albumin and amylase in urine. This study was conducted to analyze the changes in amylase levels in hypertension. MATERIAL AND METHODS: This is a hospital based study. The patients attending the medicine department were selected for the study. 60 subjects were selected based on history and clinical examination consisting of 30 hypertensive patients and 30 normotensive subjects in the age group 35-60 years. Blood samples collected in vacutainers were analyzed in the clinical biochemistry laboratory. Serum samples were analyzed for total protein, albumin and amylase. RESULT: The study showed a statistically significant change in the levels of serum albumin and amylase. The level of serum albumin was 3.71 ± 0.22 g/dl in cases while it was 4.14 ± 0.20 g/dl in controls. The serum amylase levels were 99.79 ±13.63 U/L in cases while it was 137.76 ± 16.86 U/L in the control. The p-value was 0.0001 which was statistically significant. CONCLUSION: The initial damage to glomerulus can be detected by the alteration in serum amylase values in hypertension. Thus serum amylase can be considered as an early marker for detecting the renal damage in hypertension

  10. Early Detection of Disease Outbreaks

    OpenAIRE

    2005-01-01

    BACKGROUND: The ability to detect disease outbreaks early is important in order to minimize morbidity and mortality through timely implementation of disease prevention and control measures. Many national, state, and local health departments are launching disease surveillance systems with daily analyses of hospital emergency department visits, ambulance dispatch calls, or pharmacy sales for which population-at-risk information is unavailable or irrelevant. METHODS AND FINDINGS: We propose a pr...

  11. Epigenetic Markers for Molecular Detection of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Vera L. Costa

    2007-01-01

    Full Text Available Prostate cancer is a highly prevalent malignancy, which is clinically silent but curable while organ-confined. Because available screening methods show poor sensitivity and specificity, the development of new molecular markers is warranted. Epigenetic alterations, mainly promoter hypermethylation of cancer-related genes, are common events in prostate cancer and might be used as cancer biomarkers. Moreover, the development of quantitative, high-throughput techniques to assess promoter methylation enabled the simultaneous screening of multiple clinical samples. From the numerous cancer-related genes hypermethylated in prostate cancer only a few proved to be strong candidates to become routine biomarkers. This small set of genes includes GSTP1, APC, RARβ2, Cyclin D2, MDR1, and PTGS2. Single and/or multigene analyses demonstrated the feasibility of detecting early prostate cancer, with high sensitivity and specificity, in body fluids (serum, plasma, urine, and ejaculates and tissue samples. In addition, quantitative hypermethylation of several genes has been associated with clinicopathologic features of tumor aggressiveness, and also reported as independent prognostic factor for relapse. The identification of age-related methylation at specific loci and the differential frequency of methylation among ethnical groups, also provided interesting data linking methylation and prostate cancer risk. Although large trials are needed to validate these findings, the clinical use of these markers might be envisaged for the near future.

  12. Molecular markers for detection, surveillance and prognostication of bladder cancer.

    NARCIS (Netherlands)

    Vrooman, O.P.; Witjes, J.A.

    2009-01-01

    Many markers for the detection of bladder cancers have been tested and almost all urinary markers reported are better than cytology with regard to sensitivity, but they score lower in specificity. Currently molecular and genetic changes play an important role in the discovery of new molecular

  13. Early detection of ovarian cancer: background, rationale, and structure of the Yale Early Detection Program.

    Science.gov (United States)

    Schwartz, P. E.; Chambers, J. T.; Taylor, K. J.; Pellerito, J.; Hammers, L.; Cole, L. A.; Yang-Feng, T. L.; Smith, P.; Mayne, S. T.; Makuch, R.

    1991-01-01

    Ovarian cancer has received national attention as a highly virulent disease. Its lack of early warning symptoms and the failure to develop highly sensitive screening tests have led some physicians to recommend prophylactic oophorectomies to women with relatives who have had ovarian cancer. Others have recommended routine screening of otherwise normal women for CA 125, a circulating tumor marker, and ultrasound examinations. Each of these techniques is associated with substantial false-positive rates that could lead to unnecessary surgery. A review of epidemiologic data suggests that familial ovarian cancer kindreds are rare, but women with first-degree relatives who have had ovarian cancer have a significant risk themselves for developing ovarian cancer. In addition, women with a great number of ovulatory cycles are at an increased risk for the disease. Circulating tumor markers are frequently elevated in women with advanced ovarian cancer, but their value in early detection of ovarian cancer has yet to be established. Advances in endovaginal ultrasound and color Doppler flow technology have significantly improved our ability to assess pelvic organs. This article presents the background, rationale, and structure of the Yale Early Detection Program for ovarian cancer, whose goals are to identify the best techniques for diagnosing ovarian cancer in an early stage, to determine the frequency with which such tests should be employed, to assess false-positive results, and to identify women who might benefit from prophylactic oophorectomies. PMID:1810100

  14. Markers of early disease and prognosis in COPD

    Directory of Open Access Journals (Sweden)

    Morten Dahl

    2009-04-01

    Full Text Available Morten Dahl, Børge G NordestgaardDepartment of Clinical Biochemistry, Herlev Hospital, Copenhagen University Hospital, Faculty of Health Sciences, University of Copenhagen, Copenhagen, DenmarkAbstract: COPD is a complex disease with multiple pathological components, which we unfortunately tend to ignore when spirometry is used as the only method to evaluate the disorder. Additional measures are needed to allow a more complete and clinically relevant assessment of COPD. The earliest potential risk factors of disease in COPD are variations in the genetic background. Genetic variations are present from conception and can determine lifelong changes in enzyme activities and protein concentrations. In contrast, measurements in blood, sputum, exhaled breath, broncho-alveolar lavage, and lung biopsies may vary substantially over time. This review explores potential markers of early disease and prognosis in COPD by examining genetic markers in the α1-antitrypsin, cystic fibrosis transmembrane conductance regulator (CFTR, and MBL-2 genes, and by examining the biochemical markers fibrinogen and C-reactive protein (CRP, which correlate with degree of pulmonary inflammation during stable conditions of COPD. Chronic lung inflammation appears to contribute to the pathogenesis of COPD, and markers of this process have promising predictive value in COPD. To implement markers for COPD in clinical practice, besides those already established for the α1-antitrypsin gene, further research and validation studies are needed.Keywords: chronic obstructive pulmonary disease, biomarker, pathogenesis, prognosis, genetics

  15. CD13 and TCR clone: markers of early mycosis fungoides.

    Science.gov (United States)

    Bernier, Claire; Nguyen, Jean Michel; Quéreux, Gaëlle; Renault, Jean Jaques; Bureau, Brigine; Dreno, Brigitte

    2007-01-01

    Making a differential diagnosis between early mycosis fungoides and parapsoriasis is often difficult at the clinical and histological level. The aim of this study was to explore markers that could help in this process. A total of 88 patients were included in 2 categories: large plaque parapsoriasis and digitiform parapsoriasis. A histological examination was performed for each patient, and expression of the antigen My7 (CD13), which is lacking in cutaneous T-lymphomas (but not in inflammatory lesions) and rearrangement of the T-cell receptor gene were analysed. A histological aspect of epidermotropic cutaneous T-cell lymphoma was observed in 23.5% of cases of large plaque parapsoriasis and 15% of cases of digitiform parapsoriasis. A disappearance of My7 antigen was noted in the 2 forms of parapsoriasis, more frequently when there was cutaneous T-cell lymphoma histology. A cutaneous clone was observed in 10.3% of cases of large plaque parapsoriasis, but not of digitiform parapsoriasis. For 3 patients, a cutaneous clone and a disappearance of My7 were associated with a non-specific histology. Considering these histological, immunological and molecular biological data, it appears that My7 antigen combined with T-cell clone may help the dermatologist to confirm the diagnosis of early mycosis fungoides. Moreover, further studies will determine whether CD13 is an early prognostic marker of evolution of a parapsoriasis to mycosis fungoides. Finally, these results demonstrate that digitiform parapsoriasis can be an early stage of MF.

  16. Ethics dilemmas of early detection of obesity

    DEFF Research Database (Denmark)

    Vallgårda, Signild

    2016-01-01

    Aim: To discuss the ethics dilemmas of the early detection of overweight and obesity. Methods: Analysis of the ethical aspects of early detection. Results: The early detection of overweight and obesity entails a number of ethical dilemmas because it may both be helpful and harmful. It may help...

  17. Genome-scale screen for DNA methylation-based detection markers for ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Mihaela Campan

    Full Text Available BACKGROUND: The identification of sensitive biomarkers for the detection of ovarian cancer is of high clinical relevance for early detection and/or monitoring of disease recurrence. We developed a systematic multi-step biomarker discovery and verification strategy to identify candidate DNA methylation markers for the blood-based detection of ovarian cancer. METHODOLOGY/PRINCIPAL FINDINGS: We used the Illumina Infinium platform to analyze the DNA methylation status of 27,578 CpG sites in 41 ovarian tumors. We employed a marker selection strategy that emphasized sensitivity by requiring consistency of methylation across tumors, while achieving specificity by excluding markers with methylation in control leukocyte or serum DNA. Our verification strategy involved testing the ability of identified markers to monitor disease burden in serially collected serum samples from ovarian cancer patients who had undergone surgical tumor resection compared to CA-125 levels. We identified one marker, IFFO1 promoter methylation (IFFO1-M, that is frequently methylated in ovarian tumors and that is rarely detected in the blood of normal controls. When tested in 127 serially collected sera from ovarian cancer patients, IFFO1-M showed post-resection kinetics significantly correlated with serum CA-125 measurements in six out of 16 patients. CONCLUSIONS/SIGNIFICANCE: We implemented an effective marker screening and verification strategy, leading to the identification of IFFO1-M as a blood-based candidate marker for sensitive detection of ovarian cancer. Serum levels of IFFO1-M displayed post-resection kinetics consistent with a reflection of disease burden. We anticipate that IFFO1-M and other candidate markers emerging from this marker development pipeline may provide disease detection capabilities that complement existing biomarkers.

  18. Biomarkers for early detection of Alzheimer disease.

    Science.gov (United States)

    Barber, Robert C

    2010-09-01

    The existence of an effective biomarker for early detection of Alzheimer disease would facilitate improved diagnosis and stimulate therapeutic trials. Multidisciplinary clinical diagnosis of Alzheimer disease is time consuming and expensive and relies on experts who are rarely available outside of specialty clinics. Thus, many patients do not receive proper diagnosis until the disease has progressed beyond stages in which treatments are maximally effective. In the clinical trial setting, rapid, cost-effective screening of patients for Alzheimer disease is of paramount importance for the development of new treatments. Neuroimaging of cortical amyloid burden and volumetric changes in the brain and assessment of protein concentrations (eg, β-amyloid 1-42, total tau, phosphorylated tau) in cerebrospinal fluid are diagnostic tools that are not widely available. Known genetic markers do not provide sufficient discriminatory power between different forms of dementia to be useful in isolation. Recent studies using panels of biomarkers for diagnosis of Alzheimer disease or mild cognitive impairment have been promising, though no such studies have been cross-validated in independent samples of subjects. The ideal biomarker enabling early detection of Alzheimer disease has not yet been identified.

  19. Novel Implant Coating Agent Promotes Gene Expression of Osteogenic Markers in Rats during Early Osseointegration

    Directory of Open Access Journals (Sweden)

    Kostas Bougas

    2012-01-01

    Full Text Available The aim of this study was to evaluate the early bone response around laminin-1-coated titanium implants. Forty-five rats distributed in three equally sized groups were provided with one control (turned and one test (laminin-1-coated implant and were sacrificed after 3, 7, and 21 days. Real-time reverse-transcriptase polymerase chain reaction was performed for osteoblast markers (alkaline phosphatase, runt-related transcription factor 2, osteocalcin, type I collagen, and bone morphogenic protein 2, osteoclast markers (cathepsin K and tartrate-resistant acid phosphatase, inflammation markers (tumor necrosis factor α, interleukin 1β and interleukin 10, and integrin β1. Bone implant contact (BIC and bone area (BA were assessed and compared to the gene expression. After 3 days, the expression of bone markers was higher for the control group. After 7 days, the expression of integrin β1 and osteogenic markers was enhanced for the test group, while cathepsin K and inflammation markers were down-regulated. No significant differences in BIC or BA were detected between test and control at any time point. As a conclusion, implant coating with laminin-1 altered gene expression in the bone-implant interface. However, traditional evaluation methods, as histomorphometry, were not adequately sensitive to detect such changes due to the short follow-up time.

  20. Implications of automated creatine kinase (CK)-MM1,2,3/CK-MB1,2 isoform analysis as an early marker for the detection of myocardial tissue damage

    NARCIS (Netherlands)

    Swaanenburg, JCJM; Pentinga, M; Dejongste, MJL; Kema, IP

    1996-01-01

    Measurement of creatine kinase (CK) isoforms enables the clinician to detect myocardial tissue damage at an early stage after myocardial infarction. According to the manufacturer's specifications, it should be possible to perform CK isoform analysis automatically using the new Cardio Rep(TM) analyse

  1. Early detection of materials degradation

    Science.gov (United States)

    Meyendorf, Norbert

    2017-02-01

    Lightweight components for transportation and aerospace applications are designed for an estimated lifecycle, taking expected mechanical and environmental loads into account. The main reason for catastrophic failure of components within the expected lifecycle are material inhomogeneities, like pores and inclusions as origin for fatigue cracks, that have not been detected by NDE. However, material degradation by designed or unexpected loading conditions or environmental impacts can accelerate the crack initiation or growth. Conventional NDE methods are usually able to detect cracks that are formed at the end of the degradation process, but methods for early detection of fatigue, creep, and corrosion are still a matter of research. For conventional materials ultrasonic, electromagnetic, or thermographic methods have been demonstrated as promising. Other approaches are focused to surface damage by using optical methods or characterization of the residual surface stresses that can significantly affect the creation of fatigue cracks. For conventional metallic materials, material models for nucleation and propagation of damage have been successfully applied for several years. Material microstructure/property relations are well established and the effect of loading conditions on the component life can be simulated. For advanced materials, for example carbon matrix composites or ceramic matrix composites, the processes of nucleation and propagation of damage is still not fully understood. For these materials NDE methods can not only be used for the periodic inspections, but can significantly contribute to the material scientific knowledge to understand and model the behavior of composite materials.

  2. Optical detection of sepsis markers using liquid crystal based biosensors

    Science.gov (United States)

    McCamley, Maureen K.; Artenstein, Andrew W.; Opal, Steven M.; Crawford, Gregory P.

    2007-02-01

    A liquid crystal based biosensor for the detection and diagnosis of sepsis is currently in development. Sepsis, a major clinical syndrome with a significant public health burden in the US due to a large elderly population, is the systemic response of the body to a localized infection and is defined as the combination of pathologic infection and physiological changes. Bacterial infections are responsible for 90% of cases of sepsis in the US. Currently there is no bedside diagnostic available to positively identify sepsis. The basic detection scheme employed in a liquid crystal biosensor contains attributes that would find value in a clinical setting, especially for the early detection of sepsis. Utilizing the unique properties of liquid crystals, such as birefringence, a bedside diagnostic is in development which will optically report the presence of biomolecules. In a septic patient, an endotoxin known as lipopolysaccharide (LPS) is released from the outer membrane of Gram-negative bacteria and can be found in the blood stream. It is hypothesized that this long chained molecule will cause local disruptions to the open surface of a sensor containing aligned liquid crystal. The bulk liquid crystal ampli.es these local changes at the surface due to the presence of the sepsis marker, providing an optical readout through polarizing microscopy images. Liquid crystal sensors consisting of both square and circular grids, 100-200 μm in size, have been fabricated and filled with a common liquid crystal material, 5CB. Homeotropic alignment was confirmed using polarizing microscopy. The grids were then contacted with either saline only (control), or saline with varying concentrations of LPS. Changes in the con.guration of the nematic director of the liquid crystal were observed through the range of concentrations tested (5mg/mL - 1pg/mL) which have been confirmed by a consulting physician as clinically relevant levels.

  3. Markers of neurodevelopmental impairments in early-onset psychosis

    Directory of Open Access Journals (Sweden)

    Petruzzelli MG

    2015-07-01

    Full Text Available Maria Giuseppina Petruzzelli,1 Lucia Margari,1 Francesco Craig,1 Maria Gloria Campa,1 Domenico Martinelli,2 Adriana Pastore,3 Marta Simone,1 Francesco Margari3 1Child and Adolescence Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University “Aldo Moro” of Bari, 2Department of Medical and Surgical Sciences; University of Foggia, Foggia, 3Psychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organ, University “Aldo Moro” of Bari, Bari, Italy Background: The aim of this study was to assess the association between the clinical and neurobiological markers of neurodevelopmental impairments and early-onset schizophrenia spectrum psychosis. Methods: A sample of 36 patients with early-onset schizophrenia spectrum psychosis was compared to a control sample of 36 patients with migraine. We assessed early childhood neurodevelopmental milestones using a modified version of the General Developmental Scale, general intellectual ability using the Wechsler Intelligence Scale for Children–Revised or Leiter International Performance Scale–Revised for patients with speech and language abnormalities, and neurological soft signs with specific regard to subtle motor impairment. Results: Subjects with early-onset psychosis had a higher rate of impaired social development (P=0.001, learning difficulties (P=0.04, enuresis (P=0.0008, a lower intelligence quotient (P<0.001, and subtle motor impairments (P=0.005 than control subjects. Conclusion: We suggest that neurodevelopment in early-onset psychosis is characterized by a global impairment of functional and adaptive skills that manifests from early childhood, rather than a delay or limitation in language and motor development. The current evidence is based on a small sample and should be investigated in larger samples in future research. Keywords: early-onset psychosis, early-onset schizophrenia, neurodevelopment, social cognition

  4. Detection of 2-alkylcyclobutanones as a marker of irradiated avocado

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, Damaris L. Moreno, E-mail: damaris@ceaden.edu.cu [Centro de Aplicaciones Tecnologicas y Desarrolo Nuclear (CEADEN), Habana (Cuba); Werner, Dalal [Technical Institute for Food Industry (AERIAL), Strasbourg (France). Technology Resource Centre; Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    The 2-alkylcyclobutanones are compound only formed in processed foods with ionizing radiations, which are used as markers to detect foods that have been irradiated and they have some content of fat. The samples were irradiated in a dose 7 kGy, the extraction was carried out for the Shoxlet method and the detection for the EN 1785 Standard. The results showed the utility of the 2- alkylcyclobutanone marker for the identification of irradiated foods. The obtained results showed that the avocado can be identification by the marked 2-TCB. (author)

  5. Probing the Association between Early Evolutionary Markers and Schizophrenia

    Science.gov (United States)

    Srinivasan, Saurabh; Bettella, Francesco; Hassani, Sahar; Wang, Yunpeng; Witoelar, Aree; Schork, Andrew J.; Thompson, Wesley K.; Collier, David A.; Desikan, Rahul S.; Melle, Ingrid; Dale, Anders M.; Djurovic, Srdjan; Andreassen, Ole A.

    2017-01-01

    Schizophrenia is suggested to be a by-product of the evolution in humans, a compromise for our language, creative thinking and cognitive abilities, and thus, essentially, a human disorder. The time of its origin during the course of human evolution remains unclear. Here we investigate several markers of early human evolution and their relationship to the genetic risk of schizophrenia. We tested the schizophrenia evolutionary hypothesis by analyzing genome-wide association studies of schizophrenia and other human phenotypes in a statistical framework suited for polygenic architectures. We analyzed evolutionary proxy measures: human accelerated regions, segmental duplications, and ohnologs, representing various time periods of human evolution for overlap with the human genomic loci associated with schizophrenia. Polygenic enrichment plots suggest a higher prevalence of schizophrenia associations in human accelerated regions, segmental duplications and ohnologs. However, the enrichment is mostly accounted for by linkage disequilibrium, especially with functional elements like introns and untranslated regions. Our results did not provide clear evidence that markers of early human evolution are more likely associated with schizophrenia. While SNPs associated with schizophrenia are enriched in HAR, Ohno and SD regions, the enrichment seems to be mediated by affiliation to known genomic enrichment categories. Taken together with previous results, these findings suggest that schizophrenia risk may have mainly developed more recently in human evolution. PMID:28081145

  6. Improved Detection of Microsatellite Instability in Early Colorectal Lesions.

    Directory of Open Access Journals (Sweden)

    Jeffery W Bacher

    Full Text Available Microsatellite instability (MSI occurs in over 90% of Lynch syndrome cancers and is considered a hallmark of the disease. MSI is an early event in colon tumor development, but screening polyps for MSI remains controversial because of reduced sensitivity compared to more advanced neoplasms. To increase sensitivity, we investigated the use of a novel type of marker consisting of long mononucleotide repeat (LMR tracts. Adenomas from 160 patients, ranging in age from 29-55 years old, were screened for MSI using the new markers and compared with current marker panels and immunohistochemistry standards. Overall, 15 tumors were scored as MSI-High using the LMRs compared to 9 for the NCI panel and 8 for the MSI Analysis System (Promega. This difference represents at least a 1.7-fold increase in detection of MSI-High lesions over currently available markers. Moreover, the number of MSI-positive markers per sample and the size of allelic changes were significantly greater with the LMRs (p = 0.001, which increased confidence in MSI classification. The overall sensitivity and specificity of the LMR panel for detection of mismatch repair deficient lesions were 100% and 96%, respectively. In comparison, the sensitivity and specificity of the MSI Analysis System were 67% and 100%; and for the NCI panel, 75% and 97%. The difference in sensitivity between the LMR panel and the other panels was statistically significant (p<0.001. The increased sensitivity for detection of MSI-High phenotype in early colorectal lesions with the new LMR markers indicates that MSI screening for the early detection of Lynch syndrome might be feasible.

  7. WMAP Detection of Early Reionization

    Science.gov (United States)

    Kogut, A.

    2003-01-01

    The Wilkinson Microwave Anisotropy Probe (WMAP) has mapped the full sky in Stokes I, Q, and U parameters at frequencies 23, 33, 41, 61, and 94 GHz. We detect correlations between the temperature and polarization maps significant at more than 10 standard deviations. The correlations are inconsistent with instrument noise and are significantly larger than the upper limits established for potential systematic errors. The correlations are present in all WMAP frequency bands with similar amplitude from 23 to 94 GHz, and are consistent with a superposition of a CMB signal with a weak foreground. The fitted CMB component is robust against different data combinations and fitting techniques. On small angular scales the WMAP data show the temperature-polarization correlation expected from adiabatic density perturbations. The data for $\\ell > 20$ agree well with the signal predicted solely from the temperature power spectra, with no additional free parameters. The existence of correlations on super-horizon scales provides significant support for inflationary cosmologies. We detect excess power on large angular scales compared to predictions based on the temperature power spectra alone. The excess power is well described by reionization at redshift $11 reionization optical depth yields results consistent with the best-fit $\\Lambda$CDM model, with best fit value $\\tau = 0.17 \\pm 0.04$ at 68\\% confidence, including systematic and foreground uncertainties. This trough in the absorption spectra of distant quasars, and implies that the universe has a complex ionization history. I will discuss the WMAP data and its implications for reionization in the early universe.

  8. Breast Cancer Early Detection and Diagnosis

    Science.gov (United States)

    ... En Español Category Cancer A-Z Breast Cancer Breast Cancer Early Detection and Diagnosis Breast cancer is sometimes ... cancer screening is so important. Learn more. Can Breast Cancer Be Found Early? Breast cancer is sometimes found ...

  9. Genetic characterization of early maturing maize hybrids (Zea mays L.) obtained by protein and RAPD markers

    National Research Council Canada - National Science Library

    Bauer, Iva; Mladenovic-Drinic, Snezana; Filipovic, Milomir; Konstantinov, Kosana

    2005-01-01

    .... The objective of our study was to characterize set of early maturing maize hybrids with protein and RAPD markers and to compare this clasification with their pedigree information. RAPD markers gave significantly higher rate of polymorphism than protein markers. Better corelation was found among pedigree information and protein markers.

  10. Early detection of COPD in general practice

    DEFF Research Database (Denmark)

    Ulrik, Charlotte Suppli; Løkke, Anders; Dahl, Ronald

    2011-01-01

    Early detection enables the possibility for interventions to reduce the future burden of COPD. The Danish National Board of Health recommends that individuals >35 years with tobacco/occupational exposure, and at least 1 respiratory symptom should be offered a spirometry to facilitate early detect...

  11. Early detection of ovarian cancer: preliminary results of the Yale Early Detection Program.

    Science.gov (United States)

    Schwartz, P. E.; Chambers, J. T.; Taylor, K. J.; Pellerito, J.; Hammers, L.; Cole, L. A.; Yang-Feng, T. L.; Smith, P.; Mayne, S. T.; Makuch, R.

    1991-01-01

    Eighty-four women at high risk for ovarian cancer by having first-degree relatives with epithelial ovarian cancer participated in a newly established, early ovarian cancer detection program at Yale University. Participants were to be evaluated with physical examinations and circulating tumor markers at entry and every six months thereafter. Endovaginal ultrasound and color Doppler flow studies were to be performed at three and nine months following entry into the program. In addition, women were encouraged to follow American Cancer Society guidelines for mammography. Stool was checked for occult blood. Endometrial sampling was offered to post-menopausal women. No participant has developed an ovarian cancer since entering the program. One woman has been diagnosed to have breast cancer. False-positive levels of circulating tumor markers (CA 125, 4/84 [4.8 percent]; lipid-associated sialic acid in plasma, 13/84 [15.5 percent]; NB/70K, 4/84 [4.8 percent]; and urinary gonadotropin fragment, 1/65 [1.5 percent]) were observed on entry into the program. Low resistive indices (less than 0.5) were documented in 8/91 (8.8 percent) ovaries studied by the color Doppler flow technique. One participant underwent a laparotomy based on a false-positive endovaginal ultrasound examination. Tests now being employed in community practice have a high likelihood of being associated with false-positive results. Therapeutic interventions based on isolated abnormal tumor markers or ultrasound studies obtained from women with family histories of ovarian cancer may lead to inappropriate surgery. It is necessary for cancer centers to develop expertise in ovarian cancer detection techniques to advise physicians in their geographic areas appropriately about the significance of the abnormal screening test. PMID:1810101

  12. Ethics dilemmas of early detection of obesity

    DEFF Research Database (Denmark)

    Vallgårda, Signild

    2016-01-01

    Aim: To discuss the ethics dilemmas of the early detection of overweight and obesity. Methods: Analysis of the ethical aspects of early detection. Results: The early detection of overweight and obesity entails a number of ethical dilemmas because it may both be helpful and harmful. It may help...... people to lead a healthier life and non-detection could be considered neglectful. It may, however, cause anxiety, interfere with people’s integrity, focus only on individual causes and responsibilities, cause stigmatization and have adverse effects by inducing weight gain. Conclusions: Documentation...

  13. Detection of argan oil adulterated with vegetable oils: New markers

    Energy Technology Data Exchange (ETDEWEB)

    Ourrach, I.; Rada, M.; Perez-Camino, M. C.; Benaissa, M.; Guinda, A

    2012-07-01

    This work aims to contribute to controlling the authenticity of pure argan oil, a valuable Moroccan product. Fatty acids, hydrocarbon fraction, 3,5-stigmastadiene, the alkyl esters of fatty acids, chlorophyllic pigments and physical properties such as viscosity, density and refractive index were studied in order to detect the adulteration of argan oil with edible vegetable oils. The results found in this study show that 3,5-stigmastadiene, kaurene and pheophytin-a can be used as possible new markers for argan oil blends of up to 5% with refined, sunflower and virgin olive oils. Due to the similarity of the fatty acid compositions of the edible oils studied and argan oil, fatty acids can be employed as markers for the detection of argan oil adulteration at levels higher than 10%. Among the physical properties studied, the refractive index shows significant differences for sunflower oil and its blend at 10% with argan oil. (Author) 35 refs.

  14. Markers for detecting alcoholism and monitoring for continued abuse.

    Science.gov (United States)

    Morgan, M Y

    1980-01-01

    Several biochemical and haematological abnormalities are associated with excessive alcohol intake and some are used in the recognition and management of alcoholics. The ideal biological marker for detecting and monitoring alcoholics should be sensitive and highly specific for alcohol abuse; its value should be affected by changes in alcohol intake over relatively short periods of time and it should be quick, simple, convenient and inexpensive to estimate. At the present time no simple reliable marker is available which fulfills these criteria. Measurements of serum aspartate transaminase, serum gamma-glutamyl-transpeptidase and mean corpuscular volume are of proven value however and the majority of alcoholics can be detected and monitored by combining the measurements of these three tests. Blood/breath alcohol measurements are of limited value for detection but are useful for follow up. Measurement of the plasma alpha-amino-n-butyric acid/leucine ratio is of disputed value and not likely to be of great practical use. Measurement of serum alpha-lipoproteins, erythrocyte delta-aminolaevulinic acid dehydrase activity and qualitative estimation of serum transferrin have all been proposed as markers for alcohol abuse and are currently under evaluation.

  15. Early indices of deviance detection in humans and animal models.

    Science.gov (United States)

    Grimm, Sabine; Escera, Carles; Nelken, Israel

    2016-04-01

    Detecting unexpected stimuli in the environment is a critical function of the auditory system. Responses to unexpected "deviant" sounds are enhanced compared to responses to expected stimuli. At the human scalp, deviance detection is reflected in the mismatch negativity (MMN) and in an enhancement of the middle-latency response (MLR). Single neurons often respond more strongly to a stimulus when rare than when common, a phenomenon termed stimulus-specific adaptation (SSA). Here we compare stimulus-specific adaptation with scalp-recorded deviance-related responses. We conclude that early markers of deviance detection in the time range of the MLR could be a direct correlate of cortical SSA. Both occur at an early level of cortical activation, both are robust findings with low-probability stimuli, and both show properties of genuine deviance detection. Their causal relation with the later scalp-recorded MMN is a key question in this field.

  16. Androgenetic alopecia as an early marker of benign prostatic hyperplasia.

    Science.gov (United States)

    Arias-Santiago, Salvador; Arrabal-Polo, Miguel Angel; Buendía-Eisman, Agustín; Arrabal-Martín, Miguel; Gutiérrez-Salmerón, María Teresa; Girón-Prieto, María Sierra; Jimenez-Pacheco, Antonio; Calonje, Jaime Eduardo; Naranjo-Sintes, Ramón; Zuluaga-Gomez, Armando; Serrano Ortega, Salvio

    2012-03-01

    Androgenetic alopecia (AGA) and benign prostatic hyperplasia are both androgen-dependent entities that respond to the blocking of 5-alpha-reductase. The objective of this study was to determine whether prostatic volumes and urinary flow changes were higher in patients with early-onset AGA than in healthy control subjects. This was an observational case-control study of 87 men: 45 with early-onset AGA diagnosed in the dermatology department and 42 control subjects. End-point variables were prostatic volume, measured by transrectal ultrasound, and urinary flow, measured by urinary flowmetry. A hormone study was performed on all participants, and the International Prostate Symptom Score and International Index of Erectile Function score were determined. The groups did not significantly differ in mean age (cases, 52.7 years vs control subjects, 49.8 years; P = .12). Patients with AGA had significantly higher mean prostate volume (29.65 vs 20.24 mL, P Prostate Symptom Score (4.93 vs 1.23, P prostate-specific antigen value (1.53 vs 0.94 ng/mL, P prostatic hyperplasia after adjusting for age, urinary volume, urination time, International Prostate Symptom Score, abdominal obesity, glucose levels, systolic blood pressure, insulin levels, fibrinogen, and C-reactive protein (odds ratio = 5.14, 95% confidence interval 1.23-47.36, P = .041). The study of larger sample sizes would facilitate stratified analyses according to the Ebling type of androgenetic alopecia. There is a relationship between the presence of AGA and prostate growth-associated urinary symptoms, likely attributable to their pathophysiological similarity. This study suggests that early-onset AGA may be an early marker of urinary/prostatic symptomatology. Future studies may clarify whether treatment of patients with AGA may benefit the concomitant benign prostatic hypertrophy, which would be present at an earlier stage in its natural evolution. Copyright © 2010 American Academy of Dermatology, Inc. Published by

  17. Defeating cancer with early detection

    CERN Multimedia

    2003-01-01

    A meeting of scientists and industry experts will hold an open review of the Three Dimension Complete Body Screening System (3D-CBS) on the 1st of July 2003. This new imaging technlogy is potentially powerful and safe enough to offer routine screening of healthy patients for early signs of cancer (1 page).

  18. Magnetic resonance imaging markers for early diagnosis of Parkinson's disease

    Institute of Scientific and Technical Information of China (English)

    Silvia Marino; Rosella Ciurleo; Giuseppe Di Lorenzo; Marina Barresi; Simona De Salvo; Sabrina Giacoppo; Alessia Bramanti; Pietro Lanzafame; Placido Bramanti

    2012-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by selective and progressive degeneration, as well as loss of dopaminergic neurons in the substantia nigra. In PD, approximately 60-70% of nigrostriatal neurons are degenerated and 80% of content of the striatal dopamine is reduced before the diagnosis can be established according to widely accepted clinical diagnostic criteria. This condition describes a stage of disease called "prodromal", where non-motor symptoms, such as olfactory dysfunction, constipation, rapid eye movement behaviour disorder, depression, precede motor sign of PD. Detection of prodromal phase of PD is becoming an important goal for determining the prognosis and choosing a suitable treatment strategy. In this review, we present some non-invasive instrumental approaches that could be useful to identify patients in the prodromal phase of PD or in an early clinical phase, when the first motor symptoms begin to be apparent. Conventional magnetic resonance imaging (MRI) and advanced MRI techniques, such as magnetic resonance spectroscopy imaging, diffusion-weighted and diffusion tensor imaging and functional MRI, are useful to differentiate early PD with initial motor symptoms from atypical parkinsonian disorders, thus, making easier early diagnosis. Functional MRI and diffusion tensor imaging techniques can show abnormalities in the olfactory system in prodromal PD.

  19. Magnetic resonance imaging markers for early diagnosis of Parkinson's disease☆

    Science.gov (United States)

    Marino, Silvia; Ciurleo, Rosella; Di Lorenzo, Giuseppe; Barresi, Marina; De Salvo, Simona; Giacoppo, Sabrina; Bramanti, Alessia; Lanzafame, Pietro; Bramanti, Placido

    2012-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by selective and progressive degeneration, as well as loss of dopaminergic neurons in the substantia nigra. In PD, approximately 60-70% of nigrostriatal neurons are degenerated and 80% of content of the striatal dopamine is reduced before the diagnosis can be established according to widely accepted clinical diagnostic criteria. This condition describes a stage of disease called “prodromal”, where non-motor symptoms, such as olfactory dysfunction, constipation, rapid eye movement behaviour disorder, depression, precede motor sign of PD. Detection of prodromal phase of PD is becoming an important goal for determining the prognosis and choosing a suitable treatment strategy. In this review, we present some non-invasive instrumental approaches that could be useful to identify patients in the prodromal phase of PD or in an early clinical phase, when the first motor symptoms begin to be apparent. Conventional magnetic resonance imaging (MRI) and advanced MRI techniques, such as magnetic resonance spectroscopy imaging, diffusion-weighted and diffusion tensor imaging and functional MRI, are useful to differentiate early PD with initial motor symptoms from atypical parkinsonian disorders, thus, making easier early diagnosis. Functional MRI and diffusion tensor imaging techniques can show abnormalities in the olfactory system in prodromal PD. PMID:25745453

  20. Screening and Early Detection - Cancer Currents Blog

    Science.gov (United States)

    A catalog of posts from NCI’s Cancer Currents blog on research related to cancer screening and early detection. Includes posts on diagnostic biomarkers and advances or trends in screening practices.

  1. Kidney Disease: Early Detection and Treatment

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues Special Section Kidney Disease: Early Detection and Treatment Past Issues / Winter ... called a "urine albumin-to-creatinine ratio." Treating Kidney Disease Kidney disease is usually a progressive disease, ...

  2. Early detection of contagious diseases

    Science.gov (United States)

    Colston, Jr., Billy W.; Milanovich, Fred P.; Estacio, Pedro; Chang, John

    2011-08-09

    This invention provides an electronic proximity apparatus and a surveillance method using such an apparatus for alerting individuals that are exposed to a contagious disease. When a person becomes symptomatic and is diagnosed as positive for a given contagious agent, individuals that have recently maintained a threshold proximity with respect to an infected individual are notified and advised to seek immediate medial care. Treatment of individuals in the very early phases of infection (pre-symptomatic) significantly reduces contagiousness of the infected population first exposed to the contagious disease, thus preventing spread of the disease throughout the general population.

  3. Early detection of congenital syphilis

    Directory of Open Access Journals (Sweden)

    Nagalakshmi Chowdhary

    2014-01-01

    Full Text Available Late congenital syphilis is a very rare clinical entity, and its early diagnosis and treatment is essential. Dental findings often provide valuable evidence for the diagnosis of late congenital syphilis. It occurs due to the transmission of the disease from an infected mother to her fetus through placenta. This long forgotten disease continues to effect pregnant women resulting in perinatal morbidity and mortality. Congenital syphilis is a preventable disease, and its presence reflects a failure of prenatal care delivery system, as well as syphilis control programs. We are reporting a case of late congenital syphilis with only Hutchinson′s teeth.

  4. Early detection of COPD in general practice

    DEFF Research Database (Denmark)

    Ulrik, Charlotte Suppli; Løkke, Anders; Dahl, Ronald

    2011-01-01

    Early detection enables the possibility for interventions to reduce the future burden of COPD. The Danish National Board of Health recommends that individuals >35 years with tobacco/occupational exposure, and at least 1 respiratory symptom should be offered a spirometry to facilitate early...... detection of COPD. The aim, therefore, was to provide evidence for the feasibility and impact of doing spirometry in this target population....

  5. Bayesian Reasoning Using 3D Relations for Lane Marker Detection

    DEFF Research Database (Denmark)

    Boesman, Bart; Jensen, Lars Baunegaard With; Baseski, Emre;

    2009-01-01

    We introduce a lane marker detection algorithm that integrates 3D attributes as well as 3D relations between local edges and semi-global contours in a Bayesian framework. The algorithm is parameter free and does not make use of any heuristic assumptions. The reasoning is based on the complete...... conditional probabilities of the different cues which are estimated from a training set. The importance of the individual visual cues can be computed using a standard measure and the cues can then be combined in an optimal way. In addition we show that when doing 3D reasoning, the uncertainties connected...

  6. Early detection of ecosystem regime shifts

    DEFF Research Database (Denmark)

    Lindegren, Martin; Dakos, Vasilis; Groeger, Joachim P.;

    2012-01-01

    methods may have limited utility in ecosystem-based management as they show no or weak potential for early-warning. We therefore propose a multiple method approach for early detection of ecosystem regime shifts in monitoring data that may be useful in informing timely management actions in the face......Critical transitions between alternative stable states have been shown to occur across an array of complex systems. While our ability to identify abrupt regime shifts in natural ecosystems has improved, detection of potential early-warning signals previous to such shifts is still very limited...

  7. AUDIOMETRY-FIRST STEP TO EARLY DETECTION

    Directory of Open Access Journals (Sweden)

    Slavco CADIEV

    1997-09-01

    Full Text Available The problem of early detection of children with sense of hearing is very complicate. If the damage of sense of hearing is not detected on time and if You don’t take adequate treatment, after seven year that is impossible. Audiometry is one step to reestablishment diagnostic with help of electronic technology.

  8. Early detection of hearing loss

    Directory of Open Access Journals (Sweden)

    Schade, Götz

    2008-01-01

    Full Text Available The universal newborn hearing screening (UNHS is currently spreading in Germany, as well, even though there can be no talk of a comprehensive establishment. The introduction of UNHS in several federal states such as Hamburg, Hessen, and Schleswig-Holstein can be ascribed to the personal commitment of individual pediatric audiologists. Apart from the procurement of the screening equipment and the training of the staff responsible for the examination of the newborns, the tracking, i.e. the follow-up on children with conspicuous test results, is of utmost importance. This involves significant administration effort and work and is subject to data protection laws that can differ substantially between the various federal states. Among audiologists, there is consensus that within the first three months of a child’s life, a hearing loss must be diagnosed and that between the age of 3 and 6 months, the supply of a hearing aid must have been initiated. For this purpose, screening steps 1 (usually a TEOAE measurement and 2 (AABR testing need to be conducted in the maternity hospital. The follow-up of step 1 then comprises the repetition of the TEOAE- and AABR measurement for conspicuous children by a specialized physician. The follow-up of step 2 comprises the confirmatory diagnostics in a pediatric audiological center. This always implies BERA diagnostics during spontaneous sleep or under sedation. The subsequent early supply of a hearing aid should generally be conducted by a (pediatric acoustician specialized on children.

  9. Internet worm early detection and response mechanism

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In recent years, fast spreading worm has become one of the major threats to the security of the Internet and has an increasingly fierce tendency.In view of the insufficiency that based on Kalman filter worm detection algorithm is sensitive to interval, this article presents a new data collection plan and an improved worm early detection method which has some deferent intervals according to the epidemic worm propagation model, then proposes a worm response mechanism for slowing the wide and fast worm propagation effectively.Simulation results show that our methods are able to detect worms accurately and early.

  10. Rapid detection of autosomal aneuploidy using microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Ray, P.N.; Teshima, I.E. [Hospital for Sick Children, Ontario (Canada); Winsor, E.J.T. [Toronto Hospital, Ontario (Canada)] [and others

    1994-09-01

    Trisomy occurs in at least 4% of all clinically recognized pregnancies, making it the most common type of chromosome abnormality in humans. The most commonly occurring trisomies are those of chromosomes 13, 18, 21 and aneuploidy of X and Y, accounting for about 0.3% of all newborns and a much higher percentage of conceptuses. In Canada, prenatal chromosome analysis by amniocentesis is offered to those women {ge} 35 years of age at the time of delivery or equivalent risk by maternal serum screen. We are developing a rapid molecular diagnostic test to detect the most common autosomal aneuploidies in prenatal and neonatal samples. The tests makes use of highly polymorphic short tandem repeat markers labeled with fluorescent tags which allow analysis on a GENESCANNER automated fragment analyzer (ABI). Multiple polymorphic markers have been selected on each of chromosomes 13, 18 and 21. At a given locus, trisomic fetuses/neonates will have either three alleles or two alleles with one allele having twice the intensity of the other. Unaffected individuals have two equal intensity alleles. We are conducting a blind study that will compare the detection efficiencies of FISH analysis on uncultured cells and the molecular method on confirmation amniotic fluid samples collected at the time of termination of affected fetuses. Results on cultured amniocytes from one such patient confirmed that trisomy 21 can be detected. FISH was not done on this sample. In addition, detection efficiency of the molecular method in whole blood samples from affected neonates is also being studied. To date, two such samples have been tested, one with trisomy 13 and one with trisomy 18, and both samples were diagnosed correctly. Preliminary results suggest that this method may provide a valuable tool for the rapid diagnosis of aneuploidy.

  11. Detection and monitoring of early caries lesions

    DEFF Research Database (Denmark)

    Pretty, I A; Ekstrand, K R

    2016-01-01

    AIM: To review the current evidence base of detecting and monitoring early carious lesions in children and adolescents and a rationale proposed to ensure that such lesions are identified and appropriately managed. METHODS: The systematic literature search identified initially a review by Gomez...... of existing visible and radiographical systems to monitor lesions over time. Using low-cost intra-oral cameras facilitates the recording of lesion appearance in the patient record and may be of significant benefit in monitoring early lesions over time following their detection. This benefit extends...

  12. [Early detection and treatment of strabismus].

    Science.gov (United States)

    Mojon, Daniel

    2016-01-01

    An early diagnosis of strabismus is important in order to rule out treatable organic causes and in children, if indicated, to start as early as possible with an amblyopia treatment. Early detection will also decrease the risk for accidents secondary to diplopia, to the loss of binocular vision and to the restriction of the binocular visual field in case of esodeviations. The following therapeutic options exist: in some cases the prescription of the correct refraction will be sufficient, for small deviations a prismatic correction may allow a longstanding treatment, for larger or incomitant deviations strabismus surgery will be necessary, which nowadays can be performed using minimal-invasive technique on an outpatient base.

  13. Inflammatory markers and extent and progression of early atherosclerosis

    DEFF Research Database (Denmark)

    Willeit, Peter; Thompson, Simon G; Agewall, Stefan

    2016-01-01

    -IMT) in the general population. METHODS: Information on high-sensitivity C-reactive protein, fibrinogen, leucocyte count and CCA-IMT was available in 20 prospective cohort studies of the PROG-IMT collaboration involving 49,097 participants free of pre-existing cardiovascular disease. Estimates of associations were...... inflammatory markers and baseline CCA-IMT. After adjustment for traditional cardiovascular risk factors, mean differences in baseline CCA-IMT per one-SD higher inflammatory marker were: 0.0082 mm for high-sensitivity C-reactive protein (p ... for leucocyte count (p = 0.033). 'Inflammatory load', defined as the number of elevated inflammatory markers (i.e. in upper two quintiles), showed a positive linear association with baseline CCA-IMT (p 

  14. Hybrid hydrogel photonic barcodes for multiplex detection of tumor markers.

    Science.gov (United States)

    Xu, Yueshuang; Zhang, Xiaoping; Luan, Chengxin; Wang, Huan; Chen, Baoan; Zhao, Yuanjin

    2017-01-15

    Barcodes-based suspension array have for demonstrated values in multiplex assay of tumor markers. Photonic barcodes which are encoded by their characteristic reflection peaks are the important supports for suspension array due to their stable code, low fluorescent background and high surface-volume ratio. Attempts to develop this technology tend to improve the function of the photonic barcodes. Here, we present a new type of hybrid hydrogel photonic barcodes for efficient multiplex assays. This photonic barcodes are hybrid inverse opal hydrogel composed of poly(ethylene glycol) diacrylate (PEG-DA) and agarose. The polymerized PEG-DA hydrogel could guarantee the stabilities of the inverse opal structure and its resultant code, while the agarose could offer active chemical groups for the probe immobilization and homogeneous water surrounding for the bioassay. In addition, the interconnected pores inverse opal structure could provide channels for biomolecules diffusing and reaction into the voids of barcodes. These features imparted the hybrid hydrogel photonic barcodes with limits of detection (LOD) of 0.78ng/mL for carcinoembryonic antigen (CEA) and 0.21ng/mL for α-fetoprotein (AFP), respectively. It was also demonstrated that the proposed barcodes showed acceptable accuracy and detection reproducibility, and the results were in acceptable agreement with those from common clinic method for the detections of practical clinical samples. Thus, our technique provides a new platform for simultaneous multiplex immunoassay.

  15. Haploid Origin of Cork Oak Anther Embryos Detected by Enzyme and RAPD Gene Markers.

    Science.gov (United States)

    Bueno; Agundez; Gomez; Carrascosa; Manzanera

    2000-05-01

    In vitro-induced cork oak (Quercus suber L.) embryos from anther cultures proved to be of haploid origin both by enzyme and RAPD gene marker analysis. The problem considered was to ascertain if embryo cultures originated either from a single haploid cell, from a microspore, or from multiple haploid cells. Therefore, a heterozygotic gene was searched for in the parent tree. The gene coding for shikimate dehydrogenase (SKDH1) proved to be heterozygous in the parental tree, and subsequently, these allozymes were screened for the embryos induced in anther cultures from the same tree. Only haploid embryos were found, confirming the microspore origin. Different genotypes were not identified inside each anther by isozyme analysis, probably because of selective pressure for one embryo early in development, but both parental SKDH1 alleles were found in the embryos of different anthers. The banding patterns detected by RAPD markers permitted the identification of multiple microspore origins inside each anther.

  16. Ghost marker detection and elimination in marker-based optical tracking systems for real-time tracking in stereotactic body radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Guanghua, E-mail: yan@ufl.edu; Li, Jonathan; Huang, Yin; Mittauer, Kathryn; Lu, Bo; Liu, Chihray [Department of Radiation Oncology, University of Florida, Gainesville, Florida 32610 (United States)

    2014-10-15

    Purpose: To propose a simple model to explain the origin of ghost markers in marker-based optical tracking systems (OTS) and to develop retrospective strategies to detect and eliminate ghost markers. Methods: In marker-based OTS, ghost markers are virtual markers created due to the cross-talk between the two camera sensors, which can lead to system execution failure or inaccuracy in patient tracking. As a result, the users have to limit the number of markers and avoid certain marker configurations to reduce the chances of ghost markers. In this work, the authors propose retrospective strategies to detect and eliminate ghost markers. The two camera sensors were treated as mathematical points in space. The authors identified the coplanar within limit (CWL) condition as the necessary condition for ghost marker occurrence. A simple ghost marker detection method was proposed based on the model. Ghost marker elimination was achieved through pattern matching: a ghost marker-free reference set was matched with the optical marker set observed by the OTS; unmatched optical markers were eliminated as either ghost markers or misplaced markers. The pattern matching problem was formulated as a constraint satisfaction problem (using pairwise distances as constraints) and solved with an iterative backtracking algorithm. Wildcard markers were introduced to address missing or misplaced markers. An experiment was designed to measure the sensor positions and the limit for the CWL condition. The ghost marker detection and elimination algorithms were verified with samples collected from a five-marker jig and a nine-marker anthropomorphic phantom, rotated with the treatment couch from −60° to +60°. The accuracy of the pattern matching algorithm was further validated with marker patterns from 40 patients who underwent stereotactic body radiotherapy (SBRT). For this purpose, a synthetic optical marker pattern was created for each patient by introducing ghost markers, marker position

  17. Overweight patterns throughout childhood and cardiometabolic markers in early adolescence

    NARCIS (Netherlands)

    Berentzen, N. E.; van Rossem, L.; Gehring, U.; Koppelman, G. H.; Postma, D. S.; de Jongste, J. C.; Smit, H. A.; Wijga, A. H.

    BACKGROUND: Risk of cardiovascular and metabolic disease is higher in adults who were relatively thin at birth and had subsequent accelerated weight gain. This specific pattern of weight gain may relate to unfavorable cardiometabolic markers already in childhood. We prospectively assessed whether

  18. Is "Two" a Plural Marker in Early Child Language?

    Science.gov (United States)

    Barner, David; Lui, Toni; Zapf, Jennifer

    2012-01-01

    Is "two" ever a plural marker in child language? By some accounts, children bootstrap the distinction between the words "one" and "two" by observing their use with singular-plural marking ("one ball/two balls"). Others argue that the numeral "two" marks plurality before children begin using numerals to denote precise quantities. We tested the…

  19. Prevention and early detection of prostate cancer

    NARCIS (Netherlands)

    J. Cuzick (Jack); M.A. Thorat (Mangesh A); G. Andriole (Gerald); O.W. Brawley (Otis W); P.H. Brown (Powel H); Z. Culig (Zoran); R. Eeles (Rosalind); L.G. Ford (Leslie G); F. Hamdy (Freddie); L. Holmberg (Lars); D. Ilic (Dragan); T.J. Key (Timothy J); C.L. Vecchia (Carlo La); H. Lilja (Hans); M. Marberger (Michael); F.L. Meyskens (Frank L); L.M. Minasian (Lori M); C. Parker (C.); H.L. Parnes (Howard L); S. Perner (Sven); H. Rittenhouse (Harry); J.A. Schalken (J.); H.-P. Schmid (Hans-Peter); B.J. Schmitz-Dräger (Bernd J); F.H. Schröder (Fritz); A. Stenzl (Arnulf); B. Tombal (Bertrand); T.J. Wilt (Timothy J.); K. Wolk (Kerstin)

    2014-01-01

    textabstractProstate cancer is a common malignancy in men and the worldwide burden of this disease is rising. Lifestyle modifications such as smoking cessation, exercise, and weight control offer opportunities to reduce the risk of developing prostate cancer. Early detection of prostate cancer by pr

  20. Prevention and early detection of prostate cancer

    NARCIS (Netherlands)

    J. Cuzick (Jack); M.A. Thorat (Mangesh A); G. Andriole (Gerald); O.W. Brawley (Otis W); P.H. Brown (Powel H); Z. Culig (Zoran); R. Eeles (Rosalind); L.G. Ford (Leslie G); F. Hamdy (Freddie); L. Holmberg (Lars); D. Ilic (Dragan); T.J. Key (Timothy J); C.L. Vecchia (Carlo La); H. Lilja (Hans); M. Marberger (Michael); F.L. Meyskens (Frank L); L.M. Minasian (Lori M); C. Parker (C.); H.L. Parnes (Howard L); S. Perner (Sven); H. Rittenhouse (Harry); J.A. Schalken (J.); H.-P. Schmid (Hans-Peter); B.J. Schmitz-Dräger (Bernd J); F.H. Schröder (Fritz); A. Stenzl (Arnulf); B. Tombal (Bertrand); T.J. Wilt (Timothy J.); K. Wolk (Kerstin)

    2014-01-01

    textabstractProstate cancer is a common malignancy in men and the worldwide burden of this disease is rising. Lifestyle modifications such as smoking cessation, exercise, and weight control offer opportunities to reduce the risk of developing prostate cancer. Early detection of prostate cancer by pr

  1. Developmental Dyslexia: Early Precursors, Neurobehavioral Markers, and Biological Substrates

    Science.gov (United States)

    Benasich, April A., Ed.; Fitch, R. Holly, Ed.

    2012-01-01

    Understanding the precursors and early indicators of dyslexia is key to early identification and effective intervention. Now there's a single research volume that brings together the very latest knowledge on the earliest stages of dyslexia and the diverse genetic, neurobiological, and cognitive factors that may contribute to it. Based on findings…

  2. Neuroimaging markers for the prediction and early diagnosis of Alzheimer’s disease dementia

    Science.gov (United States)

    Ewers, Michael; Sperling, Reisa A.; Klunk, William E.; Weiner, Michael W.; Hampel, Harald

    2011-01-01

    Alzheimer’s disease (AD) is a progressive age-related neurodegenerative disease. At the time of clinical manifestation of dementia, significant irreversible brain damage is already present, rendering the diagnosis of AD at early stages of the disease an urgent prerequisite for therapeutic treatment to halt, or at least slow, disease progression. In this Review, we discuss various neuroimaging measures that are proving to have potential value as biomarkers of AD pathology for the detection and prediction of AD before the onset of dementia. Recent studies that have identified AD-like structural and functional brain changes in elderly people who are cognitively within the normal range or who have mild cognitive impairment (MCI) are discussed. A dynamic sequence model of changes that occur in neuroimaging markers during the different disease stages is presented and the predictive value of multimodal neuroimaging for AD dementia is considered. PMID:21696834

  3. A minimally invasive multiple marker approach allows highly efficient detection of meningioma tumors

    Directory of Open Access Journals (Sweden)

    Meese Eckart

    2006-12-01

    Full Text Available Abstract Background The development of effective frameworks that permit an accurate diagnosis of tumors, especially in their early stages, remains a grand challenge in the field of bioinformatics. Our approach uses statistical learning techniques applied to multiple antigen tumor antigen markers utilizing the immune system as a very sensitive marker of molecular pathological processes. For validation purposes we choose the intracranial meningioma tumors as model system since they occur very frequently, are mostly benign, and are genetically stable. Results A total of 183 blood samples from 93 meningioma patients (WHO stages I-III and 90 healthy controls were screened for seroreactivity with a set of 57 meningioma-associated antigens. We tested several established statistical learning methods on the resulting reactivity patterns using 10-fold cross validation. The best performance was achieved by Naïve Bayes Classifiers. With this classification method, our framework, called Minimally Invasive Multiple Marker (MIMM approach, yielded a specificity of 96.2%, a sensitivity of 84.5%, and an accuracy of 90.3%, the respective area under the ROC curve was 0.957. Detailed analysis revealed that prediction performs particularly well on low-grade (WHO I tumors, consistent with our goal of early stage tumor detection. For these tumors the best classification result with a specificity of 97.5%, a sensitivity of 91.3%, an accuracy of 95.6%, and an area under the ROC curve of 0.971 was achieved using a set of 12 antigen markers only. This antigen set was detected by a subset selection method based on Mutual Information. Remarkably, our study proves that the inclusion of non-specific antigens, detected not only in tumor but also in normal sera, increases the performance significantly, since non-specific antigens contribute additional diagnostic information. Conclusion Our approach offers the possibility to screen members of risk groups as a matter of routine

  4. Defining Early Markers of Neurodevelopmental Disorders in Infants With TSC

    Science.gov (United States)

    2013-10-01

    8 2 INTRODUCTION: Our goal is to investigate and define clinical, behavioral, and neurophysiological markers of...from infants (18-30 months) with TSC and age-matched controls to estimate their respective dominant cortical rhythms encoded in the EEG, and age...related changes in these rhythms . In addition to traditionally estimated rhythms (from delta to gamma), at 18 months a high- frequency (>80 Hz) rhythm

  5. First trimester intact hCG as an early marker of trisomy 21: a promise unrecognised?

    Science.gov (United States)

    Spencer, Kevin; Cowans, Nicholas J; Uldbjerg, Niels; Vereecken, Annie; Tørring, Niels

    2008-12-01

    An initial study of trisomy 21 cases showed that prior to 10 weeks, maternal serum levels of intact hCG in the early first trimester are lower than normal. Here we further study the levels prior to and after 10 weeks of gestation to further establish whether or not the intact hCG is effective as a very early screening marker. Fifty-nine samples from pregnancies with trisomy 21 were identified, 31 were collected between the sixth and ninth weeks of gestation and 28 after the tenth week. A series of 629 gestational age-matched samples collected during the same period formed the control group. Intact hCG was measured by a DELFIA assay. The multiples of the median (MoM) in cases (n = 31) collected prior to 10 weeks were 0.79 (CI 0.62-0.98) at a median gestation of 9.1 weeks. Prior to 9 weeks (n = 14) the median was 0.774 (CI 0.54-1.09) at a median gestation of 8.5 weeks. Modelling the detection rate for a 3 or 5% false-positive rate when screening using intact hCG, free beta-hCG and PAPP-A at 8-10 weeks of gestation indicated that 71 or 77% of cases would be detected. More data are needed to establish a secure MoM for intact hCG in pregnancies prior to 10 weeks, before it could be considered a suitable screening marker. Copyright (c) 2008 John Wiley & Sons, Ltd.

  6. Immunohistochemical markers for corneal stem cells in the early developing human eye

    DEFF Research Database (Denmark)

    Lyngholm, Mikkel; Høyer, Poul E; Vorum, Henrik;

    2008-01-01

    markers and potential markers for LSCs and early transient amplifying cells in human adults. In this study, we describe the development of the ectodermally derived LSCs and the mesodermally derived niche cells from the time at which the cornea is defined (week 6) until the formation of the early limbal...... niche (week 14) in human embryos and fetuses. The expression of SOD2 and CK15 was investigated together with other recently identified limbal proteins. Previously suggested LSC and differentiation markers (PAX6, aquaporin-1 and nestin) were also investigated. Both SOD2 and CK15 were present...

  7. Detection of argan oil adulterated with vegetable oils: new markers

    Directory of Open Access Journals (Sweden)

    Ourrach, I.

    2012-10-01

    Full Text Available This work aims to contribute to controlling the authenticity of pure argan oil, a valuable Moroccan product. Fatty acids, hydrocarbon fraction, 3,5-stigmastadiene, the alkyl esters of fatty acids, chlorophyllic pigments and physical properties such as viscosity, density and refractive index were studied in order to detect the adulteration of argan oil with edible vegetable oils. The results found in this study show that 3,5-stigmastadiene, kaurene and pheophytin-a can be used as possible new markers for argan oil blends of up to 5% with refined, sunflower and virgin olive oils. Due to the similarity of the fatty acid compositions of the edible oils studied and argan oil, fatty acids can be employed as markers for the detection of argan oil adulteration at levels higher than 10%. Among the physical properties studied, the refractive index shows significant differences for sunflower oil and its blend at 10% with argan oil.

    El objetivo principal de este trabajo es contribuir al control de la autenticidad del aceite argán, un producto marroquí muy valorado. Con el fin de detectar la adulteración del aceite de argán con aceites vegetales comestibles, se han estudiado los siguientes parámetros: ácidos grasos, fracción de hidrocarburos, 3,5-estigmastadieno, ésteres alquílicos, pigmentos clorofílicos y propiedades físicas como la viscosidad, densidad e índice de refracción. Los resultados de este estudio muestran que el 3,5-estigmastadieno, kaureno y la feofitina-a podrían utilizarse como nuevos marcadores en la detección del aceite de argán adulterado con aceites refinados y aceite oliva virgen al 5%. La composición en ácidos grasos puede emplearse para la detección de la adulteración del aceite de argán a niveles superiores al 10%, debido a la similitud en la composición de los aceites estudiados. Entre las propiedades físicas analizadas, el índice de refracción mostró diferencias significativas entre el aceite de arg

  8. Multiple Biomarker Panels for Early Detection of Breast Cancer in Peripheral Blood

    Directory of Open Access Journals (Sweden)

    Fan Zhang

    2013-01-01

    Full Text Available Detecting breast cancer at early stages can be challenging. Traditional mammography and tissue microarray that have been studied for early breast cancer detection and prediction have many drawbacks. Therefore, there is a need for more reliable diagnostic tools for early detection of breast cancer due to a number of factors and challenges. In the paper, we presented a five-marker panel approach based on SVM for early detection of breast cancer in peripheral blood and show how to use SVM to model the classification and prediction problem of early detection of breast cancer in peripheral blood. We found that the five-marker panel can improve the prediction performance (area under curve in the testing data set from 0.5826 to 0.7879. Further pathway analysis showed that the top four five-marker panels are associated with signaling, steroid hormones, metabolism, immune system, and hemostasis, which are consistent with previous findings. Our prediction model can serve as a general model for multibiomarker panel discovery in early detection of other cancers.

  9. Early detection of ovarian cancer: background, rationale, and structure of the Yale Early Detection Program.

    OpenAIRE

    Schwartz, P. E.; Chambers, J. T.; Taylor, K. J.; Pellerito, J.; Hammers, L.; Cole, L. A.; Yang-Feng, T L; Smith, P; Mayne, S T; Makuch, R.

    1991-01-01

    Ovarian cancer has received national attention as a highly virulent disease. Its lack of early warning symptoms and the failure to develop highly sensitive screening tests have led some physicians to recommend prophylactic oophorectomies to women with relatives who have had ovarian cancer. Others have recommended routine screening of otherwise normal women for CA 125, a circulating tumor marker, and ultrasound examinations. Each of these techniques is associated with substantial false-positiv...

  10. Early Detection of Alzheimer's - A Crucial Requirement

    CERN Document Server

    Bukhari, Ijaz

    2013-01-01

    Alzheimer's, an old age disease of people over 65 years causes problems with memory, thinking and behavior. This disease progresses very slow and its identification in early stages is very difficult. The symptoms of Alzheimer's appear slowly and gradually will have worse effects. In its early stages, not only the patients themselves but their loved ones are generally unable to accept that the patient is suffering from disease. In this paper, we have proposed a new algorithm to detect patients of Alzheimer's at early stages by comparing the Magnetic Resonance Images (MRI) of the patients with normal persons of their age. The progress of the disease can also be monitored by periodic comparison of the previous and current MRI.

  11. Gene methylation profiles of normal mucosa, and benign and malignant colorectal tumors identify early onset markers

    Directory of Open Access Journals (Sweden)

    Vatn Morten

    2008-12-01

    Full Text Available Abstract Background Multiple epigenetic and genetic changes have been reported in colorectal tumors, but few of these have clinical impact. This study aims to pinpoint epigenetic markers that can discriminate between non-malignant and malignant tissue from the large bowel, i.e. markers with diagnostic potential. The methylation status of eleven genes (ADAMTS1, CDKN2A, CRABP1, HOXA9, MAL, MGMT, MLH1, NR3C1, PTEN, RUNX3, and SCGB3A1 was determined in 154 tissue samples including normal mucosa, adenomas, and carcinomas of the colorectum. The gene-specific and widespread methylation status among the carcinomas was related to patient gender and age, and microsatellite instability status. Possible CIMP tumors were identified by comparing the methylation profile with microsatellite instability (MSI, BRAF-, KRAS-, and TP53 mutation status. Results The mean number of methylated genes per sample was 0.4 in normal colon mucosa from tumor-free individuals, 1.2 in mucosa from cancerous bowels, 2.2 in adenomas, and 3.9 in carcinomas. Widespread methylation was found in both adenomas and carcinomas. The promoters of ADAMTS1, MAL, and MGMT were frequently methylated in benign samples as well as in malignant tumors, independent of microsatellite instability. In contrast, normal mucosa samples taken from bowels without tumor were rarely methylated for the same genes. Hypermethylated CRABP1, MLH1, NR3C1, RUNX3, and SCGB3A1 were shown to be identifiers of carcinomas with microsatellite instability. In agreement with the CIMP concept, MSI and mutated BRAF were associated with samples harboring hypermethylation of several target genes. Conclusion Methylated ADAMTS1, MGMT, and MAL are suitable as markers for early tumor detection.

  12. Systemic immune markers characterizing early stages of rheumatoid arthritis

    NARCIS (Netherlands)

    Chalan, Paulina Luiza

    2016-01-01

    Rheumatoid arthritis is a chronic autoimmune disease occurring in ~1% of the world population. The main feature of the disease is ongoing joint inflammation, caused by immune cells and their soluble factors, leading to irreversible bone erosions and cartilage damage. Early treatment can halt progres

  13. Secretome-based identification of ULBP2 as a novel serum marker for pancreatic cancer detection.

    Directory of Open Access Journals (Sweden)

    Ya-Ting Chang

    Full Text Available BACKGROUND: To discover novel markers for improving the efficacy of pancreatic cancer (PC diagnosis, the secretome of two PC cell lines (BxPC-3 and MIA PaCa-2 was profiled. UL16 binding protein 2 (ULBP2, one of the proteins identified in the PC cell secretome, was selected for evaluation as a biomarker for PC detection because its mRNA level was also found to be significantly elevated in PC tissues. METHODS: ULBP2 expression in PC tissues from 67 patients was studied by immunohistochemistry. ULBP2 serum levels in 154 PC patients and 142 healthy controls were measured by bead-based immunoassay, and the efficacy of serum ULBP2 for PC detection was compared with the widely used serological PC marker carbohydrate antigen 19-9 (CA 19-9. RESULTS: Immunohistochemical analyses revealed an elevated expression of ULPB2 in PC tissues compared with adjacent non-cancerous tissues. Meanwhile, the serum levels of ULBP2 among all PC patients (n = 154 and in early-stage cancer patients were significantly higher than those in healthy controls (p<0.0001. The combination of ULBP2 and CA 19-9 outperformed each marker alone in distinguishing PC patients from healthy individuals. Importantly, an analysis of the area under receiver operating characteristic curves showed that ULBP2 was superior to CA 19-9 in discriminating patients with early-stage PC from healthy controls. CONCLUSIONS: Collectively, our results indicate that ULBP2 may represent a novel and useful serum biomarker for pancreatic cancer primary screening.

  14. Validation of Candidate Serum Ovarian Cancer Biomarkers for Early Detection

    Directory of Open Access Journals (Sweden)

    Feng Su

    2007-01-01

    Full Text Available Objective: We have previously analyzed protein profi les using Surface Enhanced Laser Desorption and Ionization Time-Of-Flight Mass Spectroscopy (SELDI-TOF-MS [Kozak et al. 2003, Proc. Natl. Acad. Sci. U.S.A. 100:12343–8] and identified 3 differentially expressed serum proteins for the diagnosis of ovarian cancer (OC [Kozak et al. 2005, Proteomics, 5:4589–96], namely, apolipoprotein A-I (apoA-I, transthyretin (TTR and transferin (TF. The objective of the present study is to determine the efficacy of the three OC biomarkers for the detection of early stage (ES OC, in direct comparison to CA125.Methods: The levels of CA125, apoA-I, TTR and TF were measured in 392 serum samples [82 women with normal ovaries (N, 24 women with benign ovarian tumors (B, 85 women with ovarian tumors of low malignant potential (LMP, 126 women with early stage ovarian cancer (ESOC, and 75 women with late stage ovarian cancer (LSOC], obtained through the GOG and Cooperative Human Tissue Network. Following statistical analysis, multivariate regression models were built to evaluate the utility of the three OC markers in early detection.Results: Multiple logistic regression models (MLRM utilizing all biomarker values (CA125, TTR, TF and apoA-I from all histological subtypes (serous, mucinous, and endometrioid adenocarcinoma distinguished normal samples from LMP with 91% sensitivity (specifi city 92%, and normal samples from ESOC with a sensitivity of 89% (specifi city 92%. MLRM, utilizing values of all four markers from only the mucinous histological subtype showed that collectively, CA125, TTR, TF and apoA-I, were able to distinguish normal samples from mucinous LMP with 90% sensitivity, and further distinguished normal samples from early stage mucinous ovarian cancer with a sensitivity of 95%. In contrast, in serum samples from patients with mucinous tumors, CA125 alone was able to distinguish normal samples from LMP and early stage ovarian cancer with a sensitivity of

  15. Detection of Y STR markers of male fetal dna in maternal circulation

    Directory of Open Access Journals (Sweden)

    Nair Seema

    2007-01-01

    Full Text Available Background: Circulating fetal cells and cell free DNA in the maternal blood has been shown to help in prenatal diagnosis of genetic disorders without relying on invasive procedures leading to significant risk of pregnancy loss. Aim: The current study was undertaken to detect the male fetal population using Y STR markers DYS 19, DYS 385 and DYS 392 and also to study the extent of persistence of fetal DNA in the mother following delivery. Materials and Methods: Blinded study was conducted on 50 mothers delivering male and female babies. Cellular and cell free DNA was extracted from maternal and fetal cord blood and amplified for Y STR markers by PCR. Results: The amplification sensitivity of Y specific STR, DYS19 was 100% (22/22 in the male fetal DNA samples. The incidence of other STRs, i.e., DYS385 and DYS392 were 91% (20/22 each. Analysis of results revealed that thirteen of the twenty six women had detectable male fetal DNA at the time of delivery. However fetal DNA was not detectable twenty four hours after delivery. Conclusion: Preliminary results show that the separation of fetal cell-free DNA in the maternal circulation is a good low-cost approach for the future development of novel strategies to provide non-invasive techniques for early prenatal diagnosis.

  16. Early diagnostic markers of sepsis after oesophagectomy (including thromboelastography

    Directory of Open Access Journals (Sweden)

    Durila Miroslav

    2012-06-01

    Full Text Available Abstract Background Early diagnosis of sepsis and its differentiation from the noninfective SIRS is very important in order that treatment can be initiated in a timely and appropriate way. In this study we investigated standard haematological and biochemical parameters and thromboelastography (TEG in patients who had undergone surgical resection of the oesophagus to find out if changes in any of these parameters could help in early differentiation between SIRS and sepsis development. Methods We enrolled 43 patients (aged 41–74 years of whom 38 were evaluable. Blood samples were obtained on the morning of surgery and then at 24-hour intervals for the next 6 days. Samples were analysed for procalcitonin (PCT, C-reactive protein (CRP, interleukin-6 (IL- 6, aspartate transaminase (AST, alanine transaminase (ALT , lactate, white blood count (WBC, D-dimers, antithrombin (AT, international normalised ratio (INR, activated partial thromboplastin time (APTT and parameters of TEG. Results Significant differences between patients who developed sepsis during this period (9 patients and SIRS were found in ALT on Day 1, in AST on Days 1–4, in PCT on Days 2–6; in CRP on Days 3–6; in IL-6 on Days 2–5; in leucocytes on Days 2, 3 and 6; and in D-dimers on Days 2 and 4. Significance values ranged from p  Conclusions Sequential measurements of ALT, AST, PCT and IL-6 during the early postoperative period can be used for early differentiation of sepsis and postoperative SIRS after oesophagectomy. Among the coagulation parameters measured, only D-dimer concentrations appeared to be helpful in this process. TEG does not seem to be a useful early predictor of sepsis development; however it can be used to differentiate sepsis and SIRS from Day 5 after surgery.

  17. Auditory gap detection in the early blind.

    Science.gov (United States)

    Weaver, Kurt E; Stevens, Alexander A

    2006-01-01

    For blind individuals, audition provides critical information for interacting with the environment. Individuals blinded early in life (EB) typically show enhanced auditory abilities relative to sighted controls as measured by tasks requiring complex discrimination, attention and memory. In contrast, few deficits have been reported on tasks involving auditory sensory thresholds (e.g., Yates, J.T., Johnson, R.M., Starz, W.J., 1972. Loudness perception of the blind. Audiology 11(5), 368-376; Starlinger, I., Niemeyer, W., 1981. Do the blind hear better? Investigations on auditory processing in congenital or early acquired blindness. I. Peripheral functions. Audiology 20(6), 503-509). A study of gap detection stands at odds with this distinction [Muchnik, C., Efrati, M., Nemeth, E., Malin, M., Hildesheimer, M., 1991. Central auditory skills in blind and sighted subjects. Scand. Audiol. 20(1), 19-23]. In the current investigation we re-examined gap detection abilities in the EB using a single-interval, yes/no method. A group of younger sighted control individuals (SCy) was included in the analysis in addition to EB and sighted age matched control individuals (SCm) in order to examine the effect of age on gap detection performance. Estimates of gap detection thresholds for EB subjects were nearly identical to SCm subjects and slightly poorer relative to the SCy subjects. These results suggest some limits on the extent of auditory temporal advantages in the EB.

  18. Dermatoglyphics: A genetic marker of early childhood caries

    Directory of Open Access Journals (Sweden)

    C Anitha

    2014-01-01

    Full Text Available Background: It is an accepted fact that genetics plays an important role in determination of palmar dermatoglyphic patterns. Since caries is a multifactorial disease with the influence of genetic pattern, this study was undertaken to explore the possibility of dermatoglyphics as a noninvasive and early predictor of dental caries in children, so as to initiate preventive oral health measures at an early age. Materials and Methods: The study group comprised of 200 children aged between 4 and 5 years. The dmfs score was evaluated. The experimental group (Group 1, comprised of 100 children with early childhood caries (ECC with dmfs >5. The control group (Group 2 comprised of 100 children with dmfs score of 0. Results: An increased frequency of ulnar loops in caries-free children and whorls in children with ECC was observed. Low mean atd angle and low mean. Total ridge count was observed in the ECC group. Conclusion: There is definite variation in dermatoglyphics between the ECC and caries-free group, indicating that dermatoglyphic patterns can be used as a predictive tool for children with ECC.

  19. Genetic characterization of early maturing maize hybrids (Zea mays L. obtained by protein and RAPD markers

    Directory of Open Access Journals (Sweden)

    Bauer Iva

    2005-01-01

    Full Text Available Knowledge of maize germplasm genetic diversity is important for planning breeding programmes, germplasm conservation per se etc. Genetic variability of maize hybrids grown in the fields is also very important because genetic uniformity implies risks of genetic vulnerability to stress factors and can cause great losts in yield. Early maturing maize hybrids are characterized by shorter vegetation period and they are grown in areas with shorter vegetation season. Because of different climatic conditions in these areas lines and hybrids are developed with different features in respect to drought resistance and disease resistance. The objective of our study was to characterize set of early maturing maize hybrids with protein and RAPD markers and to compare this clasification with their pedigree information. RAPD markers gave significantly higher rate of polymorphism than protein markers. Better corelation was found among pedigree information and protein markers.

  20. Early inflammatory markers in elicitation of allergic contact dermatitis

    Directory of Open Access Journals (Sweden)

    Daraio María

    2002-08-01

    Full Text Available Abstract Background Allergic Contact Dermatitis (ACD is regarded as a T-cell-mediated delayed-type hypersensitivity reaction. We studied the kinetics of the expression of CS-1 fibronectin, thymus and activation-regulated chemokine (CCL17/ TARC and different chemokine receptors (CR in skin biopsies from individuals suffering from back problems, with the antigen responsible of their contact dermatitis and an irrelevant antigen. Methods Samples were taken at 2, 10, and 48 hours for histological and immunohistochemical studies using monoclonal antibodies against human CS-1 fibronectin, CCL17, CD3, CD68, CD49d, CXCR3, CCR5, and CCR3. Results At positive antigen stimulated sites there was an early expression of CS-1 fibronectin (2 hours, followed by CCL17 and a later accumulation of alplha4/beta1+ (CD49d, CD3+, CD68+, CXCR3+ and CCR5+ mononuclear cells. At 48 hours, approximately 59 % of infiltrating cells were CXCR3+, 42% CCR5+, and only 14 % CCR3+. Conclusions These results showed for the first time a very early expression of CS-1 fibronectin which preceded production of CCL17 in blood endothelial cells (BCEs from patients' skin with ACD. The role of these molecules in recruitment of monocytes and effector T cells in ACD is discussed.

  1. Early inflammatory markers are independent predictors of cardiac allograft vasculopathy in heart-transplant recipients.

    Directory of Open Access Journals (Sweden)

    Carlos A Labarrere

    Full Text Available BACKGROUND: Identification of risk is essential to prevent cardiac allograft vasculopathy (CAV and graft failure due to CAV (GFDCAV in heart transplant patients, which account for 30% of all deaths. Early CAV detection involves invasive, risky, and expensive monitoring approaches. We determined whether prediction of CAV and GFDCAV improves by adding inflammatory markers to a previously validated atherothrombotic (AT model. METHODS AND FINDINGS: AT and inflammatory markers interleukin-6 (IL-6 and C-reactive protein (CRP were measured in heart biopsies and sera of 172 patients followed prospectively for 8.9±5.0 years. Models were estimated for 5- and 10-year risk using (1 the first post-transplant biopsy only, or (2 all biopsies obtained within 3 months. Multivariate models were adjusted for other covariates and cross-validated by bootstrapping. After adding IL-6 and CRP to the AT models, we evaluated the significance of odds ratios (ORs associated with the additional inflammatory variables and the degree of improvement in the area under the receiver operating characteristic curve (AUROC. When inflammatory markers were tested alone in prediction models, CRP (not IL-6 was a significant predictor of CAV and GFDCAV at 5 (CAV: p<0.0001; GFDCAV: p = 0.005 and 10 years (CAV: p<0.0001; GFDCAV: p = 0.003. Adding CRP (not IL-6 to the best AT models improved discriminatory power to identify patients destined to develop CAV (using 1st biopsy: p<0.001 and p = 0.001; using all 3-month biopsies: p<0.04 and p = 0.008 at 5- and 10-years, respectively and GFDCAV (using 1st biopsy: 0.92 vs. 0.95 and 0.86 vs. 0.89; using all 3-month biopsies: 0.94 vs. 0.96 and 0.88 vs. 0.89 at 5- and 10-years, respectively, as indicated by an increase in AUROC. CONCLUSIONS: Early inflammatory status, measured by a patient's CRP level (a non-invasive, safe and inexpensive test, independently predicts CAV and GFDCAV. Adding CRP to a previously established AT model

  2. Early Inflammatory Markers Are Independent Predictors of Cardiac Allograft Vasculopathy in Heart-Transplant Recipients

    Science.gov (United States)

    Labarrere, Carlos A.; Woods, John R.; Hardin, James W.; Jaeger, Beate R.; Zembala, Marian; Deng, Mario C.; Kassab, Ghassan S.

    2014-01-01

    Background Identification of risk is essential to prevent cardiac allograft vasculopathy (CAV) and graft failure due to CAV (GFDCAV) in heart transplant patients, which account for 30% of all deaths. Early CAV detection involves invasive, risky, and expensive monitoring approaches. We determined whether prediction of CAV and GFDCAV improves by adding inflammatory markers to a previously validated atherothrombotic (AT) model. Methods and Findings AT and inflammatory markers interleukin-6 (IL-6) and C-reactive protein (CRP) were measured in heart biopsies and sera of 172 patients followed prospectively for 8.9±5.0 years. Models were estimated for 5- and 10-year risk using (1) the first post-transplant biopsy only, or (2) all biopsies obtained within 3 months. Multivariate models were adjusted for other covariates and cross-validated by bootstrapping. After adding IL-6 and CRP to the AT models, we evaluated the significance of odds ratios (ORs) associated with the additional inflammatory variables and the degree of improvement in the area under the receiver operating characteristic curve (AUROC). When inflammatory markers were tested alone in prediction models, CRP (not IL-6) was a significant predictor of CAV and GFDCAV at 5 (CAV: p<0.0001; GFDCAV: p = 0.005) and 10 years (CAV: p<0.0001; GFDCAV: p = 0.003). Adding CRP (not IL-6) to the best AT models improved discriminatory power to identify patients destined to develop CAV (using 1st biopsy: p<0.001 and p = 0.001; using all 3-month biopsies: p<0.04 and p = 0.008 at 5- and 10-years, respectively) and GFDCAV (using 1st biopsy: 0.92 vs. 0.95 and 0.86 vs. 0.89; using all 3-month biopsies: 0.94 vs. 0.96 and 0.88 vs. 0.89 at 5- and 10-years, respectively), as indicated by an increase in AUROC. Conclusions Early inflammatory status, measured by a patient's CRP level (a non-invasive, safe and inexpensive test), independently predicts CAV and GFDCAV. Adding CRP to a previously established AT model improves

  3. Sexually dimorphic gene expressions in eels: useful markers for early sex assessment in a conservation context

    Science.gov (United States)

    Geffroy, Benjamin; Guilbaud, Florian; Amilhat, Elsa; Beaulaton, Laurent; Vignon, Matthias; Huchet, Emmanuel; Rives, Jacques; Bobe, Julien; Fostier, Alexis; Guiguen, Yann; Bardonnet, Agnès

    2016-09-01

    Environmental sex determination (ESD) has been detected in a range of vertebrate reptile and fish species. Eels are characterized by an ESD that occurs relatively late, since sex cannot be histologically determined before individuals reach 28 cm. Because several eel species are at risk of extinction, assessing sex at the earliest stage is a crucial management issue. Based on preliminary results of RNA sequencing, we targeted genes susceptible to be differentially expressed between ovaries and testis at different stages of development. Using qPCR, we detected testis-specific expressions of dmrt1, amh, gsdf and pre-miR202 and ovary-specific expressions were obtained for zar1, zp3 and foxn5. We showed that gene expressions in the gonad of intersexual eels were quite similar to those of males, supporting the idea that intersexual eels represent a transitional stage towards testicular differentiation. To assess whether these genes would be effective early molecular markers, we sampled juvenile eels in two locations with highly skewed sex ratios. The combined expression of six of these genes allowed the discrimination of groups according to their potential future sex and thus this appears to be a useful tool to estimate sex ratios of undifferentiated juvenile eels.

  4. Allostatic Load Assessment for Early Detection of Stress in the Workplace in Egypt

    Directory of Open Access Journals (Sweden)

    Ola Sayed Ali

    2016-06-01

    CONCLUSION: Female gender and the old age of the Egyptian workforce under study are at higher risk of chronic diseases. Using an alternative way -for example, the cut-point method- instead of the risk quartiles for dichotomization of markers used in ALI calculation could be more precise for early detection of stress among healthy individuals.

  5. Emerging Ultrasound Technologies for Early Markers of Disease

    Directory of Open Access Journals (Sweden)

    Ernest J. Feleppa

    2002-01-01

    Full Text Available Ultrasound has been a popular clinical imaging modality for decades. It is well established as a means of displaying the macroscopic anatomy of soft-tissue structures. While conventional ultrasound methodologies (i.e., B-mode and Doppler methods are well proven and continue to advance technically on a daily basis, e.g. by extending into higher frequencies and taking advantage of harmonic phenomena in tissues, fundamentally new ultrasound technologies also are emerging and offer exciting promise for making significant improvements in the clinical imaging of disease. These emerging methods include spectrum analysis, elasticity imaging, contrast-agent methods, and advanced flow detection and measurement techniques. Each provides independent information and, used alone, each can provide powerful new imaging capabilities; combined with each other, their capabilities may be even greater in many applications; and all in principle can be used in concert with other imaging modalities to offer the possibility of further improvements in disease detection, evaluation, and monitoring.

  6. Immunosignaturing can detect products from molecular markers in brain cancer.

    Directory of Open Access Journals (Sweden)

    Alexa K Hughes

    Full Text Available Immunosignaturing shows promise as a general approach to diagnosis. It has been shown to detect immunological signs of infection early during the course of disease and to distinguish Alzheimer's disease from healthy controls. Here we test whether immunosignatures correspond to clinical classifications of disease using samples from people with brain tumors. Blood samples from patients undergoing craniotomies for therapeutically naïve brain tumors with diagnoses of astrocytoma (23 samples, Glioblastoma multiforme (22 samples, mixed oligodendroglioma/astrocytoma (16 samples, oligodendroglioma (18 samples, and 34 otherwise healthy controls were tested by immunosignature. Because samples were taken prior to adjuvant therapy, they are unlikely to be perturbed by non-cancer related affects. The immunosignaturing platform distinguished not only brain cancer from controls, but also pathologically important features about the tumor including type, grade, and the presence or absence of O(6-methyl-guanine-DNA methyltransferase methylation promoter (MGMT, an important biomarker that predicts response to temozolomide in Glioblastoma multiformae patients.

  7. Cytosolic Ca2+ shifts as early markers of cytotoxicity

    Science.gov (United States)

    2013-01-01

    The determination of the cytotoxic potential of new and so far unknown compounds as well as their metabolites is fundamental in risk assessment. A variety of strategic endpoints have been defined to describe toxin-cell interactions, leading to prediction of cell fate. They involve measurement of metabolic endpoints, bio-energetic parameters or morphological cell modifications. Here, we evaluated alterations of the free cytosolic Ca2+ homeostasis using the Fluo-4 dye and compared results with the metabolic cell viability assay Alamar Blue. We investigated a panel of toxins (As2O3, gossypol, H2O2, staurosporine, and titanium(IV)-salane complexes) in four different mammalian cell lines covering three different species (human, mouse, and African green monkey). All tested compounds induced an increase in free cytosolic Ca2+ within the first 5 s after toxin application. Cytosolic Ca2+ shifts occurred independently of the chemical structure in all tested cell systems and were persistent up to 3 h. The linear increase of free cytosolic Ca2+ within the first 5 s of drug treatment correlates with the EC25 and EC75 values obtained in Alamar Blue assays one day after toxin exposure. Moreover, a rise of cytosolic Ca2+ was detectable independent of induced cell death mode as assessed by caspase and poly(ADP-ribose) polymerase (PARP) activity in HeLa versus MCF-7 cells at very low concentrations. In conclusion, a cytotoxicity assay based on Ca2+ shifts has a low limit of detection (LOD), is less time consuming (at least 24 times faster) compared to the cell viability assay Alamar Blue and is suitable for high-troughput-screening (HTS). PMID:23384168

  8. OCT4 and SOX2 are reliable markers in detecting stem cells in odontogenic lesions

    Directory of Open Access Journals (Sweden)

    Abhishek Banerjee

    2016-01-01

    Full Text Available Context (Background: Stem cells are a unique subpopulation of cells in the human body with a capacity to initiate differentiation into various cell lines. Tumor stem cells (TSCs are a unique subpopulation of cells that possess the ability to initiate a neoplasm and sustain self-renewal. Epithelial stem cell (ESC markers such as octamer-binding transcription factor 4 (OCT4 and sex-determining region Y (SRY-box 2 (SOX2 are capable of identifying these stem cells expressed during the early stages of tooth development. Aims: To detect the expression of the stem cell markers OCT4 and SOX2 in the normal odontogenic tissues and the odontogenic cysts and tumors. Materials and Methods: Paraffin sections of follicular tissue, radicular cyst, dentigerous cyst, odontogenic keratocyst, ameloblastoma, adenomatoid odontogenic tumor, and ameloblastic carcinoma were obtained from the archives. The sections were subjected to immunohistochemical assay by the use of mouse monoclonal antibodies to OCT4 and SOX2. Statistical Analysis: The results were evaluated by descriptive analysis. Results: The results show the presence of stem cells in the normal and lesional tissues with these stem cell identifying markers. SOX2 was found to be more consistent and reliable in the detection of stem cells. Conclusion: The stem cell expressions are maintained in the tumor transformation of tissue and probably suggest that there is no phenotypic change of stem cells in progression from normal embryonic state to its tumor component. The quantification and localization reveals interesting trends that indicate the probable role of the cells in the pathogenesis of the lesions.

  9. Early detection and treatment of Speckled leukoplakia

    Directory of Open Access Journals (Sweden)

    Selviana Tampoma

    2016-12-01

    Full Text Available Background: Leukoplakia is one of potentially malignant disorders that can be found on oral mucosa. Speckled leukoplakia is a rare type of leukoplakia with a very high risk of premalignant growth. Approximately 3 % of worldwide population has suffered from leukoplakia, 5-25% of which tend to be malignant leukoplakia. Purpose: This case report was aimed to discuss about early detection of speckled leukoplakia as one of potentially malignant disorders. Case: A 62 year old male patient came with chief complaint of bald and painful tongue since one month ago. The patient has a history of allergic reaction, hypertension, uric acid, and hepatitis B. He had been a heavy smoker since young until 10 years ago. Intra oral examination showed a firm, rough, non scrapable white plaque lesion with a size of 1 x 1.5 cm, surrounded by painful erosion with diffuse boundary. Case Management: Based on cytology examination, the patient was reffered to oncologist to get an excisional biopsy. Next, the patient succesfully underwent the excisional biopsy and came for control. The results showed the healing process of the lesion with a minimal complaint of bald tongue, especially when eating spicy or hot meal. To improve healing process, the patient then was given an antibacterial mouth rinse containing zinc and mulvitamin. Conclusion: Speckled leukoplakia could show high malignant transformation rate, therefore, early detection and treatment are necessary.

  10. Malignant external otitis: early scintigraphic detection

    Energy Technology Data Exchange (ETDEWEB)

    Strashun, A.M.; Nejatheim, M.; Goldsmith, S.J.

    1984-02-01

    Pseudomonas otitis externa in elderly diabetics may extend aggressively to adjacent bone, cranial nerves, meninges, and vessels, leading to a clinical diagnosis of ''malignant'' external otitis. Early diagnosis is necessary for successful treatment. This study compares the findings of initial radiographs, thin-section tomography of temporal bone, CT scans of head and neck, technetium-99m methylene diphosphonate (MDP) and gallium-67 citrate scintigraphy, and single-photon emission computed tomography (SPECT) for detection of temporal bone osteomylitis in ten patients fulfilling the clinical diagnostic criteria of malignant external otitis. Skull radiographs were negative in all of the eight patients studied. Thin-section tomography was positive in one of the seven patients studied using this modality. CT scanning suggested osteomyelitis in three of nine patients. Both Tc-99m and Ga-67 citrate scintigraphy were positive in 10 of 10 patients. These results suggest that technetium and gallium scintigraphy are more sensitive than radiographs and CT scans for early detection of malignant external otitis.

  11. The clinical value of serum tumor markers combined dynamic detection in early diagnosis and monitoring treatment of lung cancer%血清肿瘤标记物联合动态检测在肺癌早期诊断和监控治疗中的临床价值

    Institute of Scientific and Technical Information of China (English)

    邹见刚; 王笑峰

    2016-01-01

    测比较差异有统计学意义(均<0.01)。结论:血清肿瘤标记物CA50、CEA、Scc- Ag、CYFRA21-1、PTN、NSE联合动态检测可作为肺癌早期诊断的辅助手段及疾病复发转移和治疗有效性的监控指标,有利于临床早期诊断、指导治疗、判断预后。%Objective: To investigate the clinical application value of serum tumor marker carbohydrate antigen CA50, carci-noembryonic antigen (CEA), squamous cell carcinoma antigen (Scc- Ag), antigen of cytokeratin 19 fragment (CYFRA21- 1), people multi- effect PTN protein and neuron specific enolization enzyme NSE joint dynamic testing in the early diagnosis and monitoring of lung cancer. Methods: Serum tumor marker levels of CA50、 CEA、 Scc- Ag、 CYFRA21- 1、 PTN、 NSE were measured with electrochemiluminescence and ELISA respectively in 201 patients with lung cancer and 50 patients with lung benign lesions and 50 cases of healthy physical examination. Retrospective statistical methods were used to analyze the correlation of the serum tumor mark-ers and benign and malignant lung disease, and futher to explore the early diagnosis and monitoring clinical value in lung cancer by serum tumor markers joint dynamic detection treatment. Results:(1)Serum CA50, CEA, Scc- Ag, CYFRA21- 1, PTN, NSE levels in lung cancer group were significantly higher than the group of lung benign disease and normal control ( 0.05), but all were significantly related with tumor size, clinical stage, histological type, recurrence and metasasis, combining pleural effusion and post treatment(all <0.01); (3)Serum CA50 and CEA had higher expression levels and positive detec-tion rate in lung adenocarcinoma patients; Scc- Ag and CYFRA21- 1 had higher serum expression levels and positive detection rate in lung squamous carcinoma patients; PTN and NSE had higher serum expression levels and positive detection rate in small cell lung cancer patients (all <0.01) ; (4) The sensitivity of CA50, CEA, Scc Ag

  12. Membrane-based oligonucleotide array developed from multiple markers for the detection of many Phytophthora species.

    Science.gov (United States)

    Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André

    2013-01-01

    Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.

  13. Case Series: Fetal Pulmonary Vein A-Wave Reversal: An Early Marker of Left-Sided Cardiac Anomalies?

    Directory of Open Access Journals (Sweden)

    Aldo L. Schenone

    2015-04-01

    Full Text Available Background - Improvements in congenital heart disease (CHD screening are needed based on the lack of sensitivity of current screening methods and the understanding that the early detection of certain CHDs may improve outcomes. Fetal venous circulation has caught medical attention, and two studies demonstrated that it is feasible to register pulmonary vein flow velocity waveforms (FVWs during early gestation. Meanwhile, the latter study proposed pulmonary vein A-wave reversal as a marker of cardiac anomaly. Methods - We report a series of six consecutive fetuses with confirmed cardiac anomalies that underwent first-trimester screening, including pulmonary vein FVWs, at our center during 2013. CHD was confirmed by late pregnancy echocardiography, and in three cases fetal autopsies were performed. Result/Discussion - The ductus venosus (DV and nuchal translucency (NT predicted 50% of CHD cases, whereas the combination of markers identified 66.6% of CHD cases. When adding pulmonary vein assessment, the rate of detection rose to 83.3%. Total five of six cases of CHD had reversal of pulmonary vein A-wave during early pregnancy. The sixth case with CHD and nonreversal of A-wave was described as right ventricle hypoplasia with type 1 tricuspid atresia and persistent ductus arteriosus. Conclusion This is the first series reporting pulmonary vein end-diastolic reversal as a CHD screening add-on during early pregnancy. The addition of pulmonary vein FVW assessment to the current CHD screening bundle could increase the rate detection of cardiac anomalies. This pilot study suggests that pulmonary vein end-diastolic flow reversal favors detection of left-sided CHD over the right-sided ones.

  14. Computer-aided-detection marker value and breast density in the detection of invasive lobular carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Destounis, Stamatia; Hanson, Sarah [The Elizabeth Wende Breast Clinic, Rochester, NY (United States); Roehrig, Jimmy [R2/Hologic, Inc., Santa Clara, CA (United States)

    2007-08-15

    Invasive Lobular Carcinoma (ILC) is frequently a mammographic and diagnostic dilemma; thus any additional information that CAD (Computer-Aided Detection) systems can give radiologists may be helpful. Our study was to evaluate the role of CAD numeric values as indicators of malignancy and the effect of breast density in the diagnosis of ILC. Eighty consecutive biopsy-proven ILC cases with CAD (ImageChecker {sup registered}, Hologic vertical stroke R2, Santa Clara, CA, versions 2.3, 3.1, 3.2, 5.0, 5.2) diagnosed between June 2002 and December 2004 were retrospectively reviewed. Data included: BIRADS {sup registered} breast density, whether CAD marked the cancer at diagnosis year or years prior, and lesion type. Study mammograms underwent additional CAD scans (Image Checker {sup registered} V5.3, V8.0, V8.1) to obtain a numeric value associated with each marker, low values represent increasingly suspicious features. CAD correctly marked 65% (52/80) of ILC cases, detection was found to decrease with increased breast density. Numeric values of CAD marks at sites of carcinoma showed median score of 171 (range 0 - 1121). The CAD marker may potentially be used as an additional indicator of suspicious lesion features in all breast densities and higher likelihood that an area on the mammogram requires further investigation. (orig.)

  15. Common Raman Spectral Markers among Different Tissues for Cancer Detection

    Directory of Open Access Journals (Sweden)

    Zohreh Dehghani-Bidgoli

    2014-11-01

    Full Text Available Introduction Raman spectroscopy is a vibrational spectroscopic technique, based on inelastic scattering of monochromatic light. This technique can provide valuable information about biomolecular changes, associated with neoplastic transformation. The purpose of this study was to find Raman spectral markers for distinguishing normal samples from cancerous ones in different tissues. Materials and Methods Ten tissue samples from the breast, colon, pancreas, and thyroid were collected. A Raman system was used for Raman spectroscopic measurement of tissues at 532 nm laser excitation. Five to six Raman spectra were acquired from each sample (a total of 52 spectra. Raman spectra were investigated in important bands associated with Amid1, CH2 (scissoring, Amid3, d(NH, n(C-C, and das (CH3 in both normal and cancerous groups. In addition, common spectral markers, which discriminated between normal and cancerous samples in the above tissues, were investigated. Results Common spectral markers among different tissues included intensities of Amid3 and CH2 (scissoring and intensity ratios of I(Amid1/I(CH2, I(n(C-C/I(CH2, and I(d(NH/I(CH2. This study showed that Amid1-, n(C-C-, and d(NH-to-CH2 intensity ratios can discriminate between normal and cancerous samples, with an accuracy of 84.6%, 82.7%, and 82.7% in all studied tissues, respectively. Conclusion This study demonstrates the presence of common spectral markers, associated with neoplastic changes, among different tissues.

  16. Fiducial Marker Detection and Pose Estimation From LIDAR Range Data

    Science.gov (United States)

    2010-03-01

    Markers .................................................26 E. APPLICATIONS OF 3D POINT CLOUDS ................................................27 F...in the environment and produces 3D coordinates or range and bearing values. The raw data can be easily represented by point clouds , with each point...registration and pose estimation include cylinders, spheres, and orthogonal planes (Gao, 2007; Haas, 2005). E. APPLICATIONS OF LIDAR 3D POINT CLOUDS Robotics

  17. The early markers for later dyskinetic cerebral palsy are different from those for spastic cerebral palsy

    NARCIS (Netherlands)

    Einspieler, C; Cioni, G; Paolicelli, PB; Bos, AF; Dressler, A; Ferrari, F; Roversi, MF; Prechtl, HFR

    2002-01-01

    Qualitative abnormalities of spontaneous motor activity in new-borns and young infants are early predictive markers for later spastic cerebral palsy. Aim of this research was to identify which motor patterns may be specific for later dyskinetic cerebral palsy. In a large, prospectively performed lon

  18. The early markers for later dyskinetic cerebral palsy are different from those for spastic cerebral palsy

    NARCIS (Netherlands)

    Einspieler, C; Cioni, G; Paolicelli, PB; Bos, AF; Dressler, A; Ferrari, F; Roversi, MF; Prechtl, HFR

    Qualitative abnormalities of spontaneous motor activity in new-borns and young infants are early predictive markers for later spastic cerebral palsy. Aim of this research was to identify which motor patterns may be specific for later dyskinetic cerebral palsy. In a large, prospectively performed

  19. Metabolomics profiling for identification of novel potential markers in early prediction of preeclampsia.

    Directory of Open Access Journals (Sweden)

    Sylwia Kuc

    Full Text Available OBJECTIVE: The first aim was to investigate specific signature patterns of metabolites that are significantly altered in first-trimester serum of women who subsequently developed preeclampsia (PE compared to healthy pregnancies. The second aim of this study was to examine the predictive performance of the selected metabolites for both early onset [EO-PE] and late onset PE [LO-PE]. METHODS: This was a case-control study of maternal serum samples collected between 8+0 and 13+6 weeks of gestation from 167 women who subsequently developed EO-PE n = 68; LO-PE n = 99 and 500 controls with uncomplicated pregnancies. Metabolomics profiling analysis was performed using two methods. One has been optimized to target eicosanoids/oxylipins, which are known inflammation markers and the other targets compounds containing a primary or secondary biogenic amine group. Logistic regression analyses were performed to predict the development of PE using metabolites alone and in combination with first trimester mean arterial pressure (MAP measurements. RESULTS: Two metabolites were significantly different between EO-PE and controls (taurine and asparagine and one in case of LO-PE (glycylglycine. Taurine appeared the most discriminative biomarker and in combination with MAP predicted EO-PE with a detection rate (DR of 55%, at a false-positive rate (FPR of 10%. CONCLUSION: Our findings suggest a potential role of taurine in both PE pathophysiology and first trimester screening for EO-PE.

  20. Metabolomics Profiling for Identification of Novel Potential Markers in Early Prediction of Preeclampsia

    Science.gov (United States)

    Kuc, Sylwia; Koster, Maria P. H.; Pennings, Jeroen L. A.; Hankemeier, Thomas; Berger, Ruud; Harms, Amy C.; Dane, Adrie D.; Schielen, Peter C. J. I.; Visser, Gerard H. A.; Vreeken, Rob J.

    2014-01-01

    Objective The first aim was to investigate specific signature patterns of metabolites that are significantly altered in first-trimester serum of women who subsequently developed preeclampsia (PE) compared to healthy pregnancies. The second aim of this study was to examine the predictive performance of the selected metabolites for both early onset [EO-PE] and late onset PE [LO-PE]. Methods This was a case-control study of maternal serum samples collected between 8+0 and 13+6 weeks of gestation from 167 women who subsequently developed EO-PE n = 68; LO-PE n = 99 and 500 controls with uncomplicated pregnancies. Metabolomics profiling analysis was performed using two methods. One has been optimized to target eicosanoids/oxylipins, which are known inflammation markers and the other targets compounds containing a primary or secondary biogenic amine group. Logistic regression analyses were performed to predict the development of PE using metabolites alone and in combination with first trimester mean arterial pressure (MAP) measurements. Results Two metabolites were significantly different between EO-PE and controls (taurine and asparagine) and one in case of LO-PE (glycylglycine). Taurine appeared the most discriminative biomarker and in combination with MAP predicted EO-PE with a detection rate (DR) of 55%, at a false-positive rate (FPR) of 10%. Conclusion Our findings suggest a potential role of taurine in both PE pathophysiology and first trimester screening for EO-PE. PMID:24873829

  1. Evaluation of Early Markers of Nephropathy in Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Pierina De Muro

    2016-01-01

    Full Text Available Aims. T2DM often remains undiagnosed for many years because hyperglycemia develops gradually and may not produce any symptoms. As patients with T2DM are at increased risk of microvascular and macrovascular complications, the preclinical diagnosis of the state is the key point of the disease management. Methods. We evaluated parameters such as GAGs/PGs, NAG, and NGAL in urine samples from 43 normoalbuminuric T2DM patients and 31 apparently healthy control subjects. Results. The total urinary GAG excretion showed no significant differences between patients and controls. The electrophoretic analysis evidenced the presence of UTI and its degradation products (LSC and SM-LSC, CS, and HS. We observed modifications of HS and total UTI (including UTI and its degradation products relative contents in T2DM patients compared with controls whereas no differences in CS percentage were found. NGAL levels were significantly increased in T2DM patients and were positively correlated with both NAG (r=0.606, p<0.0001 and the presence of hypertension (r=0.352, p<0.05. Conclusions. These data suggest that the assessed molecules could represent useful markers to detect early renal impairment in patients with T2DM.

  2. Screening and early detection of lung cancer.

    Science.gov (United States)

    Van't Westeinde, Susan C; van Klaveren, Rob J

    2011-01-01

    Lung cancer with an estimated 342,000 deaths in 2008 (20% of total) is the most common cause of death from cancer, followed by colorectal cancer (12%), breast cancer (8%), and stomach cancer (7%) in Europe. In former smokers, the absolute lung cancer risk remains higher than in never-smokers; these data therefore call for effective secondary preventive measures for lung cancer in addition to smoking cessation programs. This review presents and discusses the most recent advances in the early detection and screening of lung cancer.An overview of randomized controlled computerized tomography-screening trials is given, and the role of bronchoscopy and new techniques is discussed. Finally, the approach of (noninvasive) biomarker testing in the blood, exhaled breath, sputum, and bronchoscopic specimen is reviewed.

  3. Detection of Autophagy in Caenorhabditis elegans Using GFP::LGG-1 as an Autophagy Marker.

    Science.gov (United States)

    Palmisano, Nicholas J; Meléndez, Alicia

    2016-01-04

    In yeast and mammalian cells, the autophagy protein Atg8/LC3 (microtubule-associated proteins 1A/1B light chain 3B encoded by MAP1LC3B) has been the marker of choice to detect double-membraned autophagosomes that are produced during the process of autophagy. A lipid-conjugated form of Atg8/LC3B is localized to the inner and outer membrane of the early-forming structure known as the phagophore. During maturation of autophagosomes, Atg8/LC3 bound to the inner autophagosome membrane remains in situ as the autophagosomes fuse with lysosomes. The nematode Caenorhabditis elegans is thought to conduct a similar process, meaning that tagging the nematode ortholog of Atg8/LC3-known as LGG-1-with a fluorophore has become a widely accepted method to visualize autophagosomes. Under normal growth conditions, GFP-modified LGG-1 displays a diffuse expression pattern throughout a variety of tissues, whereas, when under conditions that induce autophagy, the GFP::LGG-1 tag labels positive punctate structures, and its overall level of expression increases. Here, we present a protocol for using fluorescent reporters of LGG-1 coupled to GFP to monitor autophagosomes in vivo. We also discuss the use of alternative fluorescent markers and the possible utility of the LGG-1 paralog LGG-2.

  4. XIAP as a prognostic marker of early recurrence of nonmuscular invasive bladder cancer

    Institute of Scientific and Technical Information of China (English)

    LI Ming; SONG Tao; YIN Zhen-fei; NA Yan-qun

    2007-01-01

    Background Dysregulation of apoptosis has been implicated not only in carcinogenesis and tumor progression but also in tumor recurrence. We investigated whether the expression of X-linked inhibitor of apoptosis (XIAP) might predict early recurrence in patients with non-muscular invasive bladder cancer.Methods The cohort comprised 176 consecutive patients with primary superficial bladder cancer treated with transurethral resection. Immunohistochemical staining using the standard avidin-biotin-peroxidase technique and RT-PCR were used to detect XIAP protein and mRNA expressions in cancer tissues. The relationship between XIAP expression and clinicopathological characteristics, cancer recurrence were analyzed.Results XIAP expression was observed in 108 cases (61.4%) and no expression in 68. There was no correlation between XIAP expression rate and the tumor pathological grade, but was an apparent trend toward the increased XIAP levels from well (G1) to poor (G3) differentiated cancer. Eighty-two (46.6%) patients experienced tumor recurrence at a mean of 28.6 months of the follow-up; 66 of them expressed XIAP (61.1%) and 16 were XIAP negative (23.5%). Twelve patients presented with invasive disease at the time of relapse and all of them expressed XIAP. Patients without XIAP expression or with low tumor grades had significantly higher recurrence-free survival than those with XIAP expression(log rank test P=0.0015) or high tumor grades (log rank test P<0.001). Multivariate analysis revealed that XIAP expression, tumor grade, and tumor number were independent predictors for the recurrence of non-muscular invasive bladder cancer (P=-0.004, 0.016, and 0.043, respectively).Conclusions XIAP may be considered as a new independent prognostic marker for early recurrence of non-muscular invasive bladder cancer.

  5. Clinical diagnostic value of Molybdenum Target X-ray combined with four Serum tumor markers in the detection of Mastocarcinoma

    Institute of Scientific and Technical Information of China (English)

    Ding-Hua Xu; Chun-Xian Cai; Guang-Xue Huang

    2015-01-01

    Objective: To explore the clinical diagnostic value of Molybdenum Target X-ray combined with serum CA15-3, CA125, CEA and CYFRA21-1 tumor markers in the detection of Mastocarcinoma. Method:90 cases confirmed by surgery pathology diagnosis according to the diagnosis of breast nodules disease patients were divided into benign tumor group (n=32) and breast cancer group (n=58), all patients were with preoperative line of molybdenum target X-ray radiography examination; Another group chose healthy women of our hospital for check-up in 56 cases as the control group, electrochemiluminescence immunoassay detection of three groups of participants were four kinds of serum tumor markers level, evaluation of single and combined testing the sensitivity of the diagnosis of breast cancer, specific degree, positive predictive value and negative predictive value. Results: CA15-3, CA125, CEA and CYFRA21-1 in breast cancer group were significantly higher than that of the control group and benign tumor group, the difference was statistically significant (all P0.05); Molybdenum target X-ray slice of the sensitivity of the diagnosis of breast cancer was higher, but the specific degree was low, and lower the sensitivity of the serum tumor markers in the diagnosis of breast cancer, the specific degree was higher, the molybdenum target X-ray slice joint the sensitivity of the four tumor markers in the diagnosis of breast cancer was 89.66%, 78.13%. Conclusions: The combined Mastocarcinoma detection of Molybdenum Target X-ray with serum CA15-3, CA125, CEA and CYFRA21-1 tumor markers can improve the detective rate and plays an important role in Mastocarcinoma early detection.

  6. Quantum-dot-tagged photonic crystal beads for multiplex detection of tumor markers.

    Science.gov (United States)

    Li, Juan; Wang, Huan; Dong, Shujun; Zhu, Peizhi; Diao, Guowang; Yang, Zhanjun

    2014-12-04

    Novel quantum-dot-tagged photonic crystal beads were fabricated for multiplex detection of tumor markers via self-assembly of quantum dot-embedded polystyrene nanospheres into photonic crystal beads through a microfluidic device.

  7. Methylation markers of early-stage non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Kaie Lokk

    Full Text Available BACKGROUND: Despite of intense research in early cancer detection, there is a lack of biomarkers for the reliable detection of malignant tumors, including non-small cell lung cancer (NSCLC. DNA methylation changes are common and relatively stable in various types of cancers, and may be used as diagnostic or prognostic biomarkers. METHODS: We performed DNA methylation profiling of samples from 48 patients with stage I NSCLC and 18 matching cancer-free lung samples using microarrays that cover the promoter regions of more than 14,500 genes. We correlated DNA methylation changes with gene expression levels and performed survival analysis. RESULTS: We observed hypermethylation of 496 CpGs in 379 genes and hypomethylation of 373 CpGs in 335 genes in NSCLC. Compared to adenocarcinoma samples, squamous cell carcinoma samples had 263 CpGs in 223 hypermethylated genes and 513 CpGs in 436 hypomethylated genes. 378 of 869 (43.5% CpG sites discriminating the NSCLC and control samples showed an inverse correlation between CpG site methylation and gene expression levels. As a result of a survival analysis, we found 10 CpGs in 10 genes, in which the methylation level differs in different survival groups. CONCLUSIONS: We have identified a set of genes with altered methylation in NSCLC and found that a minority of them showed an inverse correlation with gene expression levels. We also found a set of genes that associated with the survival of the patients. These newly-identified marker candidates for the molecular screening of NSCLC will need further analysis in order to determine their clinical utility.

  8. Nanotechnology Method Comparison for Early Detection of Cancer

    Directory of Open Access Journals (Sweden)

    Wamakshi Bhati

    2013-02-01

    Full Text Available Since 1999, cancer has been the leading cause of death under the age of 85 years and the eradication of this disease has been the long sought-after goal of scientists and physicians. Cancer is a disease in which abnormal cells divide uncontrollably. These abnormal cells have the ability to invade and destroy normal body cells, which is life threatening. One of the most important factors in effective cancer treatment is the detection of cancerous tumour cells in an early stage. Nanotechnology brings new hope to the arena of cancer detection research, owing to nanoparticles’ unique physical and chemical properties, giving them the potential to be used in the detection and monitoring of cancer. One such approach is quantum dots based detection which is rapid, easy and economical enabling quick point-of-care screening of cancer markers. QDs have got unique properties which make them ideal for detecting tumours. On the other hand, Gold nanoparticles have been in the bio-imaging spotlight due to their special optical properties. Au-NPs with strong surface-plasmon-enhanced absorption and scattering have allowed them to emerge as powerful imaging labels and contrast agents. This paper includes the comparative study of both the methods. Compared with quantum dots, the gold-nanoparticles are more than 200 times brighter on a particle-to-particle basis, although they are about 60 times larger by volume. Thus, Gold nanoparticles in suspension, offers advantages compared with quantum dots in that the gold appears to be non-toxic and the particles produce a brighter, sharper signal.

  9. Development of a Multiantigen Panel for Improved Detection of Borrelia burgdorferi Infection in Early Lyme Disease.

    Science.gov (United States)

    Lahey, Lauren J; Panas, Michael W; Mao, Rong; Delanoy, Michelle; Flanagan, John J; Binder, Steven R; Rebman, Alison W; Montoya, Jose G; Soloski, Mark J; Steere, Allen C; Dattwyler, Raymond J; Arnaboldi, Paul M; Aucott, John N; Robinson, William H

    2015-12-01

    The current standard for laboratory diagnosis of Lyme disease in the United States is serologic detection of antibodies against Borrelia burgdorferi. The Centers for Disease Control and Prevention recommends a two-tiered testing algorithm; however, this scheme has limited sensitivity for detecting early Lyme disease. Thus, there is a need to improve diagnostics for Lyme disease at the early stage, when antibiotic treatment is highly efficacious. We examined novel and established antigen markers to develop a multiplex panel that identifies early infection using the combined sensitivity of multiple markers while simultaneously maintaining high specificity by requiring positive results for two markers to designate a positive test. Ten markers were selected from our initial analysis of 62 B. burgdorferi surface proteins and synthetic peptides by assessing binding of IgG and IgM to each in a training set of Lyme disease patient samples and controls. In a validation set, this 10-antigen panel identified a higher proportion of early-Lyme-disease patients as positive at the baseline or posttreatment visit than two-tiered testing (87.5% and 67.5%, respectively; P Lyme disease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Identification of Catechol as a New Marker for Detecting Propolis Adulteration

    Directory of Open Access Journals (Sweden)

    Shuai Huang

    2014-07-01

    Full Text Available Adulteration of propolis with poplar extract is a serious issue in the bee products market. The aim of this study was to identify marker compounds in adulterated propolis, and examine the transformation of chemical components from poplar buds to propolis. The chemical profiles of poplar extracts and propolis were compared, and a new marker compound, catechol, was isolated and identified from the extracts of poplar buds. The polyphenol oxidase, catechol oxidase, responsible for catalyzing oxidation of catechol was detected in poplar buds and propolis. The results indicate catechol can be used as a marker to detect propolis adulterated with poplar extract.

  11. Early detection and monitoring of Malaria

    Science.gov (United States)

    Rahman, Md Z.; Roytman, Leonid; Kadik, Abdelhamid; Miller, Howard; Rosy, Dilara A.

    2015-05-01

    Global Earth Observation Systems of Systems (GEOSS) are bringing vital societal benefits to people around the globe. In this research article, we engage undergraduate students in the exciting area of space exploration to improve the health of millions of people globally. The goal of the proposed research is to place students in a learning environment where they will develop their problem solving skills in the context of a world crisis (e.g., malaria). Malaria remains one of the greatest threats to public health, particularly in developing countries. The World Health Organization has estimated that over one million die of Malaria each year, with more than 80% of these found in Sub-Saharan Africa. The mosquitoes transmit malaria. They breed in the areas of shallow surface water that are suitable to the mosquito and parasite development. These environmental factors can be detected with satellite imagery, which provide high spatial and temporal coverage of the earth's surface. We investigate on moisture, thermal and vegetation stress indicators developed from NOAA operational environmental satellite data. Using these indicators and collected epidemiological data, it is possible to produce a forecast system that can predict the risk of malaria for a particular geographical area with up to four months lead time. This valuable lead time information provides an opportunity for decision makers to deploy the necessary preventive measures (spraying, treated net distribution, storing medications and etc) in threatened areas with maximum effectiveness. The main objective of the proposed research is to study the effect of ecology on human health and application of NOAA satellite data for early detection of malaria.

  12. Biomarkers for Early Detection of Malignant Mesothelioma: Diagnostic and Therapeutic Application

    Directory of Open Access Journals (Sweden)

    Marco Tomasetti

    2010-04-01

    Full Text Available Malignant mesothelioma (MM is a rare and aggressive tumour of the serosal cavities linked to asbestos exposure. Improved detection methods for diagnosing this type of neoplastic disease are essential for an early and reliable diagnosis and treatment. Thus, focus has been placed on finding tumour markers for the non-invasive detection of MM. Recently, some blood biomarkers have been described as potential indicators of early and advanced MM cancers. The identification of tumour biomarkers alone or in combination could greatly facilitate the surveillance procedure for cohorts of subjects exposed to asbestos, a common phenomenon in several areas of western countries.

  13. The detection of a precartilage, blastema-specific marker.

    Science.gov (United States)

    Aulthouse, A L; Solursh, M

    1987-04-01

    Mesenchymal cell aggregates, termed blastema in vivo, precede cartilage differentiation in vivo and in high-density cell cultures. The galactose specific lectin, peanut agglutinin (PNA), has been shown to be blastema specific (B. Zimmermann and M. Thies, 1984, Histochemistry 81, 353-361). PNA appears to be a marker for precartilage cellular aggregates both in vivo and in vitro. Frozen sections of stage 24 chick wing buds were double stained with PNA-rhodamine and by indirect immunofluorescence with antibody directed against type II collagen. The PNA stained the humeral blastema intensely and extended distal to the level of type II collagen. High-density cultures of stage 24 chick wing buds were also evaluated for the distribution of PNA binding. Sixteen-hour cultures showed the earliest consistent appearance of PNA binding. The PNA-stained areas coincided with hematoxylin-stained cell aggregates. PNA staining was inhibited by 50 mM D(+)-galactose and was not sensitive to 1% testicular hyaluronidase pretreatment. No Alcian blue-staining nodules were present yet at 16 hr. The presence of a precartilage, blastema-specific marker in situ, as well as in precartilage aggregates in cultures, suggests the similarities in chondrogenesis between these two conditions. Stage 19 limb bud cultures did not form nodules but did form aggregates that were PNA positive. Furthermore, single cells that differentiated into chondrocytes on collagen gels or after cytochalasin D treatment lacked PNA-binding material. These results suggest that this material is specific to precartilage aggregates. The PNA-positive material was extracellular in distribution and was removed after brief extraction with 0.5 M guanidine hydrochloride.

  14. Early detection of first-episode psychosis

    DEFF Research Database (Denmark)

    Larsen, Tor K; Melle, Ingrid; Auestad, Bjørn

    2006-01-01

    Early intervention is assumed to improve outcome in first-episode psychosis, but this has not been proven.......Early intervention is assumed to improve outcome in first-episode psychosis, but this has not been proven....

  15. The Usefulness of Biological and Neuroimaging Markers for the Diagnosis of Early-Onset Alzheimer's Disease

    Directory of Open Access Journals (Sweden)

    Alessandro Padovani

    2011-01-01

    Full Text Available The recent proposed criteria for Alzheimer's Disease (AD have strongly claimed the usefulness of biological and neuroimaging markers for early identification AD. Cerebrospinal fluid (CSF Tau/Abeta ratio, hippocampal atrophy, posterior cingulate, and neocortical associative area hypometabolism, or amyloid burden evaluated by PiB compound, held the premises to increase diagnostic accuracy in the preclinical disease stages. Despite many efforts to identify subjects at risk of developing AD, less attention has been paid to presenile AD diagnosis. A few data are already available in early onset AD, mainly obtained in cases of monogenic disorder. In this paper, we discuss the current literature on the role of biological and neuroimaging markers in presenile AD.

  16. A novel carbohydrate antigen expression during development of Opisthorchis viverrini- associated cholangiocarcinoma in golden hamster: a potential marker for early diagnosis.

    Science.gov (United States)

    Sawanyawisuth, Kanlayanee; Silsirivanit, Atit; Kunlabut, Kunlathida; Tantapotinan, Nattawat; Vaeteewoottacharn, Kulthida; Wongkham, Sopit

    2012-03-01

    Poor prognosis of cholangiocarcinoma (CCA) is primarily due to delayed diagnosis because of the lack of appropriate tumor marker(s) to detect cancer development at an early stage. We have recently established a S121 monoclonal antibody (mAb) which recognizes an unidentified glycan epitope on MUC5AC, designated as CCA-associated carbohydrate antigen (CCA-CA). This antigen is expressed in human CCA cells but not in normal biliary epithelia. Detection of CCA-CA effectively distinguished CCA patients' sera from normal control sera with high specificity and sensitivity. In the present study, we examined a time profile of the expression of CCA-CA by immunohistochemical methods in the liver tissues of Opisthorchis viverrini (Ov)-associated CCA in a hamster model. Hamsters were divided into four groups; non-treated, Ov infected, NDMA (N-nitrosodimethamine) treated and Ov+NDMA treated groups, and animals from each group were euthanized at 1, 3 and 6 months post-treatment. CCA-CA was not detected in normal biliary cells of non-treated hamsters throughout the course of experiment. CCA-CA became detectable in the cytoplasm and apical surface of biliary cells of the NDMA and Ov+NDMA groups at early stage (1 month) of tumor development and increased with tumor progression. In contrast, CCA-CA was detected as nuclear staining at the 1 month post Ov infection and declined thereafter. These results suggest the possibility of CCA-CA as an early marker for CCA.

  17. Detection of agar, by analysis of sugar markers, associated with Bacillus anthracis spores, after culture.

    Science.gov (United States)

    Wunschel, David S; Colburn, Heather A; Fox, Alvin; Fox, Karen F; Harley, William M; Wahl, Jon H; Wahl, Karen L

    2008-08-01

    Detection of small quantities of agar associated with spores of Bacillus anthracis could provide key information regarding its source or growth characteristics. Agar, widely used in growth of bacteria on solid surfaces, consists primarily of repeating polysaccharide units of 3,6-anhydro-l-galactose (AGal) and galactose (Gal) with sulfated and O-methylated galactoses present as minor constituents. Two variants of the alditol acetate procedure were evaluated for detection of potential agar markers associated with spores. The first method employed a reductive hydrolysis step, to stabilize labile anhydrogalactose, by converting to anhydrogalactitol. The second eliminated the reductive hydrolysis step simplifying the procedure. Anhydrogalactitol, derived from agar, was detected using both derivatization methods followed by gas chromatography-mass spectrometry (GC-MS) analysis. However, challenges with artifactual background (reductive hydrolysis) or marker destruction (hydrolysis) respectively lead to the use of an alternative agar marker. A minor agar component, 6-O-methyl galactose (6-O-M gal), was readily detected in agar-grown but not broth-grown bacteria. Detection was optimized by the use of gas chromatography-tandem mass spectrometry (GC-MS-MS). With appropriate choice of sugar marker and analytical procedure, detection of sugar markers for agar has considerable potential in microbial forensics.

  18. Detection of Agar, by Analysis of Sugar Markers, Associated with Bacillus Anthracis Spores, After Culture

    Energy Technology Data Exchange (ETDEWEB)

    Wunschel, David S.; Colburn, Heather A.; Fox, Alvin; Fox, Karen F.; Harley, William M.; Wahl, Jon H.; Wahl, Karen L.

    2008-08-01

    Detection of small quantities of agar associated with spores of Bacillus anthracis could provide key information regarding its source or growth characteristics. Agar, widely used in growth of bacteria on solid surfaces, consists primarily of repeating polysaccharide units of 3,6-anhydro-L-galactose (AGal) and galactose (Gal) with sulfated and O-methylated galactoses present as minor constituents. Two variants of the alditol acetate procedure were evaluated for detection of potential agar markers associated with spores. The first method employed a reductive hydrolysis step, to stabilize labile anhydrogalactose, by converting to anhydrogalactitol. The second eliminated the reductive hydrolysis step simplifying the procedure. Anhydrogalactitol, derived from agar, was detected using both derivatization methods followed by gas chromatography-mass spectrometry (GC-MS) analysis. However, challenges with artefactual background (reductive hydrolysis) or marker destruction (hydrolysis) lead to the search for alternative sugar markers. A minor agar component, 6-O-methyl galactose (6-O-M gal), was readily detected in agar-grown but not broth-grown bacteria. Detection was optimized by the use of gas chromatography-tandem mass spectrometry (GC-MS-MS). With appropriate choice of sugar marker and analytical procedure, detection of sugar markers for agar has considerable potential in microbial forensics.

  19. Fourier transform infrared spectroscopic imaging identifies early biochemical markers of tissue damage

    Science.gov (United States)

    Varma, Vishal K.; Ohlander, Samuel; Nguyen, Peter; Vendryes, Christopher; Parthiban, Sujeeth; Hamilton, Blake; Wallis, M. Chad; Kajdacsy-Balla, Andre; Hannaford, Blake; Lendvay, Thomas; Hotaling, James M.; Walsh, Michael J.

    2014-03-01

    Fourier Transform Infrared (FT-IR) spectroscopic imaging can allow for the rapid imaging of tissue biochemistry in a label-free and non-perturbing fashion. With the rapid adoption of new minimally invasive surgery (MIS) technologies over the last 20 years, adequate skill to safely and effectively use these technologies may not be achieved and risk of undue physical pressure being placed on tissues is a concern. Previous work has demonstrated that a number of histological stains can detect tissue damage, however, this process requires the initiation and progression of a signaling cascade that results in the epitope of interest being expressed. We proposed to identify the early biochemical markers associated with physical tissue damage from applied forces, thus not requiring transcriptional and translational protein synthesis as traditional immunohistochemistry does. To demonstrate that FT-IR can measure biochemical changes in tissues that have undergone physical force, we took ex-vivo lamb's liver that had been freshly excised and applied varying levels of physical pressure (0kPa to 30kPa). Tissues were then formalin-fixed, paraffin-embedded, and sectioned on to glass for H and E staining to identify damage and on to an IR slide for FT-IR imaging. Regions of interest containing hepatocytes were identified and average FT-IR spectra were extracted from the damaged and undamaged livers. FT-IR spectra showed clear biochemical changes associated with tissue damage. In addition, chemical changes could be observed proceeding histological changes observed when using conventional staining approaches.

  20. Plasma renin activity: An early marker of progressive renal disease in posterior urethral valves

    Directory of Open Access Journals (Sweden)

    Minu Bajpai

    2013-01-01

    Full Text Available Introduction: A significant number of children with posterior urethral valves (PUV develop chronic renal failure (CRF due to activation of the renin angiotensin system (RAS. We investigated the role of plasma renin activity (PRA in these cases and sought to establish a relationship between the accepted criteria of renal damage and PRA. Aims and Objectives: The aim of this study is to establish the relationship between PRA and CRF. Materials and Methods: The records of 250 patients with PUV were reviewed. Multiple linear regression analysis was used to assess correlations between PRA, grade of reflux, presence of scars and raised creatinine and decrease in glomerular filtration rates (GFR. A P < 0.5 was considered as significant. Results: A total of 58 patients were included. Their mean age was 16 years, range 5.3-24.2 years, mean follow-up period was 12.6 ± 3.6 years. At diagnosis, 22/58 (38% patients were in CRF and 36/58 (62% patients had normal renal function (RF. The mean PRA after treatment was higher in those who developed CRF than in those with normal RF (12.6 ± 10.2 vs. 34.6 ± 14.2 ng/ml/24 h, P = 0.02. Mean GFR at 1 year of age were 48 ± 9.8 ml/min/1.73 m 2 and 86 ± 12.5 ml/min/1.73 m 2 respectively (P = 0.005. PRA correlated negatively with GFR, t = -2.816, Confidence Interval: P = 0. 007. In the temporal plot over a period of 14 years, a rise in PRA preceded the fall in GFR in patients who developed CRF. Conclusions: This study shows that RAS is activated earlier in kidneys susceptible to damage. PRA could be investigated as a marker for the early detection and prevention of ongoing renal damage.

  1. SCREENING FOR EARLY DETECTION OF EATING DISORDERS

    Directory of Open Access Journals (Sweden)

    Elisaveta Pavlova

    2016-12-01

    Full Text Available Background: Eating Disorders (EDs are characterized by a persistent disturbance of eating or eating-related behavior that significantly impairs physical health or psychosocial functioning. EDs are caused by a complex interaction of genetic, biological, behavioral, psychological, and social factors. Their epidemiology is rising for the past decades, and EDs affect all races, social levels and both genders. Due to the long and expensive treatment, chronic course, and the fact that most of the sufferers do not realize the need for therapy or do not seek treatment, the demand on developing prevention programs, early detection and assessment is essential. Despite the fact, that many new EDs screening tools were developed already, there is a great lack of validated screening instruments, adapted to the Bulgarian conditions. Objects and methods: Our study aimed at eliciting a comprehensive battery for screening of not only specific ED pathology, but also some risk factors, such as negative body image, weight and depressive symptoms. The object of our study consisted of 201 females, aged 18 to 45 (mean 24.65. SCOOF- questionnaire, Eating Disorder Diagnostic Scale (EDDS-5, Body Image Questionnaire-34 and Beck Depression Inventory (BDI were applied. Results: Our preliminary results show that approximately 45% of the tested subjects show some of the: negative body image, eating disorders’ clinical pathology, distorted eating patterns, subclinical eating disorders pathology, overweight/obesity, or depressive symptoms. Conclusion: Our ongoing efforts in area of research also are aimed at developing and refining strategies for preventing and treating ED among adolescents and adults.

  2. Pollen genetic markers for detection of mutagens in the environment

    Energy Technology Data Exchange (ETDEWEB)

    Nilan, R.A.; Rosichan, J.L.; Arenaz, P.; Hodgdon, A.L.; Kleinhofs, A.

    1980-01-01

    To utilize and exploit pollen for in situ mutagen monitoring, screening and toxicology, the range of genetic traits in pollen must be identified and analyzed. To be useful for the development of mutagen detection systems proteins should be: (1) activity stainable or immunologically identifiable in the pollen, (2) the products of one to three loci; and (3) gametophytic and nuclear in origin. Several proteins, including alcohol dehydrogenase in maize, which meet these criteria are discussed. The waxy locus in barley and maize which controls starch deposition for pollen screening and mutant detection. Thirty waxy mutant lines, induced by sodium azide and gamma-rays are characterized for spontaneous and induced reversion frequencies, allelism, karyotype, amylose content, and UDPglucose glucosyltransferase (waxy gene product) activity. Twelve mutant alleles are being mapped by recombinant frequencies.

  3. Demographic changes and marker properties affect detection of human population differentiation

    Directory of Open Access Journals (Sweden)

    Sanichwankul Kittipong

    2007-05-01

    Full Text Available Abstract Background Differentiating genetically between populations is valuable for admixture and population stratification detection and in understanding population history. This is easy to achieve for major continental populations, but not for closely related populations. It has been claimed that a large marker panel is necessary to reliably distinguish populations within a continent. We investigated whether empirical genetic differentiation could be accomplished efficiently among three Asian populations (Hmong, Thai, and Chinese using a small set of highly variable markers (15 tetranucleotide and 17 dinucleotide repeats. Results Hmong could be differentiated from Thai and Chinese based on multi-locus genotypes, but Thai and Chinese were indistinguishable from each other. We found significant evidence for a recent population bottleneck followed by expansion in the Hmong that was not present in the Thai or Chinese. Tetranucleotide repeats were less useful than dinucleotide repeat markers in distinguishing between major continental populations (Asian, European, and African while both successfully distinguished Hmong from Thai and Chinese. Conclusion Demographic history contributes significantly to robust detection of intracontinental population structure. Populations having experienced a rapid size reduction may be reliably distinguished as a result of a genetic drift -driven redistribution of population allele frequencies. Tetranucleotide markers, which differ from dinucleotide markers in mutation mechanism and rate, are similar in information content to dinucleotide markers in this situation. These factors should be considered when identifying populations suitable for gene mapping studies and when interpreting interpopulation relationships based on microsatellite markers.

  4. Genomic Integrity Detection of In Vitro Irradiated Banana Using Microsatellite Marker.

    OpenAIRE

    Nina Ratna Djuita; Rita Megia

    2010-01-01

    Genomic Integrity Detection of In Vitro Irradiated Banana Using Microsatellite Marker. The research aims todetect genomic integrity of in vitro irradiated banana using microsatellite marker. These studies were done on bananacv. Pisang Mas irradiated by 15 Gy of gamma ray. The DNA was isolated from each accesion following Dixie.Amplification of DNA products were done by Perkin Elmer Gene Amp PCR 2400 using ten primers, and thenelectroforesis in agarose 1%. Finally a vertical polyacrylamide gel...

  5. A Novel Point-of-Care Biomarker Recognition Method: Validation by Detecting Marker for Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Sahana Pentyala

    2015-04-01

    Full Text Available Biological fluid collection to identify and analyze different disease markers is a routine and normal procedure in health care settings. Body fluids are as varied as urine, blood, mucus, cerebrospinal fluid (CSF, tears, semen, etc. The volumes of the collected fluids range from micro liters (e.g., tears, CSF to tens and hundreds of milliliters (blood, urine, etc.. In some manifestations, a disease marker (particularly protein markers can occur in trace amounts, yet the fluids collected are in large volumes. To identify these trace markers, cumbersome methods, expensive instruments, and trained personnel are required. We developed an easy method to rapidly capture, concentrate, and identify protein markers in large volumes of test fluids. This method involves the utilization of two antibodies recognizing two different epitopes of the protein biomarker. Antibody-1 helps to capture and concentrate the biomarker and Antibody-2 adsorbed or conjugated to nanogold beads will detect the biomarker. This method was validated in capturing and detecting lipocalin type prostaglandin-D2 synthase, a marker in urine that implicates diabetic nephropathy. A one-step collection, concentration, and detection device was designed based on this method. This device can replace many of the normal body fluid collection devices such as tubes and containers. A one-step fluid collection and biomarker capture and concentration device for rapid diagnosis of diseases has tremendous advantage in terms of cost and providing timely results.

  6. Detecting Early Signatures of Persuasion in Information Cascades

    Science.gov (United States)

    2014-01-01

    ADDRESS. Indiana University at Bloomington Trustees of Indiana University 509 E 3RD ST Bloomington, IN 47401 -3654 Detecting Early Signatures of Persuasion ...SMISC  Project:   DESPIC:  Detecting  Early  Signatures  of   Persuasion  in  Information  Cascades     Teams:   Indiana

  7. Promoting early detection of breast cancer and care strategies for ...

    African Journals Online (AJOL)

    Promoting early detection of breast cancer and care strategies for Nigeria. ... Journal Home > Vol 21, No 2 (2017) > ... Worldwide, it is predicted that more than one million women are diagnosed with breast cancer, and ... between wide spread education, early detection, the disease stage at diagnosis, and survival rates.

  8. Plasma protein thiols: an early marker of oxidative stress in asthma and chronic obstructive pulmonary disease.

    Science.gov (United States)

    Zinellu, Angelo; Fois, Alessandro Giuseppe; Sotgia, Salvatore; Zinellu, Elisabetta; Bifulco, Fabiana; Pintus, Gianfranco; Mangoni, Arduino A; Carru, Ciriaco; Pirina, Pietro

    2016-02-01

    Chronic obstructive pulmonary disease (COPD) and asthma are both characterized by heterogeneous chronic airway inflammation and obstruction as well as oxidative stress (OS). However, it is unknown whether OS occurs in early disease and how to best assess its presence. Plasma OS markers (TBARS, PSH, taurine, GSH, ergothioneine and paraoxonase 1 activity) and lung function tests were measured in patients with mild stable asthma (n = 24) and mild stable COPD (n = 29) and in age- and sex-matched controls. Forced expiratory volume in 1 s (FEV1 ) was associated with age both in patients and control groups. By contrast, FEV1 was positively correlated with PSH only in COPD (ρ = 0·49, P = 0·007). In multiple logistic regression analysis, lower PSH was the only OS marker independently associated with increased odds of both asthma (OR = 0·32, 95% CI 0·13-0·78, P = 0·01) and COPD (OR = 0·50, 95% CI 0·26-0·95, P = 0·03). These findings suggest that proteins -SH are a sensitive OS marker in early COPD and asthma.

  9. Evaluation of the diagnostic value of 64 simultaneously measured autoantibodies for early detection of gastric cancer

    Science.gov (United States)

    Werner, Simone; Chen, Hongda; Butt, Julia; Michel, Angelika; Knebel, Phillip; Holleczek, Bernd; Zörnig, Inka; Eichmüller, Stefan B.; Jäger, Dirk; Pawlita, Michael; Waterboer, Tim; Brenner, Hermann

    2016-01-01

    Autoantibodies against tumor-associated antigens (TAAs) have been suggested as biomarkers for early detection of gastric cancer. However, studies that systematically assess the diagnostic performance of a large number of autoantibodies are rare. Here, we used bead-based multiplex serology to simultaneously measure autoantibody responses against 64 candidate TAAs in serum samples from 329 gastric cancer patients, 321 healthy controls and 124 participants with other diseases of the upper digestive tract. At 98% specificity, sensitivities for the 64 tested autoantibodies ranged from 0–12% in the training set and a combination of autoantibodies against five TAAs (MAGEA4 + CTAG1 + TP53 + ERBB2_C + SDCCAG8) was able to detect 32% of the gastric cancer patients at a specificity of 87% in the validation set. Sensitivities for early and late stage gastric cancers were similar, while chronic atrophic gastritis, a precursor lesion of gastric cancer, was not detectable. However, the 5-marker combination also detected 26% of the esophageal cancer patients. In conclusion, the tested autoantibodies and combinations alone did not reach sufficient sensitivity for gastric cancer screening. Nevertheless, some autoantibodies, such as anti-MAGEA4, anti-CTAG1 or anti-TP53 and their combinations could possibly contribute to the development of cancer early detection tests (not necessarily restricted to gastric cancer) when being combined with other markers. PMID:27140836

  10. Soluble macrophage-derived CD163 is a marker of disease activity and progression in early rheumatoid arthritis

    DEFF Research Database (Denmark)

    Greisen, Stinne Ravn; Moller, H J; Stengaard-Pedersen, Kristian

    2011-01-01

    To investigate the expression of the soluble form of the resident macrophage marker CD163 (sCD163) and its association with core parameters for disease activity, including radiographic progression in early rheumatoid arthritis (RA).......To investigate the expression of the soluble form of the resident macrophage marker CD163 (sCD163) and its association with core parameters for disease activity, including radiographic progression in early rheumatoid arthritis (RA)....

  11. Full automatic fiducial marker detection on coil arrays for accurate instrumentation placement during MRI guided breast interventions

    Science.gov (United States)

    Filippatos, Konstantinos; Boehler, Tobias; Geisler, Benjamin; Zachmann, Harald; Twellmann, Thorsten

    2010-02-01

    With its high sensitivity, dynamic contrast-enhanced MR imaging (DCE-MRI) of the breast is today one of the first-line tools for early detection and diagnosis of breast cancer, particularly in the dense breast of young women. However, many relevant findings are very small or occult on targeted ultrasound images or mammography, so that MRI guided biopsy is the only option for a precise histological work-up [1]. State-of-the-art software tools for computer-aided diagnosis of breast cancer in DCE-MRI data offer also means for image-based planning of biopsy interventions. One step in the MRI guided biopsy workflow is the alignment of the patient position with the preoperative MR images. In these images, the location and orientation of the coil localization unit can be inferred from a number of fiducial markers, which for this purpose have to be manually or semi-automatically detected by the user. In this study, we propose a method for precise, full-automatic localization of fiducial markers, on which basis a virtual localization unit can be subsequently placed in the image volume for the purpose of determining the parameters for needle navigation. The method is based on adaptive thresholding for separating breast tissue from background followed by rigid registration of marker templates. In an evaluation of 25 clinical cases comprising 4 different commercial coil array models and 3 different MR imaging protocols, the method yielded a sensitivity of 0.96 at a false positive rate of 0.44 markers per case. The mean distance deviation between detected fiducial centers and ground truth information that was appointed from a radiologist was 0.94mm.

  12. Detecting uncertainty in spoken dialogues: an explorative research to the automatic detection of a speakers' uncertainty by using prosodic markers

    NARCIS (Netherlands)

    Dral, J.; Heylen, Dirk K.J.; op den Akker, Hendrikus J.A.; Ahmad, K.

    2008-01-01

    This paper reports results in automatic detection of speakers uncertainty in spoken dialogues by using prosodic markers. For this purpose a substantial part of the AMI corpus (a multi-modal multi-party meeting corpus) has been selected and converted to a suitable format so its data could be analyzed

  13. Detection of activated parietal epithelial cells on the glomerular tuft distinguishes early focal segmental glomerulosclerosis from minimal change disease.

    Science.gov (United States)

    Smeets, Bart; Stucker, Fabien; Wetzels, Jack; Brocheriou, Isabelle; Ronco, Pierre; Gröne, Hermann-Josef; D'Agati, Vivette; Fogo, Agnes B; van Kuppevelt, Toin H; Fischer, Hans-Peter; Boor, Peter; Floege, Jürgen; Ostendorf, Tammo; Moeller, Marcus J

    2014-12-01

    In rodents, parietal epithelial cells (PECs) migrating onto the glomerular tuft participate in the formation of focal segmental glomerulosclerosis (FSGS) lesions. We investigated whether immunohistologic detection of PEC markers in the initial biopsies of human patients with first manifestation of idiopathic nephrotic syndrome with no immune complexes can improve the sensitivity to detect sclerotic lesions compared with standard methods. Ninety-five renal biopsies were stained for claudin-1 (PEC marker), CD44 (activated PECs), and LKIV69 (PEC matrix); 38 had been diagnosed as early primary FSGS and 57 as minimal change disease. PEC markers were detected on the tuft in 87% of the biopsies of patients diagnosed as primary FSGS. PEC markers were detected in FSGS lesions from the earliest stages of disease. In minimal change disease, no PEC activation was observed by immunohistology. However, in 25% of biopsies originally diagnosed as minimal change disease the presence of small lesions indicative of a sclerosing process were detected, which were undetectable on standard periodic acid-Schiff staining, even though only a single histologic section for each PEC marker was evaluated. Staining for LKIV69 detected lesions with the highest sensitivity. Two novel PEC markers A-kinase anchor protein 12 and annexin A3 exhibited similar sensitivity. In summary, detection of PECs on the glomerular tuft by immunostaining improves the differentiation between minimal change disease and primary FSGS and may serve to guide clinical decision making.

  14. Methylated free-circulating HPP1 DNA is an early response marker in patients with metastatic colorectal cancer.

    Science.gov (United States)

    Herbst, Andreas; Vdovin, Nikolay; Gacesa, Sanja; Philipp, Alexander; Nagel, Dorothea; Holdt, Lesca M; Op den Winkel, Mark; Heinemann, Volker; Stieber, Petra; Graeven, Ullrich; Reinacher-Schick, Anke; Arnold, Dirk; Ricard, Ingrid; Mansmann, Ulrich; Hegewisch-Becker, Susanna; Kolligs, Frank T

    2017-05-01

    Detection of methylated free-circulating DNA (mfcDNA) for hyperplastic polyposis 1 (HPP1) in blood is correlated with a poor prognosis for patients with metastatic colorectal cancers (mCRC). Here, we analyzed the plasma levels of HPP1 mfcDNA in mCRC patients treated with a combination therapy containing a fluoropyrimidine, oxaliplatin and bevacizumab to test whether HPP1 mfcDNA is a suitable prognostic and response biomarker. From 467 patients of the prospective clinical study AIO-KRK-0207, mfcDNA was isolated from plasma samples at different time points and bisulfite-treated mfcDNA was quantified using methylation specific PCR. About 337 of 467 patients had detectable levels for HPP1 mfcDNA before start of treatment. The detection was significantly correlated with poorer overall survival (OS) (HR = 1.86; 95%CI 1.37-2.53). About 2-3 weeks after the first administration of combination chemotherapy, HPP1 mfcDNA was reduced to non-detectable levels in 167 of 337 patients. These patients showed a better OS compared with patients with continued detection of HPP1 mfcDNA (HR HPP1(sample 1: pos/ sample 2: neg) vs. HPP1(neg/neg) = 1.41; 95%CI 1.00-2.01, HPP1(neg,pos/pos) vs. HPP1(neg/neg) = 2.60; 95%CI 1.86-3.64). Receiver operating characteristic analysis demonstrated that HPP1 mfcDNA discriminates well between patients who do (not) respond to therapy according to the radiological staging after 12 or 24 weeks (AUC = 0.77 or 0.71, respectively). Detection of HPP1 mfcDNA can be used as a prognostic marker and an early marker for response (as early as 3-4 weeks after start of treatment compared with radiological staging after 12 or 24 weeks) to identify patients who will likely benefit from a combination chemotherapy with bevacizumab. © 2017 UICC.

  15. Early detection of nonnative alleles in fish populations: When sample size actually matters

    Science.gov (United States)

    Croce, Patrick Della; Poole, Geoffrey C.; Payne, Robert A.; Gresswell, Bob

    2017-01-01

    Reliable detection of nonnative alleles is crucial for the conservation of sensitive native fish populations at risk of introgression. Typically, nonnative alleles in a population are detected through the analysis of genetic markers in a sample of individuals. Here we show that common assumptions associated with such analyses yield substantial overestimates of the likelihood of detecting nonnative alleles. We present a revised equation to estimate the likelihood of detecting nonnative alleles in a population with a given level of admixture. The new equation incorporates the effects of the genotypic structure of the sampled population and shows that conventional methods overestimate the likelihood of detection, especially when nonnative or F-1 hybrid individuals are present. Under such circumstances—which are typical of early stages of introgression and therefore most important for conservation efforts—our results show that improved detection of nonnative alleles arises primarily from increasing the number of individuals sampled rather than increasing the number of genetic markers analyzed. Using the revised equation, we describe a new approach to determining the number of individuals to sample and the number of diagnostic markers to analyze when attempting to monitor the arrival of nonnative alleles in native populations.

  16. MRI-alone radiation therapy planning for prostate cancer: Automatic fiducial marker detection

    Energy Technology Data Exchange (ETDEWEB)

    Ghose, Soumya, E-mail: soumya.ghose@case.edu; Mitra, Jhimli [Department of Biomedical Engineering, Case Western Reserve University, Cleveland, Ohio 44106 and CSIRO Health and Biosecurity, The Australian e-Health & Research Centre, Herston, QLD 4029 (Australia); Rivest-Hénault, David; Fazlollahi, Amir; Fripp, Jurgen; Dowling, Jason A. [CSIRO Health and Biosecurity, The Australian e-Health & Research Centre, Herston, QLD 4029 (Australia); Stanwell, Peter [School of health sciences, The University of Newcastle, Newcastle, NSW 2308 (Australia); Pichler, Peter [Department of Radiation Oncology, Cavalry Mater Newcastle Hospital, Newcastle, NSW 2298 (Australia); Sun, Jidi; Greer, Peter B. [School of Mathematical and Physical Sciences, The University of Newcastle, Newcastle, NSW 2308, Australia and Department of Radiation Oncology, Cavalry Mater Newcastle Hospital, Newcastle, NSW 2298 (Australia)

    2016-05-15

    Purpose: The feasibility of radiation therapy treatment planning using substitute computed tomography (sCT) generated from magnetic resonance images (MRIs) has been demonstrated by a number of research groups. One challenge with an MRI-alone workflow is the accurate identification of intraprostatic gold fiducial markers, which are frequently used for prostate localization prior to each dose delivery fraction. This paper investigates a template-matching approach for the detection of these seeds in MRI. Methods: Two different gradient echo T1 and T2* weighted MRI sequences were acquired from fifteen prostate cancer patients and evaluated for seed detection. For training, seed templates from manual contours were selected in a spectral clustering manifold learning framework. This aids in clustering “similar” gold fiducial markers together. The marker with the minimum distance to a cluster centroid was selected as the representative template of that cluster during training. During testing, Gaussian mixture modeling followed by a Markovian model was used in automatic detection of the probable candidates. The probable candidates were rigidly registered to the templates identified from spectral clustering, and a similarity metric is computed for ranking and detection. Results: A fiducial detection accuracy of 95% was obtained compared to manual observations. Expert radiation therapist observers were able to correctly identify all three implanted seeds on 11 of the 15 scans (the proposed method correctly identified all seeds on 10 of the 15). Conclusions: An novel automatic framework for gold fiducial marker detection in MRI is proposed and evaluated with detection accuracies comparable to manual detection. When radiation therapists are unable to determine the seed location in MRI, they refer back to the planning CT (only available in the existing clinical framework); similarly, an automatic quality control is built into the automatic software to ensure that all gold

  17. Early bronchiectasis in cystic fibrosis detected by surveillance CT.

    Science.gov (United States)

    Pillarisetti, Naveen; Linnane, Barry; Ranganathan, Sarath

    2010-08-01

    There is emerging evidence that cystic fibrosis lung disease begins early in infancy. Newborn screening allows early detection and surveillance of pulmonary disease and the possibility of early intervention in this life-shortening condition. We report two children with cystic fibrosis who underwent a comprehensive assessment from diagnosis that included measurement of lung function, limited-slice high-resolution CT and BAL performed annually. Early aggressive surveillance enabled significant lung disease and bronchiectasis to be detected during the first few years of life and led to a change in management, highlighting a clinical role for CT scanning during the preschool years in children with cystic fibrosis.

  18. Detection of Early lung Cancer Among Military Personnel (DECAMP)

    Science.gov (United States)

    2016-10-01

    Award Number: W81XWH-11-2-0161 TITLE: Detection of Early lung Cancer Among Military Personnel (DECAMP) PRINCIPAL INVESTIGATOR: Avrum E. Spira...W81XWH-11-2-0161 Detection of Early lung Cancer Among Military Personnel (DECAMP) 5b. GRANT NUMBER W81XWH-11-2-0161 5c. PROGRAM ELEMENT NUMBER 6...bodily fluids, which may be used for the early detection of lung cancer among military personnel and veterans. Over the course of the fifth year of

  19. Determining early markers of disease using Raman spectroscopy in a rat combat-trauma model of heterotopic ossification

    Science.gov (United States)

    Cilwa, Katherine E.; Qureshi, Ammar T.; Forsberg, Jonathan A.; Davis, Thomas A.; Crane, Nicole J.

    2016-02-01

    Traumatic heterotopic ossification (HO) is the pathological formation of bone in soft tissue and is a debilitating sequela following acute trauma involving blast-related extremity musculoskeletal injuries, severe burns, spinal cord injury, and traumatic brain injury. Over 60% of combat related injuries and severe burns develop HO; often resulting in reduced mobility, chronic pain, ulceration, tissue entrapment, and reduced ambulation. Detection and prognosis is limited by current clinical imaging modalities (computed tomography, radiography, and ultrasound). This study identifies Raman spectral signatures corresponding to histological changes in a combat-trauma induced rat HO model at early time points prior to radiographic evidence of HO. HO was induced in Sprague-Dawley rats via blast over pressure injury, mid-femoral fracture, soft tissue crush injury, and limb amputation through the zone of injury. Rats were euthanized, and amputated limbs were formalin fixed and embedded in paraffin; 10 μm sections were placed on gold slides, and paraffin was chemically removed. Tissues from sham-treated animals served as controls. Tissue maps consisting of Raman spectra were generated using a Raman microprobe system with an 80-90 μm spot size and 785 nm excitation in regions exhibiting histological evidence of early HO development according to adjacent HE sections. Factors were extracted from mapping data using Band-Target Entropy Minimization algorithms. Areas of early HO were highlighted by a Raman factor indicative of the presence of collagen. Identification of collagen as an early marker of HO prior to radiographic detection in a clinically relevant animal model serves to inform future clinical work.

  20. A multi-marker model for detecting chromosomal segments displaying QTL activity

    Energy Technology Data Exchange (ETDEWEB)

    Rodolphe, F.; Lefort, M. (INRA Centre de Recherches de Jouy en Josas (France))

    1993-08-01

    A statistical method is presented for detecting quantitative trait loci (QTLs), based on the linear model. Unlike methods able to detect a few well separated QTLs and to estimate their effects and positions, this method considers the genome as a whole and enables the detection of chromosomal segments involved in the differences between two homozygous lines, and their backcross, doubled haploid, or F[sub 2] progenies, for a quantitative trait. Genetic markers must be codominant, but missing markers are accepted, provided they are missing independently from the experiment. Asymptotic properties, which are of practical use, are developed. This method does not rely on strong genetic hypotheses, and thus does not permit any precise genetic analysis of the trait under study, but it does assess which regions of the genome are involved, whatever the complexity of the genetic determinism (number, effects and interactions among QTLs). Simultaneous use of several methods, including this one, should lead to better efficiency in QTL detection.

  1. [Association of muscle strength with early markers of cardiovascular risk in sedentary adults].

    Science.gov (United States)

    Triana-Reina, Héctor Reynaldo; Ramírez-Vélez, Robinson

    2013-10-01

    To assess the association between muscle strength and early cardiovascular risk (CVR) markers in sedentary adults. A total of 176 sedentary subjects aged 18-30 years were enrolled. Body mass index and fat percentage were calculated, and waist circumference, grip strength by dynamometry, systolic blood pressure, diastolic blood pressure, mean arterial pressure, and maximal oxygen uptake by VO2max were measured as CVR markers. A multivariate logistic regression analysis was used to assess associations between muscle strength and CVR markers. Inverse correlations were found between muscle strength and adiposity (r=-.317; P=.001), waist circumference (r=-.309; P=.001), systolic blood pressure (r=-.401; P=.001), and mean arterial pressure (r=-.256; P=.001). Subjects with lower levels of muscle strength had a 5.79-fold (95% CI 1.57 to 9.34; P=.008) risk of having higher adiposity levels (≥25%) and a 9.67-fold (95% CI=3.86 to 19.22; Pcardiovascular risk. Copyright © 2012 SEEN. Published by Elsevier Espana. All rights reserved.

  2. Hemorrhagic shock and encephalopathy syndrome – the markers for an early HSES diagnosis

    Directory of Open Access Journals (Sweden)

    Miyaichi Toshinori

    2008-10-01

    Full Text Available Abstract Background The hemorrhagic shock and encephalopathy syndrome (HSES is a devastating disease that affects young children. The outcomes of HSES patients are often fatal or manifesting severe neurological sequelae. We reviewed the markers for an early diagnosis of HSES. Methods We examined the clinical, biological and radiological findings of 8 patients (4 months to 9 years old who met the HSES criteria. Results Although cerebral edema, disseminated intravascular coagulopathy (DIC, and multiple organ failure were seen in all 8 cases during their clinical courses, brain computed tomography (CT scans showed normal or only slight edema in 5 patients upon admission. All 8 patients had normal platelet counts, and none were in shock. However, they all had severe metabolic acidosis, which persisted even after 3 hours (median base excess (BE, -7.6 mmol/L. And at 6 hours after admission (BE, -5.7 mmol/L they required mechanical ventilation. Within 12 hours after admission, fluid resuscitation and vasopressor infusion for hypotension was required. Seven of the patients had elevated liver enzymes and creatine kinase (CK upon admission. Twenty-four hours after admission, all 8 patients needed vasopressor infusion to maintain blood pressure. Conclusion CT scan, platelet count, hemoglobin level and renal function upon admission are not useful for an early diagnosis of HSES. However, the elevated liver enzymes and CK upon admission, hypotension in the early stage after admission with refractory acid-base disturbance to fluid resuscitation and vasopressor infusion are useful markers for an early HSES diagnosis and helpful to indicate starting intensive neurological treatment.

  3. Early changes in emotional processing as a marker of clinical response to SSRI treatment in depression.

    Science.gov (United States)

    Godlewska, B R; Browning, M; Norbury, R; Cowen, P J; Harmer, C J

    2016-11-22

    Antidepressant treatment reduces behavioural and neural markers of negative emotional bias early in treatment and has been proposed as a mechanism of antidepressant drug action. Here, we provide a critical test of this hypothesis by assessing whether neural markers of early emotional processing changes predict later clinical response in depression. Thirty-five unmedicated patients with major depression took the selective serotonin re-uptake inhibitor (SSRI), escitalopram (10 mg), over 6 weeks, and were classified as responders (22 patients) versus non-responders (13 patients), based on at least a 50% reduction in symptoms by the end of treatment. The neural response to fearful and happy emotional facial expressions was assessed before and after 7 days of treatment using functional magnetic resonance imaging. Changes in the neural response to these facial cues after 7 days of escitalopram were compared in patients as a function of later clinical response. A sample of healthy controls was also assessed. At baseline, depressed patients showed greater activation to fear versus happy faces than controls in the insula and dorsal anterior cingulate. Depressed patients who went on to respond to the SSRI had a greater reduction in neural activity to fearful versus happy facial expressions after just 7 days of escitalopram across a network of regions including the anterior cingulate, insula, amygdala and thalamus. Mediation analysis confirmed that the direct effect of neural change on symptom response was not mediated by initial changes in depressive symptoms. These results support the hypothesis that early changes in emotional processing with antidepressant treatment are the basis of later clinical improvement. As such, early correction of negative bias may be a key mechanism of antidepressant drug action and a potentially useful predictor of therapeutic response.

  4. Quantitative PCR for Detection and Enumeration of Genetic Markers of Bovine Fecal Pollution

    Science.gov (United States)

    Accurate assessment of health risks associated with bovine (cattle) fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for the detection of two recently described cow feces-spec...

  5. Detecting autologous blood transfusions: a comparison of three passport approaches and four blood markers

    DEFF Research Database (Denmark)

    Mørkeberg, J; Sharpe, K; Belhage, B

    2011-01-01

    Blood passport has been suggested as an indirect tool to detect various kinds of blood manipulations. Autologous blood transfusions are currently undetectable, and the objective of this study was to examine the sensitivities of different blood markers and blood passport approaches in order to det...

  6. Conformational altered p53 as an early marker of oxidative stress in Alzheimer's disease.

    Science.gov (United States)

    Buizza, Laura; Cenini, Giovanna; Lanni, Cristina; Ferrari-Toninelli, Giulia; Prandelli, Chiara; Govoni, Stefano; Buoso, Erica; Racchi, Marco; Barcikowska, Maria; Styczynska, Maria; Szybinska, Aleksandra; Butterfield, David Allan; Memo, Maurizio; Uberti, Daniela

    2012-01-01

    In order to study oxidative stress in peripheral cells of Alzheimer's disease (AD) patients, immortalized lymphocytes derived from two peculiar cohorts of patients, referring to early onset AD (EOSAD) and subjects harboured AD related mutation (ADmut), were used. Oxidative stress was evaluated measuring i) the typical oxidative markers, such as HNE Michel adducts, 3 Nitro-Tyrosine residues and protein carbonyl on protein extracts, ii) and the antioxidant capacity, following the enzymatic kinetic of superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione reductase (GRD). We found that the signs of oxidative stress, measured as oxidative marker levels, were evident only in ADmut but not in EOSAD patients. However, oxidative imbalance in EOSAD as well as ADmut lymphocytes was underlined by a reduced SOD activity and GRD activity in both pathological groups in comparison with cells derived from healthy subjects. Furthermore, a redox modulated p53 protein was found conformational altered in both EOSAD and ADmut B lymphocytes in comparison with control cells. This conformational altered p53 isoform, named "unfolded p53", was recognized by the use of two specific conformational anti-p53 antibodies. Immunoprecipitation experiments, performed with the monoclonal antibodies PAb1620 (that recognizes p53wt) and PAb240 (that is direct towards unfolded p53), and followed by the immunoblotting with anti-4-hydroxynonenal (HNE) and anti- 3-nitrotyrosine (3NT) antibodies, showed a preferential increase of nitrated tyrosine residues in unfolded p53 isoform comparing to p53 wt protein, in both ADmut and EOSAD. In addition, a correlation between unfolded p53 and SOD activity was further found. Thus this study suggests that ROS/RNS contributed to change of p53 tertiary structure and that unfolded p53 can be considered as an early marker of oxidative imbalance in these patients.

  7. Conformational altered p53 as an early marker of oxidative stress in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Laura Buizza

    Full Text Available In order to study oxidative stress in peripheral cells of Alzheimer's disease (AD patients, immortalized lymphocytes derived from two peculiar cohorts of patients, referring to early onset AD (EOSAD and subjects harboured AD related mutation (ADmut, were used. Oxidative stress was evaluated measuring i the typical oxidative markers, such as HNE Michel adducts, 3 Nitro-Tyrosine residues and protein carbonyl on protein extracts, ii and the antioxidant capacity, following the enzymatic kinetic of superoxide dismutase (SOD, glutathione peroxidase (GPx and glutathione reductase (GRD. We found that the signs of oxidative stress, measured as oxidative marker levels, were evident only in ADmut but not in EOSAD patients. However, oxidative imbalance in EOSAD as well as ADmut lymphocytes was underlined by a reduced SOD activity and GRD activity in both pathological groups in comparison with cells derived from healthy subjects. Furthermore, a redox modulated p53 protein was found conformational altered in both EOSAD and ADmut B lymphocytes in comparison with control cells. This conformational altered p53 isoform, named "unfolded p53", was recognized by the use of two specific conformational anti-p53 antibodies. Immunoprecipitation experiments, performed with the monoclonal antibodies PAb1620 (that recognizes p53wt and PAb240 (that is direct towards unfolded p53, and followed by the immunoblotting with anti-4-hydroxynonenal (HNE and anti- 3-nitrotyrosine (3NT antibodies, showed a preferential increase of nitrated tyrosine residues in unfolded p53 isoform comparing to p53 wt protein, in both ADmut and EOSAD. In addition, a correlation between unfolded p53 and SOD activity was further found. Thus this study suggests that ROS/RNS contributed to change of p53 tertiary structure and that unfolded p53 can be considered as an early marker of oxidative imbalance in these patients.

  8. Hypermethylated MAL gene – a silent marker of early colon tumorigenesis

    Directory of Open Access Journals (Sweden)

    Kallioniemi Anne

    2008-03-01

    Full Text Available Abstract Background Tumor-derived aberrantly methylated DNA might serve as diagnostic biomarkers for cancer, but so far, few such markers have been identified. The aim of the present study was to investigate the potential of the MAL (T-cell differentiation protein gene as an early epigenetic diagnostic marker for colorectal tumors. Methods Using methylation-specific polymerase chain reaction (MSP the promoter methylation status of MAL was analyzed in 218 samples, including normal mucosa (n = 44, colorectal adenomas (n = 63, carcinomas (n = 65, and various cancer cell lines (n = 46. Direct bisulphite sequencing was performed to confirm the MSP results. MAL gene expression was investigated with real time quantitative analyses before and after epigenetic drug treatment. Immunohistochemical analysis of MAL was done using normal colon mucosa samples (n = 5 and a tissue microarray with 292 colorectal tumors. Results Bisulphite sequencing revealed that the methylation was unequally distributed within the MAL promoter and by MSP analysis a region close to the transcription start point was shown to be hypermethylated in the majority of colorectal carcinomas (49/61, 80% as well as in adenomas (45/63, 71%. In contrast, only a minority of the normal mucosa samples displayed hypermethylation (1/23, 4%. The hypermethylation of MAL was significantly associated with reduced or lost gene expression in in vitro models. Furthermore, removal of the methylation re-induced gene expression in colon cancer cell lines. Finally, MAL protein was expressed in epithelial cells of normal colon mucosa, but not in the malignant cells of the same type. Conclusion Promoter hypermethylation of MAL was present in the vast majority of benign and malignant colorectal tumors, and only rarely in normal mucosa, which makes it suitable as a diagnostic marker for early colorectal tumorigenesis.

  9. Combined Screening for Early Detection of Pre-Eclampsia

    Directory of Open Access Journals (Sweden)

    Hee Jin Park

    2015-08-01

    Full Text Available Although the precise pathophysiology of pre-eclampsia remains unknown, this condition continues to be a major cause of maternal and fetal mortality. Early prediction of pre-eclampsia would allow for timely initiation of preventive therapy. A combination of biophysical and biochemical markers are superior to other tests for early prediction of the development of pre-eclampsia. Apart from the use of parameters in first-trimester aneuploidy screening, cell-free fetal DNA quantification is emerging as a promising marker for prediction of pre-eclampsia. This article reviews the current research of the most important strategies for prediction of pre-eclampsia, including the use of maternal risk factors, mean maternal arterial pressure, ultrasound parameters, and biomarkers.

  10. Combined Screening for Early Detection of Pre-Eclampsia.

    Science.gov (United States)

    Park, Hee Jin; Shim, Sung Shin; Cha, Dong Hyun

    2015-08-04

    Although the precise pathophysiology of pre-eclampsia remains unknown, this condition continues to be a major cause of maternal and fetal mortality. Early prediction of pre-eclampsia would allow for timely initiation of preventive therapy. A combination of biophysical and biochemical markers are superior to other tests for early prediction of the development of pre-eclampsia. Apart from the use of parameters in first-trimester aneuploidy screening, cell-free fetal DNA quantification is emerging as a promising marker for prediction of pre-eclampsia. This article reviews the current research of the most important strategies for prediction of pre-eclampsia, including the use of maternal risk factors, mean maternal arterial pressure, ultrasound parameters, and biomarkers.

  11. APPLICATION OF RYE SSR MARKERS FOR DETECTION OF GENETIC DIVERSITY IN TRITICALE

    Directory of Open Access Journals (Sweden)

    Želmíra Balážová

    2016-06-01

    Full Text Available Present study aims to testify usefulness of particular rye SSR markers for the detection of genetic diversity degree in the set of 20 triticale cultivars coming from different European countries. For this purpose, a set of six rye SSR markers were used. The set of six polymorphic markers provided 22 alleles with an average frequency of 3.67 alleles per locus. The number of alleles ranged between 2 (SCM43 and 5 (SCM28, SCM86. Resulting from the number and frequency of alleles diversity index (DI, polymorphic information content (PIC and probability of identity (PI were calculated. An average value of PIC for 6 SSR markers was 0.505, the highest value was calculated for rye SSR marker SCM86 (0.706. Based on UPGMA algorithm, a dendrogram was constructed. In dendrogram cultivars were divided into two main clusters. The first cluster contained two cultivars, Russian cultivar Greneder and Slovak cultivar Largus, and second included 18 cultivars. Genetically the closest were two Greek cultivars (Niobi and Thisbi and were close to other Greek cultivar Vrodi. It was possible to separate triticale cultivars of spring and winter form in dendrogram. Results showed the utility of rye microsatellite markers for estimation of genetic diversity of European triticale genotypes leading to genotype identification.

  12. Combined Diffusion Tensor Imaging and Arterial Spin Labeling as Markers of Early Parkinson’s disease

    Science.gov (United States)

    Wei, Xiaobo; Yan, Ronghua; Chen, Zhaoyu; Weng, Ruihui; Liu, Xu; Gao, Huimin; Xu, Xiaofeng; Kang, Zhuang; Liu, Zhexing; Guo, Yan; Liu, Zhenhua; Larsen, Jan Petter; Wang, Jin; Tang, Beisha; Hallett, Mark; Wang, Qing

    2016-01-01

    This study aimed to identify a PD-specific MRI pattern using combined diffusion tensor imaging (DTI) and arterial spin labeling (ASL) to discriminate patients with early PD from healthy subjects and evaluate disease status. Twenty-one early and 22 mid-late PD patients, and 22 healthy, age/gender-matched controls underwent 3-T MRI with apparent diffusion coefficient (ADC), fractional anisotropy (FA), fiber number (FN) and cerebral blood flow (CBF) measurements. We found that compared with healthy subjects, there was a profound reduction in FN passing through the SN in PD. FA in the SN and CBF in the caudate nucleus were inversely correlated with motor dysfunction. A negative correlation was observed between FA in the hippocampus (Hip) and the NMSS-Mood score, whereas CBF in the Hip and the prefrontal cortex(PFC) correlated with declined cognition. Stratified five-fold cross-validation identified FA in the SN(FA-SNAv), CBF in the PFC(CBF-PFCAv) and FA in the parietal white matter(FA-PWMAv), and the combination of these measurements offered relatively high accuracy (AUC 0.975, 90% sensitivity and 100% specificity) in distinguishing those with early PD from healthy subjects. We demonstrate that the decreased FNs through SN in combination with changes in FA-SNAv, CBF-PFCAv and FA-PWMAv values might serve as potential markers of early-stage PD. PMID:27646647

  13. Combined Diffusion Tensor Imaging and Arterial Spin Labeling as Markers of Early Parkinson's disease.

    Science.gov (United States)

    Wei, Xiaobo; Yan, Ronghua; Chen, Zhaoyu; Weng, Ruihui; Liu, Xu; Gao, Huimin; Xu, Xiaofeng; Kang, Zhuang; Liu, Zhexing; Guo, Yan; Liu, Zhenhua; Larsen, Jan Petter; Wang, Jin; Tang, Beisha; Hallett, Mark; Wang, Qing

    2016-09-20

    This study aimed to identify a PD-specific MRI pattern using combined diffusion tensor imaging (DTI) and arterial spin labeling (ASL) to discriminate patients with early PD from healthy subjects and evaluate disease status. Twenty-one early and 22 mid-late PD patients, and 22 healthy, age/gender-matched controls underwent 3-T MRI with apparent diffusion coefficient (ADC), fractional anisotropy (FA), fiber number (FN) and cerebral blood flow (CBF) measurements. We found that compared with healthy subjects, there was a profound reduction in FN passing through the SN in PD. FA in the SN and CBF in the caudate nucleus were inversely correlated with motor dysfunction. A negative correlation was observed between FA in the hippocampus (Hip) and the NMSS-Mood score, whereas CBF in the Hip and the prefrontal cortex(PFC) correlated with declined cognition. Stratified five-fold cross-validation identified FA in the SN(FA-SNAv), CBF in the PFC(CBF-PFCAv) and FA in the parietal white matter(FA-PWMAv), and the combination of these measurements offered relatively high accuracy (AUC 0.975, 90% sensitivity and 100% specificity) in distinguishing those with early PD from healthy subjects. We demonstrate that the decreased FNs through SN in combination with changes in FA-SNAv, CBF-PFCAv and FA-PWMAv values might serve as potential markers of early-stage PD.

  14. Early detection of CLas infections in citrus

    Science.gov (United States)

    “Early” detection of CLas infection is essential to minimize the risk of Huanglongbing (HLB) epidemics in areas where the pathogen has been recently introduced. Any delay in confirmation of CLas infection results in delays of regulatory and management actions, and increased spread of the pathogen ev...

  15. Early detection and assertive community treatment of young psychotics

    DEFF Research Database (Denmark)

    Jørgensen, P; Nordentoft, M; Abel, M B

    2000-01-01

    Recent research indicates that early detection of young persons suffering from psychosis and subsequent intensive intervention enhances treatment response and prognosis, but the data are only preliminary and suggestive....

  16. Early Detection of Viral Hepatitis Can Save Lives - PSA (:30)

    Centers for Disease Control (CDC) Podcasts

    2010-05-12

    Early detection of viral hepatitis can help prevent liver damage, cirrhosis, and even liver cancer.  Created: 5/12/2010 by Centers for Disease Control and Prevention (CDC).   Date Released: 5/12/2010.

  17. One Step Quick Detection of Cancer Cell Surface Marker by Integrated NiFe-based Magnetic Biosensing Cell Cultural Chip

    Institute of Scientific and Technical Information of China (English)

    Chenchen Bao; Lei Chen; Tao Wang; Chong Lei; Furong Tian; Daxiang Cui; Yong Zhou

    2013-01-01

    RGD peptides has been used to detect cell surface integrin and direct clinical effective therapeutic drug selection. Herein we report that a quick one step detection of cell surface marker that was realized by a specially designed NiFe-based magnetic biosensing cell chip combined with functionalized magnetic nanoparti-cles. Magnetic nanoparticles with 20-30 nm in diameter were prepared by coprecipitation and modified with RGD-4C, and the resultant RGD-functionalized magnetic nanoparticles were used for targeting cancer cells cul-tured on the NiFe-based magnetic biosensing chip and distinguish the amount of cell surface receptor-integrin. Cell lines such as Calu3, Hela, A549, CaFbr, HEK293 and HUVEC exhibiting different integrin expression were chosen as test samples. Calu3, Hela, HEK293 and HUVEC cells were successfully identified. This approach has advantages in the qualitative screening test. Compared with traditional method, it is fast, sensitive, low cost, easy-operative, and needs very little human intervention. The novel method has great potential in applications such as fast clinical cell surface marker detection, and diagnosis of early cancer, and can be easily extended to other biomedical applications based on molecular recognition.

  18. Early-stage tumor detection using photoacoustic microscopy: a pattern recognition approach

    Science.gov (United States)

    Yeh, Chenghung; Wang, Liang; Liang, Jinyang; Zhou, Yong; Hu, Song; Sohn, Rebecca E.; Arbeit, Jeffrey M.; Wang, Lihong V.

    2017-03-01

    We report photoacoustic microscopy (PAM) of arteriovenous (AV) shunts in early stage tumors in vivo, and develop a pattern recognition framework for computerized tumor detection. Here, using a high-resolution photoacoustic microscope, we implement a new blood oxygenation (sO2)-based disease marker induced by the AV shunt effect in tumor angiogenesis. We discovered a striking biological phenomenon: There can be two dramatically different sO2 values in bloodstreams flowing side-by-side in a single vessel. By tracing abnormal sO2 values in the blood vessels, we can identify a tumor region at an early stage. To further automate tumor detection based on our findings, we adopt widely used pattern recognition methods and develop an efficient computerized classification framework. The test result shows over 80% averaged detection accuracy with false positive contributing 18.52% of error test samples on a 50 PAM image dataset.

  19. A Cell-Based Approach to Early Pancreatic Cancer Detection

    Science.gov (United States)

    2016-10-01

    Award Number: W81XWH-15-1-0457 TITLE: A Cell-Based Approach to Early Pancreatic Cancer Detection PRINCIPAL INVESTIGATOR: Dr. Ben Stanger...SUBTITLE 5a. CONTRACT NUMBER A Cell-Based Approach to Early Pancreatic Cancer Detection 5b. GRANT NUMBER W81XWH-15-1-0457 5c. PROGRAM ELEMENT NUMBER 6...pancreatic cancer patients. 15. SUBJECT TERMS Pancreatic cancer , metastasis, circulating tumor cells 16. SECURITY CLASSIFICATION OF: U 17. LIMITATION

  20. Early detection of age related macular degeneration: current status

    OpenAIRE

    Schwartz, Roy; Loewenstein, Anat

    2015-01-01

    Early diagnosis and treatment of choroidal neovascularization (CNV), a main cause of severe vision loss in age related macular degeneration (AMD), is crucial in order to preserve vision and the quality of life of patients. This review summarizes current literature on the subject of early detection of CNV, both in the clinic setting and mainly in the patient’s home. New technologies are evolving to allow for earlier detection and thus vision preservation in AMD patients.

  1. Early detection of age related macular degeneration: current status.

    Science.gov (United States)

    Schwartz, Roy; Loewenstein, Anat

    2015-01-01

    Early diagnosis and treatment of choroidal neovascularization (CNV), a main cause of severe vision loss in age related macular degeneration (AMD), is crucial in order to preserve vision and the quality of life of patients. This review summarizes current literature on the subject of early detection of CNV, both in the clinic setting and mainly in the patient's home. New technologies are evolving to allow for earlier detection and thus vision preservation in AMD patients.

  2. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat.

    Science.gov (United States)

    Aggarwal, R; Gupta, S; Banerjee, S; Singh, V B

    2011-11-01

    Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

  3. Early detection of peroneal neuropathy by ultrasound

    Directory of Open Access Journals (Sweden)

    Shih-Wei Huang

    2014-01-01

    Full Text Available A 12 year old boy presented with ankle sprain. The physical examination revealed mild weakness of ankle dorsiflexion. An ultrasound was done for the soft tissues of the ankle. In addition to relative atrophy of the peroneus longus muscle, a compressive common peroneal nerve (CPN lesion with a synovial cyst at the level of the proximal tibiofibular joint (PTFJ was accidently found. Since there were features of CPN compression by the synovial cyst, total excision of the cyst was performed. After the operation, muscle strength improved and the neurological deficit subsided. Therefore, the early diagnosis of PTFJ synovial cyst with nerve injury was crucial in order to achieve a better result. The obscure nature of clinical presentations can delay the diagnosis, which may potentially lead to a poor prognosis after treatment in such cases. This report highlights the fact that ankle sprain do need a thorough clinical work up in some cases.

  4. Expression of regulatory T cell (Treg) activation markers in endometrial tissues from early and late pregnancy in the feline immunodeficiency virus (FIV)-infected cat.

    Science.gov (United States)

    Lockett, N N; Scott, V L; Boudreaux, C E; Clay, B T; Pruett, S B; Ryan, P L; Coats, K S

    2010-09-01

    Regulatory T cells (Tregs) support pregnancy maintenance by suppressing placental inflammation, while diminished Treg function may accompany reproductive failure. Experimental FIV infection frequently results in vertical transmission and increased pregnancy failure in the cat. The mechanism of reproductive compromise is unknown. We hypothesized that FIV infection alters endometrial Treg population dynamics and function, potentiating vertical transmission and reproductive failure. RNA collected from early and late gestation reproductive tissue and fetuses from FIV infected and control cats was probed for expression of FIV gag and Treg markers CD25, FOXP3, and CTLA4, using real time reverse-transcriptase (RT)-PCR. Frequent placental and fetal infection and reproductive failure were detected at early and late pregnancy. Expression of FOXP3 and CTLA4 was higher in early gestation tissues from control cats. FIV infection significantly reduced expression of FOXP3 and CTLA4 at early, but not late pregnancy. At late pregnancy, CTLA4 was expressed to higher levels in infected tissues. The number of tissues with decreased co-expression of FOXP3 and CTLA4 was significant in infected cats at early pregnancy. No significant changes in CD25 expression occurred between FIV-infected and control animals at early or late pregnancy. Differences in Treg marker expression were not significant between viable and non-viable pregnancies in infected cats. The detection of Treg markers in these feline tissues provides the first evidence of feline endometrial Tregs and suggests that such cells diminish as pregnancy progresses. These cells may be depleted or rendered less functional by viral infection, but understanding their role in pregnancy requires further study.

  5. Early detection of dental caries using photoacoustics

    Science.gov (United States)

    Kim, K.; Witte, R.; Koh, I.; Ashkenazi, S.; O'Donnell, M.

    2006-02-01

    For decades, visual, tactile and radiographic examinations have been the standard for diagnosing caries. Nonetheless, the extent of variation in the diagnosis of dental caries is substantial among dental practitioners using these traditional techniques. Therefore, a more reliable standard for detecting incipient caries would be desirable. Using photoacoustics, near-infrared (NIR) optical contrast between sound and carious dental tissues can be relatively easily and accurately detected at ultrasound resolution. In this paper, a pulsed laser (Nd:YAG, Quanta-Ray) was used to probe extracted human molars at different disease stages determined from periapical radiographs. Both fundamental (1064nm) and first harmonic (532nm) pulses (15ns pulse length, 100mJ at fundamental and 9mJ at first harmonic , 10Hz pulse repetition rate) were used to illuminate the occlusal surface of tooth samples placed in a water tank. The photoacoustic signal was recorded with an unfocused wideband single-element piezoelectric transducer (centered at 12 MHz, bandwidth 15 MHz) positioned at small angle (less than 30 degrees) to the laser beam close to the occlusal surface. At the fundamental wavelength, total photoacoustic energy increases from normal to incipient stage disease by as much as a factor of 10. Differences between photoacoustic energy at the fundamental and first harmonic wavelength further indicate spectral absorption changes of the underlying structure with disease progression. Using a focused laser beam, an extracted molar with suspected incipient caries was scanned along the occulusal surface to help localize the caries inside enamel and dentin. The significantly increasing photoacoustic signal at a specific scan line both at fundamental and first harmonic indicates the local development of the incipient caries. The photoacoustic results compare well with visual inspection after layer by layer dissection. Preliminary results demonstrate the feasibility of detecting incipient

  6. Tumor Interstitial Fluid Pressure as an Early-Response Marker for Anticancer Therapeutics

    Directory of Open Access Journals (Sweden)

    Stephane Ferretti

    2009-09-01

    Full Text Available Solid tumors have a raised interstitial fluid pressure (IFP due to high vessel permeability, low lymphatic drainage, poor perfusion, and high cell density around the blood vessels. To investigate tumor IFP as an early-response biomarker, we have tested the effect of seven anticancer chemotherapeutics including cytotoxics and targeted cytostatics in 13 experimental tumor models. IFP was recorded with the wick-in-needle method. Models were either ectopic or orthotopic and included mouse and rat syngeneic as well as human xenografts in nude mice. The mean basal IFP was between 4.4 and 15.2mm Hg; IFP was lowest in human tumor xenografts and highest in rat syngeneic models. Where measured, basal IFP correlated positively with relative tumor blood volume (rTBV determined by dynamic contrast-enhanced magnetic resonance imaging. Most chemotherapeutics sooner (2 or 3 days or later (6 or 7 days lowered tumor IFP significantly, and the cytotoxic patupilone caused the greatest decrease in IFP. In rat mammary orthotopic BN472 tumors, significant drug-induced decreases in IFP and rTBV correlated positively with each other for both patupilone and the cytostatic vatalanib. In the two orthotopic models studied, early decreases in IFP were significantly (P ≤ .005 correlated with late changes in tumor volume. Thus, drug-induced decreases in tumor IFP are an early marker of response to therapy, which could aid clinical development.

  7. Imprecise vowel articulation as a potential early marker of Parkinson's disease: effect of speaking task.

    Science.gov (United States)

    Rusz, Jan; Cmejla, Roman; Tykalova, Tereza; Ruzickova, Hana; Klempir, Jiri; Majerova, Veronika; Picmausova, Jana; Roth, Jan; Ruzicka, Evzen

    2013-09-01

    The purpose of this study was to analyze vowel articulation across various speaking tasks in a group of 20 early Parkinson's disease (PD) individuals prior to pharmacotherapy. Vowels were extracted from sustained phonation, sentence repetition, reading passage, and monologue. Acoustic analysis was based upon measures of the first (F1) and second (F2) formant of the vowels /a/, /i/, and /u/, vowel space area (VSA), F2i/F2u and vowel articulation index (VAI). Parkinsonian speakers manifested abnormalities in vowel articulation across F2u, VSA, F2i/F2u, and VAI in all speaking tasks except sustained phonation, compared to 15 age-matched healthy control participants. Findings suggest that sustained phonation is an inappropriate task to investigate vowel articulation in early PD. In contrast, monologue was the most sensitive in differentiating between controls and PD patients, with classification accuracy up to 80%. Measurements of vowel articulation were able to capture even minor abnormalities in speech of PD patients with no perceptible dysarthria. In conclusion, impaired vowel articulation may be considered as a possible early marker of PD. A certain type of speaking task can exert significant influence on vowel articulation. Specifically, complex tasks such as monologue are more likely to elicit articulatory deficits in parkinsonian speech, compared to other speaking tasks.

  8. Tumor interstitial fluid pressure as an early-response marker for anticancer therapeutics.

    Science.gov (United States)

    Ferretti, Stephane; Allegrini, Peter R; Becquet, Mike M; McSheehy, Paul Mj

    2009-09-01

    Solid tumors have a raised interstitial fluid pressure (IFP) due to high vessel permeability, low lymphatic drainage, poor perfusion, and high cell density around the blood vessels. To investigate tumor IFP as an early-response biomarker, we have tested the effect of seven anticancer chemotherapeutics including cytotoxics and targeted cytostatics in 13 experimental tumor models. IFP was recorded with the wick-in-needle method. Models were either ectopic or orthotopic and included mouse and rat syngeneic as well as human xenografts in nude mice. The mean basal IFP was between 4.4 and 15.2mm Hg; IFP was lowest in human tumor xenografts and highest in rat syngeneic models. Where measured, basal IFP correlated positively with relative tumor blood volume (rTBV) determined by dynamic contrast-enhanced magnetic resonance imaging. Most chemotherapeutics sooner (2 or 3 days) or later (6 or 7 days) lowered tumor IFP significantly, and the cytotoxic patupilone caused the greatest decrease in IFP. In rat mammary orthotopic BN472 tumors, significant drug-induced decreases in IFP and rTBV correlated positively with each other for both patupilone and the cytostatic vatalanib. In the two orthotopic models studied, early decreases in IFP were significantly (P tumor volume. Thus, drug-induced decreases in tumor IFP are an early marker of response to therapy, which could aid clinical development.

  9. Early hearing detection and intervention in South Africa.

    Science.gov (United States)

    Swanepoel, DeWet; Störbeck, Claudine; Friedland, Peter

    2009-06-01

    Early hearing detection and intervention programs have become the standard of care to ensure optimal outcomes for infants with hearing loss, their families and society at large. The overwhelming majority of infants with congenital or early-onset permanent bilateral hearing loss are however born in developing countries like South Africa where services are scarce and awareness poor. Despite its comparatively well-developed economic and reasonably developed health care infrastructure in sub-Saharan Africa, limited information on infant hearing loss and the status of early hearing detection and intervention has been available for South Africa. Recently however, an increasing number of initiatives and reports have highlighted the extent of infant hearing loss and the status of identification and intervention services offered in the country. This report provides a review of the available evidence on infant hearing loss and the status of current early hearing detection and intervention services in South Africa.

  10. Detecting autologous blood transfusions: a comparison of three passport approaches and four blood markers.

    Science.gov (United States)

    Mørkeberg, J; Sharpe, K; Belhage, B; Damsgaard, R; Schmidt, W; Prommer, N; Gore, C J; Ashenden, M J

    2011-04-01

    Blood passport has been suggested as an indirect tool to detect various kinds of blood manipulations. Autologous blood transfusions are currently undetectable, and the objective of this study was to examine the sensitivities of different blood markers and blood passport approaches in order to determine the best approach to detect autologous blood transfusions. Twenty-nine subjects were transfused with either one (n=8) or three (n=21) bags of autologous blood. Hemoglobin concentration ([Hb]), percentage of reticulocytes (%ret) and hemoglobin mass (Hbmass) were measured 1 day before reinfusion and six times after reinfusion. The sensitivity and specificity of a novel marker, Hbmr (based on Hbmass and %ret), was evaluated together with [Hb], Hbmass and OFF-hr by different passport methods. Our novel Hbmr marker showed superior sensitivity in detecting the highest dosage of transfused blood, with OFF-hr showing equal or superior sensitivities at lower dosages. Hbmr and OFF-hr showed superior but equal sensitivities from 1 to 4 weeks after transfusion compared with [Hb] and Hbmass, with Hbmass being the only tenable prospect to detect acute transfusions. Because autologous blood transfusions can be an acute practice with blood withdrawal and reinfusion within a few days, Hbmass seems to be the only option for revealing this practice. © 2009 John Wiley & Sons A/S.

  11. CLINICAL USE OF COMBINED DETECTION WITH TUMOR MARKERS FOR PANCREATIC CANCER

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective To explore the value of clinical use of combined detection with tumor markers for pancreatic cancer. Methods Tumor markers CA242,CA19-9 and CA50 in serum of 32 patinets with pancreatic cancer;26 patients with non-pancreatic digestive tract cancers and 24 patietns with benign pancreatic or biliary tract diseases were measured by immunoradiometric assay (IRMA). Results The levels of three markers in serum and positive rates of patients with pancreatic cancer were higher than those of other patients. The effect of measurement combining CA242 with CA19-9 was the best. The sensitivity ,specificity and accuracy of diagnosis for pancreatic cancer were 92.6%, 73.8% and 81.2% respectively. The levels of CA242 and CA19-9 were positively relative to burden of pancreatic cancer, and serum levels of these two markers of patients with resectable pancreatic cancer were lower than those with unresectable, but on difference was observed for CA50. Conclusion Combined detection of serum CA242 and CA19-9 could prove the effectual indicator for finding the patients with pancreatic cancer in high risk population or for resectable pancreatic cancer. Pre-operative measurement of serum levels of CA242 and CA19-9 is helpful to evaluate the burden of the tumors and possiblity of resect for pancreatic cancers.

  12. [Confocal microscopy as an early relapse marker after keratoplasty due to Fusarium solani keratitis].

    Science.gov (United States)

    Daas, L; Bischoff-Jung, M; Viestenz, A; Seitz, B; Viestenz, A

    2017-01-01

    In the case of therapy-resistant keratitis an infection with Fusarium solani should be taken into consideration as a rare but very severe eye disease. In the majority of cases Fusarium solani keratitis will result in a protracted clinical course despite aggressive medicinal and surgical interventions. We describe the case of a referred patient after intensive topical, intracameral and systemic antibacterial and antimycotic therapy as well as surgical treatment with emergency keratoplasty à chaud because of Fusarium solani keratitis. The patient presented to our department with persistent discomfort for further therapeutic interventions. Using confocal microscopy we were able to demonstrate the presence of fungal hyphae in the host cornea and the graft, which was important for making further surgical decisions. Furthermore, this emphasizes the role of confocal microscopy as an early relapse marker during the clinical monitoring.

  13. Cortico-amygdala coupling as a marker of early relapse risk in cocaine-addicted individuals

    Directory of Open Access Journals (Sweden)

    Meredith J Mchugh

    2014-02-01

    Full Text Available Addiction to cocaine is a chronic condition characterized by high rates of early relapse. This study builds on efforts to identify neural markers of relapse risk by studying resting state functional connectivity (rsFC in neural circuits arising from the amygdala; a brain region implicated in relapse-related processes including craving and reactivity to stress following acute and protracted withdrawal from cocaine. Whole-brain resting-state fMRI connectivity (6 min was assessed in 45 cocaine-addicted individuals and 22 healthy controls. Cocaine-addicted individuals completed scans in the final week of a residential treatment episode. To approximate preclinical models of relapse-related circuitry separate seeds were derived for the left and right basolateral (BLA and corticomedial (CMA amygdala. Participants also completed the Iowa Gambling Task, Wisconsin Card Sorting Test, Cocaine Craving Questionnaire, Obsessive Compulsive Cocaine Use scale, Temperament and Character Inventory and the NEO-PI-R. Relapse within the first 30 days post-treatment (n = 24 was associated with reduced rsFC between the left CMA and ventromedial prefrontal cortex/rostral anterior cingulate cortex (vmPFC/rACC relative to cocaine-addicted individuals who remained abstinent (non-relapse, n = 21. Non-relapse participants evidenced reduced rsFC between the bilateral BLA and visual processing regions (lingual gyrus/cuneus compared to controls and relapsed participants. Early relapse was associated with fewer years of education but unrelated to trait reactivity to stress, neurocognitive and clinical characteristics or cocaine use history. Findings suggest that rsFC within neural circuits implicated in preclinical models of relapse may provide a promising marker of relapse risk in cocaine-addicted individuals. Future efforts to replicate the current findings and alter connectivity within these circuits may yield novel interventions and improve treatment outcomes.

  14. Detection of trisomy 18 and trisomy 13 using first and second trimester Down's syndrome screening markers.

    Science.gov (United States)

    Bestwick, Jonathan P; Huttly, Wayne J; Wald, Nicholas J

    2013-06-01

    To estimate the detection rates (DRs) and false-positive rates (FPRs) in the incidental identification of trisomy 18 (T18) and trisomy 13 (T13) as part of antenatal screening for Down's syndrome (DS) using the Combined, Quadruple and Integrated test markers. Screening marker levels on 224 T18 and 67 T13 pregnancies screened for DS were evaluated. Estimated means, standard deviations and correlation coefficients were used with published estimates for unaffected pregnancies to derive detection algorithms for the two disorders. DRs and FPRs of the algorithms were estimated using Monte Carlo simulation. In T18 and T13 pregnancies first trimester nuchal translucency was raised, free β-human chorionic gonadotrophin (hCG) and pregnancy associated plasma protein-A reduced. In T18 pregnancies second trimester alphafetoprotein, unconjugated oestriol and free β-hCG were reduced. In T13 pregnancies second trimester inhibin-A was raised. These markers specified T18 and T13 algorithms. The DS Combined test algorithm detected 42% of T18 and 59% of T13 (2.00% FPR); 88% and 74% by adding the T18 Combined test algorithm (2.17% FPR) and 89% and 75% by further adding the T13 Combined test algorithm (2.19% FPR). The corresponding detection rates for the Quadruple test were: 5% and 21% (2.00% FPR), 59% and 21% (2.16% FPR) and 59% and 24% (2.28% FPR), and for the Integrated test were: 40% and 60% (2.00% FPR), 92% and 68% (2.12% FPR) and 92% and 74% (2.18% FPR).[Corrected] Antenatal screening for DS detects about 40% of T18 and about 60% of T13 pregnancies. The addition of a T18 algorithm substantially increases the detection of both trisomies with a small increase in the FPR. The further addition of a T13 algorithm results in a small increase in the detection of T13.

  15. Comparison Between AFLP and RFLP Markers in Detecting the Diversity of Rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    CHEN Liang; LIANG Chun-yang; SUN Chuan-qing; JIN De-min; JIANG Ting-bo; WANG Bin; WANG Xiang-kun

    2002-01-01

    AFLP and RFLP were used to study the diversity of 20 rice cultivars. 15 primer combinations were used in the AFLP analysis and 47 - 118 bands were amplified in each lane. A total of 107 polymorphic bands were detected in the RFLP analysis using 49 RFLP probes. The cluster analysis based on RFLP data showed that 20 rice cultivars could be divided into an indica group and a japonica group, as did the AFLP data; however AFLP is more suitable in detecting the difference of pedigree and ecotype among the 20 cultivars.The genetic distance based on AFLP and RFLP data showed the same tendency, but AFLP markers increased the measure of genetic distance among intra-subspecific cultivars and decreased the measure of genetic distance among inter-subspecific cultivars relative to RFLP markers. That indicated that AFLP is more suitable than RFLP in the diversity study and RFLP is more suitable to study the indica-japonica differentiation of cultivars.

  16. Genetic markers of adult obesity risk are associated with greater early infancy weight gain and growth.

    Directory of Open Access Journals (Sweden)

    Cathy E Elks

    2010-05-01

    Full Text Available BACKGROUND: Genome-wide studies have identified several common genetic variants that are robustly associated with adult obesity risk. Exploration of these genotype associations in children may provide insights into the timing of weight changes leading to adult obesity. METHODS AND FINDINGS: Children from the Avon Longitudinal Study of Parents and Children (ALSPAC birth cohort were genotyped for ten genetic variants previously associated with adult BMI. Eight variants that showed individual associations with childhood BMI (in/near: FTO, MC4R, TMEM18, GNPDA2, KCTD15, NEGR1, BDNF, and ETV5 were used to derive an "obesity-risk-allele score" comprising the total number of risk alleles (range: 2-15 alleles in each child with complete genotype data (n = 7,146. Repeated measurements of weight, length/height, and body mass index from birth to age 11 years were expressed as standard deviation scores (SDS. Early infancy was defined as birth to age 6 weeks, and early infancy failure to thrive was defined as weight gain between below the 5th centile, adjusted for birth weight. The obesity-risk-allele score showed little association with birth weight (regression coefficient: 0.01 SDS per allele; 95% CI 0.00-0.02, but had an apparently much larger positive effect on early infancy weight gain (0.119 SDS/allele/year; 0.023-0.216 than on subsequent childhood weight gain (0.004 SDS/allele/year; 0.004-0.005. The obesity-risk-allele score was also positively associated with early infancy length gain (0.158 SDS/allele/year; 0.032-0.284 and with reduced risk of early infancy failure to thrive (odds ratio = 0.92 per allele; 0.86-0.98; p = 0.009. CONCLUSIONS: The use of robust genetic markers identified greater early infancy gains in weight and length as being on the pathway to adult obesity risk in a contemporary birth cohort.

  17. Early metabolic markers that anticipate loss of insulin independence in type 1 diabetic islet allograft recipients.

    Science.gov (United States)

    Hirsch, D; Odorico, J; Danobeitia, J S; Alejandro, R; Rickels, M R; Hanson, M; Radke, N; Baidal, D; Hullett, D; Naji, A; Ricordi, C; Kaufman, D; Fernandez, L

    2012-05-01

    The objective of this study was to identify predictors of insulin independence and to establish the best clinical tools to follow patients after pancreatic islet transplantation (PIT). Sequential metabolic responses to intravenous (I.V.) glucose (I.V. glucose tolerance test [IVGTT]), arginine and glucose-potentiated arginine (glucose-potentiated arginine-induced insulin secretion [GPAIS]) were obtained from 30 patients. We determined the correlation between transplanted islet mass and islet engraftment and tested the ability of each assay to predict return to exogenous insulin therapy. We found transplanted islet mass within an average of 16 709 islet equivalents per kg body weight (IEQ/kg BW; range between 6602 and 29 614 IEQ/kg BW) to be a poor predictor of insulin independence at 1 year, having a poor correlation between transplanted islet mass and islet engraftment. Acute insulin response to IVGTT (AIR(GLU) ) and GPAIS (AIR(max) ) were the most accurate methods to determine suboptimal islet mass engraftment. AIR(GLU) performed 3 months after transplant also proved to be a robust early metabolic marker to predict return to insulin therapy and its value was positively correlated with duration of insulin independence. In conclusion, AIR(GLU) is an early metabolic assay capable of anticipating loss of insulin independence at 1 year in T1D patients undergoing PIT and constitutes a valuable, simple and reliable method to follow patients after transplant.

  18. Protein Biomarkers for the Early Detection of Breast Cancer

    Directory of Open Access Journals (Sweden)

    David E. Misek

    2011-01-01

    Full Text Available Advances in breast cancer control will be greatly aided by early detection so as to diagnose and treat breast cancer in its preinvasive state prior to metastasis. For breast cancer, the second leading cause of cancer-related death among women in the United States, early detection does allow for increased treatment options, including surgical resection, with a corresponding better patient response. Unfortunately, however, many patients' tumors are diagnosed following metastasis, thus making it more difficult to successfully treat the malignancy. There are, at present, no existing validated plasma/serum biomarkers for breast cancer. Only a few biomarkers (such as HER-2/neu, estrogen receptor, and progesterone receptor have utility for diagnosis and prognosis. Thus, there is a great need for new biomarkers for breast cancer. This paper will focus on the identification of new serum protein biomarkers with utility for the early detection of breast cancer.

  19. DETECTION OF SENTINEL LYMPH NODE IN EARLY CERVICAL CANCER

    Institute of Scientific and Technical Information of China (English)

    刘琳; 李斌; 章文华

    2004-01-01

    Objective: To assess the value of sentinel lymph node (SLN) localization by lymphoscintigraphy and gamma probe detection in early cervical cancer. Methods: A total of 27 patients with operable invasive early cervical cancer and clinically proved negative pelvic lymph nodes were included in this study. The 99Tcm-dextran of 74 MBq (2 mCi) was injected around the cervix at 2( and 10(. Lymphoscintigraphy and gamma probe detection were used to find the SLN. Results: The SLN was identified in 27 patients. The sensitivity and specificity of the SLN detection to predict the metastasis of the pelvic lymph node were 100% and 100% respectively. Conclusion: Identification of the SLN using radionuclide is feasible and possible in women with early cervical cancer.

  20. Nanoparticle Detection of Urinary Markers for Point-of-Care Diagnosis of Kidney Injury.

    Directory of Open Access Journals (Sweden)

    Hyun Jung Chung

    Full Text Available The high incidence of acute and chronic kidney injury due to various environmental factors such as heavy metals or chemicals has been a major problem in developing countries. However, the diagnosis of kidney injury in these areas can be more challenging due to the lack of highly sensitive and specific techniques that can be applied in point-of-care settings. To address this, we have developed a technique called 'micro-urine nanoparticle detection (μUNPD', that allows the detection of trace amounts of molecular markers in urine. Specifically, this technique utilizes an automated on-chip assay followed by detection with a hand-held device for the read-out. Using the μUNPD technology, the kidney injury markers KIM-1 and Cystatin C were detected down to concentrations of 0.1 ng/ml and 20 ng/ml respectively, which meets the cut-off range required to identify patients with acute or chronic kidney injury. Thus, we show that the μUNPD technology enables point of care and non-invasive detection of kidney injury, and has potential for applications in diagnosing kidney injury with high sensitivity in resource-limited settings.

  1. Nanoparticle Detection of Urinary Markers for Point-of-Care Diagnosis of Kidney Injury.

    Science.gov (United States)

    Chung, Hyun Jung; Pellegrini, Kathryn L; Chung, Jaehoon; Wanigasuriya, Kamani; Jayawardene, Innocent; Lee, Kyungheon; Lee, Hakho; Vaidya, Vishal S; Weissleder, Ralph

    2015-01-01

    The high incidence of acute and chronic kidney injury due to various environmental factors such as heavy metals or chemicals has been a major problem in developing countries. However, the diagnosis of kidney injury in these areas can be more challenging due to the lack of highly sensitive and specific techniques that can be applied in point-of-care settings. To address this, we have developed a technique called 'micro-urine nanoparticle detection (μUNPD)', that allows the detection of trace amounts of molecular markers in urine. Specifically, this technique utilizes an automated on-chip assay followed by detection with a hand-held device for the read-out. Using the μUNPD technology, the kidney injury markers KIM-1 and Cystatin C were detected down to concentrations of 0.1 ng/ml and 20 ng/ml respectively, which meets the cut-off range required to identify patients with acute or chronic kidney injury. Thus, we show that the μUNPD technology enables point of care and non-invasive detection of kidney injury, and has potential for applications in diagnosing kidney injury with high sensitivity in resource-limited settings.

  2. Serologic markers for detecting malaria in areas of low endemicity, Somalia, 2008.

    Science.gov (United States)

    Bousema, Teun; Youssef, Randa M; Cook, Jackie; Cox, Jonathan; Alegana, Victor A; Amran, Jamal; Noor, Abdisalan M; Snow, Robert W; Drakeley, Chris

    2010-03-01

    Areas in which malaria is not highly endemic are suitable for malaria elimination, but assessing transmission is difficult because of lack of sensitivity of commonly used methods. We evaluated serologic markers for detecting variation in malaria exposure in Somalia. Plasmodium falciparum or P. vivax was not detected by microscopy in cross-sectional surveys of samples from persons during the dry (0/1,178) and wet (0/1,128) seasons. Antibody responses against P. falciparum or P. vivax were detected in 17.9% (179/1,001) and 19.3% (202/1,044) of persons tested. Reactivity against P. falciparum was significantly different between 3 villages (p<0.001); clusters of seroreactivity were present. Distance to the nearest seasonal river was negatively associated with P. falciparum (p = 0.028) and P. vivax seroreactivity (p = 0.016). Serologic markers are a promising tool for detecting spatial variation in malaria exposure and evaluating malaria control efforts in areas where transmission has decreased to levels below the detection limit of microscopy.

  3. Development of an assisting detection system for early infarct diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Sim, K. S.; Nia, M. E.; Ee, C. S. [Faculty of Engineering and Technology, Multimedia University, Melaka (Malaysia)

    2015-04-24

    In this paper, a detection assisting system for early infarct detection is developed. This new developed method is used to assist the medical practitioners to diagnose infarct from computed tomography images of brain. Using this assisting system, the infarct could be diagnosed at earlier stages. The non-contrast computed tomography (NCCT) brain images are the data set used for this system. Detection module extracts the pixel data from NCCT brain images, and produces the colourized version of images. The proposed method showed great potential in detecting infarct, and helps medical practitioners to make earlier and better diagnoses.

  4. Limitations of Colposcopy in Early Invasive Cervical Cancer Detection

    OpenAIRE

    Grubišić, Goran

    2007-01-01

    Colposcopy is a key element in the diagnostic chain required to reduce cervical cancer mortality but it has limitations in the diagnosis of malignant disease. In the Republic of Croatia the Croatian Society for Colposcopy and Cervical Pathology started constructing guidelines for early detection, therapy and follow-up of patients with early invasive cervical cancer in order to achieve the best possible results in diagnosis, therapy and follow-up. From 2001 to 2006 Croatian society ...

  5. Early detection of Alzheimer's disease using MRI hippocampal texture

    DEFF Research Database (Denmark)

    Sørensen, Lauge; Igel, Christian; Hansen, Naja Liv

    2016-01-01

    Cognitive impairment in patients with Alzheimer's disease (AD) is associated with reduction in hippocampal volume in magnetic resonance imaging (MRI). However, it is unknown whether hippocampal texture changes in persons with mild cognitive impairment (MCI) that does not have a change...... in hippocampal volume. We tested the hypothesis that hippocampal texture has association to early cognitive loss beyond that of volumetric changes. The texture marker was trained and evaluated using T1-weighted MRI scans from the Alzheimer's Disease Neuroimaging Initiative (ADNI) database, and subsequently...

  6. Use of Bioluminescence Markers To Detect Pseudomonas spp. in the Rhizosphere

    Science.gov (United States)

    de Weger, Letty A.; Dunbar, Paul; Mahafee, Walter F.; Lugtenberg, Ben J. J.; Sayler, Gary S.

    1991-01-01

    The use of bioluminescence as a sensitive marker for detection of Pseudomonas spp. in the rhizosphere was investigated. Continuous expression of the luxCDABE genes, required for bioluminescence, was not detectable in the rhizosphere. However, when either a naphthalene-inducible luxCDABE construct or a constitutive luxAB construct (coding only for the luciferase) was introduced into the Pseudomonas cells, light emission could be initiated just prior to measurement by the addition of naphthalene or the substrate for luciferase, n-decyl aldehyde, respectively. These Pseudomonas cells could successfully be detected in the rhizosphere by using autophotography or optical fiber light measurement techniques. Detection required the presence of 103 to 104 CFU/cm of root, showing that the bioluminescence technique is at least 1,000-fold more sensitive than β-galactosidase-based systems. Images PMID:16348610

  7. Early Detection of Rogue Waves Using Compressive Sensing

    CERN Document Server

    Bayindir, Cihan

    2016-01-01

    We discuss the possible usage of the compressive sampling for the early detection of rogue waves in a chaotic sea state. One of the promising techniques for the early detection of the oceanic rogue waves is to measure the triangular Fourier spectra which begin to appear at the early stages of their development. For the early detection of the rogue waves it is possible to treat such a spectrum as a sparse signal since we would mainly be interested in the high amplitude triangular region located at the central wavenumber. Therefore compressive sampling can be a very efficient tool for the rogue wave early warning systems. Compressed measurements can be acquired by remote sensing techniques such as coherent SAR which measure the ocean surface fluctuation or by insitu techniques such as spectra measuring tools mounted on a ship hull or bottom mounted pressure gauges. By employing a numerical approach we show that triangular Fourier spectra can be sensed by compressed measurements at the early stages of the develo...

  8. Persistence of host-associated Bacteroidales gene markers and their quantitative detection in an urban and agricultural mixed prairie watershed.

    Science.gov (United States)

    Tambalo, Dinah D; Fremaux, Bastien; Boa, Tyler; Yost, Christopher K

    2012-06-01

    Microbial source tracking is an emerging tool developed to protect water sources from faecal pollution. In this study, we evaluated the suitability of real time-quantitative PCR (qPCR) Taqman assays developed for detection of host-associated Bacteroidales markers in a prairie watershed. The qPCR primers and probes used in this study exhibited high accuracy (88-96% sensitivity and ≥ 99% host specificity) in detecting Bacteroidales spp. that are associated with faeces from humans, ruminants, bovines, and horses. The ruminant- and human-associated markers were also found in high concentrations within individual faecal samples, ranging from 3.4 to 7.3 log(10) marker copy numberg(-1) of individual host faeces. Following validation of host sensitivity and specificity, the host-associated Bacteroidales markers were detected in the Qu'Appelle Valley watershed of Saskatchewan, Canada which experiences a diversity of anthropogenic inputs. Concentrations of the ruminant marker were well-correlated with proximity to cattle operations and there was a correlation between the marker and Escherichia coli concentrations at these sites. Low concentrations of the human faecal marker were measured throughout the sampling sites, and may indicate a consistent influx of human faecal pollution into the watershed area. Persistence of each of the Bacteroidales host-associated marker was also studied in situ. The results indicated that the markers persist for shorter periods of time (99% decay in 15 days), suggesting they are effective at detecting recent faecal contamination events. The levels of Bacteroidales markers and E. coli counts did not correlate with the presence of the pathogenic bacteria, Salmonella spp. or Campylobacter spp. detected in the Qu'Appelle Valley. Collectively, the results obtained in this study demonstrated that the qPCR approach for detecting host-associated Bacteroidales spp. markers can be a useful tool in helping to determine host-specific impacts of faecal

  9. Changes in fractal dimension and lacunarity as early markers of UV-induced apoptosis.

    Science.gov (United States)

    Pantic, Igor; Harhaji-Trajkovic, Ljubica; Pantovic, Aleksandar; Milosevic, Nebojsa T; Trajkovic, Vladimir

    2012-06-21

    The aim of our study was to employ fractal analysis for evaluation of ultrastructural changes during early stages of apoptosis. Apoptosis was induced in U251 human glioma cell line by exposure to UVB light. The cells were visualized by optical phase-contrast microscopy and photographed before the UV treatment, immediately after the treatment, as well as at 30 min intervals during 5h observation period. For each of the 32 cells analyzed, cellular and nuclear fractal dimension, as well as nuclear lacunarity, were determined at each time point. Our data demonstrate that cellular ultrastructural complexity determined by fractal dimension and lacunarity significantly decreases after the UV irradiation, with the nuclear lacunarity being a particularly sensitive parameter in detecting early apoptosis. Importantly, fractal analysis was able to detect cellular apoptotic changes earlier than conventional flow cytometric analysis of phosphatidylserine exposure, DNA fragmentation and cell membrane permeabilization. These results indicate that fractal analysis might be a powerful and affordable method for non-invasive early identification of apoptosis in cell cultures. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Early molecular diagnosis and detection of Puccinia striiformis f. sp. tritici in China.

    Science.gov (United States)

    Lihua, C; Shichang, X; Ruiming, L; Taiguo, L; Wanquan, C

    2008-05-01

    Wheat stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici (Pst), is the most important foliar disease on wheat in China. Early molecular diagnosis and detection of stripe rust will provide a useful aid to the accurate forecast and seasonal control of this destructive disease. Our objective was to develop PCR assays for the rapid identification and detection of P. striiformis. The genomic DNA of P. striiformis and P. triticina were amplified by a pair of primers derived from conserved beta-tubulin gene sequence. A 235-bp specific DNA fragment of P. striiformis was isolated and purified. Based on its sequence, another two primer sets were designed successfully to obtain new sequence-characterized amplified region (SCAR) markers of P. striiformis, which could be amplified in all test isolates of P. striiformis, whereas no DNA fragment was obtained in other nontarget wheat pathogens. The detection limit of the primer set YR (f)/YR (r1) was 2.20 pg microl(-1). The new SCAR markers of P. striiformis can also be detected in Pst-infected wheat leaves postinoculated for 2 days. Our assays are significantly faster than the conventional methods used in the identification of P. striiformis. Development of a simple, high-throughput assay kit for the rapid diagnosis and detection of wheat stripe rust would be anticipated in a further study.

  11. Detection of early caries by laser-induced breakdown spectroscopy

    Science.gov (United States)

    Sasazawa, Shuhei; Kakino, Satoko; Matsuura, Yuji

    2015-07-01

    To improve sensitivity of dental caries detection by laser-induced breakdown spectroscopy (LIBS) analysis, it is proposed to utilize emission peaks in the ultraviolet. We newly focused on zinc whose emission peaks exist in ultraviolet because zinc exists at high concentration in the outer layer of enamel. It was shown that by using ratios between heights of an emission peak of Zn and that of Ca, the detection sensitivity and stability are largely improved. It was also shown that early caries are differentiated from healthy part by properly setting a threshold in the detected ratios. The proposed caries detection system can be applied to dental laser systems such as ones based on Er:YAG-lasers. When ablating early caries part by laser light, the system notices the dentist that the ablation of caries part is finished. We also show the intensity of emission peaks of zinc decreased with ablation with Er:YAG laser light.

  12. Comparative analyses of different genetic markers for the detection of Acanthamoeba spp. isolates.

    Science.gov (United States)

    Derda, Monika; Wojtkowiak-Giera, Agnieszka; Hadaś, Edward

    2014-09-01

    Acanthamoeba are widespread free-living amoebae which may cause granulomatous amoebic encephalitis (GAE), keratitis, skin ulcerations and disseminated tissue infection. An important diagnostic and prognostic factor for the treatment of infection is a quick and correct diagnosis of amoebae strains. The aim of our study was to develop a rapid method for detection and identification of pathogenic Acanthamoeba spp. strains from diagnostic material collected from water. In this study we analysed five amplification-based genetic markers (Aca 16S, Ac6/210, GP, JDP, Nelson) used for identification of pathogenic Acanthamoeba spp. strains isolated in water sources in Poland, Iceland and Sweden. Our results demonstrated the presence of pathogenic Acanthamoeba strains in tap water. PCR assay appeared to be a more rapid and sensitive method to detect the presence of amoebae than the limited conventional techniques. Based on our observations, we can confirm that the use of four out of five genetic markers (Aca 16S, Ac 6/210, JDP, GP, Nelson) may be helpful in identification of Acanthamoeba spp. strains, but only one Aca 16S primer pair is a highly specific marker that distinguishes between pathogenic strains of Acanthamoeba and other free-living amoeba families.

  13. Urinary collagen degradation products as early markers of progressive renal fibrosis.

    Science.gov (United States)

    Hijmans, Ryanne S; Rasmussen, Daniel Guldager Kring; Yazdani, Saleh; Navis, Gerjan; van Goor, Harry; Karsdal, Morten Asser; Genovese, Federica; van den Born, Jacob

    2017-03-20

    Renal fibrogenesis is associated with increased ECM remodeling and release of collagen fragments in urine in progressive renal disease. We investigated the diagnostic value of urinary collagen degradation products in a proteinuria-driven fibrosis rat model with and without anti-fibrotic S1P-receptor modulator FTY720 treatment. Proteinuria was induced in male Wistar rats by Adriamycin (ADR) injection (n = 16). Healthy rats served as controls (n = 12). Six weeks post-injection, all underwent renal biopsy, and FTY720-treatment started in ADR-rats (n = 8) and controls (n = 6). Others remained untreated. Rats were sacrificed after 12 weeks. Collagen type I (C1M) and III (C3M) degradation fragments were measured in blood and urine using ELISA. Kidneys were stained for various inflammatory and fibrotic markers. Six weeks post-injection proteinuria increased (versus controls, P < 0.001) and although no accumulation of interstitial renal collagen type III (iColl3) was observed at this time, urinary C3M (uC3M) and C1M (uC1M) were significantly increased (both P < 0.001). At 12 weeks, uC3M (P < 0.001) and uC1M (P < 0.01) further increased in ADR-rats versus controls, just as fibronectin, PDGF-β receptor, hyaluronan (all P < 0.01), iColl3, PAS, myofibroblasts, macrophages and T-cells (all P < 0.05). FTY720-treatment reduced accumulation of immune cells, α-SMA+ myofibroblasts and PAS-score, but not iColl3 and uC3M. Correlation analyses indicated that uC3M and uC1M reflected and predicted tubulointerstitial fibrogenesis. These data displayed urinary collagen breakdown products as sensitive early markers of interstitial fibrosis, preceding histological fibrotic changes, which might replace the invasive renal biopsy procedure to assess fibrosis. Anti-fibrotic FTY720 intervention reduced some fibrotic markers without affecting collagen type III metabolism.

  14. Innovation in observation: a vision for early outbreak detection.

    Science.gov (United States)

    Fefferman, Nh; Naumova, En

    2010-01-01

    The emergence of new infections and resurgence of old onesFhealth threats stemming from environmental contamination or purposeful acts of bioterrorismFcall for a worldwide effort in improving early outbreak detection, with the goal of ameliorating current and future risks. In some cases, the problem of outbreak detection is logistically straightforward and mathematically easy: a single case of a disease of great concern can constitute an outbreak. However, for the vast majority of maladies, a simple analytical solution does not exist. Furthermore, each step in developing reliable, sensitive, effective surveillance systems demonstrates enormous complexities in the transmission, manifestation, detection, and control of emerging health threats. In this communication, we explore potential future innovations in early outbreak detection systems that can overcome the pitfalls of current surveillance. We believe that modern advances in assembling data, techniques for collating and processing information, and technology that enables integrated analysis will facilitate a new paradigm in outbreak definition and detection. We anticipate that moving forward in this direction will provide the highly desired sensitivity and specificity in early detection required to meet the emerging challenges of global disease surveillance.

  15. Testing breast cancer serum biomarkers for early detection and prognosis in pre-diagnosis samples

    Science.gov (United States)

    Kazarian, Anna; Blyuss, Oleg; Metodieva, Gergana; Gentry-Maharaj, Aleksandra; Ryan, Andy; Kiseleva, Elena M; Prytomanova, Olga M; Jacobs, Ian J; Widschwendter, Martin; Menon, Usha; Timms, John F

    2017-01-01

    Background: Breast cancer is a leading cause of morbidity and mortality worldwide. Although mammography screening is available, there is an ongoing interest in improved early detection and prognosis. Herein, we have analysed a combination of serological biomarkers in a case–control cohort of sera taken before diagnosis. Methods: This nested case–control study within the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS) used serum samples from 239 women who subsequently developed breast cancer and 239 matched cancer-free controls. Sera were screened by ELISA for 9 candidate markers. Univariate and multivariate analyses were performed to examine associations with clinico-pathological features and between case controls in different time groups before diagnosis. Results: Significant associations with clinico-pathological features related to prognosis were found for several candidates (CA15-3, HSP90A and PAI-1). However, there were no consistent differences between cases and controls for any candidate in the lead up to diagnosis. Whilst combination models outperformed single markers, there was no increase in performance towards diagnosis. Conclusions: This study using unique pre-diagnosis samples shows that CA15-3, HSP90A and PAI-1 have potential as early prognostic markers and warrant further investigation. However, none of the candidates or combinations would be useful for screening. PMID:28081538

  16. Postpartum Circulating Markers of Inflammation and the Systemic Acute-Phase Response After Early-Onset Preeclampsia

    NARCIS (Netherlands)

    van Rijn, Bas B; Bruinse, Hein W; Veerbeek, Jan H; Post Uiterweer, Emiel D; Koenen, SV; van der Bom, Johanna G; Rijkers, Ger T; Roest, Mark; Franx, Arie

    2016-01-01

    Preeclampsia is an inflammatory-mediated hypertensive disorder of pregnancy and seems to be an early indicator of increased cardiovascular risk, but mechanisms underlying this association are unclear. In this study, we identified levels of circulating inflammatory markers and dynamic changes in the

  17. Chemiluminescence enzyme immunoassay based on magnetic nanoparticles for detection of hepatoceUular carcinoma marker glypican-3

    Institute of Scientific and Technical Information of China (English)

    Qian-Yun Zhang; Hui Chen; Zhen Lin; Jin-Ming Lin

    2011-01-01

    Glypican-3 (GPC3) is reported as a great promising tumor marker for hepatocellular carcinoma (HCC) diagnosis. Highly sensitive and accurate analysis of serum GPC3 (sGPC3), in combination with or instead of traditional HCC marker alpha-fetoprotein (AFP), is essential for early diagnosis of I-ICC. Biomaterial-functionalized magnetic particles have been utilized as solid supports with good biological compatibility for sensitive immunoassay. Here, the magnetic nanoparticles (MnPs) and magnetic microparticles (MmPs) with carboxyl groups were further modified with streptavidin, and applied for the development of chemiluminescence enzyme immunoassay (CLEIA). After comparing between MnPs- and MmPs-based CLEIA, MnPs-based CLEIA was proved to be a better method with less assay time, greater sensitivity, better linearity and longer chemiluminescence platform. MnPs-based CLEIA was applied for detection of sGPC3 in normal liver, hepatocirrhosis, secondary liver cancer and HCC serum samples. The results indicated that sGPC3 was effective in diagnosis of HCC with high performance.

  18. Multiplexed detection of protein cancer markers on Au/Ag-barcoded nanorods using fluorescent-conjugated polymers.

    Science.gov (United States)

    Zheng, Weiming; He, Lin

    2010-07-01

    Integration of fluorescent-conjugated polymers as detection moiety with metallic striped nanorods for multiplexed detection of clinically important cancer marker proteins in an immunoassay format was demonstrated in this report. Specifically, cationic conjugated polymers were introduced to protein complexes through electrostatic binding to negatively charged double-stranded DNA, which was tagged on detection antibodies prior to antigen recognition. The intense fluorescence emission of conjugated polymers resulted in highly sensitive detection of cancer marker proteins wherein an undiluted bovine serum sample as low as approximately 25 target molecules captured on each particle was detectable. Meanwhile, the use of polymer molecules as the detection probe did not obscure the optical pattern of underlying nanorods, i.e., the encoding capability of barcoded nanorods was preserved, which allowed simultaneous detection of three cancer marker proteins with good specificity.

  19. Sleep Spindles as Biomarker for Early Detection of Neurodegenerative Disorders

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to the use of sleep spindles as a novel biomarker for early diagnosis of synucleinopathies, in particular Parkinson's disease (PD). The method is based on automatic detection of sleep spindles. The method may be combined with measurements of one or more further...

  20. Growth monitoring as an early detection tool: a systematic review

    NARCIS (Netherlands)

    Scherdel, P.; Dunkel, L.; Dommelen, P. van; Goulet, O.; Salaün, J.F.; Brauner, R.; Heude, B.; Chalumeau, M.

    2016-01-01

    Growth monitoring of apparently healthy children aims at early detection of serious underlying disorders. However, existing growth-monitoring practices are mainly based on suboptimal methods, which can result in delayed diagnosis of severe diseases and inappropriate referrals. We did a systematic re

  1. Why Ambiguity Detection Is a Predictor of Early Reading Skill

    Science.gov (United States)

    Wankoff, Lorain Szabo; Cairns, Helen Smith

    2009-01-01

    This study was designed to determine the contributions of metalinguistic skill and psycholinguistic processing ability to children's ability to detect the ambiguity of sentences and the relationship among all three factors to early reading ability. A total of 20 first graders and 20 second graders were given tasks testing the following abilities:…

  2. Illumina Spin-off to Develop Early-Detection Test.

    Science.gov (United States)

    Colwell, Janet

    2016-04-01

    DNA-sequencing giant Illumina has formed a new company, called Grail, to develop liquid biopsies capable of spotting cancer before symptoms arise. The start-up is working on a low-cost "pan-cancer" test that can detect multiple cancer types early, which it hopes to introduce by 2019.

  3. Early cell death detection with digital holographic microscopy.

    Directory of Open Access Journals (Sweden)

    Nicolas Pavillon

    Full Text Available BACKGROUND: Digital holography provides a non-invasive measurement of the quantitative phase shifts induced by cells in culture, which can be related to cell volume changes. It has been shown previously that regulation of cell volume, in particular as it relates to ionic homeostasis, is crucially involved in the activation/inactivation of the cell death processes. We thus present here an application of digital holographic microscopy (DHM dedicated to early and label-free detection of cell death. METHODS AND FINDINGS: We provide quantitative measurements of phase signal obtained on mouse cortical neurons, and caused by early neuronal cell volume regulation triggered by excitotoxic concentrations of L-glutamate. We show that the efficiency of this early regulation of cell volume detected by DHM, is correlated with the occurrence of subsequent neuronal death assessed with the widely accepted trypan blue method for detection of cell viability. CONCLUSIONS: The determination of the phase signal by DHM provides a simple and rapid optical method for the early detection of cell death.

  4. Progress in Life Marker Chip Technology for Detection of Life on Mars

    Science.gov (United States)

    Sims, M. R.; Cullen, D. C.; Laan, E.; Borst, G.; Prak, A.; Richter, L.; Gaubert, F.; Steele, A.; Parnell, J.; Sephton, M.

    2007-12-01

    Detection of Life on Mars will rely on detection of biomarkers, physical or chemical structures that can be associated with Life. As a possible payload for the ESA ExoMars rover mission planned in 2013 and other future missions a Life Marker Chip instrument is being developed. This instrument uses immuno-assay techniques to detect the relevant biomarkers. This paper describes the typical targets it will search for, its operating principle and the status of development. 63 biomarker targets have been identified and assays have been developed for a limited subset. Assay development includes use of recombinant DNA techniques to generate the molecular receptors (antibodies). This type of instrument has applications in terrestrial research e.g. sub-glacial lakes as well as planetary exploration. Breadboard demonstrators have been built of the assay system and key components of the micro-fluidics. Results from these breadboards will be presented, along with plans for future development.

  5. Aptamer-based microcantilever biosensor for ultrasensitive detection of tumor marker nucleolin.

    Science.gov (United States)

    Li, Huiyan; Bai, Xiaojing; Wang, Nan; Chen, Xuejuan; Li, Jing; Zhang, Zhe; Tang, Jilin

    2016-01-01

    We present an aptamer-based microcantilever biosensor for label-free detection of nucleolin. The sensor cantilevers in the microcantilever array were functionalized with nucleolin aptamer (AS1411) while the reference cantilevers were modified by 6-mercapto-1-hexanol (MCH) to eliminate environmental disturbances. The interaction between nucleolin and AS1411 induced surface stress changes, resulting in a differential deflection between sensor and reference cantilevers. The amplitude of differential cantilever deflection had a good linear relationship with the nucleolin concentration ranging from 10 nM to 250 nM with a correlation coefficient of 0.999. The detection limit was about 1.0 nM, at a signal-to-noise ratio of 3. The aptamer-based microcantilever sensor demonstrated good selectivity and was facile, rapid, and reagentless. Our results show the potential for the application of microcantilever biosensor system as a powerful tool to detect tumor markers with high sensitivity and specificity.

  6. [Detection of early forms of keratoconus - current screening methods].

    Science.gov (United States)

    Goebels, S; Eppig, T; Seitz, B; Langenbucher, A

    2013-10-01

    The detection of early forms of keratoconus is still a challenge for clinicians. Beside clinical examination and diagnosis of keratoconus, a series of examination techniques has been established in clinical routine to assist in the diagnosis of early forms of keratoconus: corneal topography for measuring the geometry of the corneal front surface, tomography for measuring the geometry of structures of the anterior segment of the eye, aberrometers for evaluation of optical aberrations of the entire eye, and a system for investigation of the biomechanical properties of the cornea. These instruments provide software tools which are designed for diagnostic support in keratoconus. In this review article, we provide an overview over the spectrum of measurement systems currently on the market focussing on their performance for detecting (early forms of) keratoconus. In detail, we focus on dedicated keratoconus screening software modules of topography, tomography, aberrometry and biomechanics.

  7. The search for early markers of plague: evidence for accumulation of soluble Yersinia pestis LcrV in bubonic and pneumonic mouse models of disease.

    Science.gov (United States)

    Flashner, Yehuda; Fisher, Morly; Tidhar, Avital; Mechaly, Adva; Gur, David; Halperin, Gideon; Zahavy, Eran; Mamroud, Emanuelle; Cohen, Sara

    2010-07-01

    Markers of the early stages of plague, a rapidly progressing deadly disease, are crucial for enabling the onset of an effective treatment. Here, we show that V-antigen protein (LcrV) is accumulated in the serum of Yersinia pestis-infected mice before bacterial colonization of the spleen and dissemination to blood, in a model of bubonic plague. LcrV accumulation is detected earlier than that of F1 capsular antigen, an established marker of disease. In a mouse model of pneumonic plague, LcrV can be determined in the bronchoalveolar lavage fluid somewhat later than F1, but before dissemination of Y. pestis to the blood. Thus, determination of soluble LcrV is suggested as a potential useful tool for monitoring disease progression in both bubonic and pneumonic plague. Moreover, it may be of particular advantage in cases of infections with F1 nonproducing strains.

  8. Early detection of occult atrial fibrillation and stroke prevention.

    Science.gov (United States)

    Keach, Joseph Walker; Bradley, Steven M; Turakhia, Mintu P; Maddox, Thomas M

    2015-07-01

    Atrial fibrillation (AF) is a very common arrhythmia and significantly increases stroke risk. This risk can be mitigated with oral anticoagulation, but AF is often asymptomatic, or occult, preventing timely detection and treatment. Accordingly, occult AF may cause stroke before it is clinically diagnosed. Currently, guidelines for the early detection and treatment of occult AF are limited. This review addresses recent advancements in occult AF detection methods, identification of populations at high risk for occult AF, the treatment of occult AF with oral anticoagulation, as well as ongoing trials that may answer critically important questions regarding occult AF screening.

  9. Role of Gold Nanoparticles in Early Detection of Oral Cancer

    Directory of Open Access Journals (Sweden)

    P Sanjay Reddy

    2010-01-01

    Nanotechnology is the science of the small; the very small. It is the use and manipulation of matter at a tiny scale. At this size, atoms and molecules work differently and provide a variety of surprising and interesting uses. These nanoparticles can be used to detect/mondor cancer (by utilizing or adding optical, magnetic, and fluorescent properties. This novel imaging tool can lead to significant improvements in cancer therapy due to earlier detection, accurate staging and microtumor identification. In this review, we will summarize the current state of the art of gold nanoparticles in early detection of oral cancer.

  10. Early physiological markers of cardiovascular risk in community based adolescents with a depressive disorder.

    Science.gov (United States)

    Waloszek, Joanna M; Byrne, Michelle L; Woods, Michael J; Nicholas, Christian L; Bei, Bei; Murray, Greg; Raniti, Monika; Allen, Nicholas B; Trinder, John

    2015-04-01

    Depression is recognised as an independent cardiovascular risk factor in adults. Identifying this relationship early on in life is potentially important for the prevention of cardiovascular disease (CVD). This study investigated whether clinical depression is associated with multiple physiological markers of CVD risk in adolescents from the general community. Participants aged 12-18 years were recruited from the general community and screened for depressive symptoms. Individuals with high and low depressive symptoms were administered a diagnostic interview. Fifty participants, 25 with a current depressive episode and 25 matched healthy controls, subsequently completed cardiovascular assessments. Variables assessed were automatic brachial and continuous beat-to-beat finger arterial blood pressure, heart rate, vascular functioning by pulse amplitude tonometry following reactive hyperaemia and pulse transit time (PTT) at rest. Blood samples were collected to measure cholesterol, glucose and glycohaemoglobin levels and an index of cumulative risk of traditional cardiovascular risk factors was calculated. Depressed adolescents had a significantly lower reactive hyperaemia index and shorter PTT, suggesting deterioration in vascular integrity and structure. Higher fasting glucose and triglyceride levels were also observed in the depressed group, who also had higher cumulative risk scores indicative of increased engagement in unhealthy behaviours and higher probability of advanced atherosclerotic lesions. The sample size and number of males who completed all cardiovascular measures was small. Clinically depressed adolescents had poorer vascular functioning and increased CVD risk compared to controls, highlighting the need for early identification and intervention for the prevention of CVD in depressed youth. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Fluorescence video endoscopic system for early cancer detection

    Science.gov (United States)

    Lytle, A. Charles; Dunn, J. B.; Paspa, Paul M.; Doiron, Daniel R.; Balchum, Oscar J.

    1990-06-01

    A video system is being developed to allow the detection of cancerous lesions that are too small to be accurately identified visually or with x-ray. The system makes use of standard endoscopes and provides a video display of both the color image and a false color fluorescence image, with automated switching between the two views. Excitation of the fluorescence marker, Heinatoporphyrin Derivative (HpD) , or it ' 5 purified form , diheinatoporphyrin ether! ester (DHE) , is provided by a krypton ion laser operating in the violet. A brief discussion of fluorescence diagnostic theory and a description of the prototype system, its clinical use , and performance is reviewed.

  12. Soluble E-Cadherin: An Early Marker of Severity in Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    A. Sewpaul

    2009-01-01

    Full Text Available Background/Aims. At present, there is no simple test for predicting severity in acute pancreatitis. We investigated the use of an assay of soluble E-cadherin (sE-cadherin. Methods. Concentrations of sE-cadherin, from 19 patients with mild acute pancreatitis, 7 patients with severe acute pancreatitis, 11 patients with other acute gastrointestinal pathologies, and 12 healthy subjects were measured using a commercially available sandwich ELISA kit based on two monoclonal antibodies specific to the extracellular fragment of human E-cadherin. Measurements were made at 12 hours or less from onset of pain and also at 24 and 48 hours after onset of pain. Results. Mean (standard deviation concentration of sE-cadherin in patients with severe acute pancreatitis at <12 hours was 17780 ng/mL (7853, significantly higher than that of healthy volunteers 5180 ng/mL (1350, =.0039, patients with other gastrointestinal pathologies 7358 ng/mL (6655, =.0073, and also significantly higher than that of patients with mild pancreatitis, 7332 ng/mL (2843, =.0019. Discussion. Serum sE-cadherin could be an early (within 12 hours objective marker of severity in acute pancreatitis. This molecule warrants further investigation in the form of a large multicentre trial.

  13. Hyperintense acute reperfusion marker on FLAIR is not associated with early haemorrhagic transformation in the elderly

    Energy Technology Data Exchange (ETDEWEB)

    Rozanski, Michal [Charite, Universitaetsmedizin Berlin, Department of Neurology, Center for Stroke Research Berlin-CSB, Berlin (Germany); Charite Campus Mitte, Department of Neurology, Berlin (Germany); Ebinger, Martin; Schmidt, Wolf U.; Hotter, Benjamin; Pittl, Sandra; Heuschmann, Peter U.; Jungehuelsing, Jan G.; Fiebach, Jochen B. [Charite, Universitaetsmedizin Berlin, Department of Neurology, Center for Stroke Research Berlin-CSB, Berlin (Germany)

    2010-12-15

    The hyperintense acute reperfusion marker (HARM) has been described as a predictor for haemorrhagic transformation (HT) in acute ischaemic stroke. We hypothesised that this phenomenon is not present in the elderly. It was possible to assess 47/84 consecutive patients aged 80 and over with diagnosed ischaemic stroke or transient ischaemic attack (TIA). MRI was performed within 24 h of onset of symptoms with follow-up MRI within a further 48 h. Of 47 included patients, 19 showed HARM; it was only seen on follow-up examination. Ten of the 47 patients underwent thrombolysis with recombinant tissue plasminogen activator (rt-PA); 4 of them showed HARM, and 1 of those showed HT. HARM was found in three out of eight patients with haemorrhagic transformation on baseline and/or follow-up MRI. We did not observe an association between HARM and early HT either in the whole group or in the patients who received thrombolysis. HARM was not associated with HT in the elderly after ischaemic stroke, independent of treatment. While it may indicate dysfunction of the blood-brain barrier (BBB), it does not necessarily amount to HT. (orig.)

  14. Matrix Metalloproteinase-2 Promoter Genotype as a Marker of Cutaneous T-Cell Lymphoma Early Stage

    Directory of Open Access Journals (Sweden)

    Anna Vasku

    2010-01-01

    Full Text Available The aim of the study was to investigate the DNA polymorphic genotype in MMP-2 promoter gene as a potential candidate region for the development of the cutaneous T-cell lymphoma (CTCL and/or its progression. A total of 89 Czech patients with CTCL (including 23 patients with large plaque parapsoriasis were compared to 198 controls of similar age and sex distribution, without personal or family history of chronic skin diseases and without personal history of malignancy. The three selected polymorphisms in the promoter of MMP-2 gene (−1575G/A, −1306C/T, and −790T/G were determined using the PCR-based methodology with RFLP. In our cohort, the associated GGCCTT MMP-2 promoter genotype was highly significantly more frequent in CTCL-Ia stage patients compared to patients with parapsoriasis, the tests having high sensitivity and specificity (78%, 83%, resp.. To conclude, use of associated MMP-2 promoter genotype as a DNA marker might make it possible to distinguish between the patients with parapsoriasis and those with CTCL stage Ia, which could substantially improve possibilities of clinical diagnostics, therapy design, and prognosis of this serious condition in the early stages.

  15. Matrix metalloproteinase-2 promoter genotype as a marker of cutaneous T-cell lymphoma early stage.

    Science.gov (United States)

    Vasku, Anna; Vasku, Julie Bienertova; Necas, Miroslav; Vasku, Vladimir

    2010-01-01

    The aim of the study was to investigate the DNA polymorphic genotype in MMP-2 promoter gene as a potential candidate region for the development of the cutaneous T-cell lymphoma (CTCL) and/or its progression. A total of 89 Czech patients with CTCL (including 23 patients with large plaque parapsoriasis) were compared to 198 controls of similar age and sex distribution, without personal or family history of chronic skin diseases and without personal history of malignancy. The three selected polymorphisms in the promoter of MMP-2 gene (-1575G/A, -1306C/T, and -790T/G) were determined using the PCR-based methodology with RFLP. In our cohort, the associated GGCCTT MMP-2 promoter genotype was highly significantly more frequent in CTCL-Ia stage patients compared to patients with parapsoriasis, the tests having high sensitivity and specificity (78%, 83%, resp.). To conclude, use of associated MMP-2 promoter genotype as a DNA marker might make it possible to distinguish between the patients with parapsoriasis and those with CTCL stage Ia, which could substantially improve possibilities of clinical diagnostics, therapy design, and prognosis of this serious condition in the early stages.

  16. Preparation of bioconjugates of CdTe nanocrystals for cancer marker detection

    Energy Technology Data Exchange (ETDEWEB)

    Hu Fengqin [Key Laboratory of Colloid, Interface Science and Chemical Thermodynamics, Molecular Science Center, Institute of Chemistry, Chinese Academy of Sciences, Zhong Guan Cun, Bei Yi Jie 2, Beijing 100080 (China); Ran Yuliang [Department of Cell and Molecular Biology, Cancer Institute, Chinese Academy of Medical Sciences and Peking Union Medical College, Pan Jia Yuan, Chao Yang Qu, Beijing 100021 (China); Zhou Zhuan [Department of Cell and Molecular Biology, Cancer Institute, Chinese Academy of Medical Sciences and Peking Union Medical College, Pan Jia Yuan, Chao Yang Qu, Beijing 100021 (China); Gao Mingyuan [Key Laboratory of Colloid, Interface Science and Chemical Thermodynamics, Molecular Science Center, Institute of Chemistry, Chinese Academy of Sciences, Zhong Guan Cun, Bei Yi Jie 2, Beijing 100080 (China)

    2006-06-28

    Highly fluorescent CdTe quantum dots (Q-dots) stabilized by 3-mercaptopropionic acid (MPA) were prepared by an aqueous solution approach and used as fluorescent labels in detecting a cancer marker, carcinoembryonic antigen (CEA), expressed on human colon carcinoma cell line LS 180. Nonspecific adsorptions of CdTe Q-dots on carcinoma cells were observed and effectively eliminated by replacing MPA with a thiolated PEG (poly(ethylene glycol), Mn = 750) synthesized according to literature. It was unexpectedly found out that the PEG-coated CdTe Q-dots exhibited very strong and specific affinity to anti-CEA monoclonal antibody rch 24 (rch 24 mAb). The resultant CdTe-(rch 24 mAb) conjugates were successfully used in detections of CEA expressed on the surface of cell line LS 180. Further experiments demonstrated that the fluorescent CdTe Q-dots exhibited much better photostability and a brighter fluorescence than FITC, which consequently led to a higher efficiency in the cancer marker detection.

  17. Early Detection of Rogue Waves by the Wavelet Transforms

    CERN Document Server

    Bayindir, Cihan

    2015-01-01

    We discuss the possible advantages of using the wavelet transform over the Fourier transform for the early detection of rogue waves. We show that the triangular wavelet spectra of the rogue waves can be detected at early stages of the development of rogue waves in a chaotic wave field. Compared to the Fourier spectra, the wavelet spectra is capable of detecting not only the emergence of a rogue wave but also its possible spatial (or temporal) location. Due to this fact, wavelet transform is also capable of predicting the characteristic distances between successive rogue waves. Therefore multiple simultaneous breaking of the successive rogue waves on ships or on the offshore structures can be predicted and avoided by smart designs and operations.

  18. Application of leftover sample material from waterborne protozoa monitoring for the molecular detection of Bacteroidales and fecal source tracking markers

    Science.gov (United States)

    In this study, we examined the potential for detecting fecal bacteria and microbial source tracking markers in samples discarded during the concentration of Cryptosporidium and Giardia using USEPA Method 1623. Recovery rates for different fecal bacteria were determined using sp...

  19. Application of leftover sample material from waterborne protozoa monitoring for the molecular detection of Bacteroidales and fecal source tracking markers

    Science.gov (United States)

    In this study, we examined the potential for detecting fecal bacteria and microbial source tracking markers in samples discarded during the concentration of Cryptosporidium and Giardia using USEPA Method 1623. Recovery rates for different fecal bacteria were determined using sp...

  20. Serum inter-cellular adhesion molecule 1 is an early marker of diagnosis and prediction of severe acute pancreatitis

    Institute of Scientific and Technical Information of China (English)

    Hai-Hang Zhu; Lin-Lin Jiang

    2012-01-01

    AIM:To determine if serum inter-cellular adhesion molecule 1 (ICAM-1) is an early marker of the diagnosis and prediction of severe acute pancreatitis (SAP)within 24 h of onset of pain,and to compare the sensitivity,specificity and prognostic value of this test with those of acute physiology and chronic health evaluation (APACHE) Ⅱ score and interleukin-6 (IL-6).METHODS:Patients with acute pancreatitis (AP) were divided into two groups according to the Ranson's criteria:mild acute pancreatitis (MAP) group and SAP group.Serum ICAM-1,APACHE Ⅱ and IL-6 levels were detected in all the patients.The sensitivity,specificity and prognostic value of the ICAM-1,APACHE Ⅱ score and IL-6 were evaluated.RESULTS:The ICAM-1 level in 36 patients with SAP within 24 h of onset of pain was increased and was significantly higher than that in the 50 patients with MAP and the 15 healthy volunteers (P < 0.01).The ICAM-1 level (25 ng/mL) was chosen as the optimum cutoff to distinguish SAP from MAP,and the sensitivity,specificity,positive predictive value,negative predictive value (NPV),positive likelihood ratio and negative likelihood ratio were 61.11%,71.42%,0.6111,0.7142,2.1382 and 0.5445,respectively.The area under the curve demonstrated that the prognostic accuracy of ICAM-1 (0.712) was similar to the APACHE-Ⅱ scoring system (0.770) and superior to IL-6 (0.508) in distinguishing SAP from MAP.CONCLUSION:ICAM-1 test is a simple,rapid and reliable method in clinical practice.It is an early marker of diagnosis and prediction of SAP within the first 24 h after onset of pain or on admission.As it has a relatively low NPV and does not allow it to be a stand-alone test for the diagnosis of AP,other conventional diagnostic tests are required.

  1. Promise and Challenge: Markers of Prostate Cancer Detection, Diagnosis and Prognosis

    Directory of Open Access Journals (Sweden)

    D. A. Troyer

    2004-01-01

    Full Text Available Approximately 1 man in 6 will be diagnosed with prostate cancer during his life lifetime, and over 200,000 men in the U.S. are diagnosed with prostate cancer annually. Since the widespread adoption of PSA testing, about 60–70% of men at risk in the U.S. have had a blood test for prostate cancer. With this, prostate cancer death rates have decreased, yet only slightly. Thirty thousand men still die each year from this disease. PSA testing fails to identify a small but significant proportion of aggressive cancers, and only about 30% of men with a “positive” PSA have a positive biopsy. Additionally, of men who are treated for prostate cancer, about 25% require additional treatment, presumably due to disease recurrence. Also of concern is the growing evidence that there are some prostate cancers for which treatment may not be necessary. Very long-term studies from the U.S. and Europe, following men with prostate cancer have found that some tumors do not progress over time. In these individuals, prostate cancer treatment is unnecessary and harmful as these men do not benefit from treatment but will be at risk of treatment-related side effects and complications. They suggest a fundamental problem with prostate cancer: it is not possible, at this time, to predict the natural history of the disease. It is for these reasons that the most important challenge in prostate cancer today is the inability to predict the behavior of an individual tumor in an individual patient. Here we review issues related to performance and validation of biomarkers with a focus on “doing no harm”, and bearing in mind that it is the ultimate goal of early detection to save lives. Improved diagnostic and prognostic biomarkers are needed for prostate cancer, and the use of these markers should ultimately translate into increased life span and quality of life. The ultimate goal would be to not only have accurate biomarkers suitable for early diagnosis, but also

  2. Cardiac troponins I and T: molecular markers for early diagnosis, prognosis, and accurate triaging of patients with acute myocardial infarction.

    Science.gov (United States)

    Tiwari, Ram P; Jain, Anubhav; Khan, Zakir; Kohli, Veena; Bharmal, R N; Kartikeyan, S; Bisen, Prakash S

    2012-12-01

    Acute myocardial infarction (AMI) is the leading cause of death worldwide, with early diagnosis still being difficult. Promising new cardiac biomarkers such as troponins and creatine kinase (CK) isoforms are being studied and integrated into clinical practice for early diagnosis of AMI. The cardiac-specific troponins I and T (cTnI and cTnT) have good sensitivity and specificity as indicators of myocardial necrosis and are superior to CK and its MB isoenzyme (CK-MB) in this regard. Besides being potential biologic markers, cardiac troponins also provide significant prognostic information. The introduction of novel high-sensitivity troponin assays has enabled more sensitive and timely diagnosis or exclusion of acute coronary syndromes. This review summarizes the available information on the potential of troponins and other cardiac markers in early diagnosis and prognosis of AMI, and provides perspectives on future diagnostic approaches to AMI.

  3. Detecting Acute Myocardial Infarction by Diffusion-Weighted versus T2-Weighted Imaging and Myocardial Necrosis Markers.

    Science.gov (United States)

    Jin, Jiyang; Chen, Min; Li, Yongjun; Wang, YaLing; Zhang, Shijun; Wang, Zhen; Wang, Lin; Ju, Shenghong

    2016-10-01

    We used a porcine model of acute myocardial infarction to study the signal evolution of ischemic myocardium on diffusion-weighted magnetic resonance images (DWI). Eight Chinese miniature pigs underwent percutaneous left anterior descending or left circumflex coronary artery occlusion for 90 minutes followed by reperfusion, which induced acute myocardial infarction. We used DWI preprocedurally and hourly for 4 hours postprocedurally. We acquired turbo inversion recovery magnitude T2-weighted images (TIRM T2WI) and late gadolinium enhancement images from the DWI slices. We measured the serum myocardial necrosis markers myoglobin, creatine kinase-MB isoenzyme, and cardiac troponin I at the same time points as the magnetic resonance scanning. We used histochemical staining to confirm injury. All images were analyzed qualitatively. Contrast-to-noise ratio (the contrast between infarcted and healthy myocardium) and relative signal index were used in quantitative image analysis. We found that DWI identified myocardial signal abnormity early (acute myocardial infarction and identified the infarct-related high signal more often than did TIRM T2WI: 7 of 8 pigs (87.5%) versus 3 of 8 (37.5%) (P=0.046). Quantitative image analysis yielded a significant difference in contrast-to-noise ratio and relative signal index between infarcted and normal myocardium on DWI. However, within 4 hours after infarction, the serologic myocardial injury markers were not significantly positive. We conclude that DWI can be used to detect myocardial signal abnormalities early after acute myocardial infarction-identifying the infarction earlier than TIRM T2WI and widely used clinical serologic biomarkers.

  4. Detecting a hierarchical genetic population structure via Multi-InDel markers on the X chromosome

    Science.gov (United States)

    Fan, Guang Yao; Ye, Yi; Hou, Yi Ping

    2016-01-01

    Detecting population structure and estimating individual biogeographical ancestry are very important in population genetics studies, biomedical research and forensics. Single-nucleotide polymorphism (SNP) has long been considered to be a primary ancestry-informative marker (AIM), but it is constrained by complex and time-consuming genotyping protocols. Following up on our previous study, we propose that a multi-insertion-deletion polymorphism (Multi-InDel) with multiple haplotypes can be useful in ancestry inference and hierarchical genetic population structures. A validation study for the X chromosome Multi-InDel marker (X-Multi-InDel) as a novel AIM was conducted. Genetic polymorphisms and genetic distances among three Chinese populations and 14 worldwide populations obtained from the 1000 Genomes database were analyzed. A Bayesian clustering method (STRUCTURE) was used to discern the continental origins of Europe, East Asia, and Africa. A minimal panel of ten X-Multi-InDels was verified to be sufficient to distinguish human ancestries from three major continental regions with nearly the same efficiency of the earlier panel with 21 insertion-deletion AIMs. Along with the development of more X-Multi-InDels, an approach using this novel marker has the potential for broad applicability as a cost-effective tool toward more accurate determinations of individual biogeographical ancestry and population stratification. PMID:27535707

  5. Early markers of autism spectrum disorders in infants and toddlers prospectively identified in the Social Attention and Communication Study.

    Science.gov (United States)

    Barbaro, Josephine; Dissanayake, Cheryl

    2013-01-01

    The Social Attention and Communication Study involved the successful implementation of developmental surveillance of the early markers of autism spectrum disorders in a community-based setting. The objective in the current study was to determine the most discriminating and predictive markers of autism spectrum disorders used in the Social Attention and Communication Study at 12, 18 and 24 months of age, so that these could be used to identify children with autism spectrum disorders with greater accuracy. The percentage of 'yes/no' responses for each behavioural marker was compared between children with autistic disorder (n = 39), autism spectrum disorder (n = 50) and developmental and/or language delay (n = 20) from 12 to 24 months, with a logistic regression also conducted at 24 months. Across all ages, the recurring key markers of both autistic disorder and autism spectrum disorder were deficits in eye contact and pointing, and from 18 months, deficits in showing became an important marker. In combination, these behaviours, along with pretend play, were found to be the best group of predictors for a best estimate diagnostic classification of autistic disorder/autism spectrum disorder at 24 months. It is argued that the identified markers should be monitored repeatedly during the second year of life by community health-care professionals.

  6. Marker-dependent associations among oxidative stress, growth and survival during early life in a wild mammal

    Science.gov (United States)

    Selman, Colin; Blount, Jonathan D.; Pilkington, Jill G.; Watt, Kathryn A.; Pemberton, Josephine M.; Reid, Jane M.

    2016-01-01

    Oxidative stress (OS) is hypothesized to be a key physiological mechanism mediating life-history trade-offs, but evidence from wild populations experiencing natural environmental variation is limited. We tested the hypotheses that increased early life growth rate increases OS, and that increased OS reduces first-winter survival, in wild Soay sheep (Ovis aries) lambs. We measured growth rate and first-winter survival for four consecutive cohorts, and measured two markers of oxidative damage (malondialdehyde (MDA), protein carbonyls (PC)) and two markers of antioxidant (AOX) protection (total AOX capacity (TAC), superoxide dismutase (SOD)) from blood samples. Faster lamb growth was weakly associated with increased MDA, but not associated with variation in the other three markers. Lambs with higher SOD activity were more likely to survive their first winter, as were male but not female lambs with lower PC concentrations. Survival did not vary with MDA or total TAC. Key predictions relating OS to growth and survival were therefore supported in some OS markers, but not others. This suggests that different markers capture different aspects of the complex relationships between individual oxidative state, physiology and fitness, and that overarching hypotheses relating OS to life-history variation cannot be supported or refuted by studying individual markers. PMID:27733545

  7. Marker-dependent associations among oxidative stress, growth and survival during early life in a wild mammal.

    Science.gov (United States)

    Christensen, Louise L; Selman, Colin; Blount, Jonathan D; Pilkington, Jill G; Watt, Kathryn A; Pemberton, Josephine M; Reid, Jane M; Nussey, Daniel H

    2016-10-12

    Oxidative stress (OS) is hypothesized to be a key physiological mechanism mediating life-history trade-offs, but evidence from wild populations experiencing natural environmental variation is limited. We tested the hypotheses that increased early life growth rate increases OS, and that increased OS reduces first-winter survival, in wild Soay sheep (Ovis aries) lambs. We measured growth rate and first-winter survival for four consecutive cohorts, and measured two markers of oxidative damage (malondialdehyde (MDA), protein carbonyls (PC)) and two markers of antioxidant (AOX) protection (total AOX capacity (TAC), superoxide dismutase (SOD)) from blood samples. Faster lamb growth was weakly associated with increased MDA, but not associated with variation in the other three markers. Lambs with higher SOD activity were more likely to survive their first winter, as were male but not female lambs with lower PC concentrations. Survival did not vary with MDA or total TAC. Key predictions relating OS to growth and survival were therefore supported in some OS markers, but not others. This suggests that different markers capture different aspects of the complex relationships between individual oxidative state, physiology and fitness, and that overarching hypotheses relating OS to life-history variation cannot be supported or refuted by studying individual markers.

  8. A New Methodology for Early Anomaly Detection of BWR Instabilities

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, K. N.

    2005-11-27

    The objective of the performed research is to develop an early anomaly detection methodology so as to enhance safety, availability, and operational flexibility of Boiling Water Reactor (BWR) nuclear power plants. The technical approach relies on suppression of potential power oscillations in BWRs by detecting small anomalies at an early stage and taking appropriate prognostic actions based on an anticipated operation schedule. The research utilizes a model of coupled (two-phase) thermal-hydraulic and neutron flux dynamics, which is used as a generator of time series data for anomaly detection at an early stage. The model captures critical nonlinear features of coupled thermal-hydraulic and nuclear reactor dynamics and (slow time-scale) evolution of the anomalies as non-stationary parameters. The time series data derived from this nonlinear non-stationary model serves as the source of information for generating the symbolic dynamics for characterization of model parameter changes that quantitatively represent small anomalies. The major focus of the presented research activity was on developing and qualifying algorithms of pattern recognition for power instability based on anomaly detection from time series data, which later can be used to formulate real-time decision and control algorithms for suppression of power oscillations for a variety of anticipated operating conditions. The research being performed in the framework of this project is essential to make significant improvement in the capability of thermal instability analyses for enhancing safety, availability, and operational flexibility of currently operating and next generation BWRs.

  9. A New Methodology for Early Anomaly Detection of BWR Instabilities

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, K. N.

    2005-11-27

    The objective of the performed research is to develop an early anomaly detection methodology so as to enhance safety, availability, and operational flexibility of Boiling Water Reactor (BWR) nuclear power plants. The technical approach relies on suppression of potential power oscillations in BWRs by detecting small anomalies at an early stage and taking appropriate prognostic actions based on an anticipated operation schedule. The research utilizes a model of coupled (two-phase) thermal-hydraulic and neutron flux dynamics, which is used as a generator of time series data for anomaly detection at an early stage. The model captures critical nonlinear features of coupled thermal-hydraulic and nuclear reactor dynamics and (slow time-scale) evolution of the anomalies as non-stationary parameters. The time series data derived from this nonlinear non-stationary model serves as the source of information for generating the symbolic dynamics for characterization of model parameter changes that quantitatively represent small anomalies. The major focus of the presented research activity was on developing and qualifying algorithms of pattern recognition for power instability based on anomaly detection from time series data, which later can be used to formulate real-time decision and control algorithms for suppression of power oscillations for a variety of anticipated operating conditions. The research being performed in the framework of this project is essential to make significant improvement in the capability of thermal instability analyses for enhancing safety, availability, and operational flexibility of currently operating and next generation BWRs.

  10. Spectroscopic techniques as a diagnostic tool for early detection of osteoporosis

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Kanika; Lee, Kwang Sung; Lee, Dong Geun; Kim, Yong Ki; Kim, Kyung Chun [Pusan National University, Busan (Korea, Republic of)

    2010-08-15

    Osteoporosis (OP) a kind of bone disease, is very serious in particular for old persons, and may lead them to immobility and death. Early detection of the diseases is the first consideration for the patients to have more options to live a healthy life. The biomarkers or bonemarkers provide a promising challenge in clinical proteomics for early disease detection. In this paper, optical techniques such as Fourier Transform Infrared Spectroscopy (FTIR) and UV/Visible spectroscopy are employed to find the bone markers and emphasis has been given on noninvasive modalities for early detection of osteoporosis. Blood plasma samples procured from two groups, patients and healthy persons were tested. Both of the optical techniques revealed obvious differences in the spectra: between two groups, for example, increase in intensity for OP persons. New peaks were found at 1646, 1540, 1456 and 1077 cm-1 in FTIR spectra. Except 1588 cm-1, we showed decrease in spectral intensity of OP persons. In UV/Visible spectroscopy results, new peaks appeared in the OP patients spectra at the wavelength of 279 nm and 414 nm. These differences in the spectra of the two types samples, allow rapid and cost-effective discrimination of the potential patients with the optical techniques which were verified by the bone densitometer in the hospitals. The new and novel technique is quick, reliable and effective

  11. Dyes as bifunctional markers of DNA hybridization on surfaces and mutation detection.

    Science.gov (United States)

    García-Mendiola, Tania; Cerro, María Ramos; López-Moreno, José María; Pariente, Félix; Lorenzo, Encarnación

    2016-10-01

    The interaction of small molecules with DNA has found diagnostic and therapeutic applications. In this work, we propose the use of two different dyes, in particular Azure A and Safranine, as bifunctional markers of on-surface DNA hybridization and potent tools for screening of specific gene mutations directly in real DNA PCR amplicons extracted from blood cells. By combining spectroscopic and electrochemical methods we demonstrate that both dyes can interact with single and double stranded DNA to a different extent, allowing reliable hybridization detection. From these data, we have also elucidated the nature of the interaction. We conclude that the binding mode is fundamentally intercalative with an electrostatic component. The dye fluorescence allows their use as nucleic acid stains for the detection of on-surfaces DNA hybridization. Its redox activity is exploited in the development of selective electrochemical DNA biosensors.

  12. Assessment of nuclear nanomorphology marker to improve the detection of malignancy from bile duct biopsy specimens.

    Science.gov (United States)

    Hartman, Douglas J; Krasinskas, Alyssa M; Uttam, Shikhar; Staton, Kevin; Bista, Rajan; Rizvi, Sumera; Slivka, Adam; Brand, Randall; Liu, Yang

    2014-06-01

    The accurate diagnosis of malignancy from small bile duct biopsy specimens is often challenging. This proof-of-concept study assessed the feasibility of a novel optical technology, spatial-domain low-coherence quantitative phase microscopy (SL-QPM), that assesses nanoscale structural alterations in epithelial nuclei for improving the diagnosis of malignancy in bile duct biopsy specimens. The SL-QPM analysis was performed on standard histology specimens of bile duct biopsy specimens from 45 patients. We analyzed normal cells with benign follow-up, histologically normal cells with pancreaticobiliary malignancy, and malignant epithelial cells. The SL-QPM-derived nuclear nanomorphology marker can not only distinguish benign and malignant epithelial cells but can also detect features of malignancy in those cells normal by light microscopy with a discriminatory accuracy of 0.90. When combining pathology with SL-QPM, the sensitivity is improved to 88.5% from 65.4% of conventional pathology, while maintaining 100% specificity. SL-QPM-derived nuclear nanomorphology markers represent a novel approach for detecting malignancy from histologically normal-appearing epithelial cells, with potential as an adjunctive test in patients with negative or inconclusive pathologic diagnosis on bile duct biopsy specimens. Copyright© by the American Society for Clinical Pathology.

  13. Microsatellite DNA markers applied to detection of multiple paternity in Caiman latirostris in Santa Fe, Argentina.

    Science.gov (United States)

    Amavet, Patricia; Rosso, Esteban; Markariani, Rosa; Piña, Carlos Ignacio

    2008-12-01

    Detecting multiple paternity in wild populations of the broad-snouted caiman (Caiman latirostris) has important implications for conservation efforts. We have applied microsatellite markers to examine genetic variation in C. latirostris and also have provided the first data concerning detection of multiple paternity in wild populations of this species. Blood samples from four nest-guarding C. latirostris females and their hatchlings were obtained from Santa Fe Province, Argentina. Amplified products were analyzed by electrophoresis on 10% polyacrylamide gels and visualized with silver staining. Four out of the eight markers tested reliably amplified and yielded useful data. Using polyacrylamide gels with silver staining provides high enough resolution to obtain individual genotypes. In order to assess the presence or absence of more than two parents in each nest, we used the single locus Minimum Method, and applied Cervus 3.0 and Gerud 2.0 software in parentage analyses. Our results indicate more than one father in at least two families. This behavior could be the consequence of high habitat variability in the area where our population was sampled. The ability to understand mating systems is important for maintaining viable populations of exploited taxa like C. latirostris.

  14. Detection of Genetic Diversity in Synthetic Hexaploid Wheats Using Microsatellite Markers

    Institute of Scientific and Technical Information of China (English)

    CHEN Guo-yue; LI Li-hui

    2007-01-01

    Ninety-five synthetic hexaploid wheats(2n=6x=42,AABBDD)were analyzed using 45 microsatellite markers to investigate the potential genetic diversity in wheat breeding programs.A total of 326 alleles were detected by these microsatellite primer pairs,with an average of 6.65 alleles per locus.The polymorphic information content(PIC),Simpson index(SI),and genetic similarity(GS)coefficient showed that the D genome is of the highest genetic diversity among the A,B,and D genomes in the synthetic hexaploid wheats.The results also indicated that the synthetic hexaploid wheat is an efficient way to enrich wheat genetic backgrounds,especially to use the genetic variations of the D genome from Aegilops squarrosa for wheat improvement.The UPGMA dendogram,based on a similarity matrix by a simple matching coefficient algorithm,delineated the above accessions into 5 major clusters and was in accordance with the available pedigree information.The results demonstrated the utility of microsatellite markers in detecting DNA polymorphism and estimating genetic diversity.

  15. Early detection of drillstring washouts reduces fishing jobs

    Energy Technology Data Exchange (ETDEWEB)

    Dudleson, B. (Dubai Petroleum Co. (FR)); Arnold, M.; McCann, D. (Sedco Forex (FR))

    1990-10-01

    Rapid detection of unexpected drilling events requires continuous monitoring of drilling parameters. A major R and D program by a drilling contractor has led to the introduction of a computerized monitoring system on its offshore rigs. System includes advanced color graphics displays and new smart alarms to help both contractor and operator personnel detect and observe drilling events before they would normally be apparent with conventional rig instrumentation. This article describes a module of this monitoring system, which uses expert system technology to detect the earliest stages of drillstring washouts. Field results demonstrate the effectiveness of the smart alarm incorporated in the system. Early detection allows the driller to react before a twist-off results in expensive fishing operations.

  16. Early Detection System of Vascular Disease and Its Application Prospect

    Directory of Open Access Journals (Sweden)

    Huan Liu

    2016-01-01

    Full Text Available Markers of imaging, structure, and function reflecting vascular damage, integrating a long time accumulation effect of traditional and unrecognized cardiovascular risk factors, can be regarded as surrogate endpoints of target organ damage before the occurrence of clinical events. Prevention of cardiovascular disease requires risk stratification and treatment of traditional risk factors, such as smoking, hypertension, hyperlipidemia, and diabetes. However, traditional risk stratification is not sufficient to provide accurate assessment of future cardiovascular events. Therefore, vascular injury related parameters obtained by ultrasound or other noninvasive devices, as a surrogate parameter of subclinical cardiovascular disease, can improve cardiovascular risk assessment and optimize the preventive treatment strategy. Thus, we will summarize the research progress and clinical application of early assessment technology of vascular diseases in the present review.

  17. Early forest fire detection using low-energy hydrogen sensors

    Directory of Open Access Journals (Sweden)

    K. Nörthemann

    2013-11-01

    Full Text Available Most huge forest fires start in partial combustion. In the beginning of a smouldering fire, emission of hydrogen in low concentration occurs. Therefore, hydrogen can be used to detect forest fires before open flames are visible and high temperatures are generated. We have developed a hydrogen sensor comprising of a metal/solid electrolyte/insulator/semiconductor (MEIS structure which allows an economical production. Due to the low energy consumption, an autarkic working unit in the forest was established. In this contribution, first experiments are shown demonstrating the possibility to detect forest fires at a very early stage using the hydrogen sensor.

  18. Early breast cancer detection using techniques other than mammography

    Energy Technology Data Exchange (ETDEWEB)

    Kopans, D.B.

    1984-09-01

    X-ray mammography is the only imaging method currently available with any proven efficacy for screening to detect early-stage, clinically occult breast cancer. Sonography has a limited role in the differentiation of cystic from solid masses and as a guide for aspiration and preoperative localization of selected breast lesions. Computed tomography has a more limited role to determine the spatial orientation of a lesion detected only in the lateral mammographic position. All other imaging methods should be considered experimental at this time.

  19. Early detection of cutaneous melanoma by sequential digital dermatoscopy (SDD).

    Science.gov (United States)

    Kraus, Sophie Luise; Haenssle, Holger Andreas

    2013-06-01

    The early diagnosis and excision of cutaneous melanoma is essential for an improved prognosis of the disease. Besides the investigation of pigmented lesions with the unaided eye and conventional dermatoscopy, long-term sequential digital dermatoscopy has been shown to improve the sensitivity of melanoma detection, especially in high-risk patients. In addition to the static clinical and dermatoscopic assessment, the sequential digital dermatoscopy strategy helps to detect changes over time. This review summarizes the latest developments in the field of sequential digital dermatoscopy, describes current strategies for the selection of patients and lesions to monitor, and suggests objective criteria that should lead to an excisional biopsy.

  20. CSF biomarkers associated with disease heterogeneity in early Parkinson's disease: the Parkinson's Progression Markers Initiative study.

    Science.gov (United States)

    Kang, Ju-Hee; Mollenhauer, Brit; Coffey, Christopher S; Toledo, Jon B; Weintraub, Daniel; Galasko, Douglas R; Irwin, David J; Van Deerlin, Vivianna; Chen-Plotkin, Alice S; Caspell-Garcia, Chelsea; Waligórska, Teresa; Taylor, Peggy; Shah, Nirali; Pan, Sarah; Zero, Pawel; Frasier, Mark; Marek, Kenneth; Kieburtz, Karl; Jennings, Danna; Tanner, Caroline M; Simuni, Tanya; Singleton, Andrew; Toga, Arthur W; Chowdhury, Sohini; Trojanowski, John Q; Shaw, Leslie M

    2016-06-01

    The development of biomarkers to predict the progression of Parkinson's disease (PD) from its earliest stage through its heterogeneous course is critical for research and therapeutic development. The Parkinson's Progression Markers Initiative (PPMI) study is an ongoing international multicenter, prospective study to validate biomarkers in drug-naïve PD patients and matched healthy controls (HC). We quantified cerebrospinal fluid (CSF) alpha-synuclein (α-syn), amyloid-beta1-42 (Aβ1-42), total tau (t-tau), and tau phosphorylated at Thr181 (p-tau) in 660 PPMI subjects at baseline, and correlated these data with measures of the clinical features of these subjects. We found that CSF α-syn, t-tau and p-tau levels, but not Aβ1-42, were significantly lower in PD compared with HC, while the diagnostic value of the individual CSF biomarkers for PD diagnosis was limited due to large overlap. The level of α-syn, but not other biomarkers, was significantly lower in PD patients with non-tremor-dominant phenotype compared with tremor-dominant phenotype. In addition, in PD patients the lowest Aβ1-42, or highest t-tau/Aβ1-42 and t-tau/α-syn quintile in PD patients were associated with more severe non-motor dysfunction compared with the highest or lowest quintiles, respectively. In a multivariate regression model, lower α-syn was significantly associated with worse cognitive test performance. APOE ε4 genotype was associated with lower levels of Aβ1-42, but neither with PD diagnosis nor cognition. Our data suggest that the measurement of CSF biomarkers in early-stage PD patients may relate to disease heterogeneity seen in PD. Longitudinal observations in PPMI subjects are needed to define their prognostic performance.

  1. Low cardiorespiratory fitness in people at risk for type 2 diabetes: early marker for insulin resistance

    Directory of Open Access Journals (Sweden)

    Leite Silmara AO

    2009-09-01

    Full Text Available Abstract Purpose There is a significant association between insulin resistance and low cardiorespiratory fitness in nondiabetic subjects. In a population with risk factors for type 2 diabetes (T2DM, before they are insulin resistant, we investigated low exercise capacity (VO2max as an early marker of impaired insulin sensitivity in order to determine earlier interventions to prevent development of insulin resistance syndrome (IRS and T2DM. Methods Cross-sectional analyses of data on 369 (78 men and 291 women people at risk for IRS and T2DM, aged 45.6 +/- 10 years (20-65 years old from the Community Diabetes Prevention Project in Minnesota were carried out. The cardiorespiratory fitness (VO2max by respiratory gas exchange and bicycle ergometer were measured in our at risk non insulin resistant population and compared with a control group living in the same geographic area. Both groups were equally sedentary, matched for age, gender and BMI. Results The most prevalent abnormality in the study population was markedly low VO2max when compared with general work site screening control group, (n = 177; 137F; 40 M, mean age 40 ± 11 years; BMI = 27.8 ± 6.1 kg/m2. Individuals at risk for IRS and T2DM had a VO2max (22 ± 6 ml/kg/min 15% lower than the control group VO2max (26 ± 9 ml/kg/min (p 2max was inversely correlated with HOMA-IR (r = -0.30, p Conclusions Decreased VO2max is correlated with impaired insulin sensitivity and was the most prevalent abnormality in a population at risk for IRS and T2DM but without overt disease. This raises the possibility that decreased VO2 max is among the earliest indicators of IRS and T2DM therefore, an important risk factor for disease progression.

  2. The Vallecas Project: a cohort to identify early markers and mechanisms of Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Javier eOlazarán

    2015-09-01

    Full Text Available Introduction. Alzheimer’s disease (AD is a major threat for the well-being of an increasingly aged world population. The physiopathological mechanisms of late-onset AD are multiple, possibly heterogeneous, and not well understood. Different combinations of variables from several domains (i.e., clinical, neuropsychological, structural, and biochemical markers may predict dementia conversion, according to distinct physiopathological pathways, in different groups of subjects. Methods. We launched the Vallecas Project (VP, a cohort study of non-demented people aged 70 to 85, to characterize the social, clinical, neuropsychological, structural, and biochemical underpinnings of AD inception. Given the exploratory nature of the VP, multidimensional and machine learning techniques will be applied, in addition to the traditional multivariate statistical methods. Results. A total of 1,169 subjects were recruited between October 2011 and December 2013. Mean age was 74.4 years (SD 3.9, 63.5% of the subjects were women, and 17.9% of the subjects were carriers of at least one ε4 allele of the apolipoprotein E (APOE gene. Cognitive diagnoses at inclusion were as follows: normal cognition 93.0% and mild cognitive impairment (MCI 7.0% (3.1% amnestic MCI, 0.1% non-amnestic MCI, 3.8% mixed MCI. Blood samples were obtained and stored for future determinations in 99.9% of the subjects and 3T magnetic resonance imaging (MRI study was conducted in 89.9% of the volunteers. The cohort is being followed up annually for four years after the baseline. Conclusion. We have established a valuable homogeneous single-center cohort which, by identifying groups of variables associated with high risk of MCI or dementia conversion, should help to clarify the early physiopathological mechanisms of AD and should provide avenues for prompt diagnosis and AD prevention.

  3. Methylene blue as an early diagnostic marker for oral precancer and cancer.

    Science.gov (United States)

    Riaz, Akhtar; Shreedhar, Balasundari; Kamboj, Mala; Natarajan, S

    2013-12-01

    Oral cancer is one of the most common neoplasm's and is ranked eighth in the cancer incidence worldwide. Early detection is of critical importance because survival rates markedly improve. In vivo staining is a simple, inexpensive, and fairly sensitive method. Involved 120 patients (50 with Premalignant Lesion, 50 with OSCC and 20 controls) stained by Methylene Blue (MB). The results of MB uptake were compared with a simultaneous biopsy of these lesions. Pathologically confirmed precancers and cancers were the positive targets of this screening, while hyperkeratosis without dysplasia and no evidence of malignancy were sorted as negative subjects of screening. The results revealed sensitivity of 91.4%, specificity of 66.6%, positive predictive value 97.7% and negative predictive value 33% leading to diagnostic accuracy of MB stain to 90%. We state that MB staining is useful diagnostic tool in community oral cancer screening programmes for high-risk individuals.

  4. A Virtual Bioinformatics Knowledge Environment for Early Cancer Detection

    Science.gov (United States)

    Crichton, Daniel; Srivastava, Sudhir; Johnsey, Donald

    2003-01-01

    Discovery of disease biomarkers for cancer is a leading focus of early detection. The National Cancer Institute created a network of collaborating institutions focused on the discovery and validation of cancer biomarkers called the Early Detection Research Network (EDRN). Informatics plays a key role in enabling a virtual knowledge environment that provides scientists real time access to distributed data sets located at research institutions across the nation. The distributed and heterogeneous nature of the collaboration makes data sharing across institutions very difficult. EDRN has developed a comprehensive informatics effort focused on developing a national infrastructure enabling seamless access, sharing and discovery of science data resources across all EDRN sites. This paper will discuss the EDRN knowledge system architecture, its objectives and its accomplishments.

  5. Early caries detection: comparison of two procedures. A pilot study

    Directory of Open Access Journals (Sweden)

    Fabrizio Guerra

    2016-12-01

    Full Text Available Caries is one of the most common chronic diseases and the main cause of tooth loss. Early detection provides a better evaluation of the disease and improves the chances to succeed of prevention strategies. This pilot study aims to compare the effectiveness of ICDAS-II system (International Caries Detection and Assessment System and the fluorescence terminal (Proof of VistaCam iX intraoral camera, in the early diagnosis and assessment of caries in permanent teeth. Results shows a fair correlation between ICDAS II and VistaCam iX Proof; intraoral camera proved to be a useful support to the ICDAS II visual / tactile monitoring of carious lesions in occlusal surfaces.

  6. Early Detection and Classification of Melanoma Skin Cancer

    Directory of Open Access Journals (Sweden)

    Abbas Hanon. Alasadi

    2015-10-01

    Full Text Available Melanoma is a form of cancer that begins in melanocytes (cells that make the pigment melanin. It can affect the skin only, or it may spread to the organs and bones. It is less common, but more serious and aggressive than other types of skin cancer. Melanoma can be of benign or malignant. Malignant melanoma is the dangerous condition, while benign is not. In order to reduce the death rate due to malignant melanoma skin cancer, it is necessary to diagnose it at an early stage. In this paper, a detection system has been designed for diagnosing melanoma in early stages by using digital image processing techniques. The system consists of two phases: the first phase detects whether the pigmented skin lesion is malignant or benign; the second phase recognizes malignant melanoma skin cancer types. Both first and second phases have several stages. The experimental results are acceptable.

  7. Early detection of diabetes after pregnancy complicated by gestational diabetes

    DEFF Research Database (Denmark)

    Nielsen, Jane Hyldgård; Overgaard, Charlotte; Olesen, Christinna Rebecca

    2016-01-01

    ) develops type 2 diabetes within a ten-year period. Early detection can prevent or delay the onset of late complications, for which follow-up screening is important. The women are recommended follow-up screening every 1-2 years after birth do to the potentials in early detection of diabetes and prevention...... of health consequences for women. Aims: Examine the extent of participation in follow-up screening in the Danish Region of North Jutland, and the possible consequences of nonattendance. Methods: A register based study. In Danish national registers 2171 birthing women whose pregnancy was complicated by GDM...... and their participating in follow-up screening were identified. Diagnosis of diabetes or treatment with glucose-lowering agents after giving birth were also identified. Results: Attendance in follow-up screening significantly decreased with time after giving birth. Women attending follow-up screening had a significantly...

  8. Aneuploidy involving chromosome 1 may be an early predictive marker of intestinal type gastric cancer

    Energy Technology Data Exchange (ETDEWEB)

    Williams, L. [Royal Glamorgan Hospital, Ynysmaerdy, Llantrisant CF72 8XR (United Kingdom); Somasekar, A. [Institute of Life Science, Swansea School of Medicine, Swansea University, Swansea SA28PP (United Kingdom); Neath Port Talbot Hospital, Abertawe Bro Morgannwg University NHS Trust, Baglan Way, Port Talbot SA12 7BX (United Kingdom); Davies, D.J.; Cronin, J.; Doak, S.H. [Institute of Life Science, Swansea School of Medicine, Swansea University, Swansea SA28PP (United Kingdom); Alcolado, R. [Royal Glamorgan Hospital, Ynysmaerdy, Llantrisant CF72 8XR (United Kingdom); Williams, J.G. [Neath Port Talbot Hospital, Abertawe Bro Morgannwg University NHS Trust, Baglan Way, Port Talbot SA12 7BX (United Kingdom); Griffiths, A.P. [Department of Histopathology, Morriston Hospital, Abertawe Bro Morgannwg University NHS Trust, Morriston, SA66NL (United Kingdom); Baxter, J.N. [Department of Surgery, Morriston Hospital, Abertawe Bro Morgannwg University NHS Trust, Morriston, SA66NL (United Kingdom); Jenkins, G.J.S., E-mail: g.j.jenkins@swansea.ac.uk [Institute of Life Science, Swansea School of Medicine, Swansea University, Swansea SA28PP (United Kingdom)

    2009-10-02

    Intestinal type gastric cancer is a significant cause of mortality, therefore a better understanding of its molecular basis is required. We assessed if either aneuploidy or activity of the oncogenic transcription factor nuclear factor kappa B (NF-{kappa}B), increased incrementally during pre-malignant gastric histological progression and also if they correlated with each other in patient samples, as they are both induced by oxygen free radicals. In a prospective study of 54 (aneuploidy) and 59 (NF-{kappa}B) consecutive patients, aneuploidy was assessed by interphase fluorescent in situ hybridisation (FISH) for chromosome 1. NF-{kappa}B was assessed by expression of interleukin-8 (IL-8), and in a subset, by immunohistochemistry (IHC) for active p65. Aneuploidy levels increased incrementally across the histological series. 2.76% of cells with normal histology (95% CI, 2.14-3.38%) showed background levels of aneuploidy, this increased to averages of 3.78% (95% CI, 3.21-4.35%), 5.89% (95% CI, 3.72-8.06%) and 7.29% (95% CI, 4.73-9.85%) of cells from patients with gastritis, Helicobacter pylori positive gastritis and atrophy/intestinal metaplasia (IM) respectively. IL-8 expression was only increased in patients with current H. pylori infection. NF-{kappa}B analysis showed some increased p65 activity in inflamed tissues. IL-8 expression and aneuploidy level were not linked in individual patients. Aneuploidy levels increased incrementally during histological progression; were significantly elevated at very early stages of neoplastic progression and could well be linked to cancer development and used to assess cancer risk. Reactive oxygen species (ROS) induced in early gastric cancer are presumably responsible for the stepwise accumulation of this particular mutation, i.e. aneuploidy. Hence, aneuploidy measured by fluorescent in situ hybridisation (FISH) coupled to brush cytology, would be worthy of consideration as a predictive marker in gastric cancer and could be

  9. Multilocus detection of wolf x dog hybridization in italy, and guidelines for marker selection.

    Science.gov (United States)

    Randi, Ettore; Hulva, Pavel; Fabbri, Elena; Galaverni, Marco; Galov, Ana; Kusak, Josip; Bigi, Daniele; Bolfíková, Barbora Černá; Smetanová, Milena; Caniglia, Romolo

    2014-01-01

    Hybridization and introgression can impact the evolution of natural populations. Several wild canid species hybridize in nature, sometimes originating new taxa. However, hybridization with free-ranging dogs is threatening the genetic integrity of grey wolf populations (Canis lupus), or even the survival of endangered species (e.g., the Ethiopian wolf C. simensis). Efficient molecular tools to assess hybridization rates are essential in wolf conservation strategies. We evaluated the power of biparental and uniparental markers (39 autosomal and 4 Y-linked microsatellites, a melanistic deletion at the β-defensin CBD103 gene, the hypervariable domain of the mtDNA control-region) to identify the multilocus admixture patterns in wolf x dog hybrids. We used empirical data from 2 hybrid groups with different histories: 30 presumptive natural hybrids from Italy and 73 Czechoslovakian wolfdogs of known hybrid origin, as well as simulated data. We assessed the efficiency of various marker combinations and reference samples in admixture analyses using 69 dogs of different breeds and 99 wolves from Italy, Balkans and Carpathian Mountains. Results confirmed the occurrence of hybrids in Italy, some of them showing anomalous phenotypic traits and exogenous mtDNA or Y-chromosome introgression. Hybridization was mostly attributable to village dogs and not strictly patrilineal. The melanistic β-defensin deletion was found only in Italian dogs and in putative hybrids. The 24 most divergent microsatellites (largest wolf-dog FST values) were equally or more informative than the entire panel of 39 loci. A smaller panel of 12 microsatellites increased risks to identify false admixed individuals. The frequency of F1 and F2 was lower than backcrosses or introgressed individuals, suggesting hybridization already occurred some generations in the past, during early phases of wolf expansion from their historical core areas. Empirical and simulated data indicated the identification of the past

  10. Multilocus detection of wolf x dog hybridization in italy, and guidelines for marker selection.

    Directory of Open Access Journals (Sweden)

    Ettore Randi

    Full Text Available Hybridization and introgression can impact the evolution of natural populations. Several wild canid species hybridize in nature, sometimes originating new taxa. However, hybridization with free-ranging dogs is threatening the genetic integrity of grey wolf populations (Canis lupus, or even the survival of endangered species (e.g., the Ethiopian wolf C. simensis. Efficient molecular tools to assess hybridization rates are essential in wolf conservation strategies. We evaluated the power of biparental and uniparental markers (39 autosomal and 4 Y-linked microsatellites, a melanistic deletion at the β-defensin CBD103 gene, the hypervariable domain of the mtDNA control-region to identify the multilocus admixture patterns in wolf x dog hybrids. We used empirical data from 2 hybrid groups with different histories: 30 presumptive natural hybrids from Italy and 73 Czechoslovakian wolfdogs of known hybrid origin, as well as simulated data. We assessed the efficiency of various marker combinations and reference samples in admixture analyses using 69 dogs of different breeds and 99 wolves from Italy, Balkans and Carpathian Mountains. Results confirmed the occurrence of hybrids in Italy, some of them showing anomalous phenotypic traits and exogenous mtDNA or Y-chromosome introgression. Hybridization was mostly attributable to village dogs and not strictly patrilineal. The melanistic β-defensin deletion was found only in Italian dogs and in putative hybrids. The 24 most divergent microsatellites (largest wolf-dog FST values were equally or more informative than the entire panel of 39 loci. A smaller panel of 12 microsatellites increased risks to identify false admixed individuals. The frequency of F1 and F2 was lower than backcrosses or introgressed individuals, suggesting hybridization already occurred some generations in the past, during early phases of wolf expansion from their historical core areas. Empirical and simulated data indicated the

  11. A Simple System for the Early Detection of Breast Cancer

    Science.gov (United States)

    2015-07-01

    informatics, immunology , benign cancer , prognostic studies, baseline diagnostics, heatmaps, ROCurves 2 Major Activities 1. Production of IMS arrays...AD______________ AWARD NUMBER: W81XWH-14-1-0231 TITLE: A Simple System for the Early Detection of Breast Cancer PRINCIPAL INVESTIGATOR...0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing

  12. DNA methylation-based biomarkers for early detection of non-small cell lung cancer: an update

    Directory of Open Access Journals (Sweden)

    Laird-Offringa Ite A

    2008-10-01

    Full Text Available Abstract Lung cancer is the number one cancer killer in the United States. This disease is clinically divided into two sub-types, small cell lung cancer, (10–15% of lung cancer cases, and non-small cell lung cancer (NSCLC; 85–90% of cases. Early detection of NSCLC, which is the more common and less aggressive of the two sub-types, has the highest potential for saving lives. As yet, no routine screening method that enables early detection exists, and this is a key factor in the high mortality rate of this disease. Imaging and cytology-based screening strategies have been employed for early detection, and while some are sensitive, none have been demonstrated to reduce lung cancer mortality. However, mortality might be reduced by developing specific molecular markers that can complement imaging techniques. DNA methylation has emerged as a highly promising biomarker and is being actively studied in multiple cancers. The analysis of DNA methylation-based biomarkers is rapidly advancing, and a large number of potential biomarkers have been identified. Here we present a detailed review of the literature, focusing on DNA methylation-based markers developed using primary NSCLC tissue. Viable markers for clinical diagnosis must be detectable in 'remote media' such as blood, sputum, bronchoalveolar lavage, or even exhaled breath condensate. We discuss progress on their detection in such media and the sensitivity and specificity of the molecular marker panels identified to date. Lastly, we look to future advancements that will be made possible with the interrogation of the epigenome.

  13. Earthquake Early Warning with Seismogeodesy: Detection, Location, and Magnitude Estimation

    Science.gov (United States)

    Goldberg, D.; Bock, Y.; Melgar, D.

    2016-12-01

    Earthquake early warning is critical to reducing injuries and casualties in case of a large magnitude earthquake. The system must rely on near-source data to minimize the time between event onset and issuance of a warning. Early warning systems typically use seismic instruments (seismometers and accelerometers), but these instruments experience difficulty maintaining reliable data in the near-source region and undergo magnitude saturation for large events. Global Navigation Satellite System (GNSS) instruments capture the long period motions and have been shown to produce robust estimates of the true size of the earthquake source. However, GNSS is often overlooked in this context in part because it is not precise enough to record the first seismic wave arrivals (P-wave detection), an important consideration for issuing an early warning. GNSS instruments are becoming integrated into early warning, but are not yet fully exploited. Our approach involves the combination of direct measurements from collocated GNSS and accelerometer stations to estimate broadband coseismic displacement and velocity waveforms [Bock et al., 2011], a method known as seismogeodesy. We present the prototype seismogeodetic early warning system developed at Scripps and demonstrate that the seismogeodetic dataset can be used for P-wave detection, hypocenter location, and shaking onset determination. We discuss uncertainties in each of these estimates and include discussion of the sensitivity of our estimates as a function of the azimuthal distribution of monitoring stations. The seismogeodetic combination has previously been shown to be immune to magnitude saturation [Crowell et al., 2013; Melgar et al., 2015]. Rapid magnitude estimation is an important product in earthquake early warning, and is the critical metric in current tsunami hazard warnings. Using the seismogeodetic approach, we refine earthquake magnitude scaling using P-wave amplitudes (Pd) and peak ground displacements (PGD) for a

  14. Early hearing detection and intervention: 2010 CODEPEH recommendation.

    Science.gov (United States)

    Trinidad-Ramos, Germán; de Aguilar, Valentín Alzina; Jaudenes-Casaubón, Carmen; Núñez-Batalla, Faustino; Sequí-Canet, José Miguel

    2010-01-01

    Newborn hearing screening is currently performed routinely in many regional health-care systems in Spain. Despite the remarkable expansion in newborn hearing screening since 2000, its feasibility and the benefits of early identification and intervention, many major challenges still remain. In this article, the Committee for the Early Detection of Hearing Loss (Comisión para la Detección Precoz de la Hipoacusia, CODEPEH) updates the recommendations that are considered important for the future development of early hearing detection and intervention (EDHI) systems in the following points: 1. Screening protocols: Separate protocols are recommended for NICU (Neonatal Intensive Care Units) and well-infant nurseries. 2. Diagnostic audiology evaluation. Professionals with skills and expertise in evaluating newborn and young infants should provide diagnosis, selection and fitting of amplification devices. 3. Medical evaluation. Risk factors for congenital and acquired hearing loss have been combined in a single list rather than grouped by time of onset. A stepwise diagnostic paradigm is diagnostically more efficient and cost-effective than a simultaneous testing approach. 4. Early intervention and surveillance. All individuals providing services to infants with hearing loss should have specialized training and expertise in the development of audition, speech and language. Regular surveillance should be performed on developmental milestones, auditory skills, parental concerns, and middle ear status. 5. Quality control. Data management as part of an integrated system is important to monitor and improve the quality of EDHI services.

  15. Detection of early seizures by diffuse optical tomography

    Science.gov (United States)

    Zhang, Tao; Hajihashemi, M. Reza; Zhou, Junli; Carney, Paul R.; Jiang, Huabei

    2015-03-01

    In epilepsy it has been challenging to detect early changes in brain activity that occurs prior to seizure onset and to map their origin and evolution for possible intervention. Besides, preclinical seizure experiments need to be conducted in awake animals with images reconstructed and displayed in real-time. We demonstrate using a rat model of generalized epilepsy that diffuse optical tomography (DOT) provides a unique functional neuroimaging modality for noninvasively and continuously tracking brain activities with high spatiotemporal resolution. We developed methods to conduct seizure experiments in fully awake rats using a subject-specific helmet and a restraining mechanism. For the first time, we detected early hemodynamic responses with heterogeneous patterns several minutes preceding the electroencephalographic seizure onset, supporting the presence of a "pre-seizure" state both in anesthetized and awake rats. Using a novel time-series analysis of scattering images, we show that the analysis of scattered diffuse light is a sensitive and reliable modality for detecting changes in neural activity associated with generalized seizure. We found widespread hemodynamic changes evolving from local regions of the bilateral cortex and thalamus to the entire brain, indicating that the onset of generalized seizures may originate locally rather than diffusely. Together, these findings suggest DOT represents a powerful tool for mapping early seizure onset and propagation pathways.

  16. Simultaneous detection of mRNA and protein stem cell markers in live cells

    Directory of Open Access Journals (Sweden)

    Bao Gang

    2009-04-01

    Full Text Available Abstract Background Biological studies and medical application of stem cells often require the isolation of stem cells from a mixed cell population, including the detection of cancer stem cells in tumor tissue, and isolation of induced pluripotent stem cells after eliciting the expression of specific genes in adult cells. Here we report the detection of Oct-4 mRNA and SSEA-1 protein in live carcinoma stem cells using respectively molecular beacon and dye-labeled antibody, aiming to establish a new method for stem cells detection and isolation. Results Quantification of Oct-4 mRNA and protein in P19 mouse carcinoma stem cells using respectively RT-PCR and immunocytochemistry confirmed that their levels drastically decreased after differentiation. To visualize Oct-4 mRNA in live stem cells, molecular beacons were designed, synthesized and validated, and the detection specificity was confirmed using control studies. We found that the fluorescence signal from Oct-4-targeting molecular beacons provides a clear discrimination between undifferentiated and retinoic acid-induced differentiated cells. Using deconvolution fluorescence microscopy, Oct-4 mRNAs were found to reside on one side of the cytosol. We demonstrated that, using a combination of Oct-4 mRNA-targeting molecular beacon with SSEA-1 antibody in flow cytometric analysis, undifferentiated stem cells can be clearly distinguished from differentiated cells. We revealed that Oct-4 targeting molecular beacons do not seem to affect stem cell biology. Conclusion Molecular beacons have the potential to provide a powerful tool for highly specific detection and isolation of stem cells, including cancer stem cells and induced pluripotent stem (iPS cells without disturbing cell physiology. It is advantageous to perform simultaneous detection of intracellular (mRNA and cell-surface (protein stem cell markers in flow cytometric analysis, which may lead to high detection sensitivity and efficiency.

  17. 44. Copeptin as early marker of acute non-ST elevation myocardial infarction in patients suspected with acute coronary syndrome

    Directory of Open Access Journals (Sweden)

    S. Rafla

    2016-07-01

    . All the patients with NSTEMI (30 had positive copeptin and positive troponin except one only who had + troponin only and another one who had + copeptin only. Of the 58 patients without MI none had the two tests positive, only one had + troponin and one had + copeptin. Using ROC curve: copeptin had sensitivity 100% and specificity 82.8% with using cut off point 13.2 pmol/l. So copeptin can be used for early detection of myocardial infarction. Copeptin seems to be an ideal confirmatory marker for rapid rule out of AMI. If the two tests (with troponin are positive, this is evident MI; if the two are negative it rules out MI.

  18. Mast cell reactivity at the margin of human skin wounds: an early cell marker of wound survival?

    Science.gov (United States)

    Oehmichen, M; Gronki, T; Meissner, C; Anlauf, M; Schwark, T

    2009-10-30

    Detecting the vitality of mechanical skin wounds (antemortem versus postmortem injury) in human cadavers remains a specifically forensic problem. To determine whether skin mast cells (MCs) are activated during the very early phase of human wound healing we performed a histomorphometric evaluation of the extent of MC enzyme loss as an indication of MC degranulation at the wound margins of skin wounds in 64 human cadavers. We compared the number of tryptase-reactive MCs, which are said not to loose all of their enzyme activity during degranulation process, with the number of naphthol AS-D chloroacetate esterase (NAS-DClAE)-positive MCs, which loose their complete enzyme activity in the form of enzyme-positive granula after activation. The enzyme activity was evaluated on sequential histological sections after autopsy as an indirect quantification of the number of degranulated MCs. Most of the victims had died within 10-60 min after injury (n=50), 12 survived between 60 min and 24h, and only 2 victims survived more than 24h (12 days each). The number of enzyme-positive MCs were counted in six successive visual fields (0.785 mm(2)) on the one hand located parallel to and--on the other hand--at increasing distances outward from the wound margins. In victims surviving the injury less than 60 min the average number of NAS-DClAE-reactive MCs next to the wound margin was significantly lower than the number of tryptase-reactive MCs. The extent of the reduction in NAS-DClAE-reactive MC counts correlated inversely with the distance from the wound edges. Our findings show that MCs undergo very early loss of NAS-DClAE activity at wound margins, and thus appear to be an early cell marker of wound survival. However, definitive evidence that the enzyme loss (degranulation) represents a vital process can only be obtained by comparing MC enzyme loss induced by injury during intact circulation with the MC reaction to injury inflicted very shortly after cardiac arrest, a question that

  19. Detection and source identification of faecal pollution in non-sewered catchment by means of host-specific molecular markers.

    Science.gov (United States)

    Ahmed, W; Powell, D; Goonetilleke, A; Gardner, T

    2008-01-01

    Multiple host-specific molecular markers were used to detect the sources of faecal pollution in a mixed land use non-sewered catchment in Southeast Queensland, Australia. These markers included human-specific Bacteroides (HF183 and HF134), cattle-specific Bacteroides (CF128), dog-specific Bacteroides (BacCan) and human-specific enterococci surface protein (esp) markers. The sensitivity and specificity of these markers were determined by testing 197 faecal samples from 13 host groups. The overall sensitivity and specificity of these markers was high (sensitivity>/=85% and specificity>/=93%) indicating their suitability for detecting the sources of faecal pollution. Of the 16 samples collected from the study area, 14 (87%) were positive for at least one of the molecular marker tested. Amongst all the markers, cattle-specific CF128 was more prevalent than others, followed by human-specific HF183 which was consistently detected in samples collected from sites within close proximity to urban development. Significant correlations were found between E. coli and enterococci concentrations with the positive/negative results of human-specific Bacteroides HF183 (psources of human faecal pollution in surface waters in Southeast Queensland, Australia.

  20. NT-proBNP as Early Marker of Subclinical Late Cardiotoxicity after Doxorubicin Therapy and Mediastinal Irradiation in Childhood Cancer Survivors

    Directory of Open Access Journals (Sweden)

    Amal Zidan

    2015-01-01

    Full Text Available Background. Childhood cancer survivors treated with anthracyclines and mediastinal irradiation are at risk for late onset cardiotoxicity. Aims of the Study. To assess the role of N-terminal pro-brain natriuretic peptide (NT-proBNP and tissue Doppler imaging (TDI as early predictors of late onset cardiotoxicity in asymptomatic survivors of childhood cancer treated with doxorubicin with or without mediastinal irradiation. Methods. A cross-sectional study on 58 asymptomatic survivors of childhood cancer who received doxorubicin in their treatment protocols and 32 asymptomatic Hodgkin’s lymphoma survivors who received anthracycline and mediastinal irradiation. Levels of NT-proBNP, TDI, and conventional echocardiography were determined. Results. Thirty percent of survivors had abnormal NT-proBNP levels. It was significantly related to age at diagnosis, duration of follow-up, and cumulative dose of doxorubicin. TDI detected myocardial affection in 20% more than conventional echocardiography. Furthermore, abnormalities in TDI and NT-pro-BNP levels were more common in Hodgkin lymphoma survivors receiving both chemotherapy and radiotherapy. Conclusions. TDI could detect early cardiac dysfunction even in those with normal conventional echocardiography. Measurement of NT-proBNP represents an interesting strategy for detecting subclinical cardiotoxicity. We recommend prospective and multicenter studies to validate the role of NT-proBNP as an early marker for late onset doxorubicin-induced cardiotoxicity.

  1. Molecular Assay for Detection of Genetic Markers Associated with Decreased Susceptibility to Cephalosporins in Neisseria gonorrhoeae.

    Science.gov (United States)

    Peterson, S W; Martin, I; Demczuk, W; Bharat, A; Hoang, L; Wylie, J; Allen, V; Lefebvre, B; Tyrrell, G; Horsman, G; Haldane, D; Garceau, R; Wong, T; Mulvey, M R

    2015-07-01

    The incidence of antimicrobial-resistant Neisseria gonorrhoeae continues to rise in Canada; however, antimicrobial resistance data are lacking for approximately 70% of gonorrhea infections that are diagnosed directly from clinical specimens by nucleic acid amplification tests (NAATs). We developed a molecular assay for surveillance use to detect mutations in genes associated with decreased susceptibility to cephalosporins that can be applied to both culture isolates and clinical samples. Real-time PCR assays were developed to detect single nucleotide polymorphisms (SNPs) in ponA, mtrR, penA, porB, and one N. gonorrhoeae-specific marker (porA). We tested the real-time PCR assay with 252 gonococcal isolates, 50 nongonococcal isolates, 24 N. gonorrhoeae-negative NAAT specimens, and 34 N. gonorrhoeae-positive NAAT specimens. Twenty-four of the N. gonorrhoeae-positive NAAT specimens had matched culture isolates. Assay results were confirmed by comparison with whole-genome sequencing data. For 252 N. gonorrhoeae strains, the agreement between the DNA sequence and real-time PCR was 100% for porA, ponA, and penA, 99.6% for mtrR, and 95.2% for porB. The presence of ≥2 SNPs correlated with decreased susceptibility to ceftriaxone (sensitivities of >98%) and cefixime (sensitivities of >96%). Of 24 NAAT specimens with matched cultures, the agreement between the DNA sequence and real-time PCR was 100% for porB, 95.8% for ponA and mtrR, and 91.7% for penA. We demonstrated the utility of a real-time PCR assay for sensitive detection of known markers for the decreased susceptibility to cephalosporins in N. gonorrhoeae. Preliminary results with clinical NAAT specimens were also promising, as they correlated well with bacterial culture results.

  2. Genetics and early detection in idiopathic pulmonary fibrosis.

    Science.gov (United States)

    Putman, Rachel K; Rosas, Ivan O; Hunninghake, Gary M

    2014-04-01

    Genetic studies hold promise in helping to identify patients with early idiopathic pulmonary fibrosis (IPF). Recent studies using chest computed tomograms (CTs) in smokers and in the general population have demonstrated that imaging abnormalities suggestive of an early stage of pulmonary fibrosis are not uncommon and are associated with respiratory symptoms, physical examination abnormalities, and physiologic decrements expected, but less severe than those noted in patients with IPF. Similarly, recent genetic studies have demonstrated strong and replicable associations between a common promoter polymorphism in the mucin 5B gene (MUC5B) and both IPF and the presence of abnormal imaging findings in the general population. Despite these findings, it is important to note that the definition of early-stage IPF remains unclear, limited data exist to definitively connect abnormal imaging findings to IPF, and genetic studies assessing early-stage pulmonary fibrosis remain in their infancy. In this perspective we provide updated information on interstitial lung abnormalities and their connection to IPF. We summarize information on the genetics of pulmonary fibrosis by focusing on the recent genetic findings of MUC5B. Finally, we discuss the implications of these findings and suggest a roadmap for the use of genetics in the detection of early IPF.

  3. Early detection of abnormal patient arrivals at hospital emergency department

    KAUST Repository

    Harrou, Fouzi

    2015-10-21

    Overcrowding is one of the most crucial issues confronting emergency departments (EDs) throughout the world. Efficient management of patient flows for ED services has become an urgent issue for most hospital administrations. Handling and detection of abnormal situations is a key challenge in EDs. Thus, the early detection of abnormal patient arrivals at EDs plays an important role from the point of view of improving management of the inspected EDs. It allows the EDs mangers to prepare for high levels of care activities, to optimize the internal resources and to predict enough hospitalization capacity in downstream care services. This study reports the development of statistical method for enhancing detection of abnormal daily patient arrivals at the ED, which able to provide early alert mechanisms in the event of abnormal situations. The autoregressive moving average (ARMA)-based exponentially weighted moving average (EWMA) anomaly detection scheme proposed was successfully applied to the practical data collected from the database of the pediatric emergency department (PED) at Lille regional hospital center, France.

  4. [Early detection of cervical cancer in Chile: time for change].

    Science.gov (United States)

    Léniz Martelli, Javiera; Van De Wyngard, Vanessa; Lagos, Marcela; Barriga, María Isabel; Puschel Illanes, Klaus; Ferreccio Readi, Catterina

    2014-08-01

    Mortality rates for cervical cancer (CC) in Chile are higher than those of developed countries and it has an unequal socioeconomic distribution. The recognition of human papilloma virus (HPV) as the causal agent of cervical cancer in the early 80's changed the prevention paradigms. Current goals are to prevent HPV infection by vaccination before the onset of sexual activity and to detect HPV infection in women older than 30 years. This article reviews CC prevention and early detection methods, discusses relevant evidence to support a change in Chile and presents an innovation proposal. A strategy of primary screening based on HPV detection followed by triage of HPV-positive women by colposcopy in primary care or by cytological or molecular reflex testing is proposed. Due to the existence in Chile of a well-organized nationwide CC prevention program, the replacement of a low-sensitivity screening test such as the Papanicolau test with a highly sensitive one such as HPV detection, could quickly improve the effectiveness of the program. The program also has a network of personnel qualified to conduct naked-eye inspections of the cervix, who could easily be trained to perform triage colposcopy. The incorporation of new prevention strategies could reduce the deaths of Chilean women and correct inequities.

  5. A decade of aquatic invasive species (AIS) early detection ...

    Science.gov (United States)

    As an invasion prone location, the St. Louis River Estuary (SLRE) has been a case study for ongoing research to develop the framework for a practical Great Lakes monitoring network for early detection of aquatic invasive species (AIS). Early detection, however, necessitates finding new invaders before they are common. Here we outline our research (2005 present) approach and findings, including strategies to increase detection efficiency by optimizing specimen collection and identification methods. Initial surveys were designed to over-sample to amass data as the basis for numerical experiments to investigate to the effort required for a given detection probability. Later surveys tested the outcome of implementing these strategies, examined the potential benefits of sampling larval fish instead of adults and explored the prospect of using advanced DNA based methods as an alternative to traditional taxonomy. To date we have identified several previously undetected invertebrate invaders, developed survey design and gear recommendations and have refined the search strategy for systems beyond the SLRE. In addition, because we’ve accumulated such a large body of data we now have the basis to show spatial-temporal trends for native and non-native species in the SLRE. not applicable

  6. Evaluation of a CLEIA automated assay system for the detection of a panel of tumor markers.

    Science.gov (United States)

    Falzarano, Renato; Viggiani, Valentina; Michienzi, Simona; Longo, Flavia; Tudini, Silvestra; Frati, Luigi; Anastasi, Emanuela

    2013-10-01

    Tumor markers are commonly used to detect a relapse of disease in oncologic patients during follow-up. It is important to evaluate new assay systems for a better and more precise assessment, as a standardized method is currently lacking. The aim of this study was to assess the concordance between an automated chemiluminescent enzyme immunoassay system (LUMIPULSE® G1200) and our reference methods using seven tumor markers. Serum samples from 787 subjects representing a variety of diagnoses, including oncologic, were analyzed using LUMIPULSE® G1200 and our reference methods. Serum values were measured for the following analytes: prostate-specific antigen (PSA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen 125 (CA125), carbohydrate antigen 15-3 (CA15-3), carbohydrate antigen 19-9 (CA19-9), and cytokeratin 19 fragment (CYFRA 21-1). For the determination of CEA, AFP, and PSA, an automatic analyzer based on chemiluminescence was applied as reference method. To assess CYFRA 21-1, CA125, CA19-9, and CA15-3, an immunoradiometric manual system was employed. Method comparison by Passing-Bablok analysis resulted in slopes ranging from 0.9728 to 1.9089 and correlation coefficients from 0.9977 to 0.9335. The precision of each assay was assessed by testing six serum samples. Each sample was analyzed for all tumor biomarkers in duplicate and in three different runs. The coefficients of variation were less than 6.3 and 6.2 % for within-run and between-run variation, respectively. Our data suggest an overall good interassay agreement for all markers. The comparison with our reference methods showed good precision and reliability, highlighting its usefulness in clinical laboratory's routine.

  7. An Early Fire Detection Algorithm Using IP Cameras

    Directory of Open Access Journals (Sweden)

    Hector Perez-Meana

    2012-05-01

    Full Text Available The presence of smoke is the first symptom of fire; therefore to achieve early fire detection, accurate and quick estimation of the presence of smoke is very important. In this paper we propose an algorithm to detect the presence of smoke using video sequences captured by Internet Protocol (IP cameras, in which important features of smoke, such as color, motion and growth properties are employed. For an efficient smoke detection in the IP camera platform, a detection algorithm must operate directly in the Discrete Cosine Transform (DCT domain to reduce computational cost, avoiding a complete decoding process required for algorithms that operate in spatial domain. In the proposed algorithm the DCT Inter-transformation technique is used to increase the detection accuracy without inverse DCT operation. In the proposed scheme, firstly the candidate smoke regions are estimated using motion and color smoke properties; next using morphological operations the noise is reduced. Finally the growth properties of the candidate smoke regions are furthermore analyzed through time using the connected component labeling technique. Evaluation results show that a feasible smoke detection method with false negative and false positive error rates approximately equal to 4% and 2%, respectively, is obtained.

  8. Genomic Integrity Detection of In Vitro Irradiated Banana Using Microsatellite Marker.

    Directory of Open Access Journals (Sweden)

    Nina Ratna Djuita

    2010-11-01

    Full Text Available Genomic Integrity Detection of In Vitro Irradiated Banana Using Microsatellite Marker. The research aims todetect genomic integrity of in vitro irradiated banana using microsatellite marker. These studies were done on bananacv. Pisang Mas irradiated by 15 Gy of gamma ray. The DNA was isolated from each accesion following Dixie.Amplification of DNA products were done by Perkin Elmer Gene Amp PCR 2400 using ten primers, and thenelectroforesis in agarose 1%. Finally a vertical polyacrylamide gel electroforesis was run and the products werevisualized by silver staining. The result shown that among the primers tested, eight primers produced clear, discrete,and reproducible bands. Number of DNA band exhibited ranging from one to two, following the ploidy level of pisangMas which is a diploid banana cultivar (AA. One band suggest homozygote allele while two bands showedheterozygote allele. Out of eight primers, six primers produced different allele among irradiated, in vitro, and in vivocontrol plant. Meanwhile, for the other two primers the allele were monomorph for all the accessions examined.Genomic modification was observed at all irradiated plants. The modification can happened at zygosity of certain allelethat may change from heterozygote to homozygote or vice versa. While modification in allele size that underlyinggenomic instability could be caused by several genetic events such as deletion, insertion, and amplification ofnucleotides.

  9. Detection of the tumor marker mucine with a diode-laser-based evanescent wave sensor

    Science.gov (United States)

    Bock, Daniel; Kaul, Sepp; Loescher, Frank; Ruckstuhl, Thomas; Schulz, V.; Ueberfeld, J.; Seeger, Stefan

    1996-11-01

    Optical sensors based on the utilization of the evanescent field arising at the interface between two media in the case of total internal reflection are an excellent tool for the reduction of time consuming and complex chemical analysis. We developed a fiber-optic based set-up with visible diode lasers as excitation sources. As recognition element an optical fiber covered with a photopolymerized antibody monolayer was used. Beside the commercially available cyanine fluorescent dye Cy 5, newly developed fluorescent dyes in the red spectral region were coupled to antibodies. In order to test the set-up in a clinically relevant system the antibodies BM-2 and BM-7 were chosen. With this antibody system the tumor marker mucine in a sandwich immunoassay was investigated. This protein shows increased concentrations in serum and ascites in the case of breast cancer. The combination of semiconductor devices and ultrathin antibody layers together with an antibody system directed against mucine offers the possibility of an on-line detection of the tumor marker.

  10. Detection of Tumor Marker CA125 in Ovarian Carcinoma Using Quantum Dots

    Institute of Scientific and Technical Information of China (English)

    Hui-Zhi WANG; Hai-Yan WANG; Ru-Qiang LIANG; Kang-Cheng RUAN

    2004-01-01

    Semiconductor quantum dots (QDs) offer several advantages over organic dyes in fluorescence-imaging applications, such as higher quantum yield, exceptional photostability, and a narrow, tunable,and symmetric emission spectrum. To explore whether QDs could specifically and effectively label tumor markers and be used in immunohistochemistry as a novel type of fluorescent probe, we used quantum dots with maximum emission wavelength 605 nm (QD605) to detect the ovarian carcinoma marker CA125 in specimens of different types (fixed cells, tissue sections, and xenograft piece). Additionally, we compared the photostability of QD signals with that of a conventional organic dye, FITC. All labeling signals of QDs were found to be more specific and brighter than those of FITC. Moreover, the QDs exhibited exceptional photostability during continuous illumination for 1 h by a high-intensity laser (Ar laser power 100 mW) at 488 nm, while the FITC signals faded very quickly and became undetectable after 24 min of illumination. These results indicate that QD-based probes can offer substantial advantages over existing fluorophores in many applications, and can be used effectively in immunohistochemistry as a novel class of fluorescent probes.

  11. A theoretical timeline for myocardial infarction: immunohistochemical evaluation and western blot quantification for Interleukin-15 and Monocyte chemotactic protein-1 as very early markers.

    Science.gov (United States)

    Turillazzi, Emanuela; Di Paolo, Marco; Neri, Margherita; Riezzo, Irene; Fineschi, Vittorio

    2014-07-02

    Experimental and human studies have demonstrated that innate immune mechanisms and consequent inflammatory reaction play a critical role in cardiac response to ischemic injury. Thus, the detection of immuno-inflammatory and cellular phenomena accompanying cardiac alterations during the early inflammatory phase of myocardial infarction (MI) may be an excellent diagnostic tool. Current knowledge of the chronology of the responses of myocardial tissue following the occurrence of ischemic insult, as well as the existence of numerous studies aiming to identify reliable markers in dating MI, induced us to investigate the myocardial specimens of MI fatal cases in order to better define the age of MI. We performed an immunohistochemical study and a Western blot analysis to evaluate detectable morphological changes in myocardial specimens of fatal MI cases and to quantify the effects of cardiac expression of inflammatory mediators (CD15, IL-1β, IL-6, TNF-α, IL-15, IL-8, MCP-1, ICAM-1, CD18, tryptase) and structural and functional cardiac proteins. We observed a biphasic course of MCP-1: it was strongly expressed in the very early phase (0-4 hrs), to diminish in the early period (after 6-8 hrs). Again, our choice of IL-15 is explained by the synergism with neutrophilic granulocytes (CD15) and our study shows the potential for striking cytokine synergy in promoting fast, local neutrophil response in damaged tissues. A progressively stronger immunoreaction for the CD15 antibody was visible in the areas where the margination of circulating inflammatory cells was detectable, up to very strong expression in the oldest ones (>12 hours). Further, the induction of CD15, IL-15, MCP-1 expression levels was quantified by Western blot analysis. The results were as follows: IL-15/β-actin 0.80, CD15/β-actin 0.30, and MCP-1/β-actin 0.60, matching perfectly with the results of immunohistochemistry. Control hearts from traumatic death cases did not show any immunoreactivity to the

  12. Plasma TIMP-1 and CEA as markers for detection of primary colorectal cancer

    DEFF Research Database (Denmark)

    Christensen, Ib Jarle; Brünner, Nils; Dowell, Barry

    2015-01-01

    BACKGROUND/AIM: The combination of plasma tissue inhibitor of metalloproteinases-1 (1) and CEA has been shown to have utility in early detection of colorectal cancer (2). A prospective study was performed to validate previous findings. PATIENTS AND METHODS: Individuals undergoing large bowel...... was detected in 32 individuals, 24 with colonic cancer (CC) and 8 with rectal cancer (RC). Other findings were 265 with adenomas and 889 with non-neoplastic pathology. The biomarker levels were elevated in plasma from patients with CRC, but also from patients with various co-morbidities compared to individuals...... endoscopy were prospectively included (N=1965). Baseline data and co-morbidity were recorded. The primary end-point was the detection of CRC. Plasma was obtained before endoscopy and TIMP-1 and CEA levels were determined using an automated analysis platform when all samples were collected. RESULTS: CRC...

  13. Early detection of choroidal neovascularization in age related macular degeneration

    Directory of Open Access Journals (Sweden)

    Tural Galbinur

    2012-01-01

    Full Text Available Purpose: to identify factors associated with early detection of choroidal neovascularization CNV in clinical practice.Methods: Seventy six AMD patients who had history of CNV in one eye and presented with CNV in the second eye and evaluated for association with visual acuity (VA at time of presentation. Demographics, clinical data and lesion characteristics were retrospectively collected.Results: Better VA was associated with history of CNV in the fellow eye (p<0.0001, adherence to follow-up every four-months (p=0.015, younger age (p=0.03, smaller lesion (p<0.0001, and non-subfoveal localization (p=0.048. VA of the fellow eye did not correlate with VA at presentation with CNV.Conclusion: these data suggest that experience of CNV, regardless of VA, facilitates early diagnosis in the fellow eye. Adherence to follow-up in the routine clinic setting also facilitates early detection of CNV.

  14. Soluble Flt-1 and PlGF: new markers of early pregnancy loss?

    LENUS (Irish Health Repository)

    Muttukrishna, Shanthi

    2012-01-31

    Recent data have indicated a relationship between placental oxygen and angiogenic protein levels in the first trimester of normal pregnancies. Our objective was to investigate if maternal serum levels of angiogenic factors Soluble vascular endothelial growth factor (VEGF) receptor 1 (sFlt-1), soluble Endoglin and placental growth factor (PlGF) are altered in women with symptoms of threatened miscarriage (TM) and if they are predictive of a subsequent miscarriage. Blood samples were collected at 6-10 weeks from women presenting with TM (n = 40), from asymptomatic controls (n = 32) and from non- pregnant women in their luteal phase (n = 14). All samples were assayed for serum level of sFLT-1, PlGF, sEndoglin and HSP70 using commercial ELISAs. Samples were analysed retrospectively on the basis of pregnancy outcome. TM group included 21 women with a normal pregnancy outcome and 19 with subsequent complete miscarriage. The latter subgroup had significantly lower mean maternal serum (MS) sFlt-1 (83%, P<0.001) and PlGF (44%, P<0.001) compared to those with a normal pregnancy outcome. Asymptomatic control pregnant women had similar MS levels of sFlt-1 and PlGF compared to the TM patients with a normal outcome. The mean MS sFlt-1 (>10 fold) and MS PlGF ( approximately 2 fold) levels were significantly (P<0.001) higher in control pregnant women compared to the non-pregnant group in the luteal phase of the menstrual cycle. Soluble Endoglin was not altered in the normal pregnant women compared to non pregnant women, although lower in the TM subgroup with a subsequent miscarriage ( approximately 25%, P<0.001) compared to TM with a live birth. There was no significant difference in the mean MS HSP 70 levels between the different groups. This study shows that sFlt1 and PlGF MS levels are increased by several folds in early pregnancy and that MS sFlt-1 and MS PlGF are markedly decreased in threatened miscarriage patients who subsequently have a miscarriage suggesting these

  15. Study of early atherosclerotic markers in women with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Ritu Karoli

    2012-01-01

    Full Text Available Objective: Women with polycystic ovary syndrome (PCOS may represent a large underappreciated segment of female population who is at increased cardiovascular risk because of the presence of cluster of metabolic abnormalities. The aim of our study was to assess atherosclerotic risk factors in women with PCOS. Materials and Methods: In a cross-sectional study, 50 women with PCOS and 50 age and weight-matched healthy controls were enrolled. Endothelial dysfunction by flow-mediated dilatation (FMD of brachial artery, highly sensitive C-reactive protein (hs CRP, and carotid intima media thickness (CIMT were measured in both cases and control groups. Results: The mean age of women with PCOS was 26.82 ± 3.26 years and Body-mass index (BMI of 26.2 ± 4.8 kg/ m 2 . Thirty-six (72% patients were overweight or obese,54% had central obesity and 12% had impaired glucose tolerance. Among the markers of atherosclerosis, hsCRP levels were nonsignificantly higher in patients with PCOS than in controls. The FMD was 12.18 ± 2.3% vs 8.3 ± 2.23% in patients with PCOS and controls respectively (P=0.01. CIMT was significantly different in two study groups (0.68 ± 0.11 in PCOS vs 0.52 ± 0.02 in normal subjects, (P=0.01. FMD had significant negative correlation with homeostasis model assessment (HOMA index (r = −0.32, P=0.02 and hs CRP (r = −0.37, P=0.04 while hs CRP was correlated with BMI (r = 0.54, P=0.005, HOMA (r = 0.38, P=0.02 and FMD (r = -0.33, P=0.01. CIMT was significantly different in women with PCOS and control subjects, and it had significant correlation with age (r = 0.42, P=0.03, BMI (r = 0.36, P=0.01, waist circumference (r = 0.52, P=0.001 and HOMA (r = 0.31, P=0.04. Conclusion: Women with PCOS definitely have increased risk for future cardiovascular events. Clinicians should consider early cardiovascular screening and interventions to control all modifiable cardiovascular risk factors.

  16. Soluble Flt-1 and PlGF: new markers of early pregnancy loss?

    LENUS (Irish Health Repository)

    Muttukrishna, Shanthi

    2011-01-01

    Recent data have indicated a relationship between placental oxygen and angiogenic protein levels in the first trimester of normal pregnancies. Our objective was to investigate if maternal serum levels of angiogenic factors Soluble vascular endothelial growth factor (VEGF) receptor 1 (sFlt-1), soluble Endoglin and placental growth factor (PlGF) are altered in women with symptoms of threatened miscarriage (TM) and if they are predictive of a subsequent miscarriage. Blood samples were collected at 6-10 weeks from women presenting with TM (n = 40), from asymptomatic controls (n = 32) and from non- pregnant women in their luteal phase (n = 14). All samples were assayed for serum level of sFLT-1, PlGF, sEndoglin and HSP70 using commercial ELISAs. Samples were analysed retrospectively on the basis of pregnancy outcome. TM group included 21 women with a normal pregnancy outcome and 19 with subsequent complete miscarriage. The latter subgroup had significantly lower mean maternal serum (MS) sFlt-1 (83%, P<0.001) and PlGF (44%, P<0.001) compared to those with a normal pregnancy outcome. Asymptomatic control pregnant women had similar MS levels of sFlt-1 and PlGF compared to the TM patients with a normal outcome. The mean MS sFlt-1 (>10 fold) and MS PlGF (∼2 fold) levels were significantly (P<0.001) higher in control pregnant women compared to the non-pregnant group in the luteal phase of the menstrual cycle. Soluble Endoglin was not altered in the normal pregnant women compared to non pregnant women, although lower in the TM subgroup with a subsequent miscarriage (∼25%, P<0.001) compared to TM with a live birth. There was no significant difference in the mean MS HSP 70 levels between the different groups. This study shows that sFlt1 and PlGF MS levels are increased by several folds in early pregnancy and that MS sFlt-1 and MS PlGF are markedly decreased in threatened miscarriage patients who subsequently have a miscarriage suggesting these proteins are

  17. Using genetic markers in unpedigreed populations to detect a heritable trait

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Before a breeder invests selection pressure on a trait of interest, it needs to be established whether that trait is actually heritable. Some traits may not have been measured widely in pedigreed populations, for example, a disease or deformity may become more prevalent than previously, but is still relatively rare. One approach to detect inheritance would be to screen a commercial population to obtain a sample of "affecteds" (the test group) and to also obtain a random control group. These individuals are then genotyped with a set of genetic markers and the relationships between individuals within each group estimated. If the relatedness is higher in the test group than in the control group, this provides initial evidence for the trait being heritable. A power simulation shows that this approach is feasible with moderate resources.

  18. Development and validation of a novel molecular biomarker diagnostic test for the early detection of sepsis.

    Science.gov (United States)

    Sutherland, Allison; Thomas, Mervyn; Brandon, Roslyn A; Brandon, Richard B; Lipman, Jeffrey; Tang, Benjamin; McLean, Anthony; Pascoe, Ranald; Price, Gareth; Nguyen, Thu; Stone, Glenn; Venter, Deon

    2011-06-20

    Sepsis is a complex immunological response to infection characterized by early hyper-inflammation followed by severe and protracted immunosuppression, suggesting that a multi-marker approach has the greatest clinical utility for early detection, within a clinical environment focused on Systemic Inflammatory Response Syndrome (SIRS) differentiation. Pre-clinical research using an equine sepsis model identified a panel of gene expression biomarkers that define the early aberrant immune activation. Thus, the primary objective was to apply these gene expression biomarkers to distinguish patients with sepsis from those who had undergone major open surgery and had clinical outcomes consistent with systemic inflammation due to physical trauma and wound healing. This was a multi-centre, prospective clinical trial conducted across four tertiary critical care settings in Australia. Sepsis patients were recruited if they met the 1992 Consensus Statement criteria and had clinical evidence of systemic infection based on microbiology diagnoses (n = 27). Participants in the post-surgical (PS) group were recruited pre-operatively and blood samples collected within 24 hours following surgery (n = 38). Healthy controls (HC) included hospital staff with no known concurrent illnesses (n = 20). Each participant had minimally 5 ml of PAXgene blood collected for leucocyte RNA isolation and gene expression analyses. Affymetrix array and multiplex tandem (MT)-PCR studies were conducted to evaluate transcriptional profiles in circulating white blood cells applying a set of 42 molecular markers that had been identified a priori. A LogitBoost algorithm was used to create a machine learning diagnostic rule to predict sepsis outcomes. Based on preliminary microarray analyses comparing HC and sepsis groups, a panel of 42-gene expression markers were identified that represented key innate and adaptive immune function, cell cycling, WBC differentiation, extracellular remodelling and immune

  19. Detection of serum p53 antibodies in patients with esophageal squamous cell carcinoma: correlation with clinicopathologic features and tumor markers.

    Science.gov (United States)

    Shimada, H; Nakajima, K; Ochiai, T; Koide, Y; Okazumi, S I; Matsubara, H; Takeda, A; Miyazawa, Y; Arima, M; Isono, K

    1998-01-01

    The significance of serum p53-Abs in patients with esophageal squamous cell carcinoma was determined. Examination of clinicopathological features and assessment of tumor marker sensitivities of carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC-Ag) and CYFRA21-1 were performed. Thirty-three (58%) of 57 patients were positive for serum p53-Abs, however, no relation with cancer progression existed. Fourteen of the 33 sero-positive patients revealed normal levels of all tumor markers tested. Thus, serum p53-Abs appears to be a useful marker for the detection of esophageal squamous cell carcinoma.

  20. Deep Recurrent Neural Networks for seizure detection and early seizure detection systems

    Energy Technology Data Exchange (ETDEWEB)

    Talathi, S. S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-06-05

    Epilepsy is common neurological diseases, affecting about 0.6-0.8 % of world population. Epileptic patients suffer from chronic unprovoked seizures, which can result in broad spectrum of debilitating medical and social consequences. Since seizures, in general, occur infrequently and are unpredictable, automated seizure detection systems are recommended to screen for seizures during long-term electroencephalogram (EEG) recordings. In addition, systems for early seizure detection can lead to the development of new types of intervention systems that are designed to control or shorten the duration of seizure events. In this article, we investigate the utility of recurrent neural networks (RNNs) in designing seizure detection and early seizure detection systems. We propose a deep learning framework via the use of Gated Recurrent Unit (GRU) RNNs for seizure detection. We use publicly available data in order to evaluate our method and demonstrate very promising evaluation results with overall accuracy close to 100 %. We also systematically investigate the application of our method for early seizure warning systems. Our method can detect about 98% of seizure events within the first 5 seconds of the overall epileptic seizure duration.

  1. Automated detection of dark and bright lesions in retinal images for early detection of diabetic retinopathy.

    Science.gov (United States)

    Akram, Usman M; Khan, Shoab A

    2012-10-01

    There is an ever-increasing interest in the development of automatic medical diagnosis systems due to the advancement in computing technology and also to improve the service by medical community. The knowledge about health and disease is required for reliable and accurate medical diagnosis. Diabetic Retinopathy (DR) is one of the most common causes of blindness and it can be prevented if detected and treated early. DR has different signs and the most distinctive are microaneurysm and haemorrhage which are dark lesions and hard exudates and cotton wool spots which are bright lesions. Location and structure of blood vessels and optic disk play important role in accurate detection and classification of dark and bright lesions for early detection of DR. In this article, we propose a computer aided system for the early detection of DR. The article presents algorithms for retinal image preprocessing, blood vessel enhancement and segmentation and optic disk localization and detection which eventually lead to detection of different DR lesions using proposed hybrid fuzzy classifier. The developed methods are tested on four different publicly available databases. The presented methods are compared with recently published methods and the results show that presented methods outperform all others.

  2. FUMEPOC: Early detection of chronic obstructive pulmonary disease in smokers

    Directory of Open Access Journals (Sweden)

    Fernández Antonio

    2011-05-01

    Full Text Available Abstract Background Currently is not feasible using conventional spirometry as a screening method in Primary Care especially among smoking population to detect chronic obstructive pulmonary disease in early stages. Therefore, the FUMEPOC study protocol intends to analyze the validity and reliability of Vitalograph COPD-6 spirometer as simpler tool to aid screening and diagnosis of this disease in early stages in primary care surgery. Methods / Design Study design: An observational, descriptive study of diagnostic tests, undertaken in Primary Care and Pneumology Outpatient Care Centre at San Juan Hospital and Elda Hospital. All smokers attending the primary care surgery and consent to participate in the study will undergo a test with Vitalograph COPD-6 spirometer. Subsequently, a conventional spirometry will be performed in the hospital and the results will be compared with those of the Vitalograph COPD-6 test. Discussion It is difficult to use the spirometry as screening for early diagnose test in real conditions of primary care clinical practice. The use of a simpler tool, Vitalograph COPD-6 spirometer, can help in the early diagnose and therefore, it could improve the clinical management of the disease.

  3. Correlates of circulating ovarian cancer early detection markers and their contribution to discrimination of early detection models

    DEFF Research Database (Denmark)

    Fortner, Renée T; Vitonis, Allison F; Schock, Helena

    2017-01-01

    - vs. premenopausal women (p ≤ 0.02). Among postmenopausal women, CA125 was higher among women with higher parity and older age at menopause (ptrend ≤ 0.02), but lower among women reporting oophorectomy, hysterectomy, ever use of estrogen-only hormone therapy, or current smoking (p 

  4. Early and Delayed Antiretroviral Therapy (ART) Result in Comparable Reductions in CD8+ T Cell Exhaustion Marker Expression.

    Science.gov (United States)

    Rutishauser, Rachel; Hartogensis, Wendy; Deguit, Christian D; Krone, Melissa; Hoh, Rebecca; Hecht, Rick; Pilcher, Christopher D; Bacchetti, Peter; Deeks, Steven G; Hunt, Peter W; McCune, Joseph M

    2017-03-23

    In untreated HIV infection, CD8+ T cell exhaustion (i.e., decreased proliferative and effector capacity) is associated with high levels of expression of co-inhibitory receptors, including PD-1, TIGIT, CD160, and 2B4. This is evident for both HIV-specific and non-HIV-specific CD8+ T cells. Antiretroviral therapy (ART) initiated during chronic infection decreases but may not completely normalize the expression of such "exhaustion markers." Compared to initiation of ART later in the course of disease, initiation soon after infection reduces some parameters of chronic inflammation and adaptive immune dysfunction. However, it is not known if Early ART (e.g., initiated within the first six months after HIV infection) versus Delayed ART (e.g., initiated during chronic infection) preferentially reduces expression of exhaustion markers. We evaluated exhaustion marker expression on subsets of circulating effector and memory CD8+ T cells at longitudinal pre- and post-ART (two and five years on ART) time points from n=19 (Early ART) and n=23 (Delayed ART) individuals. Prior to ART, TIGIT and CD160 were expressed on a statistically significantly higher proportion of effector and transitional memory cells from individuals in the Delayed ART group: the timing of ART initiation, however, did not consistently affect the expression of the exhaustion markers once viral suppression was achieved. Understanding which factors do and do not regulate aspects of CD8+ T cell exhaustion, including the expression of exhaustion markers, is critical to inform the rational design of CD8+ T cell-based therapies to treat HIV, for which CD8+ T cell exhaustion remains an important barrier to efficacy.

  5. Neuroimaging parameters in early open spina bifida detection. Further benefit in first trimester screening?

    Science.gov (United States)

    Iliescu, D; Comănescu, A; Antsaklis, P; Tudorache, Stefania; Ghiluşi, Mirela; Comănescu, Violeta; Paulescu, Daniela; Ceauşu, Iuliana; Antsaklis, A; Novac, Liliana; Cernea, N

    2011-01-01

    Morphological investigation of the central nervous system (CNS) in fetuses with positive markers for open spina bifida (OSB) detection, visualized by ultrasound during the first trimester of pregnancy. Data from fetuses that underwent routine first trimester ultrasound scan in our center during September 2007-March 2011 and presented abnormal aspects of the fourth ventricle, also referred as intracranial translucency (IT), provided the morphological support to evaluate CNS features. A neuro-histological study of posterior cerebral fossa illustrated anatomical features of the structures involved in the sonographic first trimester detection of neural tube defects. Abnormal IT aspects were found in OSB cases examined in the first trimester, but also in other severe cerebral abnormalities. Brain stem antero-posterior diameter (BS) and brain stem to occipital bone (BSOB) ratio may be more specific for OSB detection. Correlations between histological aspects of posterior brain fossa and ultrasound standard assessment have been made; highlighting the anatomical features involved by the new techniques developed for OSB early detection. Preliminary results show that modern sonographic protocols are capable to detect abnormalities in the morphometry of the posterior brain. First trimester fourth ventricle abnormalities should be followed by careful CNS evaluation because are likely to appear in OSB affected fetuses, but also in other CNS severe anomalies; in such cases, normal BS and BSOB ratio may serve as indirect argument for spine integrity, if specificity is confirmed in large series of fetuses.

  6. A New Computed Tomography-Based Radiographic Method to Detect Early Loosening of Total Wrist Implants

    Energy Technology Data Exchange (ETDEWEB)

    Olivecrona, H.; Noz, M.E.; Maguire, G.Q. Jr; Zeleznik, M.P.; Sollerman, C.; Olivecrona, L. [Dept. of Hand Surgery, Soedersjukhuset, Stockholm (Sweden)

    2007-11-15

    Background: Diagnosis of loosening of total wrist implants is usually late using routine radiographs. Switching modality to computed tomography (CT) should aid in early diagnosis. Purpose: To propose and evaluate the accuracy of a new CT method for assessing loosening of the carpal component in total wrist arthroplasty. Material and Methods: A protocol encompassing volume registration of paired CT scans of patients with unexplained pain in a prosthetically replaced wrist (used in clinical routine) is presented. Scans are acquired as a dynamic examination under torsional load. Using volume registration, the carpal component of the prosthesis is brought into spatial alignment. After registration, prosthetic loosening is diagnosed by a shift in position of the bones relative to the prosthesis. This study is a preclinical validation of this method using a human cadaverous arm with a cemented total wrist implant and tantalum markers. Seven CT scans of the arm were acquired. The scans were combined into 21 pairs of CT volumes. The carpal component was registered in each scan pair, and the residual mismatch of the surrounding tantalum markers and bone was analyzed both visually and numerically. Results: The detection limit for prosthetic movement was less than 1 mm. Conclusion: The results of this study demonstrate that CT volume registration holds promise to improve detection of movement of the carpal component at an earlier stage than is obtainable with plain radiography.

  7. Using of Telomerase Enzyme in Urine as a Non invasive Marker for Cancer Bladder Detection

    Directory of Open Access Journals (Sweden)

    Azza A Hassan*, Fawzia A . El- Sheshtawey** , Seliem A. Seliem

    2008-12-01

    Full Text Available Background: Urinary bladder cancer is one of the major health problem all over the world. Cystoscopy remains the gold standard for identifying bladder cancer but it is invasive and expensive, therefore, a simple, non invasive test for detecting bladder cancer would be helpful. Several biomarkers for bladder cancer have been used, but no single marker has been accurate and conclusive. Aim: The current study aimed to measure telomerase enzyme in urine as a useful non invasive marker for detection of bladder cancer. Methods : Forty eight patients ( 39 males and 9 females were included, They are complaining of urinary symptoms and undergo cystoscopy with biopsy of bladder lesions and histopathological examination. They were divided into groups: Group I: 16 patients ( 11 males and 5 females have benign urologic conditions. Group II: 32 patients (28 males and 4 females have proven bladder cancer patients underwent transurethral resection of bladder tumor or cystoscopy with biopsy of bladder lesions. Also, 15 apparently healthy volunteers with matched age and sex with patients were served as a control group. All subjects were submitted to laboratory estimation of the following in urine: urinary creatinine, urine cytology, telomerase enzyme in urine by telomerase PCR and complete urine examination. Results : The results of this study revealed that a highly significant increase in the frequency of cytolological positive cases for tumor cells in malignant group than each of benign group and healthy subjects, while no significant difference was detected between benign group and healthy subjects. The frequency of telomerase in urine was significantly higher in malignant group than each of benign group and healthy subjects, while no significant difference was detected between benign group and healthy subjects. The telomerase activity has sensitivity of 90.6% for diagnosis of cancer bladder with 93.7% for specificity and PPV was 96.6%, NPV was 83.3% and

  8. Early detection of invasive plants: principles and practices

    Science.gov (United States)

    Welch, Bradley A.; Geissler, Paul H.; Latham, Penelope

    2014-01-01

    Invasive plants infest an estimated 2.6 million acres of the 83 million acres managed by the National Park Service (NPS) in the United States. The consequences of these invasions present a significant challenge for the NPS to manage the agency’s natural resources “unimpaired for the enjoyment of future generations.” More NPS lands are infested daily despite diligent efforts to curtail the problem. Impacts from invasive species have been realized in most parks, resulting in an expressed need to control existing infestations and restore affected ecosystems. There is a growing urgency in the NPS and other resource management organizations to be proactive. The NPS I&M Program, in collaboration with the U.S. Geological Survey (USGS) Status and Trends Program, compiled this document to provide guidance and insight to parks and other natural areas engaged in developing early-detection monitoring protocols for invasive plants. While several rapid response frameworks exist, there is no consistent or comprehensive guidance informing the active detection of nonnative plants early in the invasion process. Early-detection was selected as a primary focus for invasive-species monitoring because, along with rapid response, it is a key strategy for successful management of invasive species. Eradication efforts are most successful on small infestations (that is less than 1 hectare) and become less successful as infestation size increases, to the point that eradication is unlikely for large (that is greater than 1,000 hectares) populations of invasive plants. This document provides guidance for natural resource managers wishing to detect invasive plants early through an active, directed monitoring program. It has a Quick-Start Guide to direct readers to specific chapters and text relevant to their needs. Decision trees and flow charts assist the reader in deciding what methods to choose and when to use them. This document is written in a modular format to accommodate use of

  9. Marker chromosomes.

    Science.gov (United States)

    Rao, Kiran Prabhaker; Belogolovkin, Victoria

    2013-04-01

    Marker chromosomes are a morphologically heterogeneous group of structurally abnormal chromosomes that pose a significant challenge in prenatal diagnosis. Phenotypes associated with marker chromosomes are highly variable and range from normal to severely abnormal. Clinical outcomes are very difficult to predict when marker chromosomes are detected prenatally. In this review, we outline the classification, etiology, cytogenetic characterization, and clinical consequences of marker chromosomes, as well as practical approaches to prenatal diagnosis and genetic counseling.

  10. Diagnostic utility of oxidative damage markers for early rheumatoid arthritis in non-smokers and negative anti-CCP patients

    Directory of Open Access Journals (Sweden)

    E. Melguizo

    2014-04-01

    Full Text Available Background. Besides the development of new markers and diagnostic criteria for rheumatoid arthritis (RA, many patients are still diagnosed after several years of symptoms. Oxidative stress markers are already increased at an early stage of RA. Our aim was to evaluate the additional diagnostic value of these markers. Methods. A case-control study was performed. Patients met the 1987 RA ACR criteria, less than 2 years of symptoms and no previous treatment with disease-modifying anti-rheumatic drugs (DMARD, steroids or vitamin E. Controls were selected from patient's relatives and matched (1:1 by gender, age, and current smoking habit. Oxidative damage markers were malonyldialdehyde (MDA, Lipid hydroperoxides (LOOH and Carbonyl proteins (CP. Statistical analysis was performed in agreement with the STARD initiative. Results. Sixty-five RA patients without treatment and 65 healthy controls were included. LOOH, CP, antibodies against citrullinated peptides (anti-CCP and rheumatoid factor (RF were significantly higher in patients, and MDA higher in controls. The same results were obtained in the subgroups of patients who smoke or not, and in anti-CCP positive or negative. The diagnosis performance of traditional markers showed good specificity but low sensitivity. The addition of LOOH and CP increased the sensitivity and the area under the receiving operating characteristic (ROC curve especially in non-smoking (66% and negative anti-CCP (51% patients. Conclusions. The separate or combined addition of LOOH or CP to the traditional disease markers improved the diagnosis of RA, especially in non-smoking or negative anti-CCP patients.

  11. Detection and mapping of QTL for earliness components in a bread wheat recombinant inbred lines population.

    Science.gov (United States)

    Hanocq, E; Niarquin, M; Heumez, E; Rousset, M; Le Gouis, J

    2004-12-01

    Earliness, an adaptative trait and factor of variation for agronomic characters, is a major trait in plant breeding. Its constituent traits, photoperiod sensitivity (PS), vernalization requirement (VR) and intrinsic earliness (IE), are largely under independent genetic controls. Mapping of major genes and quantitative trait loci (QTL) controlling these components is in progress. Most of the studies focusing on earliness considered it as a whole or through one (or two) of its components. The purpose of this study was to detect and map QTL for the three traits together through an experimental design combining field trials and controlled growth conditions. QTL were mapped in a population of F(7) recombinant inbred lines derived by single-seed descent from a cross between two French varieties, 'Renan' and 'Recital'. A map was previously constructed, based on 194 lines and 254 markers, covering about 77% of the genome. Globally, 13 QTL with a LOD>2.5 were detected, of which four control PS, five control VR and four control IE. Two major photoperiod sensitive QTL, together explaining more than 31% of the phenotypic variation, were mapped on chromosomes 2B and 2D, at the same position as the two major genes Ppd-B1 and Ppd-D1. One major VR QTL explaining (depending on the year) 21.8-39.6% of the phenotypic variation was mapped on 5A. Among the other QTL, two QTL of PS and VR not referenced so far were detected on 5A and 6D, respectively. A VR QTL already detected on 2B in a connected population was confirmed.

  12. Cancer Screening and Early Detection in the 21(st) Century.

    Science.gov (United States)

    Loud, Jennifer T; Murphy, Jeanne

    2017-05-01

    To review the trends in and principles of cancer screening and early detection. Journal articles, United States Preventive Services Task Force (USPSTF) publications, professional organization position statements, and evidence-based summaries. Cancer screening has contributed to decreasing the morbidity and mortality of cancer. Efforts to improve the selection of candidates for cancer screening, to understand the biological basis of carcinogenesis, and the development of new technologies for cancer screening will allow for improvements in cancer screening over time. Nurses are well-positioned to lead the implementation of cancer screening recommendations in the 21(st) century through their practice, research, educational efforts, and advocacy. Published by Elsevier Inc.

  13. Early Hearing Detection and Intervention: Can Your Baby Hear?

    Centers for Disease Control (CDC) Podcasts

    2007-06-15

    This podcast discusses how important it is that every child receives a hearing screening as soon as possible after birth. It also gives specific ways that parents and health providers can find out if a child has a possible hearing loss and where to get further information. (Created 6/5/2007 by the Early Hearing Detection and Intervention Program, NCBDDD).  Created: 6/15/2007 by National Center on Birth Defects and Developmental Disabilities.   Date Released: 6/25/2007.

  14. Early Oscillation Detection Technique for Hybrid DC/DC Converters

    Science.gov (United States)

    Wang, Bright L.

    2011-01-01

    Oscillation or instability is a situation that must be avoided for reliable hybrid DC/DC converters. A real-time electronics measurement technique was developed to detect catastrophic oscillations at early stages for hybrid DC/DC converters. It is capable of identifying low-level oscillation and determining the degree of the oscillation at a unique frequency for every individual model of the converters without disturbing their normal operations. This technique is specially developed for space-used hybrid DC/DC converters, but it is also suitable for most of commercial and military switching-mode power supplies. This is a weak-electronic-signal detection technique to detect hybrid DC/DC converter oscillation presented as a specific noise signal at power input pins. It is based on principles of feedback control loop oscillation and RF signal modulations, and is realized by using signal power spectral analysis. On the power spectrum, a channel power amplitude at characteristic frequency (CPcf) and a channel power amplitude at switching frequency (CPsw) are chosen as oscillation level indicators. If the converter is stable, the CPcf is a very small pulse and the CPsw is a larger, clear, single pulse. At early stage of oscillation, the CPcf increases to a certain level and the CPsw shows a small pair of sideband pulses around it. If the converter oscillates, the CPcf reaches to a higher level and the CPsw shows more high-level sideband pulses. A comprehensive stability index (CSI) is adopted as a quantitative measure to accurately assign a degree of stability to a specific DC/DC converter. The CSI is a ratio of normal and abnormal power spectral density, and can be calculated using specified and measured CPcf and CPsw data. The novel and unique feature of this technique is the use of power channel amplitudes at characteristic frequency and switching frequency to evaluate stability and identify oscillations at an early stage without interfering with a DC/DC converter s

  15. Method for early detection of cooling-loss events

    Energy Technology Data Exchange (ETDEWEB)

    Bermudez, Sergio A.; Hamann, Hendrik F.; Marianno, Fernando J.

    2015-12-22

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  16. Method for early detection of cooling-loss events

    Energy Technology Data Exchange (ETDEWEB)

    Bermudez, Sergio A.; Hamann, Hendrik; Marianno, Fernando J.

    2015-06-30

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  17. [Scoring system for early detection of critical illness can fail].

    Science.gov (United States)

    Kamstrup Christiansen, Lærke; Andreasen, Jo Bønding; Frederiksen, Christian Alcaraz; Juhl-Olsen, Peter; Sloth, Erik

    2013-02-18

    A 57-year old male underwent elective aortic valve replacement. The immediate post-operative course was uneventful and the patient was discharged with the lowest possible score on a newly implemented scale for early detection of critical illness. The following day he was readmitted with dyspnoea. The critical illness score was still low despite ultrasonic demonstration of a large pericardial effusion requiring drainage. We are concerned that the widely adopted critical illness scale is not sufficiently sensitive for cardiac surgery patients and advocate the use of point-of-care ultrasound.

  18. Detection of early dental caries with short pulse laser

    Energy Technology Data Exchange (ETDEWEB)

    Okubo, Nahoko; Goto, Shigeru [Osada Research Inst., Ltd., Tokyo (Japan); Tanaka, Hiroshi; Ohzu, Akira; Arisawa, Takashi [Japan Atomic Energy Research Inst., Kansai Research Establishment, Advanced Photon Research Center, Kyoto (Japan)

    2002-07-01

    Differences in the optical properties of polarization and photoluminescence between caries lesion and noncaries (sound) enamel have been investigated by focusing a pulsed Nd:YAG laser of 532 nm on the surface of teeth. Significant difference in the polarization property of the scattered light from the surface can be observed with some carious samples. For photoluminescence spectral lines which appear at around 650 nm, the intensity of caries lesion has been approximately two times higher than that of sound one. A discussion is presented in which early are potentially detectable by the pulsed laser. (author)

  19. The usefulness of early whole body bone scintigraphy in the detection of bone metastasis from prostatic cancer

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, Nobuaki; Fukunaga, Masao; Furukawa, Yohji; Tanaka, Hiroyoshi (Kawasaki Medical School, Kurashiki, Okayama (Japan))

    1994-06-01

    Early whole body bone scintigraphy was performed on 25 patients with prostatic cancer (15 cases with bone metastases and 10 cases without bone metastasis) to obtain anterior and posterior whole body images five minutes after administration of [sup 99m]Tc-hydroxymethylene diphosphonate(HMDP). The results were compared with the findings of routine bone scintigraphy after three hours, and the usefulness of the above method for the diagnosis of bone metastasis from prostatic cancer was evaluated. In cases in which increased activity was found in the upper and lower lumbar vertebrae by routine bone scintigraphy but no abnormality was seen by early whole body bone scintigraphy, senile degenerative bone changes such as spondylosis deformance were observed by bone radiography. In cases with multiple bone metastases, abnormal multiple accumulations were found by both early whole body bone scintigraphy and routine bone scintigraphy. In addition, in cases showing super bone scan, high accumulation in the skeletal system had already been detected by early whole body bone scintigraphy. When the courses before and after treatment in nine cases of multiple bone metastases were passaged from the results of early whole body bone scintigraphy and from changes in tumor markers (prostatic specific antigen, [gamma]-semino protein and prostatic acid phosphatase), increased activity and the appearance of new hot spots as well as an increase in tumor markers were detected by early whole body scintigraphy in three of the four advanced cases, whereas decreased accumulations and a decrease in and normalization of tumor markers were observed in five improved cases. (author).

  20. Sensors and Instrumentation towards early detection of osteoporosis

    KAUST Repository

    Afsarimanesh, Nasrin

    2016-07-27

    A label-free non-invasive sensing system for detection of C-terminal telopeptide of type-I collagen (CTX-I) has been developed in order to detect bone loss at an early stage, by Electrochemical Impedance Spectroscopy (EIS). A planar interdigital sensor was functionalized by immobilizing streptavidin agarose on the sensing area of the sensor to introduce selectivity for the antigen-antibody solution. Different concentrations of CTX-I were tested using the functionalized sensing surface to capture the target molecule. Preliminary results are provided in the paper assisted with the respective equivalent circuit of the working technology on the sensor using Complex Non-linear Least Square (CNLS). The results are encouraging and will be used to develop a complete system for commercialization complementing the existing systems. © 2016 IEEE.

  1. Detection of quantitative trait loci in outbred populations with incomplete marker data

    NARCIS (Netherlands)

    Bink, M.C.A.M.; Arendonk, van J.A.M.

    1999-01-01

    Augmentation of marker genotypes for ungenotyped individuals is implemented in a Bayesian approach via the use of Markov chain Monte Carlo techniques. Marker data on relatives and phenotypes are combined to compute conditional posterior probabilities for marker genotypes of ungenotyped individuals.

  2. Two-dimensional radial laser scanning for circular marker detection and external mobile robot tracking.

    Science.gov (United States)

    Teixidó, Mercè; Pallejà, Tomàs; Font, Davinia; Tresanchez, Marcel; Moreno, Javier; Palacín, Jordi

    2012-11-28

    This paper presents the use of an external fixed two-dimensional laser scanner to detect cylindrical targets attached to moving devices, such as a mobile robot. This proposal is based on the detection of circular markers in the raw data provided by the laser scanner by applying an algorithm for outlier avoidance and a least-squares circular fitting. Some experiments have been developed to empirically validate the proposal with different cylindrical targets in order to estimate the location and tracking errors achieved, which are generally less than 20 mm in the area covered by the laser sensor. As a result of the validation experiments, several error maps have been obtained in order to give an estimate of the uncertainty of any location computed. This proposal has been validated with a medium-sized mobile robot with an attached cylindrical target (diameter 200 mm). The trajectory of the mobile robot was estimated with an average location error of less than 15 mm, and the real location error in each individual circular fitting was similar to the error estimated with the obtained error maps. The radial area covered in this validation experiment was up to 10 m, a value that depends on the radius of the cylindrical target and the radial density of the distance range points provided by the laser scanner but this area can be increased by combining the information of additional external laser scanners.

  3. Two-Dimensional Radial Laser Scanning for Circular Marker Detection and External Mobile Robot Tracking

    Directory of Open Access Journals (Sweden)

    Jordi Palacín

    2012-11-01

    Full Text Available This paper presents the use of an external fixed two-dimensional laser scanner to detect cylindrical targets attached to moving devices, such as a mobile robot. This proposal is based on the detection of circular markers in the raw data provided by the laser scanner by applying an algorithm for outlier avoidance and a least-squares circular fitting. Some experiments have been developed to empirically validate the proposal with different cylindrical targets in order to estimate the location and tracking errors achieved, which are generally less than 20 mm in the area covered by the laser sensor. As a result of the validation experiments, several error maps have been obtained in order to give an estimate of the uncertainty of any location computed. This proposal has been validated with a medium-sized mobile robot with an attached cylindrical target (diameter 200 mm. The trajectory of the mobile robot was estimated with an average location error of less than 15 mm, and the real location error in each individual circular fitting was similar to the error estimated with the obtained error maps. The radial area covered in this validation experiment was up to 10 m, a value that depends on the radius of the cylindrical target and the radial density of the distance range points provided by the laser scanner but this area can be increased by combining the information of additional external laser scanners.

  4. Detection of Glypican-3 Proteins for Hepatocellular Carcinoma Marker Using Wireless-Electrodeless Quartz-Crystal Microbalance

    Science.gov (United States)

    Ogi, Hirotsugu; Omori, Toshinobu; Hatanaka, Kenichi; Hirao, Masahiko; Nishiyama, Masayoshi

    2008-05-01

    Pure shear-wave resonances were excited and detected in 18- and 30-µm-thick electrodeless AT-cut quartz plates in liquids using line antennas contactlessly, achieving high-frequency quartz-crystal microbalances (QCMs). Their fundamental resonance frequencies (85 and 54 MHz) were monitored to study interactions in real time between human glypican-3 and an anti-glypican-3 antibody: glypican-3 is a prospective protein marker for hepatocellular carcinoma. Their affinity was determined by the Langmuir kinetics. This study demonstrates the high ability of the wireless-electrodeless QCM for detection of the protein markers and development of drugs for disorders.

  5. Early Lung Cancer Detection in Uranium Miners with Abnormal Sputum Cytology

    Energy Technology Data Exchange (ETDEWEB)

    Saccomanno, G.

    2000-06-30

    ''Early Lung Cancer Detection in Uranium Miners with Abnormal Sputum Cytology'' was funded by the Department of Energy to monitor the health effects of radon exposure and/or cigarette smoke on uranium workers from the Colorado Plateau. The resulting Saccomanno Uranium Workers Archive and data base has been used as a source of information to prove eligibility for compensation under the Radiation Exposure Compensation Act and as the source of primary data tissue for a subcontract and other collaborations with outside investigators. The latter includes a study of radon exposure and lung cancer risk in a non-smoking cohort of uranium miners (subcontract); a study of genetic markers for lung cancer susceptibility; and a study of {sup 210}Pb accumulation in the skull as a biomarker of radon exposure.

  6. Enhancement of visual motion detection thresholds in early deaf people.

    Science.gov (United States)

    Shiell, Martha M; Champoux, François; Zatorre, Robert J

    2014-01-01

    In deaf people, the auditory cortex can reorganize to support visual motion processing. Although this cross-modal reorganization has long been thought to subserve enhanced visual abilities, previous research has been unsuccessful at identifying behavioural enhancements specific to motion processing. Recently, research with congenitally deaf cats has uncovered an enhancement for visual motion detection. Our goal was to test for a similar difference between deaf and hearing people. We tested 16 early and profoundly deaf participants and 20 hearing controls. Participants completed a visual motion detection task, in which they were asked to determine which of two sinusoidal gratings was moving. The speed of the moving grating varied according to an adaptive staircase procedure, allowing us to determine the lowest speed necessary for participants to detect motion. Consistent with previous research in deaf cats, the deaf group had lower motion detection thresholds than the hearing. This finding supports the proposal that cross-modal reorganization after sensory deprivation will occur for supramodal sensory features and preserve the output functions.

  7. Enhancement of visual motion detection thresholds in early deaf people.

    Directory of Open Access Journals (Sweden)

    Martha M Shiell

    Full Text Available In deaf people, the auditory cortex can reorganize to support visual motion processing. Although this cross-modal reorganization has long been thought to subserve enhanced visual abilities, previous research has been unsuccessful at identifying behavioural enhancements specific to motion processing. Recently, research with congenitally deaf cats has uncovered an enhancement for visual motion detection. Our goal was to test for a similar difference between deaf and hearing people. We tested 16 early and profoundly deaf participants and 20 hearing controls. Participants completed a visual motion detection task, in which they were asked to determine which of two sinusoidal gratings was moving. The speed of the moving grating varied according to an adaptive staircase procedure, allowing us to determine the lowest speed necessary for participants to detect motion. Consistent with previous research in deaf cats, the deaf group had lower motion detection thresholds than the hearing. This finding supports the proposal that cross-modal reorganization after sensory deprivation will occur for supramodal sensory features and preserve the output functions.

  8. PHI in the Early Detection of Prostate Cancer.

    Science.gov (United States)

    Fuchsova, Radka; Topolcan, Ondrej; Windrichova, Jindra; Hora, Milan; Dolejsova, Olga; Pecen, Ladislav; Kasik, Petr; Novak, Jaroslav; Casova, Miroslava; Smejkal, Jiri

    2015-09-01

    To evaluate changes in the serum levels of prostate specific antigen (PSA), %free PSA and -2proPSA biomarkers, and prostate health index (PHI) in the diagnostic algorithm of early prostate cancer. The Immunoanalytical Laboratory of the University Hospital in Pilsen examined sera from 263 patients being treated at the Hospital's Urology Department with suspected prostate cancer who had undergone biopsies and were divided into a benign and malignant group. The monitored biomarkers were measured using chemiluminescence. All statistical analyses were calculated using the SAS software. We found statistically significantly increased levels of -2proPSA, PHI and PSA and decreased levels of %freePSA in patients diagnosed with prostate cancer by prostate biopsy vs. patients with benign prostatic hypertrophy (median values: -2proPSA: 16 vs. 21 ng/l, PHI: 35 vs. 62, total PSA: 7.2 vs. 7.7 μg/l and %free PSA: 16.7 vs. 11.7%). Receiver operating characteristic curves showed the best performance for PHI compared to other markers. The assessment of -2proPSA and the calculation of PHI appear to be of great benefit for a more accurate differential diagnosis of benign hyperplasia and prostate cancer. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  9. Detection of early glaucomatous progression with octopus cluster trend analysis.

    Science.gov (United States)

    Naghizadeh, Farzaneh; Holló, Gábor

    2014-01-01

    To compare the ability of Corrected Cluster Trend Analysis (CCTA) and Cluster Trend Analysis (CTA) with event analysis of Octopus visual field series to detect early glaucomatous progression. One eye of 15 healthy, 19 ocular hypertensive, 20 preperimetric, and 51 perimetric glaucoma (PG) patients were investigated with Octopus normal G2 test at 6-month intervals for 1.5 to 3 years. Progression was defined with significant worsening in any of the 10 Octopus clusters with CCTA, and event analysis criteria, respectively. With event analysis, 9 PG eyes showed localized progression and 1 diffuse mean defect (MD) worsening. With CCTA, progression was indicated in 1 normal, 1 ocular hypertensive, and 1 preperimetric glaucoma eyes due to vitreous floaters, and 28 PG eyes including all 9 eyes with localized progression with event analysis. The locations of CCTA progression matched those found with event analysis in all 9 cases. In 17 of the remaining 19 eyes, progressing clusters matched the locations that were suspicious but not definitive for progression with event analysis. In the eye with diffuse MD worsening, CTA found significant progression for 7 clusters. For global MD progression rate, eyes worsened with CCTA only did not differ from the stable eyes but had significantly smaller progression rates than the eyes progressed with event analysis (P=0.0002). In PG, Octopus CCTA and CTA are clinically useful to identify early progression and areas suspicious for early progression. However, in some eyes with no glaucomatous visual field damage, vitreous floaters may cause progression artifacts.

  10. Early Forest Fire Detection Using Low Energy Hydrogen Sensors

    Directory of Open Access Journals (Sweden)

    Jürgen Müller

    2016-08-01

    Full Text Available The North-east German Lowlands is a region with one of the highest forest fire risks in Europe. In order to keep damage levels as low as possible, it is important to have an effective early warning system. Such a system is being developed on the basis of a hydrogen sensor, which makes it possible to detect a smouldering forest fire before the development of open flames. The prototype hydrogen sensor produced at the Humboldt University Berlin has a metal/ solid electrolyte/insulator/ semiconductor (MEIS structure, which allows cost-effective production. Due to the low energy consumption, an autarchic working unit could be installed in the forest. Field trials have shown that it is possible to identify a forest fire in its early stages when hydrogen concentrations are still low. A significant change in the signal due to a fire was measured at a distance of about 100m. In view of the potential impacts of climate change, the innovative pre-ignition warning system is an important early diagnosis and monitoring module for the protection of the forests.

  11. FluBreaks: early epidemic detection from Google flu trends.

    Science.gov (United States)

    Pervaiz, Fahad; Pervaiz, Mansoor; Abdur Rehman, Nabeel; Saif, Umar

    2012-10-04

    The Google Flu Trends service was launched in 2008 to track changes in the volume of online search queries related to flu-like symptoms. Over the last few years, the trend data produced by this service has shown a consistent relationship with the actual number of flu reports collected by the US Centers for Disease Control and Prevention (CDC), often identifying increases in flu cases weeks in advance of CDC records. However, contrary to popular belief, Google Flu Trends is not an early epidemic detection system. Instead, it is designed as a baseline indicator of the trend, or changes, in the number of disease cases. To evaluate whether these trends can be used as a basis for an early warning system for epidemics. We present the first detailed algorithmic analysis of how Google Flu Trends can be used as a basis for building a fully automated system for early warning of epidemics in advance of methods used by the CDC. Based on our work, we present a novel early epidemic detection system, called FluBreaks (dritte.org/flubreaks), based on Google Flu Trends data. We compared the accuracy and practicality of three types of algorithms: normal distribution algorithms, Poisson distribution algorithms, and negative binomial distribution algorithms. We explored the relative merits of these methods, and related our findings to changes in Internet penetration and population size for the regions in Google Flu Trends providing data. Across our performance metrics of percentage true-positives (RTP), percentage false-positives (RFP), percentage overlap (OT), and percentage early alarms (EA), Poisson- and negative binomial-based algorithms performed better in all except RFP. Poisson-based algorithms had average values of 99%, 28%, 71%, and 76% for RTP, RFP, OT, and EA, respectively, whereas negative binomial-based algorithms had average values of 97.8%, 17.8%, 60%, and 55% for RTP, RFP, OT, and EA, respectively. Moreover, the EA was also affected by the region's population size

  12. 77 FR 66469 - Breast and Cervical Cancer Early Detection and Control Advisory Committee (BCCEDCAC)

    Science.gov (United States)

    2012-11-05

    ... HUMAN SERVICES Centers for Disease Control and Prevention Breast and Cervical Cancer Early Detection and... meeting of the aforementioned committee: Name: Breast and Cervical Cancer Early Detection and Control..., regarding the early detection and control of breast and cervical cancer. The committee makes recommendations...

  13. Visual change detection recruits auditory cortices in early deafness.

    Science.gov (United States)

    Bottari, Davide; Heimler, Benedetta; Caclin, Anne; Dalmolin, Anna; Giard, Marie-Hélène; Pavani, Francesco

    2014-07-01

    Although cross-modal recruitment of early sensory areas in deafness and blindness is well established, the constraints and limits of these plastic changes remain to be understood. In the case of human deafness, for instance, it is known that visual, tactile or visuo-tactile stimuli can elicit a response within the auditory cortices. Nonetheless, both the timing of these evoked responses and the functional contribution of cross-modally recruited areas remain to be ascertained. In the present study, we examined to what extent auditory cortices of deaf humans participate in high-order visual processes, such as visual change detection. By measuring visual ERPs, in particular the visual MisMatch Negativity (vMMN), and performing source localization, we show that individuals with early deafness (N=12) recruit the auditory cortices when a change in motion direction during shape deformation occurs in a continuous visual motion stream. Remarkably this "auditory" response for visual events emerged with the same timing as the visual MMN in hearing controls (N=12), between 150 and 300 ms after the visual change. Furthermore, the recruitment of auditory cortices for visual change detection in early deaf was paired with a reduction of response within the visual system, indicating a shift from visual to auditory cortices of part of the computational process. The present study suggests that the deafened auditory cortices participate at extracting and storing the visual information and at comparing on-line the upcoming visual events, thus indicating that cross-modally recruited auditory cortices can reach this level of computation.

  14. Parietal Epithelial Cell Activation Marker in Early Recurrence of FSGS in the Transplant

    NARCIS (Netherlands)

    Fatima, H.; Moeller, M.J.; Smeets, B.; Yang, H.C.; D'Agati, V.D.; Alpers, C.E.; Fogo, A.B.

    2012-01-01

    BACKGROUND AND OBJECTIVES: Podocyte loss is key in glomerulosclerosis. Activated parietal epithelial cells are proposed to contribute to pathogenesis of glomerulosclerosis and may serve as stem cells that can transition to podocytes. CD44 is a marker for activated parietal epithelial cells. This stu

  15. Linguistic Markers of Stance in Early and Advanced Academic Writing: A Corpus-Based Comparison

    Science.gov (United States)

    Aull, Laura L.; Lancaster, Zak

    2014-01-01

    This article uses corpus methods to examine linguistic expressions of stance in over 4,000 argumentative essays written by incoming first-year university students in comparison with the writing of upper-level undergraduate students and published academics. The findings reveal linguistic stance markers shared across the first-year essays despite…

  16. Plasma thymus and activation-regulated chemokine as an early response marker in classical Hodgkin's lymphoma

    NARCIS (Netherlands)

    Plattel, Wouter J.; van den Berg, Anke; Visser, Lydia; van der Graaf, Anne-Marijn; Pruim, Jan; Vos, Hans; Hepkema, Bouke; Diepstra, Arjan; van Imhoff, Gustaaf W.

    2012-01-01

    BACKGROUND: Plasma thymus and activation-regulated chemokine is a potential biomarker for classical Hodgkin's lymphoma. To define its value as a marker to monitor treatment response, we correlated serial plasma thymus and activation-regulated chemokine levels with clinical response in newly diagnose

  17. Urine albumin to creatinine ratio: A marker of early endothelial dysfunction in youth

    Science.gov (United States)

    The urine albumin-to-creatinine ratio (UACR) is a useful predictor of cardiovascular (CV) events in adults. Its relationship to vascular function in children is not clear. We investigated whether UACR was related to insulin resistance and endothelial function, a marker of subclinical atherosclerosis...

  18. Determinants of DHA status and functional effects on metabolic markers and immune modulation in early life

    DEFF Research Database (Denmark)

    Harsløf, Laurine Bente Schram

    by identifying the involved pathways and genes. The second part of the PhD thesis explores whether functional effects of n-3 LCPUFA on metabolic markers and immune maturation in young children can be supported by polymorphisms in genes involved in the mechanisms (PPARG2, COX2 and NFKB1). Results can be found...

  19. Mature astrocytes in the adult human neocortex express the early neuronal marker doublecortin.

    NARCIS (Netherlands)

    Verwer, R.W.H.; Sluiter, A.A.; Balesar, R.A.; Baayen, J.C.; Noske, D.P.; Dirven, C.M.; Wouda, J.; van Dam, A.M.; Lucassen, P.J.; Swaab, D.F.

    2007-01-01

    Doublecortin (DCX) is a microtubule-associated protein expressed by migrating neuroblasts and is considered to be a reliable marker of neurogenesis. DCX has been used to study the relation between neurogenesis in adult human brain and neurological and neurodegenerative disease processes in the searc

  20. Non-Invasive Markers for Early Diagnosis and Determination of the Severity of Necrotizing Enterocolitis

    NARCIS (Netherlands)

    Thuijls, Geertje; Derikx, Joep P. M.; van Wijck, Kim; Zimmermann, Luc J. I.; Degraeuwe, Pieter L.; Mulder, Twan L.; Van der Zee, David C.; Brouwers, Hens A. A.; Verhoeven, Bas H.; van Heurn, L. W. Ernest; Kramer, Boris W.; Buurman, Wim A.; Heineman, Erik

    2010-01-01

    Objectives: To improve diagnosis of necrotizing enterocolitis (NEC) by noninvasive markers representing gut wall integrity loss (I-FABP and claudin-3) and gut wall inflammation (calprotectin). Furthermore, the usefulness of I-FABP to predict NEC severity and to screen for NEC was evaluated. Methods:

  1. Non-invasive markers for early diagnosis and determination of the severity of necrotizing enterocolitis.

    NARCIS (Netherlands)

    Thuijls, G.; Derikx, J.P.; Wijck, K. van; Zimmermann, L.J.; Degraeuwe, P.L.J.; Mulder, T.L.; Zee, D.C. van der; Brouwers, H.A.A.; Verhoeven, B.H.; Heurn, L.W.E. van; Kramer, B.W.; Buurman, W.A.; Heineman, E.

    2010-01-01

    OBJECTIVES: To improve diagnosis of necrotizing enterocolitis (NEC) by noninvasive markers representing gut wall integrity loss (I-FABP and claudin-3) and gut wall inflammation (calprotectin). Furthermore, the usefulness of I-FABP to predict NEC severity and to screen for NEC was evaluated. METHODS:

  2. Postpartum Circulating Markers of Inflammation and the Systemic Acute-Phase Response After Early-Onset Preeclampsia.

    Science.gov (United States)

    van Rijn, Bas B; Bruinse, Hein W; Veerbeek, Jan H; Post Uiterweer, Emiel D; Koenen, Steven V; van der Bom, Johanna G; Rijkers, Ger T; Roest, Mark; Franx, Arie

    2016-02-01

    Preeclampsia is an inflammatory-mediated hypertensive disorder of pregnancy and seems to be an early indicator of increased cardiovascular risk, but mechanisms underlying this association are unclear. In this study, we identified levels of circulating inflammatory markers and dynamic changes in the systemic acute-phase response in 44 women with a history of severe early-onset preeclampsia, compared with 29 controls with only uneventful pregnancies at 1.5 to 3.5 years postpartum. Models used were in vivo seasonal influenza vaccination and in vitro whole-blood culture with T-cell stimulants and the toll-like receptor-4 ligand lipopolysaccharide. Outcome measures were C-reactive protein, interleukin-6 (IL-6), IL-18, fibrinogen, myeloperoxidase, and a panel of 13 cytokines representative of the innate and adaptive inflammatory response, in addition to established cardiovascular markers. The in vivo acute-phase response was higher for women with previous preeclampsia than that for controls without such a history, although only significant for C-reactive protein (P=0.04). Preeclampsia was associated with higher IL-1β (Ppreeclampsia: an adaptive response cluster associated with increased C-reactive protein and IL-6 before and after vaccination, increased weight, and low high-density lipoprotein cholesterol; and a toll-like receptor-4 mediated the cluster associated with increased IL-18 before and after vaccination but not associated with other cardiovascular markers. Furthermore, we found interactions between previous preeclampsia, common TLR4 gene variants, and the IL-18 response to vaccination. In conclusion, preeclampsia is associated with alterations in the inflammatory response postpartum mostly independent of other established cardiovascular risk markers. © 2015 American Heart Association, Inc.

  3. Heart rate and blood pressure control in obesity - how to detect early dysregulation?

    Science.gov (United States)

    Javorka, Michal; Turianikova, Zuzana; Tonhajzerova, Ingrid; Lazarova, Zuzana; Czippelova, Barbora; Javorka, Kamil

    2016-09-01

    Obesity is accompanied by many severe complications including various cardiovascular disorders. An impairment of cardiovascular control by autonomic nervous system could be one of the possible links between obesity and cardiovascular complications development. The aim of this study was to compare spontaneous heart rate and systolic blood pressure oscillations reflecting cardiovascular autonomic control of young obese subjects with normal control subjects by linear and nonlinear methods and to find sensitive markers of early autonomic dysregulation. Continuous recordings of beat-to-beat systolic blood pressure and RR intervals from ECG were obtained from 40 obese subjects (25 female, age 14·2 [13·1-16·1] (median [interquartile range]) years) and gender and age matched non-obese control subjects. In addition to linear measures (time and frequency domain), we performed recurrence quantification analysis (RQA) and multiscale entropy analysis for both signals. While no significant differences in heart rate and systolic blood pressure dynamics were detected by linear measures and MSE, analysis of recurrence plots from RR intervals time series showed significant differences - indices trapping time and maximal length of vertical from RQA were significantly higher in obese compared to control group. We conclude that heart rate and blood pressure control by autonomic nervous system in young obese subjects is relatively well preserved. However, novel RQA-related measures are able to detect early subtle abnormalities in cardiac autonomic control in obese subjects indicating decreased signal complexity. © 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

  4. INFERNO: a system for early outbreak detection and signature forecasting.

    Science.gov (United States)

    Naumova, Elena N; O'Neil, E; MacNeill, I

    2005-08-26

    Public health surveillance systems that monitor daily disease incidence provide valuable information about threats to public health and enable public health authorities to detect enteric outbreaks rapidly. This report describes the INtegrated Forecasts and EaRly eNteric Outbreak (INFERNO) detection system of algorithms for outbreak detection and forecasting. INFERNO incorporates existing knowledge of infectious disease epidemiology into adaptive forecasts and uses the concept of an outbreak signature as a composite of disease epidemic curves. Four main components comprise the system: 1) training, 2) warning and flagging, 3) signature forecasting, and 4) evaluation. The unifying goal of the system is to gain insight into the nature of temporal variations in the incidence of infection. Daily collected records are smoothed initially by using a loess-type smoother. Upon receipt of new data, the smoothing is updated; estimates are made of the first two derivatives of the smoothed curve, which are used for near-term forecasting. Recent data and near-term forecasts are used to compute a five level, color-coded warning index to quantify the level of concern. Warning algorithms are designed to balance false detection of an epidemic (Type I errors) with failure to correctly detect an epidemic (Type II errors). If the warning index signals a sufficiently high probability of an epidemic, the fitting of a gamma-based signature curve to the actual data produces a forecast of the possible size of the outbreak. Although the system is under development, its potential has been demonstrated through successful use of emergency department records associated with a substantial waterborne outbreak of cryptosporidiosis that occurred in Milwaukee, Wisconsin, in 1993. Prospects for further development, including adjustment for seasonality and reporting delays, are also outlined.

  5. Justification for screening programs for early detection of HBV infections

    Directory of Open Access Journals (Sweden)

    Małgorzata Leźnicka

    2014-12-01

    Full Text Available Background: The objective of the study was to collect the data on undetected hepatitis B virus (HBV in the frequently hospitalized (at least twice in the last 5 years population of the Kujawsko-Pomorskie voivodship. The study results could be used by occupational health services and local governments to take preventive actions. Material and Methods: The study focused on empirical data derived from hepatitis B Screening Programme in the Kujawsko-Pomorskie voivodship. The study comprised 6332 people tested for hepatitis B virus surface antigen – HBsAg. They had been hospitalized at least twice. The diagnostic survey was based on an anonymous questionnaire, developed for this study. For the statistical analysis the Statistica 10.0 program was used. A level of statistical significance was assumed at a value of α = 0.05. The results showing that the probability test p satisfy the inequality p < 0.05 were considered to be statistically significant. Results: HBs antigen was detected in 34 patients (0.54%. There was no association between the detected infections and the gender of the respondents. There was no relationship between the detected infections and transfusion of blood and blood products before 1992. Surgical procedures performed in the patients did not increase the risk of hepatitis B infection. Conclusions: Actions aimed at detecting asymptomatic infections should primarily focus on the 35–39 age group. Effective identification of chronically-infected people and application of optimal treatment play a key role in reducing the risk of disease progression in the whole population. Therefore, the implementation of screening programs is warranted for prevention and early detection of hepatitis B. Med Pr 2014;65(6:777–784

  6. Serum levels of advanced glycation endproducts and other markers of protein damage in early diabetic nephropathy in type 1 diabetes.

    Directory of Open Access Journals (Sweden)

    Bruce A Perkins

    Full Text Available OBJECTIVE: To determine the role of markers of plasma protein damage by glycation, oxidation and nitration in microalbuminuria onset or subsequent decline of glomerular filtration rate (termed "early GFR decline" in patients with type 1 diabetes. METHODS: From the 1(st Joslin Kidney Study, we selected 30 patients with longstanding normoalbuminuria and 55 patients with new onset microalbuminuria. Patients with microalbuminuria had 8-12 years follow-up during which 33 had stable GFR and 22 early GFR decline. Mean baseline GFR(CYSTATIN C was similar between the three groups. Glycation, oxidation and nitration markers were measured in protein and ultrafiltrate at baseline by liquid chromatography-tandem mass spectrometry using the most reliable methods currently available. RESULTS: Though none were significantly different between patients with microalbuminuria with stable or early GFR decline, levels of 6 protein damage adduct residues of plasma protein and 4 related free adducts of plasma ultrafiltrate were significantly different in patients with microalbuminuria compared to normoalbuminuria controls. Three protein damage adduct residues were decreased and 3 increased in microalbuminuria while 3 free adducts were decreased and one increased in microalbuminuria. The most profound differences were of N-formylkynurenine (NFK protein adduct residue and N(ω-carboxymethylarginine (CMA free adduct in which levels were markedly lower in microalbuminuria (P<0.001 for both. CONCLUSIONS: Complex processes influence levels of plasma protein damage and related proteolysis product free adducts in type 1 diabetes and microalbuminuria. The effects observed point to the possibility that patients who have efficient mechanisms of disposal of damaged proteins might be at an increased risk of developing microalbuminuria but not early renal function decline. The findings support the concept that the mechanisms responsible for microalbuminuria may differ from the

  7. Human heart-type fatty acid-binding protein as an early diagnostic marker of doxorubicin cardiac toxicity

    Directory of Open Access Journals (Sweden)

    Ashraf H. ElGhandour

    2009-04-01

    Full Text Available Progressive cardiotoxicity following treatment with doxorubicin-based chemotherapy in patients with non-Hodgkin’s lymphoma (NHL may lead to late onset cardiomyopathy. So, early prediction of toxicity can lead to prevention of heart failure in these patients. The aim of this work was to investigate the role of H-FABP as an early diagnostic marker of anthracycline-induced cardiac toxicity together with brain natriuretic peptide (BNP as an indication of ventricular dysfunction in such patients. Our study was conducted on 40 NHL patients who received 6 cycles of a doxorubicin containing chemotherapy protocol (CHOP, not exceeding the total allowed dose of doxorubicin (500 mg/m2. Ten healthy controls were included in our study. Human heart-type fatty acid binding protein (H-FABP was assessed 24 hours after the first cycle of CHOP. Plasma levels of BNP were estimated both before starting chemotherapy and after the last cycle of CHOP. Resting echocardiography was also performed before and at the end of chemotherapy cycles. The ejection fraction (EF of 8 of our patients decreased below 50% at the end of the sixth cycle. Elevated levels of both H-FABP and BNP were found in all patients wth EF below 50% and both markers showed a positive correlation with each other. We concluded that H-FABP may serve as a reliable early marker for prediction of cardiomyopathy induced by doxorubicin. Thus, in patients with elevated H-FABP, alternative treatment modalities with no cardiac toxicity may be considered in order to prevent subsequent heart failure in these patients.

  8. Surface engineered biosensors for the early detection of cancer

    Science.gov (United States)

    Islam, Muhymin

    Cancer commences in the building block of human body which is cells and in most of the cases remains silent at early stage. Diseases are only expressed at molecular and cellular level at primary stages. Recognition of diseases at this micro and nano level might reduce the mortality rate of cancer significantly. This research work aimed to introduce novel electronic biosensors for for identification of cancer at cellular level. The dissertation study focuses on 1) Label-Free Isolation of Metastatic Tumor Cells Using Filter Based Microfluidic device; 2) Nanotextured Polymer Substrates for Enhanced Cancer Cell Isolation and Cell Growth; 3) Nanotextured Microfluidic Channel for Electrical Profiling and Detection of Tumor Cells from Blood; and 4) Single Biochip for the Detection of Tumor Cells by Electrical Profile and Surface Immobilized Aptamer. Standard silicon processing techniques were followed to fabricate all of the biosensors. Nantoextruing and surface functionalizon were also incorporated to elevate the efficiency of the devices. The first approach aimed to detect cancer cells from blood based on their mechanophysical properties. Cancer cells are larger than blood cells but highly elastic in nature. These cells can squeeze through small microchannels much smaller than their size. The cross sectional area of the microchannels was optimized to isolate tumor cells from blood. Nanotextured polymer substrates, a platform inspired from the natural basement membrane was used to enhance the isolation and growth of tumor cells. Micro reactive ion etching was performed to have better control on features of nantoxtured surfaces and did not require any template. Next, electrical measurement of ionic current was performed across single microchannel to detect tumor cells from blood. Later, nanotexturing enhanced the efficiency of the device by selectively altering the translocation profile of cancer cells. Eventually aptamer functionalized nanotextured polymer surface was

  9. Study on the Clinical Value of Pulmonary Tumor Markers and Bone Alkafine Phosphatase Detection in Early Diagnosis of Bone Metastasis of Lung Cancer%肺肿瘤标志物及碱性磷酸酶对肺癌骨转移早期诊断的临床意义

    Institute of Scientific and Technical Information of China (English)

    李殿波; 姜格宁

    2015-01-01

    Objective To study the clinical significance of pulmonary tumormarkers:cytokeratin19 solu-ble fragments ( CYFRA21-1 ) , carcinoembryonic antigen ( CEA ) , neuron specific enolase ( NSE ) , carbohy-drate antigen 125(CA125) and bone alkaline phosphatase(BALP) in early diagnosis of bone metastasis of lung cancer.Methods A total of 123 patients hospitalized in Linyi Tumor Hospital from Jul.2009 to Dec. 2011[including 47 cases of lung benign tumor(as the benign lung tumor group),40 cases of lung cancer without bone metastases(as the lung cancer without bone metastases group),and 36 cases of lung cancer with bone metastases( as the bone metastasis of lung cancer group ) ] were selected.The enzyme-linked immu-nosorbent assay was applied to detect the expression levels of CYFRA21-1,CEA,NSE,CA125 and BALP in the serum of all the patients,and such levels were compared among the groups.Results The expression lev-els of CYFRA 21-1,CEA,NSE,CA125,BALP of benign lung tumor group were (5.0 ±0.8) μg/L,(6.7 ± 0.5) pg/L,(18.9 ±2.5)μg/L,(29.0 ±2.8) kU/L,( 224.7 ±16.5) U/L;those of the lung cancer with-out bone metastases group were (15.1 ±2.7) μg/L,(10.6 ±1.7) pg/L,(30.2 ±4.2) μg/L,(60.1 ± 4.7) kU/L,(454.6 ±32.7) U/L;and those of the bone metastasis of lung cancer group were (29.7 ± 8.8) μg/L, (18.2 ±1.8) pg/L,(58.2 ±6.9) μg/L,(100.7 ±8.8) kU/L, (668.2 ±45.8) U/L.Such levels of the lung cancer without bone metastases group and bone metastasis of lung cancer group significantly increased compared with benign lung tumor group ( P <0.05 ).Such levels of the bone-metastasis of lung cancer group were also significantly higher than those of the lung cancer without bone metastases group ( P<0.05).Conclusion Detection of serum levels of CYFRA21-1,CEA,NSE,CA125 and BALP in patients with bone metastases of lung cancer can reveal the biological changes of such patients and has certain signifi-cance in the early diagnosis of bone-metastasis of lung cancer.%目的:探讨肺

  10. Determinants of DHA status and functional effects on metabolic markers and immune modulation in early life

    DEFF Research Database (Denmark)

    Harsløf, Laurine Bente Schram

    intake and other potential determinants in infancy and childhood. The first part of the PhD thesis describes several potential determinants of infant and young child DHA status including genetic variation in FADS, breastfeeding and fish intake. Results can be found in Paper 1. Evidence for effects of n-3...... LCPUFA on metabolic markers such as glucose homeostasis, lipid profile and blood pressure in young children is limited. No studies have explored whether polymorphisms of genes encoding proteins involved in the mechanisms behind the effect (such as PPARG2 and COX2) can support the findings of diet studies...... by identifying the involved pathways and genes. The second part of the PhD thesis explores whether functional effects of n-3 LCPUFA on metabolic markers and immune maturation in young children can be supported by polymorphisms in genes involved in the mechanisms (PPARG2, COX2 and NFKB1). Results can be found...

  11. Development of SCAR Markers for the DNA-Based Detection of the Asian Long-Horned Beetle; Anoplophora glabripennis (Motschulsky)

    Science.gov (United States)

    Damodar R. Kethidi; David B. Roden; Tim R. Ladd; Peter J. Krell; Arthur Ratnakaran; Qili Feng

    2003-01-01

    DNA markers were identified for the molecular detection of the Asian long-horned beetle (ALB), Anoplophora glabripennis (Mot.), based on sequence charaterized amplified regions (SCARS) derived from random amplified polymorphic DNA (RAPD) fragments. A 2,740-bp DNA fragment that was present only in ALB and not in other Cerambycids was identified after...

  12. Harnessing Raman spectroimmunoassay for detection of serological breast cancer markers (Conference Presentation)

    Science.gov (United States)

    Barman, Ishan; Li, Ming

    2017-02-01

    Two critical, unmet needs in breast cancer are the early detection of cancer metastasis and recurrence, and the sensitive assessment of temporal changes in tumor burden in response to therapy. The present research is directed towards developing a non-invasive, ultrasensitive and specific tool that provides a comprehensive real-time picture of the metastatic tumor burden and provides a radically new route to address these overarching challenges. As the continuing search for better diagnostic and prognostic clues has shifted away from a singular focus on primary tumor lesions, circulating and disseminated biomarkers have surfaced as attractive candidates due to the intrinsic advantages of a non-invasive, repeatable "liquid biopsy" procedure. However, a reproducible, facile blood-based test for diagnosis and follow-up of breast cancer has yet to be incorporated into a clinical laboratory assay due to the limitations of existing assays in terms of sensitivity, extensive sample processing requirements and, importantly, multiplexing capability. Here, by architecting nano-structured probes for detection of specific molecular species, we engineer a novel plasmon-enhanced Raman spectroscopic platform that offers a paradigmatic shift from the capabilities of today's diagnostic test platforms. Specifically, quantitative single-droplet serum tests reveal ultrasensitive and multiplexed detection of three key breast cancer biomarkers, cancer antigen 15-3 (CA15-3), CA27-29 and carcinoembryonic antigen (CEA), over several order of magnitude range of biomarker concentration and clear segmentation of the sera between normal and metastatic cancer levels.

  13. Borrelia burgdorferi genetic markers and disseminated disease in patients with early Lyme disease.

    Science.gov (United States)

    Jones, Kathryn L; Glickstein, Lisa J; Damle, Nitin; Sikand, Vijay K; McHugh, Gail; Steere, Allen C

    2006-12-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P=0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease.

  14. Borrelia burgdorferi Genetic Markers and Disseminated Disease in Patients with Early Lyme Disease▿

    Science.gov (United States)

    Jones, Kathryn L.; Glickstein, Lisa J.; Damle, Nitin; Sikand, Vijay K.; McHugh, Gail; Steere, Allen C.

    2006-01-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P = 0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease. PMID:17035489

  15. Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

    OpenAIRE

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-01-01

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

  16. Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

    OpenAIRE

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-01-01

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

  17. Dinamic changes of pro-inflammatory cytokines, adhesion molecules and lymphocytes activation markers as early indicators of diseases severity in patients with Dengue

    Directory of Open Access Journals (Sweden)

    Silvana Vielma

    2014-09-01

    Full Text Available Several immunopathogenic mechanisms have been proposed to explain the massive increase of vascular permeability observed in the severe forms of infection by Dengue Virus (DENV. Our aim was to determine the kinetic changes of inflammatory mediators (IL-8, TNF- α, soluble early lymphocyte activation markers (sIL-2R, sTNF-Rp75 and soluble fractions of cell adhesion molecules (sICAM-1 and sVCAM-1 as indicators for early recognition of disease severity in patients with laboratory-confirmed dengue. Twenty patients classified as Dengue±Warning Signs (D±WS and thirty patients with Severe Dengue (SD were included in the study. Serums of apparently healthy individuals were included as controls. Compared with normal subjects, D±WS cases did not show significant differences in the levels of IL-8 or TNF-α during the acute nor in the critical stages of the disease; however, in D±WS cases levels of sICAM-1 and sVCAM-1 were higher than controls during both phases; in contrast, significant increase of sTNF-p75 and sIL2R levels were observed during the critical phase of the disease. Compared with both dengue patients and controls, patients with SD showed significant rise in the levels of IL-8 and TNF-α during the critical phase of the disease and a significant increase in adhesion molecules were detected in both phases, but the highest levels of sVCAM-1 and sIL-2R were observed only during the acute stage of the disease. In conclusion, sIL-2R and sVCAM-1, as early markers of lymphocyte and endothelial activation, would serves as indicators of severity during the acute phase of dengue infection.

  18. Value of routine ultrasound in detecting early joint changes in children with haemophilia using the 'Haemophilia Early Arthropathy Detection with UltraSound' protocol

    NARCIS (Netherlands)

    Foppen, W; van der Schaaf, I C; Fischer, K

    2016-01-01

    INTRODUCTION: Patients with haemophilia tend to bleed in large joints even during prophylactic replacement therapy. Detection of early blood-induced joint changes may improve monitoring of treatment. The aim of this study was to explore the value of routine ultrasound in detecting early joint abnorm

  19. Identification and evaluation of plasma microRNAs for early detection of colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Xiaoya Luo

    Full Text Available BACKGROUND: Colorectal cancer (CRC is one of the most commonly diagnosed cancers. Circulating microRNAs (miRNAs have been suggested as potentially promising markers for early detection of CRC. We aimed to identify and evaluate a panel of miRNAs that might be suitable for CRC early detection. METHODS: MiRNAs were profiled by TaqMan MicroRNA Array and screened for differential expression in 5 pools of plasma samples of CRC patients (N = 50 and 5 pools of neoplasm-free controls (N = 50. Additional miRNAs were selected from a literature review. Identified candidates were evaluated in independent validation samples with respect to discrimination of CRC patients (N = 80 or advanced adenoma patients (N = 50 and neoplasm-free controls (N = 194. Diagnostic performance of the panel of miRNAs was assessed by multiple logistic regression, using bootstrap analysis to correct for over-optimism. RESULTS: Five miRNAs identified to be differentially expressed from TaqMan MicroRNA Array (miR-29a, -106b, -133a, -342-3p, -532-3p, and seven miRNAs reported to be differentially expressed in the literature (miR-18a, -20a, -21, -92a, -143, -145, -181b were selected for validation. Nine of the twelve miRNAs (miR-18a, -20a, -21, -29a, -92a, -106b, -133a, -143, -145 were found to be differentially expressed in CRC patients and controls in the validation samples. The optimism-corrected area under the curve was 0.745 (95% confidence interval: 0.708-0.846. None of the selected miRNAs showed significant differential expression between advanced adenoma patients and neoplasm-free controls. CONCLUSION: The identified panel of miRNAs could be of potential use in the development of a multi-marker blood based test for early detection of CRC. IMPACT: The study underscores the high potential of plasma miRNAs for the improvement of current offers of non-invasive CRC screening.

  20. GC-MS detection of chiral markers in cocoa beans of different quality and geographic origin.

    Science.gov (United States)

    Caligiani, Augusta; Cirlini, Martina; Palla, Gerardo; Ravaglia, Roberta; Arlorio, Marco

    2007-05-05

    Fermented cocoa beans (Theobroma cacao L., Sterculiaceae) from different countries of origin (Ecuador, Ghana, Trinidad) and cocoa beans roasted under defined conditions (industrial roasting; 150-220 degrees C for 20 min, dry roasting in conventional oven) were analyzed for their contents of certain chiral hydroxy acids, catechins, and amino acids. Cocoa beans are fermented, dried, and industrially transformed by roasting for the production of chocolate, cocoa powders, and other cocoa-related products. Fermentation and roasting conditions influence the contents of chiral compounds such as hydroxy acids, amino acids, and polyphenols, depending on technological procedures as well as some technical parameters. The aim of this work was to check if the content and nature of the named chiral compounds present both in fermented and roasted cocoa beans could be related to the traditional parameters used to classify the variety of seeds and the degree of fermentation. The extent of racemization of amino acids in fermented cocoa beans was low while it slowly increased during roasting, depending on the temperature applied. L-lactic acid was always higher than the D-form while citric acid was generally the most abundant hydroxy acid detected in beans. A correlation was found between polyphenol content and degree of fermentation, while epimerization of (-)-epicatechin to (+)-catechin was observed during roasting. On the whole, results showed that several chiral compounds could be considered as good quality markers for cocoa seeds and cocoa-related products of different quality and geographic origin.

  1. Raman Spectra of Nanodiamonds: New Treatment Procedure Directed for Improved Raman Signal Marker Detection

    Directory of Open Access Journals (Sweden)

    Raoul R. Nigmatullin

    2013-01-01

    Full Text Available Detonation nanodiamonds (NDs have shown to be promising agents in several industries, ranging from electronic to biomedical applications. These NDs are characterized by small particle size ranging from 3 to 6 nm, while having a reactive surface and a stable inert core. Nanodiamonds can exhibit novel intrinsic properties such as fluorescence, high refractive index, and unique Raman signal making them very attractive imaging agents. In this work, we used several nanodiamond preparations for Raman spectroscopic studies. We exposed these nanodiamonds to increasing temperature treatments at constant heating rates (425–575°C aiding graphite release. We wanted to correlate changes in the nanodiamond surface and properties with Raman signal which could be used as a detection marker. These observations would hold potential utility in biomedical imaging applications. First, the procedure of optimal linear smoothing was applied successfully to eliminate the high-frequency fluctuations and to extract the smoothed Raman spectra. After that we applied the secondary Fourier transform as the fitting function based on some significant set of frequencies. The remnant noise was described in terms of the beta-distribution function. We expect this data treatment to provide better results in biomolecule tracking using nanodiamond base Raman labeling.

  2. 2-NBDG, a fluorescent analogue of glucose, as a marker for detecting cell electropermeabilization in vitro.

    Science.gov (United States)

    Raeisi, Elham; Mir, Lluis M

    2012-10-01

    This study investigated whether molecules spontaneously transported inside cells, like glucose derivatives, can also be used as electropermeabilization markers. Uptake of a fluorescent deoxyglucose derivative (2-NBDG) by normal and electropermeabilized cells in culture was analyzed. 2-NBDG was added to DC-3F cell suspensions and cells, exposed or not to eight square-wave electric pulses of 100-μs duration and of appropriate field amplitude at a repetition frequency of 1 Hz or 5 kHz, were incubated at 37 °C. 2-NBDG uptake was temperature-, concentration- and time-dependent in cells submitted or not to the electric pulses. In spite of significant uptake of 2-NBDG mediated by GLUT transporters into nonpermeabilized cells, the electric pulses significantly increased about ten to hundred times the 2-NBDG uptake into the cells. The increase in the field amplitude from 900 to 1,500 V/cm resulted in a progressive increase of 2-NDBG. Our results show that under the conditions of in vivo exposure duration to FDG and the physiological concentration of D-glucose, electric pulses increased 2-NBDG uptake into electropermeabilized cells. Under our experimental conditions, the percentage of permeabilized cells within the population of cells exposed to electric pulses remained at the same level regardless of the pulse frequency used, 1 Hz or 5 kHz. The findings showed that glucose derivatives can also be used to detect electropermeabilized cells exposed to electric pulses.

  3. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Kárita Cláudia Freitas-Lidani

    2014-07-01

    Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

  4. P504S: a new molecular marker for the detection of prostate carcinoma.

    Science.gov (United States)

    Jiang, Z; Woda, B A; Rock, K L; Xu, Y; Savas, L; Khan, A; Pihan, G; Cai, F; Babcook, J S; Rathanaswami, P; Reed, S G; Xu, J; Fanger, G R

    2001-11-01

    The ability to diagnose prostate carcinoma would be improved by the detection of a tumor-associated antigen. P504S, a cytoplasmic protein, was recently identified by cDNA library subtraction in conjunction with high throughput microarray screening from prostate carcinoma. The aim of this study was to establish the pattern of expression of P504S in prostate carcinoma and benign prostatic tissue. A total of 207 cases, including 137 cases of prostate carcinoma and 70 cases of benign prostate, from prostatectomies (n = 77), prostate needle biopsies (n = 112), and transurethral prostate resections (n = 18) were examined by immunocytochemistry for P504S. P504S showed strong cytoplasmic granular staining in 100% of prostate carcinomas regardless of Gleason scores and diffuse (>75% of tumor) staining in 92% of cases. In contrast, 171 of 194 (88%) of benign prostates, including 56 of 67 (84%) benign prostate cases and 115 of 127 (91%) cases of benign glands adjacent to cancers were negative for P504S. The remainders of benign prostates were focally and weakly positive for P504S. The staining pattern of these normal glands was different and easily distinguishable from that observed in prostate carcinoma. Expression of P504S was not found in basal cell hyperplasia, urothelial cells/metaplasia and small atrophic glands that may mimic prostate carcinoma. Our findings indicate that P504S is a highly sensitive and specific positive marker for prostate carcinoma.

  5. Intraspecific chromosomal and genetic polymorphism in Brassica napus L. detected by cytogenetic and molecular markers

    Indian Academy of Sciences (India)

    Alexandra V. Amosova; Lyudmila V. Zemtsova; Zoya E. Grushetskaya; Tatiana E. Samatadze; Galina V. Mozgova; Yadviga E. Pilyuk; Valentina T. Volovik; Natalia V. Melnikova; Alexandr V. Zelenin; Valentina A. Lemesh; Olga V. Muravenko

    2014-04-01

    The application of DNA intercalator 9-aminoacridine allowed us to increase the resolution of chromosome C-banding and DAPI-banding patterns and to investigate chromosomal polymorphism in karyotypes of seven spring and six winter rape varieties. It was shown that the pericentromeric and intercalary C-bands of most of the chromosomes in spring rape were smaller in size and less polymorphic than those of winter rape. More 26S and 5S rDNA sites were found in the winter rape karyotypes than the spring varieties. Separate or colocalized 26S and 5S rDNA sites were revealed on chromosomes 4, 5, 6, 8, 10, 14, 15, 16 and 18. Intervarietal and intravarietal polymorphism of the number and chromosomal localization of rDNA sites were detected. The generalized idiogram of chromosomes of 13 Brassica napus varieties with account of all possibilities of C-banding patterns as well as localization of 26S and 5S rDNA sites were constructed. Polymorphism of the examined molecular and cytogenetic markers as well as the heterozygosis level of FAE1.1 gene controlling erucic acid synthesis in rapeseed was higher in the winter varieties than in the spring ones. The obtained data were in a satisfactory agreement with increased tolerance to environmental stress conditions of winter rape.

  6. Genetic Variation of Inbred Lines of Maize Detected by SSR Markers

    Institute of Scientific and Technical Information of China (English)

    LI Xin-hai; FU Jun-hua; ZHANG Shi-huang; YUAN Li-xing; LI Ming-shun

    2001-01-01

    Simple sequence repeats (SSRs) were used to detect genetic variation among 21 maize(Zea mays L. ) inbred lines. Forty-three SSR primers selected from 69 primers gave stable amplification profiles, which could be clearly resolved on 3% Metaphor agarose gel, and produced 127 polymorphic amplified fragments.The average number of alleles per SSR locus was 2.95 with a range from 2 to 7. The polymorphism information content (PIC) for the SSR loci varied from 0.172 to 0.753 with an average of 0.511. Genetic similarities among the 21 lines ranged from 0.480 between the combination of Zhongzi451 vs. K12 up to 0.768 between CA156 vs. Ye478. The cluster analysis showed that 21 inbred lines could be classified into two distinct clusters with several subclusters, which corresponded to the heterotic groups determined by their pedigree information.Eight SSR primers, which had high level of polymorphism, could allow a rapid and efficient identification of 21 inbreds. Consequently, SSR markers could be used for measuring genetic variation of maize inbred lines and assigning them to heterotic groups.

  7. Klinefelter syndrome: are we missing opportunities for early detection?

    Science.gov (United States)

    Nahata, Leena; Rosoklija, Ilina; Yu, Richard N; Cohen, Laurie E

    2013-10-01

    Klinefelter syndrome is a common condition that remains underdiagnosed, particularly prior to adulthood. Early detection could prevent morbidity and mortality, but the classic phenotype of small testes and tall stature may not be apparent until adolescence, and there is minimal guidance regarding whom to screen. We performed a retrospective study at Boston Children's Hospital in patients with the ICD-9 code for "Klinefelter syndrome" diagnosed prior to age 20 years, and determined age and reason for diagnosis, karyotype, heights, and comorbid conditions. Eighty percent had a 47,XXY karyotype, of whom half were diagnosed at age 11 to 19 years. The most common comorbidities were neurocognitive, including learning disabilities (67%), psychosocial problems (33%), and attention deficit disorder (27%). Subjects were only slightly taller than average in childhood (height standard deviation score = 0.64). These data show that Klinefelter syndrome is associated with long-standing comorbidities that frequently remain under-recognized; a karyotype should be considered in boys with neurocognitive problems.

  8. CADe tools for early detection of breast cancer

    CERN Document Server

    Bottigli, U; Delogu, P; Fantacci, M E; Fauci, F; Forni, G; Golosio, B; Lauria, A; López, E; Magro, R; Masala, G L; Oliva, P; Palmiero, R; Raso, G; Retico, A; Stumbo, S; Tangaro, S

    2004-01-01

    A breast neoplasia is often marked by the presence of microcalcifications and massive lesions in the mammogram: hence the need for tools able to recognize such lesions at an early stage. Our collaboration, among italian physicists and radiologists, has built a large distributed database of digitized mammographic images and has developed a Computer Aided Detection (CADe) system for the automatic analysis of mammographic images and installed it in some Italian hospitals by a GRID connection. Regarding microcalcifications, in our CADe digital mammogram is divided into wide windows which are processed by a convolution filter; after a self-organizing map analyzes each window and produces 8 principal components which are used as input of a neural network (FFNN) able to classify the windows matched to a threshold. Regarding massive lesions we select all important maximum intensity position and define the ROI radius. From each ROI found we extract the parameters which are used as input in a FFNN to distinguish betwee...

  9. Salivary Antimicrobial Peptides in Early Detection of Periodontitis

    Directory of Open Access Journals (Sweden)

    Guliz N. eGuncu

    2015-12-01

    Full Text Available In the pathogenesis of periodontitis, an infection-induced inflammatory disease of the tooth-supporting tissues, there is a complex interaction between the subgingival microbiota and host tissues. A periodontal diagnostic tool for detecting the initiation and progression of the disease, monitoring the response to therapy, or measuring the degree of susceptibility to future disease progression has been of interest for a long time. The value of various enzymes, proteins, and immunoglobulins, which are abundant constituents of saliva, as potential biomarkers has been recognized and extensively investigated for periodontal diseases. Gingival defensins and cathelicidins are small cationic antimicrobial peptides that play an important role in innate immune response. However, their applicability as salivary biomarkers is still under debate. The present review focuses on proteomic biomarkers and antimicrobial peptides, in particular, to be used at early phases of periodontitis.

  10. Salivary Antimicrobial Peptides in Early Detection of Periodontitis.

    Science.gov (United States)

    Güncü, Güliz N; Yilmaz, Dogukan; Könönen, Eija; Gürsoy, Ulvi K

    2015-01-01

    In the pathogenesis of periodontitis, an infection-induced inflammatory disease of the tooth-supporting tissues, there is a complex interaction between the subgingival microbiota and host tissues. A periodontal diagnostic tool for detecting the initiation and progression of the disease, monitoring the response to therapy, or measuring the degree of susceptibility to future disease progression has been of interest for a long time. The value of various enzymes, proteins, and immunoglobulins, which are abundant constituents of saliva, as potential biomarkers has been recognized and extensively investigated for periodontal diseases. Gingival defensins and cathelicidins are small cationic antimicrobial peptides that play an important role in innate immune response. However, their applicability as salivary biomarkers is still under debate. The present review focuses on proteomic biomarkers and antimicrobial peptides, in particular, to be used at early phases of periodontitis.

  11. Optimizing early upper gastrointestinal cancer detection at endoscopy.

    Science.gov (United States)

    Veitch, Andrew M; Uedo, Noriya; Yao, Kenshi; East, James E

    2015-11-01

    Survival rates for upper gastrointestinal cancers are poor and oesophageal cancer incidence is increasing. Upper gastrointestinal cancer is also often missed during examinations; a predicament that has not yet been sufficiently addressed. Improvements in the detection of premalignant lesions, early oesophageal and gastric cancers will enable organ-preserving endoscopic therapy, potentially reducing the number of advanced upper gastrointestinal cancers and resulting in improved prognosis. Japan is a world leader in high-quality diagnostic upper gastrointestinal endoscopy and the clinical routine in this country differs substantially from Western practice. In this Perspectives article, we review lessons learnt from Japanese gastroscopy technique, training and screening for risk stratification. We suggest a key performance indicator for upper gastrointestinal endoscopy with a minimum total procedure time of 8 min, and examine how quality assurance concepts in bowel cancer screening in the UK could be applied to upper gastrointestinal endoscopy and improve clinical practice.

  12. Barriers for early detection of cancer amongst Indian rural women

    Directory of Open Access Journals (Sweden)

    Neha Tripathi

    2014-01-01

    Full Text Available Context: Breast and cervical cancer are the most common causes of cancer mortality among women worldwide, but actually they are largely preventable diseases. Healthcare providers in developing countries regularly see women with advanced, incurable cancers. Health of a rural Indian women and her access to health facility is compromised due to sociocultural, economical, and environmental factors. Aims: To know the problems associated with early detection of cancers in rural women. Settings and Design: Rural area and cross-sectional. Subjects and Methods: Study subject: Women of 35 years and above. Exclusion criteria: Not willing to participate. Sample size: All eligible women of selected villages. Sampling Technique: Random selection of villages. Study duration: 2 months. Study tools: Pretested questionnaire. Statistical Analysis Used: Percentages, χ2 test, analysis of variance (ANOVA, multivariate analysis. Results: Awareness about symptoms, possibility of early detection, available tests, possibility of cure of disease was low. Main barrier for screening was cognitive, that is, ′don′t know′ answer by 83.99% women for cancer cervix, 84.93%, for cancer breast, and 67.26% for oral cancer. Awareness score was significantly associated with age (χ2 = 17.77, P = 0.001, education (χ2 = 34.62, P = 0.000, and income (χ2 = 16.72, P = 0.002; while attitude score with age (χ2 = 16.27, P = 0.012 and education (χ2 = 25.16, P = 0.003. Practice score was significantly associated with age (χ2 = 11.28, P = 0.023, education (χ2 = 32.27, P = 0.003, and occupation (χ2 = 10.69, P = 0.03. Awareness, attitude, and practice score of women having history of cancer in family or relative was significantly high than women without history. Conclusions: Cognitive barrier was the important barrier which has to be taken care of.

  13. Early Hearing Detection and Vocabulary of Children With Hearing Loss.

    Science.gov (United States)

    Yoshinaga-Itano, Christine; Sedey, Allison L; Wiggin, Mallene; Chung, Winnie

    2017-08-01

    To date, no studies have examined vocabulary outcomes of children meeting all 3 components of the Early Hearing Detection and Intervention (EHDI) guidelines (hearing screening by 1 month, diagnosis of hearing loss by 3 months, and intervention by 6 months of age). The primary purpose of the current study was to examine the impact of the current EHDI 1-3-6 policy on vocabulary outcomes across a wide geographic area. A secondary goal was to confirm the impact of other demographic variables previously reported to be related to language outcomes. This was a cross-sectional study of 448 children with bilateral hearing loss between 8 and 39 months of age (mean = 25.3 months, SD = 7.5 months). The children lived in 12 different states and were participating in the National Early Childhood Assessment Project. The combination of 6 factors in a regression analysis accounted for 41% of the variance in vocabulary outcomes. Vocabulary quotients were significantly higher for children who met the EHDI guidelines, were younger, had no additional disabilities, had mild to moderate hearing loss, had parents who were deaf or hard of hearing, and had mothers with higher levels of education. Vocabulary learning may be enhanced with system improvements that increase the number of children meeting the current early identification and intervention guidelines. In addition, intervention efforts need to focus on preventing widening delays with chronological age, assisting mothers with lower levels of education, and incorporating adults who are deaf/hard-of-hearing in the intervention process. Copyright © 2017 by the American Academy of Pediatrics.

  14. Early detection of AD using cortical thickness measurements

    Science.gov (United States)

    Spjuth, M.; Gravesen, F.; Eskildsen, S. F.; Østergaard, L. R.

    2007-03-01

    Alzheimer's disease (AD) is a neurodegenerative disorder that causes cortical atrophy and impaired cognitive functions. The diagnosis is difficult to make and is often made over a longer period of time using a combination of neuropsychological tests, and structural and functional imaging. Due to the impact of early intervention the challenge of distinguishing early AD from normal ageing has received increasing attention. This study uses cortical thickness measurements to characterize the atrophy in nine mild AD patients (mean MMSE-score 23.3 (std: 2.6)) compared to five healthy middle-aged subjects. A fully automated method based on deformable models is used for delineation of the inner and outer boundaries of the cerebral cortex from Magnetic Resonance Images. This allows observer independent high-resolution quantification of the cortical thickness. The cortex analysis facilitates detection of alterations throughout the entire cortical mantle. To perform inter-subject thickness comparison in which the spatial information is retained, a feature-based registration algorithm is developed which uses local cortical curvature, normal vector, and a distance measure. A comparison of the two study groups reveals that the lateral side of the hemispheres shows diffuse thinner areas in the mild AD group but especially the medial side shows a pronounced thinner area which can be explained by early limbic changes in AD. For classification principal component analysis is applied to reduce the high number of thickness measurements (>200,000) into fewer features. All mild AD and healthy middle-aged subjects are classified correctly (sensitivity and specificity 100%).

  15. Concrete bridge deck early problem detection and mitigation using robotics

    Science.gov (United States)

    Gucunski, Nenad; Yi, Jingang; Basily, Basily; Duong, Trung; Kim, Jinyoung; Balaguru, Perumalsamy; Parvardeh, Hooman; Maher, Ali; Najm, Husam

    2015-04-01

    More economical management of bridges can be achieved through early problem detection and mitigation. The paper describes development and implementation of two fully automated (robotic) systems for nondestructive evaluation (NDE) and minimally invasive rehabilitation of concrete bridge decks. The NDE system named RABIT was developed with the support from Federal Highway Administration (FHWA). It implements multiple NDE technologies, namely: electrical resistivity (ER), impact echo (IE), ground-penetrating radar (GPR), and ultrasonic surface waves (USW). In addition, the system utilizes advanced vision to substitute traditional visual inspection. The RABIT system collects data at significantly higher speeds than it is done using traditional NDE equipment. The associated platform for the enhanced interpretation of condition assessment in concrete bridge decks utilizes data integration, fusion, and deterioration and defect visualization. The interpretation and visualization platform specifically addresses data integration and fusion from the four NDE technologies. The data visualization platform facilitates an intuitive presentation of the main deterioration due to: corrosion, delamination, and concrete degradation, by integrating NDE survey results and high resolution deck surface imaging. The rehabilitation robotic system was developed with the support from National Institute of Standards and Technology-Technology Innovation Program (NIST-TIP). The system utilizes advanced robotics and novel materials to repair problems in concrete decks, primarily early stage delamination and internal cracking, using a minimally invasive approach. Since both systems use global positioning systems for navigation, some of the current efforts concentrate on their coordination for the most effective joint evaluation and rehabilitation.

  16. Early detection of influenza like illness through medication sales.

    Science.gov (United States)

    Socan, Maja; Erculj, Vanja; Lajovic, Jaro

    2012-06-01

    Monitoring sales of medications is a potential candidate for an early signal of a seasonal influenza epidemic. To test this theory, the data from a traditional, consultation-oriented influenza surveillance system were compared to medication sales and a predictive model was developed. Weekly influenza-like incidence rates from the National Influenza Sentinel Surveillance System were compared to sales of seven groups of medications (nasal decongestants, medicines for sore throat (MST), antitussives, mucolytics, analgo-antipyretics, non-steroidal anti-inflamatory drugs (NSAIDs), betalactam antibiotics, and macrolide antibiotics) to determine the correlation of medication sales with the sentinel surveillance system - and therefore their predictive power. Poisson regression and regression tree approaches were used in the statistical analyses. The fact that NSAIDs do not exhibit any seasonality and that prescription of antibiotics requires a visit to the doctor's office makes the two medication groups inappropriate for predictive purposes. The influenza-like illness (ILI) curve is the best matched by the mucolytics and antitussives sales curves. Distinct seasonality is also observed with MST and decongestants. The model including these four medication groups performed best in prediction of ILI incidence rate using the Poisson regression model. Sales of antitussives proved to be the best single predictive variable for regression tree model. Sales of medication groups included in the model were demonstrated to have a predictive potential for early detection of influenza season. The quantitative information on medication sales proves to be a useful supplementary system, complementing the traditional consultation-oriented surveillance system.

  17. Cortisol, heart rate, and blood pressure as early markers of PTSD risk: A systematic review and meta-analysis.

    Science.gov (United States)

    Morris, Matthew C; Hellman, Natalie; Abelson, James L; Rao, Uma

    2016-11-01

    Individuals with posttraumatic stress disorder (PTSD) typically exhibit altered hypothalamic-pituitary-adrenal (HPA) function and sympathetic nervous system (SNS) activity. The goals of this study were to determine whether HPA and SNS alterations in the immediate aftermath of trauma predict subsequent PTSD symptom development and whether inconsistencies observed between studies can be explained by key demographic and methodological factors. This work informs secondary prevention of PTSD by identifying subgroups of trauma survivors at risk for PTSD. This meta-analysis (26 studies, N=5186 individuals) revealed that higher heart rate measured soon after trauma exposure was associated with higher PTSD symptoms subsequently (r=0.13). Neither cortisol (r=-0.07) nor blood pressure (diastolic: r=-0.01; systolic: r=0.02) were associated with PTSD symptoms which may be influenced by methodological limitations. Associations between risk markers (heart rate, cortisol, systolic blood pressure) and PTSD symptoms were in the positive direction for younger samples and negative direction for older samples. These findings extend developmental traumatology models of PTSD by revealing an age-related shift in the presentation of early risk markers. More work will be needed to identify risk markers and pathways to PTSD while addressing methodological limitations in order to shape and target preventive interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Amygdala reactivity to sad faces in preschool children: An early neural marker of persistent negative affect

    Directory of Open Access Journals (Sweden)

    Michael S. Gaffrey

    2016-02-01

    Conclusions: The current findings provide preliminary evidence for amygdala activity as a potential biomarker of persistent negative affect during early childhood and suggest future work examining the origins and long-term implications of this relationship is necessary.

  19. Network analysis in detection of early-stage mild cognitive impairment

    Science.gov (United States)

    Ni, Huangjing; Qin, Jiaolong; Zhou, Luping; Zhao, Zhigen; Wang, Jun; Hou, Fengzhen

    2017-07-01

    The detection and intervention for early-stage mild cognitive impairment (EMCI) is of vital importance However, the pathology of EMCI remains largely unknown, making it be challenge to the clinical diagnosis. In this paper, the resting-state functional magnetic resonance imaging (rs-fMRI) data derived from EMCI patients and normal controls are analyzed using the complex network theory. We construct the functional connectivity (FC) networks and employ the local false discovery rate approach to successfully detect the abnormal functional connectivities appeared in the EMCI patients. Our results demonstrate the abnormal functional connectivities have appeared in the EMCI patients, and the affected brain regions are mainly distributed in the frontal and temporal lobes In addition, to quantitatively characterize the statistical properties of FCs in the complex network, we herein employ the entropy of the degree distribution (EDD) index and some other well-established measures, i.e., clustering coefficient (CC) and the efficiency of graph (EG). Eventually, we found that the EDD index, better than the widely used CC and EG measures, may serve as an assistant and potential marker for the detection of EMCI.

  20. Graphene quantum dots FRET based sensor for early detection of heart attack in human.

    Science.gov (United States)

    Bhatnagar, Deepika; Kumar, Vanish; Kumar, Ashok; Kaur, Inderpreet

    2016-05-15

    Cardiac immunosensor for early detection of heart attack (myocardial infarction) was developed using amine functionalized graphene quantum dots (afGQDs) conjugated with antibody anti-cardiac Troponin I (anti-cTnI) to detect cardiac marker antigen Troponin I (cTnI) in blood based on fluorescence resonance energy transfer (FRET) between conjugate and graphene (quencher) only in 10 min. The anti-cTnI was covalently conjugated to afGQDs through carbodiimide coupling reaction. The conjugate was characterized by zeta potential UV-vis spectroscopy and field emission scanning electron microscopy (FESEM). The sensing performance of the sensor was studied with respect to changes in the photon count and photoluminescence of GQDs based on interaction of target cTnI with its specific anti-cTnI antibody. The sensor is highly specific and shows negligible response to non-specific antigens. The sensor displayed a linear response to cTnI from 0.001 to 1000 ng mL(-1) with a limit of detection of 0.192 pg mL(-1).

  1. Detection of tumor stem cell markers in pancreatic carcinoma cell lines

    Institute of Scientific and Technical Information of China (English)

    Monika Olempska; Patricia Alice Eisenach; Ole Ammerpohl; Hendrik Ungefroren; Fred Fandrich; Holger Kalthoff

    2007-01-01

    BACKGROUND: Cancer of the pancreas is the fourth leading cause of cancer death in industrialized countries. In malignancy, actively proliferating cells may be effectively targeted and killed by anti-cancer therapies, but stem cells may survive and support re-growth of the tumor. Thus, new strategies for the treatment of cancer clearly will also have to target cancer stem cells. The goal of the present study was to determine whether pancreatic carcinoma cell growth may be driven by a subpopulation of cancer stem cells. Because previous data implicated ABCG2 and CD133 as stem cell markers in hematopoietic and neural stem/progenitor cells, we analyzed the expression of these two proteins in pancreatic carcinoma cell lines. METHODS:Five established pancreatic adenocarcinoma cell lines were analyzed. Total RNA was isolated and real-time RT-PCR was performed to determine the expression of ABCG2 and CD133. Surface expression of ABCG2 and CD133 was analyzed by lfow cytometric analysis. RESULTS:All pancreatic carcinoma cell lines tested expressed signiifcantly higher levels of ABCG2 than non-malignant ifbroblasts or two other malignant non-pancreatic cell lines, i.e., SaOS2 osteosarcoma and SKOV3 ovarian cancer. Elevated CD133 expression was found in two out of ifve pancreatic carcinoma cell lines tested. Using lfow cytometric analysis we conifrmed surface expression of ABCG2 in all ifve lines. Yet, CD133 surface expression was detectable in the two cell lines, A818-6 and PancTu1, which exhibited higher mRNA levels. CONCLUSIONS: Two stem cell markers, ABCG2 and CD133 are expressed in pancreatic carcinoma cell lines. ABCG2 and/or CD133 positive cells may represent subpopulation of putative cancer stem cells also in this malignancy. Because cancer stem cells are thought to be responsible for tumor initiation and its recurrence after an initial response to chemotherapy, they may be a very promising target for new drug developments.

  2. [Effect of stimulation with the measles virus on expression of early activation markers on CD4+ T lymphocytes].

    Science.gov (United States)

    Siennicka, Joanna; Cześcik, Agnieszka; Dunal, Milena; Trzcińska, Agnieszka

    2011-01-01

    Elimination of measles is one of the priority plans of WHO. The success of this plan depends on the development of long lasting, postvaccinal immune response. The aim of this study was to present the effect of stimulation with different strains of measles virus on the expression of T-helper cell (CD4+ T) early activation markers in people with different history of measles infection and to determine the correlation between the activation and dose of virus used for stimulation. The study was conducted using material derived from two patients: one seropositive due to natural infection and one vaccinated, with traces of anti-MeV IgG antibodies. In the CD4 T helper cells, the expression of CD69 receptor and the ability of the cells to produce INF after stimulation with the vaccine-derived or wild-type strain of measles virus was determined. For antigen-specific stimulation the virus suspension containing about 100 infectious particle, its tenfold and hundredfold dilutions was used. We found that the expression of T-helper cells early activation markers depended on the strain of the measles virus used for the stimulation, type of the immune response (postvaccinal, natural infection), and in the case of CD69 expression also on the dose of the virus used for the stimulation.

  3. Detection and parameter estimation for quantitative trait loci using regression models and multiple markers

    Directory of Open Access Journals (Sweden)

    Schook Lawrence B

    2000-07-01

    Full Text Available Abstract A strategy of multi-step minimal conditional regression analysis has been developed to determine the existence of statistical testing and parameter estimation for a quantitative trait locus (QTL that are unaffected by linked QTLs. The estimation of marker-QTL recombination frequency needs to consider only three cases: 1 the chromosome has only one QTL, 2 one side of the target QTL has one or more QTLs, and 3 either side of the target QTL has one or more QTLs. Analytical formula was derived to estimate marker-QTL recombination frequency for each of the three cases. The formula involves two flanking markers for case 1, two flanking markers plus a conditional marker for case 2, and two flanking markers plus two conditional markers for case 3. Each QTL variance and effect, and the total QTL variance were also estimated using analytical formulae. Simulation data show that the formulae for estimating marker-QTL recombination frequency could be a useful statistical tool for fine QTL mapping. With 1 000 observations, a QTL could be mapped to a narrow chromosome region of 1.5 cM if no linked QTL is present, and to a 2.8 cM chromosome region if either side of the target QTL has at least one linked QTL.

  4. Fluorescence spectroscopic detection of early injury-induced atherosclerosis

    Science.gov (United States)

    Lucas, Alexandra; Perk, Masis; Wen, Yue; Smith, Carol

    1992-08-01

    Laser-induced fluorescence spectroscopy has been used for the detection of advanced atherosclerotic lesions. Angioplasty balloon-mediated injury was examined spectroscopically in order to assess the sensitivity of fluorescence spectroscopy for detection of early atherosclerosis. Abdominal aortic balloon angioplasty was performed via femoral artery cutdown in nine White Leghorn roosters (five normal, four atherogenic diet). Roosters were sacrificed at 1, 2, 4, 8, and 12 week intervals. Fluorescence emission spectra (n equals 114) were recorded from each aortic section (XeCl excimer laser, 308 nm, 1.5 - 2.0 mJ/pulse, 5 Hz). Changes in normalized fluorescence emission intensity were correlated with selected sections of histology. All balloon-injured segments showed intimal fibrous proliferation. For intimal thickness measuring > 70 (mu) , fluorescence emission intensity was decreased at 440 - 460 nm (p Lesions complicated by thrombus also had lower fluorescence emission at 425 - 450 nm when compared to histologically normal aorta (p muscular (abdominal) aorta (p muscular abdominal aorta.

  5. Social Network Sensors for Early Detection of Contagious Outbreaks

    CERN Document Server

    Christakis, Nicholas A

    2010-01-01

    Current methods for the detection of contagious outbreaks give contemporaneous information about the course of an epidemic at best. Individuals at the center of a social network are likely to be infected sooner, on average, than those at the periphery. However, mapping a whole network to identify central individuals whom to monitor is typically very difficult. We propose an alternative strategy that does not require ascertainment of global network structure, namely, monitoring the friends of randomly selected individuals. Such individuals are known to be more central. To evaluate whether such a friend group could indeed provide early detection, we studied a flu outbreak at Harvard College in late 2009. We followed 744 students divided between a random group and a friend group. Based on clinical diagnoses, the progression of the epidemic in the friend group occurred 14.7 days (95% C.I. 11.7-17.6) in advance of the randomly chosen group (i.e., the population as a whole). The friend group also showed a significa...

  6. Early Oscillation Detection for DC/DC Converter Fault Diagnosis

    Science.gov (United States)

    Wang, Bright L.

    2011-01-01

    The electrical power system of a spacecraft plays a very critical role for space mission success. Such a modern power system may contain numerous hybrid DC/DC converters both inside the power system electronics (PSE) units and onboard most of the flight electronics modules. One of the faulty conditions for DC/DC converter that poses serious threats to mission safety is the random occurrence of oscillation related to inherent instability characteristics of the DC/DC converters and design deficiency of the power systems. To ensure the highest reliability of the power system, oscillations in any form shall be promptly detected during part level testing, system integration tests, flight health monitoring, and on-board fault diagnosis. The popular gain/phase margin analysis method is capable of predicting stability levels of DC/DC converters, but it is limited only to verification of designs and to part-level testing on some of the models. This method has to inject noise signals into the control loop circuitry as required, thus, interrupts the DC/DC converter's normal operation and increases risks of degrading and damaging the flight unit. A novel technique to detect oscillations at early stage for flight hybrid DC/DC converters was developed.

  7. Early Detection of Lung Cancer Using Neural Network Techniques

    Directory of Open Access Journals (Sweden)

    Prashant Naresh

    2014-08-01

    Full Text Available Effective identification of lung cancer at an initial stage is an important and crucial aspect of image processing. Several data mining methods have been used to detect lung cancer at early stage. In this paper, an approach has been presented which will diagnose lung cancer at an initial stage using CT scan images which are in Dicom (DCM format. One of the key challenges is to remove white Gaussian noise from the CT scan image, which is done using non local mean filter and to segment the lung Otsu’s thresholding is used. The textural and structural features are extracted from the processed image to form feature vector. In this paper, three classifiers namely SVM, ANN, and k-NN are applied for the detection of lung cancer to find the severity of disease (stage I or stage II and comparison is made with ANN, and k-NN classifier with respect to different quality attributes such as accuracy, sensitivity(recall, precision and specificity. It has been found from results that SVM achieves higher accuracy of 95.12% while ANN achieves 92.68% accuracy on the given data set and k-NN shows least accuracy of 85.37%. SVM algorithm which achieves 95.12% accuracy helps patients to take remedial action on time and reduces mortality rate from this deadly disease.

  8. Saliva: an emerging biofluid for early detection of diseases.

    Science.gov (United States)

    Lee, Yu-Hsiang; Wong, David T

    2009-08-01

    The capability to assess physiological states, detect morbidity initiation and progression, and monitor posttreatment therapeutic outcomes through a noninvasive approach is one of the most desirable goals for healthcare research and delivery. Saliva, a multi-constituent oral fluid, has high potential for the surveillance of general health and disease. To reach the above goal through saliva-based diagnostics, two prerequisites must be fulfilled: (1) discovering biomarker(s) for different diseases among the complicated components of saliva, and (2) advancing sensitivity and specificity of biomarker(s) through persistent development of technologies. Under the support and research blueprint initiated by the National Institute of Dental and Craniofacial Research (NIDCR), salivary diagnostics has not only steadily progressed with respect to accuracy and availability, but has also bridged up-to-date nanotechnology to expand the areas of application. With collective efforts over several years, saliva has been demonstrated to be a promising bodily fluid for early detection of diseases, and salivary diagnostics has exhibited tremendous potential in clinical applications. This review presents an overview of the value of saliva as a credible diagnostic tool, the discovery of salivary biomarkers, and the development of salivary diagnostics now and in the future.

  9. CD44 is a marker for the outer pillar cells in the early postnatal mouse inner ear.

    Science.gov (United States)

    Hertzano, Ronna; Puligilla, Chandrakala; Chan, Siaw-Lin; Timothy, Caroline; Depireux, Didier A; Ahmed, Zubair; Wolf, Jeffrey; Eisenman, David J; Friedman, Thomas B; Riazuddin, Sheikh; Kelley, Matthew W; Strome, Scott E

    2010-09-01

    Cluster of differentiation antigens (CD proteins) are classically used as immune cell markers. However, their expression within the inner ear is still largely undefined. In this study, we explored the possibility that specific CD proteins might be useful for defining inner ear cell populations. mRNA expression profiling of microdissected auditory and vestibular sensory epithelia revealed 107 CD genes as expressed in the early postnatal mouse inner ear. The expression of 68 CD genes was validated with real-time RT-PCR using RNA extracted from microdissected sensory epithelia of cochleae, utricles, saccules, and cristae of newborn mice. Specifically, CD44 was identified as preferentially expressed in the auditory sensory epithelium. Immunohistochemistry revealed that within the early postnatal organ of Corti, the expression of CD44 is restricted to outer pillar cells. In order to confirm and expand this finding, we characterized the expression of CD44 in two different strains of mice with loss- and gain-of-function mutations in Fgfr3 which encodes a receptor for FGF8 that is essential for pillar cell development. We found that the expression of CD44 is abolished from the immature pillar cells in homozygous Fgfr3 knockout mice. In contrast, both the outer pillar cells and the aberrant Deiters' cells in the Fgfr3 ( P244R/ ) (+) mice express CD44. The deafness phenotype segregating in DFNB51 families maps to a linkage interval that includes CD44. To study the potential role of CD44 in hearing, we characterized the auditory system of CD44 knockout mice and sequenced the entire open reading frame of CD44 of affected members of DFNB51 families. Our results suggest that CD44 does not underlie the deafness phenotype of the DFNB51 families. Finally, our study reveals multiple potential new cell type-specific markers in the mouse inner ear and identifies a new marker for outer pillar cells.

  10. [Early detection and prevention of cancers in various therapeutic areas. Discussion].

    Science.gov (United States)

    Akaza, H; Tsuruo, T; Tsukamoto, T; Noguchi, S; Moriwaki, H; Isonishi, S; Masuda, N; Hinotsu, S; Nash, A F; von Euler, M; Wildin, J; Stribling, D

    1999-10-01

    As illustrated by prostate cancer screening provides an opportunity for early intervention and treatment. However the screening test needs to detect patients with cancer with a low rate of false positives and at a stage which can be treated. Recently the concept of treating patients at high risk of developing breast cancer or suffering a recurrence has been highlighted by the western studies with Nolvadex (tamoxifen). Thus roundtable discussion (held in Tokyo) discussed the different strategies in Japan compared to US & Europe for screening & early intervention/prevention of cancer for breast, prostate, bladder, liver, lung, gynaecological & GI cancers. The range of strategies for cancer screening, how it is funded, whether it is appropriately targeted and whether there is any evidence for a beneficial effect on morbidity or mortality & future prospects for improved sensitivity through new methodology or markers were discussed. Although the relative rates of cancer vary between Japan & the West, the same factors seem to influence cancer development & the data on intervention were seen to be valid. The changing patterns of cancer in Japan suggest a clear opportunity for reducing, the incidence of cancer through lifestyle modification. For some cancers, e.g. cervical & bladder where there is a clear link between abnormal cytology & development cancer true prevention is already practiced. In other cases, preventive treatment is limited by the efficacy of available therapies. As far as drug treatment is concerned, funding of healthcare in Japan does not recognise the concept of prevention although there is, in practice, no barrier to the use of interventions where there is a clear link between biochemical/histological markers & development of cancer.

  11. Detection of cord blood hepcidin levels as a biomarker for early-onset neonatal sepsis.

    Science.gov (United States)

    Cizmeci, Mehmet Nevzat; Kara, Semra; Kanburoglu, Mehmet Kenan; Simavli, Serap; Duvan, Candan Iltemur; Tatli, Mustafa Mansur

    2014-03-01

    Early-onset neonatal sepsis (EONS) continues to be a severe condition associated with a high mortality and morbidity. However, symptoms and laboratory markers of this serious condition are nonspecific and currently there are no available standard tests to provide perfect diagnostic accuracy. An early recognition and initiation of antimicrobial therapy are essential in order to prevent morbidity and mortality. Hepcidin, the key regulator of iron homeostasis, is also an acute-phase reactant, which has a critical role in inflammation and contributes to host defense by interfering with microorganism's access to iron. Since hepcidin expression is induced by interleukin-6 (IL-6), it also plays role in the innate immune system. Recently, endogenous expression of hepcidin by macrophages and neutrophils in response to bacterial pathogens confirmed its role in innate immunity. The clear link between the hepcidin molecule and innate immunity may be used for the detection of EONS. We hypothesized that an increased level of hepcidin in cord blood may be used as a reliable biological marker of EONS and designed a prospective cohort study to test this hypothesis and collected pilot data. Cord blood samples of all infants born between January 2009 and December 2010 at our university hospital were collected after parental consent and a total of 38 infants were enrolled in the study who fulfilled the sepsis criteria. The range of cord blood hepcidin was found to be significantly increased in newborns with EONS (min-max: 118.1-8400 ng/mL). To the best of our knowledge, this is the first study to investigate the pathophysiologic relevance of hepcidin in EONS and demonstrate increased levels of hepcidin in cord blood as an acute-phase reactant in response to sepsis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Human mammaglobin: a superior marker for reverse-transcriptase PCR in detecting circulating tumor cells in breast cancer patients.

    Science.gov (United States)

    Li, GuangLiang; Zhang, Jing; Jin, KeTao; He, KuiFeng; Wang, HaoHao; Lu, HaiQi; Teng, LiSong

    2011-04-01

    Breast cancer is the most frequent cancer in women in the USA and the second most common cause of death in females who develop cancer. Recently, the detection of circulating tumor cells has emerged as a promising tool for monitoring the progression of clinically occult micrometastases in breast cancer patients. Sensitive molecular techniques, primarily based upon the reverse-transcriptase PCR, using various molecules as markers, have been developed to detect circulating tumor cells. Among those molecules, human mammaglobin mRNA has been found to be the most specific marker for the hematogenous spread of breast cancer cells. In this article, we review the current knowledge regarding the use of reverse-transcriptase PCR for detecting human mammaglobin mRNA as a biomarker for circulating tumor cells in breast cancer patients, and evaluate the clinical implications of human mammaglobin since it was first isolated in 1996.

  13. Identifying MRI markers to evaluate early treatment-related changes post-laser ablation for cancer pain management

    Science.gov (United States)

    Tiwari, Pallavi; Danish, Shabbar; Madabhushi, Anant

    2014-03-01

    Laser interstitial thermal therapy (LITT) has recently emerged as a new treatment modality for cancer pain management that targets the cingulum (pain center in the brain), and has shown promise over radio-frequency (RF) based ablation which is reported to provide temporary relief. One of the major advantages enjoyed by LITT is its compatibility with magnetic resonance imaging (MRI), allowing for high resolution in vivo imaging to be used in LITT procedures. Since laser ablation for pain management is currently exploratory and is only performed at a few centers worldwide, its short-, and long-term effects on the cingulum are currently unknown. Traditionally treatment effects are evaluated by monitoring changes in volume of the ablation zone post-treatment. However, this is sub-optimal since it involves evaluating a single global parameter (volume) to detect changes pre-, and post-MRI. Additionally, the qualitative observations of LITT-related changes on multi-parametric MRI (MPMRI) do not specifically address differentiation between the appearance of treatment related changes (edema, necrosis) from recurrence of the disease (pain recurrence). In this work, we explore the utility of computer extracted texture descriptors on MP-MRI to capture early treatment related changes on a per-voxel basis by extracting quantitative relationships that may allow for an in-depth understanding of tissue response to LITT on MRI, subtle changes that may not be appreciable on original MR intensities. The second objective of this work is to investigate the efficacy of different MRI protocols in accurately capturing treatment related changes within and outside the ablation zone post-LITT. A retrospective cohort of studies comprising pre- and 24-hour post-LITT 3 Tesla T1-weighted (T1w), T2w, T2-GRE, and T2-FLAIR acquisitions was considered. Our scheme involved (1) inter-protocol as well as inter-acquisition affine registration of pre- and post-LITT MRI, (2) quantitation of MRI parameters

  14. Simultaneous quantitative detection of multiple tumor markers with a rapid and sensitive multicolor quantum dots based immunochromatographic test strip.

    Science.gov (United States)

    Wang, Chunying; Hou, Fei; Ma, Yicai

    2015-06-15

    A novel multicolor quantum dots (QDs) based immunochromatographic test strip (ICTS) was developed for simultaneous quantitative detection of multiple tumor markers, by utilizing alpha fetoprotein (AFP) and carcinoembryonic antigen (CEA) as models. The immunosensor could realize simultaneous quantitative detection of tumor markers with only one test line and one control line on the nitrocellulose membrane (NC membrane) due to the introduction of multicolor QDs. In this method, a mixture of mouse anti-AFP McAb and mouse anti-CEA McAb was coated on NC membrane as test line and goat anti-mouse IgG antibody was coated as control line. Anti-AFP McAb-QDs546 conjugates and anti-CEA McAb-QDs620 conjugates were mixed and applied to the conjugate pad. Simultaneous quantitative detection of multiple tumor markers was achieved by detecting the fluorescence intensity of captured QDs labels on test line and control line using a test strip reader. Under the optimum conditions, AFP and CEA could be detected as low as 3 ng/mL and 2 ng/mL in 15 min with a sample volume of 80 μL, and no obvious cross-reactivity was observed. The immunosensor was validated with 130 clinical samples and in which it exhibited high sensitivity (93% for AFP and 87% for CEA) and specificity (94% for AFP and 97% for CEA). The immunosensor also demonstrated high recoveries (87.5-113% for AFP and 90-97.3% for CEA) and low relative standard deviations (RSDs) (2.8-6.2% for AFP and 4.9-9.6% for CEA) when testing spiked human serum. This novel multicolor QDs based ICTS provides an easy and rapid, simultaneous quantitative detecting strategy for point-of-care testing of tumor markers. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Procalcitonin, interleukin 6 and systemic inflammatory response syndrome (SIRS): early markers of postoperative sepsis after major surgery.

    Science.gov (United States)

    Mokart, D; Merlin, M; Sannini, A; Brun, J P; Delpero, J R; Houvenaeghel, G; Moutardier, V; Blache, J L

    2005-06-01

    Patients who undergo major surgery for cancer are at high risk of postoperative sepsis. Early markers of septic complications would be useful for diagnosis and therapeutic management in patients with postoperative sepsis. The aim of this study was to investigate the association between early (first postoperative day) changes in interleukin 6 (IL-6), procalcitonin (PCT) and C-reactive protein (CRP) serum concentrations and the occurrence of subsequent septic complications after major surgery. Serial blood samples were collected from 50 consecutive patients for determination of IL-6, PCT and CRP serum levels. Blood samples were obtained on the morning of surgery and on the morning of the first postoperative day. Sixteen patients developed septic complications during the first five postoperative days (group 1), and 34 patients developed no septic complications (group 2). On day 1, PCT and IL-6 levels were significantly higher in group 1 (P-values of 0.003 and 0.006, respectively) but CRP levels were similar. An IL-6 cut-off point set at 310 pg ml(-1) yielded a sensitivity of 90% and a specificity of 58% to differentiate group 1 patients from group 2 patients. When associated with the occurrence of SIRS on day 1 these values reached 100% and 79%, respectively. A PCT cut-off point set at 1.1 ng ml(-1) yielded a sensitivity of 81% and a specificity of 72%. When associated with the occurrence of SIRS on day 1, these values reached 100% and 86%, respectively. PCT and IL-6 appear to be early markers of subsequent postoperative sepsis in patients undergoing major surgery for cancer. These findings could allow identification of postoperative septic complications.

  16. Kick Detection at the Bit: Early Detection via Low Cost Monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Tost, Brian [National Energy Technology Lab. (NETL), Albany, OR (United States). Oak Ridge Inst. for Science and Education (ORISE); Rose, Kelly [National Energy Technology Lab. (NETL), Albany, OR (United States); Aminzadeh, Fred [Univ. of Southern California, Los Angeles, CA (United States). Dept. of Petroleum Engineering; Ante, Magdalene A. [Univ. of Southern California, Los Angeles, CA (United States). Dept. of Petroleum Engineering; Huerta, Nicolas [National Energy Technology Lab. (NETL), Albany, OR (United States)

    2016-06-07

    Formation fluid influxes (i.e. kicks) pose persistent challenges and operational costs during drilling operations. Implications of kicks range in scale but cumulatively result in substantial costs that affect drilling safety, environment, schedule, and infrastructure. Early kick detection presents a low-cost, easily adopted solution for avoiding well control challenges associated with kicks near the bit. Borehole geophysical tools used during the drilling process as part of the logging-while-drilling (LWD) and measurement-while-drilling (MWD) provide the advantage of offering real-time downhole data. LWD/MWD collect data on both the annulus and borehole wall. The annular data are normally treated as background, and are filtered out to isolate the formation measurements. Because kicks will change the local physical properties of annular fluids, bottom-hole measurements are among the first indicators that a formation fluid has invaded the wellbore. This report describes and validates a technique for using the annular portion of LWD/MWD data to facilitate early kick detection using first order principles. The detection technique leverages data from standard and cost-effective technologies that are typically implemented during well drilling, such as MWD/LWD data in combination with mud-pulse telemetry for data transmission.

  17. [Early loss of heterozygosity on chromosome arm 16q in flat epithelial atypia of the breast. Detection by microsatellite analyses].

    Science.gov (United States)

    Schmidt, H; Dahrenmöller, C; Agelepoulos, K; Hungermann, D; Böcker, W

    2008-11-01

    With the improvement of breast carcinoma screening, pre-malignant cell lesions such as flat epithelial atypia (FEA) are detected more frequently. Several studies have demonstrated that FEA show features of a ductal neoplasia, but is it really a precursor lesion? We have started a comparative genetic analysis of a panel of nine microsatellite markers on six different chromosomal regions to investigate whether FEAs show the same characteristic genetic alterations as ductal carcinomas in situ (DCISs) and invasive carcinoma of the breast. FEAs, DCISs and invasive carcinomas of the same patients were microdissected using PALM micro laser technology. DNA was isolated using the QIAamp DNA Micro Kit (QIAGEN). We have investigated a set of the polymorphic microsatellite markers D7S522, D8S522, NEFL, D10S541 (PTEN), D13S153 (RB1), D16S400, D16S402, D16S422 and D17S855 (BRCA1) using multiplex PCR for the detection of allelic imbalances. Most of the investigated FEAs showed a lower frequency of loss of heterozygosity than associated DCISs or invasive carcinomas. However, we were able to detect the same alterations in FEAs as in DCISs or invasive carcinomas in a number of cases. Notably, the microsatellite marker on 16q showed more prevalent allelic imbalances in FEAs than the other investigated markers. One of the hallmarks in the pathogenesis of a large subgroup of invasive breast carcinomas is the early loss of chromosome arm 16q. In this study, we were able to detect frequent genetic alterations on chromosome 16q in FEAs, associated DCISs and invasive carcinomas. This suggests that FEA is a precursor lesion in the low-grade pathway.

  18. Relation between cardiovascular disease risk markers and brain infarcts detected by magnetic resonance imaging in an elderly population.

    Science.gov (United States)

    Nylander, Ruta; Lind, Lars; Wikström, Johan; Lindahl, Bertil; Venge, Per; Larsson, Anders; Ärnlöv, Johan; Berglund, Lars; Ahlström, Håkan; Johansson, Lars; Larsson, Elna-Marie

    2015-02-01

    Established cardiovascular risk markers, such as hypertension, are associated with increased risk of brain infarcts. The newer markers N-terminal pro-brain natriuretic peptide, troponin I, C-reactive protein, and cystatin C may affect the risk of cardiovascular events and potentially, thereby, also stroke. We investigated the association between established and new risk markers for cardiovascular disease and brain infarcts detected by magnetic resonance imaging (MRI) at age 75. Four hundred six randomly selected subjects from the Prospective Investigation of the Vasculature in Uppsala Seniors study were examined with MRI of the brain at age 75. Blood samples, measurements, and dedicated questionnaires at age 70 were used for analysis of risk markers. A history of diseases had been obtained at age 70 and 75. MRI was evaluated regarding lacunar and cortical infarcts. Univariate associations between outcomes and risk markers were assessed with logistic regression models. One or more infarcts were seen in 23% of the subjects (20% had only lacunar infarcts, 1% had only cortical infarcts, and 2% had both). Hypertension (odds ratio [OR] 2.6, 95% confidence interval [CI] 1.4, 4.7) and obesity (OR 1.3; CI 1.0, 1.8) were significantly associated with increased risk of brain infarction. The newer risk markers were not significantly associated with the brain infarcts. The new markers were not associated with the predominantly lacunar infarcts in our 75-year-old population, why troponin I and NT-proBNP may be associated mainly with cardioembolic infarcts as shown recently. Copyright © 2015 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  19. Early markers of renal injury in predicting outcome in thermal burn patients

    Directory of Open Access Journals (Sweden)

    Sabry Alaa

    2009-01-01

    Full Text Available Acute renal failure (ARF is a well known complication of severe burn and is an important factor that can increase mortality. To determine the predictors of acute renal failure that occur in major burns, we studied 40 patients with moderate to severe thermal burn injury - second to third degree with > 20% of total body surface area. All patients were subjected to routine in-vestigations including: Serum creatinine, blood urea nitrogen, fractional excretion of sodium, uri-nary malondialdehyde and microalbuminuria on day 0, 3, 7, 14 and 21 of hospitalization. Nine patients (22.5 % developed acute renal failure; 4 patients required supportive dialysis. The group that de-veloped ARF showed an increase of markers of glomerular damage with appearance of micro-albuminuria on day 0 that reached 3 - 4 folds above its normal level on day 14 and remained constant with elevated serum creatinine and burn size in the 3 rd week of ARF, and progressed to overt proteinuria in 3 cases. Urinary malondialdehyde increased 3 folds above normal values before de-veloping acute renal failure, and gradually increased on day 14, which coincided with the increased of microalbuminuria. Two cases (22.2% in the ARF group who developed septicemia and required dialysis died on the 32 nd and 36 th days post-burn. Burn size and occurrence of septicemia were the only predictors of acute renal failure using multiple regression analysis (P value < 0.001 and < 0.0371, respectively. We conclude that acute renal failure complicates burn patients and is related to the size and depth of burn and occurrence of septicemia. Microalbuminuria and urinary malon-dialdehyde are useful markers for prediction of renal outcome in such group of patients.

  20. Detection of bacterial blight resistant gene xa5 using linked marker ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... Key words: Rice, xa5, bacterial blight, linked marker. INTRODUCTION ... be the only reliable method to control the disease. Investigations ... DNA extraction. Total genomic DNA was extracted using young leaves at seedling.

  1. Novel serological neo-epitope markers of extracellular matrix proteins for the detection of portal hypertension

    DEFF Research Database (Denmark)

    Leeming, Diana Julie; Karsdal, M A; Byrjalsen, I

    2013-01-01

    The hepatic venous pressure gradient (HVPG) is an invasive, but important diagnostic and prognostic marker in cirrhosis with portal hypertension (PHT). During cirrhosis, remodelling of fibrotic tissue by matrix metalloproteinases (MMPs) is a permanent process generating small fragments of degraded...

  2. Early detection of biochemically occult autonomous thyroid nodules.

    Science.gov (United States)

    Brusca, N; Virili, C; Cellini, M; Capriello, S; Gargano, L; Salvatori, R; Centanni, M; Santaguida, M G

    2016-12-01

    Autonomously functioning thyroid areas may be associated with subclinical or overt hyperthyroidism, but may exist even in the presence of normal TSH. This study was aimed at comparing the rate of autonomously functioning areas and their cardiac sequelae in patients with nodular goitre studied with the usual and a novel approach. In total 490 adult outpatients with thyroid nodular goitre, living in a mild iodine-deficient area, were selected in our referral centre for thyroid diseases from 2009 to 2014 on the basis of a suspicion of thyroid functional autonomy. They were divided in three groups according to a non-conventional approach (excessive response to thyroxine treatment: group 1) or conventional approach (low/normal TSH with clinical suspicion or low TSH: groups 2 and 3). All patients of the study with the suspicion of thyroid functional autonomy underwent thyroid scan with radioactive iodine (I(131)) uptake (RAIU). The percentage of confirmed thyroid functional autonomy was 319/490, being significantly higher in group 3 than in groups 1 and 2 (81.5 vs 64.7 vs 52.6%; chi-square P < 0.0001). However, the diagnosis with non-conventional approach was made at a significant earlier age (P < 0.0001). Cardiac arrhythmias as well as atrial fibrillation were similarly detected by conventional and non-conventional approaches (chi-square test: P = 0.2537; P = 0.8425). The hyper-responsiveness to thyroxine treatment should induce the suspicion of thyroid functional autonomy at an early stage, allowing to detect autonomous functioning areas in apparently euthyroid patients. © 2016 European Society of Endocrinology.

  3. Assessment of Urinary-5-Hydroxyindolacetic Acid as A Diagnostic Parameter in Early Detection of Acute Appendicitis

    Directory of Open Access Journals (Sweden)

    Zuhair B Kamal

    2017-04-01

    Full Text Available Background: Acute appendicitis is the most common abdominal surgical emergency especially in children and young adults. The diagnosis of appendicitis is difficult because half the cases are incorrectly identified. Serotonin was defined as a good diagnostic marker for many inflammations including appendicitis and it is metabolite into 5-hydroxyindolacetic acid (5-HIAA to be excreted in urine. 5-HIAA is suggested to be of diagnostic importance in the detection of this disease. The aim of this study was to evaluate the diagnostic importance of urinary-5-HIAA as an added parameter to Alvarado score. Methods: Seventy patients (35 females and 35 males with acute appendicitis (35 were mild and 35 severe-perforated and gangrenous were included in this study and 70 healthy individuals were taken as a control group. Urinary-5-HIAA was estimated in all patients and control group using ELISA method. Results: Sensitivity for the mild group is 94.2%, specificity 100% and diagnostic accuracy is 97.4%, while the sensitivity for the severe group is 37%. It was found that there is a highly significant difference between mild and control groups (P<0.05. The diagnostic accuracy for the mild group is 97.4% and for the severe is 68.5%. Conclusion: We conclude that urinary-5-HIAA is a high sensitive test for early detection of acute appendicitis.

  4. The evolving role of the dynamic thermal analysis in the early detection of breast cancer

    Science.gov (United States)

    Salhab, M; Al Sarakbi, W; Mokbel, K

    2005-01-01

    It is now recognised that the breast exhibits a circadian rhythm which reflects its physiology. There is increasing evidence that rhythms associated with malignant cells proliferation are largely non-circadian and that a circadian to ultradian shift may be a general correlation to neoplasia. Cancer development appears to generate its own thermal signatures and the complexity of these signatures may be a reflection of its degree of development. The limitations of mammography as a screening modality especially in young women with dense breasts necessitated the development of novel and more effective screening strategies with a high sensitivity and specificity. Dynamic thermal analysis of the breast is a safe, non invasive approach that seems to be sensitive for the early detection of breast cancer. This article focuses on dynamic thermal analysis as an evolving method in breast cancer detection in pre-menopausal women with dense breast tissue. Prospective multi-centre trials are required to validate this promising modality in screening. The issue of false positives require further investigation using molecular genetic markers of malignancy and novel techniques such as mammary ductoscopy. PMID:15819982

  5. Early Neural Markers of Implicit Attitudes: N170 Modulated by Intergroup and Evaluative Contexts in IAT

    Directory of Open Access Journals (Sweden)

    Agustin eIbanez

    2010-10-01

    Full Text Available The Implicit Association Test (IAT is the most popular measure to evaluate implicit attitudes. Nevertheless, its neural correlates are not yet fully understood. We examined event related potentials (ERPs in response to face- and word- processing while indigenous and non-indigenous participants performed an IAT displaying faces (ingroup and outgroup members and words (positive and negative valence as targets of category judgments. The N170 component was modulated by valence of words and by ingroup/outgroup face categorization. Contextual effects (face-words implicitly associated in the task had an influence on the N170 amplitude modulation. On the one hand, in face categorization, right N170 showed differences according to the association between social categories of faces and affective valence of words. On the other, in word categorization, left N170 presented a similar modulation when the task implied a negative valence associated with ingroup faces. Only indigenous participants showed a significant IAT effect and N170 differences. Our results demonstrate an early ERP blending of stimuli processing with both intergroup and evaluative contexts, suggesting an integration of contextual information related to intergroup attitudes during the early stages of word and face processing. To our knowledge, this is the first report of early ERPs during an ethnicity IAT, opening a new branch of exchange between social neuroscience and social psychology of attitudes.

  6. Effect of α-lipoic acid combined with conventional therapy on serum markers of early diabetic nephropathy patients

    Institute of Scientific and Technical Information of China (English)

    Xin-Dong Jin; Xiang-Dong Liu; Xi-Ping Niu

    2015-01-01

    Objective: To study the effect ofα-lipoic acid combined with conventional therapy on serum markers of early diabetic nephropathy patients.Methods: Patients with early diabetic nephropathy treated in our hospital from May 2012 to May 2014 were chosen for study and randomly divided into two groups. Lipoic acid group received α-lipoic acid combined with conventional drug therapy; conventional group received conventional drug therapy. Then renal function, oxidative stress, podocyte injury degree, mitochondrial fusion and fission protein contents of both groups were compared.Results:(1) renal function and oxidative stress indicators: serum CysC, RBP, 8-OHdG, NT, MDA and F2-aisoprostanes contents of lipoic acid group showed a decreasing trend; (2) podocyte injury indicators: serum Nephrin, Podocin, Desmin and CD2AP contents of lipoic acid group showed a significantly increasing trend; (3) mitochondrial indicators: serum Mfs1, Mfs2 and Opa1 contents of lipoic acid group significantly increased; Fis1, Mff and GDAP1 contents significantly decreased.Conclusion:α-lipoic acid combined with conventional therapy is helpful to improve renal function, relieve oxidative stress and protect podocyte structure and mitochondrial function; it’s an ideal method in treating early diabetic nephropathy.

  7. Early detection and management of pulmonary arterial hypertension

    Directory of Open Access Journals (Sweden)

    Marc Humbert

    2012-12-01

    Full Text Available The long-term prognosis for patients with pulmonary arterial hypertension (PAH remains poor, despite advances in treatment options that have been made in the past few decades. Recent evidence suggests that World Health Organization functional class I or II patients have significantly better long-term survival rates than patients in higher functional classes, thus providing a rationale for earlier diagnosis and treatment of PAH. However, early diagnosis is challenging and there is frequently a delay between symptom onset and diagnosis. Screening programmes play an important role in PAH detection and expert opinion favours echocardiographic screening of asymptomatic patients who may be predisposed to the development of PAH (i.e. those with systemic sclerosis or sickle cell disease, although current guidelines only recommend annual echocardiographic screening in symptomatic patients. This article reviews the currently available screening programmes, including their limitations, and describes alternative screening approaches that may identify more effectively those patients who require right heart catheterisation for a definitive PAH diagnosis.

  8. Marcadores eletrocardiográficos para detecção precoce de doença cardíaca em pacientes com talassemia beta maior Electrocardiographic markers for the early detection of cardiac disease in patients with beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Kemal Nisli

    2010-04-01

    Full Text Available OBJETIVO: Analisar comparativamente a dispersão da onda P (DOP em pacientes com talassemia beta maior (β-TM e indivíduos saudáveis (controles para a detecção precoce do risco de arritmias. MÉTODOS: Oitenta e uma crianças com β-TM, com idades entre 4 e 19 anos, e 74 crianças saudáveis (grupo controle foram submetidas a exame eletrocardiográfico e ecocardiograma transtorácico de rotina para avaliação cardíaca. A DOP foi calculada como a diferença entre as durações máxima e mínima da onda P. RESULTADOS: Houve uma diferença estatisticamente significativa entre o grupo de estudo e o grupo controle no pico de velocidade do fluxo transmitral no início da diástole (E e na razão E/fluxo transmitral tardio (A. A duração máxima da onda P e a DOP foram significativamente maiores nos pacientes com β-TM do que nos indivíduos controles. CONCLUSÕES: O aumento da DOP em nossos pacientes com β-TM pode estar relacionado à depressão na condução intra-atrial, devido à dilatação atrial, e ao aumento da atividade simpática. Estes pacientes devem ser acompanhados atentamente devido à possibilidade de ocorrência de arritmias com risco de vida.OBJECTIVE: To comparatively evaluate P-wave dispersion (PWD in patients with β-thalassemia major (TM and healthy control subjects for the early prediction of arrhythmia risk. METHODS: Eighty-one children with β-TM, aged 4-19 years, and 74 healthy children (control group underwent routine electrocardiography and transthoracic echocardiography for cardiac evaluation. PWD was calculated as the difference between the maximum and the minimum P-wave duration. RESULTS: There was a statistically significant difference between study and control groups in peak early (E mitral inflow velocity and E/late (A velocity ratio. Maximum P-wave duration and PWD were found to be significantly higher in β-TM patients than in control subjects. CONCLUSIONS: Increased PWD in our β-TM patients might be related

  9. [Detection of an NA gene molecular marker in H7N9 subtype avian influenza viruses by pyrosequencing].

    Science.gov (United States)

    Zhao, Yong-Gang; Liu, Hua-Lei; Wang, Jing-Jing; Zheng, Dong-Xia; Zhao, Yun-Ling; Ge, Sheng-Qiang; Wang, Zhi-Liang

    2014-07-01

    This study aimed to establish a method for the detection and identification of H7N9 avian influenza viruses based on the NA gene by pyrosequencing. According to the published NA gene sequences of the avian influenza A (H7N9) virus, a 15-nt deletion was found in the NA gene of H7N9 avian influenza viruses. The 15-nt deletion of the NA gene was targeted as the molecular marker for the rapid detection and identification of H7N9 avian influenza viruses by pyrosequencing. Three H7N9 avian influenza virus isolates underwent pyrosequencing using the same assay, and were proven to have the same 15-nt deletion. Pyrosequencing technology based on the NA gene molecular marker can be used to identify H7N9 avian influenza viruses.

  10. Education concerning carcinoma of prostate and its early detection

    Science.gov (United States)

    Jędrzejewska, Sylwia

    2011-01-01

    Introduction and objectives Prostate cancer is the most common male cancer. Insufficient knowledge of PCa among men causes its low detection. Lack of essential actions in health education and widely understood prophylaxis, the need of the latter are maybe responsible for the increasing mortality rate. According to our assumption, educating men increase their awareness on the need of screening tests and results in increasing reporting to physical examinations. This in turn allows for an early detection of the disease. Material and methods A research was conducted between the years 2003-2009 on the knowledge of PCa among 260 men. They were divided into two groups. Group A – 63 patients treated for carcinoma of prostate and group B – 197 men reporting spontaneously to screening tests. In order to check the adopted hypothesis, we prepared an educational material and test of knowledge – test with a questionnaire. Knowledge was evaluated before (test I) and after the education process (test II). Until 2009, we were monitoring the number of patients from group B reporting to screening tests and their knowledge was once again checked (test III). Two subgroups C and D were created from group B – 117 healthy men and 80 with diagnosed diseases respectively (70 with benign prostatic hyperplasia, 7 with prostatitis, and 3 with carcinoma of prostate). Patients with prostatitis and PCa and 3 patients from group C not reporting to the tests were excluded from further monitoring. Maths statistics with the use of SPSS 12.0 PL program and Statistica 6.0 constituted the base for working out the results. Results We observed a higher knowledge about carcinoma of prostate in group A than in group B (p 40 from groups C and D were interested in health care (p70 a lower level of motivation was observed. The interest was proportional to the level of education, and this was differentiating in an analogical way the motivation to extend knowledge about prostate cancer (pmotivation for

  11. Human Neutrophil Peptides 1-3 – Early Markers in Development of Colorectal Adenomas and Carcinomas

    Science.gov (United States)

    Mothes, Henning; Melle, Christian; Ernst, Günther; Kaufmann, Roland; von Eggeling, Ferdinand; Settmacher, Utz

    2008-01-01

    Expression of Human Neutrophil Peptides (HNP) 1–3 was recently found to be associated with development of colorectal cancer. Raised defensin-expression in tumours is believed to stem from increased infiltration of neutrophils into tumour environment. To further specify the role of α-defensins in tumourigenesis and progression, HNP1–3 were analyzed in colorectal adenomas and carcinomas of 87 patients and quantified in relation to cancer stage and grading. Using the ProteinChip arrays, HNP1–3 were found upregulated in both colorectal adenomas and carcinomas. By combining the array with Laser capture microscopy we were able to confirm that HNP1–3 are expressed by tumour cells but not by neutrophils or other tumour invading cells. These findings suggest that α-defensins are more likely to contribute to tumour growth than they are to mount an effective host anti-tumour response. However, the amount of HNP-expression was not found to be related to tumour stage, grading, and serological tumour markers. PMID:18957723

  12. Diffusion imaging changes in grey matter in Alzheimer's disease: a potential marker of early neurodegeneration.

    Science.gov (United States)

    Weston, Philip S J; Simpson, Ivor J A; Ryan, Natalie S; Ourselin, Sebastien; Fox, Nick C

    2015-01-01

    Alzheimer's disease (AD) is recognized to have a long presymptomatic period, during which there is progressive accumulation of molecular pathology, followed by inexorable neuronal damage. The ability to identify presymptomatic individuals with evidence of neurodegenerative change, to stage their disease, and to track progressive changes will be important for early diagnosis and for prevention trials. Despite recent advances, particularly in magnetic resonance imaging, our ability to identify early neurodegenerative changes reliably is limited. The development of diffusion-weighted magnetic resonance imaging, which is sensitive to microstructural changes not visible with conventional volumetric techniques, has led to a number of diffusion imaging studies in AD; these have largely focused on white matter changes. However, in AD cerebral grey matter is affected very early, with pathological studies suggesting that grey matter changes predate those in white matter. In this article we review the growing number of studies that assess grey matter diffusivity changes in AD. Although use of the technique is still at a relatively early stage, results so far have been promising. Initial studies identified changes in diffusion measures in the hippocampi of patients with mild cognitive impairment, which predated macroscopic volume loss, with positive predictive value for progression to AD dementia. More recent studies have identified abnormalities in multiple neocortical areas (particularly the posterior cingulate) at various stages of disease progression. Studies of patients who carry genetic mutations predisposing to autosomal dominant familial AD have shown cortical and subcortical grey matter diffusivity changes several years before the expected onset of the first clinical symptoms. The technique is not without potential methodological difficulties, especially relating to partial volume effects, although recent advances appear to be reducing such issues. Going forward

  13. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers.

    Directory of Open Access Journals (Sweden)

    Abiye Shenkut Abebe

    Full Text Available This study aimed at investigating the genetic diversity, relationship and population structure of 110 local Swedish chickens derived from five breeds (Gotlandshöna, Hedemorahöna, Öländsk dvärghöna, Skånsk blommehöna, and Bohuslän- Dals svarthöna, in the rest of the paper the shorter name Svarthöna is used using 24 microsatellite markers. In total, one hundred thirteen alleles were detected in all populations, with a mean of 4.7 alleles per locus. For the five chicken breeds, the observed and expected heterozygosity ranged from 0.225 to 0.408 and from 0.231 to 0.515, with the lowest scores for the Svarthöna and the highest scores for the Skånsk blommehöna breeds, respectively. Similarly, the average within breed molecular kinship varied from 0.496 to 0.745, showing high coancestry, with Skånsk blommehöna having the lowest and Svarthöna the highest coancestry. Furthermore, all breeds showed significant deviations from Hardy-Weinberg expectations. Across the five breeds, the global heterozygosity deficit (FIT was 0.545, population differentiation index (FST was 0.440, and the global inbreeding of individuals within breed (FIS was 0.187. The phylogenetic relationships of chickens were examined using neighbor-joining trees constructed at the level of breeds and individual samples. The neighbor-joining tree constructed at breed level revealed two main clusters, with Hedemorahöna and Öländsk dvärghöna breeds in one cluster, and Gotlandshöna and Svarthöna breeds in the second cluster leaving the Skånsk blommehöna in the middle. Based on the results of the STRUCTURE analysis, the most likely number of clustering of the five breeds was at K = 4, with Hedemorahöna, Gotlandshöna and Svarthöna breeds forming their own distinct clusters, while Öländsk dvärghöna and Skånsk blommehöna breeds clustered together. Losses in the overall genetic diversity of local Swedish chickens due to breeds extinction varied from -1.46% to -6

  14. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers.

    Science.gov (United States)

    Abebe, Abiye Shenkut; Mikko, Sofia; Johansson, Anna M

    2015-01-01

    This study aimed at investigating the genetic diversity, relationship and population structure of 110 local Swedish chickens derived from five breeds (Gotlandshöna, Hedemorahöna, Öländsk dvärghöna, Skånsk blommehöna, and Bohuslän- Dals svarthöna, in the rest of the paper the shorter name Svarthöna is used) using 24 microsatellite markers. In total, one hundred thirteen alleles were detected in all populations, with a mean of 4.7 alleles per locus. For the five chicken breeds, the observed and expected heterozygosity ranged from 0.225 to 0.408 and from 0.231 to 0.515, with the lowest scores for the Svarthöna and the highest scores for the Skånsk blommehöna breeds, respectively. Similarly, the average within breed molecular kinship varied from 0.496 to 0.745, showing high coancestry, with Skånsk blommehöna having the lowest and Svarthöna the highest coancestry. Furthermore, all breeds showed significant deviations from Hardy-Weinberg expectations. Across the five breeds, the global heterozygosity deficit (FIT) was 0.545, population differentiation index (FST) was 0.440, and the global inbreeding of individuals within breed (FIS) was 0.187. The phylogenetic relationships of chickens were examined using neighbor-joining trees constructed at the level of breeds and individual samples. The neighbor-joining tree constructed at breed level revealed two main clusters, with Hedemorahöna and Öländsk dvärghöna breeds in one cluster, and Gotlandshöna and Svarthöna breeds in the second cluster leaving the Skånsk blommehöna in the middle. Based on the results of the STRUCTURE analysis, the most likely number of clustering of the five breeds was at K = 4, with Hedemorahöna, Gotlandshöna and Svarthöna breeds forming their own distinct clusters, while Öländsk dvärghöna and Skånsk blommehöna breeds clustered together. Losses in the overall genetic diversity of local Swedish chickens due to breeds extinction varied from -1.46% to -6.723%. The results

  15. Quantum dots and microfluidic single-molecule detection for screening genetic and epigenetic cancer markers in clinical samples

    Science.gov (United States)

    Wang, Tza-Huei; Bailey, Vasudev; Liu, Kelvin

    2011-06-01

    Genomic analysis of biomarkers, including genetic markers such as point mutations and epigenetic markers such as DNA methylation, has become a central theme in modern disease diagnosis and prognosis. Recently there is an increasing interest in using single-molecule detection (SMD) for genomic detection. The driving force not only comes from its ultrahigh sensitivity that can allow the detection of low-abundance nucleic acids with reduced or without the need of amplification but also from its potential in achieving high-accuracy quantification of rare targets via singlemolecule sorting. The unique photophysical properties of semiconductor quantum dots (QDs) have made them ideal for use as spectral labels and luminescent probes. QDs also make excellent donors to pair with organic dyes in the fluorescence resonance energy transfer (FRET) process due to the features of narrow emission spectra and small Stokes shift. We have developed highly sensitive, quantitative and clinically relevant technologies for analysis of genomic markers based on the convergence of SMD, microfluidic manipulations, and quantum dot fluorescence resonance energy transfer technology (QD-FRET). Extraordinary performances of these new technologies have been exemplified by analysis of a variety of biomarkers including point mutations, DNA integrity and DNA methylation in clinical samples.

  16. The impact of visual acuity on age-related differences in neural markers of early visual processing.

    Science.gov (United States)

    Daffner, Kirk R; Haring, Anna E; Alperin, Brittany R; Zhuravleva, Tatyana Y; Mott, Katherine K; Holcomb, Phillip J

    2013-02-15

    The extent to which age-related differences in neural markers of visual processing are influenced by changes in visual acuity has not been systematically investigated. Studies often indicate that their subjects had normal or corrected-to-normal vision, but the assessment of visual acuity seems to most frequently be based only on self-report. Consistent with prior research, to be included in the current study, subjects had to report normal or corrected-to-normal vision. Additionally, visual acuity was formally tested using a Snellen eye chart. Event-related potentials (ERPs) were studied in young adults (18-32years old), young-old adults (65-79years old), and old-old adults (80+ years old) while they performed a visual processing task involving selective attention to color. Age-related differences in the latency and amplitude of ERP markers of early visual processing, the posterior P1 and N1 components, were examined. All results were then re-analyzed after controlling for visual acuity. We found that visual acuity declined as a function of age. Accounting for visual acuity had an impact on whether older and younger adults differed significantly in the size and latency of the posterior P1 and N1 components. After controlling for visual acuity, age-related increases in P1 and N1 latency did not remain significant, and older adults were found to have a larger P1 amplitude than young adults. Our results suggest that until the relationship between age-associated differences in visual acuity and early ERPs is clearly established, investigators should be cautious when interpreting the meaning of their findings. Self-reports about visual acuity may be inaccurate, necessitating formal measures. Additional investigation is needed to help establish guidelines for future research, especially of very old adults.

  17. Early detection of tumor relapse/regrowth by consecutive minimal residual disease monitoring in high-risk neuroblastoma patients

    Science.gov (United States)

    Hirase, Satoshi; Saitoh, Atsuro; Hartomo, Tri Budi; Kozaki, Aiko; Yanai, Tomoko; Hasegawa, Daiichiro; Kawasaki, Keiichiro; Kosaka, Yoshiyuki; Matsuo, Masafumi; Yamamoto, Nobuyuki; Mori, Takeshi; Hayakawa, Akira; Iijima, Kazumoto; Nishio, Hisahide; Nishimura, Noriyuki

    2016-01-01

    Neuroblastoma is an aggressive pediatric tumor accounting for ~15% of cancer-associated mortalities in children. Despite the current intensive therapy, >50% of high-risk patients experience tumor relapse or regrowth caused by the activation of minimal residual disease (MRD). Although several MRD detection protocols using various reverse transcription-quantitative polymerase chain reaction (RT-qPCR) markers have been reported to evaluate the therapeutic response and disease status of neuroblastoma patients, their clinical significance remains elusive. The present study reports two high-risk neuroblastoma patients, whose MRD was consecutively monitored using 11 RT-qPCR markers (CHRNA3, CRMP1, DBH, DCX, DDC, GABRB3, GAP43, ISL1, KIF1A, PHOX2B and TH) during their course of treatment. The two patients initially responded to the induction therapy and reached MRD-negative status. The patients' MRD subsequently became positive with no elevation of their urinary homovanillic acid, urinary vanillylmandelic acid and serum neuron-specific enolase levels at 13 or 19 weeks prior to the clinical diagnosis of tumor relapse or regrowth. The present cases highlight the possibility of consecutive MRD monitoring using 11 markers to enable an early detection of tumor relapse or regrowth in high-risk neuroblastoma patients. PMID:27446404

  18. [DNA-technologies application for early detection of caries predisposition].

    Science.gov (United States)

    Gorbunova, I L

    2006-01-01

    In the paper the possible use of modern DNA-technologies for estimation of gene pool, dental hard tissue resistance to caries prognosis, hereditary predisposition to the main oral diseases diagnosis are presented. Application potentialities of DNA-markers for multiple testing in population are identified. Today very little information is available concerning Russia gene pool characteristics in genome polymorphism, DNA-markers-allelic gene variants, related to the caries predisposition. These characteristics are needed to solve the problems concerning dental diseases prophylaxis and treatment.

  19. Tackling the 'dyslexia paradox': reading brain and behavior for early markers of developmental dyslexiax.

    Science.gov (United States)

    Ozernov-Palchik, Ola; Gaab, Nadine

    2016-01-01

    Developmental dyslexia is an unexplained inability to acquire accurate or fluent reading that affects approximately 5-17% of children. Dyslexia is associated with structural and functional alterations in various brain regions that support reading. Neuroimaging studies in infants and pre-reading children suggest that these alterations predate reading instruction and reading failure, supporting the hypothesis that variant function in dyslexia susceptibility genes lead to atypical neural migration and/or axonal growth during early, most likely in utero, brain development. Yet, dyslexia is typically not diagnosed until a child has failed to learn to read as expected (usually in second grade or later). There is emerging evidence that neuroimaging measures, when combined with key behavioral measures, can enhance the accuracy of identification of dyslexia risk in pre-reading children but its sensitivity, specificity, and cost-efficiency is still unclear. Early identification of dyslexia risk carries important implications for dyslexia remediation and the amelioration of the psychosocial consequences commonly associated with reading failure.

  20. Tackling the ‘dyslexia paradox’: reading brain and behavior for early markers of developmental dyslexia

    Science.gov (United States)

    Ozernov-Palchik, Ola; Gaab, Nadine

    2016-01-01

    Developmental dyslexia is an unexplained inability to acquire accurate or fluent reading that affects approximately 5–17% of children. Dyslexia is associated with structural and functional alterations in various brain regions that support reading. Neuroimaging studies in infants and pre-reading children suggest that these alterations predate reading instruction and reading failure, supporting the hypothesis that variant function in dyslexia susceptibility genes lead to atypical neural migration and/or axonal growth during early, most likely in utero, brain development. Yet, dyslexia is typically not diagnosed until a child has failed to learn to read as expected (usually in second grade or later). There is emerging evidence that neuroimaging measures, when combined with key behavioral measures, can enhance the accuracy of identification of dyslexia risk in prereading children but its sensitivity, specificity, and cost-efficiency is still unclear. Early identification of dyslexia risk carries important implications for dyslexia remediation and the amelioration of the psychosocial consequences commonly associated with reading failure. PMID:26836227

  1. Biomarkers for Early Detection a nd Screening in Pancreatic Cancer Highlights from the “45 th ASCO Annual Meeting”. Orlando, FL, USA. May 29 - June 2, 2009

    Directory of Open Access Journals (Sweden)

    Christopher J Hoimes

    2009-07-01

    Full Text Available Pancreatic cancer is the second most frequent gastrointestinal malignancy with an unabated mortality that reflects the advanced stage of presentation. Detection of early disease through screening likely is the best way to meaningfully prolong survival. The development of biomarkers for screening holds enormous promise for increasing early detection and impacting mortality. Many biomarkers have been studied including the serum protein carbohydrate antigen 19-9, vascular endothelial growth factor, and nuclear factor kappa B, however, still no blood test or other fluid analysis reliably predicts patients with disease. The authors review abstracts from the 2009 annual meeting of the American Society of Clinical Oncology, Orlando, FL, U.S.A., that report evidence for early detection using a salivary biomarker array (#4630; a mucin epitope to PAM4 (#4613; a plasma nucleotide marker of hypoxia, miR-210 (#4624; and a cleavage product of complement pathway component C3b, iC3b (#4626. The meeting featured pancreatic cancer in over 100 research abstracts, of which, four are reviewed that focus on potential markers for early detection. When applied to a population of high risk patients, biomarkers of early pancreatic cancer could provide a minimally invasive way of identifying patients that require further evaluation using endoscopic tools. These molecular beacons may even be found to be sufficiently sensitive, specific, and cost effective to be applied to a broader population of patients.

  2. Epigenetic-genetic chromosome dosage approach for fetal trisomy 21 detection using an autosomal genetic reference marker.

    Directory of Open Access Journals (Sweden)

    Yu K Tong

    Full Text Available BACKGROUND: The putative promoter of the holocarboxylase synthetase (HLCS gene on chromosome 21 is hypermethylated in placental tissues and could be detected as a fetal-specific DNA marker in maternal plasma. Detection of fetal trisomy 21 (T21 has been demonstrated by an epigenetic-genetic chromosome dosage approach where the amount of hypermethylated HLCS in maternal plasma is normalized using a fetal genetic marker on the Y chromosome as a chromosome dosage reference marker. We explore if this method can be applied on both male and female fetuses with the use of a paternally-inherited fetal single nucleotide polymorphism (SNP allele on a reference chromosome for chromosome dosage normalization. METHODOLOGY: We quantified hypermethylated HLCS molecules using methylation-sensitive restriction endonuclease digestion followed by real-time or digital PCR analyses. For chromosome dosage analysis, we compared the amount of digestion-resistant HLCS to that of a SNP allele (rs6636, a C/G SNP that the fetus has inherited from the father but absent in the pregnant mother. PRINCIPAL FINDINGS: Using a fetal-specific SNP allele on a reference chromosome, we analyzed 20 euploid and nine T21 placental tissue samples. All samples with the fetal-specific C allele were correctly classified. One sample from each of the euploid and T21 groups were misclassified when the fetal-specific G allele was used as the reference marker. We then analyzed 33 euploid and 14 T21 maternal plasma samples. All but one sample from each of the euploid and T21 groups were correctly classified using the fetal-specific C allele, while correct classification was achieved for all samples using the fetal-specific G allele as the reference marker. CONCLUSIONS: As a proof-of-concept study, we have demonstrated that the epigenetic-genetic chromosome dosage approach can be applied to the prenatal diagnosis of trisomy 21 for both male and female fetuses.

  3. Comprehensive Population-Specific Marker Panel for Early Prostate Cancer Diagnostics and Risk Assessment

    Science.gov (United States)

    2014-08-01

    classes, and wrote manuscripts and grants. For the research part, we hypothesized that a combination panel (DETECT) of genetic biomechanical, socio...cultural and lifestyle population specific biomarkers and factors will provided a valuable PCa screening and risk assessment tool. The PI genotyped 528...significantly associated with prostate cancer risk associated with one of the SNPs in African American men was found in obese men only; if was not

  4. Evaluation of left ventricular enlargement as a marker of early disease in familial dilated cardiomyopathy.

    Science.gov (United States)

    Fatkin, Diane; Yeoh, Thomas; Hayward, Christopher S; Benson, Victoria; Sheu, Angela; Richmond, Zara; Feneley, Michael P; Keogh, Anne M; Macdonald, Peter S

    2011-08-01

    Echocardiographic screening of families with dilated cardiomyopathy has identified a subgroup of asymptomatic relatives with left ventricular enlargement (LVE). The prognostic significance of LVE in this setting is incompletely understood. We evaluated 457 asymptomatic relatives in 128 dilated cardiomyopathy families and identified 110 individuals (24%) with LVE. Serial echocardiograms in 72 untreated LVE relatives showed that 9 individuals (13%) had development of dilated cardiomyopathy over 10 to 152 months (median, 52). Thirty LVE relatives and 30 age- and sex-matched healthy control subjects were evaluated using 2-dimensional and M-mode echocardiography, tissue Doppler imaging, noninvasive pressure-volume assessment, exercise stress echocardiography, and brain natriuretic peptide levels. LVE relatives showed mild defects of systolic and diastolic LV function, with normal filling pressures and exercise-induced increments in systolic contraction in most cases. LV dimensions and fractional shortening most effectively differentiated LVE relatives from control subjects, with other functional indices lacking additive discriminative value. In a receiver operating characteristics analysis, the area under the curve for LV end-diastolic diameter (% predicted) was 0.96 (P116% or LV end-diastolic diameter (% predicted) 112% to 116%+fractional shortening ≤29% had high sensitivity (100%) and specificity (93%) for LVE relatives and identified 8 of 9 progressors. LVE is a common finding in asymptomatic relatives in dilated cardiomyopathy families and can be a marker of preclinical cardiomyopathy. Assessment of LV size and contractile function is required for differentiating between pathological and physiological causes of LVE and may help to identify those at risk of disease progression.

  5. Early reduced liver graft survival in hepatitis C recipients identified by two combined genetic markers.

    Science.gov (United States)

    Romagnoli, Renato; Martini, Silvia; Tandoi, Francesco; Dell Olio, Dominic; Magistroni, Paola; Bertinetto, Francesca E; Dametto, Ennia; Rizzetto, Mario; Salizzoni, Mauro; Amoroso, Antonio

    2016-10-01

    HLA and IL-28B genes were independently associated with severity of HCV-related liver disease. We investigated the effects of these combined genetic factors on post-transplant survival in HCV-infected recipients, aiming to provide new data to define the optimal timing of novel antiviral therapies in the transplant setting. HLA-A/B/DRB1 alleles and IL-28B rs12979860 (C > T) polymorphism frequencies were determined in 449 HCV viremic recipients and in their donors. Median follow-up was 10 years; study outcome was graft survival. HLA-DRB1*11 phenotype and IL-28B C/C genotype were significantly less frequent in recipients than donors (27.8% vs. 45.9% and 27.4% vs. 44.9%, respectively, P C/C (P = 0.0436). Conversely, concomitant absence of HLA-DRB1*11 and IL-28B C/C in 228 (50.8%) predicted worse survival (P = 0.0006), which was already evident at the first post-transplant year (P = 0.0370). In multivariable Cox analysis, absence of both markers ranked second as risk factor for survival (HR = 1.74), following donor age ≥ 70 years (HR = 1.77). In the current era of direct-acting antiviral agents, the negative effects of this common immunogenetic profile in HCV-infected recipients could be most effectively neutralized by peri-transplant treatment. This should be particularly relevant in countries where elderly donors represent an unavoidable resource.

  6. Detecting RAPD Markers Linked to Ripe Rot Resistance Genes in Chinese Wild Vitis

    Institute of Scientific and Technical Information of China (English)

    WANG Yue-jin; XU Yan; ZHANG Jian-xia; ZHOU Peng; WAN Yi-zhen

    2002-01-01

    With F1 individuals of the cross combination 88-110 of 83-4-96 ( V. quinquangularis Rehd. )× Muscat Rose ( V. vinifera L. ), the RAPD marker OPC15-1300 linked to ripe rot ( Gloeosporium fruetigenum Berk. ) resistance genes in Chinese wild Vitis was gained using bulked segregation analysis(BSA). And it was found that OPC15-1300 could be hereditary from the resistant parent (83-4-96) after the marker was tested in 50 F1 plants of the cross combination 88-110, 32 accessions of 8 Chinese wild Vitis species and 14cultivars of V. vinifera L. Also, it has provided a solid basis for molecular marker-assisted selection (MAS)and for possibly cloning disease resistance genes in the future.

  7. Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease

    Directory of Open Access Journals (Sweden)

    McDonald Jacob

    2011-08-01

    Full Text Available Abstract Background Increasing evidence links diverse forms of air pollution to neuroinflammation and neuropathology in both human and animal models, but the effects of long-term exposures are poorly understood. Objective We explored the central nervous system consequences of subchronic exposure to diesel exhaust (DE and addressed the minimum levels necessary to elicit neuroinflammation and markers of early neuropathology. Methods Male Fischer 344 rats were exposed to DE (992, 311, 100, 35 and 0 μg PM/m3 by inhalation over 6 months. Results DE exposure resulted in elevated levels of TNFα at high concentrations in all regions tested, with the exception of the cerebellum. The midbrain region was the most sensitive, where exposures as low as 100 μg PM/m3 significantly increased brain TNFα levels. However, this sensitivity to DE was not conferred to all markers of neuroinflammation, as the midbrain showed no increase in IL-6 expression at any concentration tested, an increase in IL-1β at only high concentrations, and a decrease in MIP-1α expression, supporting that compensatory mechanisms may occur with subchronic exposure. Aβ42 levels were the highest in the frontal lobe of mice exposed to 992 μg PM/m3 and tau [pS199] levels were elevated at the higher DE concentrations (992 and 311 μg PM/m3 in both the temporal lobe and frontal lobe, indicating that proteins linked to preclinical Alzheimer's disease were affected. α Synuclein levels were elevated in the midbrain in response to the 992 μg PM/m3 exposure, supporting that air pollution may be associated with early Parkinson's disease-like pathology. Conclusions Together, the data support that the midbrain may be more sensitive to the neuroinflammatory effects of subchronic air pollution exposure. However, the DE-induced elevation of proteins associated with neurodegenerative diseases was limited to only the higher exposures, suggesting that air pollution-induced neuroinflammation may

  8. The DNA-instability test as a specific marker of malignancy and its application to detect cancer clones in borderline malignancy

    Directory of Open Access Journals (Sweden)

    M Fukuda

    2009-06-01

    Full Text Available Recent progress in cytogenetic and biochemical mutator assay technologies has enabled us to detect single gene alterations and gross chromosomal rearrangements, and it became clear that all cancer cells are genetically unstable. In order to detect the genome-wide instability of cancer cells, a new simple method, the DNA-instability test, was developed. The methods to detect genomic instability so far reported have only demonstrated the presence of qualitative and quantitative alterations in certain specific genomic loci. In contrast to these commonly used methods to reveal the genomic instability at certain specific DNA regions, the newly introduced DNA-instability test revealed the presence of physical DNA-instability in the entire DNA molecule of a cancer cell nucleus as revealed by increased liability to denature upon HCl hydrolysis or formamide exposure. When this test was applied to borderline malignancies, cancer clones were detected in all cases at an early-stage of cancer progression. We proposed a new concept of “procancer” clones to define those cancer clones with “functional atypia” showing positivities for various cancer markers, as well as DNA-instability testing, but showing no remarkable ordinary “morphological atypia” which is commonly used as the basis of histopathological diagnosis of malignancy.

  9. DEK: A novel early screening and prognostic marker for breast cancer.

    Science.gov (United States)

    Ying, Guo; Wu, Yonghui

    2015-11-01

    The present study aimed to investigate the expression status and clinical implications of DEK in breast cancer, in order to contribute to developments in breast cancer management. DEK expression status was detected in 628 breast cancer specimens by western blot analysis and immunohistochemistry staining, and the correlation between DEK protein and clinico‑pathological parameters and prognosis of breast cancer was subsequently determined. In comparison to para-carcinoma tissues, DEK protein was highly expressed in breast cancer specimens and was correlated with chemotherapy resistance. In total, 61.94% (389/628) of breast cancer cases exhibited high expression of DEK. According to universal analysis, it was observed that age, tumor size, histological grade, metastatic nodes and distant metastasis (P=0.024, 0.001, 0.001, 0.001 and 0.001 respectively) are key factors associated with DEK. Furthermore, compared with samples with no or low DEK protein expression, high DEK expression resulted in a significantly increased distant metastasis rate and poor disease‑specific survival (P=0.001). In addition, DEK protein was detected as an independent prognostic factor (P=0.001) in the Cox regression analysis. DEK was correlated with chemotherapy resistance and may be an independent prognostic factor for breast cancer, as well as a potential therapeutic target.

  10. Acute Septal Panniculitis. A Cutaneous Marker of a Very Early Stage of Pancreatic Panniculitis Indicating Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Surendran E

    2005-07-01

    Full Text Available CONTEXT: Pancreatitis may occasionally be complicated by panniculitis as a result of the release of pancreatic enzymes. Pancreatic panniculitis is rare, occurring in 2-3% of all patients with pancreatic disorders, with a higher incidence among alcoholic males. CASE REPORT: A 29-year-old male was admitted to our Department with acute abdominal pain one day following alcohol consumption. On physical examination, tender erythematous plaques and nodules were present on the left ankle and the pretibial regions of both lower legs, a clinical sign of panniculitis indicating acute pancreatitis common in alcoholic patients. Abdominal ultrasonography showed a diffusely edematous pancreas suggestive of acute pancreatitis. Abdominal contrast enhanced computerized tomography revealed features suggestive of severe acute pancreatitis with pancreatic necrosis. A skin biopsy confirmed the diagnosis of septal panniculitis without vasculitis or fat necrosis, which is indicative of a very early stage of pancreatic panniculitis suggesting acute alcoholic pancreatitis. CONCLUSION: Septal panniculitis without vasculitis or fat necrosis is a cutaneous clinical marker which denotes a very early stage of pancreatic panniculitis associated with acute alcoholic pancreatitis. The treatment of pancreatic panniculitis is primarily supportive and depends on the underlying pancreatic pathology which may include surgery or endoscopic management.

  11. Flow cytometric detection of some activation and proliferation markers in human hematopoietic cell lines.

    Science.gov (United States)

    Glasová, M; Koníková, E; Kusenda, J; Babusíková, O

    1996-01-01

    Simultaneous surface marker/DNA, cytoplasmic/DNA or nuclear/DNA staining was used to study proliferation of hematopoietic cell lines (MOLT4, BJAB, P3HR1). Different fixation/permeabilization methods (paraformaldehyde with metanol or Tween 20 or saponin, buffered formaldehyde-acetone) were used providing optimal results of the double stainings. There was a significant increase of S phase and proliferation index (PI) of CD71+ and Ki67+ MOLT4 cells in comparison with their negative counterparts. This indicates their close connection with proliferation. Unlike that, the correlation between the expression of CD38 and S phase or PI was not significant either in MOLT4 or in P3HRI cells. For cytoplasmic markers CD3 (in MOLT4 cells) and CD22 (in BJAB cells) statistically significant (cCD3) and not significant (cCD22) correlation was demonstrated between their expression and S phase or PI. Molecular equivalents of soluble fluorescein values for CD71 were always higher than for CD38. The density of these cell surface markers in addition to the percentage of their expression is of considerable significance for their evaluation as activation or proliferation markers.

  12. Cytogenetic and molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background.

    Science.gov (United States)

    Gong, Wenping; Li, Guangrong; Zhou, Jianping; Li, Genying; Liu, Cheng; Huang, Chengyan; Zhao, Zhendong; Yang, Zujun

    2014-09-01

    Aegilops uniaristata has many agronomically useful traits that can be used for wheat breeding. So far, a Triticum turgidum - Ae. uniaristata amphiploid and one set of Chinese Spring (CS) - Ae. uniaristata addition lines have been produced. To guide Ae. uniaristata chromatin transformation from these lines into cultivated wheat through chromosome engineering, reliable cytogenetic and molecular markers specific for Ae. uniaristata chromosomes need to be developed. Standard C-banding shows that C-bands mainly exist in the centromeric regions of Ae. uniaristata but rarely at the distal ends. Fluorescence in situ hybridization (FISH) using (GAA)8 as a probe showed that the hybridization signal of chromosomes 1N-7N are different, thus (GAA)8 can be used to identify all Ae. uniaristata chromosomes in wheat background simultaneously. Moreover, a total of 42 molecular markers specific for Ae. uniaristata chromosomes were developed by screening expressed sequence tag - sequence tagged site (EST-STS), expressed sequence tag - simple sequence repeat (EST-SSR), and PCR-based landmark unique gene (PLUG) primers. The markers were subsequently localized using the CS - Ae. uniaristata addition lines and different wheat cultivars as controls. The cytogenetic and molecular markers developed herein will be helpful for screening and identifying wheat - Ae. uniaristata progeny.

  13. Detection of Autoantibodies to Vascular Endothelial Growth Factor Receptor-3 in Bile Duct Ligated Rats and Correlations with a Panel of Traditional Markers of Liver Diseases

    Directory of Open Access Journals (Sweden)

    Florent Duval

    2016-01-01

    Full Text Available There is a need for new noninvasive biomarkers (NIBMs able to assess cholestasis and fibrosis in chronic cholestatic liver diseases (CCLDs. Tumorigenesis can arise from CCLDs. Therefore, autoantibodies to tumor-associated antigens (TAA may be early produced in response to abnormal self-antigen expression caused by cholestatic injury. Vascular endothelial growth factor receptor-3 (VEGFR-3 has TAA potential since it is involved in cholangiocytes and lymphatic vessels proliferations during CCLDs. This study aims to detect autoantibodies directed at VEGFR-3 during bile duct ligation- (BDL- induced cholestatic injury in rat sera and investigate whether they could be associated with traditional markers of liver damage, cholestasis, and fibrosis. An ELISA was performed to detect anti-VEGFR-3 autoantibodies in sera of rats with different degree of liver injury and results were correlated with aminotransferases, total bilirubin, and the relative fibrotic area. Mean absorbances of anti-VEGFR-3 autoantibodies were significantly increased from week one to week five after BDL. The highest correlation was observed with total bilirubin (R2 = 0.8450, P=3.04e-12. In conclusion, anti-VEGFR-3 autoantibodies are early produced during BDL-induced cholestatic injury, and they are closely related to cholestasis, suggesting the potential of anti-VEGFR-3 autoantibodies as NIBMs of cholestasis in CCLDs and justifying the need for further investigations in patients with CCLD.

  14. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    Science.gov (United States)

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for Advancement of Cytometry.

  15. Serum anti-Ku86 is a potential biomarker for early detection of hepatitis C virus-related hepatocellular carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Nomura, Fumio, E-mail: fnomura@faculty.chiba-u.jp [Department of Molecular Diagnosis, Graduate School of Medicine, Chiba University and Divisions of Laboratory Medicine, Clinical Genetics and Proteomics, Chiba University Hospital, Chiba (Japan); Sogawa, Kazuyuki; Noda, Kenta; Seimiya, Masanori; Matsushita, Kazuyuki; Miura, Toshihide [Department of Molecular Diagnosis, Graduate School of Medicine, Chiba University and Divisions of Laboratory Medicine, Clinical Genetics and Proteomics, Chiba University Hospital, Chiba (Japan); Tomonaga, Takeshi [Laboratory of Proteome Research, National Institute of Biomedical Innovation, Ibaraki (Japan); Yoshitomi, Hideyuki [Department of General Surgery, Graduate School of Medicine, Chiba University, Chiba (Japan); Imazeki, Fumio [Department of Medicine and Clinical Oncology, Graduate School of Medicine, Chiba University, Chiba (Japan); Takizawa, Hirotaka [Kashiwado Clinic in Port-Square of the Kashiwado Memorial Foundation, Chiba (Japan); Mogushi, Kaoru [Information Center for Medical Sciences, Tokyo Dental and Medical University, Tokyo (Japan); Miyazaki, Masaru [Department of General Surgery, Graduate School of Medicine, Chiba University, Chiba (Japan); Yokosuka, Osamu [Department of Medicine and Clinical Oncology, Graduate School of Medicine, Chiba University, Chiba (Japan)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer Overexpression of Ku86 in human liver cancer was shown by immunohistochemistry. Black-Right-Pointing-Pointer Serum anti-Ku86 was significantly elevated in early hepatocellular carcinoma. Black-Right-Pointing-Pointer Anti-Ku86 may be more sensitive than the conventional markers for early detection. Black-Right-Pointing-Pointer Serum anti-Ku86 significantly decreased after surgical resection of liver tumors. Black-Right-Pointing-Pointer Elevation of serum anti-Ku86 in other non-liver solid tumors was minimal. -- Abstract: Hepatocellular carcinoma (HCC), the predominant form of primary liver cancer, is one of the most common cancers worldwide and the third most common cause of cancer-related death. Imaging studies including ultrasound and computed tomography are recommended for early detection of HCC, but they are operator dependent, costly and involve radiation. Therefore, there is a need for simple and sensitive serum markers for the early detection of hepatocellular carcinoma (HCC). In our recent proteomic studies, a number of proteins overexpressed in HCC tissues were identified. We thought if the serum autoantibodies to these overexpressed proteins were detectable in HCC patients. Of these proteins, we focused on Ku86, a nuclear protein involved in multiple biological processes and aimed to assess the diagnostic value of serum anti-Ku86 in the early detection of HCC. Serum samples were obtained prior to treatment from 58 consecutive patients with early or relatively early hepatitis C virus (HCV)-related HCC and 137 patients with HCV-related liver cirrhosis without evidence of HCC. Enzyme immunoassays were used to measure serum levels of autoantibodies. Serum levels of anti-Ku86 antibodies were significantly elevated in HCC patients compared to those in liver cirrhosis patients (0.41 {+-} 0.28 vs. 0.18 {+-} 0.08 Abs at 450 nm, P < 0001). Setting the cut-off level to give 90% specificity, anti-Ku86 was positive in 60.7% of

  16. A novel microsatellite DNA marker at locus D7S1870 detects hemizygosity in 75% of patients with Williams syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert-Dussardier, B. [Hopital des Enfants-Malades, Paris (France)]|[Hopital Dupuytren, Limoges (France); Bonneau, D. [Hopital des Enfants-Malades, Paris (France)]|[Hopital Jean Bernard, Poitiers (France); Gigarel, N.; Le Merrer, M.; Bonnet, D.; Lyonnet, S.; Munnich, A. [Hopital des Enfants-Malades, Paris (France); Philip, N.; Mattei, M.G. [Hopital de La Timone, Marseille (France)] [and others

    1995-02-01

    Williams syndrome (WS) is a predominantly sporadic developmental disorder characterized by dysmorphic facial features, infantile hypercalcemia, premature aging of skin, mental retardation and gregarious personality. Supravalvular aortic stenosis (SVAS) and other vascular diseases caused by the narrowing of large elastic arteries are present in almost 80% of cases. Recently, hemizygosity at the elastin locus has been shown in sporadic WS, suggesting that this disease is caused by deletions encompassing the elastin gene on chromosome 7q11.23. Taking advantage of a large series of sporadic WS (27 cases), we have explored the potential application of novel microsatellite DNA markers in the rapid detection of hemizygosity in WS. We report here a highly informative marker at locus D7S1870, which detected failure of parental inheritance in almost 75% of cases of WS in our series. This marker can be regarded therefore as a reliable and useful diagnostic tool in suspected cases of WS as well as in complicated forms of supravalvular aortic stenosis. 10 refs., 2 figs.

  17. The Progression and Early detection of Subclinical Atherosclerosis (PESA) study

    DEFF Research Database (Denmark)

    Fernández-Ortiz, Antonio; Jiménez-Borreguero, L Jesús; Peñalvo, José L

    2013-01-01

    The presence of subclinical atherosclerosis is a likely predictor of cardiovascular events; however, factors associated with the early stages and progression of atherosclerosis are poorly defined.......The presence of subclinical atherosclerosis is a likely predictor of cardiovascular events; however, factors associated with the early stages and progression of atherosclerosis are poorly defined....

  18. Directly detecting the evolution of early-type galaxies

    NARCIS (Netherlands)

    Trager, Scott; Faber, SM; Dressler, A; Renzini, A; Bender, R

    2005-01-01

    We describe observations focused on understanding the epochs and timescales of the formation and evolution of early-type galaxies, particularly those in clusters. We show that while early-type cluster galaxies are on average older and closer to coeval than their counterparts in the field, significan

  19. Early Detection of Breast Cancer Using Molecular Beacons

    Science.gov (United States)

    2008-01-01

    exfoliated cells in body fluids is more quantitative than that detected in cancer cells on frozen tissue sections because most cells in tissue sections...the MB and QD detections are more specific and sensitive than cytological method in detecting breast cancer cells. The proposed study will also...Lewis) for the presence of benign, atypical or malignant cells. We will then compare the results of the MB and QD detection with cytological findings

  20. Molecular biomarker set for early detection of ovarian cancer

    KAUST Repository

    Bajic, Vladimir B.

    2015-06-16

    Embodiments of the present invention concern methods and compositions related to detection of ovarian cancer, including detection of the stage of ovarian cancer, in some cases. In particular, the invention encompasses use of expression of TFAP2A and in some embodiments CA125 and/or E2F5 to identify ovarian cancer, including detecting mRNA and/or protein levels of the respective gene products. Kits for detection of ovarian cancer are also described.

  1. Long-term follow-up of the TIPS early detection in psychosis study

    DEFF Research Database (Denmark)

    Hegelstad, Wenche Ten Velden; Larsen, Tor K; Auestad, Bjørn

    2012-01-01

    Early detection in first-episode psychosis confers advantages for negative, cognitive, and depressive symptoms after 1, 2, and 5 years, but longitudinal effects are unknown. The authors investigated the differences in symptoms and recovery after 10 years between regional health care sectors...... with and without a comprehensive program for the early detection of psychosis....

  2. Overview of Early Detection and Treatment Strategies for Suicidal Behavior in Young People.

    Science.gov (United States)

    Blumenthal, Susan J.; Kupfer, David J.

    1988-01-01

    A new approach to early detection and intervention for the prevention of youth suicide is presented. The approach integrates a proposed model of risk factors with a multithreshold level of early detection. Psychiatric diagnosis, personality traits, psychosocial factors, life events and chronic medical illness, biological factors, and family…

  3. Monitoring of lipoxygenase-related plant emission for early detection of drought stress in greenhouse

    NARCIS (Netherlands)

    Takayama, K.; Jansen, R.M.C.; Verstappen, F.W.A.; Bouwmeester, H.J.

    2008-01-01

    Early detection of plant stress is a key to effective plant management for crop production. Drought stress is a common abiotic stress in crop production and early detection of drought stress allows us to improve water usage effi ciency and crop quality by demandbased irrigation. This study demonstra

  4. Genetic Diversity and Evolutionary Tendency Detected by Isozyme, RFLP and RAPD Markers in the Wild and Cultivated Soybean in China

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A large numbers of samples of wild soybean accessions and cultivated soybean landraces from various areas in China were analyzed by isozyrme, cytoplasmic DNA RFLP and nuclear DNA RAPD markers in order to reveal their genetic diversity. Greater comprehensive genetic diversity was detected in wild soybean than in cultivated soybean. The genetic plentifulness and the genetic dispersion of wild soybean were 180 (95. 2%) and 0. 2891 while those of cultivated soybean were 154(81.5%) and 0. 2091,respectively. On the most loci, especially on isozyme loci Idh1, Aph, Idh2,and Dia, cytoplasmic DNA RFLP loci cp Ⅰ , cp Ⅲ, mt Ⅳ a and mt Ⅳ b, and nuclear RAPD loci OPAP4-8, OPAP5-1, OPAP9-8 and OPAP20-8, the wild soybeans djffered remarkably from the cultivated ones in allele frequency. These markers could be used in further study on the evolution and origin of the cultivated soybean.

  5. Genetic Diversity and Evolutionary Tendency Detected by Isozyme, RFLP and RAPD Markers in the Wild and Cultivated Soybean in China

    Institute of Scientific and Technical Information of China (English)

    Xu Donghe; Gao Zhong; Gai Junyi; Zhang Zhiyong; Chen Shouyi; Fukushi Hirofurm; Kitajirma Shunji; Abe Jun; Shimamoto Yoshiya

    2000-01-01

    A large numbers of samples of wild soybean accessions and cultivated soybean landraces from various areas in China were analyzed by isozyrme, cytoplasmic DNA RFLP and nuclear DNA RAPD markers in order to reveal their genetic diversity. Greater comprehensive genetic diversity was detected in wild soybean than in cultivated soybean. The genetic plentifulness and the genetic dispersion of wild soybean were 180 (95. 2%) and 0. 2891 while those of cultivated soybean were 154(81.5%) and 0. 2091,respectively. On the most loci, especially on isozyme loci Idh1, Aph, Idh2,and Dia, cytoplasmic DNA RFLP loci cp Ⅰ , cp Ⅲ, mt Ⅳ a and mt Ⅳ b, and nuclear RAPD loci OPAP4-8, OPAP5-1, OPAP9-8 and OPAP20-8, the wild soybeans djffered remarkably from the cultivated ones in allele frequency. These markers could be used in further study on the evolution and origin of the cultivated soybean.

  6. Bulked Segregant Analysis to Detect QTL Related to Heat Tolerance in Rice(Oryza sativa L.)Using SSR Markers

    Institute of Scientific and Technical Information of China (English)

    ZHANG Gui-lian; CHEN Li-yun; XIAO Guo-ying; XIAO Ying-hui; CHEN Xin-bo; ZHANG Shun-tang

    2009-01-01

    The study was undertaken to assess the genetic effect of quantitative trait loci(QTLs)conferring heat tolerance at flowering stage in rice.A population consisting of 279 F2 individuals from the cross between 996,a heat tolerant cultivar and 4628,a heat-sensitive cultivar,was analyzed for their segregation pattern of the difference of seed set rate under optimal temperature condition and high temperature condition.The difference of seed set rate under optimal temperature condition and high temperature condition showed normal distribution,indicating the polygenic control over the trait.To identify main effect of QTL for heat tolerance,the parents were surveyed with 200 primer pairs of simple sequence repeats(SSR).The parental survey revealed 30% polymorphism between parents.In order to detect the main QTL association with heat tolerance,a strategy of combining the DNA pooling from selected segregants and genotyping was adopted.The association of putative markers identified based on DNA pooling from selected segregants was established by single marker analysis(SMA).The results of SMA revealed that SSR markers,RM3735 on chromosome 4 and RM3586 on chromosome 3 showed significant association with heat tolerance respectively.accounted for 17 and 3% of the total variation respectively.The heat tolerance during flowering stage in rice was controlled by multiple gene.The SSR markers,RM3735 on chromosome 4 and RM3586 on chromosome 3 showed significant association with heat tolerance respectively,accounted for 17 and 3% of the total variation respectively.The two genetic loci,especially for RM3735 on chromosome 4,can be used in marker-assistant-selected method in heat tolerance breeding in rice.

  7. The importance of early detection of lip cancer risk groups

    Science.gov (United States)

    Fratila, M.; Rosu, S.

    2014-03-01

    in frequency as well as in the therapeutic problems raised. In the face and oral cavity cancer catagory, lip represents 2% of all cases and 19-25% of the total facial cancer area. Lip cancer is one of the localizations that, when detected early, can benefit from an effective therapy with high chances of healing. In order to achieve a complex treatment, interdisciplinary collaboration is required, only thus being able to determine both the therapeutic methods as well as their association.

  8. ROLE OF ELECTROPHYSIOLOGY IN EARLY DETECTION OF HEA RING IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Sree Devi

    2013-05-01

    Full Text Available ABSTRACT: In the present study about 72 children with complai nts of hearing impairment attending the Outpatient department of Government Ear, Nose a nd Throat Hospital were taken up. These children were chosen randomly and were followed up from consultation stage till the final diagnosis after completion of all the tests. The age range of children was from 1 year to 7 years. 43 Children were males and 29 children were females. All the ch ildren attended the Government E.N.T. Hospital for evaluation and further evaluations were done at the Hearing Aid Centre. Most of the children were from poor socio-economic status (White Ration Card Holders. Average time taken for each child ranged from 60 minutes to 120 minutes since t he physiological tests have to be done for the children under sedation as they are not co-operativ e. The Aims and Objectives of this study are 1. Early detection of hearing impairment in children h as been the main aim of this study. Children of age groups, ranging from 1 – 7 years with a complaint o f hearing impairment are taken up for this study. Main emphasis being on sensori-neural hearing loss with or without speech impairment, cases of external and middle ear conditions are excluded.2. Assessment of the type and degree of hearing loss and knowing probable site of pathology by conductin g a battery of tests- PTA (pure tone audiometry, FFA(Free field Audiometry, Impedance Audiometry, OAE(otoacoustic emissions, and BERA(Brain stem Evoked Response Audiometry.3. Know ing efficacy and accuracy of Electrophysiological tests in children who are othe rwise uncooperative or cannot understand and follow the subjective tests. 4. Comparing the resul ts of Electrophysiological tests and subjective tes ts. 5. Analyzing the data in terms of gender, etiology, type of hearing loss etc. With the advent of the advanced electrophysiological tests of hearing like BERA, OAE, Electrocochleography and Auditory Steady State Response audiometry

  9. Development of Diagnostic Biomarkers for Detecting Diabetic Retinopathy at Early Stages Using Quantitative Proteomics

    Directory of Open Access Journals (Sweden)

    Jonghwa Jin

    2016-01-01

    Full Text Available Diabetic retinopathy (DR is a common microvascular complication caused by diabetes mellitus (DM and is a leading cause of vision impairment and loss among adults. Here, we performed a comprehensive proteomic analysis to discover biomarkers for DR. First, to identify biomarker candidates that are specifically expressed in human vitreous, we performed data-mining on both previously published DR-related studies and our experimental data; 96 proteins were then selected. To confirm and validate the selected biomarker candidates, candidates were selected, confirmed, and validated using plasma from diabetic patients without DR (No DR and diabetics with mild or moderate nonproliferative diabetic retinopathy (Mi or Mo NPDR using semiquantitative multiple reaction monitoring (SQ-MRM and stable-isotope dilution multiple reaction monitoring (SID-MRM. Additionally, we performed a multiplex assay using 15 biomarker candidates identified in the SID-MRM analysis, which resulted in merged AUC values of 0.99 (No DR versus Mo NPDR and 0.93 (No DR versus Mi and Mo NPDR. Although further validation with a larger sample size is needed, the 4-protein marker panel (APO4, C7, CLU, and ITIH2 could represent a useful multibiomarker model for detecting the early stages of DR.

  10. Stepwise Application of Urine Markers to Detect Tumor Recurrence in Patients Undergoing Surveillance for Non-Muscle-Invasive Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Tilman Todenhöfer

    2014-01-01

    Full Text Available Background. The optimal use of urine markers in the surveillance of non-muscle-invasive bladder cancer (NMIBC remains unclear. Aim of the present study was to investigate the combined and stepwise use of the four most broadly available urine markers to detect tumor recurrence in patients undergoing surveillance of NMIBC. Patients and Methods. 483 patients with history of NMIBC were included. Cytology, UroVysion, fluorescence in situ hybridization (FISH, immunocytology (uCyt+, and NMP22 ELISA were performed before surveillance cystoscopy. Characteristics of single tests and combinations were assessed by contingency analysis. Results. 128 (26.5% patients had evidence of tumor recurrence. Sensitivities and negative predictive values (NPVs of the single tests ranged between 66.4–74.3 and 82.3–88.2%. Two-marker combinations showed sensitivities and NPVs of 80.5–89.8 and 89.5–91.2%. A stepwise application of the two-test combinations with highest accuracy (cytology and FISH; cytology and uCyt+; uCyt+ and FISH showed NPVs for high-risk recurrences (G3/Cis/pT1 of 98.8, 98.8, and 99.1%, respectively. Conclusions. Combinations of cytology, FISH, immunocytology, and NMP22 show remarkable detection rates for recurrent NMIBC. Stepwise two-test combinations of cytology, FISH, and immunocytology have a low probability of missing a high-risk tumor. The high sensitivities may justify the use of these combinations in prospective studies assessing the use of urine markers to individualize intervals between cystoscopies during follow-up.

  11. Early alterations in vascular contractility associated to changes in fatty acid composition and oxidative stress markers in perivascular adipose tissue

    Directory of Open Access Journals (Sweden)

    Rimorini Laura

    2010-10-01

    Full Text Available Abstract Aim To test the early effect of fructose-induced changes in fatty acid composition and oxidative stress markers in perivascular adipose tissue (PVAT upon vascular contractility. Methods Adult male Wistar rats were fed a commercial diet without (CD or with 10% fructose (FRD in the drinking water for 3 weeks. We measured plasma metabolic parameters, lipid composition and oxidative stress markers in aortic PVAT. Vascular contractility was measured in aortic rings sequentially, stimulated with serotonin (5-HT and high K+-induced depolarization using intact and thereafter PVAT-deprived rings. Results Comparable body weights were recorded in both groups. FRD rats had increased plasma triglyceride and fructosamine levels. Their PVAT had an increased saturated to mono- or poly-unsaturated fatty acid ratio, a significant decrease in total superoxide dismutase and glutathione peroxidase activities and in the total content of glutathione. Conversely, lipid peroxidation (TBARS, nitric oxide content, and gluthathione reductase activity were significantly higher, indicating an increase in oxidative stress. In aortic rings, removal of PVAT increased serotonin-induced contractions, but the effect was significantly lower in rings from FRD rats. This effect was no longer observed when the two contractions were performed in PVAT-deprived rings. PVAT did not affect the contractions triggered by high K+-induced depolarization either in CD or FRD rats. Conclusions FRD induces multiple metabolic and endocrine systemic alterations which also alter PVAT and the vascular relaxant properties of this tissue. The changes in PVAT would affect its paracrine modulation of vascular function.

  12. Dogs with Cognitive Dysfunction as a Spontaneous Model for Early Alzheimer's Disease: A Translational Study of Neuropathological and Inflammatory Markers.

    Science.gov (United States)

    Schütt, Trine; Helboe, Lone; Pedersen, Lars Østergaard; Waldemar, Gunhild; Berendt, Mette; Pedersen, Jan Torleif

    2016-03-15

    Aged companion dogs with canine cognitive dysfunction (CCD) spontaneously develop varying degrees of progressive cognitive decline and particular neuropathological features correspondent to the changes associated with Alzheimer's disease (AD) in humans. The aim of the present study was to characterize certain aspects of neuropathology and inflammatory markers related to aging and CCD in dogs in comparison with human AD. Fifteen brains from aged dogs with normal cognitive function, mild cognitive impairment, or CCD were investigated and compared with two control brains from young dogs and brain sections from human AD subjects. The neuropathological investigations included evaluation of amyloid-β (Aβ) plaque deposition (N-terminally truncated and pyroglutamyl-modified Aβ included), tau pathology, and inflammatory markers in prefrontal cortex. Cortical Aβ deposition was found to be only of the diffuse subtype as no dense-core or neuritic plaques were found. The Aβ deposition followed a progressive pattern in four maturation stages. Accumulation of the Aβ peptide was also observed in the vessel walls. Both immunohistochemically and biochemically measured levels of Aβ pathology in prefrontal cortex showed a consistent positive correlation to age but not to cognitive deficit severity. No evidence of neurofibrillary tau pathology was found. The level of pro-inflammatory cytokines was generally low and showed no significant association to cognitive status. The findings of the present study support the senescent dog with spontaneous cognitive dysfunction as a valuable non-transgenic model for further investigations of the molecular events involved in the neurodegenerative processes associated with aging and early stage AD, especially the Aβ-related pathology.

  13. Early detection and intervention in psychosis: an ethical paradigm shift.

    Science.gov (United States)

    McGlashan, Thomas H

    2005-08-01

    This paper will first posit the rationale for intervention before onset, then outline the current usual practice of treating schizophrenia and the determinants of that practice. Recent developments that permit or demand a change in this practice will then be elaborated. The article concludes with an elaboration of the currently known risks and benefits of early intervention research. The ethics of early intervention are undergoing a paradigm shift, a shift that supports early intervention research as being necessary to bring empirical balance to territory that is currently overpopulated with zealous opinions.

  14. Molecular markers detect stable genomic regions underlying tomato fruit shelf life and weight

    Directory of Open Access Journals (Sweden)

    Guillermo Raúl Pratta

    2011-01-01

    Full Text Available Incorporating wild germplasm such as S. pimpinellifolium is an alternative strategy to prolong tomato fruit shelf life(SL without reducing fruit quality. A set of recombinant inbred lines with discrepant values of SL and weight (FW were derived byantagonistic-divergent selection from an interspecific cross. The general objective of this research was to evaluate Genotype x Year(GY and Marker x Year (MY interaction in these new genetic materials for both traits. Genotype and year principal effects and GYinteraction were statistically significant for SL. Genotype and year principal effects were significant for FW but GY interaction wasnot. The marker principal effect was significant for SL and FW but both year principal effect and MY interaction were not significant.Though SL was highly influenced by year conditions, some genome regions appeared to maintain a stable effect across years ofevaluation. Fruit weight, instead, was more independent of year effect.

  15. Development of microsatellite markers and detection of genetic variation between Goniozus wasp populations.

    Science.gov (United States)

    Khidr, Sahand K; Hardy, Ian C W; Zaviezo, Tania; Mayes, Sean

    2014-03-20

    Molecular genetic markers reveal differences between genotypes according to the presence of alleles (the same or different) at target loci. Microsatellite markers are especially useful co-dominant markers that have been used in a wide range of studies to elucidate the population structure and dynamics of a range of organisms, including agriculturally beneficial insects such as parasitic wasps (parasitoids). In the present study, twelve primer pairs were designed for the south Asian , Goniozus nephantidis (Muesebeck) (Hymenoptera: Bethylidae), and 24 for its New World congener, Goniozus legneri Gordh, parasitoids of the larvae of the lepidopteran coconut pest Opisina arenosella Walker (Lepidoptera: Crytophasidae) and other lepidopteran pests, respectively, in order to investigate polymorphism within and between populations. The wasps fingerprinted were a total of 85 G. nephantidis and G. legneri, including individuals belonging to three putatively different strains of G. legneri. Annealing gradient tests (50-65°C) were conducted to study the quality of the PCR amplification across an annealing temperature gradient using a mixed genotype DNA template from each species separately. Seven primer pairs, which amplified clear products of approximately the expected size of G. nephantidis and 18 of G. legneri, were then selected for capillary analysis for fragment size determination on a Beckmann CEQ 8000. Neither G. nephantidis nor G. legneri were polymorphic within populations. However, there were six primer pairs that did show polymorphism between G. legneri populations that originated from different geographical areas within South America (Uruguay and Chile). Furthermore, one primer pair revealed diversity between the two strains collected within Chile. One of the markers was subsequently used to provide unbiased assessment of primary sex ratio in G. legneri.

  16. Diagnostic Accuracy and Confidence in the Clinical Detection of Cognitive Impairment in Early-Stage Parkinson Disease.

    Science.gov (United States)

    Wyman-Chick, Kathryn A; Martin, Phillip K; Barrett, Matthew J; Manning, Carol A; Sperling, Scott A

    2017-05-01

    Mild cognitive impairment (MCI) is present in up to 34% of patients with early-stage Parkinson disease (PD); however, it is difficult to detect subtle impairment without objective cognitive testing. Data were obtained from the Parkinson Progression Marker Initiative. All 341 participants were administered the Montreal Cognitive Assessment (MoCA) and a brief neuropsychological battery. Participants were classified as PD-MCI if MoCA was <26 or if they scored ≥1 standard deviation below the normative mean in 2 or more domains, based upon established criteria. The sensitivity/specificity for the clinical detection of PD-MCI was determined. Overall accuracy for clinical detection of PD-MCI was 67.4%. Although clinical determination was highly specific (96.3%; 95% confidence interval [CI]: 0.92-0.98), sensitivity was poor (32.0%; 95% CI: 0.25-0.40). Identifying MCI in early-stage PD based on clinical interview alone appears to be insufficient. The inclusion of objective cognitive tests allowing for normative sample comparisons is needed to increase the detection of cognitive impairment in this population.

  17. Detection of circulating tumor cell-specific markers in breast cancer patients using the quantitative RT-PCR assay.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Kim, Sunghyun; Park, Sunyoung; Jung, Dongju; Park, Sangjung; Han, Hyunju; Sohn, JooHyuk; Kim, SeungIl; Lee, Hyeyoung

    2015-10-01

    Breast cancer is a highly prevalent disease among women worldwide. While the expression of certain proteins within breast cancer tumors is used to determine the prognosis and select therapies, additional markers need to be identified. Circulating tumor cells (CTCs) are constituent cells that have detached from a primary tumor to circulate in the bloodstream. CTCs are considered the main source of breast cancer metastases; therefore, detection of CTCs could be a promising diagnostic method for metastatic breast cancer. In this study, the CircleGen CTC RT-qDx assay was used to analyze the mRNA expression levels of six CTC-specific markers including EpCAM, CK19, HER2, Ki67, hTERT, and vimentin with a total of 692 peripheral whole blood samples from 221 breast cancer patients and 376 healthy individuals. This assay showed high specificity with multiple markers; none of the healthy controls were detected positive, whereas 21.7 and 14 % of breast cancer patients were positive for EpCAM and CK19, respectively. Of the 221 breast cancer patients, 84 (38 %), 46 (20.8 %), 83 (37.6 %), and 39 (17.6 %) were positively for HER2, Ki67, hTERT, and vimentin mRNA, respectively. Of the 84 patients who were HER2 positive, nine (4 %) were also positive for EpCAM, CK19, Ki67, hTERT, and vimentin. Of the 139 breast cancer patients who were HER2 negative, 65 (29.1 %) were negative for EpCAM, CK19, Ki67, hTERT, and vimentin. Furthermore, the EpCAM-positive population decreased from 21.5 to 8.3 % after completion of anti-tumor treatment (TP4). Similarly, the CK19, HER2, hTERT, and vimentin positives also decreased from 13.9 to 9.5 %, from 37.7 to 21.4 %, from 37.2 to 33.3 %, and from 17.5 to 14.3 %, respectively, after completion of anti-tumor treatment. In contrast, the Ki67 positives increased from 20.6 to 41.7 % after completion of anti-tumor treatment. mRNA overexpression of six CTC-specific markers was detected by the CircleGen CTC RT-qDx assay with high specificity, and the obtained m

  18. Intercostal Artery Laceration: Rare Complication of Thoracentesis and Role of Ultrasound in Early Detection

    Directory of Open Access Journals (Sweden)

    Wissam Mansour

    2017-01-01

    Full Text Available Hemothorax is a rare but potentially fatal postthoracentesis complication. Early clinical signs may be nonspecific resulting in diagnostic delay. A high index of suspicion is vital for early diagnosis and intervention to avoid further bleeding. Following procedure, early bedside ultrasound findings can be vital for early detection. We report a case of massive hemothorax in a 63-year-old male following therapeutic thoracentesis. Diagnosis was made following highly suggestive sonographic findings prompting thoracotomy and lacerated intercostal artery cauterization.

  19. Inflammatory markers and extent and progression of early atherosclerosis: Meta-analysis of individual-participant-data from 20 prospective studies of the PROG-IMT collaboration

    NARCIS (Netherlands)

    J. Willeit (Johann); S.G. Thompson (Simon G.); S. Agewall (Stefan); G. Bergstrom (Goran); H. Bickel (Horst); A. Catapano (Alberico); K.-L. Chien (Kuo-Liong); E. de Groot; J.P. Empana (Jean Philippe); T. Etgen (Thorleif); O.H. Franco (Oscar); B. Iglseder (Bernhard); S.H. Johnsen; M. Kavousi (Maryam); L. Lind (Lars); J. Liu (Jing); E.B. Mathiesen (Ellisiv); G.D. Norata (Giuseppe); M.H. Olsen (Michael H.); A. Papagianni (Aikaterini); H. Poppert (Holger); J.F. Price (Jackie F.); R.L. Sacco (Ralph); D. Yanez (David); D. Zhao (Dong); U. Schminke (Ulf); A. Bulbul (Alpaslan); J.F. Polak (Joseph F.); M. Sitzer (Matthias); A. Hofman (Albert); L. Grigore (Liliana); M. Dörr (Marcus); T.-C. Su (Ta-Chen); P. Ducimetiere (Pierre); W. Xie (Wuxiang); K. Ronkainen (Kimmo); S. Kiechl (Stefan); T. Rundek (Tatjana); C.M. Robertson (Christine M); B. Fagerberg (Bjorn); L. Bokemark (Lena); H. Steinmetz (helmuth); M.A. Ikram (Arfan); H. Völzke (Henry); H.-J. Lin (Hung-Ju); M. Plichart (Matthieu); T.-P. Tuomainen (Tomi-Pekka); M. Desvarieux (Moise); S. McLachlan (Stela); C. Schmidt (Caroline); J. Kauhanen (Jussi); J. Willeit (Johann); M.W. Lorenz (Matthias W.); D. Sander (Dirk)

    2016-01-01

    textabstractBackground Large-scale epidemiological evidence on the role of inflammation in early atherosclerosis, assessed by carotid ultrasound, is lacking. We aimed to quantify cross-sectional and longitudinal associations of inflammatory markers with common-carotid-artery intima-media thickness

  20. The Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial Etiologic and Early Marker Studies (EEMS), 2016 Winter Review Cycle Has New Website | Division of Cancer Prevention

    Science.gov (United States)

    The Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial Etiologic and Early Marker Studies (EEMS) has a new application process for specimen requests. Researchers planning to submit a grant application in response to the Funding Opportunity Announcement PAR-15-297 must use a new website to submit applications. |

  1. Detection of the Hematopoietic Stem and Progenitor Cell Marker CD133 during Angiogenesis in Three-Dimensional Collagen Gel Culture

    Directory of Open Access Journals (Sweden)

    Masumi Akita

    2013-01-01

    Full Text Available We detected the hematopoietic stem and progenitor cell marker CD133 using immunogold labeling during angiogenesis in a three-dimensional collagen gel culture. CD133-positive cells were present in capillary tubes newly formed from aortic explants in vitro. The CD133-positive cell population had the capacity to form capillary tubes. Lovastatin strongly inhibited cell migration from aortic explants and caused the degradation of the capillary tubes. The present study provides insight into the function of CD133 during angiogenesis as well as an explanation for the antiangiogenic effect of statins.

  2. Detected troponin elevation is associated with high early mortality after lung resection for cancer

    Directory of Open Access Journals (Sweden)

    Van Tornout Fillip

    2006-10-01

    Full Text Available Abstract Background Myocardial infarction can be difficult to diagnose after lung surgery. As recent diagnostic criteria emphasize serum cardiac markers (in particular serum troponin we set out to evaluate its clinical utility and to establish the long term prognostic impact of detected abnormal postoperative troponin levels after lung resection. Methods We studied a historic cohort of patients with primary lung cancer who underwent intended surgical resection. Patients were grouped according to known postoperative troponin status and survival calculated by Kaplan Meier method and compared using log rank. Parametric survival analysis was used to ascertain independent predictors of mortality. Results From 2001 to 2004, a total of 207 patients underwent lung resection for primary lung cancer of which 14 (7% were identified with elevated serum troponin levels within 30 days of surgery, with 9 (64% having classical features of myocardial infarction. The median time to follow up (interquartile range was 22 (1 to 52 months, and the one and five year survival probabilities (95% CI for patients without and with postoperative troponin elevation were 92% (85 to 96 versus 60% (31 to 80 and 61% (51 to 71 versus 18% (3 to 43 respectively (p T stage and postoperative troponin elevation remained independent predictors of mortality in the final multivariable model. The acceleration factor for death of elevated serum troponin after adjusting for tumour stage was 9.19 (95% CI 3.75 to 22.54. Conclusion Patients with detected serum troponin elevation are at high risk of early mortality with or without symptoms of myocardial infarction after lung resection.

  3. Combined sewer overflows to surface waters detected by the anthropogenic marker caffeine.

    Science.gov (United States)

    Buerge, Ignaz J; Poiger, Thomas; Müller, Markus D; Buser, Hans-Rudolf

    2006-07-01

    Continuous progress in wastewater treatment technology and the growing number of households connected to wastewater treatment plants (WWTPs) have generally resulted in decreased environmental loading of many pollutants. Nonetheless, further reduction of pollutant inputs is required to improve the quality of surface waters in densely populated areas. In this context, the relative contribution of combined sewer overflows as sources of wastewater-derived contaminants has attracted more and more attention, but the quantitative importance of these overflows has barely been investigated. In this study, caffeine was successfully used as a chemical marker to estimate the fraction of sewer overflows in the catchment area of lake Greifensee, Switzerland. Caffeine is a ubiquitous compound in raw, domestic wastewater with typical per capita loads of approximately 16 mg person(-1) d(-1). In WWTPs of the Greifensee region, caffeine is largely eliminated (>99%), resulting in much smaller loads of combined sewer overflows were the most likely source of caffeine. Using a mass balance approach, it was possible to determine the fraction of wastewater (in dry weather equivalents) discharged untreated to the receiving streams (up to 10%, annual mean, approximately 2-3%). The concept of caffeine as a marker for combined sewer overflows was then applied to estimate phosphorus inputs to Greifensee with untreated and treated wastewater (approximately 1.5 and 2.0 t P y(-1), respectively), which corresponded well with P inputs determined in a separate study based on hydraulic considerations. For compounds with high elimination in WWTPs such as phosphorus (96-98% in the Greifensee area), inputs from combined sewer overflows are thus of similar magnitude as inputs from treated wastewater. The study demonstrated that caffeine is a suitable marker for untreated wastewater (from combined sewer overflows, direct discharges, etc.), but its sensitivity depends on regional conditions and decreases

  4. Photonic crystal enhanced fluorescence for early breast cancer biomarker detection.

    Science.gov (United States)

    Cunningham, Brian T; Zangar, Richard C

    2012-08-01

    Photonic crystal surfaces offer a compelling platform for improving the sensitivity of surface-based fluorescent assays used in disease diagnostics. Through the complementary processes of photonic crystal enhanced excitation and enhanced extraction, a periodic dielectric-based nanostructured surface can simultaneously increase the electric field intensity experienced by surface-bound fluorophores and increase the collection efficiency of emitted fluorescent photons. Through the ability to inexpensively fabricate photonic crystal surfaces over substantial surface areas, they are amenable to single-use applications in biological sensing, such as disease biomarker detection in serum. In this review, we will describe the motivation for implementing high-sensitivity, multiplexed biomarker detection in the context of breast cancer diagnosis. We will summarize recent efforts to improve the detection limits of such assays though the use of photonic crystal surfaces. Reduction of detection limits is driven by low autofluorescent substrates for photonic crystal fabrication, and detection instruments that take advantage of their unique features.

  5. Early detection, early symptom progression and symptomatic remission after ten years in a first episode of psychosis study.

    Science.gov (United States)

    Ten Velden Hegelstad, Wenche; Haahr, Ulrik; Larsen, Tor K; Auestad, Bjørn; Barder, Helene; Evensen, Julie; Joa, Inge; Johannessen, Jan O; Langeveld, Johannes; Melle, Ingrid; Opjordsmoen, Stein; Rossberg, Jan Ivar; Rund, Bjørn Rishovd; Simonsen, Erik; Vaglum, Per; McGlashan, Thomas; Friis, Svein

    2013-02-01

    Poor symptom outcome remains a challenge in psychosis: At least 50% of first-episode patients continue to have positive and/or negative symptoms after ten years. To investigate rates, early predictors and early symptom progression of long-term non-remitted psychosis in an early detection study. Symptomatic remission according to new international criteria was assessed in 174 patients at ten-year follow-up. Remitted and non-remitted patients were compared on early symptom progression, and logistic regression was applied to predict non-remission. At ten years, 50% of patients were in symptomatic remission. Non-remission was predicted by positive symptoms at inclusion and during the first year of treatment. Of individual symptoms only hallucinations were significantly predictive of ten-year non-remission. Early symptom differences were not reflected by differences in treatment. Long-term symptomatic non-remission is associated with early positive symptoms. More assertive intervention may be needed in patients who do not respond robustly in the first year of treatment, whether or not they have been detected "early". Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Early detection of positive blood cultures by the acridine orange staining technique.

    OpenAIRE

    Tierney, B M; Henry, N K; Washington, J A

    1983-01-01

    Staining 2,205 macroscopically negative blood cultures with acridine orange after 6 to 17 h of inoculation and incubation was as sensitive as an early subculture in detecting positive blood cultures. Of the 179 positive blood cultures, 30 (16.8%) were detected by acridine orange alone, 19 (10.6%) were detected by early subculture alone, 84 (46.9%) were detected by both techniques, and 46 (25.7%) were not detected by either method. The latter group includes cultures that became positive after ...

  7. Influence of G308A polymorphism of tumor necrosis factor-alpha gene on inflammatory markers in postsurgical head and neck cancer patients with early enteral nutrition.

    Science.gov (United States)

    de Luis, Daniel Antonio; Sagrado, Manue Gonzalez; Vallejo, Luis Angel; Carcedo, Luis María Gil; Izaola, Olatz; Cuellar, Luis; Terroba, María Concepción; Aller, Rocío

    2007-01-01

    Although immune dysfunction in patients with cancer could be multifactorial, the immune system may be modulated by nutritional substrates and genetic background. Our study evaluated the effect of G308A polymorphism of the tumor necrosis factor-alpha (TNF-alpha) gene on inflammatory markers in patients after surgery for head and neck cancer who received early enteral nutrition. A population of 60 patients with oral and laryngeal cancer was enrolled. At surgery patients were treated with a hyperproteic enteral diet. Perioperatively and on postoperative day 6 the following parameters were evaluated: serum values of prealbumin, transferrin, total number of lymphocytes, interleukin-6, TNF-alpha, and C-reactive protein. In addition, genotyping of G308A gene polymorphism was assessed. Patients' mean age was 61.1 +/- 14.6 y (four women, 56 men) with a body mass index of 25.4 +/- 5.2 kg/m(2) and a previous weight loss of 0.35 +/- 0.2 kg. Forty patients (37 men, 3 women; 66.6%) had the genotype G308/G308 (wild group) and 20 patients (19 men, 1 woman; 23.4%) had the genotype G308/A308 (mutant group). A significant increase in prealbumin and transferrin levels was detected in both groups. C-reactive protein decreased in both groups (wild group: 105.1 +/- 60 versus 53.8 +/- 62.3 mg/dL, P < 0.05; mutant group: 99.5 +/- 46 versus 43.9 +/- 51.9 mg/dL, P < 0.05). Interleukin-6 decreased in both groups (wild group: 20.1 +/- 22 versus 6.2 +/- 4.1 pg/mL, P < 0.05; mutant group: 22.3 +/- 38 versus 9.2 +/- 7.4 pg/mL, P = NS). Lymphocytes increased in both groups (wild group: 1102 +/- 468 versus 1600 +/- 537 10(3)/mL, P = NS; mutant group: 1441 +/- 739 10(3)/mL versus 1669 +/- 614 10(6)/mL, P = NS). TNF-alpha showed no changes. The G308A polymorphism of the TNF-alpha gene did not affect levels of inflammatory markers in patients after surgery for head and neck cancer who were treated with early enteral nutrition.

  8. DETECTION AND QUANTIFICATION OF PHYTOCHEMICAL MARKERS OF Ilex paraguariensis BY LIQUID CHROMATOGRAPHY

    Directory of Open Access Journals (Sweden)

    Rodrigo M. C. Pinto

    2015-11-01

    Full Text Available Ilex paraguariensis (yerba-mate is used as a beverage, and its extract requires adequate quality control methods in order to guarantee quality and safe use. Strategies to develop and optimize a chromatographic method to quantify theobromine, caffeine, and chlorogenic acid in I. paraguariensis extracts were evaluated by applying a quality by design (QbD model and ultra high-performance liquid chromatography (UHPLC. The presence of these three phytochemical markers in the extracts was evaluated using UHPLC-MS and was confirmed by the chromatographic bands in the total ion current traces (m/z of 181.1 [M+H]+, 195.0 [M+H]+, and 353.0 [M−H]−, respectively. The developed method was then transferred to a high-performance liquid chromatography (HPLC platform, and the three phytochemical markers were used as external standards in the validation of a method for analyses of these compounds in extracts using a diode array detector (DAD. The validated method was applied to quantify the chlorogenic acid, caffeine, and theobromine in the samples. HPLC-DAD chromatographic fingerprinting was also used in a multivariate approach to process the entire data and to separate the I. paraguariensis extracts into two groups. The developed method is very useful for qualifying and quantifying I. paraguariensis extracts.

  9. Early markers of airways inflammation and occupational asthma: Rationale, study design and follow-up rates among bakery, pastry and hairdressing apprentices

    Directory of Open Access Journals (Sweden)

    Hannhart Bernard

    2009-04-01

    Full Text Available Abstract Background Occupational asthma is a common type of asthma caused by a specific agent in the workplace. The basic alteration of occupational asthma is airways inflammation. Although most patients with occupational asthma are mature adults, there is evidence that airways inflammation starts soon after inception of exposure, including during apprenticeship. Airways hyper responsiveness to methacholine is a valid surrogate marker of airways inflammation, which has proved useful in occupational epidemiology. But it is time-consuming, requires active subject's cooperation and is not readily feasible. Other non-invasive and potentially more useful tests include the forced oscillation technique, measurement of fraction exhaled nitric oxide, and eosinophils count in nasal lavage fluid. Methods and design This study aims to investigate early development of airways inflammation and asthma-like symptoms in apprentice bakers, pastry-makers and hairdressers, three populations at risk of occupational asthma whose work-related exposures involve agents of different nature. The objectives are to (i examine the performance of the non-invasive tests cited above in detecting early airways inflammation that might eventually develop into occupational asthma; and (ii evaluate whether, and how, constitutional (e.g. atopy and behavioural (e.g. smoking risk factors for occupational asthma modulate the effects of allergenic and/or irritative substances involved in these occupations. This paper presents the study rationale and detailed protocol. Discussion Among 441 volunteers included at the first visit, 354 attended the fourth one. Drop outs were investigated and showed unrelated to the study outcome. Sample size and follow-up participation rates suggest that the data collected in this study will allow it to meet its objectives.

  10. Triple diagnostics for early detection of ambivalent necrotizing fasciitis

    NARCIS (Netherlands)

    Hietbrink, Falco; Bode, Lonneke G.; Riddez, Louis; Leenen, Luke P H; van Dijk, MR

    2016-01-01

    Background: